Molecular Genetic Studies of Senescence in Anthurium

MOLECULAR GENETIC STUDIES OF SENESCENCE IN ANTHURIUM

A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAI‘I AT MĀNOA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

MOLECULAR BIOSCIENCES AND BIOENGINEERING

AUGUST 2012

Pierriden Azucena Perez

Dissertation Committee:

David Christopher, Chairperson Anne Alvarez Richard Criley John Hu Gernot Presting

Keywords: Anthurium senescence, Agrobacterium-mediated transformation

ABSTRACT

Senescence is a complex physiological process and has become an attractive area of research in plant molecular biology. The autoregulated production of cytokinin in plants transformed with the PrSAG12-IPT gene construct significantly delayed leaf senescence, and created plants that lived longer, produced more flowers with improved vase life, and an overall increased productivity. The promoter region of an arabidopsis cysteine protease served as the senescence-activated switch for the cytokinin gene

IPT, and the discovery of a homolog in anthurium (ANTH17) made possible the cloning and isolation of its promoter. The sequence contained motifs and cis-elements characteristic of senescence response, and transformation of arabidopsis with PrANTH17-IPT showed similar traits with those transformed with PrSAG12-IPT. Agrobacterium-mediated transformation of anthurium with the senescence-activated gene constructs proved challenging, and stable transformation of plants was confirmed by screening for the reporter gene

GFP using molecular methods. An effort to establish a protoplast transient expression system in anthurium was initiated in order to study protein subcellular signaling and localization, and is still in the process of optimization. Transcriptomic analysis of senescing leaf and spathe identified proteins involved in tissue-specific development, and provided an enormous collection of over 17,000 gene sequences that are differentially expressed.

An examination of the major anthurium seed development proteins provided initial results in understanding the connection between senescence and embryo development, two very similar molecular processes in plants.

TABLE OF CONTENTS

ABSTRACT ...... ii

LIST OF TABLES ...... vii

LIST OF FIGURES ...... viii

CHAPTER I. INTRODUCTION AND LITERATURE REVIEW...... 1

Biochemical changes during senescence ...... 2

Changes in gene expression associated with senescence ...... 5

Role of hormones and plant growth regulators ...... 6

Cytokinin & isopentenyl transferase ...... 8

Transgenic expression of cytokinin in plants ...... 9

A system to regulate cytokinin production in transgenic plants ...... 10

Anthurium andreanum ...... 12

Anthurium breeding and genetic transformation ...... 13

Green Fluorescent Protein as a useful reporter gene ...... 14

Seed development and senescence ...... 15

CHAPTER II. HYPOTHESES, SIGNIFICANCE OF RESEARCH AND OBJECTIVES ...... 17

Hypotheses ...... 17

Significance of Research ...... 18

Objectives ...... 21

iii

CHAPTER III. PLANT TRANSFORMATION USING SENESCENCE REGULATED IPT CONSTRUCTS ...... 23

Introduction ...... 23

Materials and Methods ...... 24

Isolation of the promoter region of anth17 ...... 24

Generation of IPT constructs ...... 26

Anthurium plants, culture and transformation ...... 29

Arabidopsis transformation ...... 31

Screening of transformants by Western blot ...... 32

Results ...... 33

Isolation of the anth17 promoter region ...... 33

Anthurium transformation ...... 39

Arabidopsis transformation ...... 43

Discussion ...... 50

Isolation of the promoter region ...... 50

Anthurium transformation ...... 55

Arabidopsis transformation ...... 59

Conclusion ...... 60

Future studies ...... 61

CHAPTER IV. EXPRESSION OF GFP IN ANTHURIUM PROTOPLASTS ...... 62

Introduction ...... 62

Materials and Methods ...... 63

Isolation of protoplasts ...... 63

Protoplast transfection and GFP expression ...... 64

Results ...... 65

Isolation of protoplasts and transfection ...... 66

Discussion ...... 68

Conclusion ...... 69

Future research ...... 70

CHAPTER V. CHARACTERIZATION OF SENESCENCE RELATED GENE TRANSCRIPTS IN ANTHURIUM SPATHE AND LEAVES ...... 71

Introduction ...... 71

Materials and Methods ...... 73

Spathe and leaf RNA extraction, transcriptome sequencing and annotation ...... 73

Sequence selection, primer design and transcript expression levels ...... 75

Results ...... 76

RNA isolation from leaf and spathe ...... 76

Transcriptome sequencing and annotation ...... 77

Sequence selection, primer design and transcript expression levels ...... 78

Discussion ...... 88

Transcriptome sequencing, annotation and sequence selection ...... 88

Transcript expression levels ...... 91

Conclusion ...... 93

Future studies ...... 93

CHAPTER VI. ANTHURIUM SEED DEVELOPMENT ...... 95

Introduction ...... 95

Materials and Methods ...... 96

Pollination of flowers, seed development and harvesting ...... 96

Protein extraction, analysis and mass mapping ...... 97

Results ...... 99

Pollination, seed development & harvesting ...... 99

Total protein from seeds ...... 100

Protein types based on solubility ...... 101

Peptide sequencing results ...... 103

Discussion ...... 104

Pollination of flowers, seed development and harvesting ...... 104

SDS-PAGE analysis of seed proteins ...... 105

Protein extraction, analysis and mass mapping ...... 107

Conclusion ...... 108

Future studies ...... 109

Appendix A – PlantCARE Database search results ...... 110

Appendix B – RT-PCR primers designed for the selected sequences ...... 119

CHAPTER VII. LITERATURE CITED ...... 120

LIST OF TABLES

TABLE PAGE

3.1 Media composition used for in vitro culture of anthurium ...... 29

3.2 A search of the PlantCARE database using the

PrANTH17 and PrSAG12 sequences revealed the presence of regions involved in transcription regulation common in both ...... 38

5.1 Illumina RNA sequencing showed differential expression of 15 selected sequences in samples AL and AS...... 80

5.2a Differential expression of selected genes as determined by qRT-PCR analysis of synthesized cDNA from leaf and spathe samples ...... 83

5.2b Comparison of fold changes in selected genes using Illumina, RT-PCR and qPCR results ...... 84

A1 A database search of the PrANTH17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Complete list)...... 110

B1 Forward & reverse primers used in RT-PCR & qPCR to amplify a fragment of the selected sequences ...... 119

vii

LIST OF FIGURES FIGURE PAGE

3.1 The PrSAG12-IPT construct was excised from pSG516 using the SpeI site and ligated into the XbaI site in the lacZ/mcs of pCAMBIA 1303...... 27

3.2 PrANTH17 was used to replace the CaMV35S promoter in pCAMBIA1302 and the SAG12 promoter in pSG516 to generate two different constructs...... 27

3.3 Gene constructs made using senescence-regulated

promoters (PrSAG12 or PrANTH17) controlling either the IPT gene or the GFP reporter gene ...... 28

3.4 Hygromycin sensitivity response of anthurium etiolated shoot explants after 100 days of culture ...... 30

3.5 Construction of an anthurium genomic library ...... 33

3.6 Screening the anthurium genomic library for ANTH17 recombinant clones ...... 34

3.7 Restriction map of the ANTH17 recombinant clone ...... 34

3.8 The 1885 bp nucleic acid sequence of the promoter region isolated from ANTH17, a cysteine protease from anthurium ...... 35

3.9 Comparison of promoter sequences from two cysteine proteases (ANTH17 & SAG12) ...... 36

3.10 The 1.88 kb Anthurium andreanum cysteine

protease (ANTH17) promoter region (PrANTH17) showing cis-acting elements in common with the SAG12 cysteine protease ...... 37

3.11 Screening of anthurium putative lines by PCR showed amplification of the hygromycin

resistance gene, gfp reporter gene and PrSAG12- IPT gene construct ...... 39

3.12 Untransformed and putatively transformed anthurium shoots and roots viewed in white light and under Dark Reader Lamp illumination showing expression of GFP in tissues ...... 40

viii

3.13 Putatively transformed anthurium shoots viewed under white light and dark reader lamp illumination showing partial fluorescence in some shoots ...... 40

3.14 Fluorescence measurements on crude protein extracts from callus tissue ...... 41

3.15 Growth of excised leaf sections from putatively transformed and untransformed plantlets on media containing hygromycin B...... 42

3.16 Arabidopsis Col-1 untransformed WT and Col-1 transformed with the empty vector pCAMBIA1302 served as negative controls. Plants transformed

with PrSAG12-IPT exhibited two phenotypes ...... 44

3.17 Morphological differences between arabidopsis Col- 1 WT, Col-1 transformed with empty vector

pCAMBIA 1302 and Col-1 transformed with PrSAG12- IPT ...... 45

3.18 Arabidopsis Col-1 transformed with PrANTH17-IPT exhibited a variety of phenotypes ...... 47

3.19 Screening by PCR of transformed arabidopsis lines showed amplification of the gfp reporter gene,

PrSAG12-IPT gene construct and hygromycin resistance gene ...... 48

3.20a Western blot to detect expression of GFP in arabidopsis and anthurium ...... 49

3.20b Western blot to detect expression of GFP in anthurium ...... 50

4.1 GFP constructs used in protoplast transfection ...... 65

4.2 Protoplasts isolated from arabidopsis and anthurium leaf mesophyll ...... 66

4.3 Protoplasts isolated from anthurium etiolated shoots transfected with GFP constructs ...... 67

4.4 Confocal microscopy of anthurium protoplasts transfected with GFP constructs ...... 68

5.1 RNA samples electrophoresed on a 1.2% agarose formaldehyde gel showing the 28S and 18S rRNAs extracted from leaf and spathe ...... 76

5.2 Results of Illumina sequencing were annotated and classified into 22 protein classes based on biological function ...... 77

5.3 Illumina sequencing coverage of 15 selected genes in leaf and spathe samples ...... 79

5.4 RT-PCR of selected genes using cDNA synthesized from RNA samples from leaf and spathe ...... 81

5.5 Relative expression levels of selected genes between leaf and spathe samples quantified using RT-PCR ...... 82

5.6 Differential expression of selected genes between leaf and spathe samples ...... 85

5.7 Diagram showing distribution of genes unique to leaf and spathe ...... 86

6.1 Anthurium cultivar ‘Rising Sun’ crossed with anthurium cultivar ‘Nitta Orange’ produced yellowish to brown berries ...... 99

6.2 Comparative protein profiles on a 12% SDS-PAGE gel of total protein extracted from anthurium, rice and maize ...... 100

6.3a SDS-PAGE of seed proteins from anthurium, rice and maize extracted based on solubility in dilute saline buffer (globulin) ...... 101

6.3b SDS-PAGE of seed proteins from anthurium, rice and maize extracted based on solubility in dilute acid extraction buffer (glutelin) ...... 102

6.3c SDS-PAGE of seed proteins from anthurium, rice and maize extracted based on solubility in alcohol extraction buffer (prolamin) ...... 103

CHAPTER I

INTRODUCTION & LITERATURE REVIEW

Plant senescence

Senescence is a natural process in the development of a plant and is the final stage of development for a particular plant organ or tissue. It involves cellular disassembly in tissues and the recycling and mobilization of the breakdown products before cell death (Nelson 1988, Nooden et al. 1997,

Quirino et al. 2000, Thomas & Stoddart 1980). It is almost always intertwined with aging, but they are different. Senescence is a process that leads to the death of a cell, an organ, or a whole plant occurring at the final stage of development, while aging occurs throughout development – from leaf primordium initiation throughout senescence and death (Lim et al. 2003).

The post reproductive death in monocarps, tracheary xylem cells and the withering of petals after pollination, are cases of senescence (Nooden &

Leopold 1988), while the loss of viability or death of seeds and spores under air dry conditions is a good example of aging (Roberts 1988). Aging therefore, is more of a systemic process occurring in the plant as a whole, whereas senescence is limited only to organs, cells or certain parts of the plant.

During senescence there is a marked increase in the amounts of degradative enzymes such as nucleases, glycolases and proteases (Brady

1988). They break down subcellular molecules into simpler compounds for translocation to other parts for the purpose of either recycling nutrients or disposal. In addition, other catabolic enzymes (e.g. lipases, esterases, etc.)

and degradative pathways (ubiquitin) are also expressed in higher amounts during this time for the same purpose of converting molecules into simpler forms for transport to other plant organs (Zhu et al. 2009, Hajlaouia et al.

2010, Abreu & Munné-Bosch 2008).

The triggering mechanisms in senescence are not yet well understood.

Aside from being a component of normal plant growth and development, senescence could also be occurring in response to stresses. External factors such as shading (from light), temperature changes, mineral and nutrient deficiency, water stress (drought), and pathogen attack are known elicitors of the senescence program (Nooden et al. 1997, Weaver & Amasino 2001).

Whether man-made or naturally occurring, these stresses can be utilized to study senescence in plants.

Senescence in plants is also a form of adaptation for survival. Some examples include senescence of fruits to attract animals for seed dispersion, senescence in perennials and monocarps before the start of winter, senescence in rice before the drought season begins, and self-pruning or natural abscission when there is competition for light are some examples

(Leopold 1980).

Biochemical changes during senescence

The gradual disappearance of chlorophyll and concomitant yellowing is one of the most overt manifestations of senescence (Leshem 1986). The loss of chlorophyll leads to decline in photosynthesis, which is a result of reduction in light harvesting and electron transport activity (Nooden &

Leopold 1988, Schellenberg et al. 1993, Jenkins & Woolhouse 1981, Misr &

Mina 1986, Thomas & Stoddart 1980, Thomas & Matile 1988, Woolhouse

1984, 1987). The decrease in the level of chlorophyll is not a triggering process since senescence has already started way before the breakdown of chlorophyll, but rather a result of the progression of senescence.

Phytohormones, cytokinin, gibberellins, ethylene and abscisic acid influence the degradation of chlorophyll (Aharoni & Richmond 1978, Lipton 1987). The breakdown products of chlorophyll are lipofuscin-like compounds that have blue fluorescence (Düggelin et al. 1988) and non-fluorescent catabolites that are transported from the chloroplast to the vacuole (Matile 1992). The removal of Mg by Mg-dechelatase or by oxidation by peroxidase (Gassmann

& Ramanujam 1986, Matile 1992, Ziegler et al. 1988) and the removal of the phytol tail chain by senescence-activated chlorophyllase (Amir-Shapira et al.

1987) are the proposed mechanisms for chlorophyll catabolism.

Toxic triplet chlorophyll and singlet oxygen induced by the photo- oxidation of chlorophyll damages apoproteins and membranes of the photosynthetic apparatus (Melis 1991, Aro et al. 1993). Chloroplast proteases in the stroma and thylakoids (Thayer et al. 1987, Thayer et al.

1988, Weiss-Wichert et al. 1995) disassemble the photosynthetic apparatus, most particularly the photosystems (Makino et al. 1983, Matile 1992, Morita

1980, Peterson & Huffaker 1975, Roberts et al. 1987, Sodmergen 1989,

Thomas & Hilditch 1987, Thomas & Matile 1988, Wardlaw et al. 1984).

Thylakoid proteases remove the photodamaged D1 and D2 core subunits of the photosystem II reaction center (Aro et al. 1993, Christopher & Mullet

1994, Matoo et al. 1989) and are found to be light-modulated (Christopher &

Mullet 1994, Matoo et al. 1989, Melis 1991) while stromal proteases are homologs of prokaryotic Clp proteases (Shanklin et al. 1995). There is a reduction in the amounts of photosynthetic proteins (e.g. the antenna and cytochrome b6/f complex, the ATP synthase, subunits of Rubisco) during senescence (Crafts-Brandner et al. 1990, Droillard et al. 1992, Lalonde &

Dhindsa 1990, Wittenbach et al. 1980) and a decrease in expression of chloroplast genomes (Krupinska & Falk 1994, Mayfield et al. 1995, Mullet

1993, Roberts et al. 1987). The photosynthetic apparatus provides an important source of recyclable nitrogen since up to 80% of the total chloroplast nitrogen is comprised of the apoproteins of the photosystems and antenna, and Rubisco (Smart 1994).

The breakdown of the cell membrane occurs in the initial stages of plant senescence. The catabolic “phosphatidyl-linoleyl(-enyl) cascade” provides substrate for lipoxygenase, the action of which generates a series of oxy-free radicals, ethylene, endogenous Ca2+ ionophores, malondealdehyde and jasmonic acid (Leshem 1992).

The ubiquitin pathway also plays a role in plant senescence. Within the cell, ubiquitin covalently links to substrate proteins and facilitates bulk protein degradation for nitrogen recycling, and may also have a role in the wound response (Belknap & Garbarino 1996). Ubiquitin ligase is also responsible in preventing premature senescence from occurring (Raab 2009).

Changes in gene expression associated with senescence

A class of proteins highly up-regulated during senescence and are senescence-specific are called senescence-associated genes (SAGs) (Lohman et al. 1994). Over the years, increasing amounts of SAGs are being discovered in agriculturally important crops such as barley (Ay et al. 2008) and rice (Lee et al. 2001). Among the first SAGs isolated and characterized is

SAG12, a protein in arabidopsis that code for a cysteine proteinase. Also called thiol protease, this protein product is involved in both anabolic and catabolic processes in plants. Current information shows that cysteine proteinases participate in the degradation of storage proteins, protein turnover in response to biotic and abiotic stresses and in programmed cell death (PCD) following pathogen attack, tracheary element differentiation and organ senescence (Grudowska & Zagdanska 2004). Genes encoding cysteine proteinase have been isolated and characterized from a variety of crops such as pea (Cercos et al. 1999), sweet potato (Chen et al. 2002, Chen et al.

2009), tobacco (Ueda 2000) and arabidopsis (Buchanan-Wollaston et al.

2003).

Among the SAGs upregulated during senescence are genes that encode proteins such as RNases, proteases, lipases, proteins involved in the mobilization of nutrients and minerals, transporters, transcription factors, proteins related to translation and antioxidant enzymes, among others

(Quirino et al. 2000, Espinoza 2007). In dark-induced leaf senescence in rice, upregulated genes are involved in amino acid metabolism, fatty acid metabolism, protein degradation, and stress response, suggesting a probable

overlap in the plant defense response and leaf senescence programmes (Lee et al. 2001). This overlap between the plant defense response and the leaf senescence program has been proposed before (Lim & Nam 2005) and indeed several virus-induced genes are expressed at elevated levels during natural senescence (Espinoza 2007).

Role of hormones and plant growth regulators

Hormones and plant growth regulators control the rate of senescence in plants. Auxins, gibberellins and cytokinins promote plant growth, thus have the ability to delay senescence. On the other hand, molecules such as abscisic acid, jasmonic acid, ethylene serves as signals for the senescence program cascade (Sharabi-Schwager et al. 2010, Arbona & Gómez-Cadenas

2008, Lim et al. 2007).

Ethylene, a simple gaseous hydrocarbon (C2H4) primarily associated with fruit ripening and maturation (Rhodes 1980), has been shown to have a dominant role in the enhancement of plant senescence (Ferguson et al. 1983,

Matoo & Aharoni 1988). Endogenous levels of ethylene increase during senescence in a variety of species (Roberts & Osborne 1981, Roberts et al.

1983, Roberts et al. 1985) and by up to ten-fold in tissues that have been mechanically bruised, freeze damaged, UV irradiated or infected by disease

(Lieberman 1979). A very interesting review suggests that the biosynthetic relationship between the polyamine and ethylene pathways depend on the competitive demand for a limited pool of the common precursor (S- adenosylmethionine, SAM) and feedback inhibition of enzyme action system

in one pathway by the products of the other pathway (Pandey et al. 2000). It was hypothesized by the author that since polyamines and ethylene have opposite effects in relation to senescence, the two pathways are in a constant

“tug of war”, with the precursor SAM as the mediator or regulator.

Perhaps the second most important elicitor of senescence in plants after ethylene is the hormone abscisic acid (ABA), a hormone that down regulates photosynthetic enzymes. A sharp increase in endogenous ABA concentration during the later stages is typical during flower senescence in rose petals (Kumar 2008). The senescence-promoting effect of ABA could be possibly mediated via increase in the proline content in leaves coupled with a decrease in both IAA and kinetin levels (Ali & Bano 2008). ABA has an essential role in adaptive stress responses and regulates the expression of numerous stress-responsive genes (Kang et al. 2002). It has been called the stress hormone (Mauch-Mani & Mauch 2005, Chandler & Robertson 1994).

Auxin, another phytohormone, generally functions to retard senescence but in some species it promotes senescence. In poinsettia flowers, endogenous auxin level decreased with age and the application of auxin delayed senescence and abscission (Gilbart & Sink 1971). In other flowers however, auxin promotes senescence and the production of ethylene

(Leshem et al. 1986, Halevy & Mayak 1981, Nichols 1984, Nooden 1988).

Gibberellin A3 (GA3) applied as a spray on mature leaves of the perennial Paris polyphylla significantly impeded the senescence of aerial parts of the plant (Yu et al. 2009). Jasmonic acid (JA) and abscisic acid are regulators that mediate plant responses to abiotic stresses and it was found

out that both compounds ameliorate the adverse effects of drought stress in soybeans (Hassanein et al. 2009). Salicylic acid (SA) has also been shown to have a role in senescence. Arabidopsis plants mutant for the SA signaling pathway had altered senescence programs and maximal expression of several senescence-enhanced genes are dependent on the presence of SA

(Morris et al. 2000). But SA seem to have a role only in developmental senescence, since the process is delayed in plants defective in the SA pathway but not in dark-induced senescing plants (Buchanan-Wollaston

2005).

Cytokinin & isopentenyl transferase

Cytokinins are phytohormones that stimulate cell division. A crystalline compound, later named kinetin (isolated by Carlos Miller from commercial herring sperm DNA produced after heating in weakly acid solution) was the very first cytokinin isolated and identified (Skoog 1994). This groundbreaking research led to the discovery of more compounds that promote cell division – kinetin analogs, 6-benzylaminopurine and eventually the naturally occurring cytokinins and cytokinin-metabolites (Skoog 1994, McGaw 1987). Cytokinins function as regulators of shoot and root meristem activity (Werner et al.

2003) and are key hormones in regulating root gravitropism (Aloni et al.

2004). Isopentenyl transferase, a protein encoded by the IPT gene involved in crown gall formation in Agrobacterium tumefaciens infection, is the enzyme in the rate-limiting step in cytokinin biosynthesis (Barry et al. 1984).

Cytokinins play a major role in the control of senescence in plants. In mature or senescing leaves, a major property in common with flowers is that it strongly delays senescence by inhibiting oxygen uptake thereby repressing rise in respiration (Tetley & Thimann 1974, Thimann 1987). Exogenous application of Benzyladenine, a form of cytokinin, increased the vase life of anthurium to up to 2.5 fold (Paull and Chantrachit 2001). Although cytokinins have the ability to slow down the onset of senescence, if added at high dosages could induce PCD and accelerate senescence (Carimi et al. 2004).

Transgenic expression of cytokinin in plants

Over-expression of cytokinin in transformed plants resulted in morphological and physiological alterations. Tissue- and organ-specific overproduction of cytokinin in plants exhibited a variety of morphological aberrations such as inhibition of primary root elongation and lateral root formation (Medford et al.1989, Li et al. 2006, Kuderova et al. 2008), stunting, loss of apical dominance, reduction in root initiation and growth, variations in the delay of senescence in leaves depending on the growth conditions, adventitious shoot formation from unwounded leaf veins and petioles, altered nutrient distribution, and abnormal tissue development in stems (Yi et al.

1992, Hewelt et al. 1994, Smigocki 1991). Cytokinin overproducing transgenic tobacco grown in vitro demonstrated increased accumulation of phenolic compounds, synthesis of pathogenesis related proteins and increase in peroxidase activities, all of which are plant responses to stress

(Schnablova 2006). In vivo elevated cytokinin levels resulted in enlarged and retarded growth phenotypes (Guo et al. 2005).

A system to regulate cytokinin production in transgenic plants

An autoregulatory senescence inhibition system in plants was developed by Gan and Amasino (1995). This technique involved the use of a senescence-induced promoter (PrSAG12) from Arabidopsis thaliana controlling the expression of a cytokinin gene (IPT) from Agrobacterium tumefaciens.

The onset of senescence activates PrSAG12 and transcribes IPT transcripts which are readily translated into isopentenyl transferase; the rate-limiting enzyme in cytokinin biosynthesis. The production of cytokinins inhibits the progression of senescence, and increase in the levels of cytokinin attenuates the senescence signal thus turning the PrSAG12 off. Tobacco plants transformed with the construct have senescence-retarded leaves and exhibited prolonged photosynthetically active life span (Gan and Amasino

1995). A number of plant species (Hildebrand et al. 1998, Schroeder et al.

2001, McCabe et al. 2001, Chen et al. 2001, Cao 2001, Lin et al. 2002,

Gapper et al. 2002, Chang et al. 2003, Clark et al. 2004, Huynh et al. 2005,

Calderini et al. 2007, Sýkorová et al. 2008, Xu et al. 2009, Merewitz et al.

