NOTE TO USERS
The original manuscript received by UMI contains pages with indistinct print. Pages were microfilmed as received.
This reproduction is the best copy available
UMI
MITOCHONDRIAL DNA DIVERSIT'Y AND ANTHROPOGENIC INFLUENCES IN
WALLEYE (Stizostedion vitrem) FROM EASTERN LAKE HURON
A Thesis
Presented to
The Facdty of Graduate Studies
of
by
MICHAEL HENRY GATT
In partial fulfifment of requirements
for the degree of
Master of Science
December 1998
@ Michael Henry Gatt, 1998 Natidnal Library BiMiièque nationale du Canada Acquisitions and Acquisitions et Bibliographie Services seMces bibliographiques 395 Wellmgtm Street 305. rue WMnm ûüawaON K1AW OttawaON K1AW Canada Canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Lrtbrary of Canada to Bibliothèque nationale du Canada de reproduce, loan, distriiute or seLl reproduire, prêter, disîribner ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or elecironic formats. la forme de microfiche/nIm, de reproduction sur papier ou sur format éIectrooique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. MITOCHONDRIAL DNA DIVERSITY AND ANTHROPOGENIC INFLUENCES IN WALLEYE (Stizostedion FROM EASTERN LAKE HURON
Michael Henry Gatt Advisor: University of Guelph, 1998 Professor M.M. Ferguson
MtDNA diversity in contemporary samples from eight populations of walleye kom eastem Lake Huron was negatively associated with the relative amounts of anthropogenic impacts experienced by each. MtDNA diversity was also compared in contemporary and archival samples from two populations. Ln one instance, contemporary samples had reduced mtDNA diversity compared to archival samples collected before major exploitation. No such difference was detected between contemporary and archival samples fiom the second population where commercial exploitation and habitat alteration have been more limitecl. Law mtDNA diversity in artificially produced fish relative to parental sources suggests that culture programmes might be one mechanism lowering mtDNA diversity in populations. A phylogenetic cornparison of walleye mtDNA haplotypes revealed thai an analysis based on restriction fkagment length polymorphisms in two amplified fÎagments surveyed 554bp and detected almost twice the number of mutations and haplotypes than did a sequence analysis of 5 13nt of the control region. Foremost, I thank Dr. Moira Ferguson for her advice and guidance during my thesis program. I am especially thankfiil to both Drs. Moira Ferguson and Roy
Dari~nannfor providing me with the opportunity to partake Ui intereshg research in their lab at the University of Guelph. Their direction and encouragement over the years is greatly appreciaîed. Drs. Roy Danzmann and Teri Crease served as comIILittee mernbers and offered constructive crïticism and insight with various facets of the study for which I am grateful. 1owe special thanks to Amas Liskauskas (Management
Biologist - Lake Huron Management Unit) who graciously arranged bding for this study. This research was supported by hdslkm the Lake Huron Mauagement Unit,
Ontario Ministry of Natural Resources, and a Fisheries Research Grant fkom the Ontario
Federation of Anglers and Hunten.
Aninas Liskauskas also deserves thanks for coordinating field collections and providing various walleye samples. Help with collecting additional samples was provided by personnel with the Ontano Ministry of Natural Resources: Jeff Buck, Steve
Gile, Butch Lafiance, Eric Machtyre, Wayne Sehger, Jerry Srnitka, and Bruce
Stedmen. 1 thank Eric Machlyre and George Morgan (Department of Biobgy,
Laurentian University) for locating and providing archival scale samples. Lamy Wickett
(Aqua Tem Contracting) is thanked for his help with collecting samples of walleye hm the Moon Riva. 1 also wish to aclmowledge Robert Caphg, Chuck Frail, Al Hoosen,
Rob Linder, Dave Russell, Jerry Smitka, and Rino Ouellette for helping obtain samples of adults from various populations and for obtaining pond-reared walleye. Dr. Neil Billington (Zoology Department, Southern Illuiois University) generously provided purified mtDNA of a divergent walleye haplotype hma Mississippian drainage in the
USA. Also, 1 appreciate the time and help offered by Tara McParland. Tara provided partially purified mtDNA from numerous walleye samples collected during her M.Sc. thesis research,
Usefiil discussions concerning the technical and molecular analyses of my work occwed with several people sharing the lab. In particular, 1 appreciate insight fiom
Tony Fishback, David Gislason, Guy Perry, Ana Rakitin, Takashi Sakamoto and Rachael
Woram. They provided practical advice when troubleshooting was necessary. 1 particularly enjoyed partaking in philosophical conversations with my lab mates at the
Graduate Lounge on Friday evenings! John Colbourne and Kerry Naish provided assistance with the phylogenetic analyses and Ana Rakitin provided useful comments on previous versions of the thesis. 1thank Angela Holliss for sequencing amplified fragments fkom my walleye mtDNA samples. Ian Smith deserves many thanks for his help and time with bioimagixg
Lastly, 1 thank rny family and Een& for their understanding and support while 1 conducted my MSc. research. Mostly, 1thank Tiffany Hele for her votes of optimism and overwhelrning encouragement while 1completed my thesis over the last year. TABLE OF CONTENTS
... TAE3LE OF CONTENTS ...... iii
LIST OF TABLES ...... iv
LIST OF FIGURES ...... v
MATERIALS AND METHODS ...... 8 F'HYLOGENETIC ANALYSIS OF MTDNAHAPLOTYPES ...... 8 Samples ...... 8 DNA isolation ...... 8 ...... ,..... Sequence analysis ...... ,.,...... ,..... 9 Fragment-RFLP anaiysis ...... 10 mtDNA variation detected by sequence and fragment-RFLP analyses ...... 12 Relationships among haplotypes ...... 13 MTDNA DlVERsITY AND EXPLOITAïION HISTORY ...... 15 Samples ...... 15 DNA isolation ...... 16 PCR of contmporary samples ...... 16 PCR of archival samples ...... 16 Statisticai anaiysis ...... 17
PHYLOGENETICANALYSE OF MTDNAHAPLOTYPES ...... 19 Sequence analysis ...... 19 Fragment-RFLP analysis...... 20 mtDNA variation detected by sequmce and hgmmt-RFLP analyses ...... 20 Relationshrps among haplotypes ...... 21 MTDNA DIVERsïW AND EXPLOITATION HISTORY...... 23 Contemporary distribution of mtDNA haplotypes ...... 23 Historical distribution of mtDNA haplotypes ...... 24 mtDNA distribuîions in cultured fish and correspondmg source populations ...... 24 DISCUSSION ...... 40 PHYLoGENETIC ANALYSIS OF MTDNAHAPLOTYPES ...... 40 mtDNA variation detected by sequence and ftagment-RFLP analyses ...... 40 Relationships among haplotypes ...... 43 MTDNADIVERSITY AND EXPLOITATION HISTORY ...... 46 Distributions of mtDNA haplotypes ...... 46 Muence of cdtured fish on mtural populations ...... ,...... 50 LIST OF TABLES
Table 1. Exploitation categories for populations of waileye (Stizostedion Mtrarm) Ioacated in eastern Lake Huron ...... 7
Table 2. Haplotype desigaations in walleye (Stizostedion viîreum) determinecl using three different mtDNA marksystems...... 25
Table 3. Haplotype designaîions and variable nucleotide positions in the control region of walleye (Stùostedion Mnewn) sampled hmLake Huron and Lake Erie and an outgmup (haplotype 34) from Lwapalila Creek, Mississippi...... 27
Table 4. Fragment lengths (kb) obtained with restriction enzymes used to cleave amplified mtDNA of walleye (Stizostedion M'tram) sampled hmLake Huron and Lake Erie...... 28
Table 5. Fragment-RFLP haplotype designations among walleye (Stizostedion vitreum) hmpopulations of Lakes Huron and Erie...... 30 Table 6. Fragment-RFLP haplotype fiequencies and nucleon diversities (h) among wdleye (Stizostedion vitreum) populations and rehgponds kom the eastern Lake Huron region...... 37 Table 7. Frequencies of mtDNA haplotypes in walleye (Stizostedion Mtreum) sampled hmthe Moon and French (Dalles Rapids) Rivers between 1968 and LIST OF FIGURES
Figure 1. Locations of collection sites in eastem Lake Huron...... 6
Figure 2. Light strand control region sequence nom 5' to 3' of haplotype 1 in wdieye (Stizostedion vitreum)...... 26
Figure 3. Regression of pairwise cornparisons of the obsewed number of mutations per nucleotide sampled by sequence and fragment-EUXP analyses...... 3 1
Figure 4. Regression of the number of mtDNA haplotypes detected per nucleotide surveyed...... 32 Figure 5. Neighbour-joining tree relating genetic distances among haplotypa identified with control region sequence and ment-RFLP analyses...... 33 Figure 6. Majority-de consensus tree of four eqdyparsimonious trees resolved fiom heuristic searches in PAUP v3.11...... 35
Figure 7. Neighbour-joining tree of interpopulational genetic distances (D) among walleye (Stisostedion vitrant) sampled hmeastem Georgian Bay...... 3 8 INTRODUCTION
Losses of genetic variability have been documented in populations of exploited
Bshes (Hindar et al. 199 1, Smith et al. 1 99 1, Brown et al. 1992, Leary er al. 1993,
Ryman et al. 1995, Heithaus & Laushman 1997, Nielsen et al. 1997). Conserving genetic population structure or the proportion of total genetic variation partitioued within and among populations has become an important fisheries management goal (Carvaiho
1993, Carvalho & Hauser 1994, Ryman et al. 1995). Fishery practices and environmentai degradation can reduce effective population sizes to thresholds that promote genetic drift or inbreeding (Nelson & Soule 1987, Smith et al. 1991, Carvaho
1993). These processes can lead to a reduction in genetic variability within local populations in only a few generations (Carvalho 1993, Todd & Haas 1993). Further, habitat hgrnentation or transfer of fish between previously isolated populations cm alter naturai rates of gene flow and affect genetic population structure (Hindar et ai. 1991 ).
Thus, it becomes important to detennine how genetic population structure is affecteci by anthropogenic influences, such as exploitation history, for wise management and rehabilitation of exp loited fisheries resources (Moritz et al. 1995, Ryrnan et al. 1995).
The impacts of human intervention on contemponiry genetic population stmcnire of exploited fish species are not well characterized relative to historical influences. For instance, genetic population structure of North American fishes is associated with
Pleistocene glaciation events (Bematchez et al. 1989, Ward et al. 1989, Dmann&
Ihssen 1995, Wilson & Hebert 1996). In paticuiar, levels of intraspecific mimitochondrial
DNA (mtDNA) variability are lower in populations hmnorthem temperate environments than in southern refigia (Bematcha & Wilson 1998). This pattern of mtDNA variability is associated with bottlenecking effects that occmed during the northward colonization procas following the latest Pleistocene glzciaîion event
(Bernatcha et al. 1989, Brown et al. 1992). Although glaciation events have undoubtedly affecteci present day genetic popdation structure of many species, more recent events, such as exploitation, could have influenced genetic variability in populations. Brown et al. (1992) demonstrated that white sturgeon (Acipenser iransmontanus) populations fiom the Fraser River have considerably higher mtDNA diversity than the putative founder population of the Coiumbia River. This resdt was contrary to expectations and was thought to be associated with recent exploitation and habitat destruction causing genetic bottlenecks in the Columbia River population.
Similarly, Nielsen et al. (1997) showed that impacts of environmental change over a 60 year penod were associated with signifïcant reductions in the number of alleles at four rnicrosateUite DNA loci in Atlantic sahon (Safmosalar) from Denmark.
The effect of exploitation history on genetic population structure may be examined by comparing mtDNA variation in conspecific populations that are simiiar in life history, potential for gene flow, and biogeographic history, but different in exploitation history. MtDNA is a sensitive marker for detecting changes of genetic variability in populations because its effective population size is approximately 114 that of nuclear DNA (Moritz et al. 1987, Bibgton & Hebert 1991).
Walleye (Slizostedion vitreum) nom eastem Lake Huron rnay be studied as a mode1 to test if rntDNA diversity is associated with relative amounts of exploitation and anthropogenic influences experienced by each population. Walleye in this region have common life histories and typically display similar characteristics such as age at maturity, fécundity, recmitment, and relative abundance (Scott & Crossman 1985, Morgan 1996).
