Biology and Chemistry of Carotenoid Cleavage Enzymes In

BIOLOGY AND CHEMISTRY OF CAROTENOID CLEAVAGE ENZYMES IN

VISION

DARWIN O. BABINO

Submitted in partial fulfillment of the requirements

For the degree of Doctor of Philosophy

Dissertation Adviser: Dr. Johannes von Lintig

Department of Pharmacology

CASE WESTERN RESERVE UNIVERSITY

January, 2016 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES

We hereby approve the dissertation of Darwin O. Babino Candidate for the Doctor of Philosophy degree*.

Committee Chair Derek Taylor

Committee Members

Johannes von Lintig

Michael E. Harris

Krzysztof Palczewski

Robert Bonomo

Jason Mears

Date of Defense

November 9th, 2015

*We also certify that written approval has been obtained for any proprietary material contained therein.

DEDICATION

The dedication of this work is split several ways:

to Yoli to Rose to Phil

to Aurelia

iii

Table of Contents

LIST OF TABLES ...... ix

LIST OF FIGURES ...... x

ABSTRACT ...... 1

CHAPTER 1: Introduction and Background ...... 3

1.1 Retinoids in vision ...... 3

1.2 Carotenoid cleaving enzymes ...... 5

1.3 Absorption and transport of chromophore precursors ...... 8

1.4 The “canonical” visual cycle ...... 11

1.5 An alternative visual cycle for cones ...... 14

1.6 Concluding remarks ...... 15

FIGURES ...... 19

CHAPTER 2: Expression and Purification of Human β, β-carotene-15, 15’- monooxygenase (BCO1) ...... 22

2.1 Introduction and Background ...... 22

2.2 Experimental Procedures ...... 25

2.2.1 Materials ...... 25

2.2.2 Insect cell transfection, protein expression and purification ...... 27

2.2.3 Enzymatic assays ...... 28

2.2.4 Immunoblotting ...... 29

2.2.5 Triton X-114 phase separation experiments ...... 30

2.2.6 BCO1 plasmid construction for expression in Cos7 cells ...... 30

2.2.7 Determination of the subcellular localization of BCO1 in mouse liver . 31

2.3 Results ...... 32

2.3.1 Expression and enzymatic activity of human recombinant BCO1 ...... 32

2.3.2 Enzymatic activity of BCO1 soluble fraction in different detergents .... 34

2.3.3 Isolation and determination of purified human BCO1 enzymatic activity

...... 36

2.3.4 Determination of the oligomeric state of recombinant human BCO1 .. 38

2.3.5 BCO1 exists as a soluble enzyme in cells and tissues...... 38

2.4 Conclusions ...... 41

TABLES ...... 46

FIGURES ...... 47

CHAPTER 3: Characterization of the Role of β-carotene-9, 10-dioxygenase in

Macular Pigment Metabolism ...... 53

3.1 Introduction and Background ...... 53

3.2 Experimental Procedures ...... 55

3.2.1 Three-Dimensional Structure Models ...... 55

3.2.2 Plasmid Constructs for Bacterial and Eukaryote Expression ...... 55

3.2.3 Transient Transfection and Immunofluorescence ...... 56

3.2.4 Expression of Murine and Macaque BCO2 in E.coli...... 57

3.2.5 Purification and Quantification of BCO2 ...... 58

3.2.6 In Vitro Enzyme Activity Assay ...... 59

3.2.7 HPLC and LC-MS System ...... 60

3.2.8 Animals, husbandry and experimental diets ...... 61

3.2.9 Extraction of Carotenoids from Animal Tissues ...... 62

3.2.10 Induction of BCO2 and Real Time PCR ...... 63

3.3 Results ...... 64

3.3.1 Structural comparison between rodent and primate BCO2s ...... 64

3.3.2 Effect of Detergents on Enzyme Activity ...... 66

3.3.3 Biochemical Characterization of Macaque BCO2 ...... 67

3.3.4 Knockout of BCO2 leads to Systemic Tissue Accumulation ...... 72

3.3.5 Human BCO2 Expression is Oxidative Stress Responsive ...... 73

3.4 Conclusions ...... 74

FIGURES ...... 80

CHAPTER 4: Mechanism of chromophore production by the prototypical carotenoid oxygenase NinaB ...... 88

