Adrenergic Antagonists Disrupt Lipid and Cholesterol Homeostasis Resulting in Canine Hemangiosarcoma Cell Death

Adrenergic antagonists disrupt lipid and cholesterol homeostasis resulting in canine hemangiosarcoma cell death

A DISSERTATION SUBMITTED TO THE FACULTY OF UNIVERSITY OF MINNESOTA BY

Derek Matthew Korpela

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

Advisors: Dr. Erin B Dickerson, PhD and Dr. David R Brown, PhD

November 2019

ACKNOWLEDGEMENTS

Completion of research presented in this dissertation was made possible by the many outstanding faculty members, collaborators, and especially family and friends who supported me.

I first and foremost want to thank my graduate advisor Dr. Erin B Dickerson for her mentorship and dedication to guiding me through my PhD training. Her tireless pursuit of scientific rigor and wealth of knowledge was, and will continue to be, exemplary of what I will strive to attain as a scientist. While consistently challenging my abilities to think critically and advance my technical skills, Erin demonstrated incredible support and patience through countless hours spent working with me. She inspires me to pursue science with creativity and attention to detail; skills that will drive my future scientific endeavors. I am truly grateful for Erin’s mentorship as she has no doubt shaped me both as a person and veterinary scientist.

Another individual to whom I owe much gratitude is my co-advisor Dr. David R Brown. The contribution of his scientific expertise was fundamental in the shaping of my research project. Not only could I count on Dr. Brown for sound science advice, but also for support as he is one of the sincerest persons, I have had a privilege to work with. Additionally, would like to acknowledge both Dr. Ameeta Kelekar and Dr. Bruce Walcheck for their roles as committee members. The experience and knowledge they contributed were critical assets to my research, and their passion for the pursuit of discovery is a quality I will carry with me well after my training.

Finally, words cannot express the gratitude I have for my family throughout my pursuit of a PhD. The support and encouragement from my wife, Michelle, carried me through the most challenging times, and reminded me that no matter the outcome, I am blessed. The bright personalities, youthful curiosity, and infectious joy exhibited by my children, Emily and Abby, have taught me the truly valuable lessons of life. And I cannot thank my parents, David and Cheryl, enough for the love and support given me throughout my education, and for instilling in me the ambition to work to achieve my goals. To all of you, I owe my greatest thanks and love.

i ABSTRACT

The beta-adrenergic receptor (β-AR) antagonist, propranolol, has been identified as an effective adjunct therapy for angiosarcoma patients. Why angiosarcomas are susceptible to propranolol remains unknown. The objectives of this dissertation were to characterize the mechanisms behind the susceptibility of these tumors to the lethal effect of propranolol and to identify other drugs classed as AR antagonists that could further improve patient outcomes. In addition, translation of these findings could be used to treat a virtually indistinguishable tumor in dogs known as canine hemangiosarcoma. Using a panel of hemangiosarcoma cell lines, we found that propranolol reduced tumor cell viability through an β−AR-independent mechanism. Further investigation showed that propranolol inhibited endocytosis, limiting the uptake and processing of extracellular lipids. To restore lipid homeostasis, hemangiosarcoma cells rapidly increased the activation of metabolically costly cholesterol and lipid synthesis pathways, leading to ER stress, reduced mitochondrial activity, and cell death.

Screening assays identified the mixed-acting α1-, β-AR antagonist, carvedilol, as a more effective inhibitor of endocytosis, lipid homeostasis, and mitochondrial metabolism. We conclude that propranolol and carvedilol disrupt lipid homeostasis and tumor cell metabolism to kill hemangiosarcoma cells.

Repurposing propranolol or its AR-inactive R-(+) enantiomer may provide a readily translatable and clinically safe strategy for the treatment of canine hemangiosarcoma. Related drugs, such as carvedilol, may further improve outcomes for angiosarcoma patients with less side effects.

ii TABLE OF CONTENTS

Page

Acknowledgements i

Abstract ii

Table of Contents iii

List of Tables iv

List of Figures v

Chapter 1: Introduction 1

Chapter 2: Materials and Methods 22

Chapter 3: Propranolol reduces cell viability by disrupting 41 cholesterol and lipid metabolism and inducing ER stress Chapter 4: Propranolol impairs mitochondrial activity and inhibits fatty acid 62 oxidation Chapter 5: Carvedilol is a promising adjunctive drug candidate for 71 the treatment of canine hemangiosarcoma

Chapter 6:Conclusions 85

References 96

iii LIST OF TABLES

Page

1.1 Summary of studies using propranolol against various malignancies 6

1.2 Therapeutic approaches to hemangiosarcoma and outcomes 19

2.1 Antibodies 23

2.2 qRT-PCR Primers 26

3.1 Propranolol and its enantiomers reduce hemangiosarcoma cell 44 viability 5.1 Screened AR antagonists in hemangiosarcoma cell lines 73

5.2 Carvedilol and its enantiomers reduce tumor cell viability 74

iv LIST OF FIGURES

Page

1.1 Generic pathway converting PA to PI species and mTORC1 activation 10

1.2 Propranolol inhibits tumor cell macropinocytosis 13

1.3 Cancer cells experiencing stress initiate the unfolded protein 14 response (UPR) 1.4 Molecular structure of propranolol 15

2.1 TMRE assay workflow 30

2.2 Mechanism of TMRE dye accumulation 31

2.3 Transferrin uptake as a measure of receptor-mediated endocytosis 32

2.4 Mitochondrial electron transport chain targeted in MitoStress 35 analyses 2.5 Generic Seahorse Bioanalyzer readout 36

2.6 Endosome and lysosome markers identify stage of processing 38

3.1 Propranolol reduces tumor cell viability via β−AR independent 43 activity 3.2 Propranolol induces expression of genes associated with 45 cholesterol and lipid synthesis in hemangiosarcoma cell lines 3.3 Propranolol increases cholesterol and fatty acid synthesis by activating 47 SREBP-1 3.4 Propranolol upregulates expression of cholesterol and fatty acid 48 synthesis enzymes 3.5 Propranolol reduces endocytosis in hemangiosarcoma cells 50

3.6 Propranolol limits vesicle trafficking in hemangiosarcoma cells 52

3.7 Propranolol increases phosphatidic acid levels and activates Akt 54

3.8 Propranolol induces PI(3,4,5)P3 localization to the plasma 55 membrane 3.9 Propranolol activates Akt signaling pathways 56

3.10 Propranolol induces ER stress 58

3.11 Propranolol blocks autophagic flux 60

v 4.1 Propranolol alters mitochondrial activity of hemangiosarcoma cells 65

4.2 Propranolol blocks the uptake of 2-NDBG and reduces the 67 expression of glycolytic genes 4.3 Propranolol inhibits β−fatty acid oxidation 69

5.1 Carvedilol and its enantiomers reduce tumor cell viability 74

5.2 Carvedilol reduces endocytosis and sequesters cholesterol in 76 hemangiosarcoma cells 5.3 Carvedilol activates cholesterol and lipid biosynthesis pathways 78

5.4 Carvedilol alters mitochondrial activity of hemangiosarcoma cells 80

5.5 Carvedilol inhibits FAO 82

5.6 Carvedilol increases phosphatidic acid levels in hemangiosarcoma 83 cells

Chapter 4:

Propranolol impairs mitochondrial activity and inhibits fatty acid oxidation

1 Rationale and Objectives:

Cancers such as breast and prostate ductal adenocarcinomas have adapted to use exogenous uptake of extracellular nutrients from the tumor microenvironment to remain aggressive under challenging environmental conditions [1-4]. We found that hemangiosarcoma cells exhibit uptake of cholesterol and potentially fatty acids to sustain aggressive growth and proliferation. Our results demonstrate that propranolol inhibits cholesterol uptake in hemangiosarcoma cells, inducing endogenous compensatory mechanisms through rapid and prolonged synthesis of fatty acids and cholesterol metabolites.

These metabolically expensive processes require high levels of ATP, and more importantly, large quantities of NADPH [5]. Our objective in this chapter was to determine how hemangiosarcoma cells adjust their metabolism to compensate for the loss of extacellular metabolites.

Results

Propranolol alters mitochondrial activity of hemangiosarcoma cells.

To evaluate changes in cellular metabolism in response to racemic propranolol, we analyzed hemangiosarcoma cell mitochondrial activity using a

MitoStress kit and a Seahorse bioanalyzer. We found that propranolol decreased the overall oxygen consumption rate (OCR) at both early (2 hour) and late (18 hour) time points in the Dal-4 and 1426 hemangiosarcoma cell lines, showing that propranolol induced a reproducible and prolonged decrease in oxidative metabolism (Fig. 4.1A-B). To verify that these effects were the result of AR-

2 independent mechanisms, we also examined the actions of R-(+)-propranolol and obtained similar results in 1426 cells (Fig. 4.1B). Propranolol also decreased basal metabolism, maximal respiration, spare respiratory capacity, and ATP production in these cell lines (Fig.4.1C-D). To further evaluate changes in mitochondrial function, we used a tetramethylrhodamine ethyl ester (TMRE) dye assay. Propranolol increased TMRE dye accumulation in Dal-4 and 1426 cells, indicating that propranolol increased the mitochondrial membrane potential in both cell lines (Fig. 4.1E-F). Taken together, these data suggest that propranolol disrupts mitochondrial activity and limits oxidative phosphorylation in hemangiosarcoma cells.

Figure 4.1. Propranolol alters mitochondrial activity of hemangiosarcoma cells. Representative Seahorse bioanalyzer experiments using a MitoStress Kit in A) Dal-4 and B) 1426 hemangiosarcoma cells treated with propranolol (100 µM) for 2 or 18 hours, or (R+)-propranolol (50 µM) for 18 hours. Oxygen consumption rate (OCR) values per time point were normalized to protein content per well (measured after the assay was completed) and plotted against time to visualize the metabolic profiles as shown in A and B. Values for basal OCR (“Basal”), Maximal Respiration, Spare Respiratory Capacity, and ATP production for C) Dal-4 and D) 1426 cells were obtained as described in the Materials and Methods. Results are representative of data from at least three independent experiments for each cell line with at least six replicates for each condition. Mean fluorescence intensity (MFI) of TMRE in E) Dal-4 and F) 1426 cells treated with propranolol (100 µM) for 2 or 18 hours, or with (R+)-propranolol (50 µM) for 18 hours. Data are representative of at least three independent experiments with triplicates for each concentration and reported as the mean ± SEM. Differences were tested using one-way ANOVA with

4 Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). C=control; Pro= racemic propranolol; R-(+) = R-(+) enantiomer of propranolol.

Propranolol limits the uptake and processing of glucose by hemangiosarcoma cells.

Because propranolol has been shown to limit glucose uptake in breast cancer and thyroid cancer cells [6, 7], we evaluated the effect of propranolol on glucose uptake and processing in hemangiosarcoma cells. Using the fluorescent glucose analog, 2-NBDG, we found that propranolol significantly (p ≤ 0.01) reduced 2-NBDG uptake in Dal-4 cells within 2 hours, and this effect was sustained for up to 18 hours. Propranolol also reduced the uptake of 2-NBDG in

1426 cells, but this effect was only significant from controls at the 18 hour time point (Fig. 4.2A-B). To determine if reduced glucose uptake affected metabolic pathways involved in glucose metabolism, gene expression of rate-limiting enzymes in the glycolytic and gluconeogenic pathways was measured by qRT-

PCR. In Dal-4 cells, propranolol induced significant (p ≤ 0.05) decreases in both fructose-1,6-bisphosphate (FBP) and phosphofructokinase (PFK), suggesting that propranolol limited glucose processing (Fig. 4.2C). In 1426 cells, propranolol treatment resulted in significant reductions in hexokinase-1 (HK) expression, the first regulatory step in glycolysis (Fig. 4.2D). These data suggest that propranolol potentially limits processing of glucose in hemangiosarcoma cells through reduced expression of genes, whose products are known to regulate early steps of glycolysis.

Figure 4.2. Propranolol blocks the uptake of 2-NDBG and reduces the expression of glycolytic genes. Mean fluorescence intensity (MFI) of 2-NBDG uptake in A) Dal-4 and B) 1426 cells treated with propranolol (100 µM) for 2 hours or 18 hours. Data represent three independent experiments and are reported as the mean ± SEM. Relative mRNA expression of several rate limiting enzymes involved in glycolysis and gluconeogenesis in C) Dal-4 and D) 1426 cells treated with propranolol (100 µM). Data represent the relative gene expression normalized to GAPDH by qRT-PCR. Experiments with each condition were performed in triplicate, and data are reported as the mean ± SEM. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01) HK= hexokinase-1, FBP=fructose-1,6-bisphosphatase, PFK=phosphofructokinase, PEPCK=phosphoenolpyruvate carboxykinase, PK=pyruvate kinase.

Propranolol blocks fatty acid oxidation.

Because propranolol inhibited endocytosis and limited the uptake of Dil-

LDL, we hypothesized that propranolol may reduce β-FAO, as the uptake of fatty acids through endocytosis would also be limited. To test our hypothesis, we used a Seahorse Bioanalyzer in combination with a β-FAO kit to evaluate changes in

6 lipolysis in response to propranolol treatment of hemangiosarcoma cells.

8 Figure 4.3. Propranolol inhibits β−fatty acid oxidation. Representative Seahorse bioanalyzer Fatty Acid Oxidation (FAO) assays calculating OCR in A) Dal-4 and C) 1426 cells treated with propranolol (100 µM) for 2 hours or 18 hours, or R-(+) propranolol ( 50 µM) for 18 hours. OCR was calculated in BSA (control), etomoxir, and propranolol treated B) Dal-4 and D) 1426 cells as experiment controls and analyzed using the same assays shown in A and B. OCR values per time point were normalized to protein content per well (measured after the assay was completed) and plotted against time to visualize the metabolic profiles shown in A-D. OCR (“Basal”), Maximal Respiration, Spare Respiratory Capacity, and ATP production for E) Dal-4 and F) 1426 associated with experiments in A-D. Results for Dal-4 and 1426 experiments are representative of data from at least three separate experiments for each cell line with six replicates for each condition within the experiment. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). C=BSA control, P-B= Palmitate-BSA

Conclusions:

In this study, we investigated the effects of propranolol on the metabolic activity of hemangiosarcoma cells. The results indicated that propranolol increased the membrane potential of mitochondria and promoted changes in mitochondrial metabolism. Furthermore, we found that propranolol inhibited β-

FAO, which may be due to blockade of endocytosis and the reduced uptake of exogenous fatty acids by hemangiosarcoma cells. These changes likely reflect a metabolic switch from the processing of exogenous lipid metabolites to the activation of anabolic pathways and the generation of lipid metabolites necessary to maintain hemangiosarcoma cell survival. In the next chapter, we conducted studies using other adrenergic antagonists to determine if other members of this drug class may be more effective in the treatment of canine hemangiosarcoma and human angiosarcoma.

9 1. Barron, D.A. and D.R. Rowley, The reactive stroma microenvironment and prostate cancer progression. Endocr Relat Cancer, 2012. 19(6): p. R187- 204. 2. McAllister, S.S. and R.A. Weinberg, The tumour-induced systemic environment as a critical regulator of cancer progression and metastasis. Nat Cell Biol, 2014. 16(8): p. 717-27. 3. Shiao, S.L., G.C. Chu, and L.W. Chung, Regulation of prostate cancer progression by the tumor microenvironment. Cancer Lett, 2016. 380(1): p. 340-8. 4. Hanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 646-74. 5. Vander Heiden, M.G. and R.J. DeBerardinis, Understanding the Intersections between Metabolism and Cancer Biology. Cell, 2017. 168(4): p. 657-669. 6. Kang, F., et al., Propranolol inhibits glucose metabolism and 18F-FDG uptake of breast cancer through posttranscriptional downregulation of hexokinase-2. J Nucl Med, 2014. 55(3): p. 439-45. 7. Wei, W.J., et al., Propranolol sensitizes thyroid cancer cells to cytotoxic effect of vemurafenib. Oncol Rep, 2016. 36(3): p. 1576-84.

10 CHAPTER 1:

Introduction

1 Section 1.1: Angiosarcoma

Angiosarcoma (AS) is a highly aggressive and extremely rare soft tissue sarcoma arising from endothelial cells of the vascular or lymphatic systems. With an incidence of approximately 300 cases per year in the United States [1], and representing just 2% of soft tissue sarcomas world-wide [2, 3], the magnitude of occurrence is inversely proportional to the deadly nature of this cancer. Tumors can occur in any anatomical site and are often classified as cutaneous, lymphoedema-associated, radiation-induced, breast, or visceral [4]. As the most common form, cutaneous tumors appear predominantly in skin of the head and neck, encompassing nearly 60% of all cases [1], followed by lesions in the breast, extremities, trunk, liver, and heart [4-7]. Due to the aggressive nature, metastatic disease is common at the time of diagnosis, occurring in approximately 20-30% of patients [7], with occurrences slightly favoring males.

Most tumors arise spontaneously, however the medical community has accepted several risk factors both genetic and environmental including: radiation, chronic lymphoedema, and exposure to toxicants including vinyl chloride, arsenic, anabolic steroids, and thorium dioxide [4, 8-11]. Genetic factors such as neurofibromatosis (NF-1), BRCA1 or BRCA2 mutations give rise to radiation therapy-induced angiosarcoma as a consequence of breast cancer treatment, and Maffucci and Klippel-Trenaunay syndromes [4, 12]. Despite low incidence rates, diagnoses have risen in the last several decades due to radiation received for prior cancers, as well as advancements in diagnostic techniques and histopathological recognition [4]. Comprehensive molecular markers have not yet

2 been identified [4], but genetic abnormalities described in these tumors include

TP53 mutations [13, 14], KRAS mutations [15, 16], and over expression of ETS1 causing metalloproteinase production[16]. Due to their vascular origin, vascular endothelial growth factor-A (VEGF-A) overexpression is commonly found in these tumors [13, 17-19], but no consensus on molecular markers for angiosarcoma has been reached at this time.

Prognoses for angiosarcoma patients are dismal. The expected overall survival times for advanced disease are approximately 9 months for visceral tumors and 13 months for cutaneous tumors, with an overall 5-year survival rate of approximately 31% [5, 19, 20]. Factors attributed to poorer prognoses include large tumors (> 5 cm), higher grading, advanced patient age, metastatic disease, site specificity, and prior radiation exposure; however, the significance of each variable is not clearly defined [5, 7, 21-24]. Approximately 50% of patients with a localized tumor will develop metastatic disease, which dramatically worsens the prognosis by cutting the median survival time from 51 months for localized disease months to just 12 months [7, 25].

Section 1.2: Angiosarcoma therapy

Like many types of cancer, surgical resection is the treatment of choice for localized disease [5, 7, 19]. Due to the high rate of tissue invasion and occurrence in inoperable tissues (e.g. heart, areas of the head and neck), partial or complete resection may not be feasible. For the cases where surgery is performed, reports indicate a local recurrence rate between 35-86%, arising

3 within 8.5-12.3 months after resection [26-29]. Due to the risk of recurrence, adjuvant radiotherapy is recommended [7, 28], yet many studies report mixed outcomes for local control and overall survival [6, 26, 27, 29-31]. In patients with advanced or metastatic disease, systemic chemotherapy using doxorubicin or paclitaxel with or without surgery and radiation improves survival and metastatic control, however, prognoses remain bleak [5, 7, 20, 32, 33]. The rare occurrence of angiosarcoma presents a barrier for extensive study of angiosarcoma and limits therapeutic advancements. Clinical trials are small in number, case series assessing therapies are often retrospective, and few anecdotal approaches for specific tumor types have been established [4]. Moreover, treatment options for angiosarcoma patients are limited, creating a need for further research and novel approaches.

Section 1.3: Novel approaches to treat angiosarcoma

Although patient numbers are limiting, a handful of novel chemotherapeutic agents have been assessed for the treatment of angiosarcoma. Based on the high expression of VEGF in these tumors, therapeutic monoclonal antibodies targeting VEGF have been used as logical approach for treating angiosarcoma. Bevacizumab, an anti-VEGF antibody, showed moderate responses when combined with radio- or conventional chemotherapies in a small number of phase I/II trials [22, 34-36]. Similarly, broad-spectrum tyrosine kinase inhibitors targeting VEGF receptors (VEGFRs), such as sorafenib, pazopanib, and sunitinib, have been tested in several studies

4 [36-38]. Although these studies demonstrated modest increases in survival times and reduction of metastatic development, overall results were generally disappointing [39-41]. As with previous studies, the low patient numbers in these trials made interpretation of the results challenging.

Section 2.1: Drug repurposing of propranolol for cancer therapy

The development of novel anti-cancer agents requires surmounting difficult hurdles in the path from drug discovery and identification, to pre-clinical trials, and clinical studies. The average time from initial experimentation on an anti-cancer compound to regulatory review and clinical use is between 11.4 and

13.5 years [42], with costs ranging between 161 million to 1.8 billion dollars per drug [43]. Despite these numbers, there are currently greater than 40,000 clinical trials investigating new oncology specific therapeutics (clinicaltrials.gov). The estimated success rate for FDA approval of 6.7% is indicative of the difficult path toward drug approval [44].