Sexually mature fernale walleye exhibit site fidelity to natal rivers for spawning. Homing by females is an important rnechanism maintaining mtDNA differentiation between sites
(Stepien 1995, Merker & Woodniff 1996). Phylogeographic studies have shown that mtDNA diversity in walleye (Billington et al. 1992), and 0thnorthern temperate fishes
@ari~na.n& &sen 1995, Wilson & Hebert 1W6), is similar among populations existing in geographical regions that were colonized by fish fiom common glacial refugia, where similar potentials for gene flow have existed.
Degree of impacts fkom exploitation and environmental degradation has varied among walleye populations of eastern Lake Huron (Reckahn & Thuston 1991, Ontario
Ministry of Natural Resources [OMNRI 1995, Morgan 1996). Substantial declines in abundance have been reported for several populations due to commercial overexploitatio~deterioration of water quality, and habitat alteration, occurring fiom the late 1800's to the mid 1900's (Schneider & Leach 1979, Reckahn & Thunton 199 1).
During the Iast 30 years, exploitation by recreationd and commercial fisheries and environmental degradation has continu& such that marked Merences in abundance of fish nom different spawning sites exist (Figure 1, Table 1). Estimates of relative abundance in each population have been inferreci fiom historical index netting sweys and commercial and recreational catch records (Winterton 1975, Gunn 1979, Reckahn &
Thurston 1991, OMNR 1995). Morgan (1996) characterized populations within the
French River drauüige by using the fall walleye index nethg method (FWIN)recently adopted in Ontario as a provincial sampling standard for determining stock status. Recent efforts to rehabilitate populations of walleye in Ontario have led to the establishment of culture programmes (Community Fisheries Involvement Program). In eastem Lake Huron pond-reared walleye are released into nvers to support natural reproduction and sustain a viable fishery where low numbers exist. Culture programmes rnight be one mechanism whereby mtDNA diversity is lowered in populations. Ferguson
(1WO), Hindar et al. (199 1), and Kerr et al. (1996) summarize the genetic effects that cultured fish cm have on nadpopulations. MtDNA diversity could be Iower in artificially reared fish than in source populations because few parental fish are used for founding, and artificial selection and stochastic mtDNA Iineage extinction might occur during rearing.
MtDNA variation in walleye was first assessed by digesting the entire rnolecule with restriction enzymes to detect restriction fragment length polymorphisms (RFLP;
Billington & Hebert 1988, Ward et al. 1989, Billington et al. 1990, 1992). This approach has been usehl for delineating population structure and phylogeographic relationships of walleye within the Great Lakes (Billington et al. 1992). McParland (1 996) used the same approach to estimate the relative contribution of different spawning groups to mixed fisheries in the Lake Erie-Lake Huron comdor. Higher resolution of intraspecific mtDNA variation among populations can be attained by employing the polymerase chain reaction (PCR)to ampli@ specific hpents and subjecting them to either RFLP analysis
(Merker & WoodrufT 1996) or direct sequencing (Stepien 1995, Faber & Stepien 1997).
However, it is unknown how the two PCR-based approaches compare to one another and to RFLP analysis of the entire molecule in terms of detecting variation and understanding phylogenetic relationships among rntDNA haplotypes. 1 tested the hypothesis that exploitation history affects mtDNA diversity in populations of walleye hmeastem Georgian Bay and the North Channel of Lake Huron by comparing haplotype fkequencies (1) between contemporary samples ~omeight sites among six tributaries differing in exploitation history, and (2) between contemporary samples and archival scale samples collected before major exploitation in two populations. 1 predicted that mtDNA divenity in contemporary samples would be negatively associated with relative amomts of anthpogenic impacts and exploitation in each population (Table 1). Moreover, I predicted that contemporary samples would have reduced mtDNA diversity compared to archival samples in the Moon River where anthropogenic influences have been prevalent since 1970. Conversely, it was predicted that mtDNA diversity would not decrease in contemporary samples relative to archival samples fhm the Dalles Rapids population where environmental degradation and habitat alteration have been more Limited (Winterton 1975, Morgan 1996). Lady, mtDNA diversity in cultured fish and parental source populations was compared to test if culture programs could be one mechanism whereby mtDNA diversity is lowered in natural populations.
The combined use of contemporary and archival samples required different technical approaches because of differences in the qiiality and amount of mtDNA available. Thus, prior to testing the hypothesis presented above, 1 compared the genetic variation and phylogenetic relationships among divergent haplotypes detected by RR9 analysis of the entire molecule (Billington et al. 1992, McParland 1996) with that detected by direct sequencing of a segment of the control region and RFLP analysis of two specific frslgments amplined by PCR. Figure 1. Ma-showing locations of collection sites among walleye (Stizostedion vitreum) populations fiom eastem Lake Huron. 1. Spanish River; 2. Whitefish Falls River; 3. French River (Dalles Rapids); 4. French River (Meshaw Falls); 5. Pickerel River, 6. Key River; 7. Shebeshekong River, 8. Moon River. Table 1. Exploitation categones for populations of walleye (Stizostedio~tvi~reuni ) located in eastern Lake Huron. Anthropogenic influences and relative abundance in each population were estimated from Reckahn and Thurston (1991), OMNR (1 999, Morgan (1 996), and information obtained from OMNR representatives (Aninas Liskauskas, Wayne Selinger, and Jeny Srnitka).
Regioflopulation Anthropogenic Impact Relative Exploitation Abundance Category Eastern Georgian Bay Moon Overliarvest, habitat alteration, water quality deterioration, Low High water flow fluctuation during the spawning season, release of cultured fish. Shebeshekong Overharvest, habitat alteration, release of cultured fish. Low High Key Overharvest, habitat alteration, release of cultured fish. Low High French River Complex Dalles Rapids Elevated harvest, water quality deterioration. Moderate Moderate 4 Meshaw Falls Elevated harvest, water quality deterioration, release of cultured fish. Moderate Moderate Pickerel Elevated harvest, water quality deterioration. Low-Moderate Moderate North Channel Whitefish Falls Elevated harvest, water flow fluctuation dunng the spawning season, Low-Moderate High release of cultured fish. Spanish Low harvest, water quality deterioration, water flow fluctuation during High Low the spawning season, release of cultured fish. MATEXIALS AND METIIODS
Pbylogenetic anaiysis of mtDNA haplotypes
SampIes
Partially purified mtDNA from 20 fish representing the nine most common haplotypes present in Great Lakes walleye as deterrnined using RFLP analysis of the entire molecule [molecule- RFLP] (Billington & Hebert 1988) were obtained nom a previous study (McParland 1996). One fish of each haplotype was examined except for the most comrnon haplotypes (molecule-RFLP 1,4,5,8,9, and 10) for which two to four fÏsh were analyzed. In addition, 26 fish with Iess common haplotypes detected during the population analysis of Lake Huron samples (see below) and samples fiom Lake Erie
(Gatt & Ferguson unpublished &ta) were included in the phylogenetic analysis. Pure mtDNA ffom two walleye (haplotype 34) nom Luxapalfi Creek (Mississippi, USA) was provided by N. Billington (see Billington & Strange 1995). Haplotype 34 was used as an outgroup in the sequence analysis to detemiine which haplotypes are ancestral in the
Great Lakes walleye mtDNA phyiogeny. An ancestral Iineage was used as a functional outgroup in subsequent pylogenetic analyses.
DNA isolation
Either total genomic DNA (gill, muscle, liver) or partially purified mtDNA (ova, liver) were used for the analyses. Total genomic DNA was isolaîed according to the metho& of Bardakci & Skibinski (1994), except that samples were incubated for 1 to 2 hours at 50°C and dned DNA pellets were resuspended in 30 to 60~1sterile water. Partially purifiecl mtDNA were isolated according to Chapman & Powers ( 1984) as modified by Danzmann et al. (1991).
Sequence analysis
The entire control region was amplifieci from the mtDNA of eight walleye with divergent molecule-RFLP haplotypes and one fish previously not examineci (fish numbers 1,4, 5,7, 8, 11, 15, 19,24; Table 2) using oligonucleotide primers LN20 and
HN20 (Bernatchez et al. 1992). Each PCR containeci sterile de-ionized water, 1X manufacturer PCR buffer, 1.8mM MgClz 0.5pM each primer, 0.2mM dNïI"s, 1.2 unit5 of Taq polymeraseTM(Boehringer Mannheim), and 10 to 50ûng of template DNA. The thermal profile cycled 35 times; 1 minute denaturation at 92OC7 1 minute annealing at
50°C, 2 minutes extension at 64OC. Amplified products were purified (Wizard Kit-
Romega) and diluted to 60ng/10ul reaction with sterile water and directly sequenced using dRhodamine termlliator cycle sequencing redy reaction kit (Perkin-Elmer #
403042) and the initial amplification prima, each at a concentration of 2 pmol. The thermal profile was 2 minutes at 96"C,followed by 25 cycles of 30 seconds at 96"C, 15 seconds at 50°C. 2 minutes at 60°C. nie products were separateci in a 5% long ranger gel
(Perkin-Elmer #5O6 1 1) in an ABI-Prim 377 DNA Sequencer. The data were analyzed using so bare packages Sequencing Analy sis (v2.1.2) and Data Collection (v 1.1 .O).
Each electropherogram displayed heavy strand sequence that was then reverse complemented into the light strand sequence for analysis.
No readable sequences were obtained with LN20 because of length heteroplasmy in tandem repeats flanking the tRNA prohe gene. No variation among the nine sarnples analyzed was detected in the sequence of 33Ont obtained using the HN20 primer-
Therefore, a primer designated LW1 (5' ACA CCA TAC ATC TAT ATT AAC C 3';
Figure 2) was designeci and used to assess variation in an unsequenced portion of the control region in the nine walleye. PCR and sequencing conditions were as described above except LW 1 was used as an intemal primer for the sequencing reaction. Five variable sites were detected (sites 22-24,27,28; Figure 2) which were useful for resolving the mtDNA haplotypes examineci, Lee et al. (1995) reportai that mtDNA sequences flanking the tRNA proline gene show high levels of nucleotide substitution relative to the remaining portions of the control region in teleosts. Thus, an additional intemal primer HWI (heavy strand sequence 5' GTC CCT CAC CTT CAA TAA CCG 3';
Figure 2) was designed to examine a portion of the control region flanking the tRNA proline gene, including the five variable sites identified. In the final analysis, Pa amplifications and sequencing reactions were performed on the 46 fish listed in Table 2 and the outgroup using methods described previously, except that the HW I primer replaced HN20 in the initial PCR reaction and in the subsequent sequencing reaction.
Unique sequences were given letter designatiom.
Fragment-WLP unalpis
Two hgments were amplined hmthe mtDNA of 46 fish (Table 2). First, oligonucleotide primers HN20 (Bernatchez et al. 1992) and ND 5!6L (Kocher et ai.
1989) were used to ampli@ a 5.2kb fhgment containing the control region, cytochrome b, NADH dehydrogenase (ND) 5, ND 6, tRNA proline, tRNA threonine, and tRNA glutamine genes. Each PCR contained sterile de-ionized water, 1X manufacturer PCR buffer, 2.25mM MgCl*, 0.8pM each primer, 0.34mM dNTP's, 2. l units of Expand
Long Taq PolymeraseTM(Boehringer Mannheim), and 10 to 500ng of template DNA.
The thermal profiles were 2 minutes denaturation at 92OC, 2 minutes anaealïng at 53"C,3 minutes extension at 68OC, 3 cycles, 1 minute at 92OC, 1.5 minutes at 53OC, 3.5 minutes at 68"C, 10 cycles, 45 seconds at 92OC. 1.5 minutes at 54OC, 4 minutes plus 2 seconds per cycle at 6g°C, 20 cycles, 1 minute at 68OC. Second, a 2.4kb region composeci of the ND
3, ND4L9 ND4, and tRNA armegenes was amplifid using oligonucleotide primers described by Cronin et al. (1993). Each PCR containeci sterile de-ionized water, 1X manufacturer PCR buffer, 2.WMgCl*. 0.5w each primer, 0.2m.M dNïPs, 1.2 hts of Taq polymerase- (Boehringer Mannheim), and 10 to 500ng of template DNA. The themial profiles were 1.5 minutes denaturation at 92OC, 1.5 minutes armealhg at 50°C. 2 minutes extension at 64OC, 1 cycle, 1 minute at 92OC, 1-5 minutes at 50°C, 2 minutes plus 3 seconds per cycle at 65OC, 38 cycles.