4.1 Introduction and Background ...... 88

4.2 Experimental Procedures ...... 90

4.2.1 Expression of NinaB and Cell Lysis ...... 90

4.2.2 NinaB Purification ...... 91

4.2.3 Three Dimensional Structural Modeling ...... 92

4.2.4 Enzymatic Assays ...... 93

4.2.5 Isotope Labeling Experiments ...... 93

4.2.6 HPLC and LC-MS Systems ...... 94

4.3 Results ...... 95

4.3.1 Expression, Purification and Enzymatic Activity Assay of NinaB ...... 95

4.3.2 Protein Structure Analysis and Characterization of Binding Cleft

Residues ...... 95

4.3.3 NinaB’s Bipartite Substrate Recognition Site...... 96

4.3.4 Elucidation of NinaB’s Reaction Mechanism ...... 98

4.4 Conclusions ...... 100

FIGURES ...... 104

CHAPTER 5: The Role of 11-cis-Retinyl Esters in Vertebrate Cone Vision ..... 114

5.1 Introduction and Background ...... 114

5.2 Materials and Experimental Procedures ...... 116

5.2.1 Fish Maintenance and Strains ...... 116

5.2.2 TPM imaging ...... 117

5.2.3 Light Treatments of Zebrafish Larvae ...... 117

5.2.4 Retinylamine synthesis and treatments ...... 118

vii

5.2.5 HPLC analysis of retinoids of zebrafish larvae ...... 118

5.2.6 Immunohistochemistry ...... 119

5.2.7 Whole-mount in situ hybridization and immunostaining ...... 120

5.2.8 Optokinetic response assays ...... 121

5.3 Results ...... 122

5.3.1 Chemical identification and localization of 11-REs ...... 122

5.3.2 Time and light intensity-dependent variation of ocular 11-RE levels . 124

5.3.3 11-REs regenerate in the dark and are dependent on RPE65 enzyme

function ...... 125

5.3.4 The XOPS:mCFP zebrafish transgenic line displays a functional cone-

only retina ...... 127

5.3.5 Retinoid analysis of XOPS:mCFP mutants ...... 128

5.3.6 Analyses of RPE65-inhibited XOPS:mCFP eyes/ Ret-NH2 ...... 128

5.4 Conclusions ...... 130

FIGURES ...... 135

CHAPTER 6: Summary and Future Directions ...... 144

REFERENCES ...... 150

viii

LIST OF TABLES

Table 2.1. Activity of human BCO1 soluble fraction in the presence of different detergents 46

LIST OF FIGURES

Figure 1.1 Chemical structures of some of the main naturally occurring retinoids

in mammals, and key enzymatic steps in retinoid metabolism. 19

Figure 1.2 Transport systems for retinoids in mammals. 20

Figure 1.3 The canonical visual cycle in the vertebrate eye. 21

Figure 2.1 BCO1 catalyzes the oxidative conversion of β,β-carotene to retinoids.

Figure 2.2 Baculovirus expression and enzymatic activity of human BCO1. 48

Figure 2.3 Purification of human BCO1 and its enzymatic properties. 49

Figure 2.4 BCO1 is a monomeric protein. 50

Figure 2.5 Comparison of putative membrane-interacting regions between

mammalian CCOs 51

Figure 2.6 Partitioning of BCO1 in Triton X-114 phase separations and BCO1

solubility in tissues and cells. 52

Figure 3.1 Sequence and structure homology of CCOs. 80

Figure 3.2 Detergent affects CCO enzyme activity. 81

Figure 3.3 Recombinant expression, enzyme activity and cellular localization of

BCO2s. 82

Figure 3.4 Enzymatic activity assays of murine and macaque BCO2. 83

Figure 3.5 BCO2 cleaves lutein from both the β and ε ring sides at both the 9, 10 and 9’, 10’ double bonds. 84

Figure 3.6 Comparison of MaBCO2 and MuBCO2 enzymatic activity on meso-

zeaxanthin (MZ) and β-cryptoxanthin (Crypto). 85

Figure 3.7 Carotenoid accumulation in tissues of CCO knockout mice. 86

Figure 3.8 Oxidative stress induces BCO2 expression in human hepatic cells. 87

Figure 4.1 Purification and tests for enzymatic activity of NinaB on β,β-carotene.

