DOCSLIB.ORG

Strategies to Improve Dairy Cow Productivity and Welfare in Vietnam

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Strategies to Improve Dairy Cow Productivity and Welfare in Vietnam Strategies to improve dairy cow productivity and welfare in Vietnam Ngoc Bang Nguyen MSc. / BSc. A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2021 School of Veterinary Science Abstract In Vietnam, smallholder dairy farms (SDFs) account for more than 97% of the total national dairy herd, and the number of SDFs has increased rapidly recently due to the high demand for fresh milk. While studies aiming to improve the productivity and welfare of cows in SDFs could help increase national milk production, such studies are currently extremely limited due to the lack of available data about dairy cow husbandry management, breed, pedigree, and performance. The aims of this project were to describe the productivity of Vietnamese SDF cows and their welfare in typical dairying regions and to determine and prioritise potential nutrition, breeding, and management strategies to improve the productivity and welfare of those SDF cows. A total of 32 SDFs from four key contrasting dairy regions (8 farms per region) of Vietnam were chosen. The regions were those with highland/cooler climate: a southern highland region and a northern highland region; and those with lowland/hotter climate: a southern lowland region and a northern lowland region. Each farm was visited over an afternoon and during the following morning in autumn 2017 to collect necessary farming data and single-day data of all lactating cows. The farming data, including altitude, number of cattle, cow diets, feeding regimes, shed dimensions, heat stress abatement methods, and shed microclimate conditions, were obtained directly on the farms. Feed ingredients used for cow diets were sampled for chemical composition analysis. Single-day data of all lactating cows (n = 345), including milk yield, milk compositions, energy corrected milk yield (ECM), milk electrical resistance, body weight (BW), body condition score (BCS), number of inseminations per conception, panting score (PS, 4.5-point scale, 0 = normal, 4.5 = extremely heat- stressed) were measured directly on farms to be used as indicators of cow productivity and welfare. Genomic data of lactating cows were obtained by taking tail hair samples, extracting DNA, and genotyping with GGP bovine 50K chips. Infrared temperatures (IRTs) of lactating cows were measured at the inner vulval lip using an infrared thermometer, and measured at another ten different external areas, including: the outer vulval surface, inner tail base surface, ocular area, muzzle, armpit area, paralumbar fossa area, fore udder, rear udder, forehoof, and hind hoof, using an infrared camera. Data from all 32 farms were used for seven studies. The first study described herd structure and evaluated the productivity and welfare status of the cows. The second used genomic data to identify genetic diversity and breed composition. The third and fourth studies described and compared feeding regimes, diets, shed designs, heat stress abatement methods, and shed microclimate of the 32 farms in the four visited regions to evaluate the strengths and limitations of the cows’ nutrition and the heat stress management of each farm. The fifth study built multivariate models to identify nutrition, management and animal factors that were most associated with the productivity and welfare of the I cows. The sixth study tested the capability of IRTs relative to PS to assess the level of heat stress and the reduction in the cows’ milk yield under heat stress conditions. The seventh and last study tested the application of genomic selection and genome-wide association studies on milk production, body conformation (BW and BCS), and heat tolerance straits (PS and IRTs) of the SDF herds. The average herd size across regions was 29 animals comprising 11 lactating cows, four dry cows, six heifers, seven female calves, one male calf, one beef cattle, and no reproductively active bulls. All the cows were genetically very close to pure Holstein and retained a similar level of genetic diversity as the reference Holstein populations used in the USA, New Zealand, and France. The genetic proportionality of Holstein, Jersey, Brown Swiss, and Zebu, averaged across all herds, were 85.0%, 6.0%, 5.3%, and 4.5%, respectively. The most critical production and welfare issues were the high level