2010, Zhang et al. 2010) have been transformed with the SAG12:IPT gene construct. The most noticeable attribute of these transgenic plants is the ability to delay the onset of natural senescence and the capacity to retain chlorophyll in leaves thus maximizing and extending the photosynthetic capability of the plant. Modified plants also had increased production of

flowers as a result of transgene expression (Schroeder et al. 2001) and overall longevity (Gan & Amasino 1995; McCabe et al. 2001).

A senescence-activated cysteine protease, ANTH17, homologous to

SAG12 in arabidopsis was discovered in anthurium (Hayden & Christopher

2004). Transient expression assays had shown that this gene was activated in senescing leaf tissues, and that expression was repressed by both cytokinin and sucrose treatments. Isolation and use of the promoter region of

ANTH17 would be a useful endogenous senescence-responsive promoter for genetic studies.

Although the delay in leaf senescence has been remarkable in plants that possess the autoregulated senescence inhibition system, unexpected phenotypes like delayed bolting/flowering and premature leaf senescence in

PrSAG12-IPT homozygous plants (McCabe et al. 2001), reduced plant stature

(Gapper et al. 2002) and affected reproductive strategy (Sýkorová et al.

2008) have also been observed in some transgenic lines. These inconsistencies could be attributed to transgene expression variability or positional effect (Peach & Velten 1991), or could also be due to inexact senescence control programs, since PrSAG12 was from arabidopsis and is not a native promoter. The latter may enhance the correct regulation of the IPT gene. It would be interesting to examine the similarities or differences between gene expressions by promoters of homologous genes from different plant species.

Molecular breeding of crops with altered cytokinin metabolism combined with the transgenic approach shows very promising potential for application to agriculture (Ma 2008).

Anthurium andreanum

Anthurium is a widely cultivated tropical ornamental monocot plant belonging to the family Araceae, composed of about 1500 species from 100 genera (Higaki et al. 1995). Anthurium is the largest genus composed of about 900 varieties. Among the members of this family are some of the more common ornamental tropical plants Philodendron, Monstera, Taro (Colocasia),

Calla lily (Zantedeschia) and Caladium. It is a perennial herbaceous plant cultivated for its attractive flowers which is composed of the colorful modified leaf (spathe) and hundreds of small flowers on the pencil-like protrusion

(spadix) rising from the base of the spathe (Higaki et al. 1985). The plant is a native of Central and South America. The very first anthurium plant was brought to Hawaii from London in 1889 by S.M. Damon (Neal 1965). The plants were initially grown on the Damon Estate on the island of Oahu and by the 1930s had spread to other estates, nurseries and hobbyists (Kamemoto

& Kuehnle 1996).

Anthurium thrives best under 60% to 80% shade, 18 to 24 °C and relative humidity of 60% to 80% (Higaki et al. 1984). The climate in Hawaii provide the ambient conditions for growing the plants with day temperatures of about 80 °F and night temperatures of 65 °F. Growth and development of an anthurium plant occurs in two phases. The first phase is termed the

monopodial phase that corresponds to the juvenile and vegetative growth stage, and a sympodial phase wherein a flower is produced for each leaf

(Dufour & Guerin 2003). It was discovered that the young, developing subtending leaf acts as a storage sink and slows down the growth rate of the immature flower depriving it of nutrients, and removal of this leaf accelerates flower emergence (Dai & Paull 1990). In the Hawaii floriculture industry (cut flower), the crop is ranked third in terms of value of sales accounting to almost 3.4 million US dollars, and third in out-of-state sales bringing in over

4.5 million US dollars in 2010 (NASS-Hawaii 2011).

Anthurium breeding and genetic transformation

Molecular biotechnology has been proven as a very effective tool for the improvement of crops. In anthurium breeding, new cultivars and hybrids are difficult to produce. The plant has a long life cycle and development of a new hybrid takes from 8 to 10 years (Kuehnle et al. 2001). Moreover, propagation from seed is a lengthy process, and may take up to 3 years from seed to flowering (Higaki et al. 1995). Biotechnological methods, therefore offer an opportunity to speed up the rate of anthurium improvement.

Four papers have reported successful stable genetic transformation of anthurium. A DNA segment coding for the attacin gene that expresses an antibiotic was engineered into the plant for bacterial blight (Xanthomonas campestris pv. dieffenbachiae) resistance (Chen & Kuehnle 1996). A modified oryza cysteine proteinase inhibitor was used to transform plants for resistance to nematodes (Khaithong 2007, Khaithong et al. 2007) and GFP

was successfully used as a reporter gene in optimizing Agrobacterium- mediated transformation of anthurium callus explants (Zhao et al. 2010). An improved transformation method introduced genes for bacterial blight resistance and nematode resistance in different explant tissues using

Agrobacterium (Fitch et al. 2011).

Expression of β-glucuronidase (GUS) in transgenic anthurium was not observed, although the uidA gene that codes for GUS was detected by PCR

(Chen & Kuehnle 1996). It was also shown that GUS was expressed in arabidopsis control tissue but not in anthurium leaf tissues bombarded with the uidA gene construct (Hayden & Christopher 2004). Therefore, a useful reporter gene for anthurium is needed for molecular studies, such as promoter identification. Transient expression of GFP was obtained in anthurium bombarded with a GFP4 construct (Hayden & Christopher 2004).

This suggests that GFP can be a good reporter gene in anthurium molecular studies.

Green Fluorescent Protein as a useful reporter gene

The green fluorescent protein from the jellyfish Aequoria victoria has been widely used as a reporter gene in plant transformation experiments

(Stewart 2001, Shiva Prakash et al. 2008, Wakasa et al. 2007, Zhu et al.

2004, Zottini et al. 2008). Sugarcane, maize, lettuce and tobacco plants transformed with modified versions of GFP either through Agrobacterium- mediated or particle bombardment-mediated transformation were readily distinguished using a dissecting microscope with appropriate filters (Elliott et

al. 1999). Several variants of the gene have been developed that have improved fluorescence output and expression in plants (Mankin & Thompson

2001) and improved constructs have been created (Orbovic et al. 2007, Vain et al. 2003, Vickers et al. 2007). Over the years, other monocot species such as barley and rice have also been transformed with constructs containing GFP as the reporter gene (Wakasa et al. 2007, Murray et al. 2004) and just recently a report was published that used GFP as a reporter gene in the optimization of Agrobacterium-mediated expression of anthurium callus

(Zhao et al. 2010). Although the authors were able to show expression of

GFP in callus tissues and stem cells using fluorescence microscopy, no data was presented for expression in other differentiated tissues (e.g. leaf, shoot, whole plant). Green autofluorescence has been shown to be exhibited by phenolics and phenolic metabolites at 488 nm excitation (Hutzler et al. 1998) and by other secondary metabolites such as anthocyanins and flavonoids

(Grotewold et al. 1998). Green autofluorescence has also been observed in vascular tissues (Flores et al. 1993) and other organs (Chytilova et al. 1999,

Lu et al. 2008). GFP can serve as a reporter gene in the initial screening of transformants in anthurium transgenic studies but in the cases mentioned above, additional molecular screening methods such as Western blotting and/or RT-PCR are needed in order to confirm stable protein expression.

Seed development and senescence

A multitude of genes play important roles in seed development, maturation, and maintenance of viability. A gene in arabidopsis (ABI3) was

found to be essential for the synthesis of seed storage proteins and for the protection of the embryo during desiccation (Nambara et al. 1992). Genes involved in senescence are also expressed during seed formation and germination (Cercos et al. 1999), and are seen as very similar processes in terms of macromolecular metabolism. During seed germination in rice, storage proteins and seed maturation proteins were down-regulated while alpha-amylase and enzymes involved in glycolysis were up-regulated (Yang et al. 2007). A vacuolar processing enzyme (a cysteine protease) was found to play an important role in the maturation of seed proteins from castor bean

(Hara-Nishimura et al. 1995). A protein disulfide isomerase, PDI5, was discovered to function as a chaperone and regulator of a cysteine protease during programmed cell death (PCD) of endothelial cells in arabidopsis seeds

(Ondzighi et al. 2008).

CHAPTER II

HYPOTHESES

1. The promoter from the anthurium cysteine protease ANTH17 (PrANTH17)

will have similar cis-acting regulatory elements and motifs as the

SAG12 promoter (PrSAG12) from arabidopsis.

2. GFP can be expressed at sufficiently high levels in anthurium so that it

can be used as a reporter gene.

3. Transcriptomic analysis will identify genes needed for spathe and leaf

development, and reveal wide differences in the expression of many

genes.

4. Analysis of transcript levels will help identify promoters for tissue-

specific control of transgenes in anthurium.

5. Proteomic profiling of anthurium seeds will provide insight into seed

biogenesis and storage proteins, identify new proteins, and contribute

to evolutionary studies. It will determine if this monocot shares seed

protein species with other monocots.

6. Insight into seed storage proteomics will serve as an initial screen to

investigate seed viability loss in anthurium during long storage.

SIGNIFICANCE OF RESEARCH

Anthurium and arabidopsis share similar senescence induction systems (Hayden & Christopher 2004) and plants transformed with promoters from orthologous genes can have similar gene expression programs.

ANTH17 is a cysteine protease in anthurium homologous to the arabidopsis cysteine protease SAG12, and was shown to be transiently expressed during the senescent stages of leaf development (Hayden &

Christopher 2004). It was shown that similar to the arabidopsis SAG12,

ANTH17 is repressed by cytokinin treatment, and its expression is reduced by sucrose. The expression pattern of ANTH17 was opposite to known senescence down-regulated genes such as cab (chlorophyll-a,b-binding protein) and psbA (D1 protein of PSII). Isolation of the promoter region of

ANTH17 (PrANTH17) would allow comparative analysis of sequences of the promoter from the two orthologs, and expression studies in whole arabidopsis plants using fusion proteins. The resulting transformed plants

expressing a reporter gene (e.g. GFP) under the control of PrANTH17 can be studied for senescence induction experiments.

Plants transformed with the IPT gene will exhibit typical physiological responses to expression of the autoregulatory senescene inhibition system as observed in tobacco.

A number of plant species have been transformed with a construct carrying the IPT gene, involved in the rate-limiting step in cytokinin biosynthesis, conferring an autoregulated senescence inhibition system that significantly delays aging in leaves and flowers (Calderini et al. 2007, Chang et al. 2003). This also increases photosynthetic capacity of plants, with leaves staying longer on the stem due to delayed aging. Cytokinin dips have been routinely used by florists and horticulturists to lengthen the vase life of anthurium flowers (Mayak & Halevy 1970, Paull & Chantrachit 2001). Stable expression of the senescence-regulated IPT gene construct in anthurium plants would eliminate the need for the post harvest treatment as well as create a more superior crop for the industry, having flowers that possess tolerance to senescence induced by stress and injury especially during shipping and handling. This will provide stability of product quality for customers. And since the spathe is essentially a modified leaf, the delay in leaf senescence in anthurium can increase flower profitability for farmers in

Hawaii.

Expression of GFP in anthurium plants and protoplasts will be a useful tool to study cellular gene functions, subcellular sorting of proteins and promoter acitivites in anthurium for crop improvement.

The development of a plant protoplast transient expression system has been an important step towards understanding of gene functions and cellular processes at the molecular level (Sheen 2001; Yoo et al. 2007). This technique is now routinely used in the model plant arabidopsis and in other systems as well.

Transcriptomic analysis of senescent anthurium leaf and spathe can generate information on genes involved in development and they can be used for genetic improvement of anthurium.

Analysis of gene expression data has led to the discovery of regulation mechanisms by proteins. Abundant and rare transcripts are a sign the gene’s promoter is either very active or repressed, respectively.

Proteomic profiling of anthurium seed proteins can contribute towards the understanding of seed development and seed viability loss in anthurium.

The major proteins in seed are the source of nitrogen for protein assimilation by the developing embryo during germination. The type of proteins present has a significant aspect to evolutionary studies. Globulins and albumins were found to be the main seed proteins in dicots, while in monocots glutelins and prolamins predominate.

OBJECTIVES

The overall objective of this research is to gain more understanding of the senescence program in anthurium through stable transgenic expression of a senescence-regulated cytokinin biosynthesis gene in whole plants, differential gene expression analysis of senescent leaf and spathe, transient gene expression studies in protoplasts, and proteomic profiling of anthurium seed development proteins. The autoregulated production of cytokinin in plants is expected to decrease the rate of leaf senescence thereby improving the value of anthurium as a cutflower crop for farmers in Hawaii.

The specific objectives for this research:

1. A senescence-activated promoter from an endogenous cysteine

protease will be isolated, cloned, characterized and used to develop

anthurium plants that have an autoregulated senescence-inhibition

system.

2. Anthurium leaf, callus and shoot tissues will be used in the isolation

and transfection of protoplasts using GFP as a reporter gene for the

development of an efficient transient reporter expression system.

3. Transcriptome profiling, Illumina deep-sequencing and bioinformatics

will be used to identify and analyze differentially expressed

senescence-related genes in anthurium leaf and spathe tissues.

4. Major seed proteins and senescence-related proteins expressed during

seed development will be identified by extracting and subjecting total

cell proteins from rarely produced anthurium seeds to SDS-PAGE

analysis, proteomic analysis and sequence identification.

CHAPTER III

PLANT TRANSFORMATION USING SENESCENCE REGULATED IPT

CONSTRUCTS

Introduction

The development of an autoregulated senescence inhibition system by

Gan and Amasino in 1995 paved the way for creating plants that have the ability to retard leaf aging and thus possess a “stay-green” phenotype. This involved genetic transformation of plants with a construct consisting of a senescence up-regulated gene promoter from sag12 of Arabidopsis thaliana

(PrSAG12) fused to the isopentenyl transferase gene (IPT) for cytokinin biosynthesis from Agrobacterium tumefaciens. Shortly thereafter, other dicot species such as Nicotiana alata (Schroeder et al. 2001), lettuce (McCabe et al.

2001), broccoli (Chen et al. 2001; Gapper et al. 2002), petunia (Chang et al.

2003, Clark et al. 2004), tomato (Swartzberg et al. 2006), Medicago sativa

(Calderini et al. 2007) and Arabidopsis thaliana (Huynh et al. 2005) have been transformed with the PrSAG12-IPT construct, as well as monocots namely rice (Hildebrand et al. 1998; Cao 2001; Lin et al. 2002) bentgrass (Xu et al.

2009; Merewitz et al. 2010, Zhang et al. 2010) and wheat (Sýkorová et al.

2008).

In studies aimed at establishing plant gene function, arabidopsis has become the model system of choice mainly due to its ease of genetic transformation, self fertilization, a short life cycle and a small genome size, which made possible its complete sequencing (Bressan et al. 2001). A sag12

homolog, termed anth17 exists in anthurium and is upregulated during senescence (Hayden & Christopher 2004). The expression of anth17 increased during senescence of mature leaves. Treatment with cytokinin repressed anth17 expression, and presence of sucrose moderately inhibited mRNA accumulation. It has also been shown through transient assays that the arabidopsis PrSAG12 is activated during senescence in anthurium. Using the

PrANTH17 to show senescence-activation of a reporter gene in arabidopsis would confirm the presence of a similar or identical senescence signaling pathway.

In this study, the ANTH17 promoter was isolated from an anthurium genomic library. Senescence promoters from homologous senescence- induced cysteine protease genes from the dicot arabidopsis (sag12) and the monocot anthurium (anth17) were then used in Agrobacterium-mediated transformation of anthurium etiolated shoot explants. Stable integration of the gene constructs was confirmed and expression of the reporter gene GFP was verified. The senescence promoter-IPT constructs (PrSAG12-IPT and

PrANTH17-IPT) were also used to transform arabidopsis to compare the expression of the IPT gene on resulting transgenic plants.

Materials and Methods

Isolation of the promoter region of anth17

The anth17 promoter (PrANTH17) was isolated from an anthurium genomic library that was constructed using a Lambda DASH II / EcoRI vector kit (Stratagene Cloning Systems, La Jolla CA, USA). Anthurium genomic DNA

was isolated following a procedure for orchid (Champagne & Kuehnle 2000) with some modifications. Anthurium tissue ground in liquid nitrogen (1 gram) was added to 15 mL of a pre-incubated (15 minutes at room temperature)

Extraction buffer (150 mM LiCl, 5 mM EDTA, 5% SDS, 80 mM Tris-HCl pH 9, supplemented with 0.45 g PVP 40,000 + 450 µL β-mercaptoethanol) in an oakridge tube. The mixture was mixed by vigorously shaking for 5 minutes and centrifuged for 15 minutes at room temperature. All centrifugations were carried out at 10K rpm in a Sorvall SS-34 rotor. The supernatant was transferred to a new tube and another clearance spin was performed. An organic solvent extraction was done by adding an equal volume of chloroform and vigorously shaking the solution for 5 minutes. The chloroform extraction was performed again after which the supernatant was solvent-extracted twice with an equal volume of phenol:chloroform. A final chloroform solvent extraction on the supernatant was done before addition of 0.1 volume of 3 M sodium acetate (pH 5.2) and an equal volume of isopropanol in a 30 mL

Corex tube. The solution was mixed well by inversion and incubated overnight at -20 °C. The crude extract was spun at 4 °C for 30 minutes, washed with cold 70% ethanol, and spun again at 4 °C for 10 minutes before the ethanol was decanted. The pellet was allowed to air dry for 15 minutes, resuspended in 500 µL of sterile water and treated with RNase A. The DNA solution was extracted with phenol:chloroform, precipitated with sodium acetate and isopropanol as above and resuspended in sterile water. The quality and quantity of isolated DNA was assessed using a Beckman Coulter

DU730 UV/Vis spectrophotometer and visualized by agarose gel

electrophoresis using Gel Red nucleic acid stain (Biotium, Hayward CA, USA) in 1X Tris acetate EDTA (TAE) buffer. Anthurium genomic DNA pre-digested with EcoRI was ligated into the Lambda/EcoRI vector arms, packaged and incubated in Escherichia coli XL-1 blue MRA(P2) host cells according to the kit instructions. The genomic library was screened by Southern Hybridization using a 1.3 Kb anth17 cDNA clone from a previous experiment (Hayden &

Christopher 2004) and the resulting anth17-positive Lambda clones were used for phage DNA extraction using a Lambda Mini Kit (QIAGEN, Valencia

CA, USA). The promoter region upstream of the anth17 gene was amplified by PCR using a high fidelity PfuUltra polymerase (Agilent Technologies, Sta.

Clara CA, USA) and cloned in pBluescript II SK (Stratagene Cloning Systems,

La Jolla CA, USA). The isolated putative anthurium senescence-regulated promoter was sequenced and analyzed for transcription/regulatory binding regions by comparing with sequences in a plant transcription factor database

– PlantCARE: Plant cis-acting regulatory elements (PlantCARE). The same search was performed using the PrSAG12 sequence, and the results were compared with the PrANTH17 sequence database search results.

Generation of IPT constructs

The PrSAG12-IPT construct was excised from the plasmid pSG516 (Gan

& Amasino 1995) by SpeI digestion and ligated into the XbaI site of pCAMBIA1303 (Figure 3.1). The resulting binary vector was maintained in E. coli XL-1 blue and used in subsequent experiments.

The cloned anth17 promoter was used to replace a segment (the

CaMV35S promoter and part of the lacZ/MCS) upstream of mgfp5 in pCAMBIA1302; and the SAG12 promoter in pSG516 to generate the PrANTH17- mgfp5 and PrANTH17-IPT constructs, respectively (Figures 3.2A & 3.2B).

The PrANTH17-IPT construct was further sub-cloned into the lacZ/mcs of pCAMBIA1302 for use in Agrobacterium-mediated transformation.

The cloned PrANTH17 was also ligated into the control plasmids pBIN19

35S-mGFP4 and pBIN19 35S-mGFP5er (Jim Haseloff, MRC Laboratory of

Molecular Biology, Cambridge, UK) upstream of the GFP coding sequence by replacing the 35S promoter in each, creating PrANTH17-GFP4 and –GFP5er, respectively. A diagram of all the constructs made and their corresponding vector backbone and derivatives shown in Figure 3.3.

Anthurium plants, culture and transformation

Anthurium andreanum cultivar ‘Marian Seefurth’ was acquired from

Pacific Floral Exchange, Keaau, Big Island of Hawaii and grown in pots under

12-hour fluorescent lights in a growth room at ambient temperature. Callus cultures were initiated from leaf lamina sections grown on H3 medium (Table

3.1) incubated in the dark at room temperature for 4 to 6 weeks. Cultures were maintained in Cmod medium (Table 3.1) and transferred to fresh media every four weeks. Etiolated shoots were allowed to develop by transferring cultures to H1 medium (Table 3.1).

Table 3.1. Media composition used for in vitro culture of anthurium.

components H1 Cmod* H3† MS macronutrients ½ X ½ X see footnote MS micronutrients 1 X see footnote see footnote MS vitamins 1 X 1 X see footnote sucrose 2% 3% 3% NaFe-EDTA 36.7 mg/L 43 mg/L 24.7 mg/L myo-inositol 0.01% - - benzyladenine 0.2 mg/L 1 mg/L 0.2 mg/L 2,4-D - 0.08 mg/L 0.4 mg/L thiamine-HCl - 0.3 mg/L 0.2 mg/L pH 5.7 to 5.8 * Cmod uses modified MS micronutrients (½ H3BO3 & ½ MnSO4) † H3 uses ½ X Linsmaier & Skoog macronutrients, micronutrients and vitamins

The resulting etiolated shoots were used in Agrobacterium-mediated transformation as described (Chen & Kuehnle 1996). IPT constructs containing either PrSAG12 or PrANTH17 were introduced into Agrobacterium strain

LBA4404 (Invitrogen, Grand Island NY, USA) using the freeze thaw method

(Holsters et al. 1978) and used in transformation experiments, with pCAMBIA1303 and pCAMBIA1302 as control plasmids. Etiolated shoot explants co-cultivated with Agrobacterium carrying the binary plasmid were incubated at room temperature in the dark and selected on Cmod containing

25 to 50 mg/L hygromycin B (Sigma-Aldrich, St. Louis MO, USA), as determined from a hygromycin sensitivity curve (Figure 3.4).

Agrobacteria were eliminated from culture by addition of antibiotics

(250 mg/L Cefotaxime, 250 mg/L vancomycin). Tissues were transferred to fresh media every two weeks and hygromycin selection was performed for 8 to 12 months. Putatively transformed calli were screened by PCR using specific primers that amplify a 752 bp fragment of the hygromycin resistance

gene, hph, (Forward primer: 5’-CCTGAACTCACCGCGACGTCT-3’ & Reverse primer: 5’-CTCCGGATGCCTCCGCTCGAAGT-3’), a 654 bp fragment of the GFP reporter gene (Forward primer: 5’-GAACTTTTCACTGGAGTTGTCCC-3’ &

Reverse primer: 5’-CAAACTCAAGAAGGACCATGTGG-3’), and an 808 bp fragment of PrSAG12-IPT construct (Forward primer: 5’-

AACCCCATCTCAGTACCCTTC-3’ & Reverse primer: 5’-

GGAGCTCAGGGCTGGCGTAACC-3’). Anthurium genomic DNA extraction was performed as above and the resulting DNA extract was used as template in

PCR. Untransformed anthurium tissue was used as the negative control while the transformation vector (PrSAG12-IPT in pCAMBIA 1303) was used as a positive control, as well as anthurium calli spiked with 0.1, 0.5 and 1 µg of transformation vector (per gram of tissue) before undergoing total genomic

DNA extraction. A Dark Reader Hand Lamp (Clare Chemical Research,

Dolores CO, USA) was used to visualize expression of GFP in etiolated shoots.

Plantlets were regenerated by growing on H1 medium and exposure to 14h photoperiod in a growth chamber at room temperature. A hygromycin leaf assay was performed by culturing excised leaf lamina on solid medium containing 25, 50 and 100 mg/L hygromycin B for 14 weeks.

Arabidopsis transformation

Arabidopsis ecotype Columbia (Col-1) seeds were sterilized in 70% ethanol for 2 minutes followed by incubation on a platform with gentle shaking (50 rpm) in 25% commercial bleach solution (Chlorox) + 0.2%

Tween20 for 10 minutes. Disinfected seeds were washed five times in sterile

distilled water, resuspended in 0.1% agar solution and plated on germination medium (0.8% agar, 2% sucrose, 1X MS salts, pH 5.7). Plated seeds were cold treated (4 °C) for two days and placed at room temperature in a growth chamber with a 16h photoperiod. Germinated seedlings were transplanted to soil media, grown to flowering stage and transformed following the floral-dip method (Clough & Bent 1998) using Agrobacterium strain GV3101 generously provided by Stanton B. Gelvin, Purdue University. Dipped plants were incubated in a growth room under 16 hour photoperiod to seed maturity. Transformed seeds were harvested and selected on germination media containing 50 mg/L hygromycin. Screening was done by PCR using the same primers to screen for the hygromycin resistance gene and gfp reporter gene in anthurium, and an additional primer pair that amplifies a 747 bp fragment of the IPT gene (Forward primer: 5’-ACCCATGGACCTGCATCTA-3’ &

Reverse primer: 5’-GGAGCTCAGGGCTGGCGTAACC-3’). The transformation vector PrSAG12-IPT in pCAMBIA 1303 was used as the positive control and total

DNA from untransformed Col-1 WT was used as the negative control. A reaction with no DNA template served as the internal control.