104

Figure 4.2 Identification of key amino acid residues of NinaB’s catalytic domain.

105

Figure 4.3 Analysis of NinaB’s enzymatic action on all-trans-3’-dehydrolutein. 106

Figure 4.4 Regio-selectivity of oxidative cleavage and geometric isomerization.

107

Figure 4.5 Extracted ion chromatograms of lipid extracts from NinaB cell lysate in vitro enzymatic assays with lycopene. 108

Figure 4.6 Test for NinaB enzymatic activity with 15, 15’-dehydrozeaxanthin. 109

Figure 4.7 Analysis of NinaB’s enzymatic action on 20, 20’-di-nor-β-carotene. 110

Figure 4.8 The isomerooxygenase reaction proceeds via a dioxygenases reaction mechanism. 111

Figure 4.9 NinaB reaction is inhibited by various spin traps. 112

Figure 4.10 Schematic representation of the proposed catalytic mechanism for

NinaB. 113

Figure 5.1 11-cis-retinyl esters localize to the retinal pigment epithelium (RPE) in zebrafish larvae. 135

Figure 5.2 Multi–photon excitation of a 5 dpf zebrafish larval eye at 730 nm produced emission spectra indicating presence of retinosomes. 136

Figure 5.3 11-cis-retinyl esters localize to the retinal pigment epithelium in adult zebrafish eyes. 137

Figure 5.4 The consumption of 11-cis-RE, in wild-type zebrafish larvae, is time and light intensity dependent. 138

Figure 5.5 11-RE regeneration in wild-type zebrafish occurs in the dark and is prevented by inhibition of RPE65. 139

Figure 5.6 The XOPS:mCFP zebrafish line is a cone-only model. 140

Figure 5.7 The consumption of 11-cis-RE, in the XOPS:mCFP transgenic zebrafish larvae, is time and light intensity dependent. 141

Figure 5.8 11-RE regeneration in the XOPS:mCFP zebrafish line is prevented by inhibition of RPE65 and can be completely bleached-out with continuous light treatment. 142

Figure 5.9 Proposed 11-cis-retinyl ester cycle in the cone-rich zebrafish retina.

143

xii

ACKNOWLEDGEMENTS

First, I would like to thank my advisor, Dr. Johannes von Lintig for giving

me such interesting and challenging projects, dedicating his valuable time to help me through my experimental work and all aspects of my training, and for also taking time to mentor me during my development as a scientist and beyond.

Despite his support of real madrid, he’s not that bad. He finally recognized that

FC Barcelona is the best team in the world!

Thank you to all my colleagues in the von Lintig laboratory, especially Dr.

Jaimie for all his motivational support. To Victoria, Ila and Greg for their support in our experimental endeavors, thank you.

I particularly wish to thank Dr. Marcin Golczak for his help and support with my projects. Marcin has been a mentor and friend throughout my tenure as a Ph.D. student. His support has been unconditional and sometimes even detrimental to his own research. Thank you for your time and friendship.

I owe a special thanks to our collaborators, Dr. Palczewski and his group members for their support of my research. Grazyna Palczewska provided beautiful two-photon microscopy analysis that was instrumental for our zebrafish studies. David Peck was essential in always providing solutions to my experimental necessities. Dr. Kiser provided critical support of our work. Dr.

Kowatz, thank you for always lending your support of my undertakings. Dr. Sun, thank you for providing me the essential training that I was able to use throughout this work.

xiii

I owe a debt of gratitude to our collaborator, Dr. Brain Perkins for his

continued support beyond my direct studies in zebrafish. His generosity knows

no bounds.