To circumvent the cost and time required for new therapeutics, scientists have recently turned their attention toward repurposing of older, FDA-approved drugs for cancer therapy. Combining known pharmacokinetics, toxicities, dosing, and mechanisms of action for existing medications with recent advances in our biological understanding of specific cancers has made it possible to take targeted approaches towards cancer with an arsenal of readily-available drugs.

Propranolol, a beta-adrenergic receptor (β-AR) antagonist long used for the treatment of hypertension, cardiac arrhythmias, and anxiety, has been recognized as a potential adjuvant therapy for benign and malignant growths.

5 What occurred as a serendipitous discovery, propranolol was found to cause tumor regression for severe cases of a benign vascular growth called infantile hemangioma (IH) [45]. Since the establishment of propranolol as the gold standard of care for IH, clinicians and researchers have naturally expanded the repurposing of propranolol for malignant tumors. Both benchtop and clinical studies have shown promising results using propranolol against melanoma, breast cancer, pancreatic, prostate, colon cancer, thyroid cancer, and various other tumor types (Table 1.1) [46-51].

Table 1.1: Summary of studies using propranolol against various malignancies (Non-Comprehensive) Cancer Type Models of Study Results of Propranolol Therapy Breast BALB/c mice [52] Reduced stress induced metastatic behavior

Panel of cell lines/ mice [51] Potentiated antiangiogenic and efficacy of Cell lines (human cell HER2 standard therapies amplification) [53] Potentiated trastuzimab in resistant cell lines Colorectal SW480/HT-29 colon carcinoma Reduced migration of cells [54] tumor cells

Cell line panel [55] Reduced viability of human tumor cell lines

Mice [56] Blocked stress effect on tumor growth Leukemia P388 resistant cell line [57] Resensitized cells to doxorubicin

6 Jurkat/ Molt-4 Cells [58] Reduced cell viability ALL cell lines[58]

Reduced VEGF and MMP signaling Melanoma C57BL/6, BALB/c Mice [59] Decreased tumor growth

Panel of cell lines/ NOD SCID gamma mice [60] Decreased proliferation and increased apoptosis in vitro/ decreased tumor volume and metastases in vivo Prostate PC3 cell line [48] Decreased migratory behavior and metastatic tumor growth

PC3 cell line [61] Potentiated rapamycin treatment Pancreatic Panel of cell lines [62] Decreased VEGF and MMP signaling

PC-2 cell line [47] Increased apoptosis

BALB/c mice [63] Inhibited stress enhanced tumor growth

Recent reports indicate that propranolol is effective against angiosarcomas [64-70]. When combined with standard chemotherapy, propranolol has generated positive responses in almost two dozen angiosarcoma patients [64-68, 70], increasing the progression free survival (PFS) and overall survival (OS) by more than 6 months in the cases of advanced disease [71].

Although initial successes are promising, reports of disease progression in propranolol treated patients indicate a gap between our knowledge of the

7 mechanisms behind angiosarcoma susceptibility to propranolol and the development of drug tolerance [71].

Elevated expression levels of β-ARs [72, 73] in both infantile hemangiomas and angiosarcomas may potentially explain the sensitivity to β-AR antagonism by propranolol. However, the high drug concentrations needed to kill tumor cell lines in vitro [64, 71, 73] along with the high doses (≥ 1 mg/kg) administered to angiosarcoma patients to achieve efficacy [4, 66, 71], suggest the anti-tumor effects may be generated via β-AR-independent mechanisms.

Furthermore, propranolol treatment for infantile hemangioma requires high dosing (up to 2mg/kg) and prolonged treatment periods, with ~60% of patients achieving remission within 6 months. For the patients who discontinue propranolol, 10-15% will have disease recurrence, requiring extended therapy

[45, 74-76]. Reports of angiosarcoma patients receiving adjunct propranolol therapy, indicate long treatment periods of at least 11-16 months [66, 71]. The necessity for prolonged treatment and high doses suggests that propranolol may act in a receptor-independent manner that exhausts tumor cell compensatory mechanisms to cause tumor regression.

Section 2.3: The role of Alpha-AR antagonism in malignancy

Drug repurposing of β-AR antagonists for the treatment of various tumors is not unique to propranolol, as carvedilol, a β1,2-AR and α1-AR antagonist, has also been found to benefit cancer patients. In vitro and in vivo studies using carvedilol demonstrated that it exerts antiproliferative and cytotoxic effects on a

8 variety of cancer cell lines, and was more potent than other AR-antagonists in neuroblastoma cells [77-79], Furthermore, results of a retrospective cohort study found that patients receiving long-term carvedilol had a 26% reduction in cancer risk compared to the non-carvedilol cohort [80]. Both propranolol and carvedilol are β-AR targeting, and despite potential superiority to propranolol, the role of

α1-AR antagonism with carvedilol in cancer cells has not been clearly defined.

The α-AR family is subclassified into α1- and α2-ARs [81], and α1-ARs are known to play a role in several cell processes which have been linked to cancer development and growth, including, phospholipases C and A2 signaling, calcium flux and autophagy, and regulation of cell growth signaling via mitogen-activated protein kinase (MAPK) pathways [82-85]. More recent work has demonstrated that α1-AR subtypes display heterogeneous activities in these signaling pathways, and that the influence of each receptor may be tissue or disease specific [81]. Carvedilol is a pan-α1-AR antagonist and may modulate pathways not targeted by propranolol, but further studies are required to determine the role of α1-AR inhibition against vascular tumors like angiosarcoma.

Section 3.1: Lipin-1, a receptor-independent target of propranolol

A β-AR independent target of propranolol is lipin-1, an enzyme responsible for the conversion of phosphatidic acid (PA) to diacylglycerol (DAG)

[86-89]. Both PA and DAG serve multifunctional biological roles in glycerophospholipid synthesis, vesicle formation and trafficking, signal transduction, metabolism, and proliferation [90-94]. Through lipin-1 inhibition,

9 propranolol increases intracellular concentrations of PA and decreases concentrations of DAG, producing an imbalance in these tightly controlled, cellular signaling processes [87, 95].

PA, the most basic membrane phospholipid, serves as an integral component of membrane structure, a precursor for synthesis of a variety of phospholipid species, and regulator of signaling pathways involving protein and lipid kinases/phosphatases, G-coupled proteins, and transcription factors [93].

Direct interaction with these effector proteins implicates PA as a mediator of critical metabolic pathways [96]. The mammalian target of rapamycin (mTOR) is a kinase that binds other proteins to serve as two distinct complexes, mTORC1 and mTORC2. mTORC1 is a well-established metabolic regulator activated by

PA; mTOR1 activity in breast, prostate, lung, melanoma, and brain cancer has been shown to be dysregulated [53, 97, 98]. Among a variety of downstream targets, mTOR activates S6K1 and 4eBP1 to regulate proteins, such as

SREBP1, which are involved in cholesterol and fatty acid synthesis [99-102]. In the presence of propranolol, rising PA concentrations may activate mTORC1 signaling through the phosphatidylinositol (PI) cycle and Akt phosphorylation

(Fig. 1.1), stimulating the rapid synthesis of enzymes involved in the production of cholesterol and lipids. In accordance with this hypothesis, previous studies revealed that propranolol induced a significant upregulation of genes involved in cholesterol and lipid synthesis in a mouse angiosarcoma cell line [73].

Additionally, PA influences metabolic programming by serving as a PI precursor (Fig.1.1) and activating phosphatidylinositol phosphates (PIPs) which

10 are both necessary in the formation and delivery of cytoplasmic vesicles [103-

106].

Figure 1.1. Generic pathway converting PA to PI species and mTORC1 activation. (PIK3C=phosphoinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha, PDK1=pyruvate dehydrogenase kinase 1)

PI is phosphorylated by PI4 kinases to create PI(4)P, which provides the spatiotemporal regulation of vesicle transport and delivery between the Golgi, ER and plasma membrane [107-109]. PI(4,5)P2, another PIP isoform mainly localized to the plasma membrane, is known to influence actin dynamics, further regulating delivery of nutrient containing cytoplasmic vesicles [110-112].

Phosphorylation of PI(4,5)P2 creates PI(3,4,5)P3 which is a key activator of both mTORC1 and mTORC2 complexes; the influential roles of the mTOR complexes in metabolism, proliferation, autophagy, and cell survival have been previously established [113, 114]. Interestingly, dysregulated PI(3,4,5)P3 and AKT signaling have been characterized in cancer, diabetes, cardiovascular, and neurological diseases [109]. Moreover, phosphorylation of PI3P generates PI(3,5)P2, which stimulates mTORC1 activity on the late endosomal-lysosomal membrane to regulate metabolic programming. Conversely, DAG concentrations decrease with lipin-1 inhibition by propranolol, also inducing changes in vesicular transport and autophagic flux [53, 95]. In a 2014 study, Zhang et al. found that DAG is essential

11 for the fusion of autophagosomes with lysosomes through activation of Vps34 kinase to produce PI(3)P, a key activator of membrane fusion. Because propranolol inhibits the conversion of PA to DAG, limited intracellular DAG concentrations are likely to ultimately disrupt autophagosome to lysosome fusion, and ultimately disrupt processing of metabolic substrates.

Section 3.2: Altered PA and DAG concentrations dysregulate endocytosis

Cancer cells are known to use endocytosis (macropinocytosis or receptor- mediated endocytosis) to engulf extracellular material for processing through endo-lysosomal compartments, generating essential constituents for metabolism

[115-117]. PA serves as a precursor to various phosphatidylinositol derivatives and DAG, which have been implicated in the coordinated movement of membranes and the actin cytoskeleton during endocytosis [115, 118-120]. Lipin-

1 inhibition likely disrupts PA and DAG concentrations to dysregulate these processes [121]. PA accumulation in membranes contributes to curvature necessary for vesicle formation and plays a role in recruitment of signaling membrane proteins [122-124]. Another important derivative of PI involved in vesicular trafficking is PI(3)P. PI(3)P is an essential membrane component of early phase endocytic formation called the macropinocytic cup (Fig. 1.2A) [125,

126]. Elevated intracellular concentrations of PA after propranolol treatment are likely to alter membrane curvature and initiation of endocytic processing.

DAG in endocytic vesicle membranes can be converted to PA by DAG- kinase-I to influence membrane curvature and, and vesicle closure [125, 127,

12 128]. DAG also serves an important role in macropinocytosis and vesicle trafficking through activation of PKC and PKD signaling cascades, is involved with PI cycling regulation, and Ca2+ influx [129-131]. Therefore, changes in the concentrations of both PA and DAG induced by propranolol are likely to dysregulate macropinocytosis and acquisition of nutrients for tumor cells.

A B

Figure 1.2: Propranolol inhibits tumor cell macropinocytosis. A) Untreated cancer cell taking in lipid and cholesterol via macropinocytosis with PI(3,4,5)P3, DAG, and PI(3)P signaling for nutrient processing. B) Propranolol inhibits macropinocytosis and induces stress on tumor cell metabolic resources.

Section 3.4: Altered PA and DAG concentrations induce ER stress.

13 Rapid activation of protein synthesis may exceed the protein folding capacity of the endoplasmic reticulum (ER), and as a result, introduce ER stress

[132]. When initiated, three stress sensing ER transmembrane proteins, ATF6α,

IRE1α, and PERK trigger the downstream unfolded protein response (UPR) in an effort to re-establish ER homeostasis and maintain cell survival [133]. Protein translation is halted, chaperones involved in protein folding and transport are activated, and proteins are degraded [134-136]. Protein degradation by autophagy is activated by PERK and IRE1α and is key to restoring normal cell function [137-140]. If stress is prolonged, intrinsic and extrinsic apoptotic pathways are triggered, resulting in programmed cell death [141, 142]. Therefore,

PA accumulation, mTOR activation, rapid protein synthesis, and subsequent folding infidelity possibly induced by propranolol therapy may provoke ER stress,

UPR, and apoptosis in tumor cells.

Figure 1.3. Cancer cells experiencing stress initiate the unfolded protein response (UPR). To return to homeostasis cancer cells experiencing stress activate UPR. PERK, IRE1a, ATF6 activity halts protein translation, initiates pathways to activate chaperones for protein folding, and degrades misfolded proteins. Prolonged stress and irreparable cell damage lead to apoptosis.

14 Section 3.5 Lysosomaltropism of propranolol exacerbates cholesterol and lipid processing

Lysosomotropic drugs are made of weakly basic amine compounds that accumulate in the acidic environment of the late endosomal and lysosomal compartments [143, 144]. As a lipophilic compound, propranolol likely behaves as a lysosomotropic agent by readily diffusing through membrane structures, to accumulate in late endosomes and lysosomes (Fig. 1.4). Studies have suggested that lysosomotropic compounds induce cellular vacuolization to trap nutrients and macromolecules in vacuoles and prevent their processing by disrupting autophagic flux [145, 146]. The consequence of these actions leads to dysregulation of cholesterol and lipid homeostasis, exacerbating cancer cell stress. It has been noted that many lysosomotropic agents have anti-cancer properties and may trigger a cancer-specific lysosomal cell death [147, 148].

While not well understood, this may suggest another β-AR independent mechanism of propranolol that contributes to the detrimental effects of the drug on tumor cells.

Figure 1.4. Molecular structure of propranolol; a lipophilic, weak-base.

Section 4.1: Canine hemangiosarcoma as a tumor model

15 To clarify the anti-cancer mechanisms of propranolol and improve therapeutic approaches in angiosarcoma, further research is needed, but the rare occurrence of this disease (~300 cases per year) presents a major challenge.

Animal models may be the key to navigating this barrier, and are critical to understanding the pathophysiology of cancers, determining the utility of therapeutics, as well as elucidating mechanisms of resistance [149]. Murine models are commonly used preclinical models due to access, ease of use, and extensive genetic characterization [150]. Although these qualities have advanced our understanding of and therapeutic approach to cancer, they do not account for the biological complexities of spontaneously arising cancers, like angiosarcoma.

To fully understand the mechanisms of propranolol affecting angiosarcoma tumor cells, canine hemangiosarcoma is an ideal model for the human disease. Hemangiosarcoma is a spontaneously occurring tumor that is morphologically and clinically indistinguishable from human angiosarcoma.

However, unlike human angiosarcoma, canine hemangiosarcoma occurs commonly, accounting for tens of thousands of cases in dogs each year [151,

152]. Through the canine model, researchers and clinicians have an opportunity to study both diseases with greater access to cell lines, tumor tissues, and clinical cases, all of which will drive innovative approaches for improved outcomes.

Similar to angiosarcoma, hemangiosarcoma is a tumor of endothelial origin that occurs in virtually all tissues, with the most common sites being the viscera (spleen, liver, and heart), followed by cutaneous, and bone lesions [153].

16 Paralleling the human disease, visceral tumors in dogs are more aggressive and result in poorer outcomes due to frequent metastatic disease at presentation [5,

154]. Secondary lesions are often found in the lungs, liver, and mesentery, and are due to hematogenous spreading or localized seeding after tumor rupture. In many of these advanced cases, determining the primary site is not possible because of internal bleeding and/or disseminated intravascular coagulation [153,

155]. The underlying etiologies of hemangiosarcoma are not well characterized, but there is some breed predilection which is suggestive of an underlying genetic component [153].

Section 4.2: Approaches to hemangiosarcoma therapy

As in humans, prognoses for dogs diagnosed with hemangiosarcoma remain dismal. Treatment is made difficult as many tumors are only noticed when the disease has reached an advanced stage, or rupture in a critical, life- threatening event. For the patients who do receive a diagnosis, staging may provide a reliable predictor of patient outcome, [156-158]. Stage I tumors are those confined to one organ without bleeding or rupture, stage II lesions have either ruptured or spread to regional lymph nodes, and stage III disease are those patients with distant metastases [156-158]. For patients with stage I or II cancer, survival times are approximately 6 months, which is shortened in dogs with stage III disease [153].

Surgical excision is the treatment of choice for cutaneous and some visceral tumors [153]. However, for advanced stage splenic tumors (the most

17 common visceral site), surgery alone provides a median survival time of only 2-3 months [157]. Because metastatic disease is common and progression is rapid, surgery in combination with chemotherapy regimens are now the mainstay of treatment [159]. Adding doxorubicin-based chemotherapies after surgery for splenic tumors prolongs median survival times to 5-6 months, with a 1-year survival rate of approximately 16% [153, 156, 160, 161]. Protocols may also incorporate cyclophosphamide and/or vincristine in combination with doxorubicin, however a lack of clear superiority for any combination leaves many patients with poor prognoses [153, 156, 162].

Section 4.3: Novel approaches to hemangiosarcoma therapy

Bleak outcomes offered by current standard of care chemotherapy have prompted further research using alternative approaches to hemangiosarcoma therapy (Table 1.2). Based on the success in human and canine cancer studies,

Vail et al.[158] used liposome-encapsulated immunomodulators (L-MTP-PE), mimicking bacterial cell components, in combination with surgery and doxorubicin therapy to stimulate macrophage and monocyte targeting of hemangiosarcoma cells. Results showed significantly prolonged disease-free survival times for stage I versus stage II dogs, with a median survival time of 277 days compared to 143 for placebo treated patients, suggesting some efficacy of immune stimulation. With the suggestion that immunotherapy in combination with chemotherapy may provide some efficacy, Dow et al. [163] utilized a novel liposome DNA complex (LDC) vaccine derived from tumor tissue in combination

18 with doxorubicin against canine hemangiosarcoma. Results demonstrated a positive humoral immune response to tumor cells, and a median survival time of

182 days compared to 133 with doxorubicin alone. Using alternative approaches proven to work for other cancers, Lana et al. [32] tested the efficacy of a DNA-

Topoisomerase II intercalating drug, etoposide, continuously administered by metronomic pacing in stage II splenic patients. Results showed a median disease-free interval of 178 days versus 126 days for a standard doxorubicin protocol; signifying only mild benefits.

Angiogenesis is critical for tumor development, and high expression of proangiogenic vascular endothelial growth factor (VEGF) found in plasma, serum, and effusions from hemangiosarcoma suggest that this may be a good therapeutic target [153, 164]. In a study by Bray et al. [165] thalidomide, an inhibitor of angiogenic factors VEGF, FGF, and HGF, showed some benefit over several doxorubicin-combination chemotherapy protocols. For stage II splenic tumors median survival time was 172 days for surgery plus thalidomide, compared to 87 for surgery alone, and 141 for doxorubicin/cyclophosphamide/surgery therapy. Similarly, metalloproteinases

(MMPs) serve as proangiogenic enzymes by degrading extracellular matrix proteins for the development of new vessels and tumor growth. Although targeting MMPs has been shown to inhibit angiogenesis [166], a study by

Sorenmo et al. [162] using an MMP inhibitor, minocycline, with standard chemotherapy demonstrated no statistical benefit over standard chemotherapy alone. Furthermore, recent successes using tyrosine kinase inhibitors (TKIs) in

19 other cancers stimulated interest in their efficacy for hemangiosarcoma. Studies using masitinib mesylate, toceranib, imatinib and dasatinib, and a bispecific

EGFR-uPAR agent (eBAT) have been tried in combination with surgery/standard-chemotherapy, offering only modest advantages over standard chemotherapies [159, 167-169]. Overall, results from alternative approaches to hemangiosarcoma therapy have been disappointing. Dogs with hemangiosarcoma continue to have bleak prognoses, highlighting the need for more effective treatments.

Table 1.2: Therapeutic approaches to hemangiosarcoma and outcomes

Therapy Mechanism Approximate Outcome (median survival time) Surgery Tumor Excision 60-90 days, can be curative

Doxorubicin + Surgery DNA intercalation 130-180 days

Cyclophosphamide/Vincristine Crosslinks DNA / 130-180 days +/- Doxorubicin + Surgery Tubulin inhibition

Liposome Encapsulated Stimulates 277 days Immunomodulator (L-MTP- macrophages and PE) + Doxorubicin + Surgery monocytes to target tumor cells

20 Liposome DNA Complex Vaccine stimulates 182 (LDC) + Doxorubicin + anti-tumor humoral Surgery response

Metronomic Etoposide + Complexes with 178 Doxorubicin + Surgery DNA and topoisomerase II

Thalidomide+ Doxorubicin + Blocks 172 Surgery VEGF/FGF/HGF, antiangiogenic

Minocycline + Doxorubicin + Matrix 130-180 days Surgery metalloproteinase inhibitor, antiangiogenic and anti-tissue invasion Mastinib Mesylate / Toceranib Tyrosine Kinase Similar to doxorubicin + / Imatinib / Dsatinib + Inhibitors surgery Doxorubicin + Surgery

In this study, we addressed the need for improved therapeutic strategies against a deadly vascular tumor of dogs; canine hemangiosarcoma. Based on previous data suggesting that propranolol alters hemangiosarcoma lipid homeostasis, our objectives were to characterize the mechanisms behind propranolol activity in tumor cells and determine how modulations to lipid metabolic programing result in tumor cell death. Improved understanding of propranolol activities in tumor cells will allow us to exploit hemangiosarcoma cell vulnerabilities to optimize future therapeutic strategies. As part of this study, we

21 also addressed the question if hemangiosarcoma cells are more sensitive to other AR antagonists than propranolol, and in doing so, provide a foundation for future research using carvedilol for improved anti-tumor treatment. The findings presented here will advance our ability to effectively treat dogs with hemangiosarcoma, as well as translate to improved therapies for a nearly analogous tumor in humans, angiosarcoma.