Screening of transformants by Western blot for GFP expression

Successful transformation of plants with the Agrobacterium-based constructs was confirmed by Western blot to detect the expression of GFP.

Total protein was extracted from tissues (either as callus or whole plants) using an extraction buffer (50 mM Tris pH 8, 250 mM sucrose, 2 mM DTT, 2 mM EDTA, 1 mM PMSF, protease inhibitor cocktail set III-EMD Biosciences)

and ran on a standard sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) following the protocol by Laemmli (1970). The electrophoresed proteins were transferred onto a Protran® nitrocellulose membrane (Whatman Inc., Piscataway NJ, USA) and probed with an anti-GFP rabbit IgG antibody (Molecular Probes-Invitrogen Corp, Carlsbad CA, USA).

Detection was done using an Amersham ECL Western blotting analysis system (GE Healthcare, Piscataway NJ, USA).

Results

Isolation of the anth17 promoter region

Cloning and sequencing isolated a 1.88 Kb DNA fragment upstream of the anth17 gene from a genomic library (Figure 3.8). Pairwise alignment with the PrSAG12 sequence showed 46.1% similarity between the two promoter regions (Figure 3.9).

Table 3.2. A search of the PlantCARE database using the PrANTH17 sequence revealed the presence of regions (cis elements) involved in transcription regulation common in both PrANTH17 and PrSAG12. (Complete list in Appendix B). position (strand) motif species sequence function PrSAG12 PrANTH17 5UTR Py- cis-acting element Lycopersicon rich 222 (+) 1722 (+) TTTCTTCTCT conferring high esculentum stretch transcription levels AAGAA- Avena sativa 748 (+) 1051 (+) GAAAGAA motif cis-acting element Petroselinum 102 (-) ACE 585 (-) ACTACGTTGG involved in light crispum 890 (+) responsiveness part of a conserved 297 (+) Petroselinum DNA module Box 4 1735 (+) 1225 (+) ATTAAT crispum involved in light 1745 (+) responsiveness 194 (+) Pisum 531 (-) light responsive Box I 1702 (-) TTTCAAA sativum 559 (-) element 615 (+) 40 (+) common cis-acting 256 (+) Arabidopsis 616 (-) element in CAAT-box 703 (-) CCAAT thaliana 1314 (-) promoter and 799 (-) enhancer regions 1280 (-) 33 (-) cis-acting Lycopersicon 675 (-) regulatory element circadian 1060 (+) CAAAGATATC esculentum 1308 (-) involved in 2083 (+) circadian control Dianthus 559 (-) ethylene- ERE 1702 (-) ATTTCAAA caryophyllus 614 (+) responsive element 76 (-) GARE- Brassica 1443 (+) gibberellin- 633 ((+) AAACAGA motif oleracea 1718 (-) responsive element 1507 (+) Arabidopsis GTAAT(G/C)ATT HD-Zip 3 2020 (+) 1142 (+) protein binding site thaliana AC cis-acting regulatory element 85 (-) O2-site Zea mays 494 (+) GATGACATGG/A involved in zein 217 (-) metabolism regulation 495 (-) cis-acting 1276 (-) regulatory element Skn- Oryza sativa 1410 (-) 1332 (+) GTCAT required for 1_motif 2023 (+) endosperm 2158 (+) expression Unnamed 62 (+) Zea mays 1350 (+) CGTGG _1 878 (+)

A database search (PlantCARE) using the cloned sequence identified motifs, transcription factors, and binding regions present in other plant species (complete result listed in Appendix A). Further analysis and a comparison of the database search results of the PrANTH17 sequence with that of the PrSAG12 sequence showed similar motifs common in both promoter sequences (Table 3.2).

Anthurium transformation

Hygromycin resistant anthurium calli growing on selection media were used for DNA extraction. Using specific primers, PCR on total DNA from putatively transformed tissues amplified fragments of 752 bp, 654 bp, and

808 bp corresponding to the hygromycin resistance gene, gfp reporter gene and PrSAG12-IPT construct, respectively (Figure 3.11).

Amplification of the targets were also successful in the two types of positive controls included in the experiment, the plasmid construct used in transformation experiments and the untransformed tissue spiked with the plasmid construct before DNA extraction. The negative control (gDNA from untransformed anthurium) had no amplified fragments.

PCR-positive, hygromycin resistant calli were grown and allowed to develop shoots in the dark. Illumination using a handheld dark reader lamp showed varying levels of fluorescence in transformed etiolated shoots and roots, as compared to untransformed controls (Figure 3.12).

It was also observed that fluorescence in some tissues was partial and not throughout the entire shoot (Figure 3.12F, Figure 3.13) or root (Figure

3.12H).

Fluorescence of crude total protein extracted from hygromycin resistant callus tissues were compared with arabidopsis expressing GFP-2SC

(Figure 3.14).

One transformant line was found to have fluorescence twice as that in untransformed anthurium (Figure 3.14 T3), but more than half the FSU of the GFP-2SC expressing control.

Hygromycin resistant, PCR-positive shoots incubated in light and allowed to regenerate leaves were tested for expression of the hygromycin resistance gene (hph).

Leaf sections excised and grown in different levels of hygromycin showed signs of callus growth in the first four weeks of incubation in media containing 25, 50 and 100 mg/L hygromycin B (Figure 3.15) and continued

on up to the termination of the experiment after 14 weeks. Leaf sections excised from untransformed control plants placed on the right half of each petri plate showed visible signs of necrosis after 4 weeks in 25 mg/L hygromycin (Figure 3.15C first photo from left) and after 3 weeks in both 25 and 50 mg/L hygromycin (Figure 3.15B second and third photos from left, respectively). Callus formation in excised leaves was 10 out of 10 explants

(100%) in both 25 and 100 mg/L hygromycin plates, and 9 out of 10 (90%) in 50 mg/L hygromycin plate after 14 weeks of culture.

Arabidopsis transformation

Arabidopsis transformed with the binary plasmids produced antibiotic resistant seedlings when germinated on 50 mg/L hygromycin B selection medium. Two types of controls were used in this experiment – untransformed Col-1 WT and Arabidopsis transformed with the empty vector pCAMBIA 1302 (Figures 3.16A & 3.16B). Aside from the WT-looking normal phenotype, two off-phenotypes from the hygromycin resistant PrSAG12IPT transformants were observed. The first off-phenotype was a plant that had a bunched leaf whorl, slightly deformed, larger than normal leaves, and increased number of roots (Figures 3.16C & 3. 16D, right half of photo). The second observed off-phenotype was a plant that was generally smaller in size, had darker green colored compacted leaves with serrate leaf edges, and with decreased root formation (Figures 3.16E & 3.16F, right half of photo).

The IPT plants looked greener and had less yellowing in the bottom leaves (Figures 3.17G, 3.17H) compared to the control plants.

It was also observed that the IPT-transformed plants had increased lateral florets and lengthened floral spikes (Figure 3.17I), and stayed green compared to the untransformed WT control that already turned brown 115 days after germination, DAG (Figures 3.17L, 3.17M). Plants transformed with the empty vector pCAMBIA 1302 were morphologically similar to the untransformed Col-1 WT control, and had completely browned (not shown)

115 DAG, the same time as the WT plants. Transformants that exhibited normal WT phenotypes and those that had smaller, serrate leaves developed seeds while plants with the bunched-leaf-whorl phenotype never developed flowers when planted on soil. Watering was discontinued and the seeds were harvested 90 days after plating on germination media.

Transformation of arabidopsis Col-1 with the PrANTH17-IPT construct had similar results as the PrSAG12-IPT experiment. Aside from normal WT-looking plants (Figure 3.18A), the off types: bunched-leaf-whorl (Figure 3.18 G, H, &

K) and compact-serrate-leaf (Figure 3.18 B to F, I) phenotypes were also observed, as well as morphological deformities that fall in between the two off-phenotypes (Figures 3.18 I, J & L). Yellowing of leaves (Figures 3.18 B &

L) as well as accumulation of pigments (Figures 3.18 C to F) in leaves of some plants was also noted. Callus growth was noticed in at least three individual hygromycin resistant plantlets that had the bunched-leaf-whorl phenotype (not shown).

Gene specific primers showed amplification of the GFP reporter, hygromycin resistance, and IPT gene fragments in plants transformed with the senescence promoter-IPT constructs (Figure 3.19). GFP-specific primers amplified a 654 bp fragment in plants transformed with the empty vector pCAMBIA 1302, PrSAG12-IPT construct, PrANTH17-IPT construct, and the positive control (transformation vector PrSAG12-IPT in pCAMBIA 1303). Primers specific for the hygromycin gene (hph) also amplified the 752 bp target in empty vector pCAMBIA 1302, PrSAG12-IPT construct, PrANTH17-IPT construct, and the

positive control transformants. PCR using gene-specific primers amplified the

747 bp IPT gene in plants transformed with the senescence-promoter constructs PrSAG12-IPT and PrANTH17-IPT, as well as the positive control. For all three primer pairs, no amplicons were detected in the negative controls

(untransformed Col-1 WT & no template reaction tubes).

Western blot on selected plants using anti-GFP antibody detected expression of the 26.5 kDa protein in arabidopsis expressing GFP-2SC positive control (Figure 3.20a). The 28.4 kDa expected protein size was confirmed in arabidopsis Col-1 transformed with GFP5 (Figure 3.20a, lane

AtGFP5), anthurium transformed with pCAMBIA 1302 vector only control

(lane 1302) and anthurium transformed with PrANTH17-IPT cloned in pCAMBIA

1302 (lane A17IPT). A faint band at the 26 – 28 kDa mark was detected in anthurium transformed with pCAMBIA 1303 (GUS-GFP5 fusion) vector only control (Figure 3.20a, lane 1303). The protein was not detected in untransformed arabidopsis Col-1 WT, untransformed anthurium, and anthurium transformed with PrANTH17-GFP5 and PrSAG12-IPT construct in pCAMBIA 1303 (Figure 3.20a lanes AtUT, AaUT, A17GFP5 & S2IPT, respectively).

A high MW protein band of around 200 kD was also detected by

Western blot using anti-GFP antibody in PrSAG12-IPT transformed anthurium

callus (Figure 20b, lane T3). The expected 26.5 kD band for the positive control GFP-2SC was observed (Figure 3.20b, lane At-2SC). No bands were detected in untransformed anthurium WT control, and other transformed lines tested (lanes Aa UT, T1, T2, T4 & T5, respectively).

Discussion

Isolation of the promoter region

An anthurium genomic library was created in Lambda DASH II, a bacteriophage replacement vector used for cloning large DNA fragments and could accept foreign DNA with sizes ranging from 9 to 23 kb (Stratagene

Cloning Systems, La Jolla CA, USA). The Lambda DASH II vector contains

active red and gam genes located in the stuffer fragment making it unable to grow in host strains containing P2 phage lysogens. Replacement of the stuffer fragment with the foreign DNA of interest renders the phage red—

/gam— thereby giving it the ability to grow in the E. coli host XL-1 Blue

MRA(P2) used in the library construction. This ensured that only recombinant phages were recovered during screening of plaques.

A 1.28 kb Not I fragment of a senescence-regulated anthurium cysteine protease (anth17) isolated from a cDNA library (Hayden &

Christopher 2004) was used as a probe to screen the genomic library.

Hybridization was performed under high stringency, thus increasing the probability of the single stranded probe to bind to nearly exact matches.

Decreasing the stringency of hybridization conditions resulted to non-specific hybridization to DNA (Leary et al. 1983). The strength of the hybridization signal is proportional to the specific activity and inversely proportional to the probe length (Sambrook & Russell 2001). The use of a 1280 bp cDNA probe made possible a strong hybridization signal, and increased the probability of hybridizing to the target.

Restriction enzyme single and double digestions performed on the isolated recombinant clone carrying anth17 enabled generation of a profile/fingerprint unique to that particular DNA segment from the genomic library. Analysis of the digested fragments generated a hypothetical map of the recombinant clone (Figure 3.7) including the promoter region for anth17.

Cloning by PCR using a high fidelity enzyme ensured that the copied segment was accurate. Pfu polymerase, unlike Taq polymerase, has a 3'-5'

exonuclease activity that is usually associated with proofreading (Lundberg et al. 1991), and increases the efficiency in cloning DNA fragments (Costa &

Weiner 1994). Subsequent sequencing identified an 1885 bp sequence

(Figure 3.8). The accuracy of the hypothetical map showing the restriction sites was verified by running the 1.88 kb promoter sequence through

Webcutter (Heiman 1997), an online sequence analysis program that checks for restriction endonuclease sites in a nucleotide sequence.

Pairwise alignment of PrANTH17 with PrSAG12 showed 46.1% similarity

(Figure 3.9) which was fairly low. This was consistent with the findings of

Noh & Amasino (1999) in SAG12s in arabidopsis (AtSAG12) and Brassica napus (BnSAG12) wherein there was no sequence conservation except for two regions. The -747 to -570 region confers senescence-specificity in

AtSAG12 & BnSAG12 promoters (Noh & Amasino 1999). A pairwise alignment of this 313 nt sequence with PrANTH17 showed a 64% identity in 86 nt overlap with nt 1159 to 1235 (1345 to 1440 nt in Figure 3.9), and a 55% identity in 294 nt overlap with nt 873 to 1157 (1040 to 1340 nt in Figure 3.9).

The low similarity between PrANTH17 and PrSAG12 could be due to the fact that

Anthurium and Arabidopsis are less evolutionarily related than Arabidopsis and Brassica. At the amino acid level, AtSAG12 and BnSAG12 share an 84% identity (Noh & Amasino 1999), while SAG12 homolog in anthurium (ANTH17) share 58% and 67% identity with AtSAG12 and BnSAG12, respectively

(Hayden & Christopher 2004).

A transcription factor database query (PlantCARE) using the 1.88 kb promoter sequence revealed 36 different motifs, belonging to 18 different

plant species, involved in transcription regulation of the ANTH17 gene

(Appendix A, complete list). Among those, 13 were in common with the

PrSAG12 (Table 3.2). The most abundant motifs present were the CAAT box and TATA box motifs. The CAAT-box (CCAAT) is a proximal promoter element, the binding site for CAAT binding protein and CAAT/enhancer binding protein

(Allison 2007), while the TATA box (TAATA) is a core promoter element usually found around -30 of the transcription start site. Both are almost always present in promoter regions and have important roles in transcription.

These two motifs along with the cap site are the components of the initiator element which lines up the transcription apparatus thus deciding the start point of transcription, and comprise the general promoter the absence of which does not allow transcription to occur (Kelly & Darlington 1985).

The Skn-1_motif (GTCAT) is a cis-acting regulatory element required for endosperm expression. This regulator of transcription is present in the promoter region of Lysophosphatidyl acyltransferase (LPAAT) of coconut

(Cocos nucifera L.) together with several other types of promoter-related elements including TATA-box and CAAT-box (Xu et al. 2010).

A 5’-UTR Py-rich stretch (TTTCTTCTCT), was found 89 bases upstream of the ANTH17 coding region. This cis-acting element is involved in conferring high transcription levels and has also been found to be present in promoter regions of stress related proteins (Timotijevic et al. 2010; Kumar et al. 2009).

The AAGAA-motif (GAAAGAA) ‘AAGAA motif’ and ‘Opaque-2’ binding site are regulatory sequences present in the seed specific legumin promoter

(Jaiswal et al. 2007) and are also found in promoters of other genes

expressed in seeds (Vincentz et al. 1997; Wu et al. 1998). The O2 site

(GATGACATGG) is a cis-acting regulatory element involved in zein metabolism regulation. The maize (Zea mays L.) endosperm specific transcription factor, encoded by the Opaque-2(O2) locus, functions in vivo to activate transcription from its target promoters. O2 regulates the expression of a major storage protein class, the 22 kDa zeins, and of a type I ribosome inactivating protein, b-32, during maturation phase endosperm development

(Schmitz et al. 1997). The O2 site seems to play an important role in seed development. 5' Promoter deletions of the be2S1 gene showed that the domain containing the O2 target sites F1 and F2 is required for detectable reporter gene expression in transgenic tobacco seeds (Vincentz et al. 1997).

The ACE- (ACTACGTTGG), for ACGT-containing element, is a light responsive promoter element involved in both UV response and pathogen responsiveness (Logemann & Hahlbrock 2002). Box 4- (ATTAAT) and Box I-

(TTTCAAA) motifs are cis-acting elements also involved in light responsiveness and have been found to be present in promoter regions of genes involved in response to biotic and abiotic stresses (Yang et al. 2011,

Shen et al. 2011).

Circadian (CAAAGATATC) is a cis-acting regulatory element involved in circadian control. This motif is present in the promoter region of a cysteine protease associated with senescence in tobacco (Ueda et al. 2000) and was also found in a transcription factor similar to activators of the phenylpropanoid pathway for lignin production in bamboo (Wang et al. 2012).

ERE (ATTTCAAA), an ethylene-responsive element is found to be involved in the senescence-regulated expression of GST1 (Itzhaki et al. 1994) and CEBP (Iordachescu et al. 2009) in carnation, and found in bean chitinase

(Broglie et al. 1989) and fruit ripening gene in tomato (Deikman & Fischer

1988, Montgomery et al. 1993).

GARE-motif (AAACAGA), a gibberellin-responsive element is one of the hormone responsive elements found in a strawberry β-xylosidase gene probably associated to hemicellulose degradation (Bustamante et al. 2009).

The motif is also implicated in arabidopsis stress response (Nogueira et al.

2011) and in the GA-mediated cold response of pineapple polyphenol oxidase

(Zhou et al. 2003). The motif HD-Zip 3(GTAAT(G/C)ATTAC) has been shown to interact with auxin (Ilegems et al. 2010) and belongs to a class of transcription factors that are required for the formation of a functional root and shoot apical meristem (Hawker & Bowman 2004).

The G-box motif is a G-box binding domain found in Solanum melongena cysteine protease (SmCP) and enhances transcription of the gene during senescence (Xu et al. 2003).

Anthurium transformation

Integration of the PrSAG12-IPT in putatively transformed anthurium calli was confirmed by the PCR amplification of the targets (Figure 3.11 lanes T1 to T6). The hph gene that confers hygromycin resistance (hygR) is the plant selectable marker in pCAMBIA 1303 binary vector, while mGFP5 is the reporter gene and are located closer to the left and right T-DNA borders,

respectively. The PrSAG12-IPT construct, cloned in between the hph and gfp5 genes, was also detected by PCR. This indicated that the whole T-DNA was successfully transferred and integrated by Agrobacterium to the genome of the transformed lines tested. If there was no T-DNA transfer, there would be no amplification of the target genes, as in the case of the untransformed control (Figure 3.11 lane N).

The choice of hygromycin resistance as the plant selectable marker was warranted. The expression of the hph gene product, hygromycin phosphotransferase, allowed for direct selection for resistance to hygromycin

B of eukaryotic cells not naturally resistant to the antibiotic (Blochlinger &

Diggelmann 1984). The use of kanamycin resistance (nptII), glufosinate resistance (bar) and glyphosate resistance (epsp) resulted to incomplete selection and high incidence of chimerism (Di et al. 1996) and escapes

(Hinchee et al. 1988) even of up to 95% in soybeans selected using PPT

(Olhoft & Somers 2001). The efficiency of transformation in soybeans was increased from an average of 0.7% to 16.4% in a selection protocol based on hygromycin B (Olhoft et al. 2003). It was discovered that the concentration of hygromycin B that completely inhibited callus formation in etiolated shoots was 20 mg/L (Figure 3.4). A minimum of 40 mg/L hygromycin was used in selection media to eliminate the possibility of escape transformants. Excised leaf sections from putatively transformed plantlets (Figure 3.15) showed visible callus formation after 6 weeks of culture on media containing from 25 to 50 mg/L hygromycin B. This confirmed the expression of the enzyme

hygromycin phosphotransferase and supported the evidence of stable integration of the gene construct.

Putatively transformed etiolated shoots exposed to blue light using a handheld Dark Reader displayed fluorescence under blue light (Figure 3.12) and confirmed GFP expression. Wild type GFP excites at two wavelengths, the maximal at 395 nm and at 475 nm blue light, and emits green light at a wavelength of 508 nm (Haseloff et al. 1999) and versions have been modified to have a maximum peak at 475 (Haseloff 1999) . The Dark Reader handheld lamp is a non-UV blue light source generating maximum light output between 400 and 500 nm, and uses two filters to reveal fluorescence

(Clare Chemical Research, Dolores CO). The non-UV nature and versatility of the equipment made possible its use in a number of applications involving fluorophore visualization (Seville 2001) including GFP in transgenic tobacco

(Halweg et al. 2005, Peckham et al. 2006), arabidopsis (Brosnan et al. 2007), grape (De Beer & Vivier 2008) and soybean (Klink et al. 2009). It was observed in some etiolated shoots and roots that GFP expression was partial

(Figure 3.12H, Figure 3.13). This indicated the presence of chimerism and insufficient selection pressure.

Crude protein extracts from anthurium callus tissues exhibited green fluorescence when illuminated with the Handheld Dark Reader (Figure 3.14, middle photo). Fluorometer measurements indicated elevated levels of fluorescence in both transformed tissues compared to the untransformed control, but of varying degrees. This is probably due to differential expression of the transgene. The untransformed control had a measureable amount of

fluorescence in tissue, due to pigments, secondary metabolites and phenolics produced by the plant (Hutzler et al. 1998, Grotewold et al. 1998). The expression of GFP was corroborated by results of Western blotting that detected the 28.4 kDa expressed in anthurium calli transformed with the constructs PrANTH17-IPT and the vector only pCAMBIA 1302 control (Figure

3.19). A higher-MW band (96.8 kDa) was expected in anthurium transformed with the gene construct PrSAG12-IPT and vector only control pCAMBIA 1303, but the GUS-GFP fusion protein was not detected. A faint band with a size of

28.4 kDa was observed in the latter though, and could be GFP that was post- translationally processed. Interruption during T-DNA integration could have resulted to truncation of the T-strand and would explain the absence of the

96.8 kDa band in lane S12 IPT (Figure 3.19). During T-DNA transfer, a linear, single stranded free T-DNA termed T-strand, corresponding to the bottom strand so that the 5’ and 3’ ends map from the right to the left border repeat, is produced (Stachel et al. 1986, Gheysen et al. 1987). The T-DNA is nicked by the VirD2 endonuclease and attaches to the 5’ end of the T-strand, then is introduced into a double stranded break in the plant chromosomal DNA by ligation of the 3’ end (Gelvin 2008). Since the GUS-GFP reporter gene fusion is closer to the right border (RB), interruption during integration into the plant chromosome could have resulted to truncation of the T-strand segment, closer to the RB (5’ end where the VirD is attached), where the GUS-GFP reporter gene was located.

Arabidopsis transformation

The simplicity and ease of the floral dip method in transforming arabidopsis has become the standard protocol in producing transgenic arabidopsis lines. As with vacuum infiltration and other in planta transformation methods, the targets of heritable transformation are the gametophyte-progenitor tissues, mature gametophytes, or recently fertilized embryos (Clough & Bent 1998). Hygromycin concentration from 20 to 50 mg/L hygromycin has been shown to be effective in selecting transformed seedlings (Nakazawa & Matsui 2003, McNellis et al. 1998, Boisson et al.

2001). Seeds that germinated on medium containing 50 mg/L hygromycin were stably transformed, and carried the hptII gene for hygromycin resistance. Transformation using PrSAG12-IPT and PrANTH17-IPT gene constructs produced plants that have similar phenotypes, and fall into three general categories. Normal-phenotype plants morphologically similar to the controls

(untransformed Col-1 WT & pCAMBIA 1302 vector only control), bunched- leaf-whorl phenotype (Figures 3.15C & 3.15D; Figures 3.17G, 3.17H &

3.17K), and compact-serrate-leaf phenotype (Figures 3.15E & 3.15F; Figures

3.17B to 3.17F). Additional phenotypes that are combinations of the off- types were also observed in PrANTH17-IPT plants (Figures 3.17I, 3.17J & 3.17L).

These phenotypic variations could be attributed to position effect (Wilson et al. 1990, Matzke & Matzke 1998) or transgene expression variability.

Changes in T-DNA methylation were associated with phenotypic variation

(Amasino et al. 1984). “The vast differences observed among transgenics can be attributed to two broad causes, namely, those due to methods employed

to generate transgenics and those resulting from breeding” (Bhat &

Srinivasan 2002). Hypermethylation of the 35S promoter caused the transgene expression variation in transgenic petunia (Meyer et al. 1992). IPT constructs used in stable transformation can be further tested for senescence-responsiveness by measuring IPT levels in the transformed plant as it undergoes normal development, compared to an untransformed WT.

PCR screening on the transformed lines resistant to hygromycin confirmed the integration of the senescence-regulated IPT constructs PrSAG12-

IPT and PrANTH17-IPT (Figure 3.18). This was shown by the amplification of three different regions (GFP reporter gene, hygromycin resistance gene and

IPT gene) that were carried by the T-DNA. PCR using total DNA from a plant transformed with the empty vector pCAMBIA 1302 amplified only the GFP reporter gene and the hygromycin resistance gene fragments (Figure 3.18, labeled 1302). The IPT gene was not amplified since the empty vector control did not contain the IPT gene construct (PrSAG12-IPT or PrANTH17-IPT).