I owe a special thanks to the members of my Ph.D. thesis committee, Drs.

Derek Taylor, Michael Harris, Krzysztof Palczewski, and Robert Bonomo for all

their insightful and constructive analysis of my work.

During my graduate studies, I was supported by the Visual Sciences

Training Program (VSTP) grant. I would like to thank the committee and the

principle investigator of the training grant, Dr. Susann Brady-Kalnay for financial

support.

I owe a thank you to Dr. Brain McDermott and his colleagues Carol

Fernando and Shih-wei Chou for their assistance and training with our zebrafish

work.

I want to thank my entire family for their love and support, without them

none of this would have been possible. Dear Dad, you are the best example of

what a person should strive to be, thank you for always being there for me. Rose,

I could never repay the love and support that you have always given me. Also,

thanks for taking care of those bullies for me. My dear Aurelia, thank you for your

love, support and the countless hours that you spent listening to me. You made

this adventure much easier. Querida Madre gracias por ser la major madre del mundo y por todo su amor y apoyo. Con este logro estoy mas cerca que nunca para pagerle los nueve meses.

xiv

LIST OF ABBREVIATIONS

10APO: 3-hydroxy-β-apo-10’-carotenal

11-RAL: 11-cis-retinal

11-RE: 11-cis-retinyl esters

11-ROL: 11-cis-retinol

12’-oxime: All-trans-apo-12’-lycopenal oxime

ACO: Apocarotenoid- 15, 15’- oxygenase

Apo-12: all-trans-apo-12’-lycopenal

At-RAL: all-trans-retinal

At-RE: all-trans-retinyl ester

At-ROL: all-trans-retinol

C8E4: Glycol monooctyl ether

C8E6: Hexaethylene glycol monooctyl ether

CHAPS: 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate

BCO1: β-carotene-15, 15’-dioxygenase 1

BCO2: β-carotene-9’, 10’-dioxygenase

CCE: carotenoid cleavage enzyme

CRALBP: Cellular retinal binding protein

DDM: N-dodecyl-β-D-maltopyranoside

DKO: Bco1-/-; Bco2-/- double mutant mice

DMN: decyl maltose neopentyl glycol

DMPIO: 2,2-dimethyl-1-oxido-4-phenylimidazol-1-ium

DPF: Day(s) post-fertilization

DTT: dithiothreitol

ε-10Apo: 3-hydroxy-ε-10’-apocarotenal;

LRAT:Lecithin retinol acyltransferase

MP: macula pigments

MPM: Multiphoton excitation fluorescence microscopy

NinaB: neither inactivation nor afterpotential B

ND: Not detectable

NOB: nitrosobenzene;

OKR: Optokinetic response

OTG : n-Octyl-β-D-thioglucopyranoside

PBN: N-tert-Butyl-a-phenylnitrone

PBST: PBS with Tween 20

xvi

POS: Photoreceptor outer segment

Ret-NH2: Retinyl amine

Rho: Rhodopsin

RPE: Retinal pigment epithelium

RPE65: retinal pigment epithelium protein of 65 kDa

Sf9: Spodoptera frugiperda 9

TCEP/HCl: Tris(2-carboxyethyl)phosphine hydrochloride

TPM: Trusted platform module

Wt: wild-type.

XM: XOPS:mCFP

Z: zeaxanthin

xvii

Biology and Chemistry of Carotenoid Cleavage Enzymes in Vision

ABSTRACT

DARWIN O. BABINO

Animals endowed with the ability to detect light have evolved pathways to

produce and maintain the continuous regeneration of the visual chromophore,

11-cis-retinal. This C20 retinoid metabolically derives from a C40 carotenoid

precursor that is processed by successive oxidative cleavage and geometric

isomerization reactions of double bonds. Vertebrates devote three structurally

related proteins of the carotenoid cleavage enzyme (CCE) family to this task, whereas insects utilize only one. Expression and purification protocols of recombinant BCO1, the vitamin A forming enzyme, yielding highly active and a