of heat stress (96% of cows were moderate to highly heat-stressed in the afternoon), relatively low ECM (15.7 kg/cow/d), low BCS (2.8, 5-point scales), a high number of inseminations per conception in the lowland SDFs (1.9 to 3.2 times per conception), insufficient supply of water, insufficient floor allowance per cow (8 m2/cow), and excessive use of “tie” rather than “loose” stalls or pens for cows in sheds. From among the four regions, the cows in the southern lowland were least productive and had the poorest welfare conditions. The lactating cow diets in all regions were deficient in net energy and excessive in crude protein and fibre concentrations, which were associated with low milk yield and low feed efficiency in all regions. Increases in farm altitude, shed roof height, floor allowance for cows, percentages of cowshed sides open, and the use of roof soakers and fans were all associated with improved cowshed microclimate, reduced PS, decreases in the number of inseminations per conception, and improved milk production. All infrared temperatures showed potential to assess the level of heat stress in the cows. The infrared temperatures of the inner vulval lip, outer vulval surface, and inner tail base surface showed the best potential to predict ECM reduction during heat stress. Under SDF conditions, Holstein_BrownSwiss and Holstein_Jersey first crosses tended to be more productive and less heat-stressed than backcrosses of Holstein and Zebu with 15/16 Holstein purer. The moderate to high heritabilities (0.26 to 0.58) and moderate accuracies (0.23 to 0.50) of genomic estimated breeding values (GEBVs) for some milk production traits (ECM adjusted for BW and milk fat and protein concentrations), body conformation traits (BCS and BW), and heat tolerance traits (PS and IRTs at the rear udder, fore hoof and outer vulval surface) suggested the potential to apply genomic selection using single-test day phenotypic measurements for these traits. However, a larger sample size is required. Novel single nucleotide polymorphisms and genes for PS and infrared temperatures were located on chromosome (BTA) 5, BTA8, BTA11, BTA14, BTA19, and BTA20. II Overall, the most important short-term strategies to improve the productivity of SDF cows are heat stress amelioration and the measurement thereof using new technologies such as IRT. Next are nutritional strategies which include supplying ad libitum drinking water and the reformulation of cow diets by increasing available energy whilst decreasing fibre concentrations to meet the requirements of the cows in heat stress conditions. Long-term strategies could include the application of genomic selection to identify bulls and heifers with high genetic merit for milk production, heat tolerance and other key traits, from within the current Vietnamese SDF herd. III Declaration by author This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis. I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, financial support and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my higher degree by research candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award. I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School. I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis and have sought permission from co-authors for any jointly authored works included in the thesis. IV Publications included in this thesis Since thesis submission, the following papers have been published: Bang NN, Chanh NV, Trach NX, Khang DN, Hayes BJ, Gaughan JB, Lyons RE, Hai NT and McNeill DM (2021). Assessment of performance and some welfare indicators of cows in Vietnamese smallholder dairy farms. Animals, 11 (3), 674. https://doi.org/10.3390/ani11030674 (Chapter 3). Bang NN, Chanh NV, Trach NX, Khang DN, Hayes BJ, Gaughan JB, Lyons RE, Hai NT and McNeill DM (2021). Issues of feeding strategy for lactating cows in Vietnamese smallholder dairy farms. Animals, 11 (3), 729. https://doi.org/10.3390/ani11030729 (Chapter 5). Bang NN, Gaughan JB, Hayes BJ, Lyons RE, Chanh NV, Trach NX, Khang DN and McNeill DM (2021). Characteristics of cowsheds in Vietnamese smallholder dairy farms and their associations with microclimate - A preliminary study. Animals, 11 (2), 351. https://doi.org/10.3390/ani11020351 (Chapter 6). Submitted manuscripts included in this thesis Since thesis submission, the following manuscript has been submitted for publication: Bang NN, Hayes BJ, Lyons RE, Randhawa IAS, Gaughan JB and McNeill DM (2021).