22 Chapter 2:

Materials and Methods

23 Cell Lines and Culture Conditions

Canine hemangiosarcoma cell lines COSB, DAL-4, and DD-1 were generated as previously described [167, 168]. D-hemangiosarcoma-1426 (referred to as 1426) cells were established from a fragment of a splenic tumor obtained at surgery

(splenectomy) from a 10-year-old neutered male golden retriever. The tumor sample was obtained through permission of the owner. Cell lines were cultured and maintained in endothelial cell growth medium [167, 168] for approximately

10-15 passages before new vials were thawed, ensuring similar passage numbers were used in all experiments. Cells were maintained at 37°C in a 5%

CO2 atmosphere, and the medium was replaced every 2 to 3 days. All cell lines were tested for Mycoplasma and authenticated (Idexx Laboratories, Westbrook,

ME) to validate purity and quality of the cell lines.

Table 2.1: Antibodies Antibody Protein Name Manufacturer, Catalog No. α1-AR Alpha 1 adrenergic receptor Abcam, ab3462

AKT Protein kinase B Cell Signaling, 9272S

P-AKT (S473) Phosphorylated protein kinase B Cell Signaling, 9271S

β1-AR Beta 1 adrenergic receptor Abcam, ab77189

β2-AR Beta 2 adrenergic receptor Abbiotec, 251604

β3-AR Beta 3 adrenergic receptor Bios- bs-1063R

β-Actin Beta actin Invitrogen- A5441

EEA1 Early endosome associated Cell Signaling, 2411S protein 1 FASN Fatty acid synthase Invitrogen, MA514887

GSK3β Glycogen synthase kinase 3 beta Cell Signaling, 9315S

P-GSK3β Phosphorylated Glycogen Cell Signaling, 9336S synthase kinase 3 beta

HMGCR 3-Hydroxy-3-methylglutaryl-CoA Abcam, ab215365 Reductase

IRE1α Inositol-requiring enzyme 1 alpha Cell Signaling, 3294S

P-IRE1α Phosphorylated -inositol-requiring Novus, NB100-2323 enzyme 1 alpha

Lamp1 Lysosome-associated membrane Novus, NB120-19294 glycoprotein 1

LC3B I/II Microtubule-associate protein Novus, NB100-2220 light chain 3

SREBP1 Sterol regulatory binding protein 1 Thermo Scientific, MA5-16124

RAB7 Ras-related protein 7 Cell Signaling, 95746S

Ubiquitin Ubiquitin Cell Signaling, 3933S

4eBP1 Eukaryotic translation initiation Cell Signaling, 4923S factor 4E binding protein 1

P-4eBP1 Phosphorylated Eukaryotic Cell Signaling, 2855S translation initiation factor 4E binding protein 1

Immunoblotting

Standard techniques were used for immunoblotting as previously described

(Khammanivong 2014, Bryan BA). Briefly, protein samples were collected from pelleted cells that were treated with radioimmunoprecipitation assay buffer (RIPA

Buffer) containing Halt Phosphatase Inhibitor Cocktail (#78420, ThermoFisher

Scientific, Waltham, MA) and quantified using the Pierce BCA Protein Assay

(#1859078, ThermoFisher Scientific) measured using a Tecan fluorescent plate reader (Infinite M200 Pro, Mannedorf, Switzerland). Proteins were separated by

SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. Membranes were blocked with 50% Odyssey® Blocking Buffer (LI-

25 COR Biosciences, Lincoln, NE), 5% non-fat dry milk (NFDM), or 5% bovine serum albumin (BSA) diluted in TBST (20mM Tris-HCl pH 7.4, 137mM NaCl,

0.1% Tween-20). After blocking, membranes were incubated overnight at 4°C with primary antibodies diluted in 50% Odyssey Blocking Buffer, 3% BSA, or 5% milk diluted in TBST. After primary antibody incubation, the membranes were washed three times with TBST and incubated with LI-COR IRDye 800CW (780 nm) donkey anti-rabbit and/or IRDye (680 nm) donkey anti-mouse infrared fluorescence dye-conjugated secondary antibodies (LI-COR Biosciences) for 60 minutes at room temperature. Membranes were washed with TBST three times followed by two washes with TBS. The blots were scanned and documented using an Odyssey infrared imaging system (LI-COR Biosciences) at 680nm and

780nm emission wavelengths.

Cell Viability Assay

Hemangiosarcoma cell lines were cultured in hemangiosarcoma cell culture medium to ~80% confluency, detached from the plate surface using trypsin, counted, and plated in 96-well culture plates (#353072 Falcon. Corning, New

York) at 10,000 cells per well in 100 µL of hemangiosarcoma medium and allowed to adhere overnight. Propranolol was diluted in hemangiosarcoma medium and 100 µL was added to the cells to achieve the indicated concentrations. The cells were incubated for the specified time periods, and the viability was determined using the colorimetric Cell Titer 96R Aqueous Non-

Radioactive Cell Proliferation Assay (MTS Assay, Promega, Madison, WI)

26 according to the manufacturer’s instructions. Absorbance was measured using a

Tecan fluorescent plate reader at 485 nm. Viability and standard error (S.E.) were calculated using at least 3 independent experiments for each cell line, and each concentration was tested in triplicate.

qRT-PCR Analysis

Isolation of RNA from hemangiosarcoma cell lines was performed using a

RNeasy Mini Kit (#74106, Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions. Quality and quantity of the RNA samples was measured using a NanoDrop Instrument (Thermo Scientific Nanodrop 2000

Spectrophotometer). Conversion of sample RNA to cDNA was performed using a

SuperScript VILO cDNA Synthesis Kit (#11754050, ThermoFisher Scientific) according to manufacturer’s instructions. The cDNA was diluted to working concentration of 6.25 µg/mL. Reaction mixtures were prepared using a

LightCyclerR 480 SYBR Green I Master Mix kit (#04707516001 Roche, Basel,

Switzerland), and then mixed with the cDNA generated from the treated samples.

Canine specific forward and reverse primers were used for the qRT-PCR reactions, see Table 1.2. Reactions were carried out using a LightCycler 96

System (#05815916001, Roche,) with a 3-step, 45 cycle protocol, and a 60°C annealing temperature according to manufacturer’s instructions. Data was quantified using the delta-delta Cq method and normalized to the GAPDH housekeeping gene. Analyses were repeated with three individual replicates per experiment, and at least three assays per cell line.

27 Table 2.2: qRT-PCR Primers Gene Gene Name Forward Sequence Reverse Sequence Symbol (5’-3’) (5’-3’) α1-AR Alpha 1 adrenergic TACTGTCGCGTGTACGTG TCCGAGTCCGACTTGTCAGT receptor GT

β1-AR Beta 1 adrenergic TCGAGACCCTGTGTGTCA AGCACTTGGGGTCGTTGTAG receptor TC

β2-AR Beta 2 adrenergic CTGCAGACGGTCACCAAC CGCACAATACGTCAATGGAA receptor TA

β3-AR Beta 3 adrenergic GAGGCAACCTGCTGGTCA CACGTCCACTGAGGTCCA receptor T

FASN Fatty Acid TTGATTTTAAAGGGCCCA CTTGAGCAGGATGTAATGC Synthase G F-1,6- Fructose-1,6- GTCAGAAGAAGATAAGCA TTGGAAGATCCATCAAGGG BP Bisphosphate CG

GAPD Glyceraldehyde 3- GGAGTCCACTGGCGTCTT GAGGCATTGCTGATGATCTTG H phosphate CAC AGG dehydrogenase HK1 Hexokinase 1 CGAGTCATGATTGTCTATC AGGATGACCAAGTCAAGAAG AG HMG- 3-Hydroxy-3- TGACCATCTGTATGATGTC ATCACTGCTTAAAACATCCTC CR methylglutaryl-CoA C Reductase

PFK Phosphofructokina TTAACCTCTGGTGGAGAT CATGGACAAAGAAGACACG se1 G

PEPCK Phosphoenolpyruv CGCGATCTCTATCTGCCA CTGCTGCCTCTCGAAGTACT ate carboxykinase CT PK Pyruvate kinase CAATATCGTCAAGGTCGT TTCCGGTCTATTTTCTTGAC G SREBP Sterol-regulatory GAATAAGTCTGCTGTCTTG CTTCAGTGACTTGCTTTTG 1 binding protein1 C

SREBP Sterol-regulatory AGACAGATTCGCTTGTTTT AGAGTTGGTACTTGAAGGG 2 binding protein2 G

RNA sequencing and Ingenuity Pathway Analysis

RNA sequencing (RNA-Seq) analysis of canine hemangiosarcoma lines was performed as previously described (Khammanivong Oncotarget2016). Differentially regulated genes (fold-change ≥ 1.9, false discovery rate or FDR < 0.05) were

28 further interrogated for co-regulation in tumor cell lines based on Pearson correlation analysis across all tumor samples. Correlation coefficient (r) of less than or equal to -0.45 or greater or equal to 0.45 and FDR < 0.05 were used as cutoff criteria. For RNA-Seq analysis, total RNA was extracted from cells grown as heterogenous monolayer cultures. Three independent replicate monolayer cultures of COSB, Dal-4, and 1426 cell lines were submitted for analysis. RNA quality analysis was performed for each sample using Agilent Bioanalyzer

(Agilent Technologies, Santa Clara, CA) and only samples with RNA integrity number (RIN) > 8.0 were submitted for library preparation using Illumina v4 chemistry and sequencing using Illumina HiSeq 2500, 50 bp paired-end read, high output mode (University of Minnesota Genomics Center) at a depth of approximately 20 million reads. FASTQ analysis was performed for each sequencing data with a mean quality score of > 35. Sequencing data was then mapped to canine reference genome from ensemble.org using MapSplice 2.2

(Nucleic Acids Research 2010; doi: 10.1093/nar/gkq622). Transcript abundance was calculated using Subread featureCounts (Bioinformatics. 2014 Apr

1;30(7):923-30. doi: 10.1093/bioinformatics/btt656) and total transcript count values were collapsed to the gene level based on median counts representing total mRNA expression levels. Expression value of each gene was further normalized to total reads and presented as reads per million (RPM). Differential expression analysis was performed using Signal-Noise ratio and fold-change statistical analysis using GENE-E/Morpheus

(https://software.broadinstitute.org/GENE-E/;

29 https://software.broadinstitute.org/morpheus/). Gene pathway and functional analysis was performed using Ingenuity Pathway Analysis (Qiagen, Redwood,

CA).

Glucose Uptake Assay

Hemangiosarcoma cells were seeded into 6-well, culture plates at a density of

250,000 cells/well and incubated under standard conditions for 24 hours. Cells were then treated with propranolol as specified for each experiment. Prior to the addition of 2-Deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]-D-glucose (2-

NBDG) (#6065, Tocris, Bristol, United Kingdom) the hemangiosarcoma medium was removed and replaced with glucose free DMEM/F12 supplemented with

10%FBS, 1% HEPES, 0.1% heparin, and Primocin (50 mg/mL) antibiotic, and the specified concentrations of 2-NDBG were added for 20 minutes. Cells were then washed once with PBS, trypsinized, pelleted, and maintained on ice until analysis. Propidium iodide (Thermo Fisher Scientific, P3566) was added to each sample before flow cytometry to exclude dead cells from analysis. Fluorescently- labeled 2-NBDG was detected using an LSRII flow cytometer (BD Biosciences,

East Rutherford, NJ). The data were analyzed using FlowJo software (Tree Star

Inc., Ashland, OR). Assays were repeated at least three times per cell line.

Mitochondrial Coupling Assay (TMRE)

Cell lines were seeded in hemangiosarcoma medium at a density of 250,000 cells/well in 6-well culture plates for 24 hours. Each drug concentration was

30 tested in triplicate for the specified times. One hour prior to flow cytometry analysis, cells were treated with tetramethylrhodamine, ethyl ester (TMRE) and carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone) (FCCP) reagents included in the TMRE Mitochondrial Membrane Potential Assay Kit (#ab113852,

Abcam, Cambridge, United Kingdom), as indicated by the protocol. Each experimental condition included TMRE only, TMRE plus FCCP, and FCCP only.

FCCP was diluted to a final concentration of 20 µM and added to the cells as indicated 10 minutes prior to the addition of TMRE. Next, TMRE was added to specified wells at a final concentration of 300 nM and the cells incubated under standard conditions (37C, 5% CO2) for 30 minutes. Following the addition of

TMRE, the cells were washed once with PBS, trypsinized, pelleted, and maintained on ice until analysis. Fluorescence was detected using an LSRII flow cytometer, and the data were analyzed using FlowJo software. Assays were repeated at least three times per cell line.

Figure 2.1: TMRE assay workflow

Figure 2.2: Mechanism of TMRE dye accumulation. TMRE is a cell permeant, positively-charged dye that accumulates in the mitochondrial matrix of active mitochondria. Depolarized (uncoupled or FCCP-treated) mitochondria have decreased membrane potential and do not sequester the dye

Transferrin Assay

The cell lines were seeded in hemangiosarcoma cell culture medium at 250,000 cells/well in 6-well culture plates for 24 hours prior to the assay. Drug treatment conditions were applied as indicated. Prior to beginning the assay, the cell

32 culture medium was exchanged for 1 mL of DMEM/F12 supplemented with 1%

BSA and 20 mM glucose (pH 7.4). Alexa Fluor TM 488 Conjugated Transferrin

(#T13342, Invitrogen) was then added to wells at a concentration of 25 µg/mL, and the cells were incubated under standard conditions for 15-20 minutes. The cells were then washed once with PBS, trypsinized, pelleted, and maintained on ice until analysis. Controls included untreated cells incubated with transferrin, and transferrin in culture medium devoid of cells Fluorescence was detected using an LSRII flow cytometer, and data were analyzed using FlowJo software.

Assays were repeated at least three times for each cell line.

Figure 2.3: Transferrin uptake as a measure of receptor-mediated endocytosis. Transferrin is bound by specific receptors on the cell surface and is transported into the cell via receptor-mediated endocytosis. This process involves inward budding (invagination) of the plasma membrane with help from adaptor proteins, clatherins, to form a clathrin-coated pit. As the pit matures, it is cleaved through membrane binding and fission. Finally, the vesicle fuses with an endosome for sorting and processing.

Dil-LDL Uptake

The hemangiosarcoma cell lines were seeded in hemangiosarcoma cell culture medium at 250,000 cells/well in 6-well culture plates for 24 hours prior to the assay. Prior to the addition of propranolol, the cell culture medium was replaced with hemangiosarcoma medium containing 10% cholesterol-depleted serum.

Samples were treated using three scenarios: 1) cells were pretreated with propranolol (100 µM) for 2 hours followed by addition of Dil-LDL (#L3484,

ThermoFisher) at a concentration of 5 µg/mL; 2) cells were treated with propranolol (100 µM) and Dil-LDL (5 µg/mL) added at the same time point; and

3) cells were treated with Dil-LDL (5 µg/mL) alone. Cells were incubated for either 4 or 18 hours following the addition of Dil-LDL in all scenarios. Cells without the addition of Dil-LDL were used as a negative control. Excess Dil-LDL was removed by a washing with PBS, the cells were removed from the dish using trypsin, and pelleted by centrifugation. The cells were placed on ice until analysis. Fluorescence was detected using an LSRII flow cytometer, and data were analyzed using FlowJo software. Assays were performed at least three times per cell line.

Seahorse

Metabolic analyses of the hemangiosarcoma cell line panel were carried out using a Seahorse XFe96 Bioanalyzer (Agilent, Santa Clara, CA) and an XF Cell

34 Mito Stress Test Kit (#103015-100, Agilent). The concentrations of the inhibitors

(oligomycin, FCCP, rotenone/antimycin A) and cell numbers per well were optimized for each cell line. For the mitochondrial stress test, hemangiosarcoma cells were plated in a 96-well cell culture plate with 150 µL hemangiosarcoma medium and incubated for 24 hours under standard conditions. The next day, the cell culture medium was replaced and cells were treated with propranolol as indicated. On the day of the assay, the medium was also replaced with the Mito

Stress Medium 45 minutes prior to beginning the assay. The assay was carried out according to manufacturer’s 3-step protocol. For the Fatty Acid Oxidation

(FAO) assay, cells were plated and incubated using the conditions established for the Mito Stress assay. The next day, the cell culture medium was exchanged for the substrate-limited medium (DMEM with 0.5 mM glucose, 1 mM GlutaMAX,

0.5 carnitine, and 1% FBS), as specified by the manufacturer. Cells were then treatment with propranolol as indicated. On the day of the assay, the cell culture medium was replaced with the FAO Assay Medium, per the manufacturer’s recommendations and added at 135 µL/well. The assay cartridge was loaded with Mito Stress Test Kit assay reagents as above. Fifteen minutes prior to starting the assay, the CPT-1 inhibitor, etomoxir, was added at a final concentration of 40 µM to the specified wells. Immediately prior to beginning the assay, either the XF Palmitate-BSA FAO substrate or BSA (#102720-100, Agilent

Seahorse Bioscience) was added to specific wells at 30 µL/well. The assay protocol was run according to the 3-step, protocol recommended by the manufacturer. The data were analyzed using the Agilent Seahorse Wave

35 software, and the values normalized using BCA protein analysis. The assay was performed with six replicates per assay and at least three assays per cell line.

The MitoStress kit measures cellular oxygen consumption rate (OCR) in real time as an indicator of mitochondrial function using three modulating compounds (Fig. 4.1). After taking baseline measurements, tumor cells were treated with oligomycin to inhibit ATP synthase (Complex V), which reduces mitochondrial respiration. When compared to baseline readings, this phase of the analysis allows for evaluation of ATP production attributed to respiratory metabolism. Next, tumor cells are injected with carbonyl cyanide-4

(trifluoromethoxy) phenylhydrazone (FCCP), which uncouples mitochondrial proton gradient and diminishes membrane potential. The effect of this drug forces cells to run maximal rates of the electron transport chain in an effort to reestablish a proton gradient for ATP production. As a result, oxygen consumption is maximized, allowing for evaluation of the capacity of mitochondria to respond to increased energy demand under stress. Finally, tumor cells are treated with a combination of antimycin A and rotenone (Complex

I and III inhibitors, respectively) which terminate mitochondrial electron transport and subsequent respiratory metabolism. This stage of the assay reveals non- mitochondrial respiration occurring in tumor cells.

Figure 2.4. Mitochondrial electron transport chain targeted in MitoStress analyses. The MitoStress kit uses the three compounds in the following order: 1. Oligomycin, 2. FCCP, 3. Rotenone/Antimycin A to measure key steps in oxidative phosphorylation.

Figure 2.5: Generic Seahorse Bioanalyzer readout. A representative assay profile showing the key parameters of mitochondrial function with compounds added at three time points. Oligomycin: ATP-synthase, complex V, inhibitor, FCCP: membrane uncoupling agent, Antimycin A/Rotenone: electron transport chain complex I and III inhibitors.

Confocal Imaging of Hemangiosarcoma Cells:

Dil-LDL Uptake

37 Cover slips were cleaned and sterilized using Sparkleen (#04-320-4,

ThermoFisher, Waltham, MA) and 100% ethanol, respectively, by alternating steps of sonication and rinsing for 30 minutes and stored in 100% ethanol. The coverslips were rinsed once with PBS and placed into a 6-well culture plate followed by the addition of 250,000 hemangiosarcoma cells in 2 mL of hemangiosarcoma medium to each well, and cells were approximately 50-70% confluent. For evaluation of Dil-LDL (#L3484 ThermoFisher Scientific) uptake, cells were grown on cover slips in hemangiosarcoma medium supplemented with cholesterol-depleted serum in place of FBS and incubated for 24 hours. Then, drug treatment (at indicated concentrations) and Dil-LDL was added according to the manufacturer’s instructions at 5 µg/mL and incubated for the specified time.

Cells were then fixed using a 16% paraformaldehyde (EMS #15714, Hatfield, PA) diluted to 4% in PBS and incubated for 20 minutes, after which the cells were washed three times with 2 mL of PBS and stored at 4 degrees Celsius. For fixation on glass microscope slides, 10uL of ProLong Gold Antifade Mountant with DAPI (#P36931, ThermoFisher Scientific, Waltham, MA) was dropped on a clean glass slide, then the coverslips were placed, cell-side down, over ProLong

Gold on glass microscope slide and allowed to cure in a dark environment for 24 hours.

Vesicle Localization

Cells were grown on coverslips as indicated above. When confluent, medium was replaced with hemangiosarcoma medium supplemented with

38 cholesterol-depleted serum. At that time specific samples were treated with propranolol [100 µM] and incubated for two hours. Following propranolol treatment, Dil-LDL was added at 5 µg/mL to untreated and treated cells and incubated for 18 hours. Cells were fixed with 4% paraformaldehyde in PBS, washed, and then permeabilized with 0.5% Triton 100 (#X100, Sima-Aldrich, St.

