DOCSLIB.ORG

Development of Microsatellite Loci for the Western Slimy Salamander (Plethodon Albagula) Using 454 Sequencing

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of Microsatellite Loci for the Western Slimy Salamander (Plethodon Albagula) Using 454 Sequencing Conservation Genet Resour DOI 10.1007/s12686-012-9784-5 TECHNICAL NOTE Development of microsatellite loci for the western slimy salamander (Plethodon albagula) using 454 sequencing Brett N. Spatola • William E. Peterman • Nathan T. Stephens • Grant M. Connette • Donald B. Shepard • Kenneth H. Kozak • Raymond D. Semlitsch • Lori S. Eggert Received: 7 September 2012 / Accepted: 28 September 2012 Ó Springer Science+Business Media Dordrecht 2012 Abstract Terrestrial salamanders of the genus Plethodon Plethodon are closely tied to cool, moist abiotic conditions, are closely tied to abiotic environmental habitat features making them particularly sensitive to habitat alteration and and are particularly sensitive to land use and habitat fragmentation (Marsh et al. 2008; Petranka 1998). Western change. To better understand the effects of land use and slimy salamanders (Plethodon albagula) inhabit forested habitat fragmentation on population genetic characteristics, areas throughout the Ozark Highlands (Conant and Collins we screened 137 primers developed from 454 sequence 1998). The ability to disperse through and persist in frag- libraries, and developed 27 microsatellite primers for the mented landscapes can have a great impact on genetic western slimy salamander, Plethodon albagula. Twenty- diversity among populations (Noe¨l et al. 2007), and an two of these primers cross-amplified in P. shermani. These understanding of gene flow across the landscape is critical new loci will be invaluable tools to study habitat variables to forming sound conservation and management decisions affecting gene flow, population genetic structure, and (Storfer et al. 2010). genetic diversity across heterogeneous landscapes. Samples from P. albagula were collected by taking 0.5 cm of tail tissue from salamanders at Danville (n = 51) and Keywords Plethodon shermani Á Population genetics Á Reform (n = 50) Conservation areas, Missouri, USA, which Landscape genetics are separated by *25 km. Samples were stored in 95 % EtOH at -20 °C prior to DNA extraction. DNA was extracted using the Wizard SV 96 Genomic DNA Purification Habitat loss and fragmentation are key factors affecting the System (Promega, Madison, WI, USA). Sequences were stability of amphibian populations and can negatively generated using 454 technology (Roche, Branford, CT, USA) affect dispersal and population connectivity (Cushman in two ways; a microsatellite-enriched library was developed 2006; Stuart et al. 2004). Salamanders of the genus using methods outlined by Lance et al. (2010)forP. albagula, while traditional whole genome sequencing (WGS) was used to generate sequences for P. glutinosus, a sister species to B. N. Spatola Á W. E. Peterman (&) Á G. M. Connette Á P. albagula.TheP. albagula tissue was collected in Garland R. D. Semlitsch Á L. S. Eggert County, Arkansas , USA, approximately 500 km from the Division of Biological Sciences, University of Missouri-Columbia, 110 Tucker Hall, Columbia, sources of the samples were screened. For the WGS sequence