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • In France (1956-1976)
    Informations Twenty years of research in beef cattle breeding in France (1956-1976) B. VISSAC Depavtenxent de Génétique Animale, LN.R.A.,., Centre National de Recherches Zootechniques, Jouy-en-Josas, 78350, France Contents I. - Introduction 2. - Genetic variation 2.1 - PolymorPhisms 2.11 - Chromosomes 2.1 - Genes 2.121 - Biochemical mutants 2.122 - Visible mutants 2. - Polygenic variation 2.21 - Preliminary research on growth traits 2.22 - Analysis of direct and maternal effects 2.23. - Adaptability (*) In cooperation with POPESCU (cytogenetics), GROSCLAUDE (biochemical polymorphisms), I,AU- VERGNE (visible mutants), MÉNISSIER, BIBE, COLLEAU, FOULLEY and FREBLING (polygenic traits). 3. - Breeding improvement 3.1 - Practical breeding schemes 3.31 - Schemes for teyminal crossing 3.32 - Schemes for yeproductive traits 3.2 - Crossbreeding systems 3. - Optimal use of vegetable land resources by beef cattle q. - Conclusion 5. - References 1. - Introduction Interest for French research work in the field of beef cattle breeding is quite general. French beef cattle populations, which first appeared well fitted to the new requirements of intensive production systems and market demand are now, for most of them, widespread on all the continents. France being located at the meeting point of the main physical areas and human influences in Western Europe (oceanic, alpine, continental and mediterranean) its cattle industry is concerned with a wide variety of populations, environments and production systems. Further the early development of AI and reproduction control in France where the propor- tion of cows inseminated is among the highest in the world, chiefly in suckling herds, makes it easier to manage more efficient breeding programs in small holding farms.
    [Show full text]
  • Proteomic Expression Profile in Human Temporomandibular Joint
    diagnostics Article Proteomic Expression Profile in Human Temporomandibular Joint Dysfunction Andrea Duarte Doetzer 1,*, Roberto Hirochi Herai 1 , Marília Afonso Rabelo Buzalaf 2 and Paula Cristina Trevilatto 1 1 Graduate Program in Health Sciences, School of Medicine, Pontifícia Universidade Católica do Paraná (PUCPR), Curitiba 80215-901, Brazil; [email protected] (R.H.H.); [email protected] (P.C.T.) 2 Department of Biological Sciences, Bauru School of Dentistry, University of São Paulo, Bauru 17012-901, Brazil; [email protected] * Correspondence: [email protected]; Tel.: +55-41-991-864-747 Abstract: Temporomandibular joint dysfunction (TMD) is a multifactorial condition that impairs human’s health and quality of life. Its etiology is still a challenge due to its complex development and the great number of different conditions it comprises. One of the most common forms of TMD is anterior disc displacement without reduction (DDWoR) and other TMDs with distinct origins are condylar hyperplasia (CH) and mandibular dislocation (MD). Thus, the aim of this study is to identify the protein expression profile of synovial fluid and the temporomandibular joint disc of patients diagnosed with DDWoR, CH and MD. Synovial fluid and a fraction of the temporomandibular joint disc were collected from nine patients diagnosed with DDWoR (n = 3), CH (n = 4) and MD (n = 2). Samples were subjected to label-free nLC-MS/MS for proteomic data extraction, and then bioinformatics analysis were conducted for protein identification and functional annotation. The three Citation: Doetzer, A.D.; Herai, R.H.; TMD conditions showed different protein expression profiles, and novel proteins were identified Buzalaf, M.A.R.; Trevilatto, P.C.
    [Show full text]
  • Animal Genetic Resources Information Bulletin
    The designations employed and the presentation of material in this publication do not imply the expression of any opinion whatsoever on the part of the Food and Agriculture Organization of the United Nations concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Les appellations employées dans cette publication et la présentation des données qui y figurent n’impliquent de la part de l’Organisation des Nations Unies pour l’alimentation et l’agriculture aucune prise de position quant au statut juridique des pays, territoires, villes ou zones, ou de leurs autorités, ni quant au tracé de leurs frontières ou limites. Las denominaciones empleadas en esta publicación y la forma en que aparecen presentados los datos que contiene no implican de parte de la Organización de las Naciones Unidas para la Agricultura y la Alimentación juicio alguno sobre la condición jurídica de países, territorios, ciudades o zonas, o de sus autoridades, ni respecto de la delimitación de sus fronteras o límites. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, without the prior permission of the copyright owner. Applications for such permission, with a statement of the purpose and the extent of the reproduction, should be addressed to the Director, Information Division, Food and Agriculture Organization of the United Nations, Viale delle Terme di Caracalla, 00100 Rome, Italy. Tous droits réservés. Aucune partie de cette publication ne peut être reproduite, mise en mémoire dans un système de recherche documentaire ni transmise sous quelque forme ou par quelque procédé que ce soit: électronique, mécanique, par photocopie ou autre, sans autorisation préalable du détenteur des droits d’auteur.