Louis, MO) in TBS for 15 minutes. Cells were washed, blocked with a 10% goat serum #005-000-121, Jackson ImmunoResearch Laboratories, West Grove, PA) in TBS for 30 minutes. Cells were then incubated with the following primary antibodies at a 1:1000 dilution: EEA1, RAB7, Lamp1 (See table 2.1 and Figure

2.4) for 1 hour. Cells were washed with 1% goat serum-TBS solution, and incubated with anti-rabbit (#65-6140, ThermoFisher Scientific, Waltham, MA) or anti-goat (#A16003, ThermoFisher Scientific, Waltham, MA) biotinylated antibody at a 1:5000 dilution for 30 minutes. Cells were washed with 1% goat serum in

TBS and incubated with either streptavidin-alexa fluor-488 (#S32354

ThermoFisher Scientific) or streptavidin-alexa flour-700 (#S21383 ThermoFisher

Scientific) for 30 minutes. Finally, cells were washed with water, dried, and mounted onto glass slides with ProLong Gold with DAPI (#36931 ThermoFisher

Scientific) and allowed to cure overnight.

All slides were imaged using an Olympus FluoView FV1000 BX2 Upright

Confocal microscope, owned and maintained by the University Imaging Centers at the University of Minnesota. Images were processed using ImageJ.

Figure 2.6: Endosome and lysosome markers identify stage of processing

Dual-Tagged LC3B Plasmid Imaging-Autophagy Assay

COSB hemangiosarcoma cells were grown in T-25 flasks in 4 mL hemangiosarcoma media to a 90% confluency. Cells were trypsinized, pelleted, washed three times with PBS, and 1x106 cells were removed, pelleted and placed on ice. For transfection, the Lonza SE Cell Line 4D-Nucleofector X Kit L

(#V4XC-1024) was used according to the manufacturer instructions. Conditions for nucleofection had been optimized previously for the COSB cell line. Briefly,

COSB cells were resuspended in a premixture containing 2 µg of the dual-tagged

RFP-GFP LC3B plasmid (#117413, Addgene, Watertown, MA), which was mixed with 100 µL of the SF 4D-Nucleofector XSolution. Cells and reagents were placed in a 100 µL nucleocuvette for transfection using the 4D-Nucleofector Core

Unit and optimized program; DN-100. COSB cells were then plated in a T-25 flask with prewarmed hemangiosarcoma medium. Transfected cells were grown

40 to 90% confluency and under drug selection using geneticin (G-418) over a period of two to three weeks. Once ~70% clonality was reached, cells were then grown on glass coverslips and treated with propranolol [100 µM] for either 2 or 18 hours. Cells were fixed as described above and allowed to cure to a microscope slide using ProLong Gold with DAPI (#36931 ThermoFisher Scientific). Slides were imaged using an Olympus FluoView FV1000 BX2 Upright confocal microscope. Images were processed using ImageJ.

Phosphatidic Acid Assay

Total PA levels were measured in the hemangiosarcoma cell lines using the

Total Phosphatidic Acid Assay Kit (Cell Biolabs, INC. Cat.# MET-5019) according to the manufacturer’s protocol. Briefly, cells were cultured using standard conditions until the cells were approximately 90% confluent. Cells were then treated with propranolol (100 µM) at the indicated times, washed with ice-cold

PBS, and collected using a rubber policeman. The samples were pelleted, resuspended in 1 mL ice-cold PBS, and sonicated. Methanol, NaCl, and chloroform were added to the samples for phosphatidic acid isolation. Chloroform was removed from the samples using a Speedvac and the dried pellets resuspended in assay buffer. Phosphatidic acid levels were measured using the

Tecan fluorescent plate reader and calculated based on standard curves performed for each independent experiment, with three experiments per cell line.

42 Chapter 3:

Propranolol reduces cell viability by disrupting cholesterol and lipid

metabolism and inducing ER stress

43 Rationale and Objectives: Recent studies suggest the β-AR antagonist, propranolol, increases the progression free survival (PFS) and overall survival

(OS) for patients diagnosed with angiosarcoma. The reasons behind angiosarcoma vulnerability to propranolol remain unknown. In this chapter, our objective was to use a comparative approach to identify the mechanisms induced by propranolol in canine hemangiosarcoma cells that contribute to tumor cell death.

Results:

Propranolol reduces hemangiosarcoma cell viability through receptor independent activity

We used a panel of four canine hemangiosarcoma cell lines derived from primary tumor tissues, DHSA-1426 (hereafter referred to as 1426), COSB, Dal-4, and DD-1, to determine the effect of propranolol on tumor cell viability [167-170].

We found that propranolol decreased tumor cell viability in a concentration dependent manner over a 48-hour treatment period in all cell lines (Fig. 3.1A).

These were results were similar to those reported previously for cell lines derived from multiple cancer types [55, 61, 171, 172]. Because relatively high concentrations of propranolol were required to kill hemangiosarcoma cell lines, we next asked if the effects on viability were due to β-AR-independent activity. To answer this question, we exploited the racemic properties of propranolol and compared the actions of the receptor-inactive R-(+) enantiomer with those of its active S-(-) enantiomer on cell viability. Similar concentrations of the R-(+) and

44 the S-(-) enantiomers killed 1426, COSB, and Dal-4 cells (Fig. 3.1B-D). Similar results were obtained using a reconstituted mixture of the two enantiomers. The data for all of the cell lines are summarized in Table 1. Taken together, our results support the hypothesis that propranolol reduces hemangiosarcoma cell viability through β-AR-independent activity.

Figure 3.1: Propranolol reduces tumor cell viability via β−AR independent activity. A) Cell viability of hemangiosarcoma cell lines treated with increasing concentrations of propranolol for 48 hours was determined using an MTS assay. B) COSB, C) Dal-4, and D) 1426 cells were treated with increasing concentrations of the R-(+) or S-(-) enantiomers, or a reconstituted, equimolar mixture of both enantiomers, and cell viability was determined using an MTS

45 assay. Data represent at least three independent experiments for each cell line with triplicates for each concentration. Data are reported as the mean ± SEM.

LC50 ± SEM

Cell Line Propranolol Propranolol R-(+) Propranolol S-(-) Propranolol R-(+), Propranolol S-(-)

COSB 260 ( ± 5.2) 190 (± 6.4) 250 ( ± 7.0) 150 ( ± 4.5) Dal-4 75 ( ± 4.3) 80 (± 2.3) 100 ( ± 1.2) 80 ( ± 2.1) DD-1 225 ( ± 8.0) 195 ( ± 5.1) 210 ( ± 1.0) 190 ( ± 2.0) 1426 273 ( ± 11.0) 200 ( ± 6.8) 190 ( ± 2.3) 200 ( ± 3.1)

Table 3.1. Propranolol and its enantiomers reduce hemangiosarcoma cell viability. The 50% lethal concentration (LC50) of propranolol, its enantiomers, and a reconstituted racemic mixture on hemangiosarcoma cell lines. Cells were exposed to drugs for 48 hours. Data represent at least three independent experiments with triplicates for each concentration and are reported as the mean ± SEM.

Propranolol rapidly increases lipid and cholesterol synthesis in hemangiosarcoma cells.

Propranolol significantly increased the expression of genes involved in the synthesis of lipid and cholesterol metabolites in the mouse angiosarcoma cell line, SVR [71], suggesting that propranolol disrupts lipid and cholesterol homeostasis. To confirm this finding in hemangiosarcoma cells, we used RNA sequencing (RNA-Seq) to profile hemangiosarcoma cell lines treated with propranolol for 18 hours. The results from Ingenuity Pathway Analysis (IPA) of the RNA-Seq data showed that propranolol upregulated genes associated with cholesterol biosynthesis (Fig. 3.2A), as well as genes associated with lipid metabolism (Fig. 3.2B).

Figure 3.2. Propranolol induces expression of genes associated with cholesterol and lipid synthesis in hemangiosarcoma cell lines. A) Ingenuity Pathway Analysis of RNA-Seq data generated from 1426, COSB, and Dal-4 cell lines (n=3 per cell line) treated with propranolol for 18 hours compared to untreated controls (n=3 per cell line). B) Molecular and cellular functions

47 associated with differentially regulated genes are arranged with the most significantly enriched function on the top. Based on these results, we hypothesized that propranolol increases the activity of the sterol regulatory element-binding proteins (SREBPs), a family of transcription factors critical to the regulation of cholesterol and fatty acid biosynthetic gene expression [173]. Propranolol significantly increased the mRNA expression of SREBP1, but not SREBP2, in COSB, Dal-4, and 1426 cells in a time-dependent manner, and expression remained elevated for at least at least 8 hours (Fig. 3.3A-B). The activation of SREBP-1 in the Dal-4 and 1426 cell lines was confirmed by immunoblotting (Fig. 3.3C-D). We then determined the extent to which propranolol regulated the mRNA expression of two genes known to be induced by SREBP-1: fatty acid synthase (FASN), the primary enzyme responsible for the synthesis of fatty acids, and 3-hydroxy-3-methylglutaryl- coenzyme A reductase (HMGCR), the rate controlling enzyme of the mevalonate pathway [173]. Propranolol significantly induced the mRNA expression of FASN and HMGCR in all the cell lines tested (Fig. 3.4A-C). The rapid and prolonged increases in protein expression of FASN and HMGCR were confirmed by immunoblotting in the Dal-4 (Fig. 3.4D,F) and 1426 (Fig. 3.4E,G) cell lines. R-(+) propranolol increased the protein expression of FASN and HMGCR (Fig. 3.4H), confirming these responses to propranolol were independent of β-AR antagonism.

Figure 3.3. Propranolol increases cholesterol and fatty acid synthesis by activating SREBP-1. Relative mRNA expression of A) SREBP-1 and B) SREBP-2 in the COSB, Dal-4, and 1426 cell lines in response to propranolol (100 µM) for 18 hours compared to untreated controls. Data represent the relative gene expression normalized to GAPDH by qRT-PCR. Experiments with each condition were performed in triplicate, and data are reported as the mean ± SEM. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). Representative immunoblots from at least three independent experiments are shown evaluating the expression of precursor and cleaved (active) forms of SREBP-1 in untreated C) Dal-4 cells and D) 1426 cells and treated E) Dal-4 cells and F) 1426 cells in response to propranolol (100 µM) for 18 hours.

Figure 3.4. Propranolol upregulates expression of cholesterol and fatty acid synthesis enzymes. Relative mRNA expression of FASN and HMGCR in the A) COSB, B) Dal-4, and C) 1426 cell lines treated with propranolol (100 µM) for 18 hours. Data represent the relative gene expression normalized to GAPDH by qRT-PCR. Experiments with each condition were performed in triplicate, and data are reported as the mean ± SEM. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). Representative immunoblots of FASN in the untreated D) Dal-4 and E) 1426 cells and treated F) Dal-4 and G) 1426 cells. HMGCR in the untreated H) Dal-4 and I) 1426 cells and

50 treated J) Dal-4 and K) 1426 cells in response to propranolol (100 µM). L) Representative immunoblot of FASN and HMGCR in COSB cells treated with the R-(+) enantiomer (50 µM) for 18 hrs. The data shown are representative of at least three experiments.

Propranolol inhibits endocytosis in hemangiosarcoma cells

The presumptive increase in cholesterol and lipid synthesis enzymes in response to propranolol suggested that cells amplified these anabolic pathways to restore lipid homeostasis. Because proliferating cancer cells demand high levels of cholesterol and fatty acids, which can be supplied through exogenous or endogenous sources [174], we hypothesized that propranolol prevented the uptake of these essential nutrients by inhibiting endocytosis. We used a fluorescently-conjugated transferrin dye that is internalized through clathrin- mediated endocytosis to simulate fatty acid and cholesterol uptake [175].

Propranolol significantly (p ≤ 0.01) decreased the uptake of transferrin by hemangiosarcoma cells within 30 minutes (Fig. 3.5 A-C). This response was sustained over several hours with basal uptake levels recovering around 18 hours. Because mammalian cells can acquire cholesterol as low-density- lipoprotein (LDL)-bound cholesteryl esters through receptor-mediated endocytosis [176], we hypothesized that propranolol would block the uptake of fluorescently-labeled LDL (Dil-LDL). Pre-treatment with propranolol for 2 hours followed by the addition of Dil-LDL for 4 hours or 18 hours significantly reduced the endocytosis of Dil-LDL in the Dal-4 and 1426 cell lines when compared to

51 cells incubated with Dil-LDL alone (Fig. 3.5D). In addition to blocking endocytosis of Dil-LDL, we also noted that propranolol promoted the accumulation of Dil-LDL around the cell nucleus (Fig. 3.5E).

Figure 3.5. Propranolol reduces endocytosis in hemangiosarcoma cells. Transferrin dye uptake in A) COSB, B) Dal-4, and C) 1426 cell lines treated with propranolol (100 µM). Data represent the average uptake in treated samples to controls of three independent experiments reported as the mean ±SEM. D) Dil- LDL uptake in Dal-4 and 1426 cells treated with propranolol (100 µM). Cells were incubated with Dil-LDL alone for 4 hours or 18 hours or pre-treated with propranolol for 2 hours followed by incubation with Dil-LDL for 4 hour or 18 hours. Data represent three independent experiments reported as the mean ±SEM. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). E) Representative images of Dil-LDL (red) uptake and nuclear staining (DAPI, blue) in COSB cells treated with propranolol (100 µM) for 18 hours versus control. Insert at bottom left of images provides enlarged view for enhanced detail.

Lipophilic, weak organic bases, such as propranolol, readily accumulate in acidic lysosomes and have been shown to inhibit intracellular cholesterol transport, an effect that leads to cholesterol accumulation in late endosomal-

52 lysosome compartments [177]. Using markers for early endosomes (EAA-1) and late endosome-lysosomes (LAMP1) we next wanted to determine if propranolol inhibits intracellular cholesterol transport in hemangiosarcoma cells and at what stage this occurs. Co-localization of Dil-LDL with EAA-1 (Fig 3.6A) in hemangiosarcoma cells after propranolol treatment was subtle, but noticeable co-localization of Dil-LDL with LAMP-1 (Fig. 3.6B) was observed after propranolol treatment. These findings indicate that propranolol blocked the processing of endocytosed compounds to a greater extend at the late stage of endosomal- lysosome fusion than the early stages. Because the accumulation of cholesterol inside lysosomes is thought to be invisible to cellular cholesterol sensors [177], our results suggest hemangiosarcoma cells activate lipid and cholesterol synthesis pathways in response to propranolol-induced blockade of endocytosis in order to restore lipid and cholesterol homeostasis and cell survival.

Figure 3.6. Propranolol limits vesicle trafficking in hemangiosarcoma cells. A) Representative images showing co-localization of Dil-LDL (Red) and EEA-1 antibody (Green), and cell nuclei (blue) in control and propranolol-treated (100 µM) COSB cells for 18 hrs. Images are representative of 5 or more fields. B) Representative images showing co-localization of Dil-LDL (Red) and Lamp-1 antibody (Green), and cell nuclei (blue) in control and propranolol-treated (100 µM) COSB cells for 18 hrs. Images are representative of 5 or more fields. Insert at bottom left of the merged images provides enlarged view for enhanced detail.

Propranolol increases phosphatidic acid levels and activates Akt signaling.

We next sought to identify β-AR-independent mechanism(s) induced by propranolol that contributed to the restorative pathways involved in maintaining

54 lipid homeostasis. Lipin-1 is a known target of propranolol and is responsible for the enzymatic conversion of phosphatidic acid (PA) to diacylglycerol (DAG) [178].

Because inhibition of lipin-1 by propranolol has been shown to rapidly increase the intracellular levels of PA [179, 180], we treated hemangiosarcoma cells with propranolol and measured intracellular PA concentrations as a function of time.

Within 5 minutes after initiation of drug treatment, PA levels increased in COSB,

Dal-4, and 1426 cells (Fig. 3.6A-C). Within 15 minutes, PA levels rapidly declined to near baseline levels in the Dal-4 and 1426 cell lines (Fig. 3.6B-C) but return to baseline levels in COSB cells were slower, reaching pre-treatment concentrations at approximately150 minutes (Fig. 3.6A).

Previous studies from our group showed that the addition of propranolol to angiosarcoma [64] and breast cancer [181] cell lines led to a rapid (within 1 hour) and prolonged (at least 24 hours) phosphorylation of Akt. Because Akt is a key regulator of metabolism in cancer cells [182], we looked for pathways induced by propranolol that might lead to the activation of Akt. PA serves as a precursor for synthesis of a variety of phospholipid species, including phosphatidylinositol (PI).

Through a series of kinase reactions, PI is converted to phosphatidylinositol

(4,5)-bisphosphate (PIP2) and ultimately phosphatidylinositol (3,4,5)-tris- phosphate (PIP3) by the activation of phosphoinositide-3-kinase (PI3K). Akt binds to PIP3 at the plasma membrane, where it is phosphorylated and activated by 3- phosphoinositide-dependent protein kinase 1 (PDK1) and mTOR at sites Thr308 and Ser473, respectively. To confirm that propranolol activated Akt in hemangiosarcoma cell lines, we used immunoblotting to evaluate changes in the

55 phosphorylation of Akt (Ser473) over time [183]. Propranolol increased the phosphorylation of Akt in Dal-4 (Fig. 3.7D) and 1426 (Fig. 3.7E) cells within 15-30 minutes. To determine if the increases in p-Akt could be attributed to the predicted increase in PIP3 levels via the conversion of PA to PI metabolites, we used confocal imaging to monitor changes in PIP3 levels and localization in response to propranolol. In agreement with our hypothesis, we observed a ring- like formation of PIP3 at the plasma membrane of propranolol treated cells (Fig.

3.8). Our data also show that propranolol activates a common mechanism in hemangiosarcoma, angiosarcoma, and breast cancer cell lines.

56 Figure 3.7. Propranolol increases phosphatidic acid levels and activates Akt. Phosphatidic acid levels in A) COSB, B) Dal-4, and C) 1426 cells treated with propranolol (100 µM) relative to untreated controls. Data are representative of at least three independent experiments for each cell line. All concentrations of PA were analyzed in duplicate for each experiment. The data points shown are representative of the mean ± S.D. Representative immunoblotting of Akt and phospho-Akt in D) Dal-4 and E) 1426 cells treated with propranolol (100 µM). The data shown are representative of at least three experiments.

Figure 3.8. Propranolol induces PI(3,4,5)P3 localization to the plasma membrane. Representative confocal images of PI(3,4,5)P3 (red) and DAPI (blue) in 1426 cells treated with propranolol (100 µM) for 15 minutes. Images are representative of at least 5 fields.

Propranolol activates SREBP-1 signaling through mTORC1-dependent and

-independent pathways.

Because mTORC1 is activated by Akt and promotes the downstream activation of SREBPs [98, 100, 184, 185], we sought to determine if propranolol activated mTORC1 signaling in hemangiosarcoma cells as part of the mechanism to restore lipid and cholesterol homeostasis in hemangiosarcoma cells. We measured changes in phosphorylation of 4E-BP1, a translation repressor protein inhibited by mTORC1, as a marker of mTORC1 activation.

57 Phosphorylation of 4E-BP1 was detected within 15 minutes of treatment and persisted for at least 60 minutes in Dal-4 and 1426 cells (Fig. 3.8A-B), supporting activation of mTORC1, and hence SREBP-1, by propranolol.

We previously showed that propranolol rapidly induced the phosphorylation of GSK-3β in angiosarcoma and breast cancer cell lines [64,

181]. Phosphorylation and inhibition of GSK-3β by Akt has been shown to prevent the degradation and promote the nuclear accumulation of SREBP-1

[186], suggesting a mechanism for the prolonged activation of lipid and cholesterol synthesis pathways. We confirmed that propranolol increased the phosphorylation of GSK-3β within two hours in COSB cells (Fig. 3.8C) and within

30 minutes in Dal-and 1426 cells (Fig. 3.8D-E), supporting our data showing the prolonged increases in transcription of FASN and HMGCR mRNA.

Figure 3.9. Propranolol activates Akt signaling pathways. Representative immunoblots of 4E-BP1 and phospho-4E-BP1 in the A) Dal-4 and B) 1426 cell lines, and GSK-3β and phospho-GSK-3β in C) COSB, D) Dal-4, and E) 1426 cells treated with propranolol (100 µM). The data shown are representative of at least three independent experiments for each cell line.

Propranolol induces ER stress and blocks autophagic flux.

We next sought to investigate how alterations in these signaling pathways could lead to reduced tumor cell viability. Based on the rapid increases in FASN and HMGCR levels in response to propranolol, we hypothesized that the predicted increases in protein expression could induce translational infidelity and

ER stress. In acute phases of ER stress, cancer cells respond by activating the

59 unfolded protein response (UPR) to reestablish ER homeostasis [131, 187]. To investigate this mechanism, we first questioned whether propranolol increased the levels of ubiquitin as an indicator of increased protein degradation via proteasomes. Propranolol increased the number of ubiquitinated proteins in Dal-

4 and 1426 cells (Fig. 3.9A-B) within 2 hours of treatment, and these increases persisted up to 18 hours. The protease inhibitor, MG132, was used as a positive control to induce protein ubiquitination the human breast cancer cell line, MDA-

MB-231 (Fig. 3.9C).

To determine if propranolol induced the unfolded protein response in hemangiosarcoma cells, we measured the levels of the UPR regulatory enzyme

IRE1α by immunoblotting. When phosphorylated, IRE1α splicing activity leads to translation of transcription factors that promote proteins important for UPR during

ER stress, such as ER chaperones and endoplasmic reticulum associated degradation (ERAD) gene products [188]. Propranolol increased phosphorylation of IRE1α in Dal-4 and 1426 cells within 1 hour of treatment, and this response persisted for at least 18 hours (Fig. 3.9D-E). These results suggest that propranolol introduces ER stress and activation of UPR pathways in response to the rapid induction of protein and potentially fatty acid and cholesterol synthesis.