MO 65211, USA data for P. glutinosus,weusedRepeatMaskerwithTandem e-mail: [email protected] Repeats Finder (Smit et al. 2012; Benson 1999) to identify reads containing microsatellites and then used a custom N. T. Stephens Department of Biological Sciences, Arkansas State University, PerlScript to identify reads with3 40 bp of sequence flanking Jonesboro, AR 72401, USA each side of the microsatellite region. We used Primer3 implemented within MSATCOMMANDER to identify and D. B. Shepard Á K. H. Kozak design primers for screening (Faircloth 2008; Rozen and Bell Museum of Natural History and Department of Fisheries, Wildlife, and Conservation Biology, University of Minnesota, Skaletsky 2000). Primers for 137 di-, tetra-, and penta- St. Paul, MN 55108, USA nucleotide microsatellites were developed from P. albagula 123 Conservation Genet Resour Table 1 Primer sequences, repeat motif, multiplex pool, and concentration in reaction (lM) for 27 microsatellite loci for P. albagula Locus Primer sequence 50 to 30 Motif Label Multiplex Concentration GenBank # PG_184b F: GTGCCCAGTGTGCTTTACAA AACAT(6) NED 1 0.1 JX946151 R: TTTGGGTCAAACCCTCTTTG PG_3XI F: AGCGGTGGATAGTCGTACAC AACAT(12) NED 2 0.05 JX946152 R: ATAGCACATAGGCAGATCAGTC PG_43M F: AGTCATTGTCAGCTTGCGC AATG(13) FAM 2 0.05 JX946153 R: GGGAGCTTGCATCAGGAAAG PG_P0G F: ACCTGTATTTCACGCTGCAC AATG(11) VIC 1 0.05 JX946154 R: CTGCACCTCTCACCCTACTG PG_OLQ F: AACTGCGGATAGTGGTCACC AACAT(10) – – – JX946155 R: AAGCAAACCAATGTCCCTGC PG_QWZ F: TCGTCTGATTATTGCGCTGC AATG(8) PET 2 0.05 JX946156 R: ACCTATCTCATCCACCACTGC PG_RIH F: AGCAGAGGGTTAGGGTATCG AAAG(16) FAM 2 0.05 JX946157 R: GCGCTCCGACACCTAAGG PG_V58 F: CTGTGCCACCTTGTTTCCTG AATG(10) PET 1 0.075 JX946158 R: TTGTGAGTCTCCTGCCCTTG PLAL_084 F: ACTCCACAAACTCACTACCTG ACAG(11) VIC 1 0.1 JX946132 R: TGTGGACCCTATTCTTGGCC PLAL_124 F: TCTCTCTAGCCTGACGTTCTG AG(12) NED 2 0.1 JX946133 R: TGCCGGGAATAAGACAAAGC PLAL_127 F: ATGTCCGAGCTATGAAACCC AATG(6) VIC 2 0.05 JX946134 R: GCACTCGCCTTGACCATTAC PLAL_190b F: AGAAGCTGTTGGCATGAGGT AGAT(26) FAM 1 0.1 JX946135 R: AGGTGCTATGGTGTGGCTTC PLAL_241 F: CAAAGGTAGGCAATGGTCTCG AATG(15) NED 2 0.1 JX946136 R: ACGAGCTAGACCTCTATTTGGG PLAL_315 F: CGGTGAATAACTCTTAAACCGC AGAT(20) NED 1 0.1 JX946137 R: TTAGCGTCATGTTGCCTCTG PLAL_331b F: GCTATAATGGCGGACAATGG AGAT(14) FAM 1 0.1 JX946138 R: TTTTCTAGTCGCCAGGATGC PLAL_402 F: AGTGGTGAGGGAGATGGATG ATCC(14) FAM 1 0.1 JX946139 R: TGGACTGTTGCTTTCTTGTGC PLAL_542 F: ATGCCTTAGGACCGCAGTAG AGAT(32) PET 1 0.1 JX946140 R: TGGGTTTCCTGGCATACTCC PLAL_545b F: TGGGCCTGGAGCATTACATA AGAT(27) VIC 2 0.1 JX946141 R: GCTTAGTGCAAGGTGTCTTCC PLAL_615 F: CCTAAGAGCACGGGACAGAG AGAT(14) VIC 2 0.1 JX946142 R: TATGAGGTCGATCGGTGAGC PLAL_701 F: CATGCGTACAGGATTAGGTCAG ACAG(16)…AGAT(16) FAM 2 0.1 JX946143 R: CAGTCTGCCTCTTTGTAAGGC PLAL_791 F: GCTTGTTTACTTGATGGAGC AATG(11) VIC 1 0.075 JX946144 R: ACGTAATCCCAGGTTACACTCC PLAL_815b F: GCTTCGTGCATTAAGTCGTG AATG(8) – – – JX946150 R: GATGCCACCGTTATTACCA PLAL_909 F: ATCGGAAGTGGGACCATAATG AACT(21) VIC 1 0.05 JX946145 R: TCGGAAGTGGGACCATAATG PLAL_AOYX3 F: AAATGGTTTCAGGCTGGCTC AATG(11) – – – JX946149 R: GGGACTGCAAAGTGACACATG 123 Conservation Genet Resour Table 1 continued Locus Primer sequence 50 to 30 Motif Label Multiplex Concentration GenBank # PLAL_B8DRY F: TGTGGACAGTGGGATCAAGG AGAT(10) VIC 2 0.1 JX946146 R: TGATGGAGCCAGAGAGCATG