homogenous, monomeric protein was established. Enzyme activity assay

screening with various detergents provided optimal conditions for kinetic

characterization and the foundation for crystallization trials. Phase separation

experiments indicate that despite BCO1’s soluble state, the enzyme directly

interacts with hydrophobic detergent micelles to extract substrates. Our studies

on BCO2, the CCE responsible for asymmetrical conversion of carotenoids into

apocarotenoids, established methods to isolate enzymatically active primate

protein. Comparison tests to rodent BCO2 indicates that primate BCO2’s

enzymatic function is conserved and analyses suggest that the regulation of

BCO2 gene expression is governed by induction of oxidative stress. We provide

further evidence that this enzyme plays a role in carotenoid homeostasis,

including the macular pigment which has been associated with eye health.

Biochemical studies of the sole insect CCE, NinaB, revealed a bipartite substrate

binding site that conveys regio- and stereo-selectivity and catalyzes the

conversion of carotenoids into all-trans and 11-cis-retinoids via a dioxygenase mechanism. The described bipartite system recognizes key carotenoid features to optimally cleave and isomerize substrates that will produce the chromophore.

The vertebrate retinoid isomerase, RPE65, converts all-trans-retinyl esters to 11- cis-retinol in the retinal pigment epithelium. Here, we report a previously unidentified, dark-dependent role of RPE65 in the generation of 11-cis-retinyl esters within the zebrafish vertebrate model. Establishment of an 11-cis-retinyl ester pool under dark adaptation ensures sufficient supply of visual chromophore under exposure to bright light. The studies described here provide key insights into the biology and chemistry of this important family of carotenoid cleavage enzymes and the roles that they play in vision.

CHAPTER 1: Introduction and Background

1.1 Retinoids in vision

Vision, the process which acquires most of the brain’s sensory input, is a paramount example of the complex interactions of our body with the environment. At the heart of this process is a strict dependency on a dietary chromophore, a molecule absorbing and emitting specific wavelengths of visible light. To establish vision, animals have evolved pathways by which dietary chromophore precursors such as vitamin A (all-trans-retinol, ROL) and provitamin A (β, β-carotene, BC) are absorbed in the intestine, transported in the

body, taken up by cells, and metabolized to the chromophore. In order to sustain

vision, vertebrates have further evolved pathways that regenerate the visual

chromophore, 11-cis-retinal, from the photoproduct all-trans-retinal. This process

takes place in ocular cell types and is referred to as the visual or retinoid cycle.

Eye diseases have been associated with dysfunctions at both ends, i.e. either

relating to the procurement of chromophore precursors or the sustainability of the

visual process. For instance, night blindness, a condition that can be caused by

an inadequate vitamin A supply to the eyes, is the oldest described eye disease

known since ancient times (1). Although this problem was prevalent in Western

societies about 100 years ago, an improved dietary intake has largely defeated

this ailment (1). Unfortunately, this deficiency is still a major health problem that

causes blindness and increased mortality of children in developing countries (2).

Mutations in genes encoding key players involved in chromophore metabolism,

namely the visual cycle, can cause inherited retinal diseases such as retinitis

pigmentosa and Leber congenital amaurosis (LCA) (3). Within these pathways,

aberrant side products of chromophore metabolism may also trigger chronic eye

disease such as age-related macular degeneration (4).

Carotenoids and their metabolites, retinoids, are composed of isoprenoid

units that can only undergo a limited number of chemical transformations, with

just a few of these occurring naturally. Focal to our topic is the conversion of the

parent C40 carotenoid precursor into two C20 retinaldehyde (RAL) compounds

by symmetric oxidative cleavage at position C15, C15’ in the carbon backbone.

This is the formal first step in chromophore metabolism (Figure 1.1). The

enzymatic oxidative cleavages of carotenoids at specific positions of the polyene chain have been proposed for all existing kingdoms of nature as a method for the synthesis of apocarotenoids, including retinoids. The first carotenoid-cleaving enzyme (CCE) was molecularly identified by analysis of a maize mutant deficient in the apocarotenoid, abscisic acid (5). Successively, sequence homology of this plant carotenoid-cleaving enzyme, viviparous14 (VP14), which catalyzes the oxidative cleavage of the 11, 12 double bond of a 9-cis-epoxycarotenoid in the

biosynthetic pathway of the plant growth factor abscisic acid, led to the discovery

of another member of this family in insects (6). This breakthrough was followed

by the molecular cloning and biochemical characterization of structurally related

enzymes throughout the different natural kingdoms (7).