Figure 3.10. Propranolol induces ER stress. Analysis of ubiquitin expression in A) Dal-4 and B) 1426 cell lines treated with propranolol (100 µM). C) MDA-MB- 231 human breast cancer cells were treated with the protease inhibitor MG-132 and analyzed for ubiquitin expression as a positive control. Protein expression of IRE-1α and phospho-IRE-1α in D) Dal-4 and E) 1426 cells treated with propranolol (100 µM) and analyzed by immunoblotting.

Autophagy is a mechanism used by cells to degrade and recycle cellular components for generation of building blocks and ATP necessary for survival. In response to prolonged ER stress, cells can activate autophagy to maintain essential nutrient supplies [130]. Evidence suggests that inhibition of lipin-1 obstructs the late stages of autophagy. Lipin-1 is also critical for the conversion of PA to DAG, which are known to regulate vesicular transport processes involved with autophagic flux [91, 120-122, 189, 190]. Based on these studies, we hypothesized that propranolol would also inhibit autophagic flux. To test this premise, we measured the processing of microtubule-associated protein light chain 3B (LC3B), an established marker for autophagosome maturation and

61 docking [191]. Conversion of the cytoplasmic form LC3B-I form to the autophagosomal membrane bound LC3B-II conjugate serves as an indicator of autophagosome progression [192]. As the autophagosome fuses with the lysosome to form the autolysosome, LC3-II is degraded by luminal hydrolases.

Accumulation of LC3B-II suggests elevated autophagy, but autophagosome- lysosome fusion may also be obstructed based on the lack of LC3B-II degradation. Propranolol increased the ratio of LC3B-II to LC3B-I within 30 minutes, and this response persisted for up to 4 hours in Dal-4 and 1426 cells

(Fig. 3.10A-B). Serum starvation and treatment with chloroquine, an anti-malarial drug known to block autophagic flux, were used as positive controls and induced similar responses.

To confirm that propranolol inhibits autophagic flux, we transfected a dual

RFP-GFP-tagged LC3B plasmid into the COSB cell line. The tagged LC3B protein generates a yellow fluorescent signal (merging of red and green fluorescence). As the fusion of the autophagosome with the lysosome occurs,

GFP fluorescence is quenched due to the low pH of the lysosome. Progression through autophagosome-lysosome fusion is thus indicated by a red fluorescent signal, and blockade is indicated by an increase in yellow fluorescence.

Untreated COSB cells exhibited small areas of green and red co-localization

(yellow emission) and predominantly red vesicles, suggesting complete autophagic processing. Propranolol induced a substantial increase in the levels of yellow fluorescence in COSB cells (Fig. 3.10C). Collectively, these data

62 suggest that propranolol inhibits autophagic flux during late stage autophagosome-to-lysosomal fusion.

Figure 3.11. Propranolol blocks autophagic flux. Protein expression of LC3B-I and LC3B-II in A) Dal-4 and B) 1426 cells treated with propranolol (100 µM). Cells were serum starved or treated with chloroquine (50 µM) as positive controls. C) Confocal images of COSB cells transfected with the dual-tagged GFP-RFP-LC3B plasmid and stained with DAPI (blue). Cells were treated with propranolol (100 µM) for 18 hour. Images are representative of at least 5 fields. Insert at bottom left of images provides enlarged view for enhanced detail.

Conclusions:

In this chapter, we found that propranolol reduces viability in a panel of hemangiosarcoma cell lines and identified possible mechanisms underlying its cytotoxic effect. As propranolol is a well-known β-AR antagonist that is employed clinically in its racemic form, it was important to first determine if the drug’s cytotoxic effects were mediated through adrenergic receptors. Therefore, we used enantiomers of propranolol to establish that the drug acts through a β-AR

63 independent mechanism to increase cholesterol and lipid synthesis, likely in response to decreased endocytic activity induced by propranolol. Moreover, our results show that rapid increases in PA levels led to Akt-mediated activation of mTORC1, inhibition of GSK-3β, stabilization and nuclear accumulation of

SREBP-1, and translation of enzymes regulating cholesterol and fatty acid synthesis. In addition to limited access to extracellular sources of metabolites, we also found that propranolol inhibits autophagic flux, further restricting potential nutrient sources. These data suggest that the rapid synthesis of proteins, and presumably fatty acids, induces ER stress, blocks cell cycle progression, and strains tumor cell metabolic resources. We hypothesize that with prolonged propranolol activity, tumor cells are prohibited from reestablishing protein and lipid homeostasis, eventually leading to cell death. In the next chapter, we will investigate whether hemangiosarcoma metabolic programming and mitochondrial function are altered by propranolol.

Chapter 4:

Propranolol impairs mitochondrial activity and inhibits fatty acid oxidation

65 Rationale and Objectives:

Cancers such as breast and prostate ductal adenocarcinomas have adapted to use exogenous uptake of extracellular nutrients from the tumor microenvironment to remain aggressive under challenging environmental conditions [193-196]. We found that hemangiosarcoma cells exhibit uptake of cholesterol and potentially fatty acids to sustain aggressive growth and proliferation. Our results demonstrate that propranolol inhibits cholesterol uptake in hemangiosarcoma cells, inducing endogenous compensatory mechanisms through rapid and prolonged synthesis of fatty acids and cholesterol metabolites.

These metabolically expensive processes require high levels of ATP, and more importantly, large quantities of NADPH [197]. Our objective in this chapter was to determine how hemangiosarcoma cells adjust their metabolism to compensate for the loss of extracellular metabolites.

Results

Propranolol alters mitochondrial activity of hemangiosarcoma cells.

To evaluate changes in cellular metabolism in response to racemic propranolol, we analyzed hemangiosarcoma cell mitochondrial activity using a

66 independent mechanisms, we also examined the actions of R-(+)-propranolol and obtained similar results in 1426 cells (Fig. 4.1B). Propranolol also decreased basal metabolism, maximal respiration, spare respiratory capacity, and ATP production in these cell lines (Fig.4.1C-D). To further evaluate changes in mitochondrial function, we used a tetramethylrhodamine ethyl ester (TMRE) dye assay. Propranolol increased TMRE dye accumulation in Dal-4 and 1426 cells, indicating that propranolol increased the mitochondrial membrane potential in both cell lines (Fig. 4.1E-F). Taken together, these data suggest that propranolol disrupts mitochondrial activity and limits oxidative phosphorylation in hemangiosarcoma cells.

68 fluorescence intensity (MFI) of TMRE in E) Dal-4 and F) 1426 cells treated with propranolol (100 µM) for 2 or 18 hours, or with (R+)-propranolol (50 µM) for 18 hours. Data are representative of at least three independent experiments with triplicates for each concentration and reported as the mean ± SEM. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). C=control; Pro= racemic propranolol; R-(+) = R-(+) enantiomer of propranolol.

Propranolol limits the uptake and processing of glucose by hemangiosarcoma cells.

Because propranolol has been shown to limit glucose uptake in breast cancer and thyroid cancer cells [198, 199], we evaluated the effect of propranolol on glucose uptake and processing in hemangiosarcoma cells. Using the fluorescent glucose analog, 2-NBDG, we found that propranolol significantly (p ≤

0.01) reduced 2-NBDG uptake in Dal-4 cells within 2 hours, and this effect was sustained for up to 18 hours. Propranolol also reduced the uptake of 2-NBDG in

69 reduced expression of genes, whose products are known to regulate early steps of glycolysis.

70 Propranolol blocks fatty acid oxidation.

Because propranolol inhibited endocytosis and limited the uptake of Dil-

Exogenously added palmitic acid increased the basal and maximal OCR in Dal-4 and 1426 cells, indicating that palmitic acid serves as a viable substrate for hemangiosarcoma cell metabolism (Fig. 4.3A, C). In contrast, propranolol reduced basal and maximal OCR levels similar to those observed after the addition of etomoxir, an inhibitor of carnitine acyltransferase I (CPT-1), an enzyme responsible for the uptake of fatty acids from the cytoplasm and their transfer to the mitochondria (Fig. 4B, D). At levels above 5µM etomoxir has been shown to reduce oxidative metabolism independently of FAO inhibition by inducing acute production of ROS in T cells {O'Connor, 2018 #631}. While concentrations of etomoxir used were in accordance with manufacturer established protocols, CPT-1-independent activities by etomoxir at these concentrations may have contributed to reduced OCR noted in hemangiosarcoma cells. We also found that ATP production was reduced by propranolol in Dal-4 and 1426 cells (Figs. 4E-F). BSA served as a control for these assays as it was used as a carrier for palmitic acid. These data suggest that propranolol reduces the consumption of fatty acids by blocking β-FAO, thereby depriving hemangiosarcoma cells of an essential metabolic resource.

72 Figure 4.3. Propranolol inhibits β−fatty acid oxidation. Representative Seahorse bioanalyzer Fatty Acid Oxidation (FAO) assays calculating OCR in A) Dal-4 and C) 1426 cells treated with propranolol (100 µM) for 2 hours or 18 hours, or R-(+) propranolol ( 50 µM) for 18 hours. OCR was calculated in BSA (control), etomoxir, and propranolol treated B) Dal-4 and D) 1426 cells as experiment controls and analyzed using the same assays shown in A and B. OCR values per time point were normalized to protein content per well (measured after the assay was completed) and plotted against time to visualize the metabolic profiles shown in A-D. OCR (“Basal”), Maximal Respiration, Spare Respiratory Capacity, and ATP production for E) Dal-4 and F) 1426 associated with experiments in A-D. Results for Dal-4 and 1426 experiments are representative of data from at least three separate experiments for each cell line with six replicates for each condition within the experiment. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). C=BSA control, P-B= Palmitate-BSA

Conclusions:

Chapter 5:

Carvedilol is a promising adjunctive drug candidate for the treatment of canine hemangiosarcoma

Rationale and Objectives:

Our previous studies demonstrated that propranolol disrupted lipid homeostasis, induced cell stress, and reduced mitochondrial metabolism. While these mechanisms appeared to reduce hemangiosarcoma cell viability, our data also suggested that hemangiosarcoma cells can use these mechanisms to circumvent the detrimental effects of propranolol. Additionally, recent reports indicated the occurrence of disease progression in angiosarcoma patients receiving propranolol [67, 69]. Because other AR antagonists, each with unique chemical properties and specific or non-specific AR affinities, have shown to be beneficial for the treatment of several aggressive cancer types, we hypothesized that we could improve treatment efficacy for angiosarcoma and hemangiosarcoma using an AR antagonist different from propranolol [77, 78,

200-202]. The objectives of this investigation were to identify a drug from the AR antagonist class to which our panel of hemangiosarcoma cell lines would be sensitive, and to determine the effects of the drug on metabolic programming in hemangiosarcoma cells.

Results:

Carvedilol reduces hemangiosarcoma cell viability.

Using MTS viability assays, we screened a panel of drugs classified as AR antagonists to identify potential drug candidates (Table 5.1). Based on their 50%

75 lethal concentrations, we found that hemangiosarcoma cells were most sensitive to carvedilol, an α1-/β1,2-AR antagonist. Because carvedilol is approved as a vasodilator with β-AR blocking properties for treating chronic heart failure, it could represent a ready alternative to propranolol for treating cancer. Like propranolol, carvedilol has been shown to be effective against other malignancies and has

AR-independent activities such as calcium channel antagonism, antioxidant effects, and inactivation of PKC signaling pathways. [77, 200, 203].

LC50 ± S.E. Atenolol ICI-118,551 SR 59230A Carvedilol b b b a1,b COSB 425 (± 20) 210 (± 8) 30 (± 5) 30 (± 2) DD1 364 (± 15) 270 (± 10) 25 (± 4) 45 (± 5) 1426 458 (± 20) 250 (± 20) 35 (± 5) 25 (± 5)

Table 5.1: Screened AR antagonists in hemangiosarcoma cell lines. 50% lethal concentration (LC50) ± SEM of AR antagonists screened in a panel of hemangiosarcoma cell lines. How many experimental replicates.

To more directly compare the effects of carvedilol to results of propranolol viability assays in our panel of hemangiosarcoma cell lines, we added the Dal-4 cell line. We treated cells with carvedilol for 48 hours and found tumor cell viability decreased at concentrations nearly five times less than were required for propranolol (Fig. 5.1A). To determine if the combination of both α1- and β-AR antagonism or α1-AR blockade alone would explain the increased sensitivity compared to propranolol, we examined the individual enantiomers of carvedilol on tumor viability. Using the S-(-) enantiomer to inhibit both α1- and β-ARs, and the R-(+) enantiomer to solely target α1-AR, we found that each enantiomer was

76 as potent as racemic carvedilol in the Dal-4 and 1426 cell lines (Fig. 5.1B, C).

Unexpectedly, Dal-4 cells were more sensitive to the combination of the R-(+) and S-(-) enantiomers compared to the racemate (Fig. 5.1B). These data show that lower concentration of carvedilol are needed to kill hemangiosarcoma cells, and that their increased sensitivity may be due to α1-AR blockade.

Figure 5.1: Carvedilol and its enantiomers reduce tumor cell viability. A) Hemangiosarcoma cell lines were treated with racemic carvedilol or its individual enantiomers for 48 hours and viability was assessed using an MTS assay. B) Dal-4 and C) 1426 cells were treated with 20 µM of the R-(+) enantiomer, the S-(- ) enantiomer, or a reconstituted mixture of the two enantiomers. Data are representative of three combined independent experiments with triplicates for each drug concentration. Data are reported as the LC50 ±SEM.

77 LC50 ± SEM Cell Line Carvedilol Carvedilol R-(+) Carvedilol S-(-) Carvedilol R-(+), Carvedilol S-(-) COSB 23 ( ± 4.5) 31 (± 4.2) 35 ( ± 3.0) 25 ( ± 2.3) Dal-4 11 ( ± 3.0) 41 (± 3.0) 42 ( ± 2.4) 10 ( ± 1.0) DD-1 38 ( ± 5.0) 44 ( ± 6.2) 47 ( ± 4.7) 39 ( ± 5.5) 1426 25 ( ± 3.8) 51 ( ± 3.1) 46 ( ± 3.7) 44 ( ± 1.3)

Table 5.1: Carvedilol and its enantiomers reduce tumor cell viability. The 50% lethal concentration (LC50) of carvedilol, its enantiomers, and a reconstituted racemic mixture on hemangiosarcoma cell lines. Cells were exposed to drugs for 48 hours. Data represent at least three independent experiments with triplicates for each concentration and are reported as the mean ± SEM.

Carvedilol reduces endocytosis and inhibits processing of cholesterol in hemangiosarcoma cells.

We previously showed that propranolol blocked endocytosis and limited the uptake of cholesterol, leading to a rapid increase in lipid synthesis. To determine if carvedilol had a similar effect on hemangiosarcoma cells, we assessed the impact of carvedilol on endocytosis using a transferrin uptake assay. Both racemic carvedilol and its enantiomers slightly reduced transferrin uptake in the COSB cell line within two hours of drug treatment with significant reductions occurring at 18 hours (Fig. 5.3A). The 1426 cell line was more susceptible to endocytic inhibition by carvedilol, suggesting differences in the effect of carvedilol on endocytic activity for each cell line (Fig. 5.3B).

To evaluate the effects of carvedilol on receptor-mediated endocytosis, we measured the uptake of fluorescently labeled Dil-LDL in hemangiosarcoma cells.

Incubation periods of 4- or 18-hours with Dil-LDL were chosen to provide context of the duration of carvedilol activity and to directly compare these results to those previously obtained with propranolol. Hemangiosarcoma cells were pretreated

78 with carvedilol for 2 hours, followed by the addition of Dil-LDL in the presence of carvedilol for the indicated time points. Pretreatment of cells with carvedilol reduced the levels of Dil-LDL in Dal-4 and 1426 tumor cells similarly at the 4- and

18-hour time points, confirming diminished receptor-mediated endocytosis (Fig.

5.3C).

We next asked if carvedilol treatment blocks processing of cholesterol taken into tumor cells through endocytosis. Using confocal imaging to assess Dil-LDL levels in carvedilol-treated COSB and 1426 cells, we observed increases in the size of cytoplasmic vesicles (Fig. 5.3D, E). These results suggest that carvedilol disrupts processing of cholesterol.

Figure 5.2. Carvedilol reduces endocytosis and sequesters cholesterol in hemangiosarcoma cells. Transferrin dye uptake in A) COSB, B) 1426 cell lines treated with carvedilol (20 µM) or its enantiomers (10 µM). ). Data represent the average uptake in treated samples to controls of three independent experiments reported as the mean ±SEM. C) Dil-LDL uptake in Dal-4 and 1426 cells treated with carvedilol (20 µM). Cells were incubated with Dil-LDL alone for 4 hours or 18 hours or pre-treated with propranolol for 2 hours followed by incubation with Dil- LDL for 4 hours or 18 hours. Data represent the average uptake in treated samples to controls. Data represent three independent experiments reported as the mean ±SEM. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). Representative images of Dil-LDL (red) uptake and nuclear staining (DAPI, blue) in D) COSB and E) 1426 cells treated with

80 carvedilol (20 µM) for 18 hours versus control. Insert at bottom left of images provides enlarged view for enhanced detail. C=carvedilol, R= R-(+) enantiomer, S= S-(-) enantiomer.

Carvedilol increases cholesterol and lipid synthesis.

We used RNA-Seq to profile changes in gene expression in hemangiosarcoma cell lines to determine if carvedilol upregulates genes associated with cholesterol and lipid synthesis similar to propranolol, and to identify any potentially unique pathways altered by carvedilol. Results from IPA of

RNA-Seq data from hemangiosarcoma cells treated for 18 hours with carvedilol showed that carvedilol upregulated genes associated with cholesterol synthesis

(Fig. 5.4A), as well as genes associated with lipid metabolism (Fig. 5.4B). To verify these results, we used qRT-PCR to assess changes in the expression of genes involved in cholesterol and lipid synthesis. Carvedilol significantly increased the expression of FASN and HMGCR in Dal-4 and 1426 cells (Fig.

5.4C,D). Taken together with results of endocytosis studies, these data show that carvedilol limits cellular access to exogenous cholesterol and lipids and suggests that hemangiosarcoma cells activate endogenous anabolic pathways to resolve deficits in extracellular metabolite sources.

Figure 5.3. Carvedilol activates cholesterol and lipid biosynthesis pathways. A) Ingenuity Pathway Analysis of RNA-Seq data generated from 1426, COSB, and Dal-4 cell lines (n=3 per cell line) treated with carvedilol (20 µM) for 18 hours compared to untreated controls (n=3 per cell line). B) Molecular and cellular functions associated with differentially regulated genes are arranged with the most significantly enriched function on the top. qRT-PCR results evaluating the expression of rate limiting lipid and cholesterol enzymes, FASN and HMGCR, in C) Dal-4, and D) 1426 cell lines treated with carvedilol (20 µM) for 18 hours. Data represent the relative gene expression normalized to GAPDH and are shown as the mean± SEM from three combined, independent experiments with each condition performed in triplicate. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01)

Carvedilol alters mitochondrial activity of hemangiosarcoma cells

82 We previously demonstrated that propranolol induced metabolically expensive changes to tumor cell metabolism and altered mitochondrial function.

Our data suggest that carvedilol invokes similar restrictions to and subsequent reprogramming of lipid metabolism. Therefore, we hypothesized that carvedilol might also reduce mitochondrial function. We analyzed mitochondrial activity in our hemangiosarcoma cell lines using a MitoStress kit and Seahorse bioanalyzer. Results of these assays revealed that carvedilol decreased the OCR in 1426 (Fig. 5.5A) cells at the 2- and 18-hour treatment points. Carvedilol also reduced basal metabolism, maximal respiration, spare respiratory capacity, and

ATP production in the hemangiosarcoma cell lines (Fig. 5.5B). To further evaluate the effects of carvedilol on mitochondrial function, we used TMRE assays to measure the membrane potential. We found that carvedilol increased the accumulation of TMRE in COSB and 1426 cells, denoting increased mitochondrial potential (Fig. 5.5C,D). In addition, we found that the enantiomers of carvedilol had similar effects on TMRE accumulation in 1426 cells (Fig. 5.5E).

These data suggest that hemangiosarcoma cells adjust mitochondrial activity to support endogenous production of lipids.

Carvedilol inhibits fatty acid oxidation.

Results of Seahorse analyses using MitoStress kits with propranolol and carvedilol demonstrated reduced mitochondrial function and oxidative phosphorylation. Because we found that propranolol blocked β-FAO, we wanted to know if carvedilol would also block this process. To determine this, we used a

83 Seahorse bioanalyzer and an β-FAO assay to measure lipid metabolic rates in treated hemangiosarcoma cells. In untreated 1426 cells (Fig. 5.6A,B), the addition of palmitic acid increased basal and maximal OCR, indicating increased

β-FAO activity. In contrast, carvedilol reduced the OCR in 1426 cells treated with palmitic acid, suggesting that carvedilol reduced lipolysis. Because BSA is a vehicle for palmitic-acid, unconjugated BSA was used as a control. These data suggest that carvedilol blocks endocytosis, limiting fatty acid uptake into hemangiosarcoma cells, and depriving hemangiosarcoma cells of an essential metabolic resource.