PLAL_C8W7K F: AGGACCTTGGCACTCTTAGG AGAT(9) PET 2 0.05 JX946147 R: CAGAGCGTCATTTCACCCTG PLAL_EIXNY F: TTTGTTTGTGGCTAGTCGTG ACAG(9)…AGAT(11) PET 2 0.15 JX946148 R: GCCCAGTCCTTGCTTCTTTC Table 2 Size ranges, number of samples successfully amplified (N), number of alleles (NA), observed (HO) and expected (HE) heterozygosities, for microsatellite loci in P. albagula and P. shermani Locus P. albagula P. shermani Size (bp) N NA HO HE Size (bp) N NA HO HE PG_184b 182–192 99 2 0.475 0.436 166–206 8 6 0.750 0.817 PG_3XI 130–156 101 2 0.039 0.038 120–130 8 3 0.500 0.575 PG_43M 105–125 101 4 0.378 0.347 100–138 8 7 0.750 0.742 PG_OLQ ?????164–204 8 2 0.375 0.508 PG_POG 229–245 101 5 0.308 0.378 220–264 7 8 0.625 0.900 PG_QWZ 152–156 101 2 0.256 0.294 152–160 8 2 0.250 0.233 PG_RIH 204 101 1 0.000 0.000 190–204 8 2 0.125 0.125 PG_V58 140–156 101 3 0.307 0.399 132–168 8 6 0.375 0.792 Plal_084 345–413 101 3 0.29 0.324 245–421 8 10 0.625 0.950 Plal_124 302–358 101 8 0.593 0.704 240–294 8 10 1 0.95 Plal_127 87–103 101 3 0.436 0.512 84–116 8 4 0.625 0.692 Plal_190b 272–380 95 18 0.673 0.832 307–413 8 9 0.875 0.917 Plal_241 211–247 101 7 0.455 0.424 190–230 8 8 0.875 0.908 Plal_315 281–399 98 19 0.745 0.827 243–297 8 10 0.875 0.933 Plal_331b 166–186 101 6 0.653 0.638 129–177 8 7 0.875 0.867 Plal_402 107–147 101 7 0.394 0.417 59–147 8 7 0.750 0.850 Plal_542 200–248 101 7 0.652 0.65 138–231 8 10 0.750 0.917 Plal_545b 326 101 1 0.000 0.000 – – – – – Plal_615 165–181 101 4 0.2 0.208 – – – – – Plal_701 302–356 100 11 0.8 0.81 – – – – – Plal_815b ?????213–253 8 7 0.875 0.850 Plal_791 106–122 101 4 0.229 0.232 – – – – – Plal_909 156–192 101 7 0.632 0.676 122–182 8 7 1.000 0.867 Plal_AOYX3 ?????405–453 8 9 0.625 0.917 Plal_B8DRY 245–281 100 7 0.344 0.444 238–358 8 9 0.500 0.908 Plal_C8WYK 193–237 101 7 0.339 0.383 164–292 8 12 0.875 0.958 Plal_EIXNY 265–381 95 21 0.643 0.92 – – – – – Meana 100.14 7.14 0.447 0.495 7.95 7.05 0.676 0.781 a Excluding monomorphic loci. ‘‘?’’ signifies loci that worked in P. albagula, but could not be fit into multiplex reactions; ‘‘-’’signifies loci with no or poor amplification in P. shermani (n = 87) and P. glutinosis (n = 50) sequences and screened dNTP, 0.5 units AmpliTaq Gold DNA polymerase (Applied using a single sample of total genomic DNA from Biosystems, Foster City, CA, USA), 0.89 bovine serum P. albagula. PCR conditions were standardized to 15 lL albumin (BSA), 0.4 lM of forward and reverse unlabeled containing 19 PCR Gold buffer, 2.0 mM MgCl2,2.0mM primer, and 1.0 lL (50 ng) genomic DNA. The PCR profile 123 Conservation Genet Resour included an initial denaturing step at 95 °C for 10 min, fol- understanding of ecology, population biology, and con- lowed by 35 cycles of 95 °C denaturing for 45 s, 60 °C servation of these species. annealing for 45 s, extension at 72 °C for 45 s; and a final 5-min extension at 72 °C. PCR products were separated in a Acknowledgments We thank C. Cramer (ASU) for sharing 454 4 % agarose gel with Gel Star (Lonza) and 100 bp ladder. sequences for P. albagula, and funding from the University of Missouri Research Board (CB000402), the DoD Strategic Environmental Forty primers yielding clear PCR products were further Research and Development Program (RC2155), the Arkansas Biosci- screened for polymorphism on seven samples.