Conclusion

The 1.88 kb ANTH17 promoter region contained motifs and cis-acting elements similar to those found in AtSAG12 and other senescence-regulated and/or stress-responsive genes. Stable transformation of the IPT gene construct was achieved in anthurium, and GFP was expressed at sufficiently high levels allowing visual observation of transformed tissues, thus successfully serving as a reporter gene. Arabidopsis transformed with IPT using a homologous gene promoter (PrANTH17) exhibited similar phenotypes as

the endogenous gene promoter. This suggests a similar, but not identical promoter induction systems and in both species.

Future studies

PrANTH17-GFP transformed arabidopsis had already been created and could be used to test the senescence-specific responsiveness of the promoter in planta. This would strengthen the evidence regarding the presence of an identical senescence pathway in both plant species. PrANTH17 could also be further characterized by performing deletion studies to pinpoint the 313 nt region of senescence specificity, as described in AtSAG12 and BnSAG12. A more efficient anthurium transformation procedure has recently been published (Fitch et al. 2011) that could greatly improve the recovery of transformed tissues.

CHAPTER IV

EXPRESSION OF GFP IN ANTHURIUM PROTOPLASTS

Introduction

Protoplasts are cells obtained from plants that were treated with cell wall degrading enzymes such as cellulase (Cocking 1960, 1972). The ability to isolate intact and viable protoplasts (Larkin 1976) has led to its use as a physiological tool in plant studies (Galun 1981) and in stable transformation using Agrobacterium (Krens et al. 1982). The versatility in using protoplasts is that they can be isolated from a variety of tissues and can be used to compare physiological processes in a wide range of plant species.

A transient expression system was developed to study signal transduction in maize and arabidopsis mesophyll protoplasts (Sheen 2001).

The isolation procedure is simple; plant material can be obtained from germinated seeds and does not require sterile conditions for protoplast recovery. It is also relatively short and expression in transfected protoplasts can be viewed within hours, depending on the type of experiment. Despite this, several limitations have been presented. Isolation of active protoplasts seems to be cell-type and age specific. Etiolated true leaves can be obtained from monocots such as maize and barley, but not from dicots like arabidopsis and tobacco, and etiolated/greening maize leaves provide the best sources of protoplasts for photosynthetic gene studies (Sheen 2001). It is therefore necessary to tailor and optimize the transient expression system based on the plant being studied and the type of concept being investigated.

One of the challenges in working with anthuriums is the limited amount of information on the plant at the molecular level. The long generation time for the plant is one of the factors that must be considered in designing experiments in transgenic anthurium explorations. The use of a consistent and dependable system in performing molecular studies would be useful before moving on to stable transgenic approaches. This section presents initial results of the development of a transient expression assay using GFP as a reporter gene to study subcellular signaling and protein localization in anthurium protoplasts.

Materials and Methods

Isolation of protoplasts from anthurium leaf, etiolated shoots and callus

Protoplast isolation from leaf, etiolated shoot and callus cultures of

‘Marian Seefurth’ was carried out using a combination and modification of the protocols for arabidopsis (Yoo, Cho & Sheen 2007) and the monocots

Spathiphyllum and Anthurium (Duquenne et al. 2007). Half a gram (0.5 gram) of tissue (etiolated shoots or calli) from in vitro cultured anthurium were cut into 0.5 to 1 mm thin sections using a razor blade and pre- incubated for 30 minutes in 5 mL 0.5 M mannitol. The solution was replaced with 4 mL enzyme solution composed of 1.5% cellulase Onozuka R10 (RPI

Corp., Mount Prospect IL, USA), 1% macerozyme R10 (RPI Corp., Mt.

Prospect IL, USA), 0.5% macerase pectinase (Calbiochem™-EMD Biosciences,

San Diego CA, USA), 0.5% driselase® (Sigma Life Sciences, St. Louis MO,

USA), 0.5% pectolyase Y23 (PhytoTechnology Lab, Shawnee Mission KS,

USA), 0.5 M mannitol, 20 mM KCl, 20 mM MES pH 6 and vacuum infiltrated until bubbling. The mixture was incubated in the dark at room temperature

(23 °C) for 30 minutes, followed with gentle agitation (40 rpm) for 5 hours.

An equal amount (4 mL) of W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM

KCl, 2 mM MES pH 6) was added to the digestion mix, passed through a 75

µm stainless steel mesh filter (RON-VIK, Inc., Minneapolis MN, USA) and centrifuged at 200 g for 6 minutes (all centrifugations were performed at

18 °C, unless stated). The protoplasts were resuspended in 4 mL flotation medium (0.6 M sucrose, 3 mM MES pH 6) and 1 mL of rinse medium (0.5 M sorbitol, 10 mM CaCl2, 3 mM MES pH 6) was layered on top. Protoplasts were floated onto the rinse medium by density gradient centrifugation (200 g for 6 minutes), transferred gently into a new tube and washed with 10 mL of rinse medium. The protoplasts were collected by centrifugation, resuspended in 1 mL MMg solution (0.5 M mannitol, 15 mM MgCl2, 4 mM MES pH 6) and kept on ice for transfection experiments.

Protoplast transfection and GFP expression

Isolated protoplasts were transfected with the pBIN35S-GFP5 construct (Hayden, PhD thesis). Ten microliters of plasmid DNA (2 µg/µL) were pipetted into a 2-mL microcentrifuge tube followed by the addition of

100 µL of protoplasts (2 X 105 protoplasts/mL) and gently mixed by inversion.

Transfection was initiated by addition of 110 µL PEG solution (30% PEG 4000,

0.25 M mannitol, 100 mM CaCl2) and mixed by gentle tapping of the tube.

The transfection process was allowed to continue by incubating the mixture at room temperature for 10 minutes and was terminated with the addition of

400 µL W5 solution. The transfection mixture was centrifuged at 100 g for 5 minutes and resuspended in 500 µL WI solution (0.625 M mannitol, 20 mM

KCl, 4 mM MES pH 6). The transfected protoplasts were incubated overnight in the dark at room temperature (23 °C). The transfected protoplasts were collected by centrifugation, resuspended in 200 µL W5 solution and viewed using an Olympus BX51 fluorescence microscope and an Olympus FluoView

FV1000 laser scanning confocal microscope.

Results

Transient expression of GFP protoplasts was observed only in arabidopsis protoplasts transfected with 35S-GFP5 viewed under an epifluorescence microscope (Figure 4.2).

Isolation of protoplasts and transfection

The standard procedure for arabidopsis protoplast isolation was not effective for anthurium. Enzymatic digestion of cell wall was not fully achieved in most cells even after 12 hours of incubation (Figure 4.2 C & D).

Red autofluoresence was observed in both arabidopsis and anthurium leaf mesophyll protoplasts, but green autofluorescence was emitted only in anthurium leaf mesophyll protoplasts (Figure 4.2 A to D lower photos).

The quality of protoplasts isolated from leaf mesophyll improved after addition of other cell wall degrading enzymes (Figure 4.3 A to G). Protoplasts isolated from etiolated shoots also have more uniformity in size compared to those isolated from leaf mesophyll.

Discussion

Protoplast quality and yield was low when standard isolation procedure for arabidopsis was used on anthurium. Incomplete enzymatic digestion was observed probably due to anthurium having a more complex cell wall than arabidopsis. Commercial preparations of cellulase and macerase/pectinase enzymes did not have enough activity to hydrolyze the amount of complex carbohydrate present in anthurium leaf mesophyll cell walls. This was

confirmed after addition of other cell wall degrading enzymes (macerozyme, driselase, pectolyase Y23) in the enzyme solution. Although recovery was improved, there were still cells whose walls were not completely digested. It has been reported that calcium oxalate crystals are commonly found in anthurium tissue (Samuels 1923), in other members of the Araceae (Genua

& Hillson 1985) and in monocots where it is a useful taxonomic trait in systematics (Prychid & Rudall 1999). The formation of these crystals

(raphides) was evident even in a developing embryo, along with yellowish, tannin-like deposits (Matsumoto et al. 1998).

Red chlorophyll autofluorescence was observed in leaf mesophyll protoplasts. Chlorophyll fluoresces red in the spectrum used (450-480 nm excitation, 515 emission) and was expected in the tissue type. Green autofluorescence in leaf protoplasts was also observed, and believed to be caused by pigments such as flavonoids and anthocyanins (Grotewold et al.

1998) and phenolics and phenolic metabolites (Hutzler et al. 1998) which are produced in high amounts in this species.

Conclusion

The use of additional cell wall degrading enzymes such as macerozyme, pectolyase Y23 and driselase, in addition to cellulase and macerase/pectinase, improved the quality of isolated protoplasts. Yield was higher in etiolated shoots compared to leaf and callus. Green autofluorescence was evident in some samples. The study was unable to provide a conclusive result with regards to successful transfection of anthurium protoplasts using GFP.

Repeated experiments are still needed in order to verify whether the procedure developed for anthurium protoplasts is an efficient transient reporter expression system.

Future research

Electroporation can be used in cases where transfection efficiency is low. Autofluorescence can be overcome by counterstaining and the use of other fluorescent dyes. It would also be worth comparing protoplast yield in etiolated leaves versus the tissues used (leaf, etiolated shoot, dark-grown callus). Expression of GFP in protoplasts can also be verified by western blot.

CHAPTER V

CHARACTERIZATION OF SENESCENCE RELATED GENE TRANSCRIPTS

IN ANTHURIUM SPATHE AND LEAVES

Introduction

A transcriptome is a representation that conveys the identity of each expressed gene and its level of expression for a defined population of cells

(Velculescu et al. 1997). In contrast to the genome which is fixed, the transcriptome constantly changes and is continuously being altered depending on internal and external factors. In simpler terms, it is the collection of genes being expressed by the organism at a particular moment in a given state. And because it is constantly changing, transcriptome studies are a bit more challenging.

Analysis of gene expression requires large amounts of good quality

RNA. It is important that mRNA preparations have segments that contain the entire nucleotide sequence in order to attain a high cloning efficiency

(Okayama & Berg 1982). The gold standard for determining the transcriptome structure is full-length cDNA sequencing (Forrest & Carninci

2009) but this technique is tedious and expensive. Microarray technology, a high-capacity system to monitor expression of many genes in parallel, uses complementary DNAs printed by a high-speed robotic machine on glass slides (Schena 1995). Although the use of arrays is still the dominant gene expression profiling technology, it is still limited by factors such as the

number of features available for assay, the dependence on the need for information on gene structure, and the inadequate ability to discriminate alternative transcript isoforms (Forrest & Carninci 2009). Tag-based expression profiling techniques, such as SAGE (Velculescu et al. 1995) allows for a complete quantitative transcript analysis of a specific cell or tissue type even at low transcript abundance (Peters et al. 1999).

Transcriptome sequencing (RNA-Seq) is one of the latest innovations being utilized by researchers to study differential gene expression in model organisms as well as in specialized systems. The introduction of instruments capable of producing millions of DNA sequence reads in a single run allowed for the development of high-throughput next generation sequencing, NGS

(Mardis 2008). This allowed sequencing of cDNA fragments at massive scales

(Ozsolak & Milos 2011) and has opened new doors for improvement of transcriptomic analysis. The use of deep-sequencing technologies provides a more precise measurement of transcript levels and their isoforms compared to other methods (Wang et al. 2009).

The objective of this study is to identify and analyze differentially expressed senescence-related genes in anthurium leaf and spathe tissues. A survey of anthurium leaf and spathe transcriptome over different developmental stages was done using RNA-seq. An overview of the different types of genes and proteins identified from the sequences from mRNA from the tissues was presented, and the differential expression of several genes in anthurium leaf and spathe was compared. Transcript levels were quantified.

Genes upregulated and specific to spathe tissues were identified. The large

amount of sequence data generated can provide a platform for further inquiries into the transcriptome of senescing anthurium leaf and spathe, and an opportunity for anthurium biotechnology and crop improvement. For example, genes unique to spathes are probably involved in spathe development, and can be used as sources of promoters to bioengineer changes in flower color or post-harvest life.

Materials and Methods

Spathe and leaf RNA extraction, transcriptome sequencing and annotation

RNA was isolated from spathe and leaf tissues following the same protocol used for DNA isolation (Chapter III – Isolation of promoter region) but instead of RNase treatment following resuspension of the pellet (500 µL sterile water) after a -20 °C overnight incubation, RNA was selectively precipitated by adding 8 M LiCl to give a 3 M final concentration. The solution was mixed well and precipitated at 4 °C overnight. The tube was spun at 14K rpm (Beckman GS-15R centrifuge) at 4 °C for 30 minutes and washed twice with 70% ethanol. The pellet was air-dried and resuspended in either 250 µL

(healthy tissues) or 100 µL (senescent/stressed tissues) sterile RNase free- water. Quality and quantity assessments were done by spectrophotometry

(Beckman Coulter DU730 UV/Vis spectrophotometer) and formaldehyde denaturing gel electrophoresis of RNA. A formaldehyde agarose gel was made by adding 1.5 mL 37% formaldehyde to cooled down melted agarose

(1.2 grams) in 90 mL distilled water + 10 mL 10X MOPS buffer (0.2 M N-

morpholinopropanesulfonic acid, 50 mM sodium acetate, 10 mM EDTA, pH 7).

Isolated RNA mixed in 2 parts of loading buffer (750 µL formamide, 150 µL

10X MOPS, 180 µL 37% formaldehyde, 200 µL 50% glycerol, 20 µL 10% bromophenol blue, 100 µL RNase-free water) was heated to 65 °C for 10 minutes and loaded onto the formaldehyde gel pre-stained with Gel Red. RNA samples for transcriptome sequencing (RNA-seq by Cofactor Genomics, St.

Louis MO, USA) were prepared by pooling RNA isolated from different stages of tissue development and sent as dried pellet. Anthurium leaf samples (AL) were composed of 0.34 µg RNA from young green leaf, 3.78 µg RNA from mature green leaf, 4.27 µg RNA from stage1 (S1) senescent leaf, 5.25 µg

RNA from stage2 (S2) senescent leaf, and 5.04 µg RNA from stage3 (S3) senescent leaf for a total of 18.68 µg RNA. Stages of leaf development were determined based on Hayden & Christopher (2004). Anthurium spathe samples (AS) were composed of 3.71 µg RNA from mature spathe, 1.29 µg

RNA from senescent spathe, and 5 µg RNA from highly senescent spathe for a total of 10 µg RNA. Stages of spathe development were determined visually; mature spathe characterized as fully expanded with spadix color change about halfway from yellow to white, senescent spathe characterized by browning of at least half of spadix, and highly senescent spathe characterized as complete browning of spadix. The results of the transcriptome sequencing were annotated using BLAST (http://blast.ncbi.nlm.nih.gov/) and DoBlast

(http://bioinfo3.noble.org/doblast/) to identify the protein names. Online searches were done to further annotate the sequences and group the proteins according to classes based on biological process.

Sequence selection, primer design and transcript expression levels

A set of 15 genes was selected to verify differential expression using

RT-PCR and qPCR (Table 5.1). Primer sets were designed using PrimerQuest, an internet-based primer design tool from Integrated DNA Technologies

(www.idtdna.com). Complementary DNA (cDNA) for each RNA sample AL &

AS was synthesized in a reverse transcription reaction with DNase treatment.

A 20 µL reaction mixture (1X RT buffer, 0.5 unit DNase, 2.5 mM dNTPs, 2.5

µM oligo-dT15, 500 ng RNA) was incubated at 37 °C for 10 minutes, followed by 5 minutes at 70 °C, and quenched on ice. The reaction was incubated at

42 °C for 1 hour after addition of 1 µL MMLV reverse transcriptase followed by 5 minutes at 95 °C. A “no RT” control tube was also set-up with the addition of distilled water instead of the reverse transcriptase. The synthesized cDNA mix was diluted to 50 µL and used as template for PCR.

A RT-PCR was performed by setting up a 25 µL reaction (1X KCl buffer with MgCl2, 0.8 mM dNTP mix, 0.2 µM each forward and reverse primer, 0.04 units Taq polymerase) using 1 µL of the synthesized cDNA as template. To test the designed qRT-PCR primers, a 25 µL reaction (1X KCl buffer with

MgCl2, 0.8 mM dNTP mix, 0.6 µM each forward & reverse primers, 0.06 units

Taq polymerase) was set up using 2 µL of the synthesized cDNA as template.

The mixture was heated to 95 °C for 3 minutes followed by 50 cycles of

95 °C for 10 seconds and 58 °C for 30 seconds. PCR products were resolved in a 2% agarose gel in 1X TAE (pre-stained with Gel Red) using Hyperladders

IV and V as DNA size markers. Samples for qRT-PCR analysis was prepared by mixing 5 µL cDNA template and 1.5 µL of each forward and reverse

primers (10 µM stock) in a 25 µL reaction mix that was sent to Biotech Core

Facility (University of Hawaii at Manoa) equipped with a BioRad iCycler IQ for qRT-PCR with SYBR green chemistry. Differential gene expression between leaf (AL) and spathe (AS) samples was determined by analyzing data for qRT-PCR (3 independent replicates) using the Livak method (Livak &

Schmittgen 2001), also known as the 2-ΔΔCT, with sample AL as the calibrator, and glutathione peroxidase (a1111) as the reference gene.

Results

RNA isolation from leaf and spathe

Formaldehyde gel electrophoresis of pooled samples extracted from anthurium leaf and spathe revealed good quality, intact 28S and 18S rRNA

(Figure 5.1).

Transcriptome sequencing and annotation

A total of 267,415 contig assemblies were generated from the Illumina sequencing experiment performed by Cofactor Genomics. A BLAST search of the NCBI nr database identified 17,004 sequences generated from RNA-seq uniquely similar to Arabidopsis proteins. These were further annotated using online searches and grouped into 22 protein classes based on biological function (Figure 5.2).

Almost half of all unique sequences were unknown proteins (47%), while 16% of the sequences have not yet been classified. Proteins involved in transport/trafficking/vesicle biogenesis and those related to transcription accounted for 6% each, while proteins related to transcriptional processes

(including ribosomal proteins) and those involved in protein degradation comprised 3% each of the total. Stress response proteins, complex

carbohydrate metabolism proteins, proteins involved in respiration, and proteins that were classified as vague (those belonging to families, domain- containing proteins, and proteins that have multiple functions) accounted for

2% each of the total. The remaining classes; those involved in photosynthesis, lipid metabolism, morphogenesis, DNA processes, nucleic acid metabolism, amino acid metabolism, cytoskeleton, protein folding/chaperones, natural compounds biosynthesis, heat-shock proteins, hormone metabolism, and post-translational processing, each accounted for

1% or less to the total number of sequences annotated.

Sequence selection, primer design and transcript expression levels

Fifteen genes were selected from the annotated Illumina sequencing results based on their diverse representative coverage value (number of times the sequence was covered during the sequencing experiment). The selected genes represented proteins that were relatively expressed in various levels in either leaf (AL) or spathe (AS) samples (Figure 5.3).

Four proteins were more highly expressed in leaf than in spathe (a175, a675, a1199 & a3211), while six were expressed more highly in spathe than in leaf (a41, a415, a650, a1073, a9173 & a9943). Five proteins were expressed at relatively the same amounts in both leaf and spathe (a218, a489, a717, a719 & a1111).

BLAST and online searches revealed the identities of proteins the sequences are most similar to (Table 5.1).

Table 5.1. Illumina RNA sequencing by Cofactor Genomics showed varying relative expression levels of 15 selected sequences as reflected by coverage between leaf (AL) and spathe (AS) samples. Illumina seq Sequence Fold Relative Protein name* coverage identifier difference† amount AL AS

higher in a41 ACC oxidase, ACO1, ACO2 106.55 5421.96 50.89 spathe ERD9 (EARLY-RESPONSIVE TO higher in a175 5962.62 79.13 -75.35 DEHYDRATION 9) leaf callus protein P23 (translationally- a218 2776.73 2626.34 0.95 no change controlled tumor protein-like protein) chitinase; glycoside hydrolase family higher in a415 72.3 3970.09 54.91 19 protein spathe a489 dormancy/auxin associated protein 1323.26 1185.58 0.90 no change higher in a650 glutamate dehydrogenase 33.19 1696.42 51.11 spathe higher in a675 fructose-bisphosphate aldolase 2514.89 84.82 -29.65 leaf light-harvesting complex I chlorophyll a717 1138.99 1145.4 1.01 no change a/b binding protein a719 protein translation factor SUI1 1293.76 1224 0.95 no change TONOPLAST DICARBOXYLATE higher in a1073 81.91 2094.48 25.57 TRANSPORTER (TDT) spathe a1111 glutathione peroxidase 818.65 889.22 1.09 no change PSBP-1 (PHOTOSYSTEM II SUBUNIT higher in a1199 1404.77 94.34 -14.89 P-1) leaf higher in a3211 ubiquitin 13 27.2 10.93 -2.49 leaf xyloglucan higher in a9173 endotransglucosylase/hydrolase 0.63 288.86 458.51 spathe protein higher in a9943 phospholipase C 0.75 146.39 195.19 spathe

* Protein name from sequence annotation using BLAST † Fold difference of 1 or -1 means no change in expression level

Specific primers for the 15 selected sequences were designed

(Appendix B) and used for RT-PCR.

Measurement of band intensity using Image J software revealed differences in expression levels of the 15 selected genes following RT-PCR

(Figure 5.5). Six genes were expressed higher in leaf than in spathe (a489,

a675, a719, a1111, a1199 and a3211), seven genes were expressed higher in spathe than in leaf (a41, a175, a650, a717, a1073, a9173 & a9943), and two genes were expressed at relatively the same levels (a218 & a415).

Relative quantification of gene expression by the selected genes was also measured using quantitative RT-PCR (qPCR). Results (Table 5.2a) show eight genes to have higher expression in leaf (a175, a218, a489, a675, a717, a719, a1199 & a3211), while six genes were expressed higher in spathe (a41, a415, a650, a1073, a9173 & a9943). Only sequence a1111 was shown to be expressed at the same levels in both tissues.

Table 5.2a. Differential expression of selected genes as determined by qRT- PCR analysis of synthesized cDNA from leaf (AL) and spathe (AS) samples.

Sequence Ct Fold Relative identifier Protein name* change† AL AS amount

higher in a41 ACC oxidase, ACO1, ACO2 25.2 ±1.01 18.6 ±0.56 78.79 spathe ERD9 (EARLY-RESPONSIVE TO higher in a175 19.2 ±0.61 24.3 ±0.57 -42.22 DEHYDRATION 9) leaf callus protein P23 higher in a218 (translationally-controlled tumor 17.7 ±0.70 18.4 ±0.61 -1.95 protein-like protein) leaf chitinase; glycoside hydrolase higher in a415 25.6 ±1.07 23.8 ±0.35 2.83 family 19 protein spathe dormancy/auxin associated higher in a489 24 ±0.75 26.5 ±0.68 -6.65 protein leaf higher in a650 glutamate dehydrogenase 26.7 ±0.85 20.6 ±0.53 54.443 spathe higher in a675 fructose-bisphosphate aldolase 20.8 ±0.95 29.5 ±0.55 -536.21 leaf light-harvesting complex I higher in a717 20.1 ±0.87 22 ±0.60 -4.70 chlorophyll a/b binding protein leaf higher in a719 protein translation factor SUI1 19.6 ±0.40 20.9 ±0.26 -2.96 leaf TONOPLAST DICARBOXYLATE higher in a1073 25.6 ±0.87 20.9 ±0.31 22.11 TRANSPORTER (TDT) spathe a1111 glutathione peroxidase 21.9 ±0.25 21.6 ±0.31 1 same PSBP-1 (PHOTOSYSTEM II higher in a1199 18.7 ±0.64 24.4 ±0.26 -65.50 SUBUNIT P-1) leaf higher in a3211 ubiquitin 13 29.7 ±0.93 34.1 ±2.51 -24.82 leaf xyloglucan higher in a9173 endotransglucosylase/hydrolase 33.1 ±2.00 23.7 ±0.51 536.215 protein spathe higher in a9943 phospholipase C 35.6 ±2.06 28.8 ±1.05 92.625 spathe

* Protein name from sequence annotation using BLAST † Fold change in expression relative to sample AL calculated using the Livak method (ΔΔCT) using a1111 as reference gene and AL as calibrator.

Table 5.2b. Comparison of fold changes in selected genes using Illumina, RT-PCR & qPCR results.