Figure 5.4. Carvedilol alters mitochondrial activity of hemangiosarcoma cells. Representative Seahorse bioanalyzer experiments using a MitoStress Kit in A) 1426 cells treated with carvedilol (20 µM) for 2 or 18 hours. Oxygen consumption rate (OCR) values per time point were normalized to protein content per well (measured after the assay was completed) and plotted against time to visualize the metabolic profiles as shown in A. B) Values for basal OCR (“Basal”), Maximal Respiration, Spare Respiratory Capacity, and ATP production were obtained as described in the Materials and Methods. Results are representative of data from at least three independent experimental runs for each

85 cell line with at least six replicates for each condition. Mean fluorescence intensity (MFI) of TMRE in C) COSB and D) 1426 cells treated with carvedilol with (20 µM) carvedilol for 2 hours and 18 hours. E) 1426 cells treated with the enantiomers of carvedilol (10 µM) for 18 hours. Data are representative of at least three independent experiments with triplicates for each concentration and reported as the mean ± SEM. Differences were tested using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01)

86 Figure 5.5. Carvedilol inhibits FAO. Representative Seahorse bioanalyzer Fatty Acid Oxidation (FAO) assays calculating oxygen consumption rate (OCR) in A) 1426 cells treated with carvedilol (20 µM) for 18 hours. OCR was calculated in BSA (control), etomoxir, and carvedilol treated B) 1426 cells as experimental controls analyzed in the same assay as shown in A. OCR values per time point were normalized to protein content per well (measured after the assay was completed) and plotted against time to visualize the metabolism profiles as shown in A and B. Basal OCR, ATP production, spare respiratory capacity, and maximal respiration of C) 1426 associated with experiments shown above. Results for 1426 experiments are representative of data from at least three separate experiments run for each cell line with six replicates for each condition within the experiment. Data were shown using one-way ANOVA with Bonferroni correction (*p ≤ 0.05, **p ≤ 0.01). C= BSA Control, P-B= Palmitate-BSA.

Carvedilol does not induce changes in PA.

To determine if carvedilol induced changes in PA in hemangiosarcoma cells, we treated cells COSB and 1426 cells with 20 µM of carvedilol for 5, 15, 60,

120, and 240 minutes, and measured PA levels as described previously. In contrast to propranolol, carvedilol did not change PA levels in COSB cells, but did produce a minor and prolonged rise in 1426 cells (Fig. 5.2A,B). These data suggest that carvedilol induces metabolic changes through a different mechanism from propranolol and that changes in PA do not play a key role in the observed metabolic responses.

87 Figure 5.6. Carvedilol increases phosphatidic acid levels in hemangiosarcoma cells. Phosphatidic acid levels in A) COSB and B) 1426 cell lines treated with carvedilol (20 µM) relative to untreated controls. Data are shown as the mean ± S.D. of at least three independent experiments with triplicates for each time point.

Conclusions:

In this chapter, we found that carvedilol was more potent and effective than propranolol in reducing hemangiosarcoma cell metabolism and viability.

Compared to propranolol, carvedilol at relatively lower concentrations killed hemangiosarcoma cells and reprogrammed cholesterol and lipid metabolic pathways. Our results also show that carvedilol reduced endocytosis, metabolite processing, and mitochondrial function, actions that could strain essential cellular resources and contribute to tumor cell death. The use of carvedilol at low, but effective concentrations as an adjunct to cancer chemotherapy would be accompanied by a reduced incidence of adverse effects, the principal side effect being hypotension. Clearly, additional studies are needed to fully define the underlying mechanisms of carvedilol action in hemangiosarcoma cells. Our studies have provided a foundation for future work to determine the roles of α1-

ARs and AR-independent mechanisms in the anti-tumor activity of carvedilol and related drugs.

Chapter 6:

Conclusion

The primary objectives of this dissertation were to determine the mechanisms underlying the lethal effects of propranolol on hemangiosarcoma cells and to define some of the underlying metabolic vulnerabilities in these tumor cells that contribute to their sensitivity to drugs of the adrenergic receptor antagonist drug class. Also, we used hemangiosarcoma as a model for angiosarcoma to identify reasons for why angiosarcomas are sensitive to propranolol. Initial experiments showed that moderately high concentrations of propranolol were required to kill hemangiosarcoma cells in vitro, a finding consistent with the tumoricidal actions of propranolol on other cancer cell lines

[64, 69, 71]. These results, along with reports of the high doses of propranolol (≥

1 mg/kg) administered to human angiosarcoma patients [4, 66, 67, 69], suggested that the anti-tumor effects of propranolol might be attributed to β-AR- independent mechanisms. Through the deployment of propranolol stereoisomers, we found that the β-AR-inactive R-(-) enantiomer reduced tumor cell viability and modulated cell metabolism in ways identical to those induced by racemic propranolol and the β-AR-active S-(+) enantiomer of this drug. These

90 findings support the hypothesis that the anti-tumor effects of propranolol are mediated through a β-AR independent mechanism, a finding that may have positive implications for those hemangiosarcoma and angiosarcoma patients who are unable to tolerate the cardiovascular side effects of propranolol at the high doses required in cancer treatment. Although propranolol is well-tolerated in the general population, angiosarcoma often occurs in older adults, who are more prone to bradycardia, a common side effect of propranolol. Using the R-(-) enantiomer of propranolol might allow patients with susceptibility to bradycardia or patients who experience other dose-limiting adverse effects associated with β-

AR blockade (e.g. hypotension, skeletal muscle weakness) to benefit from propranolol with no side effects. Furthermore, propranolol has been reported to synergize with standard chemotherapy regimens in angiosarcoma patients [69], and R-(-) propranolol might more safely augment neoadjuvant therapy.

In addition, we discovered that the β-AR independent activity of propranolol triggered metabolically expensive, intracellular cholesterol and fatty acid synthesis pathways in hemangiosarcoma cells, leading us to hypothesize that the access of tumor cells to essential, extracellular nutrients was inhibited.

Our finding that hemangiosarcoma cells appear to rely on extracellular lipids for proliferation rather than de novo lipogenesis is a recently recognized hallmark of cancer cells [196] wherein tumor cells preferentially use fuel from the microenvironment yet readily activate anabolic pathways to synthesize essential metabolites during periods of nutrient depletion or environmental stress. This process is perhaps best exemplified by pancreatic ductal adenocarcinomas

91 (PDACs), whose environment is characterized by high interstitial pressures, limited blood flow, and low oxygen supply [115, 204, 205]. Under these conditions, stearoyl-CoA desaturase (SCD1) activity is limited by hypoxia, rendering tumor cells unable to generate the monounsaturated fatty acids necessary for proper membrane fluidity and activity of membrane associated receptors [206-208]. To thrive, PDAC cells effectively use macropinocytosis to provide the essential mono- and polyunsaturated fatty acids and proteins needed for tumor cell proliferation, tumor growth, and to maintain cell membrane integrity

[4, 115]. Unlike PDACs, hemangiosarcomas are highly angiogenic tumors with a microenvironment characterized by focal areas of hypoxia. As blood pools and thrombi develop in malformed blood vessels, areas of focal necrosis emerge and lead to tumor rupture [209]. Under these circumstances, oxygen is likely limiting, forcing hemangiosarcoma cells to rely on macropinocytosis to supply essential lipids and proteins for tumor cell survival and growth. Hypoxia also plays a major role in the progression of angiosarcomas, indicating that these tumors may also rely on extracellular lipid sources [210]. Interestingly, hemangiosarcomas also support glycolysis, as revealed in fluorescent glucose studies in dogs [166]. It is intriguing to speculate that hemangiosarcomas have developed a flexible metabolic phenotype that allows cells to adapt to the rapidly changing oxygen and nutrient sources within the TME. Because experiments in our study were conducted under normoxic conditions, future studies using hypoxic environments should be conducted to further define the metabolic pathways used by

92 hemangiosarcoma cells under these conditions and determine their responses to propranolol.

Mechanistically, we showed that propranolol, and the R-(+) enantiomer, increases PA levels and limits endocytosis in hemangiosarcoma cells, likely through lipin-1 inhibition [87, 211, 212]. These findings are not mutually exclusive as PA, and its lipin-1 product, DAG, are integral components of membrane function and have been implicated in the coordinated movement of membranes and the actin cytoskeleton during endocytosis [113, 117, 213]. PA accumulation within membranes contributes to the curvature necessary for vesicle formation and plays a role in the recruitment of signaling proteins involved in endocytosis and trafficking [120-122]. Likewise, PIP3, a downstream product of PA, is an essential membrane component facilitating macropinocytic cup formation in early endocytosis (Fig. 1.2A). While initiation requires PIP3, its concentrations drop to allow for complete cup closure [123, 124]. This suggests that propranolol- mediated elevations of PA and subsequent conversion to PIP3 may disrupt macropinosome closure and endocytic processing. Results of our experiments are consistent with this proposed mechanism which will require future study for confirmation.

To determine how propranolol induces upregulation of cholesterol and lipid synthesis pathways in hemangiosarcoma cells, we focused on the activation of a key transcription factor for these pathways, SREBP-1. SREBP-1 activity is regulated by an established governing pathway of metabolism known as the

AKT/mTORC1 pathway [91, 94]. PA is a phosphatidylinositol phosphate (PIP)

93 precursor, which generates a variety of downstream species known to influence

SREBP-1 metabolic processes [214]. Of primary interest, PI is converted to PIP2 which binds to and causes translocation of AKT to the plasma membrane for activation. Its kinase activity decreases inhibitory signals to mTORC1, resulting in activation of mTORC1 and downstream SREBP transcriptional activity. These pathways regulate cholesterol and lipid synthesis [215, 216]. Therefore, we hypothesized that the observed changes in cholesterol and fatty acid synthesis pathways occurred through activation of the AKT/mTORC1/SREBP-1 pathway

[215]. While dysregulated AKT/mTORC1 signaling has been described in hemangiosarcoma and angiosarcomas [217], our previous findings suggest that propranolol may not activate SREBP-1 by phosphorylating mTOR [64, 181].

Instead, propranolol appears to induce the phosphorylation of GSK-3 to prohibit phosphorylation-mediated ubiquitination of SREBP-1, leading to stabilization of

SREBP-1 [186]. This stabilization mechanism may explain why propranolol induces prolonged expression of SREBP-1 targets, like FASN and HMGCR mRNA and protein products previously observed, despite transient high PA levels. Phosphorylation of GSK-3 is one of several recently identified alternative pathways found to support SREBP-1 activity. In addition to this pathway, AKT phosphorylation and inhibition of INSIG2A is known to liberate SREBP from its bound state in the ER to move to SREBP to the nucleus for transcriptional regulation [218]. In a second mechanism, mTORC1 phosphorylation leads to the expulsion of lipin-1 from the nucleus, which activates SREBP [215]. Finally, mTORC1-mediated phosphorylation and activation of CREB-regulated

94 transcription coactivator 2 (CRTC2) has been shown to facilitate translocation of

SREBP1 from the ER to the Golgi and delivery the transcription factor to the nucleus [219]. Overall, the long-term activation of SREBP-1 and the blockade of fatty acid uptake reinforces the commitment of cells to anabolic metabolism.

To further investigate the consequences of propranolol on tumor cell metabolism, we focused on central carbon metabolic pathways and mitochondrial function. Real-time analyses suggested that catabolic pathways, such as glycolysis and β-FAO, were reduced in the presence of propranolol, leading to a decrease in the production of ATP. Recent studies in human bladder cancer cells showed that inhibition of FAO was associated with cell cycle arrest at the G0/G1 phase and tumor growth inhibition [220]. Propranolol was shown to block cell- cycle progression in an angiosarcoma cell line [71], suggesting that inhibition of

FAO by propranolol contributes to cell cycle inhibition. Future studies will be needed to validate the mechanisms behind propranolol-mediated cell cycle arrest and how to exploit this effect using rationally designed combinatorial approaches.

Our data suggest the metabolic changes induced by propranolol tax tumor cell resources and promote hemangiosarcoma cell death. An insight into how these two observations were connected was gained when we discovered that drug-treated hemangiosarcoma cells activated the ER stress response. In response to propranolol treatment, proteins are rapidly synthesized, a state that could lead to translational infidelity and accumulation of misfolded proteins.

Upregulated fatty acid synthesis pathways are likely to result in the accumulation of fatty acids leading to lipotoxicity, a known source of ER stress [221, 222]. To

95 reestablish ER homeostasis, we found that hemangiosarcoma cells activate the unfolded protein response, a response commonly used by other cancer types to combat cellular stress [223]. Although confirmation of increased lipogenesis is needed to verify this mechanism, our data support the premise that propranolol treatment prolongs ER stress and the UPR, likely inducing apoptosis.

A secondary, but equally important, objective of this dissertation was to determine if we could repurpose other drugs in the AR antagonist class to enhance results of propranolol treatment in hemangiosarcoma cells and provide a model for future angiosarcoma therapy. Retrospective studies in other malignant tumors such as breast, ovarian, and liver cancers identified that non- specific AR antagonists are more effective than highly-specific β-AR antagonists against malignant tumors [181, 224, 225]. Likewise, we observed that there is a relationship between the effectiveness of an AR antagonist and its lipophilic nature, indicating that its ability to penetrate a cell is important for drug activity.

Carvedilol, an α1-, β-AR antagonist was identified through a screening of potential compounds as a promising candidate. Like propranolol, carvedilol has received increased interest for its use against a number of malignancies, such as osteosarcoma, breast cancer, stomach cancer, and lung cancer [77, 78, 200].

Additionally, there are currently several phase I-III clinical studies currently underway evaluating the benefits of carvedilol as adjunct therapy for prostate and breast cancers (https://www.cancer.gov/about-cancer/treatment/clinicaltrials/intervention/carvedilol). Much like propranolol, repurposing of carvedilol or one of its enantiomers for the treatment of angiosarcoma and hemangiosarcoma

96 patients is reasonable due to a favorable safety profile across a broad range of patients with a variety of comorbidities, as well as accessibility of the drug to physicians and veterinarians [226, 227].

In this study we demonstrated that hemangiosarcoma cells show greater sensitivity to carvedilol when compared to racemic propranolol or either of its stereoisomers. These findings are important because it is more likely with carvedilol or its R-(+)-isomer with its weak alpha-AR antagonistic action that cancer patients could receive the beneficial effects of this drug class at relatively low doses that have limited side effects. To optimize a therapeutic strategy using carvedilol however, it is critical to understand the mechanisms of its anti-tumor activity. Because we previously used stereoisomers to demonstrate that propranolol acts in an AR-independent manner on tumor cells, we again employed this strategy to better understand underlying mechanisms of carvedilol against hemangiosarcoma cells. We found that R-(+) carvedilol, a weak α1-AR antagonist, was equally effective as the S-(-) enantiomer, which has mixed antagonist actions at both alpha- and beta-ARs. Although these results suggest that the effects of carvedilol may not be due to β-AR blockade, the interpretation of these results is more complex than those for propranolol. Extra vulnerability to carvedilol may be attributable to either α1-AR antagonism alone, AR- independent mechanisms (like propranolol), or a combination of these properties.

To determine if carvedilol works through the same AR-independent mechanisms as propranolol, we next measured total PA and found that carvedilol did not stimulate a rapid increase of PA levels in hemangiosarcoma cells. We have yet

97 to determine the why hemangiosarcoma cells are more susceptible to carvedilol, but these results suggest that this drug acts through different, possibly overlapping mechanisms from those underlying the effects of propranolol.

Aside from AR antagonism, previous studies have uncovered several other potential mechanisms of carvedilol activity against cancer cells. First, carvedilol was shown to suppress PKC signaling pathways [200, 203]. PKC is a member of a large family of serine/threonine kinases known to regulate important cell functions such as cell cycle progression, differentiation, and survival and death programming that, when mutated or dysregulated, are known to drive tumorigenesis [228-230]. Attenuation of PKC signaling by specific inhibitors or siRNA has been shown to induce apoptosis in several common malignancies such as bladder cancer, melanoma, osteosarcoma, ovarian cancer, and prostate cancer [231-234]. Interestingly, recent work has demonstrated that inhibition of

PKC by specific inhibitors downregulated immune checkpoint ligands in angiosarcoma cells, suggesting that blocking PKC may enhance immune checkpoint therapy in angiosarcoma patients [235]. Because carvedilol is known to antagonize PKC signaling, results uncovered in these studies suggest it would be an effective therapy for both hemangiosarcoma and angiosarcomas. A second established non-AR mechanism of carvedilol activity is calcium channel inhibition. Because calcium impacts a host of cell processes involving mitochondrial membrane potential, excitability, signaling proteins, vesicle formation and transport, cell motility, apoptosis, and transcription [129, 236], targeting calcium channels as a therapeutic strategy has received considerable

98 interest from the research community as a potential therapeutic target for a number of tumor types. These include breast cancer, endometrial carcinoma, advanced epithelial tumors, ovarian, lung cancer, breast cancer, and a number of other malignant growths [237-241]. In fact, calcium mobilization has been demonstrated to promote cell migration and invasion in hemangiosarcoma cell lines [209]. By antagonizing calcium channels in hemangiosarcoma and angiosarcoma, carvedilol may offer a safe and effective treatment strategy for these cancers.

Our findings provide a broad framework for continued studies regarding the use of propranolol and carvedilol to treat canine hemangiosarcoma and human angiosarcoma patients. This dissertation primarily focuses on the mechanisms behind propranolol activity in hemangiosarcoma cells but lays a foundation for future studies clarifying why tumor cells are more sensitive to carvedilol, and whether carvedilol is a superior option for hemangiosarcoma and angiosarcoma patients. We have established a receptor-independent mechanism by which propranolol, and likely carvedilol, reduce viability in a panel of hemangiosarcoma cell lines. Limited nutrient access to essential cholesterol and lipids provokes compensatory responses that are both taxing and unsustainable in hemangiosarcoma cells. With prolonged treatment periods, the detrimental effects of compounding stress likely lead to apoptosis. Continued studies will determine how propranolol and carvedilol can be used in conjunction with standard therapies to increase progression free and overall survival times, and to improve the quality of life for hemangiosarcoma and angiosarcoma patients.

100 REFERENCES

1. Toro, J.R., et al., Incidence patterns of soft tissue sarcomas, regardless of primary site, in the surveillance, epidemiology and end results program, 1978-2001: An analysis of 26,758 cases. Int J Cancer, 2006. 119(12): p. 2922-30. 2. Coindre, J.M., et al., Predictive value of grade for metastasis development in the main histologic types of adult soft tissue sarcomas: a study of 1240 patients from the French Federation of Cancer Centers Sarcoma Group. Cancer, 2001. 91(10): p. 1914-26. 3. Rouhani, P., et al., Cutaneous soft tissue sarcoma incidence patterns in the U.S. : an analysis of 12,114 cases. Cancer, 2008. 113(3): p. 616-27. 4. Young, R.J., et al., Angiosarcoma. Lancet Oncol, 2010. 11(10): p. 983-91. 5. Fury, M.G., et al., A 14-year retrospective review of angiosarcoma: clinical characteristics, prognostic factors, and treatment outcomes with surgery and chemotherapy. Cancer J, 2005. 11(3): p. 241-7. 6. Mark, R.J., et al., Angiosarcoma. A report of 67 patients and a review of the literature. Cancer, 1996. 77(11): p. 2400-6. 7. Fayette, J., et al., Angiosarcomas, a heterogeneous group of sarcomas with specific behavior depending on primary site: a retrospective study of 161 cases. Ann Oncol, 2007. 18(12): p. 2030-6. 8. Bosetti, C., et al., Occupational exposure to vinyl chloride and cancer risk: a review of the epidemiologic literature. Eur J Cancer Prev, 2003. 12(5): p. 427-30. 9. Locker, G.Y., et al., The clinical features of hepatic angiosarcoma: a report of four cases and a review of the English literature. Medicine (Baltimore), 1979. 58(1): p. 48-64. 10. Huang, Q., et al., The role of adrenergic receptors in lung cancer. Am J Cancer Res, 2018. 8(11): p. 2227-2237. 11. Gaballah, A.H., et al., Angiosarcoma: clinical and imaging features from head to toe. Br J Radiol, 2017. 90(1075): p. 20170039. 12. West, J.G., et al., BRCA mutations and the risk of angiosarcoma after breast cancer treatment. Clin Breast Cancer, 2008. 8(6): p. 533-7. 13. Ravi, V., et al., Identification of therapeutic targets in angiosarcoma. Journal of Clinical Oncology, 2007. 25(18_suppl): p. 10030-10030. 14. Naka, N., et al., Mutations of p53 tumor-suppressor gene in angiosarcoma. Int J Cancer, 1997. 71(6): p. 952-5. 15. Przygodzki, R.M., et al., Sporadic and Thorotrast-induced angiosarcomas of the liver manifest frequent and multiple point mutations in K-ras-2. Lab Invest, 1997. 76(1): p. 153-9. 16. Naito, S., et al., Overexpression of Ets-1 transcription factor in angiosarcoma of the skin. Pathol Res Pract, 2000. 196(2): p. 103-9.