Load more

Recommended publications
  • Salamander Species Listed As Injurious Wildlife Under 50 CFR 16.14 Due to Risk of Salamander Chytrid Fungus Effective January 28, 2016
    Salamander Species Listed as Injurious Wildlife Under 50 CFR 16.14 Due to Risk of Salamander Chytrid Fungus Effective January 28, 2016 Effective January 28, 2016, both importation into the United States and interstate transportation between States, the District of Columbia, the Commonwealth of Puerto Rico, or any territory or possession of the United States of any live or dead specimen, including parts, of these 20 genera of salamanders are prohibited, except by permit for zoological, educational, medical, or scientific purposes (in accordance with permit conditions) or by Federal agencies without a permit solely for their own use. This action is necessary to protect the interests of wildlife and wildlife resources from the introduction, establishment, and spread of the chytrid fungus Batrachochytrium salamandrivorans into ecosystems of the United States. The listing includes all species in these 20 genera: Chioglossa, Cynops, Euproctus, Hydromantes, Hynobius, Ichthyosaura, Lissotriton, Neurergus, Notophthalmus, Onychodactylus, Paramesotriton, Plethodon, Pleurodeles, Salamandra, Salamandrella, Salamandrina, Siren, Taricha, Triturus, and Tylototriton The species are: (1) Chioglossa lusitanica (golden striped salamander). (2) Cynops chenggongensis (Chenggong fire-bellied newt). (3) Cynops cyanurus (blue-tailed fire-bellied newt). (4) Cynops ensicauda (sword-tailed newt). (5) Cynops fudingensis (Fuding fire-bellied newt). (6) Cynops glaucus (bluish grey newt, Huilan Rongyuan). (7) Cynops orientalis (Oriental fire belly newt, Oriental fire-bellied newt). (8) Cynops orphicus (no common name). (9) Cynops pyrrhogaster (Japanese newt, Japanese fire-bellied newt). (10) Cynops wolterstorffi (Kunming Lake newt). (11) Euproctus montanus (Corsican brook salamander). (12) Euproctus platycephalus (Sardinian brook salamander). (13) Hydromantes ambrosii (Ambrosi salamander). (14) Hydromantes brunus (limestone salamander). (15) Hydromantes flavus (Mount Albo cave salamander).
    [Show full text]
  • Standard Common and Current Scientific Names for North American Amphibians, Turtles, Reptiles & Crocodilians
    STANDARD COMMON AND CURRENT SCIENTIFIC NAMES FOR NORTH AMERICAN AMPHIBIANS, TURTLES, REPTILES & CROCODILIANS Sixth Edition Joseph T. Collins TraVis W. TAGGart The Center for North American Herpetology THE CEN T ER FOR NOR T H AMERI ca N HERPE T OLOGY www.cnah.org Joseph T. Collins, Director The Center for North American Herpetology 1502 Medinah Circle Lawrence, Kansas 66047 (785) 393-4757 Single copies of this publication are available gratis from The Center for North American Herpetology, 1502 Medinah Circle, Lawrence, Kansas 66047 USA; within the United States and Canada, please send a self-addressed 7x10-inch manila envelope with sufficient U.S. first class postage affixed for four ounces. Individuals outside the United States and Canada should contact CNAH via email before requesting a copy. A list of previous editions of this title is printed on the inside back cover. THE CEN T ER FOR NOR T H AMERI ca N HERPE T OLOGY BO A RD OF DIRE ct ORS Joseph T. Collins Suzanne L. Collins Kansas Biological Survey The Center for The University of Kansas North American Herpetology 2021 Constant Avenue 1502 Medinah Circle Lawrence, Kansas 66047 Lawrence, Kansas 66047 Kelly J. Irwin James L. Knight Arkansas Game & Fish South Carolina Commission State Museum 915 East Sevier Street P. O. Box 100107 Benton, Arkansas 72015 Columbia, South Carolina 29202 Walter E. Meshaka, Jr. Robert Powell Section of Zoology Department of Biology State Museum of Pennsylvania Avila University 300 North Street 11901 Wornall Road Harrisburg, Pennsylvania 17120 Kansas City, Missouri 64145 Travis W. Taggart Sternberg Museum of Natural History Fort Hays State University 3000 Sternberg Drive Hays, Kansas 67601 Front cover images of an Eastern Collared Lizard (Crotaphytus collaris) and Cajun Chorus Frog (Pseudacris fouquettei) by Suzanne L.