Sequence identifier Protein name* Illumina RT-PCR qPCR a41 ACC oxidase, ACO1, ACO2 50.89 1.56 78.79 ERD9 (EARLY-RESPONSIVE a175 -75.35 1.18 -42.22 TO DEHYDRATION 9) callus protein P23 a218 (translationally-controlled 0.95 0.99 -1.95 tumor protein-like protein) chitinase; glycoside hydrolase a415 54.91 1.05 2.83 family 19 protein dormancy/auxin associated a489 0.90 -50.22 -6.65 protein a650 glutamate dehydrogenase 51.11 3.49 54.443 fructose-bisphosphate a675 -29.65 -2.57 -536.21 aldolase light-harvesting complex I a717 chlorophyll a/b binding 1.01 1.21 -4.70 protein protein translation factor a719 0.95 -1.47 -2.96 SUI1 TONOPLAST DICARBOXYLATE a1073 25.57 1.38 22.11 TRANSPORTER (TDT) a1111 glutathione peroxidase 1.09 -1.16 1 PSBP-1 (PHOTOSYSTEM II a1199 -14.89 -2.03 -65.50 SUBUNIT P-1) a3211 ubiquitin 13 -2.49 -53.98 -24.82 xyloglucan a9173 endotransglucosylase/hydrola 458.51 17.01 536.215 se protein a9943 phospholipase C 195.19 13.90 92.625 * Protein name from sequence annotation using BLAST

A total of 942 sequences were discovered to be expressed only in spathe, while 1053 were unique to leaf (Figure 5.7). Over half of those were unknown proteins (61% in leaf, 70% in spathe). In all three methods for expression measurements, Illumina sequencing, RT-PCR & qPCR, five genes were consistently expressed higher in spathe tissue: a41, a650, a1073, a9173 & a9943, while three were consistently expressed in leaves: a675, a1199 & a3211. No sequences having the same levels in both tissues were measured consistently by the three methods.

In Illumina and RT-PCR measurements, sequence a218 was similarly measured at having the same levels in both tissues. Sequence a175 was measured differently though, and was shown to be higher in leaf using

Illumina sequencing, but was shown to be the opposite (higher in spathe) using RT-PCR. The other sequences were either measured having the same levels or higher in either leaf or spathe.

All sequences that were measured by Illumina sequencing to be expressed high in leaf (a175, a675, a1199 & a3211) were also measured the same by qPCR, although additional genes (a218, a489, a717, a719) were measured by qPCR to be higher in leaf, while in Illumina they were measured to have the same level of expression in both tissues. Sets of genes that were expressed higher in spathe tissue were the same for both methods (a41, a415, a650, a1073, a9173 & a9943). Sequence a1111 was measured by both Illumina and qPCR to have the same level of expression in both leaf and spathe.

Comparison of measurements between RT-PCR & qPCR revealed that almost all genes measured by RT-PCR to be highly expressed in leaf (a489, a675, a719, a1199, a3211) were measured similarly by both methods, except for a1111 where RT-PCR scored it to be high in leaf but qPCR scored it as having the same level of expression in both leaf and spathe. Sequences a175 and a717 were both scored by RT-PCR to be higher in spathe but was scored higher in leaf by qPCR. RT-PCR scored a415 to be the same in both leaf and spathe but in qPCR it was measured to be highly expressed in spathe.

Discussion

Transcriptome sequencing, annotation and sequence selection

Further annotations (using BLAST and online searches) of the results identified the selected sequences to be proteins associated with different biological functions. Almost half (47%) of the identified sequences corresponded to proteins classified as unknown. Aside from proteins with unknown biological function, this group is also comprised of hypothetical proteins, predicted proteins, putative proteins, uncharacterized proteins, and unnamed proteins. Hypothetical proteins are predicted proteins from nucleic acid sequences that have not been shown to exist by experimental chemical evidence, and may represent up to half of the potential protein coding regions of a genome (Lubec et al. 2005).

A total of 15 nucleotide sequences that code for 15 different genes were selected and used for expression studies. One of these is sequence a41,

a gene that codes for ACC oxidase. This protein, grouped in the class of hormone metabolism, is an enzyme involved in fruit ripening (Moyaleon &

John 1994) and catalyzes the last step in ethylene biosynthesis (Kende 1993).

The gene has been used in antisense gene technology to inhibit fruit ripening

(Ayub et al. 1996). Three sequences were classified as stress proteins.

Sequence a175 was annotated to have the highest similarity to ERD9 (EARLY

RESPONSIVE TO DEHYDRATION 9) protein, most probably a member of a group of ERDs that are preferentially responsive to dehydration stress

(Kiyosue et al. 1994). Another member protein, ERD15, is rapidly induced in response to biotic and abiotic stresses and has been shown to negatively regulate abscisic acid (ABA) responses in arabidopsis (Kariola et al. 2006).

Sequence a415 was discovered to be a chitinase, an enzyme that hydrolyzes chitin. Plant chitinases play a role in pathogen resistance, and are upregulated by both biotic and abiotic stresses, and by phytohormones such as ethylene, jasmonic acid and salicylic acid (Kasprzewska 2003). The third stress response protein is sequence a1111, a glutathione peroxidase. This enzyme protects cells from oxidative damage generated by reactive oxygen species, is highly expressed in most developmental tissues but showed the strongest responses under most abiotic stresses (Milla et al. 2003).

A gene sequence (a218) classified as belonging to morphogenesis proteins, codes for callus protein P23. The gene for this protein has been cloned in pea (Pisum sativum L.), and the expression was correlated with mitosis and cell division in root caps (Woo & Hawes 1997). Sequence a650 corresponds to glutamate dehydrogenase, an enzyme that catabolizes

glutamate and has an important regulatory function in carbon and nitrogen metabolism (Robinson et al. 1991). A sequence grouped with respiration proteins (a675) was annotated to be fructose-bisphosphate aldolase. This was found to be a constituent of both the glycolytic/gluconeogenic pathway and the pentose phosphate cycle, and responds to gibberellin in rice roots

(Konishi et al. 2004).

Two sequences coded for proteins involved in photosynthesis. The first was a717, the light-harvesting complex I chlorophyll a/b binding protein, a component of the light-harvesting antenna system responsible for photoprotection (Umate 2010), and the second was a1199, the

PHOTOSYSTEM II SUBUNIT P-1 protein, a part of a multisubunit pigment- protein complex that catalyzes the light-driven water oxidation and reduction of plastoquinone (Peng et al. 2006). The TONOPLAST DICARBOXYLATE

TRANSPORTER, TDT (sequence a1073) is a malate transporter and is also involved in the regulation of pH homeostasis under certain conditions (Hurth et al. 2005). Sequence a9173 was annotated to be a xyloglucan endotransglucosylase/hydrolase protein, a cell wall modifying enzyme that has a high specificity for xyloglucan, the most abundant hemicellulose in the primary cell walls of non-graminaceous plants (Saladie et al. 2006). Ubiquitin

13, coded for by sequence a3211, is a highly conserved eukaryotic protein that covalently links to substrate proteins thereby tagging them for degradation via the ubiquitin pathway (Belknap & Garbarino 1996).

Phospholipase C (sequence a9943) hydrolyzes phosphatidylinositol bisphosphate, a membrane-associated lipid, into the signaling molecules

inositol phosphate and diacylglycerol, and was found to be inhibited by profilin, an actin-binding protein (Drøbak et al. 1994). Sequence a719, the protein translation factor SUI1, was found to be present in high amounts in yellow fruit library of pineapple and was strongly upregulated during fruit ripening (Moyle et al. 2005). A protein of unknown function (sequence a489) was a dormancy/auxin associated protein also found to be expressed in shade-induced apple abscission (Zhou et al. 2008) and during seed maturation in Brassica napus (Fei et al. 2007).

Transcript expression levels

Five genes namely a41, a650, a1073, a9173 & a9943 were highly expressed in spathe tissues. These genes correspond to ACC oxidase, glutamate dehydrogenase, TONOPLAST DICARBOXYLATE TRANSPORTER, xyloglucan endotransglucosylase/hydrolase protein & phospholipase C, respectively. ACC oxidase is involved in ethylene biosynthesis, and is mostly associated with programmed senescence such as fruit ripening and petal senescence. Although the true flowers in anthurium are borne on the spadix, it was not included in the RNA extraction performed. The increased level of expression of ACC oxidase in spathe suggests increased ethylene production in spathe compared to that in leaves. Higher expression of glutamate dehydrogenase implies higher concentration of its substrate glutamic acid.

The results in spathe expression data suggest that these five proteins are required for spathe development and senescence.

The genes required for leaf development are a675, a1199 & a3211.

These sequences correspond to fructose-bisphosphate aldolase,

PHOTOSYSTEM II SUBUNIT P-1 (PSBP-1) & ubiquitin 13, respectively.

Fructose-bisphosphate aldolase is involved in the pentose phosphate pathway and would be expressed higher in leaves since there is a higher amount of chloroplasts in the leaf than in spathe. The same for PSBP-1, a component of

Photosystem II actively expressed during photosynthesis, and expected to have higher expression in leaf. Since ubiquitin was expected to be present in both tissues, this particular protein (ubiquitin 13) could be a leaf-specific isoform of ubiquitin.

Genes expressed at relatively the same levels, a218 & a1111 corresponding to callus protein P23 & glutathione peroxidase, respectively, are proteins commonly involved in developmental processes in both tissues and are good candidates for controls. Callus protein P23 was grouped with morphogenesis proteins and was shown to be involved in mitosis and cell division, a process common in all tissue types. Glutathione peroxidase was previously mentioned to be involved in oxidative stress protection and since both leaf and spathe tissues were senescent, this gene would be expressed in both. The same level of expression by glutathione peroxidase in both tissues would also be consistent with the report that it is expressed in all developmental tissues (Milla et al. 2003). Both of these are most probably maintenance genes.

Genes expressed in higher levels in a specific tissue type indicate the importance of the protein in the developmental processes occurring at that

particular moment. Since the pooled RNA used in RNA-seq analysis were mostly from senescent tissues (78% in leaf and 64% in spathe), a majority of the genes resulting from Illumina sequencing were expected to be senescence-related genes. These genes perform specific functions during senescence.

Conclusion

Illumina sequencing, transcriptome profiling and bioinformatic analyses identified fifteen differentially expressed senescence-related genes involved in leaf and spathe development. More than half of the unique sequences, whether overall (17,004 sequences) or specific to leaf (1,053 sequences) or spathe (942 sequences), were found to be proteins of unknown function. This gives a picture of how much work needs to be invested in gene isolation and characterization. Differential expression experiments identified genes that are specific for leaf and spathe tissues undergoing senescence, as well as genes specific to either spathe or leaf.

Quantification of fold-change (the increase or decrease in transcript levels) in gene expression is relative and measurements are not exact. RNA sequencing provides an abundance of sequences for gene analysis, but requires validation using RT-PCR and/or qPCR.

Future studies

A sequence similarity search could be performed on the contig assembly data using the ANTH17 sequence to verify expression of the senescence-activated cysteine protease. The availability of sequences would

allow cloning and characterization of genes that could be of interest to anthurium crop improvement. Expression data unique to either leaf or spathe could be used in mining for tissue-specific genes for promoter isolation.

Accuracy of the contig assemblies could also be validated by performing long strand PCR followed by sequencing. The availability of a collection of sequences, all 17,000 of them, opens new frontiers for further molecular studies in anthurium.

CHAPTER VI

ANTHURIUM SEED DEVELOPMENT

Introduction

The biogenesis of a seed and associated dehydration is an end point in development, involving senescence of tissues. One example of senescing tissue in the seed is the endothelium and integuments, components of the seed coat that function in the promotion of dormancy, protection and dispersal (Haughn & Chaudhury 2005). Similar to senescence in leaves, a set of genes are involved and are upregulated during this process. An example is a protein disulfide isomerase (PDI5) that has been shown to localize in protein storage vacuoles in seeds, and is produced in high amounts just before senescence of the seed endothelium (Ondzighi et al. 2008).

Seed storage proteins play an essential role in seed development, and are mostly found in protein bodies. In all seeds, one or two groups of protein are usually present in high amounts and serve as storage of amino acids for use in germination and seedling growth (Shewry et al. 1995). These proteins are mobilized during these processes and are the primary nitrogen source for the developing embryo. Seed storage proteins of dicots are mostly albumins and globulins while those of monocots are mostly prolamins and glutelins

(Derbyshire et al., 1976). Glutelin, the major seed protein in rice, accounts for 80% of the total protein in the endosperm and is used as a nitrogen source for germination (Takaiwa and Oono 1991).

Anthurium is a broadleaf monocot which has a complete flower, but cannot self pollinate due to difference in timing of pollen production and stigma receptivity. In successful pollinations, resulting seeds have to be germinated right away. Compared to other monocots, such as the cereal grains, seeds of anthurium cannot be stored for prolonged periods due to loss of viability, a form of aging. In some plant species, it has been known that loss of moisture is associated with loss of viability in seeds (Hendry et al.

1992; Chaitanya and Naithani 1994).

It would be interesting from an evolutionary perspective to compare the protein profile of the seed storage proteins of the monocot, anthurium, with rice and maize, which are two widely studied members of the grass subfamily of the Monocotyledonae. Additionally, it would also be notable to observe the similarities and differences in the proteins, namely globulin, glutelin and prolamin seed storage proteins present in the seeds. This experiment serves as an initial study in the examination of anthurium seed proteins and storage proteins, and the possibilities of identifying genes involved in the loss of viability in anthurium seeds during prolonged storage.

Materials and Methods

Pollination of flowers, seed development and harvesting

Anthurium andreanum cultivar ‘Rising Sun’ inflorescence was mechanically pollinated by dusting receptive, nectar-secreting stigma with pollen collected from A. andreanum cultivar ‘Nitta Orange’. The plant bearing

the pollinated flower was grown in normal conditions in the growth room (70% shade, 27 °C, 60-70 % relative humidity, 12 hour light cycle) and allowed to develop seeds. The inflorescence (spathe and spadix) was harvested and seeds were collected by pressing the berries lightly until the seeds (2-3 per berry) separated from the pulp. The seeds were cleaned and stored overnight.

The cleaned up seeds were surface sterilized in a 10% Chlorox™ solution

(0.53% NaOCl) + 0.2% Tween 20 for 20 minutes, washed for another 20 minutes in a 5% Chlorox™ solution (0.27% NaOCl) + 0.2% Tween 20, and finally rinsed five times in sterile distilled water. The disinfected seeds were germinated in vitro (on filter paper and water in a petri plate under sterile conditions) at room temperature with a 12 hour photoperiod.

Protein extraction, analysis and mass mapping

Seed protein profiles for anthurium (A. andreanum), rice (Oryza sativa) and maize (Zea mays) were generated using SDS-PAGE followed by coomassie brilliant blue staining. The procedure for protein extraction from seeds/grains was adapted from the paper by Tian et al. (2004). Total seed protein was extracted by grinding 2 to 3 seeds in SDS sample buffer (pH 6.8) composed of 5% (v/v) β-mercaptoethanol, 4% (w/v) SDS, 4 M urea, 0.125 M

Tris-HCl in a mortar and pestle. Furthermore, seed protein extraction based on solubility was also performed using extraction buffers for globulins (0.5 M

NaCl, 10 mM Tris-HCl pH 6.8), glutelins (1% v/v lactic acid), and prolamins

(60% n-propanol, 5% β-mercaptoethanol). Protein extracts were loaded onto a 12% SDS-PAGE gel alongside a Full range Rainbow Protein Marker

(Amersham-GE Healthcare, Piscataway NJ, USA) and stained with Coomassie

Brilliant Blue (50% methanol, 0.05% Coomassie R-250, 10% acetic acid).

Gels were dried and selected bands were sent for protein identification.

Samples from dried gels were sent to two facilities for protein identification by mass spectrometry. Midwest Bio Services, LLC (Overland

Park KS, USA) performed tandem mass spectrometry using nano-LC/MS/MS technique on five different protein bands cut out from dried SDS-PAGE gel of total seed protein. The mass mapping services offered by Stanford PAN

Facility (Stanford CA, USA) for identifying proteins from two bands cut out from dried SDS-PAGE gels involved tryptic digestion followed by mass analysis of the resulting peptide mixture on an AB 4700 Proteomics Analyzer

(MALDI mass spectrometer). Mass spectrometry data generated from the two samples were used to identify the protein from primary sequence database using Mascot search (www.matrixscience.com).

Results

Pollination, seed development & harvesting

Mechanical pollination of flowers produced ripe berries borne on the spadix after 8 months (Figures 6.1a, 6.1b). The spadix noticeably resembled a corn cob after the yellowish, plump berries were removed (Figure 6.1c).

Two seeds were encased within each berry in gelatinous, jelly-like mucilage that had a characteristic scent similar to that of corn kernels (Figure 6.1d).

Surface-sterilized seeds germinated after 8 to 10 days in vitro (not shown).

Total protein from seeds

Total protein (extracted by grinding fresh seeds and sample buffer in a mortar and pestle) from anthurium, rice and maize whole seeds (embryo, endosperm & seed coat) generated different protein profiles (Figure 6.2).

Three major bands with MW sizes of 65-, 18- and 11-kilodaltons (kD) were observed in anthurium, while six major bands with MW sizes of 35-, 32-, 20-,

19-, 13- and 11-kD were seen in rice. In maize, multiple higher MW sized bands between 55- and 70-kD can be hardly distinguished except for a band with a MW of 65-kD. However, six lower MW sized bands smaller than 30-kD were easily resolved by the gel and had corresponding sizes of 28-, 23-, 20-,

17-, 15- and 8-kD.

100

A closer look at the total protein SDS-PAGE gel showed the presence of similar sized protein bands in all three samples. Proteins bands having MW sizes of 65-, 55- and 8-kD were seen in protein profiles for all three samples, while bands sized 50-, 43-, 40-, and 18-kD were unique to anthurium only.

Three bands having sizes of 77-, 35- and 11-kD were shared by anthurium and rice, while a 28-kD band was present in anthurium and maize. Two bands (19- & 13-kD) were unique to rice, and a 23-kD band was unique to maize. A 32- and a 20-kD band was present in both rice and maize.

Protein types based on solubility

101

Protein profiles of globulins isolated from anthurium, rice and maize using a dilute saline extraction buffer (0.5 M NaCl, 10 mM Tris-HCl pH 6.8) showed similarities in resolved protein bands between the three different species (Figure 6.3a). Protein bands having sizes of 77-, 73-, 40-, 1-1 and 8- kDa can be seen in all three species, while a 58-kDa-sized protein band was shared only by anthurium and rice. Protein bands with sizes of 31- and 27- kDa were present in both anthurium and maize, while a 21-kDa protein band was found only in rice and maize and not in anthurium.

Glutelins were isolated using a dilute acid extraction buffer (1% v/v lactic acid). Protein profiles for the three samples revealed a band unique only to anthurium (18-kD) and an 11-kD band found in all three species

102

(Figure 6.3b). The 8-kD band observed in the two previous gels (total protein

& globulin) was also visible at the bottom, just above the dye front.

SDS-PAGE analysis of prolamins, extracted based on their solubility in alcohol solution (60% n-propanol, 5% β-mercaptoethanol), from the three samples showed a band (22-kD) unique only to maize (Figure 6.3c). Two bands were shared by anthurium and maize (18- & 13-kD) while an 11-kD band was unique only to rice.

Peptide sequencing results

There were no protein matches in the NIH nr database on the five samples sent to Midwest Bio Services for tandem mass spectrometry. Mascot database search (NCBI nr) using mass spectrometry data for the two

103

samples submitted to Stanford PAN Facility returned one match. Sample B

(Figure 6.2, 11 kD band) had sequence identity to ShlA/HecA/FhaA exofamily protein from Escherichia coli CFT073.

Discussion

Pollination of flowers, seed development and harvesting

Pollination was successful, as evidenced by the development of mature seeds encased within berries on the spadix. In its natural habitat, anthurium is pollinated by insects. The inflorescence produces aromatic substances collected by various bees and wasps to use as scent attractants in courtship or as waterproofing for their nests (Bown 2000). Although the plant has a complete flower, self pollination is impossible because the plants are protogynous; the stigma is receptive before the pollen is shed (Higaki et al.

1984). Receptive stigma is evidenced by the secretion of sticky, translucent stigmatic fluid on the tip of each flower on the spadix that provides a suitable medium for pollen germination (Higaki et al. 1984). There have been reports of failures in sexual propagation attributed to species incompatibility resulting in non-viable seeds (Sheffer & Kamemoto 1976). In this experiment, the harvested seeds were able to germinate in sterile conditions, although germination in pots was not tested.

Anthurium berries resembled corn kernels, having a mucilaginous pulp encased in a shiny, waxy coating (hardened carpel wall), while the seeds

(endosperm & embryo) resembled the grains of cereals. This is not surprising since all three species are monocots. The mucilage had a characteristic scent,

104

similar to that of corn, to make it attractive to animals. Birds and mammals were presumed to be the dispersal agents of the brightly colored berries of

Araceae in its natural environment (Judd et al. 2002). It was suggested that because anthurium seeds have a very sticky coating, the birds that feed on the pulp wipe the seeds off on branches when cleaning their beaks thus leaving the seeds well-placed for germination (Bown 2000).

Seeds developed to maturity, as evidenced by the ability to germinate after one week incubation in vitro. A seed that does not develop properly, or do not mature properly does not have the ability to germinate. This is most probably due to loss of moisture, since loss in viability of seeds is due to disorganization of metabolism leading to the loss of stability of subcellular structures, including membranes resulting from loss of structured water

(Farrant et al. 1988; Chaitanya & Naithani 1994).

SDS-PAGE analysis of seed proteins

The 77-kD band (common to anthurium & rice) and the 55-kD band

(common to all three species) seen in the total protein gel (Figure 6.2) are the 76- and 57-kD polypeptides of glutelin. The 76-kD glutelin peptide belongs to albumin component and localizes in the starch granules in rice

(Yamagata et al. 1982).The 57-kD glutelin is composed of two polypeptide groups, 22 to 23 and 37 to 39 kilodalton complexes. Glutelin is the major storage protein in rice seed and the expression levels of the 76- and 57-kD polypeptides are fairly constant throughout seed development (Yamagata et al. 1982). The 57-kD polypeptide is salt soluble but not the mature subunits

105

(Yamagata et al. 1982) thus, the 55-kD band can be seen in Figures 6.2

(total protein) and 6.3a (dilute salt soluble globulins) but not in Figures 6.3b

(acid- soluble glutelins) and 6.3c (alcohol-soluble prolamins). Glutelin in rice is post-translationally cleaved to give acidic (28- to 31-kD) and basic (20- to

22-kD) polypeptides (Takaiwa et al. 1999). These mature peptides were not observed in the globulin extracts (Figure 6.3a, Os), which are expected since they are not readily salt soluble, although a 21-kD band can be seen.

Interestingly, anthurium and maize contained the 27- to 31-kD bands, and are possible rice glutelin homologs. The major bands seen in rice (Figure 6.2, lane Os) are the major groups of polypeptides when glutelin is reduced.

Three size classes of polypeptides are detected in SDS-PAGE of rice glutelin fraction; 51 kD, 34 to 37 kD, and 21 to 22 kD, and a contaminating prolamine polypeptide of 14 kD (Villareal & Juliano 1978; Krishnan & Okita

1986; Kim & Okita 1988).

Zeins are maize prolamins and consist of two major subclasses, the 22 kD and the 19 kD (Shewry & Halford 2002), and these are the major proteins seen in Figure 6.3c (22-kD & 18kD). The 28-kD band common to both anthurium and maize is most probably the 27 kD HS-7 zein of maize.

Inconsistencies in calculating MW sizes are possible, due to differences in the extraction buffers used in isolating the different protein types based on solubility. The differences in the buffer composition affected migration patterns of peptides.

106

Protein extraction, analysis and mass mapping

Tandem mass spectrometry performed on the five samples sent to

Midwest Bio Services did not correspond to any protein when ran through a peptide mass spectrometry database. In order for a particular sequence to be considered an identity, the spectrometry data should match to at least two peptides belonging to the same protein. More matches to peptides from a particular protein increase the likelihood of a complete match. This is not the case for the five samples, since there were only single hits to a particular peptide from proteins contained in the database for each of the samples submitted. This is unusual, since there should be higher similarity at the protein level than at the nucleotide level, especially for proteins belonging to the same family, and even for proteins that descended from the same ancestor. Although unusual, inability to find significant matches is highly possible, especially for proteins from species that are not widely studied, and therefore absence of protein sequences in the mass spectrometry database.

The mascot search using mass spectrometry data generated from the tryptic digestion of the two samples submitted to Stanford PAN Facility returned one match for Sample B (11 kDa). This short tryptic peptide of

947.46 Daltons corresponds to the amino acid sequence AGGNLSVSSR. A quick BLAST search revealed it to be a hemagglutinin repeat protein or a protein belonging to the hemagglutinin family from Escherichia coli. The closest match to a plant protein is an E3 ubiquitin-protein ligase At1g12760- like protein from Glycine max (soybean), which is involved in protein degradation. The closest match to a monocot was to an uncharacterized

107

protein LOC100192085 from Zea mays. This protein (NP_001130980.1) contains four ACT domains which are commonly involved in amino acid binding or small ligand binding that leads to enzyme regulation (BLAST). The

14 kD peptide from anthurium could be a part of a larger protein involved in protein degradation during seed germination.