101 17. Zietz, C., et al., MDM-2 oncoprotein overexpression, p53 gene mutation, and VEGF up-regulation in angiosarcomas. Am J Pathol, 1998. 153(5): p. 1425-33. 18. Wong, K.F., et al., Sinonasal angiosarcoma with marrow involvement at presentation mimicking malignant lymphoma: cytogenetic analysis using multiple techniques. Cancer Genet Cytogenet, 2001. 129(1): p. 64-8. 19. D'Angelo, S.P., et al., Outcomes of Systemic Therapy for Patients with Metastatic Angiosarcoma. Oncology, 2015. 89(4): p. 205-14. 20. Holden, C.A., M.F. Spittle, and E.W. Jones, Angiosarcoma of the face and scalp, prognosis and treatment. Cancer, 1987. 59(5): p. 1046-57. 21. Anaya, D.A., et al., Multifocality in retroperitoneal sarcoma: a prognostic factor critical to surgical decision-making. Ann Surg, 2009. 249(1): p. 137- 42. 22. Koontz, B.F., et al., Preoperative radiotherapy and bevacizumab for angiosarcoma of the head and neck: two case studies. Head Neck, 2008. 30(2): p. 262-6. 23. Naka, N., et al., Prognostic factors in angiosarcoma: a multivariate analysis of 55 cases. J Surg Oncol, 1996. 61(3): p. 170-6. 24. Abraham, J.A., et al., Treatment and outcome of 82 patients with angiosarcoma. Ann Surg Oncol, 2007. 14(6): p. 1953-67. 25. Buehler, D., et al., Angiosarcoma outcomes and prognostic factors: a 25- year single institution experience. Am J Clin Oncol, 2014. 37(5): p. 473-9. 26. Mullins, B. and T. Hackman, Angiosarcoma of the Head and Neck. Int Arch Otorhinolaryngol, 2015. 19(3): p. 191-5. 27. Pawlik, T.M., et al., Cutaneous angiosarcoma of the scalp: a multidisciplinary approach. Cancer, 2003. 98(8): p. 1716-26. 28. Mark, R.J., et al., Angiosarcoma of the head and neck. The UCLA experience 1955 through 1990. Arch Otolaryngol Head Neck Surg, 1993. 119(9): p. 973-8. 29. Ogawa, K., et al., Treatment and prognosis of angiosarcoma of the scalp and face: a retrospective analysis of 48 patients. Br J Radiol, 2012. 85(1019): p. e1127-33. 30. Guadagnolo, B.A., et al., Outcomes after definitive treatment for cutaneous angiosarcoma of the face and scalp. Head Neck, 2011. 33(5): p. 661-7. 31. Hodgkinson, D.J., E.H. Soule, and J.E. Woods, Cutaneous angiosarcoma of the head and neck. Cancer, 1979. 44(3): p. 1106-13. 32. Lana, S., et al., Continuous low-dose oral chemotherapy for adjuvant therapy of splenic hemangiosarcoma in dogs. J Vet Intern Med, 2007. 21(4): p. 764-9. 33. Isogai, R., et al., Successful treatment of pulmonary metastasis and local recurrence of angiosarcoma with docetaxel. J Dermatol, 2004. 31(4): p. 335-41. 34. Verschraegen, C.F., et al., Phase I/II study of docetaxel (D), gemcitabine (G), and bevacizumab (B) in patients (pts) with advanced or recurrent soft

102 tissue sarcoma (STS). Journal of Clinical Oncology, 2008. 26(15_suppl): p. 10534-10534. 35. Agulnik, M., et al., An open-label, multicenter, phase II study of bevacizumab for the treatment of angiosarcoma and epithelioid hemangioendotheliomas. Ann Oncol, 2013. 24(1): p. 257-63. 36. Peng, S., et al., Autocrine vascular endothelial growth factor signaling promotes cell proliferation and modulates sorafenib treatment efficacy in hepatocellular carcinoma. Hepatology, 2014. 60(4): p. 1264-77. 37. Tomita, H., et al., Angiosarcoma of the scalp successfully treated with pazopanib. J Am Acad Dermatol, 2014. 70(1): p. e19-21. 38. Silva, E., et al., Refractory angiosarcoma of the breast with VEGFR2 upregulation successfully treated with sunitinib. Breast J, 2015. 21(2): p. 205-7. 39. Ray-Coquard, I., et al., Sorafenib for patients with advanced angiosarcoma: a phase II Trial from the French Sarcoma Group (GSF/GETO). Oncologist, 2012. 17(2): p. 260-6. 40. van der Graaf, W.T., et al., Pazopanib for metastatic soft-tissue sarcoma (PALETTE): a randomised, double-blind, placebo-controlled phase 3 trial. Lancet, 2012. 379(9829): p. 1879-86. 41. Asano, Y., et al., Effective treatment of angiosarcoma on the nose by combination treatment with electron beam irradiation, recombinant interleukin-2 and docetaxel. Clin Exp Dermatol, 2009. 34(7): p. e227-8. 42. Ramaswami, R., et al., Disparities in Breast, Lung, and Cervical Cancer Trials Worldwide. J Glob Oncol, 2018. 4: p. 1-11. 43. Adams, C.P. and V.V. Brantner, Estimating the cost of new drug development: is it really 802 million dollars? Health Aff (Millwood), 2006. 25(2): p. 420-8. 44. Hay, M., et al., Clinical development success rates for investigational drugs. Nat Biotechnol, 2014. 32(1): p. 40-51. 45. Leaute-Labreze, C., et al., Propranolol for severe hemangiomas of infancy. N Engl J Med, 2008. 358(24): p. 2649-51. 46. Cole, S.W. and A.K. Sood, Molecular pathways: beta-adrenergic signaling in cancer. Clin Cancer Res, 2012. 18(5): p. 1201-6. 47. Zhang, D., et al., Inhibition of pancreatic cancer cell proliferation by propranolol occurs through apoptosis induction: the study of beta- adrenoceptor antagonist's anticancer effect in pancreatic cancer cell. Pancreas, 2009. 38(1): p. 94-100. 48. Palm, D., et al., The norepinephrine-driven metastasis development of PC-3 human prostate cancer cells in BALB/c nude mice is inhibited by beta-blockers. Int J Cancer, 2006. 118(11): p. 2744-9. 49. De Giorgi, V., et al., Treatment with beta-blockers and reduced disease progression in patients with thick melanoma. Arch Intern Med, 2011. 171(8): p. 779-81. 50. Barron, T.I., et al., Beta blockers and breast cancer mortality: a population- based study. J Clin Oncol, 2011. 29(19): p. 2635-44.

103 51. Yee, E.M., et al., Synthesis of novel isoflavene-propranolol hybrids as anti- tumor agents. Bioorg Med Chem, 2013. 21(7): p. 1652-60. 52. Kurozumi, S., et al., beta2-Adrenergic receptor expression is associated with biomarkers of tumor immunity and predicts poor prognosis in estrogen receptor-negative breast cancer. Breast Cancer Res Treat, 2019. 53. Pelicano, H., et al., Mitochondrial dysfunction in some triple-negative breast cancer cell lines: role of mTOR pathway and therapeutic potential. Breast Cancer Res, 2014. 16(5): p. 434. 54. Coelho, M., et al., Antiproliferative effects of beta-blockers on human colorectal cancer cells. Oncol Rep, 2015. 33(5): p. 2513-20. 55. Pantziarka, P., et al., Repurposing drugs in oncology (ReDO)-Propranolol as an anti-cancer agent. Ecancermedicalscience, 2016. 10: p. 680. 56. Liao, X., et al., Effects of propranolol in combination with radiation on apoptosis and survival of gastric cancer cells in vitro. Radiat Oncol, 2010. 5: p. 98. 57. Ramu, A., et al., Restoration of doxorubicin responsiveness in doxorubicin-resistant P388 murine leukaemia cells. Br J Cancer, 1984. 50(4): p. 501-7. 58. Hajighasemi, F. and A. Mirshafiey, In vitro sensitivity of leukemia cells to propranolol. J Clin Med Res, 2009. 1(3): p. 144-9. 59. Maccari, S., et al., Biphasic effects of propranolol on tumour growth in B16F10 melanoma-bearing mice. British Journal of Pharmacology, 2017. 174(2): p. 139-149. 60. Wrobel, L.J. and F.A. Le Gal, Inhibition of human melanoma growth by a non-cardioselective beta-blocker. J Invest Dermatol, 2015. 135(2): p. 525- 531. 61. Brohee, L., et al., Propranolol sensitizes prostate cancer cells to glucose metabolism inhibition and prevents cancer progression. Sci Rep, 2018. 8(1): p. 7050. 62. Al-Wadei, H.A., M.H. Al-Wadei, and H.M. Schuller, Prevention of pancreatic cancer by the beta-blocker propranolol. Anti-Cancer Drugs, 2009. 20(6): p. 477-482. 63. Kim-Fuchs, C., et al., Chronic stress accelerates pancreatic cancer growth and invasion: a critical role for beta-adrenergic signaling in the pancreatic microenvironment. Brain Behav Immun, 2014. 40: p. 40-7. 64. Amaya, C.N., et al., Non-selective beta blockers inhibit angiosarcoma cell viability and increase progression free- and overall-survival in patients diagnosed with metastatic angiosarcoma. Oncoscience, 2018. 5(3-4): p. 109-119. 65. Banavali, S., E. Pasquier, and N. Andre, Targeted therapy with propranolol and metronomic chemotherapy combination: sustained complete response of a relapsing metastatic angiosarcoma. Ecancermedicalscience, 2015. 9: p. 499. 66. Chow, W., et al., Growth Attenuation of Cutaneous Angiosarcoma With Propranolol-Mediated beta-Blockade. JAMA Dermatol, 2015. 151(11): p. 1226-9.

104 67. Daguze, J., M. Saint-Jean, and B. Dreno, Large nose angiosarcoma treated effectively with oral cyclophosphamide combined with propranolol. J Eur Acad Dermatol Venereol, 2018. 32(2): p. e52-e54. 68. Daguze, J., et al., Visceral metastatic angiosarcoma treated effectively with oral cyclophosphamide combined with propranolol. JAAD Case Rep, 2016. 2(6): p. 497-499. 69. Pasquier, E., et al., Effective management of advanced angiosarcoma by the synergistic combination of propranolol and vinblastine-based metronomic chemotherapy: A Bench to Bedside Study. EBioMedicine, 2016. 6: p. 87-95. 70. Chisholm, K.M., et al., beta-Adrenergic receptor expression in vascular tumors. Mod Pathol, 2012. 25(11): p. 1446-51. 71. Stiles, J.M., et al., Targeting of beta adrenergic receptors results in therapeutic efficacy against models of hemangioendothelioma and angiosarcoma. PLoS One, 2013. 8(3): p. e60021. 72. Wedgeworth, E., et al., Propranolol in the treatment of infantile haemangiomas: lessons from the European Propranolol In the Treatment of Complicated Haemangiomas (PITCH) Taskforce survey. Br J Dermatol, 2016. 174(3): p. 594-601. 73. Marqueling, A.L., et al., Propranolol and infantile hemangiomas four years later: a systematic review. Pediatr Dermatol, 2013. 30(2): p. 182-91. 74. Bagazgoitia, L., A. Hernandez-Martin, and A. Torrelo, Recurrence of infantile hemangiomas treated with propranolol. Pediatr Dermatol, 2011. 28(6): p. 658-62. 75. Pasquier, E., et al., beta-blockers increase response to chemotherapy via direct antitumour and anti-angiogenic mechanisms in neuroblastoma. Br J Cancer, 2013. 108(12): p. 2485-94. 76. Stanojkovic, T.P., et al., Inhibition of proliferation on some neoplastic cell lines-act of carvedilol and captopril. J Exp Clin Cancer Res, 2005. 24(3): p. 387-95. 77. Liu, L., et al., [Preventive effect of low-dose carvedilol combined with candesartan on the cardiotoxicity of anthracycline drugs in the adjuvant chemotherapy of breast cancer]. Zhonghua Zhong Liu Za Zhi, 2013. 35(12): p. 936-40. 78. Lin, C.S., et al., Carvedilol use is associated with reduced cancer risk: A nationwide population-based cohort study. Int J Cardiol, 2015. 184: p. 9- 13. 79. Insel, P.A., Structure and Function of Alpha-Adrenergic Receptors. The American Journal of Medicine, 1989. 87(2): p. S12-S18. 80. Segura, V., et al., Differences in the signaling pathways of alpha(1A)- and alpha(1B)-adrenoceptors are related to different endosomal targeting. PLoS One, 2013. 8(5): p. e64996. 81. Williams, N.G., H. Zhong, and K.P. Minneman, Differential coupling of alpha1-, alpha2-, and beta-adrenergic receptors to mitogen-activated protein kinase pathways and differentiation in transfected PC12 cells. J Biol Chem, 1998. 273(38): p. 24624-32.

105 82. Widmann, C., et al., Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev, 1999. 79(1): p. 143-80. 83. Wagner, E.F. and A.R. Nebreda, Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer, 2009. 9(8): p. 537-49. 84. Koul, O. and G. Hauser, Modulation of rat brain cytosolic phosphatidate phosphohydrolase: effect of cationic amphiphilic drugs and divalent cations. Archives of biochemistry and biophysics, 1987. 253(2): p. 453- 461. 85. Lavie, Y., O. Piterman, and M. Liscovitch, Inhibition of phosphatidic acid phosphohydrolase activity by sphingosine. Dual action of sphingosine in diacylglycerol signal termination. FEBS Lett, 1990. 277(1-2): p. 7-10. 86. Sozzani, S., et al., Propranolol, a phosphatidate phosphohydrolase inhibitor, also inhibits protein kinase C. J Biol Chem, 1992. 267(28): p. 20481-8. 87. Han, G.S. and G.M. Carman, Characterization of the human LPIN1- encoded phosphatidate phosphatase isoforms. J Biol Chem, 2010. 285(19): p. 14628-38. 88. Yang, C.Y. and M.A. Frohman, Mitochondria: signaling with phosphatidic acid. Int J Biochem Cell Biol, 2012. 44(8): p. 1346-50. 89. Pascual, F., A. Soto-Cardalda, and G.M. Carman, PAH1-encoded phosphatidate phosphatase plays a role in the growth phase-and inositol- mediated regulation of lipid synthesis in Saccharomyces cerevisiae. Journal of Biological Chemistry, 2013. 288(50): p. 35781-35792. 90. Pleskot, R., et al., Regulation of cytoskeletal dynamics by phospholipase D and phosphatidic acid. Trends Plant Sci, 2013. 18(9): p. 496-504. 91. Wang, X., et al., Signaling functions of phosphatidic acid. Prog Lipid Res, 2006. 45(3): p. 250-78. 92. Jang, J.H., et al., Understanding of the roles of phospholipase D and phosphatidic acid through their binding partners. Prog Lipid Res, 2012. 51(2): p. 71-81. 93. Shaughnessy, R., et al., Epidermal growth factor receptor endocytic traffic perturbation by phosphatidate phosphohydrolase inhibition: new strategy against cancer. FEBS J, 2014. 281(9): p. 2172-89. 94. Jenkins, G.M. and M.A. Frohman, Phospholipase D: a lipid centric review. Cell Mol Life Sci, 2005. 62(19-20): p. 2305-16. 95. Guertin, D.A. and D.M. Sabatini, An expanding role for mTOR in cancer. Trends Mol Med, 2005. 11(8): p. 353-61. 96. Populo, H., J.M. Lopes, and P. Soares, The mTOR signalling pathway in human cancer. Int J Mol Sci, 2012. 13(2): p. 1886-918. 97. Foster, D.A., et al., Phospholipase D and the maintenance of phosphatidic acid levels for regulation of mammalian target of rapamycin (mTOR). J Biol Chem, 2014. 289(33): p. 22583-8. 98. Fang, Y., et al., Phosphatidic acid-mediated mitogenic activation of mTOR signaling. Science, 2001. 294(5548): p. 1942-5.

106 99. Ma, X.M. and J. Blenis, Molecular mechanisms of mTOR-mediated translational control. Nat Rev Mol Cell Biol, 2009. 10(5): p. 307-18. 100. Grabiner, B.C., et al., A diverse array of cancer-associated MTOR mutations are hyperactivating and can predict rapamycin sensitivity. Cancer Discov, 2014. 4(5): p. 554-63. 101. Skippen, A., et al., Mechanism of ADP ribosylation factor-stimulated phosphatidylinositol 4,5-bisphosphate synthesis in HL60 cells. J Biol Chem, 2002. 277(8): p. 5823-31. 102. Anderson, R.A., et al., Phosphatidylinositol phosphate kinases, a multifaceted family of signaling enzymes. J Biol Chem, 1999. 274(15): p. 9907-10. 103. Andresen, B.T., et al., The role of phosphatidic acid in the regulation of the Ras/MEK/Erk signaling cascade. FEBS Lett, 2002. 531(1): p. 65-8. 104. Henkels, K.M., et al., A Phosphatidic Acid (PA) conveyor system of continuous intracellular transport from cell membrane to nucleus maintains EGF receptor homeostasis. Oncotarget, 2016. 7(30): p. 47002-47017. 105. Godi, A., et al., FAPPs control Golgi-to-cell-surface membrane traffic by binding to ARF and PtdIns(4)P. Nat Cell Biol, 2004. 6(5): p. 393-404. 106. Mizuno-Yamasaki, E., et al., Phosphatidylinositol 4-phosphate controls both membrane recruitment and a regulatory switch of the Rab GEF Sec2p. Dev Cell, 2010. 18(5): p. 828-40. 107. De Craene, J.O., et al., Phosphoinositides, Major Actors in Membrane Trafficking and Lipid Signaling Pathways. Int J Mol Sci, 2017. 18(3). 108. Desrivieres, S., et al., MSS4, a phosphatidylinositol-4-phosphate 5-kinase required for organization of the actin cytoskeleton in Saccharomyces cerevisiae. J Biol Chem, 1998. 273(25): p. 15787-93. 109. Takenawa, T. and T. Itoh, Phosphoinositides, key molecules for regulation of actin cytoskeletal organization and membrane traffic from the plasma membrane. Biochim Biophys Acta, 2001. 1533(3): p. 190-206. 110. Sun, Y., et al., Type I gamma phosphatidylinositol phosphate kinase is required for EGF-stimulated directional cell migration. J Cell Biol, 2007. 178(2): p. 297-308. 111. Lemmon, M.A., Phosphoinositide recognition domains. Traffic, 2003. 4(4): p. 201-13. 112. Hilpela, P., M.K. Vartiainen, and P. Lappalainen, Regulation of the actin cytoskeleton by PI(4,5)P2 and PI(3,4,5)P3. Curr Top Microbiol Immunol, 2004. 282: p. 117-63. 113. Swanson, J.A., Shaping cups into phagosomes and macropinosomes. Nat Rev Mol Cell Biol, 2008. 9(8): p. 639-49. 114. Bloomfield, G. and R.R. Kay, Uses and abuses of macropinocytosis. J Cell Sci, 2016. 129(14): p. 2697-705. 115. Commisso, C., et al., Macropinocytosis of protein is an amino acid supply route in Ras-transformed cells. Nature, 2013. 497(7451): p. 633-7. 116. Hansen, C.G. and B.J. Nichols, Molecular mechanisms of clathrin- independent endocytosis. J Cell Sci, 2009. 122(Pt 11): p. 1713-21.

107 117. Botelho, R.J., et al., Role of COPI in phagosome maturation. J Biol Chem, 2000. 275(21): p. 15717-27. 118. Yin, H.L. and P.A. Janmey, Phosphoinositide regulation of the actin cytoskeleton. Annu Rev Physiol, 2003. 65: p. 761-89. 119. Yoshida, S., et al., Macropinocytosis, mTORC1 and cellular growth control. Cell Mol Life Sci, 2018. 75(7): p. 1227-1239. 120. Xie, S., N. Naslavsky, and S. Caplan, Diacylglycerol kinases in membrane trafficking. Cell Logist, 2015. 5(2): p. e1078431. 121. Kooijman, E.E., et al., Modulation of membrane curvature by phosphatidic acid and lysophosphatidic acid. Traffic, 2003. 4(3): p. 162-74. 122. Giridharan, S.S., et al., Cooperation of MICAL-L1, syndapin2, and phosphatidic acid in tubular recycling endosome biogenesis. Mol Biol Cell, 2013. 24(11): p. 1776-90, S1-15. 123. Yoshida, S., et al., Sequential signaling in plasma-membrane domains during macropinosome formation in macrophages. Journal of Cell Science, 2009. 122(18): p. 3250-3261. 124. Hewlett, L.J., A.R. Prescott, and C. Watts, The coated pit and macropinocytic pathways serve distinct endosome populations. J Cell Biol, 1994. 124(5): p. 689-703. 125. Amyere, M., et al., Constitutive macropinocytosis in oncogene- transformed fibroblasts depends on sequential permanent activation of phosphoinositide 3-kinase and phospholipase C. Mol Biol Cell, 2000. 11(10): p. 3453-67. 126. Ard, R., et al., Regulation of Macropinocytosis by Diacylglycerol Kinase zeta. PLoS One, 2015. 10(12): p. e0144942. 127. Maeda, Y., et al., Recruitment of protein kinase D to the trans-Golgi network via the first cysteine-rich domain. EMBO J, 2001. 20(21): p. 5982- 90. 128. Vicinanza, M., et al., Function and dysfunction of the PI system in membrane trafficking. EMBO J, 2008. 27(19): p. 2457-70. 129. Clapham, D.E., Calcium signaling. Cell, 2007. 131(6): p. 1047-58. 130. Ogata, M., et al., Autophagy is activated for cell survival after endoplasmic reticulum stress. Mol Cell Biol, 2006. 26(24): p. 9220-31. 131. Hetz, C., The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol, 2012. 13(2): p. 89- 102. 132. Oslowski, C.M. and F. Urano, Measuring ER stress and the unfolded protein response using mammalian tissue culture system. Methods Enzymol, 2011. 490: p. 71-92. 133. Yoshida, H., et al., A time-dependent phase shift in the mammalian unfolded protein response. Dev Cell, 2003. 4(2): p. 265-71. 134. Wortel, I.M.N., et al., Surviving stress: modulation of ATF4-mediated stress responses in normal and malignant cells. Trends Endocrinol Metab, 2017. 28(11): p. 794-806. 135. Huang, Z., et al., Stress management by autophagy: Implications for chemoresistance. Int J Cancer, 2016. 139(1): p. 23-32.