The PCR products were cleaved with a combination of 17 different rdction enzymes (Ah1, Ava 1, Barn HI, Bst EII, Dde 1, Dra 1, Hae III, Hinf 1, Mbo 1, Msp 1. !?ci 1,
Nco 1, Pst 1, Rra 1, Sau 961, Sca 1, Taq I) known to detect variation in mtDNA of walleye
(N. Billington unpublished data, Billington et al. 1992, Merker & WooM1 996).
Digestions were perfomed according to the manufacturer specifications (New England
Biolabs, Pharmacia, or Boehringer Mannheim). Digested PCR hgments were separated on 0.8 or 2% agarose gels for 12 to 18 hours at 22 volts, visualized with uitraviolet radiation after ethidium bromide staining and photographeci with a digital imaging system. Fragments were compared to a lkb ladder and shed accordingly hm photographs using the imaguig software. The composite fragment patterns were used to designate fragment-RFLP haplotypes. When possible, hgment-RFLP haplotypes were designated according to nomenclature by Billington et al. (1992) and Billington &
Strange (1995). For example, fish known to have molecule-RFLP haplotype 1 were designated as £kgment-RFLPhaplotype 1.
mlDNA vanarion detected by seqrrence rurdficrgment-RFLP analyses
1 first compared the efficiency in detecting mtDNA variation by regressing the observeci number of mutations per nucleotide sampled by fkagrnent-RFLP analysis of the two bgrnents on that detected by sequence analysis of 5 13nt of the control region for each of the 46 waileye. To Merdetermine the efficiency of the two approaches, the number of haplotypes detected as a function of nucleotides surveyed was examined uskg a method similar to that described by Bematchez & Danzmann (1993). For the fiapent-
RFLP data, restriction enzymes were selected at random one at a the. The number of haplotypes detected as a hction of the number of nucleotides surveyed by each enzyme, or each set of combined enzymes, was detennined at incremental steps. The correspondhg number of nucleotides surveyed by the RFLP data at each incremental step was used to assws the number of haplotypes detected by control region sequence. A position in the 5 13nt sequence resolved was randomly detemineci aad the number of haplotypes detected as a function of the number of nucleotides sweyed at each incrementai step was calculated. The entire process was repeated 5 th.1 then regressed the number of nucleotides sampled on the resulting number of hapiotypes detected for each of the sequence and hgment-RFLP analyses. Reiationships among hupiotypes
Pairwise sequence divergences among haplotypes detected in the sequence analysis, including the outgroup, were estimitted with Kimura's (1980) 2-parameter mode1 in DNADIST (Phylip v3 Sc; Felsenstein 1995). The resulting distance matrix was used to produce a neighbour-joining tree (Saitou & Nei 1987) in NEIGHBOR (Phylip v3 Sc). in addition, the sequence data were subjected to maximum parsirnony criterion
(DNAPARS) and maximum Iikelihood (DNAML) methods. The neighbour-joining tree was arbitranly chosen for presentation since phenetic, cladistic and maximum likelihood methods produced comparable tree topologies. Confidence levels assigned to branches forming groupings with >JO% support were estimated fiom 2000 bootstrapping replicates
(SEQBOOT)and the rnajority-de consensus algorithm (CONSENSE) in Phylip 3 SC.
A fkagment-RFLP matrix representing the presence or absence of 130 restriction sites was adjusted for the semi-isoschizomer enzymes Sm 1 and Rra 1; both enzymes detected the same 3 polymorphic restriction sites in the control region. Sequence divergence @) between pairs of rntDNA haplotypes was estimated using MTDIS
(Danzmann 1998). A neighbour-j oining tree was constnicted from the pairwise distances
@) using haplotype 1 as a functional outgroup. Haplotype 1 was used as a functiond outgroup because topologies of the trees produced with the three different methods used in the sequence anaiysis revealed that this haplotype was ancestral among the major mtDNA assemblages identified. Confidence levels were assigned to branches as described previously for the sequence data. The restriction site matrix was also subjected to maximum parsimony (MIX) and maximum likelihood (RESTML) methods in Phylip
~3.5~to infèr phytogenetic relationships among haplotypes. The neighbour-joining tree was arbitrarily chosen for presentation because the tree topologies producecl with the three methods were highly congruent.
The sequence and hgment-RFLP data sets were adjusteci for overlappuig mutational sites and combined to produce a character state ma&. A cladishc analysis was performed using maximum parsimony criteria in PAUP v3.1.1 (Swofford 1993).
The restriction sites were subjected to Dollo parsimony cnteria Dollo parsimony is appropriate for restriction site data where sites are four to six thes more likely to be lost than gained depending on the number base-pairs recognized by the different restriction enzymes (Swofford et al. 1996). Variable nuclmtide sites withui the control region were subjected to Wagner parsimony criteria since this method imposes minimal constraints on permissible character state changes.
Heuristic maximum parsimony searches were conducteci using PAUP ~3.1-1 to form a majority deconsensus tree of equally parsimonious trees describing relationships among the haplotypes. Taxa were added randomly with 10 replications, with MILPARS and steepest descent options invoked and with branch swapping by the tree bisection- reconstruction algorithm. Hornoplasy was estimated using both consistency (CI) and retention (RI) indices (SwoFord et al. 1996). Bootstrapping levels of 100 pseudo- replicates and a decay index (Brema 1994) were calculateci using PAUP and AutoDecay v2.9.6 (Eriksson 1995). respectively, to assess confidence levels for different haplotype groupings. MtDNA diversity and exploitation history
A total of 337 sexually mature walleye (z sex ratio) were captured by electroshocking, trap netting, or gill netting during the spawning seasons in 1995 to 1997 at eight sites throughout eastem Lake Huron (Figure 1). Samples of fish collected fiom a parîicular site were designated a population- A small section of gill or a portion of ovulated eggs were removed hmeach fish and transported on wet ice to the University of Guelph. Populations were classified as being subjected to either low, moderate, or high exploitation based on published information (Reckahn & Thurston 1991, OMNR
1995, Morgan 1996) and personal commUNcation with OMNR representatives (Table 1).
Samples of scales from 109 walleye from the Moon River and 36 walleye fiom the
French River, captured between 1968 and 1988, were obtained nom the OMNR so that genetic population structure could be determineci relative to when increased amounts of anthropogenic impacts and exploitation were reported (mid 1970's to mid 1980's;
Reckahn & Thurston 199 1, OMNR 1995, Morgan 1996). Archival scales originated from walleye captured during index netting programs operating between 1968 and 1988.
Scales were dried and subsequentiy stored in paper envelopes for a maximum of 28 years.
A total of 96 artificially reared juvenile walleye were collected Erom three ponds during the summers of 1995 and 1996. Pond-reared waileye originated nom CFIP culture programmes. Gametes were commonly collected and pooled fiom fewer than five parental fish (2 females and 3 males) rehiming to rivers to spawn. Embryos were reared in srnail culture faciïities adjacent to nvers. Approximately 25 days later, larvae were trançferred to outdoor ponds where they remallied for two to three months before being released as juveniles into natural populations. Juveniles were collected fkom ponds with seine nets immediately pnor their release into the wild and transported to the
University of Guelph on wet ice and stored at -80°C.
DNA isolrrtr'on
Either total genomic DNA (gill, muscle, scales) or partially purified rntDNA (ova, liver) were used for the malyses following extraction protocols mentioned previously.
PCR of contemporaty saïnpfes
The two mtDNA fragments (5.2kb segment containing the control, Cytb, ND516 genes and a 2.4kb segment containing the ND3/4 genes) mentioned previously were amplified and processed as described above; except the 5.2kb product was cleaved with diagnostic restriction enzymes Dde 1, Dra 1, Nco 1, Rsa 1, and Sca 1, and the 2 -4kb product was cleaved with Ah1, Hinf 1, and Taq 1.
PCR of archival samples
Initiai attempts to amplifi a portion of the rntDNA control region with primers
LN20 and HW 1 were unsuccessN using total genomic DNA extracted fiom archival samples. As a result, LW2 (5' GCATTT AGT AGG CGT TTA GCA G 3') was designed and used with HW 1 to ampliSr a 33 1nt segment of the control region, of which 3 1ûnt were used for analyses (Figure 2). The ingredients of the PCR were identical to those used to ampli@ the 5.2kb region for the hgment-RFLP analysis. The thermal profiles were 2 minutes denaturation at 92OC, 2 minutes annealing at SO°C, 2 minutes extension at
6S°C, 3 cycles, 1 minute at 92OC, 1.5 minutes ar 50°C, 2 minutes at 68OC, 10 cycles, 45
seconds at 92OC, 1.5 minutes at 50°C, 2 minutes plus 2 seconds per cycle at 6g°C, 20 cycles, 1 minute 68OC. Amplified products were purifmi, sequenced with the HWI primer, and analyzed as mentioned previously.
Sfatidcal anlJyss
Di fferences in haplotype fiequemies among populations, between samp les collected in different years, and between artificially reared fish and parental source populations were assesseci with a pairwise contingency x test in CSRXCPRW
(Danzmann & Ihssen 1995). When pairwise cornparisons yielded more than 20 percent
of the cells as having a count les than 5 individuals a x Monte-Carlo bootstrapping
algorithm with 1000 randomizations was implernented in CHIZMCS (Danzmann &
Ihssen 1995). The algorithm describeci by Danzmann & Ihssen is similar to the one used
by Roff and Bentzen (1989) with the caveat that only row totais (population numbers) are
kept constant. The Roff and Bentzen algorithm keeps row and column (haplotype
numbers) totals constant in the resampling process. Spanish River samples collected in
1995 and 1996 were poo led for the ha1 analysis since haplotype frequencies did not
differ significantiy between them (P>0.05). Frequencies of sequence haplotypes in fish
collected fiom the Moon River in 1968-70 to 1983 and in 1988 to 1996 did not vq
significantly (PM.05) so each set was pooled for the final analysis.
Nucleon diversity (h) estimates were calculated for each population according to
Nei and Tajima (198 1). A matrix consisting of 21 polyrnorphic and 109 monomorphic restriction sites was analyzed with MTDIS (Daiipnann 1998) to estimate sequence divergence @) among the Lake Huron populations and between an outgroup population from western Lake Erie (Huron River, n=56, 11 haplotypes; Gatt & Ferguson unpublished data). Of the 130 restriction sites only 37 (16 polymorphic and 21 monomorphic) were assesseci with the enzymes used. However, these sites were sufficient to unambiguously categorize each fish to a kgment-RFLP haplotype. Thus, the matrix consisting of the 130 sites was used for estimating sequence divergence @) among populations. The resulting pairwise interpopulational genetic distances were used to produce a neighbour-joining tree (Saitou & Nei 1987) in MEGA v1 .O2 (Kumar et al.
1993). Confidence levels estimated nom 1000 bootstrapping replicates (SEQBOOT) and the majority-de consensus algorithm (CONSENSE)in Phyiip 3% were assigned to nodes adjacent to groupings with 250% support. RESULTS
Phylogenetic aaalysis of mtDNA haplotypes
Sequence anaiysis
The control region was approximately 1200 base-pairs depending on the number of tandem repeats flanking the tRNA proline gene (see Faber & Stepien 1997). Twenty- eight variable nucleotides resolving 17 haplotypes were observed in the 5 13nt assessed among the 46 Great Lakes walleye and the outgroup (Figure 2 & Table 3). The ratio of transitions to transversions was 17: 1 1. Among the 46 Great Lakes walleye (excluding the outgroup), thirteen variable nucleotides were detected with a ratio of transitions to transversions of 85 (Figure 2 & Table 3). Deletions or insertions were not detected in the sequences examineci. Estimates of pairwise sequence divergences ranged fiom
0.0402 to 0.0464 between Great Lakes haplotypes and the outgroup implying 21-24 mutations between southem and northem walleye. Painvise sequence divergence estimates ranged fi-om 0.002 to 0.0158 among the 16 haplotypes identified in Great Lakes walleye implying 1-8 mutations between divergent lineages.