Conclusion

Anthurium andreanum ‘Marian Seefurth’ and ‘Nitta Orange’ are compatible cultivars that produce mature and viable seeds that successfully geminate in vitro. The major high MW seed proteins are most similar to glutelins found in rice, and the major low MW proteins are prolamins most similar to zeins. Protein profiles generated by SDS-PAGE provided limited information on the major anthurium seed proteins. Identification of peptides by mass spectrometry is a necessity in order to generate a complete proteomic profile, although the technique is dependent on the sequences available in a database. It is believed that anthurium lacks typical monocot grain storage proteins, such as those found in rice and corn. This may have implications in embryo development, and subsequently affect seed viability.

However, several new seed or embryo proteins were identified. The information generated by this study, albeit limited, serves as preliminary work for investigating seed viability loss in anthurium during prolonged storage.

108

Future studies

It is recommended to try 2D gel electrophoresis as the next step in characterizing the major seed proteins in anthurium. The identification of peptides using mass spectrometry is especially challenging for species that are less studied, mainly due to limitations in database information. The upside to the procedure though is that the mass spectrometry data generated from the samples can be used to do another search in the future, when newer and more updated versions of databases become available. A more conventional molecular approach could prove to be a better step towards identifying the major seed proteins of anthurium and facilitate inquiry into the function of these proteins, as well as the possibility of involvement in seed development and viability.

109

Appendix A - PlantCARE Database search results (complete)

Table A1. A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence).

motif species position Strand sequence function Petroselinum 4cl-CMA2a crispum 111 - TCATCACCTAACAC light responsive element cis-acting element 5UTR Py- Lycopersicon conferring high rich stretch esculentum 222 + TTTCTTCTCT transcription levels AAGAA- motif Avena sativa 1051 + GAAAGAA Petroselinum cis-acting regulatory A-box crispum 299 + CCGTCC element cis-acting element Arabidopsis involved in the abscisic ABRE thaliana 1005 + TACGTG acid responsiveness cis-acting element involved in the abscisic ABRE Hordeum vulgare 1303 - CCGCGTAGGC acid responsiveness cis-acting element Petroselinum involved in light ACE crispum 101 - ACTACGTTGG responsiveness cis-acting element Petroselinum involved in light ACE crispum 889 + AAAACGTTTA responsiveness cis-acting regulatory element essential for the ARE Zea mays 395 + TGGTTT anaerobic induction cis-acting regulatory element essential for the ARE Zea mays 813 - TGGTTT anaerobic induction cis-acting regulatory element essential for the ARE Zea mays 639 - TGGTTT anaerobic induction part of a conserved DNA Arabidopsis module involved in light ATCT-motif thaliana 252 + AATCTAATCT responsiveness cis-acting regulatory ATGCAAAT element associated to motif Oryza sativa 693 - ATACAAAT the TGAGTCA motif part of a conserved DNA Petroselinum module involved in light Box 4 crispum 1224 + ATTAAT responsiveness Box I Pisum sativum 193 + TTTCAAA light responsive element Box I Pisum sativum 558 - TTTCAAA light responsive element Box I Pisum sativum 530 - TTTCAAA light responsive element Box I Pisum sativum 614 + TTTCAAA light responsive element common cis-acting Arabidopsis element in promoter and CAAT-box thaliana 39 + gGCAAT enhancer regions common cis-acting Arabidopsis element in promoter and CAAT-box thaliana 255 + CCAAT enhancer regions common cis-acting Arabidopsis element in promoter and CAAT-box thaliana 702 - CCAAT enhancer regions

110

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). common cis-acting Arabidopsis element in promoter and CAAT-box thaliana 798 - CCAAT enhancer regions common cis-acting Arabidopsis element in promoter and CAAT-box thaliana 1279 - CCAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 8 - CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 230 + CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 313 + CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 426 - CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 529 - CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 643 + CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 693 - CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 976 - CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 1164 - CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Brassica rapa 1252 + CAAAT enhancer regions common cis-acting element in promoter and CAAT-box Glycine max 6 + CAATT enhancer regions common cis-acting element in promoter and CAAT-box Glycine max 245 + CAATT enhancer regions common cis-acting element in promoter and CAAT-box Glycine max 246 - CAATT enhancer regions common cis-acting element in promoter and CAAT-box Glycine max 328 + CAATT enhancer regions common cis-acting element in promoter and CAAT-box Glycine max 592 + CAATT enhancer regions common cis-acting element in promoter and CAAT-box Glycine max 909 + CAATT enhancer regions common cis-acting element in promoter and CAAT-box Glycine max 998 - CAATT enhancer regions

111

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). common cis-acting element in promoter and CAAT-box Hordeum vulgare 41 + CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 160 - CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 247 - CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 256 + CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 409 - CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 450 + CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 467 + CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 567 - CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 786 - CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 950 + CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 999 - CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 1068 + CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 1138 - CAAT enhancer regions common cis-acting element in promoter and CAAT-box Hordeum vulgare 1401 - CAAT enhancer regions cis-acting regulatory Arabidopsis element related to CAT-box thaliana 103 + GCCACT meristem expression part of a light responsive CATT-motif Zea mays 673 + GCATTC element cis-acting regulatory element related to CCGTCC- Arabidopsis meristem specific box thaliana 299 + CCGTCC activation chs-Unit 1 Arabidopsis part of a light responsive m1 thaliana 109 - ACCTACCACAC element cis-acting regulatory Lycopersicon element involved in circadian esculentum 1059 + CAAAGATATC circadian control CTAG-motif Avena sativa 228 - ACTAGCAGAA Dianthus ethylene -responsive ERE caryophyllus 558 - ATTTCAAA element

112

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). Dianthus ethylene-responsive ERE caryophyllus 613 + ATTTCAAA element Arabidopsis part of a light responsive GA-motif thaliana 146 - ATAGATAA element gibberellin-responsive GARE-motif Brassica oleracea 218 - AAACAGA element gibberellin-responsive GARE-motif Brassica oleracea 1442 + AAACAGA element cis-acting regulatory Antirrhinum element involved in light G-Box majus 1005 - CACGTA responsiveness cis-acting regulatory element involved in light G-box Daucus carota 1005 + TACGTG responsiveness Arabidopsis ethylene-responsive GCC box thaliana 1108 - AGCCGCC element enhancer-like element involved in anoxic GC-motif Zea mays 288 + CCCCCG specific inducibility enhancer-like element involved in anoxic GC-motif Zea mays 332 + CCCCCG specific inducibility Arabidopsis HD-Zip 3 thaliana 1141 + GTAAT(G/C)ATTAC protein binding site cis-acting element involved in heat stress HSE Brassica oleracea 1352 - AGAAAATTCG responsiveness part of a light responsive I-box Flaveria trinervia 84 - GATATGG element part of a light responsive I-box Flaveria trinervia 1074 + GATATGG element part of a light responsive I-box Flaveria trinervia 1070 - cCATATCCAAT element cis-acting element involved in low- temperature LTR Hordeum vulgare 189 + CCGAAA responsiveness cis-acting regulatory element involved in zein O2-site Zea mays 84 - GATGATATGG metabolism regulation cis-acting regulatory element involved in zein O2-site Zea mays 216 - GATGACATGG metabolism regulation cis-acting regulatory Skn- element required for 1_motif Oryza sativa 1331 + GTCAT endosperm expression Sp1 Zea mays 48 + CC(G/A)CCC light responsive element Sp1 Zea mays 295 + CC(G/A)CCC light responsive element Sp1 Zea mays 121 + CC(G/A)CCC light responsive element Sp1 Zea mays 374 - CC(G/A)CCC light responsive element core promoter element Arabidopsis around -30 of TATA-box thaliana 54 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 70 + TATAAA transcription start

113

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). core promoter element Arabidopsis around -30 of TATA-box thaliana 263 - TATAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 264 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 271 - TATAAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 272 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 272 - TATAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 273 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 623 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 628 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 709 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 810 + TATAAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 819 - TATAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 820 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 834 - TATAAAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 835 - TATAAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 836 - TATAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 837 + TATA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 895 - TATAAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 896 - TATAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 897 + TATA transcription start

114

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). core promoter element Arabidopsis around -30 of TATA-box thaliana 1013 - TAAAGATT transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 1122 - TATAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 1123 + TATAAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 1148 - TAAAAATAA transcription start core promoter element Arabidopsis around -30 of TATA-box thaliana 1190 + TATTTAAA transcription start core promoter element around -30 of TATA-box Brassica napus 818 + ATTATA transcription start core promoter element around -30 of TATA-box Brassica oleracea 622 + ATATAAT transcription start core promoter element around -30 of TATA-box Brassica oleracea 69 + ATATAA transcription start core promoter element around -30 of TATA-box Glycine max 14 - TAATA transcription start core promoter element around -30 of TATA-box Glycine max 144 - TAATA transcription start core promoter element around -30 of TATA-box Glycine max 166 - TAATA transcription start core promoter element around -30 of TATA-box Glycine max 173 + TAATA transcription start core promoter element around -30 of TATA-box Glycine max 185 + TAATA transcription start core promoter element around -30 of TATA-box Glycine max 235 - TAATA transcription start core promoter element around -30 of TATA-box Glycine max 275 + TAATA transcription start core promoter element around -30 of TATA-box Glycine max 625 + TAATA transcription start core promoter element around -30 of TATA-box Glycine max 899 + TAATA transcription start core promoter element around -30 of TATA-box Glycine max 928 - TAATA transcription start core promoter element around -30 of TATA-box Glycine max 1187 + TAATA transcription start

115

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). core promoter element Lycopersicon around -30 of TATA-box esculentum 11 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 63 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 72 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 141 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 153 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 169 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 182 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 358 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 398 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 401 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 440 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 443 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 480 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 483 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 495 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 506 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 661 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 714 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 717 - TTTTA transcription start

116

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). core promoter element Lycopersicon around -30 of TATA-box esculentum 733 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 736 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 843 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 863 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 879 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 913 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 919 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 922 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 936 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 941 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1035 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1125 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1152 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1155 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1198 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1234 + TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1237 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1263 - TTTTA transcription start core promoter element Lycopersicon around -30 of TATA-box esculentum 1335 + TTTTA transcription start

117

Table A1. (continued) A database search of the PrAnth17 sequence using PlantCARE revealed the presence of regions involved in transcription regulation. (Rows highlighted in blue indicate sequences also found in PrSAG12 sequence). core promoter element Lycopersicon around -30 of TATA-box esculentum 1387 - TTTTA transcription start core promoter element around -30 of TATA-box Pisum sativum 833 - TATAAAAT transcription start core promoter element around -30 of TATA-box Zea mays 1151 - TTTAAAAA transcription start core promoter element around -30 of TATA-box Zea mays 1233 - TTTAAAAA transcription start cis-acting element involved in gibberellin- TATC-box Oryza sativa 704 - TATCCCA responsiveness cis-acting element TCA- Nicotiana involved in salicylic acid element tabacum 287 - CCATCTTTTT responsiveness Unnamed_ _1 Zea mays 1349 + CGTGG Unnamed_ _2 Zea mays 289 + CCCCGG Unnamed_ _2 Zea mays 333 + CCCCGG Unnamed_ _3 Zea mays 1349 + CGTGG Unnamed_ Petroselinum _4 hortense 1084 + CTCC Unnamed_ Petroselinum _4 hortense 1462 - CTCC Unnamed_ Petroselinum _4 hortense 1411 - CTCC Unnamed_ Petroselinum _4 hortense 1473 + CTCC Unnamed_ Petroselinum _4 hortense 24 + CTCC Unnamed_ Petroselinum _4 hortense 296 + CTCC Unnamed_ Petroselinum _4 hortense 230 + CTCC Unnamed_ Petroselinum _4 hortense 375 - CTCC Unnamed_ Petroselinum _4 hortense 107 + CTCC Unnamed_ Petroselinum _4 hortense 304 + CTCC Unnamed_ Petroselinum _4 hortense 256 + CTCC Unnamed_ Petroselinum _4 hortense 49 + CTCC Unnamed_ Petroselinum _4 hortense 126 + CTCC

118

Appendix B – Specific qPCR primers designed for the selected sequences

Table B1. qRT-PCR forward & reverse primers designed to amplify a fragment of the selected sequences. sequence protein name forward primer (5’-3’) reverse primer (5’-3’) identifier a41 ACC oxidase, ACO1, TGCAGTTGCTCAAGGACGGAG AGGCGATGGACATTCTGTT ACO2 AAT ACCGT a175 ERD9 (EARLY- AGCATGGCTTGCTTGCTAAGAT TGAAAGGAGACCGCAGGA RESPONSIVE TO CG GTTTCA DEHYDRATION 9) a218 callus protein P23 AATGCAAACACCAAGCTCCCAT TGACTCCCAAGTTGGATGC (translationally- CG TGAGA controlled tumor protein-like protein) a415 chitinase; glycoside CGGGCCGTAGTTGAAGTTGTA TTCAAAGAAGAGCAAGGC hydrolase family 19 TGA AACCCG protein a489 dormancy/auxin AGATCTGCGAAACCCTTGCTCA AAGGTGGAGTACTTGCGG associated protein GT AGCTTT a650 glutamate AACCCAAGTGGCCTGGATATTC CTTGGCCTTCACATCAGCA dehydrogenase CT GCATT a675 fructose-bisphosphate AGAGAGGAACATGATGCCAGG TCTACATGGCCGAGAACAA aldolase AAC CGTGA a717 light-harvesting complex ATGTTGGACCCAAGTCCTGCTA TGTCAGAAGAGCTGACTG I chlorophyll a/b binding CT CTGCAT protein a719 protein translation factor TGCGCACATGCACATACTCTTT TCAGCACTCGAGCAACTGA SUI1 GG TTGGA a1073 TONOPLAST AACATTGGCGATTCTGATGCCC AGTCTGATGGCACCGTAG DICARBOXYLATE AC ACGAAA TRANSPORTER (TDT) ACCCGATTCAAGGCTGAATACC GCATAGCGATCCACAACAT a1111 glutathione peroxidase CT TGCCT a1199 PSBP-1 (PHOTOSYSTEM AAGCTCTACATCTGCAAAGCGC TGGCAGTCCTGGCATGTAA II SUBUNIT P-1) AG CT GTTCTGTCATCATCCAGCTGCT AAGGAGTCCACCCTCCATC a3211 ubiquitin 13 TC TTGTT TGGCAATAACGTGCTTGTGTGT AACCGATTCGACCCGATCT a7025 esterase/lipase GG AAGCA a9173 xyloglucan TGTGTTCTCGGTGGATGCGGT TGTCGAAGTCCTTGTAGTA endotransglucosylase/hy AAT GGCGT drolase protein AGGTATGACGTGCCATCGTGA AAAGGCCACTGTAAGCAAC a9943 phospholipase C GAA TCGTG

119

LITERATURE CITED

Abreu E. & Munné-Bosch S. (2008). Salicylic acid may be involved in the regulation

of drought-induced leaf senescence in perennials: A case study in field-grown

Salvia officinalis L. plants. Environmental and Experimental Botany 64(2),

105–112.

Aharoni N. & Richmond A. (1978). Endogenous gibberellin and abscisic acid content

as related to senescence of detached lettuce leaves. Plant Physiol. 62(2),

224-228.

Ali S. & Bano A. (2008). Leaf and nodule senescence in chickpea (Cicer arietinum L.)

and the role of plant growth regulators. Pakistan Journal of Botany 40(6),

2841-2492.

Allison L.A. (2007). Fundamental Molecular Biology. John Wiley & Sons.

Aloni R., Langhans M., Aloni E. & Ullrich C. (2004). Role of cytokinin in the

regulation of root gravitropism. Planta 220, 177-182.

Amasino R., Powell A. & Gordon M. (1984). Changes in T-DNA methylation and

expression are associated with phenotypic variation and plant regeneration in

a crown gall tumor line. Molecular and General Genetics MGG 197(3), 437-

446.

Amir-Shapira D., Goldschmidt E. & Altman A. (1987). Chlorophyll catabolism in

senescing plant tissues; In vivo breakdown intermediates suggest different

degradative pathways for Citrus fruit and parsley leaves. Proc. Natl. Acad. Sci.

USA 84, 1901-1905.

120

Arbona V. & Gómez-Cadenas A. (2008). Hormonal modulation of citrus responses to

flooding. Journal of Plant Growth Regulation 27(3), 241-250.

Aro E-M., Virgin I. & Andersson B. (1993). Photoinhibition of photosystem II.

Inactivation, protein damage and turnover. Biochim. Biophys. Acta 1143,

113-134.

Ay N., Clauss K., Barth O. & Humbeck K. (2008). Identification and characterization

of novel senescence-associated genes from barley (Hordeum vulgare) primary

leaves. Plant Biology 10(s1), 121-135.

Ayub R., Guis M., Ben Amor M., Gillot L., Roustan J-P., Latché A., Bouzayen M. &

Pech J-C. (1996). Expression of ACC oxidase antisense gene inhibits ripening

of cantaloupe melon fruits. Nature Biotechnology 14, 862-866.

Barry G.F., Rogers S.G., Fraley R.T. & Brand L. (1984). Identification of a cloned

cytokinin biosynthetic gene. Proc. Natl. Acad. Sci. USA 81, 4776-4780.

Belknap W.R. & Garbarino J.E. (1996). The role of ubiquitin in plant senescence and

stress responses. Trends in Plant Science 1(10), 331-335.

Bewley D.J. (1997). Seed germination and dormancy. Plant Cell 9(7), 1055–1066.

Bhat S. & Srinivasan S. (2002). Molecular and genetic analyses of transgenic plants:

considerations and approaches. Plant Science 163, 673-681.

Blochlinger K. & Diggelmann H. (1984). Hygromycin B phosphotransferase as a

selectable marker for DNA transfer experiments with higher eucaryotic cells.

Mol. Cell. Biol. 4(12), 2929-2931.

121

Boisson M., Gomord V., Audran C., Berger N., Dubreucq B., Granier F., Lerouge P.,

Faye L., Caboche M. & Lepiniec L. (2001). Arabidopsis glucosidase I mutants

reveal a critical role of N-glycan trimming in seed development. The EMBO

Journal 20, 1010 – 1019.

Bown D. (2000). Aroids: Plants of the Arum Family 2nd edition. Portland OR, Timber

Press, Inc.

Brady C.J. (1988). Nucleic acid and protein synthesis. Senescence and Aging in

Plants. L. Nooden and A. Leopold. San Diego CA, Academic Press, 147-179.

Bressan R.A., Zhang C., Zhang H., Hasegawa P.M., Bohnert H. J. & Zhu J.K. (2001).

Learning from the Arabidopsis experience: the next gene search paradigm.

Plant Physiology 127, 1354–1360.

Broglie K., Biddle P., Cressman R. & Broglie R. (1989). Functional analysis of DNA

sequences responsible for ethylene regulation of a bean chitinase gene in

tobacco. Plant Cell 1, 599-607.

Brosnan C.A., Mitter N., Christie M., Smith N.A., Waterhouse P.M. & Carroll B.J.

(2007). Nuclear gene silencing directs reception of long-distance mRNA

silencing in Arabidopsis. PNAS 104, 14741–14746.

Buchanan-Wollaston V., Earl S., Harrison E., Mathas E., Navabpour S., Page T. &

Pink D. (2003). The molecular analysis of leaf senescence – a genomics

approach. Plant Biotechnology Journal 1, 3–22.

Buchanan-Wollaston V., Page T., Harrison E., Breeze E., Lim P.O., Nam H.G., Lin

J.F., Wu S.H., Swidzinski J., Ishizaki K., & Leaver C.J. (2005). Comparative

transcriptome analysis reveals significant differences in gene expression and

122

signalling pathways between developmental and dark/starvation-induced

senescence in Arabidopsis. The Plant Journal 42, 567-585.

Bustamante C., Civello P. & Martínez G. (2009). Cloning of the promoter region of β-

xylosidase (FaXyl1) gene and effect of plant growth regulators on the

expression of FaXyl1 in strawberry fruit. Plant Science 177(1), 49–56.

Calderini O., Bovone T., Scotti C., Pupilli F., Piano E. & Arcioni S. (2007). Delay of

leaf senescence in Medicago sativa transformed with the ipt gene controlled

by the senescence-specific promoter SAG12. Plant Cell Reports 26(5), 611-

615.

Carimi F., Terzi M., De Michele R., Zottini M. & Lo Schiavo F. (2004). High levels of

the cytokinin BAP induce PCD by accelerating senescence. Plant Science 166,

963-969.

Cercos M., Santamaria S. & Carbonell J. (1999). Cloning and characterization of

TPE4A, a thiol-protease gene induced during ovary senescence and seed

germination in pea. Plant Physiology 119, 1341-1348.

Chaitanya K.S.K. & Naithani S.C. (1994). Role of superoxide, lipid peroxidation and

superoxide dismutase in membrane perturbation during loss of viability in

seeds of Shorea robusta Gaertn.f. New Phytologist 126, 623–627.

doi: 10.1111/j.1469-8137.1994.tb02957.x

Champagne M.M. & Kuehnle A.R. (2000). An effective method for isolating RNA from

tissues of Dendrobium. Lindleyana 15, 165-168.

123

Chandler P. & Robertson M. (1994). Gene expression regulated by abscisic acid and

its relation to stress tolerance. Annual Review of Plant Physiology and Plant

Molecular Biology 45, 113-141.

Chang H., Jones M.L., Banowetz G.M. & Clark D.G. (2003). Overproduction of

cytokinins in petunia flowers transformed with P(SAG12)-IPT delays corolla

senescence and decreases sensitivity to ethylene. Plant Physiol 132(4), 2174-

83.

Chen F.C. & Kuehnle A.R. (1996). Obtaining transgenic Anthurium through

Agrobacterium-mediated transformation of etiolated internodes. Journal of

the American Society of Horticultural Science 121, 47-51.

Chen G.H., Huang L.T., Yap M.N., Lee R.H., Huang Y.J., Cheng M.C. & Chen, S.C.G.

(2002). Molecular characterization of a senescence-associated gene encoding

cysteine proteinase and its gene expression during leaf senescence in sweet

potato. Plant and Cell Physiology 43(9), 984-991.

Chen H.J., Huang G.J., Chen W.S., Su C.T., Hou W.C. & Lin Y.H. (2009). Molecular

cloning and expression of a sweet potato cysteine protease SPCP1 from

senescent leaves. Botanical Studies 50(2), 159-170.

Chen L.F.O., Hwang J.Y., Charng Y.Y., Sun C.W. & Yang S.F. (2001). Transformation

of broccoli (Brassica oleracea var. italica) with isopentenyltransferase gene

via Agrobacterium tumefaciens for post-harvest yellowing retardation.

Molecular Breeding: new strategies in plant improvement 7(3), 243-257.

124

Chi G., Goh H.K.L., Hoo K. & Legavre T. (1998). Gus gene expression in Anthurium

andreanum, Oncidium Gower Ramsey and Brassolaeliocattleya Orange Glory

Empress after particle bombardment. Acta Hort. (ISHS) 461, 379-384.

Christopher D.A. & Mullet J.E. (1994). Separate photosensory pathways co-regulate

blue light/ultraviolet-A-activated psbD-psbC transcription and light-induced

D2 and CP43 degradation in barley (Hordeum vulgare) chloroplasts. Plant

Physiol. 104, 1119-1129.

Chytilova E., Macas J. & Galbraith D. (1999). Green fluorescent protein targeted to

the nucleus, a transgenic phenotype useful for studies in plant biology. Annals

of Botany 83, 645-654.

Clark D., Dervinis C., Barrett J., Klee H. & Jones M. (2004). Drought-induced leaf

senescence and horticultural performance of transgenic PSAG12-IPT petunias. J.

Amer. Soc. Hort. Sci. 129(1), 93-99.

Clough S. J. & Bent A. F. (1998). Floral dip: a simplified method for Agrobacterium-

mediated transformation of Arabidopsis thaliana. The Plant Journal 16, 735–

743.

Cocking E.C. (1960). A Method for the isolation of plant protoplasts and vacuoles.

Nature 187, 962 – 963.

Cocking E.C. (1972). Plant cell protoplasts-isolation and development. Annual Review

of Plant Physiology (23), 29-50.

Costa G. & Weiner M. (1994). Polishing with T4 or Pfu polymerase increases the

efficiency of cloning of PCR fragments. Nucleic Acids Research 22(12), 2423.

125

Costa V., Angelini C., De Feis I. & Ciccodicola A. (2010). Uncovering the complexity

of transcriptomes with RNA-Seq. Journal of Biomedicine and Biotechnology.

Hindawi Publishing Corporation, Volume 2010, Article ID 853916, 19 pages.

doi:10.1155/2010/853916

Crafts-Brandner S.J., Salvucci M.E. & Egli D.B. (1990). Changes in ribulose

bisphosphate carboxylase/oxygenase and ribulose 5-phosphate kinase

abundances and photosynthetic capacty during leaf senescence. Photosyn.

Res. 23, 223-230.

Dai J. & Paull R. (1990). The role of leaf development on Anthurium flower growth. J.

Amer. Soc. Hort. Sci. 115(6), 901-905.

Daum H. & Seville M. (2002). The ToolBox: Cutting back on UV damage. Modern

Drug Discovery 5, 18-24.

De Beer A. & Vivier M.A. (2008). Vv-AMP1, a ripening induced peptide from Vitis

vinifera shows strong antifungal activity. Plant Biology 8, 75.