    [Show full text]
  • The Journal of North American Herpetology
    JNAH ISSN 2333-0694 The Journal of North American Herpetology Volume 2015(1): 17-21 1 May 2015 jnah.cnah.org POPULATION ECOLOGY OF THE NORTHERN SLIMY SALAMANDER (PLETHODON GLUTINOSUS) IN EAST-CENTRAL ILLINOIS JOHN A. CRAWFORD1,4, ANDREW R. KUHNS2, AND MATHYS J. MEYER3 1National Great Rivers Research and Education Center, East Alton, IL 62024 2University of Illinois at Urbana-Champaign, Prairie Research Institute, Illinois Natural History Survey, Champaign, IL 61820 3University of Pikeville, Division of Mathematics and Science, Pikeville, KY 41501 4 Author for correspondence: [email protected] ABSTRACT: The importance of plethodontid salamanders in forested habitats has been recognized for decades and more recently plethodontids have been touted as a model taxon for monitoring ecosys- tem integrity and recovery. However, basic demographic data that are crucial to conservation and management plans are currently lacking for many species and regions. The objectives of our study were to characterize the population density, biomass, and capture success of a peripheral population of Plethodon glutinosus to provide a comparison for eastern populations and set a baseline for future monitoring of Midwestern populations. We estimated the population density of P. glutinosus at our site to be 0.41 salamanders/m2, with an estimated biomass of 0.70 g/m2. We did not fi nd any evidence for temperature or precipitation affecting capture success. Our results showed that our density estimate falls within the range of other population ecology studies of Plethodon and sets a baseline for other peripheral Midwestern populations. INTRODUCTION Because of greater plethodontid richness and abun- The importance of plethodontid salamanders in forest- dance in the Eastern United States, studies from this re- ed habitats has been recognized for decades (Hairston, gion are more common than in the Midwest (e.g., Petran- 1987; Davic and Welsh, 2004; Peterman et al., 2008).
    [Show full text]
  • A Quantitative Field Study of Paternal Care in Ozark Hellbenders
    Journal of Ethology (2018) 36:235–242 https://doi.org/10.1007/s10164-018-0553-0 ARTICLE A quantitative feld study of paternal care in Ozark hellbenders, North America’s giant salamanders Rachel A. Settle1 · Jefrey T. Briggler2 · Alicia Mathis1 Received: 14 December 2017 / Accepted: 22 June 2018 / Published online: 11 July 2018 © Japan Ethological Society and Springer Japan KK, part of Springer Nature 2018 Abstract Paternal care is relatively uncommon in tetrapods but appears to be the rule in the large aquatic salamanders of the primitive family Cryptobranchidae (North America: hellbenders, genus Cryptobranchus; Asia: giant salamanders, genus Andrias). For the Ozark hellbender, C. alleganiensis bishopi, a federally endangered subspecies, anecdotal observations of paternal care have been reported, but no quantitative assessments have been made. We quantifed behavior of a guarding male hellbender from video footage collected over 6 weeks in 2008 from a naturally occurring nest. We quantifed behavior of the guarding male to help develop hypotheses about costs and benefts of paternal care. Overall, there were high frequencies of tail fan- ning of the eggs and rocking behaviors (rhythmic, lateral back-and-forth movements of the body), which increase aeration of the nest. The male rarely left the nest unguarded and spent over half of the recorded time at the nest exposed at the nest entrance. Potential egg predators observed included centrarchid, cyprinid, ictalurid, and percid fshes, with centrarchids being the most common and exhibiting the most interest in the nest. The frequency of foraging by the male was low (n = 8 strikes at identifable prey), with a 37% success rate.
    [Show full text]
  • DEPARTMENT of the INTERIOR Fish and Wildlife
    This document is scheduled to be published in the Federal Register on 01/13/2016 and available online at http://federalregister.gov/a/2016-00452, and on FDsys.gov DEPARTMENT OF THE INTERIOR Fish and Wildlife Service 50 CFR Part 16 RIN 1018–BA77 [Docket No. FWS–HQ–FAC–2015–0005] [FXFR13360900000–156–FF09F14000] Injurious Wildlife Species; Listing Salamanders Due to Risk of Salamander Chytrid Fungus AGENCY: Fish and Wildlife Service, Interior. ACTION: Interim rule; request for comments; notice of availability of economic analysis. 1 SUMMARY: The U.S. Fish and Wildlife Service is amending its regulations under the Lacey Act to add all species of salamanders from 20 genera, of which there are 201 species, to the list of injurious amphibians. With this interim rule, both importation into the United States and interstate transportation between States, the District of Columbia, the Commonwealth of Puerto Rico, or any territory or possession of the United States of any live or dead specimen, including parts, of these 20 genera of salamanders are prohibited, except by permit for zoological, educational, medical, or scientific purposes (in accordance with permit conditions) or by Federal agencies without a permit solely for their own use. This action is necessary to protect the interests of wildlife and wildlife resources from the introduction, establishment, and spread of the chytrid fungus Batrachochytrium salamandrivorans into ecosystems of the United States. The fungus affects salamanders, with lethal effects on many species, and is not yet known to be found in the United States. Because of the devastating effect that we expect the fungus will have on native U.S.