Analysis of the control region sequence resolved seven of the nine molecule-
RFLP haplotypes (Table 2). Sequencing failed to resolve molecule-RFLP haplotypes 2 and 10. They possessed sequence haplotype "a", which is cornmon among the molecule-
RFLP haplotype 1 lineage (Table 2). Sequence haplotypes "g" and "hWare unique but were designated as molecule-RFLP haplotype 10 and 8, respectively. Sequence haplotype "b" was undetectable by the molecule-RFLP analysis. A fish with molecule-
RFLP haplotype 8 was designated sequence haplotype "j", charactenstic of molecule-
RFLP haplotype 9 (Table 2). Fragment-RFLP anuiysis
Seven of nine restriction enzymes produced variable fragment lengths in the 2.4kb segment and ten of seventeen enzymes detected polymorphism in the 5.2kb segment
(Tables 2 & 4). A total of 130 restriction sites corresponding to approximately 553.5bp or 3.3% of the mtDNA gemme were assessed in each of the 46 fish. The number of sites detected by 4,4.6,5.3, and 6 base-pair recognition enzymes were 108,6, 3- and 13, respectively. Thirty-four sites detected by the 4 base-pair recognition enzymes and 6 sites detected by the 6 base-pair enzymes were variable after accomting for semi- isoschizomers Rra 1and Sca 1; three 6 base-pair sites reported here as being recognized by Scn 1. Thirty fragment-RFLP haplotypes were detected in the 46 walleye examined
(Table 5). Painvise estimates of sequence divergences ranged 0.002 to 0.01 8 among haplotypes irnplying 1-10 mutations between the divergent lineages.
There was a high level of congruence between haplotypes generated fiom the hgment-RFLP analysis and RFLP analysis of the entire molecule (Billington et al.
1992). Of the nine moleeule-RFLP haplotypes only haplotype 2 was not detected with the hgment-RFLP approach (Table 2). The fragment-RFLP method identifed haplotypes not detected by the molecule-RFLP method; hgment-RFLP haplotypes 6 and
7 were designated previously as molecule-FWLP hapiotypes 10 and 8, respectively.
nttDNA variation deleded by sequerace iurdfiagment-RFLP anaf'es
The proportion of the maximum number of variable sites detected per nucleotide surveyed among the Great Lakes haplotypes in the sequence and ment-RFLP analysis was 0.02 and 0.07, respectively. This result implies that the fbgment-RnP approach detected 3.5 times more mutations per nucleotide sampled than did the sequence analysis of the control region. The regression analysis based upon the observed number of mutations per nucleotide sampled by each approach suggests that the fragment-RFLP analysis was approximately 1-6 times more efficient than the sequence analysis at detecting variation among the 46 fish (Figure 3). Similarly, the number of haplotypes detected per number of nucleotides sampled in the fÏagment-RFLP analysis was approximately twice that detected by the sequence analysis (Figure 4). Thus, some hgment-RFLP haplotypes exhibited the same control region haplotype (Table 3). In other instances, some sequence haplotypes were undetected by hgment-RFLP analysis
(e.g. fish 5, 11, and 19 in Table 2).
Relationships umong huplotypes
Topologies of the two neighbour-joining trees portraying divergence estimates among haplotypes detected by the sequence and fÏagment-RFLP analyses were similar
(Figure 5). The haplotypes couid be classified into three major phylogenetic assemblages
(A,B,C) correspondhg to those reported by BiUington & Hebert (1988) and Ward et al.
(1 989). Groups A and C were supported in both trees with bootstrapping estimates greater than 50%. Although assemblage B was unresolved in both the sequence and hgment-RnP analyses some intemal groupings in the tree produced with the RFLP data, labeled II through IV, were supported by confidence levels greater than 50%
(Figure 5). Many of the kgment-RFLP haplotypes among the B assemblage did not cluster and their affiliation to any of the subgroups was unclear. The restriction sites maximum Likelihood (RESTML; Felsenstein 1995) results supported (likeiihwd ratio test; PcO.05) the B subgroups LN;except fragment-RnP haplotype 29 was not included in subgroup 1. The placement of haplotype 29 into subgroup 1 might explain why bootstrapping levels were below 50% in the phenetic analysis. The maximum likelihood analysis of the sequence data indicated that noue of the haplotypic groupings were supported among the B assemblage (likelihood ratio test; PHl.05).
A total of 33 haplotypes were resolved &er cornbining the variable sites assessed by sequence and hgment-RFLP methods (Table 2). Adjustments for overlapping mutational sites (nucleotide positions 3,4, and 6 in the control region; Figure 2, Table 3) resulted in a matrix of 50 character states; 10 fiom the sequence analysis and 40 from the
hgment-RFLP aualysis. Thirty-three of thae character states were autapomorphic.
Thus, 17 sites were informative or synapomorphic; 10 sites hmthe fragment-RFLP and
7 kom the sequence analyses. The combined data surveyed approximately 1O48Snt or
6.2% of the mtDNA molecule-
Four equally parsimonious trees were resolved hmheuristic searches using the
50 variable characters states (tree length=57, CI4.88, CI excluding Monnative
characted.7 1, RIq.96). The topology of the rnajority rule consensus tree (Figure 6)
was similar to the two neighbour-joining trees produced with individual data sets (Figure
5). However, low bootserapping levels were obtained for most clusters of haplotypes
within the B assemblage in the tree denved from the cladistic analysis. Group BIV
resolved in the hgment-RFLP anaiysis was also supported by high bootstrapping levels
in the cladistic analysis (i.e. haplotypes 20"d" and 28"d") (Figure 6). MtDNA diversity and exploitation history
Contemporary distribution of nttDNA haplotypes
Nine hgment-RFLP haplotypes (Tables 4 & 5) were identifiecl in the 8 populations examinai (Table 6). Haplotypes 4 and 5 were found in fish from dl populations and compnsed 60% and 24% of the total number of fish examine& respectively. Haplotype 16 was unique to a single individual sampled f?om the Dalles
Rapids population. The Whitefish population displayed a high kequency of haplotype 13 relative to the other populations examineci.
Most pairwise cornparisons among the populations in eastern Lake Huron differed significantly in haplotype fiequencies (P~0.05)(Appendix 1). However, the
Shebeshekong, Key, Dalles Rapids, and Mahaw Falls populations were not significantly different fiom one another. In addition, the Moon and Shebeshekong populations and the
Pickerel and Spanish populations did not Vary in haplotype fiequencies. Levels of nucleon diversity (h)varied between 0.275 in the Moon River and 0.78 L in the Whitefish
Falls populations (Table 6). The three populations of eastern Georgian Bay, designated as highly exploited (and low population abundance), exhibited lower h than the three populations of the French River with moderate exploitation or the Spanish River with low exploitation (Tables 1 & 6). The Whitefish Falls population was an exception to this pattern in that it showed elevated levels of h despite being categorized as highly exp loited-
Paixwise cornparisons of sequence divergence @) among populations ranged
hm0.00009 to 0.00 193 (Appendix I). The neighbour-joining tree showed that populations in eastern Georgian Bay and the French River drainage clustered together as did the North Channel populations (Figure 7).
Risrorical disbiouîbn of întDNA haplotypes
Three nucleotide positions (24,27,28; Figure 2 & Table 3) of the 3lûnt of the control region resolved hmthe archival samples were variable among the 145 walleye sampled hmthe Moon and Dalles Rapids populations (Table 7). Five sequence haplotypes were identified in the two populations. Two walleye sampled in 1968 fiom the Moon River exhibited a mtDNA haplotype not detected among samples surveyed brnthe centrai Great Lakes (Table 3).
MtDNA haplotype fkequencies were not temporally stable in the Moon and Dalles
Rapids populations and the composition of haplotypes changed markedly (Table 7).
Haplotype fiequencies differed significantly (P<0.001) between fish captured in the years
1983 and 1988 in the Moon River; haplotypes 1 "a", 8 "i", and "q" were not detected in samples collecteci after 1983. Likewise, fkequencies ofmtDNA haplotypes differed significantly (P10.01)between fish captured in 1972 and 1997 hmDalles Rapids, probably due to the marked change in frequency of haplotype 5 " f' (Table 7).
mtDNA distributions in culturedjWi and corresponding source popuCotions
Cultured walleye exhibited significantly different haplotype fiequemies (P 1 sequ& & Sequence Combined PFA 635 1 1 a 1 a PFA 40 PFA 32 PFA 756 PFA 68 1 ERA 13 PFA 141 PFA 65 1 PFA 41 PFA 33 SP 2 FR 3 WF 20 PFA 25 PFA 199 PFA 757 PFA 93 PFA 87 PFA 683 HR 424 SP 14 PFA 856 PFA 46 PFA 623 PFA 783 SP 10 WF 10 WF 19 WF 22 FR 2 PFA 743 FR 15 PC 7 PC 13 VB4 VB 15 VB 23 VB 30 PD 38 PC 23 PC 5 HR 361 HR 364 ERC 507 VB 50 PC 15 -. '~~DNAobtained nom a previous sfudy (McParhd 1996). 'se+ Billington et al. ( 1992) for details. 3Amplined fragment approximakly 5.2kb; control region, cytb, and ND516 genes. 4Amplified fragment approximately 2.4kb; ND314 genes. Figure 2. Light strand control region sequence (12236) nom 5' to 3' of haplotype 1 in waileye (Stizostedim viheum). Variable nucleotide positions are shown in bold and are numbered from 1 to 28. Locations of primers used for the sequence analysis are identifiai in bold and are labeled accordingly. The 3 1 Ont sequence resolved hm archival scale samples is underlined. Table 3. Haplotype designaiions and variable nucleotide positions (see Figure 2) in the control region of walleye (Stizostedio~i vitreuni ) sarnpled from Lake Huron and Lake Erie and an outgroup (haplotype 34) fiom Luxapalila Creek, Mississippi (Billington & Strange 1 995). Sequence Fragment-RFLP Variable Nucleotide Position haplotype haplotype(Table7) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 a 1,2,10 CGAGACAGGCAAGAGAACAAATTCATAC c 3 CGAGACAGGTAAGAGAACAAATTCATGC e 4 CGACACAGGTAAGAGAACAAAATTATAC f 5,19,22,23,25 CGACACAGGTAAGAGAACAAATTTATGT g 6 CGAGACAGGTAAGAGAACAAATTCATAC h 7 CGACACAGGTAAGAGGGCAAATTTATGC i 8 CGACACAGGTAAGAGAGCAAATTTATGC h) 4 j 8,9,14,2 1,27 CGACACAGGTAAGAGAACAAATTTATGC k 15 AGACACAGGTAAGAGAACAAATTTATAC 1 16 CGACACAGGTAAGACGACAAATT'I'ATAC m 29,30 CGACACAGCTAAGAGAACAAATTTATAC n 18 CGACACAGGCAAGAGAACAAATTCATAC O 24 AGACACAGGTAAGAGAGCAAATTTATGT P 26 CAACACAGGTAAGAGAACAAATTTATGC 9' ------CAAA?'TTATAT r 34 AATGCAGAGCGGATGGGTCGGTTTCCAC I '~s~lotypeq was exhibited in two walleye capîured in 1968, Moon Falls, Moon River, Ontario, Canada. Table 4. Fragment lengths (kb) obtained with restriction enzymes used to cleave amplified mtDNA of walleye (Stizostedion vitreum ) sampled fiom Lake Huron and Lake Erie. Enzyme Pattern Length (kb) FRAGMENT 1: Control region, Cytochrome b, and ND516 gens Ah I riva I Barn HI Bst EII Dde I Dra 1 Hae iIi Hhf 1 Mbo 1 Msp I Nci I Nco 1 Pst 1 Rsa 1 Sau 961 Table 4. (continueci) Sca 1 A 5.118 B 4.059, 1.059 C 4.059.0.950, O. 109 D 4.059, 1.005,0.054 Taq 1 A 1.150*, 0.820,0.734,0.510,0.456,0.383(2), 0.303,0.192,0.114(2) B 1.150*, 0.734, 0.631,0.510,0.456,0.383(2), 0303,0.192,0.189,0.114(2) * fragment length rnay vary due to presence of tandem repeats located in the control region FRAGMENT 2: ND314 genes Alu 1 Dde 1 Hae III Hinf 1 Mbo I fMsp 1 Nci 1 Sau96I A 1.311,0.449,0.351,0.254,0.079 B 1.3 11,0.449,0.351, 0.333 C 1.760,0.351,0.254,0.079 Taq 1 A 1.553,0.364,0.289 B 1.045,0.508,0.364,0289 - Table 5. Fragment-RFLP haplotype designations among walleye (Sizostedio~zvitreurri ) fiom populations of Lakes Huron and Eric. Fragment 1 : Control region, Cytochronie b, NDY6 1 Fragment 2: ND3/4 Restriction enzymes Haplotype Alu 1 Dde 1 Dra 1 Hoe III Mbo 1 Nco 1 Rsa 1 Suu 961 Sca I Taq 1 Alid 1 Dde l Hae III Hinf 1 Mbo I Suu 961 Ttiq 1 1 A A A A A A A A A A A A A A A A A Figure 3. Regression of pairwise cornparisons of the obsenred number of mutations per nucleotide sampled by sequence and ment-WLPandyses of 46 walleye. P-se compariçons were correcte-by dividing the observed