Dean C., Jones J., Favreau M., Dunsmuir P. & Bedbrook J. (1988). Influence of

flanking sequences on variability in expression levels of an introduced gene in

transgenic tobacco plants. Nucleic Acids Research 16 (19), 9267-9283.

Deikman J. & Fischer R. (1988). Interaction of a DNA binding factor with the 5'-

flanking region of an ethylene-responsive fruit ripening gene from tomato.

EMBO Journal 7, 3315-3320.

Derbyshire E., Wright D.J. & Boulter D. (1976). Legumin and vicilin, storage proteins

of legume seeds. Phytochemistry 15, 3–24.

126

Di R., Purcell V., Collins G.B. & Ghabrial S.A. (1996). Production of transgenic

soybean lines expressing the bean pod mottle virus coat protein precursor

gene. Plant Cell Rep 15, 746-750.

Drøbak B. K., Watkins P. A.C., Valenta R., Dove S. K., Lloyd C. W. & Staiger, C. J.

(1994). Inhibition of plant plasma membrane phosphoinositide phospholipase

C by the actin-binding protein, profilin. The Plant Journal, 6: 389–400.

Droillard M.J., Bate N.J., Rothstein S.J. & Thompson J.E. (1992). Active translation of

the D1 protein of photosystem II in senescing leaves. Plant Physiology 99,

589-594.

Dufour L. & Guerin V. (2003). Growth, developmental features and flower production

of Anthurium andreanum Lind. in tropical conditions. Scientia Horticulturae 98,

25–35.

Düggelin M.J., Bortlik K., Gut H., Matile P. & Thomas H. (1988). Leaf senescence in

Festuca pratensis: accumulation of lipofuscin-like compounds. Physiolog. Plant.

74, 131-136.

Elliott A.R., Campbell J.A., Dugdale B., Brettell R.I.S. & Grof C.P.L. (1999). Green-

fluorescent protein facilitates rapid in vivo detection of genetically

transformed plant cells. Plant cell reports 18(9), 707-714.

Espinoza C., Medina C., Somerville S. & Arce-Johnson P. (2007). Senescence-

associated genes induced during compatible viral interactions with grapevine

and Arabidopsis. Journal of Experimental Botany 58(12), 3197-3212.

127

Fang R-X., Nagy F., Sivasubramaniam S., & Chua N-H. (1989). Multiple cis

regulatory elements for maximal expression of the cauliflower mosaic virus

35S promoter in transgenic plants. The Plant Cell 1, 141-150.

Farrant J.M., Pammenter N.W. & Berjak P. (1988). Recalcitrance - a current

assessment. Seed Science & Technology 16, 155-156.

Ferguson I.B., Watkins C.B. & Harman J.R. (1983). Inhibition by calcium of

senescence of detached cucumber cotyledons. Plant Physiology 71, 182-186.

Fei H., Tsang E. & Cutler A. (2007). Gene expression during seed maturation in

Brassica napus in relation to the induction of secondary dormancy. Genomics

89(3), 419–428.

Fitch M., Leong T., He X., McCafferty H., Zhu Y., Moore P., Gonsalves D., Aldwinckle

H. & Atkinson H. (2011). Improved transformation of Anthurium. HortScience

46(3), 358–364.

Flores H., Dai Y-R., Cuello J., Maldonado-Mendoza I. & Loyola-Vargas V. (1993).

Green roots: photosynthesis and photoautotrophy in an underground plant

organ. Plant Physiol. 101, 363-371.

Fu Y., Ding Y., Liu X., Sun C., Cao S., Wang D., He S., Wang X., Li L. & Tian W.

(1998). Rice transformation with a senescence-inhibition chimeric gene.

Chinese Science Bulletin 43, 1810-1815.

Galun E. (1981). Plant protoplasts as physiological tools. Annual Review of Plant

Physiology 32, 237-266.

Gan S. & Amasino R. (1995). Inhibition of leaf senescence by autoregulated

production of cytokinin. Science 270, 1986-1988.

128

Gapper N.E., McKenzie M.J., Christey M.C., Braun R.H., Coupe S.A., Lill R.E. &

Jameson P.E. (2002). Agrobacterium tumefaciens-mediated transformation to

alter ethylene and cytokinin biosynthesis in broccoli. Plant Cell, Tissue and

Organ Culture 70, 41–50.

Gassmann M. & Ramanujam P. (1986). Relation between destruction of magnesium

porphyrins and chloroplast development. Akoyuniglou G. & Senger H.

Regulation of Chloroplast Differentiation. New York, AL. Liss, p. 115-123.

Gelvin S. (2008). Agrobacterium-mediated DNA transfer, and then some. Nature

Biotechnology 26(9), 998-1000.

Genua J. & Hillson C. (1985). The occurrence, type and location of calcium oxalate

crystals in the leaves of fourteen species of Araceae. Ann Bot 56(3), 351-361.

Gheysen G., Van Montagu M. & Zambryski P. (1987). Integration of Agrobacterium

tumefaciens transfer DNA (T-DNA) involves rearrangements of target plant

DNA sequences. Proc. Nadl. Acad. Sci. USA 84, 6169-6173.

Gilbart D. & Sink K. (1971). Regulation of endogenous indoleacetic acid and keeping

quality of poinsettia. Journal of American Society of Horticultural Science 96,

3-7.

Guo J., Hu X. & Duan R. (2005). Interactive effects of cytokinins, light and sucrose

on the phenotypes and the syntheses of anthocynanins and lignins in

cytokinin overproducing transgenic Arabidopsis. Journal of Plant Growth

Regulation 24, 93-101.

129

Grotewold E., Chamberlin M., Snook M., Siame B., Butler L., Swenson J., Maddock S.,

St. Clair G. & Bowen B. (1998). Engineering secondary metabolism in maize

cells by ectopic expression of transcription factors. The Plant Cell 10, 721–740.

Grudkowska M. & Zagdanska B. (2004). Multifunctional role of plant cysteine

proteinases. Acta Biochimica Polonica 51(3), 609-624.

Hajlaouia H., El Ayebb N., Garrecc J. & Denden M. (2010). Differential effects of salt

stress on osmotic adjustment and solutes allocation on the basis of root and

leaf tissue senescence of two silage maize (Zea mays L.) varieties. Industrial

Crops and Products 31(1), 122–130.

Halevy A. & Mayak S. (1981). Senescence and postharvest physiology of cut flowers.

Horticultural Review 3, 59-143.

Halweg C., Thompson W.F. & Spiker S. (2005). The Rb7 matrix attachment region

increases the likelihood and magnitude of transgene expression in tobacco

cells: a flow cytometric study. The Plant Cell 17, 418-429.

Hara-Nishimura I., Shimada T., Hiraiwa N. & Nishimura M. (1995). Vacuolar

processing enzyme responsible for maturation of seed proteins. J. Plant

Physiol. 145, 632-640.

Haseloff J., Siemering K.R., Prasher D.C. & Hodge S. (1997). Removal of a cryptic

intron and subcellular localization of green fluorescent protein are required to

mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. USA 94,

2122–2127.

Haseloff J. (1999). GFP variants for multispectral imaging of living cells. Methods Cell

Biol. 58, 139-51.

130

Haseloff J., Dormand E.L. & Brand A.H. (1999). Live imaging with green ﬂuorescent

protein. Methods Mol Biol 122, 241–259.

Hassanein R.A., El-din A.B., Salama M. & Hashem H. (2009). Role of jasmonic acid

and abscisic acid treatments in alleviating the adverse effects of drought

stress and regulating trypsin inhibitor production in soybean plant. Australian

Journal of Basic and Applied Sciences 3(2), 904-919.

Haughn G. & Chaudhury A. (2005). Genetic analysis of seed coat development in

Arabidopsis. TRENDS in Plant Science 10(10), 472-477.

Hawker N.P. & Bowman J.L. (2004). Roles for class III HD-Zip and KANADI genes in

Arabidopsis root development. Plant Physiology 135(4), 261-2270.

Hayden D. (2003). Characterization of senescence regulated gene expression in

anthurium. Ph.D. Thesis. University of Hawaii at Manoa, USA.

Hayden D. & Christopher D. (2004). Characterization of senescence-associated gene

expression and senescence-dependent and –independent cysteine proteases

differing in microsomal processing in Anthurium. Plant Science 166, 779-790.

Heiman M. (1997). "Webcutter 2.0." Webcutter 2.0. Web.

Hellens R. & Mullineaux P. (2000). A guide to Agrobacterium binary Ti vectors.

Trends in Plant Science 5(10), 446-451.

Hendry G.A.F., Finch-Savage W.E., Thorpe P.C., Atherton N.M., Buckland S. M.,

Nilsson K.A. & Seel W.E. (1992). Free radical processes and loss of seed

viability during desiccation in the recalcitrant species Quercus robur L. New

Phytologist 122, 273–279. doi: 10.1111/j.1469-8137.1992.tb04231.x

131

Hewelt A., Prinsen E., Schell J., Van Onckelen H. & Schmulling T. (1994). Promoter

tagging with a promoterless ipt gene leads to cytokinininduced phenotypic

variability in transgenic tobacco plants: implications of gene dosage effects.

Plant Journal 6, 879–891.

Higaki T., Rasmussen H.P. & Carpenter W.J. (1984). A study of some morphological

and anatomical aspects of Anthurium andreanum Lind. Hawaii Institute of

Tropical Agriculture and Human Resources Research series 30, College of

Tropical Agriculture and Human Resources, University of Hawaii.

Higaki T., Watson D. & Leonhardt K. (1985). Anthurium culture in Hawaii.

C.T.A.H.R.-U.H. Manoa.

Higaki T., Lichty J. & Moniz D. (1995). Anthurium culture in Hawaii. Research

extension series 152, HITAHR, CTAHR, UH Manoa.

Hinchee M.A.W., Connor-Ward D.V., Newell C.A., McDonnell R.E., Sato S.J., Gasser

C.S., Fischhoff D.A., Re D.B., Fraley R.T. & Horsch R.B. (1988). Production of

transgenic soybean plants using Agrobacterium-mediated DNA transfer.

Bio/Technology 6, 915–922.

Holsters M., Waele D., Depicker A., Montagu M. & Schell J. (1978). Transfection and

transformation of Agrobacterium tumefaciens. Molecular and General Genetics

163, 181-187.

Hurth M., Suh S-J., Kretzschmar T., Geis T., Bregante M., Gambale F., Martinoia E.,

and Neuhaus H.E. (2005). Impaired pH homeostasis in Arabidopsis lacking

the vacuolar dicarboxylate transporter and analysis of carboxylic acid

transport across the tonoplast. Plant Physiology 137, 901–910.

132

Hutzler P., Fischbach R., Heller W., Jungblut T., Reuber S., Schmitz R., Veit M.,

Weissenbock G. & Schnitzler J. (1998). Tissue localization of phenolic

compounds in plants by confocal laser scanning microscopy. Journal of

Experimental Botany 49(323), 953–965.

Huynh L.N., VanToai T., Streeter J. & Banowetz G. (2005). Regulation of flooding

tolerance of SAG12:ipt Arabidopsis plants by cytokinin. J. Exp. Bot. 56(415),

1397-1407.

Ilegems M., Douet V., Meylan-Bettex M., Uyttewaal M., Brand L., Bowman J.L.

& Stieger P.A. (2010). Interplay of auxin, KANADI and Class III HD-ZIP

transcription factors in vascular tissue formation. Development 137(6), 975-

84.

Iordachescu M., Bowman H., Sasaki K., Imai R., Satoh S. & Verlinden S. (2009).

Subcellular localization and changes in mRNA abundance of CEBP, a nuclear-

encoded chloroplast protein, during flower development and senescence.

Journal of Plant Biology 52(5), 365-373.

Itzhaki H., Maxson J. & Woodson W. (1994). An ethylene-responsive enhancer

element is involved in the senescence-related expression of the carnation

glutathione-Stransferase (GSTI) gene. Proc. Nadl. Acad. Sci. USA 91, 8925-

8929.

Jaiswal R., Nain V., Abdin M. & Kumar P. (2007). Isolation of pigeon pea (Cajanus

cajan L.) legumin gene promoter and identification of conserved regulatory

elements using tools of bioinformatics. Indian Journal of Biotechnology 6,

495-503.

133

Jenkins G. & Woolhouse H.W. (1981). Photosynthetic electron transport during

senescence of the primary leaves of Phaseolus vulgaris L. J. Exp. Bot. 32,

467-478.

Jones M.L. & Banowetz G.M. (2003). Elevated cytokinin levels in SAG12-IPT petunias

delay flower senescence and decrease sensitivity to ethylene. American

Society for Horticultural Science (Abstract only submission).

Judd W.S., Campbell C.S., Kellog E.A., Stevens P.F. & Donoghue M.J. (2002). Plant

Systematics: A Phylogenetic Approach, 2nd Edition. Sunderland MA, Sinauer

Associates Inc., 244.

Jyothishwaran G., Kotresha D., Selvaraj T., Srideshika, S.M., Rajvanshi P.K. &

Jayabaskaran C. (2007). A modified freeze-thaw method for efficient

transformation of Agrobacterium tumefaciens. Current Science 93(6), 770-

772.

Kamemoto H. & Kuehnle A. (1996). Breeding anthuriums in Hawaii. Honolulu HI,

University of Hawaiʻi Press.

Kang J., Choi H., Im M. & Kim S.Y. (2002). Arabidopsis basic leucine zipper proteins

that mediate stress-responsive abscisic acid signaling. The Plant Cell 14, 343-

357.

Kariola T., Brader G., Helenius E., Li J., Heino P. & Palva E.T. (2006). EARLY

RESPONSIVE TO DEHYDRATION 15, a negative regulator of abscisic acid

responses in arabidopsis. Plant Physiology 142(4), 1559-1573.

Kasprzewska A. (2003). Plant chitinases – regulation and function. Cellular &

Molecular Biology Letters 8, 809 – 824.

134

Kelly J. & Darlington G. (1987). Hybrid genes: molecular approaches to tissue-

specific gene regulation. Ann. Rev. Genet. 19, 273-96.

Kende H. (1993). Ethylene biosynthesis. Annual Review of Plant Physiology and Plant

Molecular Biology 44, 283-307.

Khaithong T., Sipes B.S. & Kuehnle A.R. (2007) Transgenic Anthurium andraeanum

expressing modified rice cysteine protease inhibitor and resistance to

Radopholus similis. In: Society of Nematologists 46th Annual Meeting, San

Diego, California, July 28-August 1, 2007. Journal of Nematology 39(1), 99-

100.

Khaithong T. (2007). Transgenic expression of proteinase inhibitors and resistance to

migratory endoparasitic nematodes. Ph.D.Thesis. University of Hawai'i at

Manoa, USA.

Kim W. & Okita T. (1988). Structure, expression, and heterogeneity of the rice seed

prolamines. Plant Physiol. 88, 649-655.

Kiyosue T., Yamaguchi-Shinozaki K. & Shinozaki K. (1994). Cloning of cDNAs for

genes that are early-responsive to dehydration stress (ERDs) in Arabidopsis

thaliana L.: identification of three ERDs as HSP cognate genes. Plant

Molecular Biology 25(5), 791-798.

Klink V.P., Kim K.H., Martins V., MacDonald M.H., Beard H.S., Alkharouf N.W., Lee

S.K., Park S.C., Matthews B.F. (2009) A correlation between host-mediated

expression of parasite genes as tandem inverted repeats and abrogation of

development of female Heterodera glycines cyst formation during infection of

Glycine max. Planta 230(1), 53-71.

135

Konishi H., Yamane H., Maeshima M. & Komatsu S. (2004). Characterization of

fructose-bisphosphate aldolase regulated by gibberellin in roots of rice

seedling. Plant Molecular Biology 56(6), 839-848.

Krishnan H. & Okita T. (1986). Structural relationship among the rice glutelin

polypeptides. Plant Physiol 81: 748-753.

Krupinska K. & Falk J. (1994). Changes in RNA polymerase activity during

biogenesis, maturation and senescence of barley chloroplasts. Comparative

analysis of transcripts synthesized either in run-on assays or by

transcriptionally active chromosomes. J of Plant Physiol 143:298-305.

Kuderova A., Urbankova I., Valkova M., Malbeck J., Brzobohaty B., Nemethova D. &

Hejatko J. (2008). Effects of conditional IPT-dependent cytokinin

overproduction on root architecture of arabidopsis seedlings. Plant Cell Physiol.

49(4), 570–582.

Kuehnle A.R., Chen F.C. & Sugii N.C. (2001). Transgenic Anthurium. Y. Bajaj.

Biotechnology in Agriculture and Forestry. Berlin, Springer-Verlag, 379.

Kumar N., Srivastava G.C. & Dixit K. (2008). Hormonal regulation of flower

senescence in roses (Rosa hybrida L.). Plant Growth Regulation 55, 65-71.

Kumar G., Mamidala P. & Podile A. (2009). Regulation of Polygalacturonase-

inhibitory proteins in plants is highly dependent on stress and light responsive

elements. Plant Omics Journal 2(6), 238-249.

Laemmli U.K. (1970). Cleavage of structural proteins during the assembly of the

head of bacteriophage T4. Nature 227, 680 – 685.

136

Lalonde L. & Dhindsa R.S. (1990). Altered protein synthesis during in situ oat leaf

senescence. Physiol. Plant 80, 619-623.

Larkin P.J. (1976). Purification and viability determinations of plant protoplasts.

Planta 128(3), 213-216.

Leary J., Brigati D. & Ward D. (1983). Rapid and sensitive colorimetric method for

visualizing biotinlabeled DNA probes hybridized to DNA or RNA immobilized on

nitrocellulose: Bio-blots. Proc. Natl Acad. Sci. USA 80, 4045-4049.

Lee R.H., Wang C.H., Huang L.T. & Chen S.C.G. (2001). Leaf senescence in rice

plants: cloning and characterization of senescence up-regulated genes.

Journal of Experimental Botany 52(358), 1117-1121.

Leshem Y., Halevy A. & Frenkel C. (1986). Processes and Control of Plant

Senescence. Vol. 8. Elsevier Science Publishers.

Leshem Y. (1992). Plant membranes: a biophysical approach to structure,

development and senescence. Dordrecht, The Netherlands, Kluwer Academic

Publishers, 266.

Li X., Mo X., Shou H. & Wu P. (2006). Cytokinin-mediated cell cycling arrest of

pericycle founder cells in lateral root initiation of Arabidopsis. Plant Cell

Physiol 47, 1112–1123.

Lieberman M. (1979). Biosynthesis and action of ethylene. Ann Rev Plant Physiol 30,

533-591.

Lim P.O., Woo H.R. & Nam H.G. (2003). Molecular genetics of leaf senescence in

Arabidopsis. TRENDS in Plant Science 8(6), 272-278.

137

Lim P.O. & Nam H.G. (2005). The molecular and genetic control of leaf senescence

and longevity in Arabidopsis. Current Topics in Developmental Biology 67, 49-

83.

Lim P-O., Kim H-J., & Nam H-G. (2007). Leaf Senescence. Annu. Rev. Plant Biol. 58,

115–36.

Lin Y.J., Cao M.L., Xu C.G., Chen H., Wei J. & Zhang Q.F. (2002). Cultivating rice

with delaying leaf- senescence by PSAG12-ipt gene transformation. Acta Bot

Sin 44, 1333–1338.

Lipton W.J. (1987). Senescence of leafy vegetables. HortSci. 22(5), 854-859.

Livak K. & Schmittgen T. (2001). Analysis of relative gene expression data using

real-time quantitative PCR and the 2−ΔΔCT method. Methods 25(4), 402–408.

Logemann E. & Hahlbrock K. (2002). Crosstalk among stress responses in plants:

Pathogen defense overrides UV protection through an inversely regulated

ACEACE type of light-responsive gene promoter unit. PNAS 99(4), 2428 –

2432.

Lohman K., Gan S., John M. & Amasino R. (1994). Molecular analysis of natural leaf

senescence in Arabidopsis thaliana. Physiol Plantarum 92, 322-328.

Lu J., Sivamani E., Li X. & Qu R. (2008). Activity of the 5' regulatory regions of the

rice polyubiquitin rubi3 gene in transgenic rice plants as analyzed by both

GUS and GFP reporter genes. Plant Cell Rep 27, 1587–1600.

Lubec G., Afjehi-Sadat L., Yang J-W. & John J.P.P. (2005).Searching for hypothetical

proteins: Theory and practice based upon original data and literature.

Progress in Neurobiology 77, 90–127.

138

Lundberg K., Shoemaker D., Adams M., Short J., Sorge J. & Mathur E. (1991). High-

fidelity amplification using a thermostable DNApolymerase isolated from

Pyrococcus furiosus. Gene 108(1), 1–6

Ma Q.H. (2008). Genetic engineering of cytokinins and their application to agriculture.

Critical Reviews in Biotechnology 28: 213-232.

Makino A., Mae T. & Ohira K. (1983). Photosynthesis and ribulose-1,5-bisphosphate

carboxylase in rice leaves. Changes in photosynthesis and enzymes involved

in carbon assimilation from leaf development through senescence. Plant

Physiol. 73: 1002-1007.

Mankin S.L. & Thompson W.F. (2001). New green fluorescent protein genes for plant

transformation: intron-containing, ER-localized, and soluble-modified. Plant

Molecular Biology Reporter 19(1), 13-26.

Mardis E. (2008). The impact of next-generationsequencing technology on genetics.

Trends in Genetics 24(3), 133–141.

Matile P. (1992). Chloroplast senescence. Baker N & Thomas H. Crop photosynthesis

spatial and temporal determinants. Amsterdam, Elsevier, 413-440.

Matsumoto T., Kuehnle A. & Webb D. (1998). Zygotic embryogenesis in Anthurium

(Araceae). American Journal of Botany 85(11), 1560–1568.

Mattoo A.K. & Aharoni N. (1988). Ethylene and plant senescence. L. Nooden & A.

Leopold. Senescence and aging in plants. San Diego CA, Academic Press, Inc.,

241-280.

Mattoo A.K., Marder J.B. & Edelman M. (1989). Dynamics of the photosystem II

reaction center. Cell 56, 241-246.

139

Mauch-Mani B. & Mauch F. (2005). The role of abscisic acid in plant–pathogen

interactions. Current Opinion in Plant Biology 8(4), 409–414.

Mayak S. & Halevy A. (1970). Cytokinin activity in rose petals and its relation to

senescence. Plant Physiol. 46(4), 497–499.

Mayfield S.P., Yohn C.B., Cohen A. & Danon A. (1995). Regulation of chloroplast

gene expression. Annu Rev Plant Physiol Plant Mol Biol 46, 147-166.

McCabe M., Garratt L., Schepers F., Jordi W., Stoopen G., Davelaar E., van Rhijn J.H.,

Power J.B. & Davey M. (2001). Effects of PSAG12-IPT gene expression on

development and senescence in transgenic lettuce. Plant Physiology 127,

505-516.

McGaw B,A. (1987). “Cytokinin metabolism”. R. Horgan & B. Jeffcoat. Cytokinins –

Plant hormones in search of a role, Monograph 14. Bristol, British Plant

Growth Regulator Group, 9-17.

McNellis T., Mudgett M., Li K., Aoyama T., Horvath D., Chua N-H. & Staskawicz B.

(1998). Glucocorticoid-inducible expression of a bacterial avirulence gene in

transgenic Arabidopsis induces hypersensitive cell death. The Plant Journal

14(2), 247-257.

Medford J.I., Horgan R.H., El-Sawi Z. & Klee, H.J. (1989). Alterations of endogenous

cytokinins in transgenic plants using a chimeric isopentenyl transferase gene.

Plant Cell 1, 403–413.

Melis A. (1991). Dynamics of photosynthetic membrane composition and function.

Biochim. Biophys. Acta. 1058, 87-106.

140

Merewitz B., Gianfagna T. & Huang B. (2010). Effects of SAG12-ipt and HSP18.2-ipt

expression on cytokinin production, root growth, and leaf senescence in

creeping bentgrass exposed to drought stress. J. Amer. Soc. Hort. Sci. 135(3),

230–239.

Meyer P., Linn F., Heidmann I., Meyer H., Niedenhof I. & Saedler H. (1992).

Endogenous and environmental factors influence 35S promoter methylation of

a maize A1 gene construct in transgenic petunia and its colour phenotype.

Molecular and General Genetics MGG 231(3), 345-352.

Milla M. A. R., Maurer A., Huete A. R. & Gustafson J. P. (2003). Glutathione

peroxidase genes in Arabidopsis are ubiquitous and regulated by abiotic

stresses through diverse signaling pathways. The Plant Journal 36(5), 602–

615.

Misr A. & Meena M. (1986). Effect of temperature on senescing detached rice leaves:

I. photoelectron transport activity of chloroplasts. Plant Science 46, 1-4.

Montgomery J., Goldman S., Deikman J., Margossian L. & Fischer R. (1993).

Identification of an ethylene-responsive region in the promoter of a fruit

ripening gene. PNAS 90, 5939-5943.

Morita K. (1980). Release of nitrogen from chloroplasts during leaf senescence in rice

(Oryza sativa L.). Annal. Botany 46, 297-302.