    [Show full text]
  • Brooding Postures and Nest Site Fidelity in the Western Slimy Salamander, Plethodon Albagula (Caudata: Plethodontidae), from an Abandoned Mine Shaft in Arkansas
    Herpetological Natural History, 9(2), 2006, pages 141–149. 141 ©2006 by La Sierra University BROODING POSTURES AND NEST SITE FIDELITY IN THE WESTERN SLIMY SALAMANDER, PLETHODON ALBAGULA (CAUDATA: PLETHODONTIDAE), FROM AN ABANDONED MINE SHAFT IN ARKANSAS Stanley E. Trauth Department of Biological Sciences, Arkansas State University, PO Box 599, State University, Arkansas 72467, USA Email: [email protected] Malcolm L. McCallum1 Environmental Sciences PhD Program, Arkansas State University, PO Box 847, State University, Arkansas 72467, USA Robyn R. Jordan Department of Biological Sciences, Arkansas State University, PO Box 599, State University, Arkansas 72467, USA Email: [email protected] David A. Saugey United States Forest Service, PO Box 189, 8607 North Highway 7, Jessieville, Arkansas 71949, USA Email: [email protected] Abstract. We examined brooding postures and nest site fidelity in a nesting aggregation of western slimy salamanders (Plethodon albagula) from an abandoned mine shaft located in the Ouachita National Forest of southwestern Arkansas. From November 1999–December 2001, we collected a photographic record of brooding and nesting behavior. Females oviposit a free-hanging, grape-like egg cluster within relatively dry nest perches along the walls of the mine shaft. We recorded six female brooding postures from 101 obser- vations involving 101 egg clutches. The most common brooding posture (34.6% of the time) was one in which the female positioned her shoulder region next to or in contact with her egg clutch. Body coiling around the egg clutch occurred 20.8% of the time and at about the same frequency as brooding postures involving eggs touching the head (17.8%) or trunk (22.8%).
    [Show full text]
  • The Importance of Microhabitat: a Comparison of Two Microendemic Species of Plethodon to the Widespread P
    Copeia 104, No. 1, 2016, 67–77 The Importance of Microhabitat: A Comparison of Two Microendemic Species of Plethodon to the Widespread P. cinereus Vincent R. Farallo1 and Donald B. Miles1 Understanding the role of microhabitats in the ecology of plethodontid salamanders is of utmost importance in the light of recent climate change. Plethodontid species are inherently susceptible to rising temperatures and drier conditions as they utilize cutaneous respiration. Furthermore, many species of plethodontid salamanders have restricted ranges, including species limited to single mountain tops, increasing the consequences of environmental change as their ability to disperse is limited. In this study we compare microhabitat data for a broadly distributed salamander species, Plethodon cinereus, and two microendemic species P. sherando and P. hubrichti. Our analyses evaluate two hypotheses. First, each of these species occupies microhabitat that differs from the available habitat. Second, microhabitat selection of the two microendemic species diverges from the widespread P. cinereus. In addition to testing these hypotheses, we provide additional data to highlight the importance of quantifying thermal microhabitats at different scales. Both P. cinereus and P. sherando were found in microhabitats that differed from randomly selected microhabitats. Moreover, P. cinereus occurred in habitats with high relative humidity and cooler air temperatures, whereas P. sherando occurred in habitats with warmer air temperatures but cooler substrate temperatures. These results suggest that habitat selection may play a role in the persistence of the range of P. sherando in contact zones with P. cinereus. Our data suggest that there may be habitat use differences between P. cinereus and P. hubrichti, but a limited sample size prevents us from making any firm conclusions.