    [Show full text]
  • ACE Appendix
    CBP and Trade Automated Interface Requirements Appendix: PGA August 13, 2021 Pub # 0875-0419 Contents Table of Changes .................................................................................................................................................... 4 PG01 – Agency Program Codes ........................................................................................................................... 18 PG01 – Government Agency Processing Codes ................................................................................................... 22 PG01 – Electronic Image Submitted Codes .......................................................................................................... 26 PG01 – Globally Unique Product Identification Code Qualifiers ........................................................................ 26 PG01 – Correction Indicators* ............................................................................................................................. 26 PG02 – Product Code Qualifiers ........................................................................................................................... 28 PG04 – Units of Measure ...................................................................................................................................... 30 PG05 – Scientific Species Code ........................................................................................................................... 31 PG05 – FWS Wildlife Description Codes ...........................................................................................................
    [Show full text]
  • Beef-Catalogue-2021-S.Pdf
    What Sets Dovea Apart Dovea Genetics is a leading bovine genetics company located in Thurles, County Tipperary, Ireland. The company has been in operation since 1952. Since then we have been working with farmers in the development of the genetic merit of the national herd. The relationships we have developed with our customers over our long standing history is very important to us. We can assure our customers of a premium product and service and we would like to thank you for your continued support www.doveagenetics.ie during these times. We appreciate feedback from farmers and respond to the demands of the market. We at Dovea Genetics take pride in sourcing the finest bulls possible both nationally and internationally to maintain our reputation of outstanding quality. Throughout this directory you will find various sires to suit your herd. Some of Maximizing Your our famous bulls to walk through Dovea such as Crossmolina Euro (CSQ), Herd’s Genetic Milbrook Dartangan (MBP) and Herbert VD Noord (WBH) are no longer available. This has resulted in us investing in the future for Irish farmers. Bulls Potential such as Bud Orpheus, an average calving, powerful Charolais sire and Haltcliffe Newton, a Limousin sire with tremendous shape and scope, just to name a few have been bought in to further strengthen our beef programme and offer the farmer even more choice when breeding the next generation. Our programme is put together to strive for the elite genetic advancement. Whether you are a pedigree breeder, weanling producer or finisher we have bulls with high terminal and/or replacement values to suit your system.
    [Show full text]
  • Genomics – a New Era for Cattle Breeding
    Genomics – A New Era for Cattle Breeding. ICBF & Teagasc Genomics Conference. Killeshin Hotel Portlaoise. 14th November 2012. Objective of conference. • An opportunity to understand genomics, from the basic concepts through to it’s role in parentage identification and future genetic improvement programs. Session 1. Genomics & parentage identification (10 am – 1 pm) • Chair: Gerard Brickley, beef farmer and herdbook representative on board of ICBF. • Introduction to animal breeding, including genomics – Dr. Sinead McParland, Teagasc. • Genomics and parentage verification – Dr. Matt McClure, US Department of Agriculture. • Developing a customised chip for Ireland – Dr. Mike Mullen, Teagasc. • Implementation of genomic services – Mary McCarthy, ICBF and Dr John Flynn, Weatherby’s Ireland. • Role of genomics in Irish dairy and beef breeding programs (Part 1) – Dr. Andrew Cromie, ICBF. • Discussion. Session 2. Genomics & genetic improvement (2-5 pm). • Chair: John O’Sullivan, dairy farmer and chairman of board of ICBF. • Role of genomics in Irish dairy and beef breeding programs (Part 2) – Dr. Andrew Cromie, ICBF. • Developments in beef genomics – Dr. Donagh Berry, Teagasc • Developments in dairy genomics – Dr. Francis Kearney, ICBF • Where next for genomics and cattle breeding – Dr. Matt McClure, US Department of Agriculture. • Discussion. Introduction to Animal Breeding & Genomics Sinead McParland Teagasc, Moorepark, Ireland [email protected] Overview • Changes to traditional animal breeding • Using DNA in animal breeding • Microsatellites
    [Show full text]
  • Snomed Ct Dicom Subset of January 2017 Release of Snomed Ct International Edition
    SNOMED CT DICOM SUBSET OF JANUARY 2017 RELEASE OF SNOMED CT INTERNATIONAL EDITION EXHIBIT A: SNOMED CT DICOM SUBSET VERSION 1.