108 136. Sano, R. and J.C. Reed, ER stress-induced cell death mechanisms. Biochim Biophys Acta, 2013. 1833(12): p. 3460-3470. 137. Ding, W.X., et al., Linking of autophagy to ubiquitin-proteasome system is important for the regulation of endoplasmic reticulum stress and cell viability. Am J Pathol, 2007. 171(2): p. 513-24. 138. Hoyer-Hansen, M. and M. Jaattela, Connecting endoplasmic reticulum stress to autophagy by unfolded protein response and calcium. Cell Death Differ, 2007. 14(9): p. 1576-82. 139. Madeo, F. and G. Kroemer, Intricate links between ER stress and apoptosis. Mol Cell, 2009. 33(6): p. 669-70. 140. Gorman, A.M., et al., Stress management at the ER: regulators of ER stress-induced apoptosis. Pharmacol Ther, 2012. 134(3): p. 306-16. 141. Kuzu, O.F., et al., Effect of lysosomotropic molecules on cellular homeostasis. Pharmacol Res, 2017. 117: p. 177-184. 142. Goldman, S.D., et al., Mechanisms of amine accumulation in, and egress from, lysosomes. Bioanalysis, 2009. 1(8): p. 1445-59. 143. Marceau, F., et al., Cation trapping by cellular acidic compartments: beyond the concept of lysosomotropic drugs. Toxicol Appl Pharmacol, 2012. 259(1): p. 1-12. 144. Morissette, G., et al., Massive cell vacuolization induced by organic amines such as procainamide. J Pharmacol Exp Ther, 2004. 310(1): p. 395-406. 145. Papadopoulos, C. and H. Meyer, Detection and Clearance of Damaged Lysosomes by the Endo-Lysosomal Damage Response and Lysophagy. Curr Biol, 2017. 27(24): p. R1330-R1341. 146. Shiraishi, N., et al., Lysosomotropic agents reverse multiple drug resistance in human cancer cells. Cancer Lett, 1986. 30(3): p. 251-9. 147. Ruggeri, B.A., F. Camp, and S. Miknyoczki, Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery. Biochem Pharmacol, 2014. 87(1): p. 150-61. 148. Park, J.S., et al., Canine cancer immunotherapy studies: linking mouse and human. Journal for ImmunoTherapy of Cancer, 2016. 4(1): p. 97. 149. Cohen, S.M., et al., Hemangiosarcoma in rodents: mode-of-action evaluation and human relevance. Toxicol Sci, 2009. 111(1): p. 4-18. 150. Clifford, C.A., A.J. Mackin, and C.J. Henry, Treatment of canine hemangiosarcoma: 2000 and beyond. J Vet Intern Med, 2000. 14(5): p. 479-85. 151. Hargis, A.M., et al., A retrospective clinicopathologic study of 212 dogs with cutaneous hemangiomas and hemangiosarcomas. Vet Pathol, 1992. 29(4): p. 316-28. 152. Hammond, T.N. and S.A. Pesillo-Crosby, Prevalence of hemangiosarcoma in anemic dogs with a splenic mass and hemoperitoneum requiring a transfusion: 71 cases (2003-2005). J Am Vet Med Assoc, 2008. 232(4): p. 553-8.

109 153. Hammer, A.S., et al., Efficacy and toxicity of VAC chemotherapy (vincristine, doxorubicin, and cyclophosphamide) in dogs with hemangiosarcoma. J Vet Intern Med, 1991. 5(3): p. 160-6. 154. Wood, C.A., et al., Prognosis for dogs with stage I or II splenic hemangiosarcoma treated by splenectomy alone: 32 cases (1991-1993). J Am Anim Hosp Assoc, 1998. 34(5): p. 417-21. 155. Vail, D.M., et al., Liposome-encapsulated muramyl tripeptide phosphatidylethanolamine adjuvant immunotherapy for splenic hemangiosarcoma in the dog: a randomized multi-institutional clinical trial. Clin Cancer Res, 1995. 1(10): p. 1165-70. 156. Dickerson, E.B. and B.A. Bryan, Beta adrenergic signaling: A targetable regulator of angiosarcoma and hemangiosarcoma. Vet Sci, 2015. 2(3): p. 270-292. 157. Brown, N.O., A.K. Patnaik, and E.G. MacEwen, Canine hemangiosarcoma: retrospective analysis of 104 cases. J Am Vet Med Assoc, 1985. 186(1): p. 56-8. 158. Ogilvie, G.K., et al., Surgery and doxorubicin in dogs with hemangiosarcoma. J Vet Intern Med, 1996. 10(6): p. 379-84. 159. Sorenmo, K.U., K.A. Jeglum, and S.C. Helfand, Chemotherapy of canine hemangiosarcoma with doxorubicin and cyclophosphamide. J Vet Intern Med, 1993. 7(6): p. 370-6. 160. U'Ren, L.W., et al., Evaluation of a novel tumor vaccine in dogs with hemangiosarcoma. J Vet Intern Med, 2007. 21(1): p. 113-20. 161. Yonemaru, K., et al., Expression of vascular endothelial growth factor, basic fibroblast growth factor, and their receptors (flt-1, flk-1, and flg-1) in canine vascular tumors. Vet Pathol, 2006. 43(6): p. 971-80. 162. Bray, J.P., et al., Does thalidomide prolong survival in dogs with splenic haemangiosarcoma? J Small Anim Pract, 2018. 59(2): p. 85-91. 163. Gilbertson-Beadling, S., et al., The tetracycline analogs minocycline and doxycycline inhibit angiogenesis in vitro by a non-metalloproteinase- dependent mechanism. Cancer Chemother Pharmacol, 1995. 36(5): p. 418-24. 164. Lyles, S.E., et al., In vitro effects of the tyrosine kinase inhibitor, masitinib mesylate, on canine hemangiosarcoma cell lines. Vet Comp Oncol, 2012. 10(3): p. 223-35. 165. Gardner, H.L., et al., Maintenance therapy with toceranib following doxorubicin-based chemotherapy for canine splenic hemangiosarcoma. BMC Vet Res, 2015. 11: p. 131. 166. Borgatti, A., et al., Safe and effective sarcoma therapy through bispecific targeting of EGFR and uPAR. Mol Cancer Ther, 2017. 16(5): p. 956-965. 167. Lamerato-Kozicki, A.R., et al., Canine hemangiosarcoma originates from hematopoietic precursors with potential for endothelial differentiation. Exp Hematol, 2006. 34(7): p. 870-8. 168. Akhtar, N., et al., Interleukin-12 inhibits tumor growth in a novel angiogenesis canine hemangiosarcoma xenograft model. Neoplasia, 2004. 6(2): p. 106-16.

110 169. Fosmire, S.P., et al., Canine malignant hemangiosarcoma as a model of primitive angiogenic endothelium. Lab Invest, 2004. 84(5): p. 562-72. 170. Tamburini, B.A., et al., Gene expression profiles of sporadic canine hemangiosarcoma are uniquely associated with breed. PLoS One, 2009. 4(5): p. e5549. 171. Gong, L., et al., Propranolol selectively inhibits cervical cancer cell growth by suppressing the cGMP/PKG pathway. Biomed Pharmacother, 2019. 111: p. 1243-1248. 172. Wang, F., et al., Propranolol suppresses the proliferation and induces the apoptosis of liver cancer cells. Mol Med Rep, 2018. 17(4): p. 5213-5221. 173. Horton, J.D., J.L. Goldstein, and M.S. Brown, SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest, 2002. 109(9): p. 1125-31. 174. Beloribi-Djefaflia, S., S. Vasseur, and F. Guillaumond, Lipid metabolic reprogramming in cancer cells. Oncogenesis, 2016. 5: p. e189. 175. Brown, M.S. and J.L. Goldstein, Receptor-mediated endocytosis: insights from the lipoprotein receptor system. Proceedings of the National Academy of Sciences, 1979. 76(7): p. 3330-3337. 176. Liscum, L. and J.R. Faust, The intracellular transport of low density lipoprotein-derived cholesterol is inhibited in Chinese hamster ovary cells cultured with 3-beta-[2-(diethylamino)ethoxy]androst-5-en-17-one. J Biol Chem, 1989. 264(20): p. 11796-806. 177. Kuzu, O.F., et al., Effect of lysosomotropic molecules on celluar homeostasis. Pharmacological Research, 2017. 117: p. 117-184. 178. Smith, S.W., S.B. Weiss, and E.P. Kennedy, The enzymatic dephosphorylation of phosphatidic acids. J Biol Chem, 1957. 228(2): p. 915-22. 179. Brohee, L., et al., Lipin-1 regulates cancer cell phenotype and is a potential target to potentiate rapamycin treatment. Oncotarget, 2015. 6(13): p. 11264-80. 180. Pappu, A.S. and G. Hauser, Propranolol-induced inhibition of rat brain cytoplasmic phosphatidate phosphohydrolase. Neurochem Res, 1983. 8(12): p. 1565-75. 181. Montoya, A., et al., Use of non-selective beta-blockers is associated with decreased tumor proliferative indices in early stage breast cancer. Oncotarget, 2017. 8(4): p. 6446-6460. 182. DeBerardinis, R.J., et al., The biology of cancer: metabolic reprogramming fuels cell growth and proliferation. Cell Metab, 2008. 7(1): p. 11-20. 183. Le Gendre, O., et al., Suppression of AKT phosphorylation restores rapamycin-based synthetic lethality in SMAD4-defective pancreatic cancer cells. Mol Cancer Res, 2013. 11(5): p. 474-81. 184. DeBerardinis, R.J. and N.S. Chandel, Fundamentals of cancer metabolism. Science Advances, 2016. 2(5): p. e1600200. 185. Dibble, C.C. and B.D. Manning, Signal integration by mTORC1 coordinates nutrient input with biosynthetic output. Nat Cell Biol, 2013. 15(6): p. 555-64.

111 186. Sundqvist, A., et al., Control of lipid metabolism by phosphorylation- dependent degradation of the SREBP family of transcription factors by SCF(Fbw7). Cell Metab, 2005. 1(6): p. 379-91. 187. Xu, C., B. Bailly-Maitre, and J.C. Reed, Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest, 2005. 115(10): p. 2656-64. 188. Calfon, M., et al., IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature, 2002. 415(6867): p. 92- 6. 189. Yang, Y., M. Lee, and G.D. Fairn, Phospholipid subcellular localization and dynamics. J Biol Chem, 2018. 293(17): p. 6230-6240. 190. Fan, X., et al., Lipin-1 determines lung cancer cell survival and chemotherapy sensitivity by regulation of endoplasmic reticulum homeostasis and autophagy. Cancer Med, 2018. 7(6): p. 2541-2554. 191. Tanida, I., T. Ueno, and E. Kominami, LC3 and Autophagy. Methods Mol Biol, 2008. 445: p. 77-88. 192. Fujita, N., et al., The Atg16L complex specifies the site of LC3 lipidation for membrane biogenesis in autophagy. Mol Biol Cell, 2008. 19(5): p. 2092-100. 193. Barron, D.A. and D.R. Rowley, The reactive stroma microenvironment and prostate cancer progression. Endocr Relat Cancer, 2012. 19(6): p. R187- 204. 194. McAllister, S.S. and R.A. Weinberg, The tumour-induced systemic environment as a critical regulator of cancer progression and metastasis. Nat Cell Biol, 2014. 16(8): p. 717-27. 195. Shiao, S.L., G.C. Chu, and L.W. Chung, Regulation of prostate cancer progression by the tumor microenvironment. Cancer Lett, 2016. 380(1): p. 340-8. 196. Hanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 646-74. 197. Vander Heiden, M.G. and R.J. DeBerardinis, Understanding the intersections between metabolism and cancer biology. Cell, 2017. 168(4): p. 657-669. 198. Kang, F., et al., Propranolol inhibits glucose metabolism and 18F-FDG uptake of breast cancer through posttranscriptional downregulation of hexokinase-2. J Nucl Med, 2014. 55(3): p. 439-45. 199. Wei, W.J., et al., Propranolol sensitizes thyroid cancer cells to cytotoxic effect of vemurafenib. Oncol Rep, 2016. 36(3): p. 1576-84. 200. Dezong, G., et al., Carvedilol suppresses migration and invasion of malignant breast cells by inactivating Src involving cAMP/PKA and PKCdelta signaling pathway. J Cancer Res Ther, 2014. 10(4): p. 998- 1003. 201. Farzam, K. and A.D. Lakhkar, Adrenergic Drugs, in StatPearls. 2019: Treasure Island (FL). 202. Ogrodowczyk, M., K. Dettlaff, and A. Jelinska, Beta-Blockers: Current state of knowledge and perspectives. Mini Rev Med Chem, 2016. 16(1): p. 40-54.

112 203. Cheng, J., K. Kamiya, and I. Kodama, Carvedilol: molecular and cellular basis for its multifaceted therapeutic potential. Cardiovasc Drug Rev, 2001. 19(2): p. 152-71. 204. Liu, T., et al., The update of prostatic ductal adenocarcinoma. Chin J Cancer Res, 2016. 28(1): p. 50-7. 205. Pavlova, N.N. and C.B. Thompson, The Emerging Hallmarks of Cancer Metabolism. Cell Metab, 2016. 23(1): p. 27-47. 206. Luyimbazi, D., et al., Rapamycin regulates stearoyl CoA desaturase 1 expression in breast cancer. Mol Cancer Ther, 2010. 9(10): p. 2770-84. 207. Stubbs, C.D. and A.D. Smith, The modification of mammalian membrane polyunsaturated fatty acid composition in relation to membrane fluidity and function. Biochim Biophys Acta, 1984. 779(1): p. 89-137. 208. Spector, A.A. and M.A. Yorek, Membrane lipid composition and cellular function. J Lipid Res, 1985. 26(9): p. 1015-35. 209. Kim, J.H., et al., Pathobiology of Hemangiosarcoma in Dogs: Research Advances and Future Perspectives. Vet Sci, 2015. 2(4): p. 388-405. 210. Maeda-Otsuka, S., et al., Hypoxia accelerates the progression of angiosarcoma through the regulation of angiosarcoma cells and tumor microenvironment. J Dermatol Sci, 2019. 93(2): p. 123-132. 211. Koul, O. and G. Hauser, Modulation of rat brain cytosolic phosphatidate phosphohydrolase: effect of cationic amphiphilic drugs and divalent cations. Arch Biochem Biophys, 1987. 253(2): p. 453-61. 212. Jamal, Z., et al., Plasma membrane fractions from rat liver contain a phosphatidate phosphohydrolase distinct from that in the endoplasmic reticulum and cytosol. J Biol Chem, 1991. 266(5): p. 2988-96. 213. Hansen, C.G., et al., SDPR induces membrane curvature and functions in the formation of caveolae. Nature cell biology, 2009. 11(7): p. 807. 214. Shao, W. and P.J. Espenshade, Expanding roles for SREBP in metabolism. Cell Metab, 2012. 16(4): p. 414-9. 215. Porstmann, T., et al., SREBP activity is regulated by mTORC1 and contributes to Akt-dependent cell growth. Cell Metab, 2008. 8(3): p. 224- 36. 216. Hassan, B., et al., Targeting the PI3-kinase/Akt/mTOR signaling pathway. Surg Oncol Clin N Am, 2013. 22(4): p. 641-64. 217. Pyuen, A.A., et al., In vitro effects of PI3K/mTOR inhibition in canine hemangiosarcoma. PLoS One, 2018. 13(7): p. e0200634. 218. Yecies, J.L., et al., Akt stimulates hepatic SREBP1c and lipogenesis through parallel mTORC1-dependent and independent pathways. Cell Metab, 2011. 14(1): p. 21-32. 219. Han, J., et al., The CREB coactivator CRTC2 controls hepatic lipid metabolism by regulating SREBP1. Nature, 2015. 524(7564): p. 243-6. 220. Cheng, S., et al., Fatty acid oxidation inhibitor etomoxir suppresses tumor progression and induces cell cycle arrest via PPARgamma-mediated pathway in bladder cancer. Clin Sci (Lond), 2019. 133(15): p. 1745-1758. 221. Borradaile, N.M., et al., Disruption of endoplasmic reticulum structure and integrity in lipotoxic cell death. J Lipid Res, 2006. 47(12): p. 2726-37.

113 222. Wei, Y., et al., Saturated fatty acids induce endoplasmic reticulum stress and apoptosis independently of ceramide in liver cells. Am J Physiol Endocrinol Metab, 2006. 291(2): p. E275-81. 223. Madden, E., et al., The role of the unfolded protein response in cancer progression: From oncogenesis to chemoresistance. Biol Cell, 2019. 111(1): p. 1-17. 224. Reiberger, T. and M. Mandorfer, Beta adrenergic blockade and decompensated cirrhosis. J Hepatol, 2017. 66(4): p. 849-859. 225. Rains, S.L., C.N. Amaya, and B.A. Bryan, Beta-adrenergic receptors are expressed across diverse cancers. Oncoscience, 2017. 4(7-8): p. 95-105. 226. Goldsmith, R.L., et al., Long-term carvedilol therapy increases parasympathetic nervous system activity in chronic congestive heart failure. Am J Cardiol, 1997. 80(8): p. 1101-4. 227. Uechi, M., et al., Cardiovascular and renal effects of carvedilol in dogs with heart failure. J Vet Med Sci, 2002. 64(6): p. 469-75. 228. Garg, R., et al., Protein kinase C and cancer: what we know and what we do not. Oncogene, 2014. 33(45): p. 5225-37. 229. Mochly-Rosen, D., K. Das, and K.V. Grimes, Protein kinase C, an elusive therapeutic target? Nat Rev Drug Discov, 2012. 11(12): p. 937-57. 230. Isakov, N., Protein kinase C (PKC) isoforms in cancer, tumor promotion and tumor suppression. Semin Cancer Biol, 2018. 48: p. 36-52. 231. Jiang, Z., et al., Reduction of protein kinase C alpha (PKC-alpha) promote apoptosis via down-regulation of Dicer in bladder cancer. J Cell Mol Med, 2015. 19(5): p. 1085-93. 232. Gurbuz, N., et al., Cystine dimethyl ester induces apoptosis through regulation of PKC-delta and PKC-epsilon in prostate cancer cells. Anticancer Agents Med Chem, 2015. 15(2): p. 217-27. 233. Lin, Y., et al., Silencing the receptor of activated C-kinase 1 (RACK1) suppresses tumorigenicity in epithelial ovarian cancer in vitro and in vivo. Int J Oncol, 2014. 44(4): p. 1252-8. 234. Ratnayake, W.S., et al., Two novel atypical PKC inhibitors; ACPD and DNDA effectively mitigate cell proliferation and epithelial to mesenchymal transition of metastatic melanoma while inducing apoptosis. Int J Oncol, 2017. 51(5): p. 1370-1382. 235. Kawamura, A., et al., Regulation of programmed cell death ligand 1 expression by atypical protein kinase C lambda/iota in cutaneous angiosarcoma. Cancer Sci, 2019. 110(5): p. 1780-1789. 236. Duchen, M.R., Mitochondria and calcium: from cell signalling to cell death. J Physiol, 2000. 529 Pt 1: p. 57-68. 237. Peters, A.A., et al., Calcium channel TRPV6 as a potential therapeutic target in estrogen receptor-negative breast cancer. Mol Cancer Ther, 2012. 11(10): p. 2158-68. 238. Hao, J., et al., Ca2+ channel subunit alpha 1D promotes proliferation and migration of endometrial cancer cells mediated by 17beta-estradiol via the G protein-coupled estrogen receptor. FASEB J, 2015. 29(7): p. 2883-93.

114 239. Cui, C., et al., Targeting calcium signaling in cancer therapy. Acta Pharm Sin B, 2017. 7(1): p. 3-17. 240. Bhargava, A. and S. Saha, T-Type voltage gated calcium channels: a target in breast cancer? Breast Cancer Res Treat, 2019. 173(1): p. 11-21. 241. Nguyen, O.N., et al., Two-pore channel function Is crucial for the migration of invasive cancer cells. Cancer Res, 2017. 77(6): p. 1427-1438.

115