    [Show full text]
  • Homing and Egg Discrimination in the Western Slimy Salamander, Plethodon Albagula (Caudata: Plethodontidae)
    bioRxiv preprint doi: https://doi.org/10.1101/388249; this version posted August 9, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Homing and Egg Discrimination in the Western Slimy Salamander, Plethodon albagula (Caudata: Plethodontidae) 1 2 ROBYN R. JORDAN, JOSEPH R. MILANOVICH, MALCOLM L. MCCALLUM AND STANLEY E. TRAUTH Department of Biological Sciences, Arkansas State University, P.O. Box 599, State University, Arkansas 72467 1Present address: Department of Biology, Loyola University Chicago, Chicago, Illinois 60660. 2Present address: School of Agriculture and Applied Sciences, Langston University, Langston, Oklahoma 73050, e-mail: [email protected] Abstract.— In some species of vertebrates egg brooding is a costly form of parental care. Therefore, misdirection of parental care can significantly lower a female’s fitness. Because of the maternal investment and increased survivorship to offspring from egg guarding, a brooding female should home to her nest site after being displaced a short distance and discriminate between her own eggs and eggs from other females. In this study, we experimentally tested, in the field, alternative hypotheses concerning homing ability and egg discrimination in a population of nesting western slimy salamanders (Plethodon albagula). Fourteen brooding females were displaced 1 m to the left or right of their nest sites (determined randomly) for the homing experiment. Furthermore, brooding females (n = 13) were presented with their own clutches, which were displaced 50 cm to the left or right (determined randomly), and unfamiliar egg clutches at their original nest sites.
    [Show full text]
  • Endoparasites of Western Slimy Salamanders, Plethodon Albagula (Caudata: Plethodontidae), from Arkansas
    J. Helminthol. Soc. Wash. 60(1), 1993, pp. 124-126 Research Note Endoparasites of Western Slimy Salamanders, Plethodon albagula (Caudata: Plethodontidae), from Arkansas CHRIS T. MCALLISTER,' STEVE J. UrroN,2 AND STANLEY E. TRAUTH3 1 Renal-Metabolic Lab (151-G), Department of Veterans Affairs Medical Center, 4500 South Lancaster Road, Dallas, Texas 75216, 2 Division of Biology, Ackert Hall, Kansas State University, Manhattan, Kansas 66506, and 3 Department of Biological Sciences, Arkansas State University, State University, Arkansas 72467 ABSTRACT: Thirty-seven western slimy salamanders, al. (1986) found the protozoan Cepedietta mi- Plethodon albagula Grobman, 1944, collected between chiganensis (Woodhead, 1928) Corliss, de Puy- December 1988 and March 1992 from 10 counties of Arkansas, were examined for endoparasites. Fourteen torac, and Lorn, 1965, and unidentified imma- (38%) were infected with 1 or more parasites: 2 (5%) ture oxyuroids in a small sample of P. glutinosus with Cepedietta michiganensis (Woodhead, 1928) Cor- (=albaguld) from Arkansas. To our knowledge, liss, de Puytorac, and Lorn, 1965, 4 (11%) with an nothing else has been published on its parasites. isosporan, 10 (27%) with Cylindrotaenia americana Herein, we report several endoparasites from P. Jewell, 1916, 4 (11%) with Batracholandros salaman- drae (Schad, 1960) Fetter and Quentin, 1976, and 1 albagula. (3%) with an acanthocephalan cystacanth. In addition, Between December 1988 and March 1992, 37 3 (8%) salamanders harbored an intraerythocytic in- juvenile and adult (x ± SEM snout-vent length clusion, Cytamoeba bactifera Labbe, 1894, thought by [SVL] = 53.9 ± 0.2, range 23-86 mm) P. alba- some to represent a protozoan of undetermined tax- onomic status.
    [Show full text]
  • Linking Microhabitat and Species Distributions Of
    Notes from the Underground: Linking Microhabitat and Species Distributions of Plethodontid Salamanders A dissertation presented to the faculty of the College of Arts and Sciences of Ohio University In partial fulfillment of the requirements for the degree Doctor of Philosophy Vincent R. Farallo April 2017 © 2017 Vincent R. Farallo. All Rights Reserved. 2 This dissertation titled Notes from the Underground: Linking Microhabitat and Species Distributions of Plethodontid Salamanders by VINCENT R. FARALLO has been approved for the Department of Biological Sciences and the College of Arts and Sciences by Donald B. Miles Professor of Biological Science Robert Frank Dean, College of Arts and Sciences 3 ABSTRACT FARALLO, VINCENT R., Ph.D., April 2017, Biological Sciences Notes from the Underground: Linking Microhabitat and Species Distributions of Plethodontid Salamanders Director of Dissertation: Donald B. Miles Environmental characteristics play a pivotal role in delineating species distributions and, in turn, influence species richness, diversity, and interspecific interactions. However, species exist at various spatial and temporal scales. Therefore, the scale at which environmental data is collected will influence the interpretations of how it impacts organisms. Most species primarily exist at a small spatial scale making broad- scale climate and habitat data often less biologically relevant to these organisms. Instead microhabitat and microclimate variables are often what species will directly experience, which makes the connection between macro- and micro-scale data important for answering evolutionary and ecological questions. This dissertation quantifies microhabitat and microclimate use of plethodontid salamanders across a broad geographic area including latitudinal and elevational gradients. First, I review the importance of micro-scale environmental data and how can bolster studies in evolutionary ecology.