nimiber of mutations between each pair of fish by the number of base pairs assessed by sequence (5 13nt) and RFLP (553.5bp) analyses. The one-twne ratio is show by a doaed line. Figure 4. Regression of the number of mtDNA haplotypes detecred per nucleotide sweyed for (A) fiapent-WLP and (B)sequence analyses. Figure 5. Neighbour-joining trees relating genetic distances among haplotypes identified with control region sequence and fragment-RFLP analyses of 46 walleye. Letters and numbers at branch tips denote haplotype designations for sequence and fragment-RFLP analyses, respectively. Numbers inside the square brackets in the upper tree refer to kagment-RFLP haplotypes exhibiting control region sequences represented by the letter. Confidence levels in percent estimated fiom 2000 bootsûapping replicates and the majority-de consensus algonthm are listed next to branches adjacent to clades with 250% support. Distances are additive according to the percentage sequence divergence sale shown. Putative phylogenetic groupings uehdicated with capital letters. FRAGMENT-RFLP Figure 6. Majority-rule consensus tree of four equally parsimonious trees resolved hmheuristic searches in PAUP v3.11; taxa were added randomly with 25 replications, with WARSand steepest decent options invoked and with branch swapping by the tree bisection- reconstruction algorithm. Numbers and letters on branches denote haplotype designations for hgrnent-RnP and sequence analyses, respectively. Confidence levels (percent) estirnated hm 100 pseudo- replicates and decay indices are listed above and below branches adjacent to clades with 239% support, respectively. Table 6. Fragment-RFLP haplotype kquencies and nucleon diversities (h) among walleye (Stizostedion vitternn ) populations and rearing ponds nom the eastem Lake Huron region. Haplo type Region/Population 1 4 5 8 11 12 13 14 16 n h Eastern Gmgian Bay MOOII(1996) - 57 11 ------68 0.275 Shebeshekong(I997) - 20 10 ------30 0.459 Key (1996) - 31 17 - 2 - - - - 50 0.509 French River CompIex Dalles Rapids (1997) 1 24 12 - - - - 2 1 40 0.561 Meshaw Falls (1996) - 16 12 - - 1-- 29 0.542 Pickerel ( 1997) - 6 4 - 3 1 - 1 - 150.771 North Channel Whitefish Falls (1996) 5 17 8 1 1 4 13 - - 49 0.781 Spanish ( 1995-'96) 4318436 - - - 56 0.661 Total 337 Rearmg Ponds Spanish ( 1996) -25-82- - - - 35 0.451 Whtefish Falls (1996) - 4 26 ------30 0.233 Key (1995) -283------31 0.181 Total 96 MOOn (74- - -Shebeshekong -( 56) (SU Meshaw Faiis (86) -Key Pickerel Daiies Rapids I Huron Figure 7. Neighbour-joining tree of interpopulational genetic distances (D) among walleye sampled fkom (0 eastem Georgian Bay and the French River complex and (II) the North Channel. Confidence levels estimated fiom 1000 bootstrapping replicates and the majority-de consensus algorithm are listed next to branches adjacent to groups with 250% support. Distances are additive according to the percentage sequence divergence scale shown. Table 7. Fre~uenciesof mtDNA haploiypes in walleye (Stizostedion vitrem ) sampled f?om the Moon and French (Dalles Rapids) Rivers between 1968 and 1 997. Haplorypes among samples collected between the years 1 968 to 1 988 were detennined by assessing variable nucleotide sites 22,23,24,27,and 28 in the control region (see Figure 2 and Table 3). Population a d f i q ' n h Moon 1968-1970 - 34 2 1 2 39 0.241 1983 3 28 1 4 - 36 0.386 1988 - 28 6 - - 34 0.299 1996 - 57 II - - 68 0.275 Toial 177 French (Dalles Rapids) 1972 1 30 - 5 - 36 0.294 1997 1 25 12 2 - 40 0.529 Total 76 1The equivalent fragment-RFLP haplotype to sequence haplotype q is iinknown because haplotype q was not detected in the sequencing analysis of divergent haplotypes. Thus, fiequencies of haplotype q can only be compared between archivai samples collected fiom 1968 to 1988. '~a~lotypesdcsignations determined by hgment-RFLP anal*. Fragment-WL.P haplotypes 14 (j)(2 waileye) and 16 (1) (1 waileye) sampled fiom the Dalles Rapids population in 1997 were grouped with haplotypes i and d, respectively, for direct cornparison to the archival samples (see Table 3). DISCUSSION Phylogenetic anaiysis of rntDNA haplotypes mtDNA variaton detected &y sequence und ficgment-RFLP analyses The control region sequence and hgment-RFLP analyses of the 20 individuals representing nine cornmon molecule-RnP haplotypes in central Great Lakes walleye (Billington et al. 1992) revealed that al1 three marker systems identified the common mtDNA Lineages (Table 2). Relatively minor discrepancies existed between each marker system indicating that variation detected in the sequence and fiagrnent-RFLP analyses is comparable to that detected by RFL,P analysis of the entire molecule. Variation resolved with the bgment-RnP analysis was approximately two times higher than that reported for the control region sequence analysis among the 46 fish; both in terms of the number of mutations observed and the number of haplotypes detected per nucleotide sunteyed (Figure 3 & 4). Although intraspecific genetic population surveys have employed direct sequencing or RFLP analysis of arnplified mtDNA segments (Cronin et al. 1993, McGauley & Mulligan 1995, Apostolidis et al. 1997, Okazaki et al. 1996, Vitic & Sto beck 1996) few have compared the efficiency of di fferent markers systems at assessing genetic variation and resolvhg phylogenetic relationships among mtDNA lineages. Stepien (1995) implied higher levels of variation in the entire control region compared to RFLP analysis over the mtDNA genome in walleye from Lake Erie. Similarly, in swordnsh (Xiphias gladius), hi& sequence variability observed in the entire control region contrasted with that observed by RFLP anaiysis over the entire molecule (Alvarado Bremer et al. 1995, Rose1 & Block 1996). In two different stuclies, empirically based cornparisons among rntDNA haplotypes of brook charr (Salvelinusfontinalis; Bernatchez & Danzmann 1993) and white sturgeon (Brown et al. 1993) revealed that nucleotide variation in a portion of the co~trolregion flanking the tRNA probe gene was two times higher than that detected by RFLP analysis of the entire molecule. Conversely, Ferguson et al. (1993) exarnined 275nt near the 3' end of the control region and detected similar low levels of genetic variability as observed by RFLP analysis of the entire rnolecule in lake sturgeon (Acipenserfilvescens). Although cornparisons of rates of evolution and patterns of genetic change observed in different segments of mtDNA should be interpreted with care, the results of this study suggest that the control region is evolving at a comparable or slower rate to protein-coding gens in mtDNA of walieye. Oniy 4 variable sites (three sites assessed by semi-isoschizomers Rsa 1 [B,E,GSI] and Sca I [B,C,D] and 1 site assessed by Hue iII [BI, see Tables 4 & 5) of the 40 detected by the fragment-RnP maiysis existed in the control region. Consequently, a large portion of the variation existed in the protein- coding gens that were assessed (cytochrome b, ND 96, ND 3/4). The notion that the control region is evolving at a slower rate compared to the protein-coding genes is supported since the amount of variation observed in the fhgment-RnP analysis is likely underestimateci. The efficiency of detecting variation by paliadromic recognition sequences is limited relative to direct DNA sequencing (Bematchez & Danzmann 1993) especially at high levels of divergence (Grant et al. in press). Independent mutational changes occurring at the same restriction site can be undetected or can cause artifactual homoplasy, and substitutions can remain undetected due to limitations in resolution of fragments in analyticd gels (Bematchez & Danzmann 1993). Higher mtDNA variation observed in the fragment-RFLP analysis (assessing mostly protein-coduig genes) comparai to the sequencing analysis might have been caused by sarnpling bias since most individuals were selected for sequencing based on variation detected initiaiiy in the fÏagrnent-RRS analysis (Table 2). Also, selecting and using restriction enzymes that were lmown previously to produce RFLP in the entire mtDNA molecule of walleye may have biased the proportion of polyrnorphic sites to monomorphic sites detected in the hgment-RFLP analysis relative to the sequence analysis. The results fiom subjecting a purely random choice of subjects to a similar analyses, using a random sample of restriction enzymes that potentially only detect monomorphic sites, could differ fiom that presented here. Despite this realization, the rate of evolution in non-coding and coding regions of mtDNA is comparable in a variety of fishes at both intraspecific and interspecific levels (Thomas & Beckenbach 1989, Gi&a et al. 1994, Zhu et al. 1994, Apostolidis et al. 1997). For example, in two different shidies with brown trout (Salmo ma), mtDNA variation detected by sequencing analysis of PO~O~Sof two protein-coding genes (280nt in cytochrome b and 3 15nt in ATPase subunit VI) was comparable to that observed in 3 10nt near the 5' end of the control region in the same individuais (Gi* et al. 1994, Apostolidis et al. 1997). In addition, Giufiet al. (1994) noticed that protein-coding and non-coding regions were congruent in terms of identifying phylogenetic groupings and that protein-coding genes allowed partial resolution of a phyletic relationship that was previously unresolved in brown trout. An inteqecific study in Cichlids hmeastem Afirica revealed similar dative sequence divergence between a 402nt segment of the cytochrome b gene and a 450nt segment near the 5' end of the control region (Sturmbauer & Meyer 1993). However, sequence variation in 195nt in the control region flanking the tRNA probe gene of three species of Pacific buttdyfishes (Chaetodontidae) was substantially higher (approliimately 40 times) than that detected in a 500nt region of the cytochrome b gene (McMillan & Palumbi 1997). The ratio of transitions to transversions (1 51.6) in the portion of the control region analyzed was comparabk to that (1.8) obsened in the entire control region sequence among wdleye sampted fkom Lake Erie (Stepien 1995). Simila.low transition to transversion ratios have been observed in a portion of the control region flanking the tRNA proline gene in rntDNA of brook charr (Bematcha & Danzmam 1993) and of brown trout (Gi* er al. 1994). However, low transition to tramversion ratios at the intraspecific level are uncornmon in vertebrates and low ratios are typicd for interspecific cornparisons (see Meyer 1993). My results support the hypothesis thaî low transition to transversion ratios in a section of the control region flanking the tRNA proline gene might be cornmon in teleosts (Bernatchez & Danmiam 1993). Relotionslr@samong haplofypes nie examination of variation among regions of the mtDNA molecule assessed in this study showed that three major phylogenetic groups exist (Figure 6), corresponding to refiqgial groups (AJ3.C) identified by BiIlington & Hebert (1988) and Ward er al- (1989). Although it may be postulated that the central Great Lakes is an area of secondary intergradation among fish originating hmdifferent refugia, the distribution of mtDNA haplotype fkquencies among populations of Lake Huron suggests this region was recolonized by fish hma Mississippian refugium (predomhance of haplotype 4; see Billington et al. 1992). The low number of haplotype 1 and haplotype 10 fish sampled £kom eastem Lake Huron sites (Table 6 & 7) combineci with the predominance of haplotype 1 fish in eastern Canada and the predominace of haplotype 10 fish in western Canada (Billington et al. 1992) suggests that secondary contact has been limitai between fish fiom different refigia in the region. The control region sequence analysis revealed that groups A and C are putatively moa closely related to haplotype 34 and suggested that lineages within these groups are ancestral in Great Lakes walleye. Estimates of sequence divergence, based on control region sequencing and Kimura's (1980) two parameter mode1 of sequence evolution, between central Great Lakes walleye and haplotype 