Morris K., MacKerness S.A., Page T., John C.F., Murphy A.M., Carr J.P. & Buchanan-

Wollaston V. (2000). Salicylic acid has a role in regulating gene expression

during leaf senescence. Plant Journal 23(5), 677-685.

141

Moyaleon M. & John P. (1994). Activity of 1-aminocyclopropane-1-carboxylate (ACC)

oxidase (ethylene-forming enzyme) in the pulp and peel of ripening bananas.

Journal Of Horticultural Science 69(2), 243-250.

Moyle R., Fairbairn D., Ripi J., Crowe M. & Botella R. (2005). Developing pineapple

fruit has a small transcriptome dominated by metallothionein. Journal of

Experimental Botany 56(409), 101–112.

Mullet J.E. (1993). Dynamic regulation of chloroplast transcription. Plant Physiol 103,

309-313.

Murray F., Brettell R., Matthews P., Bishop D. & Jacobsen J. (2004). Comparison of

Agrobacterium-mediated transformation of four barley cultivars using the GFP

and GUS reporter genes. Plant Cell Reports 22, 397-402.

Nakazawa M. & Matsui M. (2003). Selection of hygromycin-resistant Arabidopsis

seedlings. Biotechniques 34(1), 28-30.

Nambara E., Naito S. & McCourt P. (1992). A mutant of Arabidopsis which is

defective in seed development and storage protein accumulation is a new abi3

allele. The Plant Journal 2, 435–441. doi: 10.1111/j.1365-313X.1992.00435.x

NASS-Hawaii. (2011). Hawaii Flowers and Nursery Products Annual Summary.

Honolulu HI, NASS, USDA. http://www.nass.usda.gov/hi

Neal M.C. (1965). In Gardens of Hawaii. Honolulu HI, Bishop Museum Press.

Nelson C.J. (1988). Genetic associations between photosynthetic characteristics and

yield: review of evidence. Plant Physiol. Biochem 26, 543-554.

142

Nichols R. (1984). Ethylene and flower senescence. Y. Fuchs & E. Chalutz. Ethylene,

Biochemical, Physiological and Applied Aspects. : The Hague, Nijhoff/Dr. W.

Junk, 101-110.

Nogueira F., Sassaki F. & Maia I. (2011). Arabidopsis thaliana Uncoupling Proteins

(AtUCPs): insights into gene expression during development and stress

response and epigenetic regulation. J Bioenerg Biomembr 43, 71–79.

Noh Y.-S. & Amasino R.M. (1999). Regulation of a developmental senescence is

conserved between Arabidopsis and Brassica napus. Plant Mol. Biol. 41, 195–

206.

Noh Y-S. & Amasino R. (1999). Identification of a promoter region responsible for

the senescence-specific expression of SAG12. Plant Molecular Biology 41,

181–194.

Nooden L.D. (1988). The phenomena of senescence and aging. L.D. Nooden & A.C.

Leopold. Senescence and Aging in Plants. San Diego CA, Academic Press Inc.,

1-50.

Nooden L.D. (1988). Abscisic acid, auxin, and other regulators of senescence. L.D.

Nooden & A.C. Leopold. Senescence and Aging in Plants. San Diego CA,

Academic Press Inc., 330-368.

Nooden L.D., Guiamet J.J. & John I. (1997). Senescence mechanisms. Physiol Plant

101, 746-753.

Nooden L. & Leopold A. (1988). Senescence and Aging in Plants. San Diego CA,

Academic Press Inc.

143

Okayama H. & Berg P. (1982). High-efficiency cloning of full-length cDNA. Mol. Cell.

Biol. 2(2), 161-170.

Olhoft P.M. & Somers D.A. (2001). L-Cysteine increases Agrobacterium-mediated T-

DNA delivery into soybean cotyledonary-node cells. Plant Cell Rep 20, 706–

711.

Olhoft P., Flagel L., Donovan C. & Somers D. (2003). Efficient soybean

transformation using hygromycin B selection in the cotyledonary-node

method. Planta 216, 723–735.

Orbovic V., Pasquali G. & Grosser J.W. (2007). A GFP-containing binary vector for

Agrobacterium tumefaciens-mediated plant transformation. Acta horticulturae

(ISHS) 738, 245-253. http://www.actahort.org/books/738/738_24.htm

Ozsolak F. & Milos M. (2011). RNA sequencing: advances, challenges and

opportunities. Nature Reviews Genetics 12, 87-98.

Pandey S., Ranade S.A., Nagar P.K. & Kumar N. (2000). Role of polyamines and

ethylene as modulators of plant senescence. Journal of Biosciences 25(3),

291-299.

Pant D.R., Bhattarai T., Beck E. & Fettig S. (2009). Genetic transformation of

Nepalese Spring Wheat (Triticum aestivum L.) cultivars with ipt gene under

the regulation of a senescence enhanced promoter from maize. Pakistan J of

Biol Sci 12, 101-109.

Paull R. & Chantrachit T.(2001). Benzyladenine and the vase life of tropical

ornamentals. Postharvest Biology and Technology 21, 303-310.

144

Peach C. & Velten J. (1991). Transgene expression variability (position effect) of CAT

and GUS reporter genes driven by linked divergent T-DNA promoters. Plant

Molecular Biology 17(1), 49-60.

Peckham G.D., Bugos R.C. & Su W.W. (2006). Purification of GFP fusion proteins

from transgenic plant cell cultures. Protein Expression and Purifcation 49,

183–189.

Peng L., Ma J., Chi W., Guo J., Zhu S., Lu Q., Lu C. & Zhang L. (2006). LOW PSII

ACCUMULATION1 is involved in efficient assembly of Photosystem II in

Arabidopsis thaliana. The Plant Cell 18, 955-969.

Peters D., Kassam A., Yonas H., O’Hare E., Ferrell R. & Brufsky A. (1999).

Comprehensive transcript analysis in small quantities of mRNA by SAGE-Lite.

Nucleic Acids Research 27(24), e39-e44.

Peterson L.W. & Huffaker R.C. (1975). Loss of RuBPCase and increase in proteolytic

activity during senescence of detached primary barley leaves. Plant Physiol.

55, 1009-1015.

Prychid C. & Rudall P. (1999). Calcium oxalate crystals in monocotyledons: a review

of their structure and systematics. Ann Bot 84(6), 725-739.

Qin F., Wang C-R., Wang R., Ma G., Xu H-L. (2009). Regulation of endogenous

hormones on post-harvest senescence in transgenic broccoli carrying an

antisense or a sense BO-ACO 2 gene. Journal of Food, Agriculture &

Environment 7(2), 594-598.

Quirino B.F., Noh Y-S., Himelblau E. & Amasino R. (2000). Molecular aspects of leaf

senescence. Trends Plant Sci. 5, 278-282.

145

Raab S., Drechsel G., Zarepour M., Hartung W., Koshiba T., Bittner F. & Hoth S.

(2009). Identification of a novel E3 ubiquitin ligase that is required for

suppression of premature senescence in Arabidopsis. Plant Journal 59(1), 39-

51.

Rhodes M.J.C. (1980). The maturation and ripening of fruits. K.V. Thimann.

Senescence in Plants. Boca Raton FL, CRC Press, 158-205.

Roberts J. & Osborne D. (1981). Auxin and the control of ethylene production during

the development and senescence of leaves and fruits. J Exp Bot 32, 875-887.

Roberts D.R., Walker M.A., Thompson J.E. & Dumbroff E.B. (1983). The effects of

inhibitors of polyamine and ethylene biosynthesis on senescence, ethylene

production and polyamines levels in cut carnation flowers. Plant Cell

Physiology 25, 315-322.

Roberts J., Tucker G. & Maunders M. (1985). Ethylene and foliar senescence. J.

Roberts & G. Tucker. Ethylene and Plant Development. London, Butterworths,

267-275.

Roberts D.R., Thompson J.E., Dumbroff E.B., Gepstein S. & Mattoo A.K. (1987).

Differential changes in the synthesis and steady-state levels of thylakoid

proteins during bean leaf senescence. Plant Molec. Biol. 9, 343-353.

Roberts E.H. (1988). Seed aging: the genome and its expression. L.D. Nooden & A.C.

Leopold. Senescence and Aging in Plants. San Diego CA, Academic Press Inc.,

465-498.

146

Robinson S., Slade A., Fox G., Phillips R., Ratcliffe R-G. & Stewart G. (1991).The role

of glutamate dehydrogenase in plant nitrogen metabolism. Plant Physiol.

95(2), 509–516.

Saladié M., Rose J., Cosgrove D. & Catalá C. (2006). Characterization of a new

xyloglucan endotransglucosylase/hydrolase (XTH) from ripening tomato fruit

and implications for the diverse modes of enzymic action. The Plant Journal

47(2), 282–295.

Samuels J. (1923). A pathological anatomical study of crystal cyst formation in

parenchymatous tissue in the genus Anthurium. Ann Bot 2, 159.181.

Schellenberg M., Matile P. & Thomas H. (1993). Breakdown of chlorophyll in

chloroplasts of senescent barley leaves depends on ATP. Journal of Plant

Physiology 136, 564-568.

Schena M., Shalon D., Davis R.W. & Brown P.O. (1995). Quantitative monitoring of

gene expression patterns with a complementary DNA microarray. Science 270,

467-70.

Schmitz D., Lohmer S., Salamini F. & Thompson, R.D. (1997). The activation domain

of the maize transcription factor Opaque-2 resides in a single acidic region.

Nucleic Acids Res. 25(4), 756–763.

Schnablova R., Synkova H., Vicankova A., Burketova L., Eder J. & Cvikrova M.

(2006). Transgenic ipt tobacco overproducing cytokinins overaccumulates

phenolic compounds during in vitro growth. Plant Physiology and Biochemistry

44, 526-534.

147

Seville M. (2001). A whole new way of looking at things: The use of Dark Reader

technology to detect fluorophors. Electrophoresis 22, 814–828.

Shanklin J., DeWitt N.D. & Flanagan J.M. (1995). The stroma of higher plant plastids

contain ClpP and ClpC, functional homologs of Escherichia coli ClpP and ClpA:

An archetypal two-component ATP-dependent protease. Plant Cell 7, 1713-

1722.

Sharabi-Schwager M., Samach A. & Porat R. (2010). Overexpression of the CBF2

transcriptional activator in Arabidopsis counteracts hormone activation of leaf

senescence. Plant Signaling & Behavior 5(3), 296-299.

Sheen J. (2001). Signal transduction in maize and arabidopsis mesophyll protoplasts.

Plant Physiology 127, 1466–1475.

Sheffer R. D. & Kamemoto H. (1976). Cross compatibility in the genus Anthurium.

Journal of the American Society for Horticultural Science 101, 709–713.

Shen Q., Jiang M., Li H., Che L. & Yang Z-M. (2011). Expression of a Brassica napus

heme oxygenase confers plant tolerance to mercury toxicity. Plant, Cell and

Environment 34, 752–763.

Shewry P.R., Napier J.A. & Tatham A.S. (1995). Seed storage proteins: structures

and biosynthesis. Plant Cell 7(7), 945–956.

Shewry P. & Halford N. (2002). Cereal seed storage proteins: structures, properties

and role in grain utilization. Journal of Experimental Botany 53(370), 947–

958.

Shiva Prakash N., Prasad V., Chidambram T.P., Cherian S., Jayaprakash T.L.,

Dasgupta S., Wang Q., Mann M.T., Spencer T.M. & Boddupalli R.S. (2008).

148

Effect of promoter driving selectable marker on corn transformation.

Transgenic Research 17, 695-704.

Shotwell M. A., Boyer S.K., Chesnut R.S. & Larkins B.A. (1990) Analysis of seed

storage protein genes of oats. The Journal of Biological Chemistry 265, 9652-

9658.

Singh K., Foley R. & Oñate-Sánchez L. (2002). Transcription factors in plant defense

and stress responses. Current Opinion in Plant Biology 5(5), 430–436.

Skoog F. (1994). A personal history of cytokinin and plant horomone research.

D.W.S. Mok & M.C. Mok. “Cytokinins: chemistry, activity and function”. Boca

Raton, Florida, CRC Press Inc., 1-14.

Smart C.M. (1994). Gene expression during leaf senescence. New Phytologist 126(3),

419-448.

Smigocki A.C. (1991). Cytokinin content and tissue distribution in plants transformed

by a reconstructed isopentenyl transferase gene. Plant Mol. Biol 16, 105–115.

Sodmergen K.S., Tano S. & Kuroiwa T. (1989). Preferential digestion of chloroplast

nuclei (nucleoids) during senescence of the coleoptile of Oryza sativa.

Protoplasma 152, 65-68.

Stachel S. E., Timmerman B. & Zambryski P. (1986). Generation of single-stranded

T-DNA molecules during the initial stages of T-DNA transfer from

Agrobacterium tumefaciens to plant cells. Nature 322, 706-712.

Stewart C.N. Jr. (2001). The utility of green fluorescent protein in transgenic plants.

Plant Cell Reports 20(5), 376-382.

149

Stratagene. Lambda DASH II/Eco RI Vector Kit Instruction Manual. Print.

Swartzberg D., Dai N., Gan S., Amasino R. & Granot D. (2006). Effects of cytokinin

production under two SAG promoters on senescence and development of

tomato plants. Plant Biology 8, 579–586.

Sýkorová B., Kurešová G., Daskalova S., Trčková M., Hoyerová K., Raimanová I.,

Motyka V., Trávníčková A., Elliott M.C. & Kamínek M. (2008). Senescence-

induced ectopic expression of the A. tumefaciens ipt gene in wheat delays leaf

senescence, increases cytokinins content, nitrate influx, and nitrate reductase

activity, but does not affect grain yield. J Exp Bot 59, 377–387.

Takaiwa F. & Oono K. (1991). Genomic DNA sequences of two new genes for new

storage protein glutelin in rice. Jpn J Genet 66, 161-171.

Takaiwa F, Ogawa M. & Okita TW. (1999). Rice glutelins. Shewry P.R. & Casey R.

Seed Proteins. Dordrecht, Kluwer Academic Publishers, 401–425.

Tetley R.M. & Thimann K.V. (1974). The metabolism of oat leaves during senescence.

Plant Physiol. 54, 294-303.

Thayer S., Choe H., Tang A. & Huffaker R. (1987). Protein turnover during

senescence. Thomson W., Nothnagel E. & Huffaker R. Plant Senescence: Its

Biochemistry and Physiology. The American Society of Plant Physiologists, 71-

80.

Thayer S., Choe H., S. Rausser & Huffaker R. (1988). Characterization and

subcellular localization of aminopeptidase in senescing barley leaves. Plant

Physiol. 87, 894-897.

150

Thimann K. (1987). Plant senescence: a proposed integration of the constituent

processes. W. Thomson, E. Nothnagel, & R. Huffaker. Plant Senescence: Its

biochemistry and physiology. The American Society of Plant Physiologists, 1-

19.

Thomas H. & Hilditch P. (1987). Metabolism of thylakoid membrane proteins during

foliar senescence. Thomson W., Nothnagel E. & Huffaker R. Plant Senescence:

Its Biochemistry and Physiology. The American Society of Plant Physiologists,

114-122.

Thomas H. & Matile P. (1988). Photobleaching of chloroplast pigments in leaves of a

non-yellowing mutant genotype of Festuca pratensis. Phytochem 27, 345-348.

Thomas H. & Stoddart J. (1980). Leaf senescence. Ann Rev Plant Physiol 31, 83-111.

Tian H.D., Satoh H. & Takemoto Y. (2004). Inheritance of novel 57H mutations in

rice and their effect on compartmentation of endosperm storage proteins.

International Journal of Plant Science 165(4), 537-544.

Timotijevic G., Milisavljevic M., Radovic S., Konstantinovic M. & Maksimovic V.

(2010).Ubiquitous aspartic proteinase as an actor in the stress response in

buckwheat. Journal of Plant Physiology 167, 61–68.

Ueda T., Seo S., Ohashi Y. & Hashimoto J. (2000). Circadian and senescence-

enhanced expression of a tobacco cysteine protease gene. Plant Molecular

Biology 44, 649-657.

Umate P. (2010). Genome-wide analysis of the family of light-harvesting chlorophyll

a/b-binding proteins in Arabidopsis and rice. Plant Signal Behav. 5(12), 1537-

42.

151

Vain P., Afolabi A.S., Worland B. & Snape J. W. (2003). Transgene behaviour in

populations of rice plants transformed using a new dual binary vector system:

pGreen/pSoup. Theoretical and Applied Genetics 107(2), 210-217.

Velculescu V.E., Zhang L., Vogelstein B. & Kinzler K.W. (1995). Serial analysis of

gene expression. Science 270, 484–487.

Velculescu V., Zhang L., Zhou W., Vogelstein J., Basrai M., Bassett Jr. D., Hieter P.,

Vogelstein B. & Kinzler K. (1997). Characterization of the yeast transcriptome.

Cell 88, 243–251.

Vickers C.E., Schenk P.M., Li D., Mullineaux P.M. & Gresshoff P.M. (2007). pGFPGUS

Plus, a new binary vector for gene expression studies and optimising

transformation systems in plants. Biotechnology Letters 29, 1793-1796.

Villareal R. & Juliano B. (1978). Properties of glutelin from mature and developing

rice grain. Phytochemistry 17, 177-182.

Vincentz M., Leite A., Neshich G., Vriend G., Mattar C., Barros L., Weinberg D., de

Almeida E.R., de Carvalho M.P., Aragão F. & Gander E.S. (1997). ACGT and

vicilin core sequences in a promoter domain required for seed-specific

expression of a 2S storage protein gene are recognized by the opaque-2

regulatory protein. Plant Mol Biol 34, 879-889.

Wakasa Y., Ozawa K. & Takaiwa F. (2007). Agrobacterium-mediated transformation

of a low glutelin mutant of 'Koshihikari' rice variety using the mutated-

acetolactate synthase gene derived from rice genome as a selectable marker.

Plant Cell Reports 26, 1567-1573.

152

Wang Z., Gerstein M. & Snyder M. (2009). RNA-Seq: a revolutionary tool for

transcriptomics. Nature Reviews Genetics 10, 57-63.

Wang J., Wang J., Zhang H., Yang Y. & Davies K. (2012). Isolation and partial

characterization of an R2R3MYB transcription factor from the bamboo species

Fargesia fungosa. Plant Mol Biol Rep 30, 131–138.

Wardlaw T.M., Bhalla P.L. & Dalling M.J. (1984). Changes in the number and

composition of chloroplasts during senescence of mesophyll cells of attached

and detached primary leaves (Triticum aestivum L.). Plant Physiol. 75, 421-

424.

Weaver L.M. & Amasino R.M. (2001). Senescence is induced in individually

darkened Arabidopsis leaves, but inhibited in whole darkened plants. Plant

Physiol. 127, 876-886.

Weiss-Wichert C., Altenfeld U. & Johanningmeier U. (1995). Detection of P-subunit of

the Clp-protease in chloroplasts. Xth Int. Photosyn. Cong. Photosyn.

Montpellier, France, p. 156.

Werner T., Motyka V., Laucou V., Smets R., Van Onckelen H. & Schmüllin T. (2003).

Cytokinin-deficient transgenic arabidopsis plants show multiple developmental

alterations indicating opposite functions of cytokinins in the regulation of

shoot and root meristem activity. The Plant Cell 15, 2532-2550

Wilhelm B. & Landry J.R. (2009). RNA-Seq—quantitative measurement of expression

through massively parallel RNA-sequencing. Methods 48, 249–257.

Wilson C., Bellen H. & Gehring W. (1990). Position effects on eukaryotic gene

expression. Annu. Rev. Cell Bio. 6, 679-714.

153

Wittenbach V.A., Ackerson R.C., Giaquinta F.T. & Herbert R.R. (1980). Changes in

photosynthesis, ribulose bisphosphate carboxylase, proteolytic activity, and

ultrastructure of soybean leaves during senescence. Crop Sci. 20, 225-231.

Woo H-H. & Hawes M. (1997). Cloning of genes whose expression is correlated with

mitosis and localized in dividing cells in root caps of Pisum sativum L. Plant

Molecular Biology 35, 1045–1051.

Woolhouse H. (1984). The biochemistry and regulation of senescence in chloroplasts.

Can. J. Bot. 62, 2934-2942.

Woolhouse H. (1987). Regulation of senescence in the chloroplast. W. Thomson, E.

Nothnagel, & R. Huffaker. Plant Senescence: Its Biochemistry and Physiology.

Rockville MD, Amer. Soc. Plant Physiol, 132-145.

Wu C., Suzuki A., Washida H. & Takaiwa F. (1998). The GCN4 motif in a rice glutelin

gene is essential for endosperm-specific gene expression and is activated by

Opaque-2 in transgenic rice plants. The Plant Journal 14(6), 673-683.

Xu L., Ye R., Zheng Y., Wang Z., Zhou P., Lin Y. & Li D. (2010). Isolation of the

endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.)

and its functional analysis in transgenic rice plants. Plant Cell Reports 29(9),

1061-1068.

Xu Z.F., Chye M.L., Li H.Y., Xu F.X. & Yao K.M. (2003). G-box binding coincides with

increased Solanum melongena cysteine protease expression in senescent

fruits and circadian-regulated leaves. Plant Molecular Biology 51(1), 9-19.

154

Xu Y., Tian J., Gianfagna T. & Huang B. (2009). Effects of SAG12-ipt expression on

cytokinin production, growth and senescence of creeping bentgrass (Agrostis

stolonifera L.) under heat stress. Plant Growth Regulation 57(3), 281-291.

Yakandawala G., Peiris S.E. & Yakandawala Y.L.N. (2000). Transient expression of

uidA reporter gene in regenerable callus tissues of Anthurium andraeanum

Lind. by Agrobacterium mediated transformation. Tropical Agricultural

Research 12, 50-55.

Yamagata H., Sugimoto T., Tanaka K. & Kasai Z. (1982). Biosynthesis of storage

proteins in developing rice seeds. Plant Physiol. 70, 1094-1100.

Yang H., Wang M., Gao Z., Zhu C. & Guo X. (2011). Isolation of a novel RNA-

dependent RNA polymerase 6 from Nicotiana glutinosa, NgRDR6, and analysis

of its response to biotic and abiotic stresses. Mol Biol Rep 38, 929–937.

Yang P., Li X., Wang X., Chen H., Chen F. & Shen S. (2007). Proteomic analysis of

rice (Oryza sativa) seeds during germination. Proteomics 7, 3358–3368.

doi: 10.1002/pmic.200700207

Yi L., Hagen G. & Guilfoyle T.J. (1992). Altered morphology in transgenic tobacco

plants that overproduce cytokinins in specific tissues and organs.

Developmental Biology 153, 386-395.

Yoo S-D., Cho Y-H. & Sheen J. (2007). Arabidopsis mesophyll protoplasts: a versatile

cell system for transient gene expression analysis. Nature Protocols 2(7),

1565-1572.

155

Yu K., Wei J., Ma Q., Yu D. & Li J. (2009). Senescence of aerial parts is impeded by

exogenous gibberellic acid in herbaceous perennial Paris polyphylla. Journal of

Plant Physiology 166(8), 819-830.

Zhang J., Van Toai T., Huynh L. & Preiszner J. (2000).Development of flooding-

tolerant Arabidopsis thaliana by autoregulated cytokinin production. Molecular

Breeding 6(2), 135-144.

Zhang Y., Liang C., Xu Y., Gianfagna T. & Huang B. (2010).Effects of ipt gene

expression on leaf senescence induced by nitrogen or phosphorus deﬁciency

in creeping bentgrass. J. Amer. Soc. Hort. Sci. 135(2), 108–115.

Zhou C., Lakso A., Robinson T. & Gan S. (2008). Isolation and characterization of

genes associated with shade-induced apple abscission. Molecular Genetics

and Genomics 280(1), 83-92.

Zhou Y., O'Hare T., Jobin-Decor M., Underhill S., Wills R. & Graham M. (2003).

Transcriptional regulation of a pineapple polyphenol oxidase gene and its

relationship to blackheart. Plant Biotechnology Journal 1(6), 463–478.

Zhu C., Zhu J., Zeng Q., Liu G., Xie Z., Tang H., Cao J. & Zhao X. (2009). Elevated

CO2 accelerates flag leaf senescence in wheat due to ear photosynthesis

which causes greater ear nitrogen sink capacity and ear carbon sink limitation.

Functional Plant Biology 36(4), 291–299

Zhu Y.J., Agbayani R. & Moore P.H. (2004). Green fluorescent protein as a visual

selection marker for papaya (Carica papaya L.) transformation. Plant Cell

Reports 22, 660-667.

156

Ziegler R., Blaheta A., Guha N. & Schönegge B. (1988). Enzymatic formation of

pheophorbide and pyropheophorbide during chllorophyll degradation in a

mutant of Chlorella fusca Shiharet Kraus. J. Plant Physiol. 132, 327-333.

Zottini M., Barizza E., Costa A., Formentin E., Ruberti C., Carimi F. & Lo Schiavo F.

(2008). Agroinfiltration of grapevine leaves for fast transient assays of gene

expression and for long-term production of stable transformed cells. Plant Cell

Reports 27, 845-853.

157