    [Show full text]
  • Livestock Achievement Program Fresno County 4-H Beef Cattle Study Guide
    LIVESTOCK ACHIEVEMENT PROGRAM FRESNO COUNTY 4-H BEEF CATTLE STUDY GUIDE LEVEL 1 & 2 PARTS OF THE MARKET STEER Level 1 & 2 WHOLESALE CUTS OF BEEF Level 2 RETAIL CUTS OF BEEF BREEDS OF BEEF CATTLE Level 1 & 2 The following breeds and their crosses are popular in our area: English Breeds Angus Hereford Shorthorn Continental Breeds Charolais Maine Anjou Simmental The Angus breed originated in the northeastern part of Scotland. When George Grant transported four Angus bulls from Scotland to the middle of the Kansas prairie in 1873, they made a lasting impression on the U.S. cattle industry. When two of the George Grant bulls were exhibited in the fall of 1873 at the Kansas City (Missouri) Livestock Exposition, some considered them "freaks" because of their polled (naturally hornless) heads and solid black color (Shorthorns were then the dominant breed). The first great herds of Angus beef cattle in America were built up by purchasing stock directly from Scotland. Twelve hundred cattle alone were imported, mostly to the Midwest, in a period of explosive growth between 1878 and 1883. Over the next quarter of a century these early owners, in turn, helped start other herds by breeding, showing, and selling their registered stock. Angus are known for fertility, calving ease, mothering ability, resistance to pink eye because of dark skin pigmentation, and propensity to marble (distribute fat within the meat) more than any other breed thus producing a high quality carcass. The Angus breed has the largest branded-beef program, Certified Angus Beef, in the world. Angus cattle are black but there is also a Red Angus breed.
    [Show full text]
  • Characterization of the Golgi C10orf76-PI4KB Complex, and Its
    bioRxiv preprint doi: https://doi.org/10.1101/634592; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 1 Characterization of the Golgi c10orf76-PI4KB complex, and its 2 necessity for Golgi PI4P levels and enterovirus replication 3 4 McPhail, J.A.1, Lyoo, H.R.2*, Pemberton, J.G.3*, Hoffmann, R.M.1, van Elst W.2, 5 Strating J.R.P.M.2, Jenkins, M.L.1, Stariha, J.T.B.1, van Kuppeveld, F.J.M.2#, Balla., T.3#, and 6 Burke, J.E.1# 7 * - These authors contributed equally 8 # - Corresponding authors 9 10 Affiliations 11 1 Department of Biochemistry and Microbiology, University of Victoria, Victoria, BC, 12 Canada 13 2 Department of Infectious Diseases & Immunology, Virology Division, Faculty of 14 Veterinary Medicine, Utrecht University, Utrecht, The Netherlands. 15 3 Section on Molecular Signal Transduction, Eunice Kennedy Shriver National Institute 16 of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 17 USA 18 19 Corresponding authors: 20 Burke, John E. ([email protected]), Tel: 1-250-721-8732 21 Balla, Tamas ([email protected]), Tel: 301-435-5637 22 van Kuppeveld, Frank J.M. ([email protected]), Tel: 31-30-253-4173 23 24 Running title 25 Role of c10orf76-PI4KB at the Golgi 26 27 28 29 30 31 32 bioRxiv preprint doi: https://doi.org/10.1101/634592; this version posted May 10, 2019.