34 (H.0402-0.0464) were greater than those obtained by Billington & Strange (1995) using RFLP analysis of the entire molecule (W.019). Although the control region seems to evolve at a similar rate relative to the protein-coding genes assessed in this study estimates based on the entire molecule might better reflect the actual divergences between northem and southem walleye. Conserveci genes account for a large portion of the molecule and appear to evolve at slow rates (Meyer 1993) cornparecl to the genes and the control region assessed in this study. However, the two different estimates of d are comparable since Billinson 8r Slrange (1995) used a maximum likelihood method (Nei & Tajima 1983, Nei et ai. 1985) which has been reported previously to be approxirnately one half the estimates of sequence divergence between a pair of DNA sequences (Danzmann et al. 1993) and the estimates obtained for restriction site data analyzed in MTDIS @mm1998) at 10w levels of divergence (d Faber & Stepien 1997). Divergences ranghg fiom 0.002 to 0.005 are consistent with the Late Pleistocene Ongin Mode1 (Klicka & Zink 1997). Although there appears to be more subdivision among the mtDNA lineages belonging to group B than previously reported for the species (Ward et al. 1989) bootstrapping support on branches adjacent to the various clusten of haplotypes was low (Figure 6). UPGMA cluster analysis indicates that sequence divergence between groups A or C and B averaged 0.008 to 0.009 suggesting a period of approximately 400 000 to 450 000 years since they shared a common ancestor. Estimated times of coalescence for intraspecific mtDNA lineages in northem waileye in this study are comparable to those proposed by Billington & Hebert (1988) when values of d (maximum likelihood method; Nei & Tajima 1983 and Nei et al. 1985) are multiplied by 2 (discussed previously). These authors estimated nucleotide site divergence leveis of H.00467 M.002 between the two main groups and suggested a period of approximately 230 000 f100 000 years since they shared a common ancestor, prior to the Wisconsin glacial advance during the late Pleistocene. Estimated divergence values in the present study were sùnilar to the mean of estimates for 12 different fieshwater species of fish (d4.0093) occupying previously glaciated regions (Billington & Hebert 1991 ). Vicariant events prior to the late Pleistocene glaciations have likely played a dominant role in stimulating mtDNA divergence withui the species. MtDNA diversity and exploitation history DiSnr'butbns 4mlDNA hapIodypes Analysis of mtDNA variatisn in contemporary and archival samples of walleye nom eastern Lake Huron suggests that a relatiomhip exists between mtDNA diversity (h) and relative amounts of anthropogenic impacts on particular populations. Generally, populations with relatively low abundance and designated as having high levels of exploitation exhibited lower h than populations with high abundance and limited exploitation. Moreover, malysis of archival samples suggests that changes in mtDNA haplotypes fiequemies were associated with relative amountç of anthropogenic impacts in two populations with diEerent exploitation histories. A temporal change in h (reduction) was only observed in the population with elevated commercial exploitation and habitat alteration and not in the second population where anthropogenic influences have been more limite& Low mtDNA heterogeneity among populations of walieye fiom eastem Georgian Bay and the French River complex differs hmother studies showing that significant mtDNA differentiaiion exists among populations sampled in southem Lake Huron and Lake Erie (Stepien 1995, McParland 1996, Merker & Woodruff 1996). Sigaincant mtDNA heterogeneity is expected among populations because of founder events derthe last glacial event and reproductive isolation due to site fidelity of sexually mature walleye to natal areas (Stepien 1995, Merker & Woodnin 1996). Levels of h are expected to be similar among populations in regions that have been colonized by fish fiom common glacial refugia For example, h ranged nom 0.721 to 0.944 (analyzed using the same hgment-RFLP marker systern desaibed in this study) among walleye captured hm fwe populations in Lake Erie (Gatt & Ferguson unpublished data) that likely were founded nom two separate refigia (Atlanitic and Mississippi). The low levels of h among populations in eastern Georgian Bay and the French River complex relative to North Channel populations (Table 6) indicate that more recent events have likely influenced the pattern of mtDNA diffemtiation and levels of h observed among populations in eastern Lake Huron. The negative association between the contemporary levels of h and amount of anthropogenic influences suggests that impacts, such as commercial overharvest and environmental degradation, might have afTected distributions of mtDNA haplotypes among populations of eastem Lake Huron (Table 1 & 6). Negative associations between levels of genetic diversity and anthropogenic impacts among populations of exploited fishes have been documented previously (see review by Ryman et al. 1995). Brown et al. (1992), Guenette et al. (1993) and Ferguson & Duckworth (1997) suggested that commercial overharvest and habitat alteration were associated with reduced mtDNA diversity in hgmented populations of North Arnerican sturgeons (Acipenser spp.). Similarly, mtDNA diversity was substantiaüy lower in grass carp (Ctenopharpgodon picm) than among different native carps in China with similar life histories, impiying that reduced diversity was related to demographic Muences causing population bottlenecks (Lu et al. 1997). Alves & Coelho (1994) suggested that low levels of heterozygosity at enzyme-coding loci in populations of a rare endemic Iberian cyprinid (Chondrostoma lusitanicum) were related to anthropogenic pressures that resulted in hgxnentation of critical habitat. Moreover, Heithaus & Laushamn (1997) showed a positive association between heterozygosity at enzyme-coding loci in three species of North Arnerican fishes and relative water quality, showing environmental degradation can dfect genetic population structure. Differences in the pattern of temporal change in mtDNA haplotype kequencies between the Moon River and Dalles Rapids populations also suggest that anthropogenic influences are associated with levels of h among eastem Lake Huron populations (Table 1 & 7). The marked reduction in h and significant change in haplotype fkequencies (P~O.001)in the Moon River population over the last 28 years, based on cornpesons of contemporary and archival samples, coincides with commercial and recreational overharvest and habitat alteration (Winterton 1975, OMNR 1995). In the Moon River, extrerne water levei fluctuation at spawning sites during the spring has been documented after a hydro-electric dam was constmcted upstream on the Muskoka River in 1967. Water flow fluctuations have negatively Sected reproductive success (annual recruitment) and migrations of adult walleye in the Moon River (Winterton 1975). Thus, low recruitment into the fishery after 1967 and commercial overharvest could have contributed to the low abundance of fish and reduced h in the Moon River after 1983. Contras. to the temporal patterns of mtDNA differentiation observed in the Moon River, h did not decrease from 1972 to 1997 in the Dalles Rapids population (Table 7). The level of h was not expected to decrease because this population has had Limited commercial exploitation and stable recruitment into the fishery (Reckahn & Thurston 1991, Morgan 1996). However, frequencies of mtDNA haplotypes differed significantly (P 5 observed in contemporary samples from Dalles Rapids. Nielsen et al. (1 997) also demonstrateci the usefulness of analyzing archival samples for assessing temporal changes in genetic variability to obtain information about a natural populations history of demographic influences. The level of h in samples îkom the Whitefish Falls population was unexpected based on prior information used to estimate recent levels of abundance and categorize this river according to its exploitation history (Table 1 & 6). It is possible that the Whitefish Falls population has not experienced a significant reduction in effective population size relative to anthropogenic influences and that h has remained elevated. Alternatively, the genetic population structure and elevated h observed might have resulted fkom migrations of waileye hmone or more adjacent populations. Hansen & Mensberg (1996) explained that extinction-recolonization events affectai microgeographicd genetic differentiation observed in exploited populations of brown tmut. They used RFLP analysis of mtDNA and variation detected at 12 protein-coding loci to show that extinction-recolonizationevents had taken place at two sites where organic pollution caused the original populations to become extirpated. It is UnkIlown if straying could account for the h observed in the Whitefish Falls population because both sexes are thought to have high site fidelity to natal areas (Stepien 1995, Faber and Stepien 1997) and this popuIation is not reported to have been extirpated. Infuence of cuitwedfih on naturalpopulations The significant difîerence in mtDNA haplotype fiequencies (Pc0.05) and reduced h obsewed between cultured walleye and their parental source populations (Table 6) suggests that culture programs might be one mechanism lowering mtDNA variation in populations of eastem Lake Huron. Ihssen et al. (unpublished data, cited by Ferguson et al. 199 1) obtained comparable results; observing that pond-reared walleye exhibited a reduction in heterozygosity at enzyme-coding loci relative to the populations f?om which their parents originated. The selection of low numbers of fernales and the differential survival of progeny caused by selection and drift during rearing is known to affect levels of mtDNA diversity in culhrred fish relative to wild populations (Ferguson 1994). Selecting low numbers of fernales hmsource populations at specific times over the spawning period and subsequent artScid selection in the rearing environment rnight have accounted for low levels of h in cultured walleye relative to wïld populations. thssen et al. (unpublished data, cited by Ferguson et al. 1991) revealed that pond-reared walleye were signincantly geneticdly homogeneous relative to source populations because gametes where collected hma low numbers of parents with similar genetic backgrounds. As mentioned previously, CFIP groups often pool gametes collected nom fewer than five sexually mature walleye (2 females and 3 males) to produce batches of htgeneration fish. In Atlantic salmon, variation in enzyme-coding loci, chromosomal patterns, mtDNA, and microsatellite DNAs have been used to demonstrate that genetic diversity decreased in first generation hatchery fish produced hma limiteci nurnber of breeders captured hmnatural populations (Verspoor 1988, Garcia-Vazgues et al. 1995, Tessier et al. 1995, 1997). Ihssen et al. (unpublished data, cited by Ferguson et al. 1991) also no ticed si@ ficant di fferences in allele fkquencies among enzyme-coding loci between year classes in cultured walleye due to variation in survival among reared families. Moreover, meristic characteristics of pond-reared walleye were shown to vary hmthose of the parental source populations (Brown & Franzin 1994). Major variations in mtDNA diversity and meristic characteristics between naturally produced and cultured walleye probably exist due to fouding effects and artificial selection during rearing. Significant differences in morphology and behaviour between artificially reared and wild Atlantic salrnon in Norwegian rivers has been docwnented by comparing sex ratios, length distributions, and tunes of ascent (Gausen & Moen 1991). The supportive breeding programmes presently used in eastern Lake Huron appear inadequate in terrns of maintiiining similar levels of h and distributions of mtDNA haplotypes between culhued walleye and their source populations. The