    [Show full text]
  • A Biological Survey and Monitoring Protocol For
    A BIOLOGICAL SURVEY AND MONITORING PROTOCOL FOR THIRTEEN CAVES AT FORT LEONARD WOOD, MISSOURI Submitted by: Steven J. Taylor1, Mike Slay2 and William Handel1 1Center for Biodiversity, Illinois Natural History Survey 607 East Peabody Drive, Champaign, IL 61820 (217) 244-2148 [email protected] 2Department of Biological Sciences 601 Science Engineering University of Arkansas Fayetteville, AR 72701 25 July 2003 Illinois Natural History Survey Center for Biodiversity Technical Report 2003(22) Prepared for Illinois State Museum Society, Attn: Steven R. Ahler Illinois State Museum Research and Collections Center 1011 E. Ash Street Springfield IL 62703 Caves are home to a variety of rare and unique vertebrates and invertebrates. Ft. Leonard Wood (Pulaski County, Missouri) contains more than 60 caves and other karst1 features (sinkholes, springs, etc.). Because light is absent from caves (beyond the twilight zone), most Missouri caves communities are decomposer communities that depend on energy entering the cave in the form of organic materials (both plant and animal) that fall into caves, are washed into caves, or are brought into caves by organisms that utilize both cave and epigean (above-ground) habitats. In addition to harboring two federally endangered bat species (Indiana Bat and the Gray Bat), the caves at Ft. Leonard Wood contain little-studied communities of invertebrates. Bat colonies (hibernacula and maternity colonies) and other trogloxenes2, such as cave crickets, woodrats and raccoons, bring organic materials into the caves that serve as part of the energy source for a unique community of cave invertebrates and smaller vertebrates (such as salamanders). Many cave-limited (troglobitic3) invertebrates are specialists in less food-rich environments, such as cave streams where energy may be derived from scattered leaf litter and twigs that wash or fall into the caves.
    [Show full text]
  • Biochemical Evolution in the Slimy Salamanders of the Plethodon Glutinosus Complex in the Eastern United States
    UNIVERSITY LIBRARY UNIVERSITY OF ILLINOIS AT URBANA-CHAMPAIGN The person charging this material is responsible for its renewal or return to the library on or before the due date. The minimum fee for a lost item is $1 25.00, $300.00 for bound journals. Theft, mutilation, and underlining of books are reasons for disciplinary action and may result in dismissal from the University. Please note: self-stick notes may result in torn pages and lift some inks. Renew via the Telephone Center at 217-333-8400, 846-262-1510 (toll-free) [email protected]. Renew online by choosing the My Account option at: http://www.library.uiuc.edu/catalog/ JUN 8 2009 MAY 1 4 2010 Digitized by the Internet Archive in 2011 with funding from University of Illinois Urbana-Champaign http://www.archive.org/details/biochemicalevolu57high the Slimy Salamanders of the Plethodon glutinosus Complex m the E KIWilllJlUWtM^K^ RICHARD HIGHTON, GEORGE C. MAHA, and LINDA R. MAXSON 57 m Biochemical Evolution in the Slimy Salamanders of the Plethodon glutinosus Complex in the Eastern United States Biochemical Evolution in the Slimy Salamanders of the Plethodon glutinosus Complex in the Eastern United States RICHARD HIGHTON, GEORGE C. MAHA, and LINDA R. MAXSON ILLINOIS BIOLOGICAL MONOGRAPHS 57 UNIVERSITY OF ILLINOIS PRESS Urbana and Chicago ILLINOIS BIOLOGICAL MONOGRAPHS Volumes 1 through 24 contained four issues each. Beginning with number 25 (issued in 1957), each publication is numbered consecutively. Standing orders are accepted for forthcoming numbers. The titles listed below are still in print. They may be purchased from the University of Illinois Press, 54 East Gregory Drive, Champaign, Illinois 61820.
    [Show full text]