    [Show full text]
  • Supplementary Figure and Tables
    USP24-GSDMB complex promotes bladder cancer proliferation via activation of the STAT3 pathway Haiqing He, Lu Yi, Bin Zhang, Bin Yan, Ming Xiao, Jiannan Ren, Dong Zi, Liang Zhu, Zhaohui Zhong, Xiaokun Zhao, Xin Jin, Wei Xiong Supplementary figure 1. A and B, T24 and 5637 cells were infected with indicated constructs for 48 h. The cells were harvested for cell cycle assay (A) and transwell invasion assay (B). Data presented as three replicates. ns, not significant; *, P < 0.05; ***, P < 0.001. Table S1: Sequences of RT-qPCR primers Species Gene Forward (5’-3’) Reverse (5’-3’) Human GAPDH CCAGAACATCATCCCTGCCT CCTGCTTCACCACCTTCTTG Human HK2 TCTATGCCATCCCTGAGGAC TCTCTGCCTTCCACTCCACT Human LDHA GGCCTGTGCCATCAGTATCT CGCTTCCAATAACACGGTTT Human ENO2 GAAGAAAAGGCCTGCAACTG CCAGGTCAGCAATGAATGTG Human GSDMB AGTCTTTGGGTTCGGAGGAT CTTGTCTGGGTCCTCCATGT Human IGFBP3 CCTGCCGTAGAGAAATGGAA AGGCTGCCCATACTTATCCA Table S2: Sequences of ChIP-qPCR primers Species Gene Forward (5’-3’) Reverse (5’-3’) Human IGFBP3 CCCCTGGGGATATAAACAGC GCATTCGTGTGTACCTCGTG Table S3: Sequences of gene-specific shRNAs shGSDMB-1 5′- CCGGGCCTTGTTGATGCTGATAGATCTCGAGATCTATCAGCATCAACAAGGCTTTTTT G-3′ shGSDMB-2 5′- CCGGGCTGTATGTTGTTGTCTCTATCTCGAGATAGAGACAACAACATACAGCTTT TTTG-3′ shSTAT3 5′- CCGGGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGCTTTTTG -3′ shUSP24-1 5′- CCGGCTCTCGTATGTAACGTATTTGCTCGAGCAAATACGTTACATACGAGAGTTTTTG TG-3′ shUSP24-2 5′- CCGGACAATACTGTGACCGTATAAACTCGAGTTTATACGGTCACAGTATTGTTTTTTG -3′ gene_id si-GSDMB si-NC log2FoldChangepvalue padj gene_namegene_chr gene_start ENSG0000014667410533.42
    [Show full text]
  • Comparing the Mrna Expression Profile and the Genetic Determinism
    González-Prendes et al. BMC Genomics (2019) 20:170 https://doi.org/10.1186/s12864-019-5557-9 RESEARCH ARTICLE Open Access Comparing the mRNA expression profile and the genetic determinism of intramuscular fat traits in the porcine gluteus medius and longissimus dorsi muscles Rayner González-Prendes1, Raquel Quintanilla2, Emilio Mármol-Sánchez1, Ramona N. Pena3, Maria Ballester2, Tainã Figueiredo Cardoso1,4, Arianna Manunza1, Joaquim Casellas5, Ángela Cánovas6, Isabel Díaz7, José Luis Noguera2, Anna Castelló1,5, Anna Mercadé5 and Marcel Amills1,5* Abstract Background: Intramuscular fat (IMF) content and composition have a strong impact on the nutritional and organoleptic properties of porcine meat. The goal of the current work was to compare the patterns of gene expression and the genetic determinism of IMF traits in the porcine gluteus medius (GM) and longissimus dorsi (LD) muscles. Results: A comparative analysis of the mRNA expression profiles of the pig GM and LD muscles in 16 Duroc pigs with available microarray mRNA expression measurements revealed the existence of 106 differentially expressed probes (fold-change > 1.5 and q-value < 0.05). Amongst the genes displaying the most significant differential expression, several loci belonging to the Hox transcription factor family were either upregulated (HOXA9, HOXA10, HOXB6, HOXB7 and TBX1) or downregulated (ARX) in the GM muscle. Differences in the expression of genes with key roles in carbohydrate and lipid metabolism (e.g. FABP3, ORMDL1 and SLC37A1) were also detected. By performing a GWAS for IMF content and composition traits recorded in the LD and GM muscles of 350 Duroc pigs, we identified the existence of one region on SSC14 (110–114 Mb) displaying significant associations with C18:0, C18:1(n-7), saturated and unsaturated fatty acid contents in both GM and LD muscles.
    [Show full text]