inherent genetic concerns associated with culture can be alleviated by following guidelines (e-g. Lannan et al. 1989, Hindar et al. 1991, Kerr et al. 1996) provided to conserve genetic variability in natural populations. In instances, culture programmes have maintained adequate levels of genetic variability in artificially reared fish. For example, Ferguson et al. (199 1) determined that OMNR rainbow trout (Oncorhynchus myfis) and brown trout hatchery broodstocks, collecteci in the early 1980s firom naturalized stocks inhabiting the Ganaraska River, Ontario (Canada) did not exhibit reduced enzyme heterozygosity compareci to their source. They suggested that the OMNR hatchery systern was successfid in maintainhg genetic variation withui broodstock strains due to a large number of founders with different genetic backgrounds randomly sampled thugtiout the spawning period over successive generations. Determining the genetic effects of artificial propagation and subsequent release of cuitured walleye into natural populations is difficult Although cultured walleye are ofien reieased into the river where their parents originate there are exceptions when fish are transfmed between drainages in eastern Lake Huron (Ihssen & Martin 1995). The creation of gene flow or introgression between previously isolated populations caused by the transfer of fkh between geographical isolated drainages can affect genetic variability of the recipient populations (Crozier & MoRett 1989, Hindar et al. 1991). For example, heterozygosity arnong enzyme-coding loci in aeelhead populations arnong coastal populations £kom Washington (USA) was much less than that reported in British Columbia (Canada) (Reisenbichler & Phelps 1989). Gene flow of cultured fish that surviveci after release shce the 1940s was proposed to have contributed to the reduction of heterozygosity among wild populations fiom Washington. In other instances, cultured fish tend to exhibit low survivorship after being released in naturai populations. In California (USA), rntDNA variation in contemporary sarnples from hatchery sources exceeded that observed in geographicaily proximate wild populations in three species of Oncorhpchus (Nielsen et al. 1994). These authors believed that the kdings reflected the historic introductions of different mtDNA lineages hmgeographically divergent populations into hatcheries and lack of survival andior introgression of cul& fish released into naturai populations. Cornparisons of mtDNA haplotype distributions in hatchery progeny and wild brook char reveaied that cultured fish (fernales) had minunal spawning success andor that their progeny had poor survivorship &er being released into populations in Algonquin Park, Ontario (Danzmann & ben1995). Survivorship of cultured walleye released at early life stages into viable populations throughout the Great Lakes appears to have been low (Colby et al. 1994, Kerr et al. 1996). Analysis of allele f?eqencies at 18 eflzyme-coding loci in walleye sampled fiom populations across Ontario showed that cultured fish had no detectable impact on the genetic structure of recipient populations (mssen & Martin 1995). Cultured walleye probably exhibit low survivorship andlor are incapable of reproducing (if reaching semal maturity) after being released into naturai populations. Founder effects and the differential fixation of haplotypes in cultured fish might be detectable if fish siwive after being released iato recipient populations. The elevated kequency of haplotype 13 fish in the Whitefish Falls population contrasts with that observeci in other eastem Lake Huron populations (Table 6) and suggests that haplotype 13 fish rnight have onginated from a previous breeding programme (i.e. founder effect). Populations receiving elevated numbers of cultured fish (Moon, Shebeshekong, Key, and Meshaw Falls; A. Liskauskas personal communication)also exhibit low levels of h relative to the other populations examined (Table 6). However, since these populations also have experienced high levels of exploitation and environmental degradation it is difficult to ascertain if culture programmes have caused a major reduction in levels of h (Table 1). Foundcr effects would be difficult to detect in recipient populations if they exhibit homogeneity in rntDNA haplotype fkquencies (Le. few haplotypes with relatively similar frequencies) and if pmgeny are retumed to the river where their parental sources originated over successive generations. For example, h was reduced in the Moon River after 1983 when intense culture and release of fish took place (Table 7)(Reckahn & Thurston 199 1). Thus, progeny produced hparental fish from the Moon River would likely exhibit either one or two haplotypes detected among contemporary samples (Table 6). As mentioued previously, levels of h among populations of eastem Lake Huron contrasts with those observeci in Lake Erie, where h mged fiom 0.721 to 0.944 among five populations using the same hgment-RFLP marksystem (Gaîî & Ferguson unpublished data). In a different study, hierarchical analysis of rnolecdar variance (AMOVA) among five populations kom Lake Erie reveaied that significant mtDNA variance existed within populations compare. to arnong populations within regions. or among regions (Faber & Stepien 1997). Although the populations studied by Gatt & Ferguson (unpublished data) and Faber & Stepien (1997) differ in temis of exploitation history (L. Halyk personal communication), co~ll~~lercialexploitation combined with the release of cultureci fish throughout the 1900s (Colby et al. 1994) does not seem to be accompanied with a reduction of h. Nelson & Soule (198T) mention that species of fish in oligotrophic enviro~l~llentsare probably less tolerant to exploitation and enWonmental change relative to the same species fond in eutrophic waters. The marked ciifference in trophic status between eastern Lake Huron (oligotrophic) and Lake Erie (eutrophic) could help to explain why the levels of h among populations hmeastern Lake Huron Vary more than in Lake Erie where simila impacts hmexpioitation and anthropogenic influences have occurred (Schneider & Leach 1979). My results suggest that walleye populations located in northem regions (low productivity/small effective population sizes) of the Great Lakes could be more vuherable to a loss of mtDNA variability caused by exploitation and anthmpogenic impacts relative to populations located in southem regions @igh productivitflarge effective population sizes). REFERENCES Alvarado Bremer JR, Baker AI, Mejuto J (1995) Mitochondrial DNA control region sequences indicate extensive mixing of swordfish (Xiphas gladius) populations in the Atlantic Ocean. Canadian Journal of Fisheries and Aquatic Sciences, 52, 1 720- 1732. Alves MI, Coelho MM (1994) Genetic variation and population subdivision of the endangered lberian cyprinid Chondrostoma lusitanicum. Journal of Fish Biology, 44, 627-636. Apostolidis APTTnantaphyllidis C, Kouvatsi A, Economidis PS ( 1997) Mitochondrial DNA sequence variation and phylogeography among SaZmo mtta L. (Greek brown trout) populations. Molealar Ecology, 6,53 1-542. Bardakci F, Skibinski DOF (1994) Application of the RAPD technique in tilapia fish: species and subspecies identification. Heredity, 73, 11 7- 123. Bernatchez L, Danzmann RG (1 993) Congruence in control-region sequence and restriction site variation in rnitochondnal DNA of brook chan (Salvelinusfontinalis Mitchell). Molecular Biology and Evolution, 10, 1002- 1 0 14. Bernatchez L, Dodson JJ, Boivin S (1989) Population bottlenecks: influence on mitochondrial DNA diversity and its effect in coregonine stock disc~ation. Journal of Fish Biology, 35 (Suppl. A), 223-244. Bematchez L, Gyuomard R, Bonhomme F (1 992) Sequence variation of the mitochondrial control region among geographically and rnorphologicalIy remote European brown trout (Solmo tmtta, L.) populations. Molecular EcoZogy, 1, 1 6 1- 173. Bernatchez L, Wilson CC (1998) Comparative phylogeography of Nearctic and Palearctic fishes. Molecular EcoZogy, 7,43 1 -452. Billington N, Barrette RJ, Hebert PDN (1992) Management implications of rnitochondrial DNA variation in walleye stocks. North American Journal of Fisheries Management 12: 276-284. Billington N, Danzmi~flllRG, Hebert PDN,Ward RD (199 1 ) Phylogenetic relationships among four members of StUostedion (Percidae) determined by mitochondnai DNA and allozyme analyses. Journal of Fish BioZogy, 39 (Suppl. A), 251-258. Billington N, Hebert PDN (1991) Mitochondrial DNA diversity in fishes and its implications for introductions. Canadian Journal of Firheries and Aquatic Sciences, 48 (Suppl. l), 80-94. Billington N, Hebert PDN (1988) Mitochondrial DNA variation in Great Lakes walleye (Stizostedion vitreum) populations. Canadian Jmalof Fisheries and Aquatic Sciences, 45,643-654. Billington N, Hebert PDN, Ward RD (1990) ALlozyme and mitochondnal DNA variation among three species of Stizostedion (Percidae): phy logenetic and zoogeographical implications. Canadian J'al of Fisheries and Aquatic Sciences, 47, 1093-1 102. Billington N, Strange RM (1995) Mitochondrial DNA analysis confims the existence of a genetically divergent walleye population in Northeastem Mississippi. Transactions of the Arnerian FLFheries Society?124,770-776. Bremer K (1994) Branch support and tree stability. CIadistics, 10,295-304. Brown JG, Franzin WG (1994)Differentiation of walleye (Stizostedim vitrmm) stocks and cornparison to their pond-reared stocks using morphological and genetic analyses. Canadian Technical Report of Fishmenesand Aqutic Sciences 1963. Brown JR, Beckenbach AT, Smith MJ (1993) Intmspecific DNA sequence variation of the mitochondrial control region of white sturgeon (Acipenser transmontanur). Molecular Biology and Evolution, 10 (Z), 326-341. Brown JR, Beckenbach AT, Smith MJ (1992) Influence of Pleistocene glaciations and human intervention upon mitochondrial DNA diversity in white sturgeon (Acipemer iramontanus)populations. Canadian Journal of Fisheries and Aquatic Sciences, 49,358-367. Carvaho GR (1993)Evolutionary aspects of fish distributions: genetic variability and adaptation. Journal of Fish Biology, 43 (Suppl. A), 53-73. Carvaho GR, Hauser L (1994)Molecular genetics and the stock concept in fishenes. Reviews in Ftrh Biology and Fisheries, 4,326-350. Chapman RW, Powers DA (1984) A method for the rapid isolation of mitochondrial DNA from fishes. Technical Report #UM-SG-TS-84-05, Maryland Sea Grant Program, College Park, MD. Colby PJ, Lewis CA, Eshemoder FU, Haas RC, Hushak LJ (1994) Walleye-rehabilitation guidelines for the Great Lakes area. Great Lakes Fishery Commission Cronin MA, Speamian WJ, Wilmot RL, Patton JC, Bickham JW (1993) Mitochondrial DNA variation in chinook (Oncorhynchur tshawytscha) and chum sahon (O. keta) detected by restriction enzyme analysis of polymerase chain reaction (PCR) products. Canadian Journal of Fisheries and Aquaric Sciences, 50,708-7 1 5. Crozier WW, Moffett UJ (1989) Amount and distribution of biochemical-genetic variation among wild populations and a hatchery stock of Atlantic salmon, Salmo salar L., fiom northeast Ireland. JmaZ of Fish Biology, 35,665-677. Danzmann RG (1998) MTDIS: A cornputer program to estimate genetic distances among populations based on variation in single-copy DNA. The Jmalof Herediîy, 89 (3), 283-284. Danmiam RG, Ferguson MM, Skulason S, Snorrason SS, Noakes DLG (1991) Mitochondrial DNA diversity among four sympatric morphs of Arctic charr, Salvelinus alpinus L., fiom Thingvallavatn, Iceland. Jmalof Fish Biologv, 39,649- 659. DamamRG, Ferguson MM, Arndt SKA (1993) Mitochondrial DNA variability in Ontario and New York rainbow trout (Oncorhynchus mykiss). Canadian Jounial of Zoology, 71, 1923-1933. Dao~nannRG, PE Ihssen (1995) A phylogeographic survey of brook cham (Salvelinus fontindis) in Algonquin Park, Ontario based upon mitochondnal DNA variation. Molecular Ecology, 4,68 1-697. Eriksson T (1995) AutoDecay v.2.9.8. Cornputer program available at hnp://www.botan.su.se/systematik/foIldT~rsten.html. Faber JE, Stepien CA (1997) The utility of mitochondrial DNA control region sequences for anaiyzing phylogenetic relationships among populations, species, and genera of the Percidae. In: Molecular Systematics of Fishes (eds Kocher TD,Stepien CA), pp. 129- 143. Academic Press, San Diego, California, USA. Felsenstein J ( 1995) PHYLIP (Phylogeny Uiference package) v3 Sc. Department of Genetics, SK-50,University of Washington, Seattle, WA. Ferguson M (1994) The role of rnolecular genetic marken in the management of cultured fishes. Reviews in Fish Biology and Fisheries, 4,35 1-3 73. Ferguson MM (1990) The genetic impact of introduced fishes on native species. Canadian Jownal of Zoology, 68,1053- 1057. Ferguson MM, Bernatchez L, Gan M, Konkle BR, Lee S, Malott ML, McKinley RS (1993) Distribution of rnitochondrial DNA variation in lake sturgeon (Acipenser filvescens) nom the Moose River basin, Ontario, Canada. Journal of Fish Biology. 43 (Suppl. A), 91-101. Ferguson MM, Duckworth GA (1997) The statu and distribution of lake sturgeon, Acipenserfilvescens, in the Canadian provinces of Manitoba, Ontario and Quebec: a genetic perspective. Environmenial Biology oft.shes, 48,299-309. Ferguson MM, kenPE, Hynes JD (1991)Are cultined stocks of brown bout (Suho ma)and rainbow trout (Oncorhynchusmykirs) genetically similar to their source populations? Canadian Journal of Fisheriesand Aquatic Sciences, 48 (Suppl. l), 118-123. Garcia-Vazguez E, Moran P, Pendas AM, Izquierdo JI, Linde AR (1995) Effect of parental numbers on chromosome patterns found in artificially produced Atlantic salmon stocks. Transactions of the American Fisheries Society, 124,939-942. Gausen D, Moen V (1991) Large-scale escapes of famied Atlantic salmon (Salmo sular) into Norwegian rivers threaten natural populations. Canadian Jomal of Fisheries and Aquatic Sciences, 48,426-428. Giu& E, Bematchez L, Guyomard R (1994)Mitochondrial control region and protein- coding genes sequence variation among phenotypic foms of brown trout Suimo trutta fiom northem Italy. Molecular Ecology, 3, 1 6 1 - 1 7 1. Grant WS, Clark AM, Bowen BW (1998) Why RFLP analysis of mitochondrial DNA failed to resolve sardine (Sardinops)biogeography: insights £kom rnitochondrial DNA cyiochrome b sequences. Canadian Journal of Fisheries and Aquatic Sciences, in press. Guenette S, Fortin R, Rassart R (1993) Mitochondrial DNA in lake sturgeon (Acipenrer fulvescens) fkom the St. Lawrence River and James Bay drainage bas& in Quebec, Canada Canadiun Journal of Fishwies and Aquatic Sciences, 50,659-664. Gunn JM (1979)A study ofthe walleye (Stizostedion Mtreum) population at the mouth of the French River. Ontario Ministry of Natural Resources, French River Project 1974- 78. Hansen MM, Mensberg KLD (1996) Founder effects and genetic population structure of brown trout (Salmo trutta) in a Danish river systern. Canadian Journal of Fisheries and Aquatic Sciences, 53,2229-223 7. Heithaus MR, Laushman RH (1997) Genetic variation and conservation of stream fishes: influence of ecology, life history, and water quality. Canadian Journal of Fisheries and Aquatic Sciences, 54, 1822-1 833. Hindar EC, Ryman N, Utter F (1991)Genetic effects of cultureci fish on naturai fish populations. Canadian Journal of FisheTies of Aquatic Sciences, 48,945-957. hsen PE, Martin GW (1995) Biochemicai genetic diversity of Ontario waileye (Stizostedion vitreum vifreum) populations: implications for stocking. Percid Community Synthesis, Aquatic Ecosystems Research Section, Ontario Ministry of Natural Resources, Maple, ON, Canada Kerr SJ, Corbett BW, Flowers DD, Fluri D, benPE, Potter BA, Seip DE (1996) Walleye stocking as a management tool. Ontario Ministry of Natural Resources, Aquatic Ecosystems Branch, Peterborough, ON, Canada Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequenca. Journal of Moleculor Evolution, 16, 11 1 - 120. Klicka J, Zink RM (1997) The importance of ment ice ages in speciation: a failed paradigm. Science, 277, 1666- 1669. Kocher TD, Thomas WK,Meyer A, Edwards SV, Paabo S, Villablanca FX, Wilson AC (1 989) Dynamics of mitochondnai DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences of the USA, 846196-6200. Kumar S, Tamura K, Nei M (1993) MEGA: Molecula. Evolutionary Genetics Anaiysis, v 1.02. The Pennsylvania State University, University Park, PA. Lannan JE, Gall GAE, Thorpe JE, Nash CE, Ballachey BE (1989) Genetic resource management of fish. Genome, 31,798-804. Leary RF, ALlendorf FW, Forbes SH (1993) Conservation genetics of bull trout in the Columbia and Klamath river drainages. Conservation Biology, 7-856-865. Lee W, Conroy J, Howell WH, Kocher TI3 (1995) Structure and evolution of teleost mitochondrial control regions. Journal of Molenrlar Evolution, 41, 54-66. Lu G, Li S, Bematchez L (1997) Mitochondrid DNA diversity, population structure, and conservation genetics of four native carps within the Yangtze River, China. Canadian Journal of Fisheries and Aquatic Sciences, 54,4748. McGauley K, Mulligan TJ (1995) Polymerase chah reaction-restriction fiagrnent length polymorphism analysis of mitochondrial rRNA genes fkom yellowtail rocknsh. Journal of Fish Biology, 47,744-747. McMillan WO, Palumbi SR (1997) Rapid rate of control-region evolution in Pacific butterfiyfishes (Chaetodontidae). Journal of Molenrlar Evolution ,45,473 -484. McParland TL (1996) Genetic population structure and mixed stock analysis of walleye (Stùostedion vibewn) in the Lake Ene-Lake Humn corridor a combined analysis with dozyme and mtDNA markers. MSc. Thesis, University of Guelph, Guelph, ON, Canada Merker RI, Wo- RC (1 996) Molecular evidence for divergent breeding groups of walleye (Stizostedion vitreum) in tributaries of Western Lake Ene. Jmalof Great Lakes Research, 22,280-288. Meyer A (1993) Evolution ofmitochondnal DNA in fishes. In: Biochemishy and moleculor biology offises, Vol. 2 (eds Hochachka PW, Mommsen TP), pp. 1-38. Elsevier Press. Morgan GE (1996) Status of the French River fishery Partl: walleye. French River Cooperative Fisheries Unit Report No. 96.1, Lamentian University, Sudbury, ON, Canada- Moritz C, Dowling TE, Brown WM (1987) Evolution of animal mitochoncirial DNA: relevance for population biology and systematics. Annwl Raiews of Ecology and Systematics, 18,269-292. Moritz C, Lavery S, Slade R (1995) Using allele kequency and phylogeny to define units for conservation and management. American Firheries Soczev ~vmposzum,17,249- 262. Nei M, Stephens JC, Saitou N (1 985) Methods for computing the standard mors of branching points in a.evoiutionary tree and their application to molecular data for humans and apes. MolecuIar Biology and EvoZution, 2,66-85. Nei M, Tajima F (1983) Maximum likelihood estimation of the nimiber of nucleotide substitutions fiom restriction sites data Genetics, 105,207-217. Nei M, Tajima F (1981) DNA polymorphism detectable by restriction endonucleases. Genetics, 97, 145-163. Nelson K, Soule M (1987) Genetical conservation of exploited fishes. In: Population Genetics and Fishery Management, (eds Ryman N, Utter F), pp. 345-368. University of Washington Press, Seattle, WA. Nielson JL, Gan C, Thomas WK (1994) Differences in genetic diversity for mitochondnal DNA between hatchery and wild populations of Oncorhynchus. Canadiun Journal of Fisheries and Aquatic Sciences, 51 (Suppl. 1), 290-297. Nielsen EE, Hansen MM, Loeschcke V (1997) Analysis of microsatellite DNA from old scale samples of Atlantic salmon Salmo salar: a cornparison of genetic composition over 60 years. Molecular EcoZogy, 6,487-792. Okazaki T, Kobayashi T, Uoymi Y (1996) Genetic relationships of pilchards (genus: Sardinops) with anti-tropical distributions. Marine Bioiogy, 126,585-590. OMNR [Ontario Ministry of Nahtral Resoma] (1995) Lake Huron Management Unit 1994 Annual Report. Queen's Printer for Ontario, ON, Canada Reckahn JA, Thmon LWD (199 1) The present (1989) statu of walleye stocks in Georgian Bay, North Channel, and Canadian waters of çouthern Lake Huron. Lnr Statu of walleye in the Greut Lakes: case sludies prepared for the 1989 workrhop (eds Colby PJ, Lewis CA, Eshenroder RL), pp. 85- 145. Great Lakes Fishery Commission, Special Publication 9 1- 1. Reisenbichler R.R, Phelps SR (1989) Genetic variation in steelhead (Salmo gairdneri) hmthe no& wast of Washington. Canadian ~ourndof Firheries and Aquatic Sciences, 46,66-73. Roff DA, Bentzen P (1989) The statistical analysis of mitochonârial DNA polymorphisms: Chi-square and the problem of small samples. MolecuIar Biolog); and Evoluaon, 6,539-545. Rose1 PE, Block BA (1996) Mitochondrïal control region variability and global population structure in the swordfïsh, Xiphias gIadiu- Marine Biology, 125, 11-22. Ryman N, Utter F, Laikre L (1 995) Protection of intraspecific biodiversity of exploited fishes. Reviews in Fish Biulugy and Fishenenes,5,417-446. Saitou NTNei M (1987) The neighbour-joining method: a new rnethod of reconstructing p hy logenetic trees. Molecular Biology und Evolution, 4,406-425. Schneider JC, Leach JH (1 979) Wdleye stocks in the Great Lakes, 1800- 1975: Bucniations and possible causes. Great Lakes Fishery Commission, Technical Report. Scott WB, Crossman EJ (1985) Freshwater fishes of Canada, pp. 767-774. Supply and Services Canada, Ottawa, Canada- Smith PJ, Francis RICC, McVeagh M (1991) Loss of genetic diversity due to fishing pressure. Fisheries Research, 10,309-316. Stepien CA (1995) Popdation genetic divergence and geographic patterns hmDNA sequences: examples hmmarine and freshwater fishes. American Fisheries Socie~ Symp~sium,17,263-287. Sturmbaua C, Meyer A (1993) Mitochondrial phylogeny of the endemic mouthbrooding lineages of cichiid fishes hmLake Tanganyika in eastem Africa Molecular Biology and Evolution, 10 (4), 75 1-768. Swofford DL (1993) Phylogenetic Adysis Using Parsimony, v3.1.1. Illinois Natural History Survey, Charnpaign. Swofford DL, Olsen GJ, Waddeil PJ, Hillis DM (1996) Phylogenetic Inference. in: Moleculur Systemutics, 2nd edn (eds Hiliis DM, Moritz C, Mable BK), pp. 407-5 14. Sinauer Associates, Inc., Massachusetts, USA. Tessier N, Bernatchez L, Resa P, Angers B (1995) Gene divmity analysis of mitochondrial DNA, microsatellites and ailoqnes in landlocked Atlantic saimon. Jmaiof Fîsh Biology, 47 (Suppl. A) 156- 163. Tessier N, Beniatcha L, Wright JM (1997) Population structure and impact of supportive breeding inférred hmmitochondrial and microsateliite DNA analyses in land-locked Atlantic salm011 Salrno salm L.. MoZenrlnr Ecology, 6, 735-750. Thomas WK, Beckenbach AT (1989) Variation in salmonid mitochondrial DNA: evolutionary wnsa-aints and mechanisrns of substitution. Jmaiof Molecuiar Evolution, 29,233-245. Todd NT, Haas RC (1993) Genetic and tagging widence for movement of waileye between Lake Erie and Lake St. Clair. Jmmai of Great Lakes Research, 19,445-452. Verspoor E (1988) Reduced genetic variability in first-generation hatchery populations of Atlantic salmon (Saimo salar). Canadian Jou171ui of Fisheries and Aqnatic Sciences, 45, 1686- 1690. Vitic E2, Strobeck C (1996) Mitochondrial DNA anaiysis of populations of lake trout (Salvelinus namayczuh) in west-central Canada: implications for stock identification. Canadian Jounai of Fishmenesand Aguatic Sciences, 53, 1O3 8- 1047. Ward RD, Billington N, Hebert PDN (1989) Cornparison of aiIozyme and mitochondrial DNA variation in populations of walleye, Stizostedion vi~eum.Canadian Journal of Fishem and Aquatic Sciences, 46,2074-2084. Wilson CC, Hebert PDN (1996) Phylogeographic origins of lake trout (Suivelinus namaycush) in eastern North America Canadiun Journi of Fisheries and Aquatic Sciences, 53,2764-2775. Winterton GK (1975) Structure and movement of a spawning stock of wdeye Stizostedion wMtreumvitrmm (Mitchiil) in Georgian Bay. MSc. Thesis, University of Guelph, Guelph, ON, Canada Zhu D, Jarnieson BGM, Hugall A, Moritz C (1994) Sequence evolution and phylogenetic signal in control-region and cytochrome b sequences in rainbow fishes (Melanotaeniidae). MolecuZar Biology and Evolution, 11 (4), 672-683. IMAGE EVALUATION TEST TARGET (QA-3)