1.2 Carotenoid cleaving enzymes

The combination of modern molecular biology and biochemistry, as well

as the use of a genetically well-defined model organism, Drosophila melanogaster, led to the identification of genes devoted to chromophore metabolism. Eventually, it was discovered that insect genomes encode only one

CCE, whereas vertebrate genomes encode three distinct family members. The vertebrate family includes, first, β, β-carotene-15,15’-monooxygenase (BCO1), which converts a limited number of provitamin A carotenoids such as β, β- carotene to retinaldehyde by symmetric cleavage at position C15,C15’ (8-10).

The role of BCO1 as the key enzyme for retinoid production has been thoroughly established. Studies in knockout mouse models showed that BCO1 is the key enzyme for retinoid production (11). In humans, a heterozygous loss-of-function mutation in BCO1 was described with evidence of both elevated β, β-carotene plasma concentrations and low retinol plasma concentrations (12). In addition, common genetic polymorphisms exist in the BCO1 gene that alter β-carotene metabolism in affected individuals (13, 14).

The second CCE, a β, β-carotene-9,10-dioxygenase (BCDO2), catalyzes cleavage of carotenoids at the C9’,C10’ double bond (15) and displays broad substrate specificity as opposed to BCO1 (16-18). BCDO2 can further metabolize its primary cleavage product by oxidative tailoring at C9,C10, indicating that the enzyme plays an additional role in apocarotenoid metabolism (18).Additionally, there is a marked difference in the subcellular localization of the two vertebrate carotenoid-oxygenases. BCO1 is a cytoplasmic protein (8) whereas BCDO2

localizes to mitochondria (18), further indicating separate roles in carotenoid metabolism. Analysis of a knockout mouse model for BCDO2 demonstrated a critical role of the second CCE for carotenoid homeostasis in tissues (18-20).

The third vertebrate family member, the retinal pigmented epithelium

(RPE) 65 kDa protein RPE65, was the first animal CCE molecularly identified

(21), but for a long period of time, RPE65 was regarded as a retinoid-binding protein (22, 23). Two observations helped decipher RPE65’s functional connection to retinoid metabolism and photoreceptor physiology. The first was made when mutations in the RPE65 gene were reported to cause LCA in humans (24). Then, it was observed that RPE65-null mice develop early-onset blindness similar to the human situation. Analyses of these mice revealed almost undetectable levels of 11-cis retinoids and a substantial accumulation of retinyl esters in the RPE, showing a metabolic dysfunction which disrupts chromophore synthesis (25). Eventually, it was shown that RPE65 is the retinoid isomerase in the vertebrate visual cycle catalyzing the conversion of all-trans-retinyl esters

(RE), primarily palmitoyl esters, into 11-cis-retinol (26-28) (Figure 1.1).

The sole insect CCE, encoded by the neither inactivation or after potential gene B (NinaB), catalyzes a combined oxidative cleavage at position C15,C15’ and isomerization at position C10,C11, yielding one molecule each of the cis- and trans-chromophore (29). Analysis of insect phototransduction cascades has significantly contributed to our understanding of the genetics of vision (30, 31).

Like RPE65 for vertebrates, NinaB has been shown to be critical for insect vision as demonstrated through NinaB null-mutations which cause the complete

absence of visual pigments in the compound eyes of fly mutants, rendering them

blind (32-34). It is apparent that all animals that are endowed with the ability to

detect light through visual pigments have evolved a pathway in which dietary

carotenoids are metabolically converted to the chromophore. These observations

across species demonstrate that both oxidative cleavage and trans-to-cis double bond conversion of carotenoids and retinoids, are intrinsic catalytic activities of animal CCE family members.

Structural data have been resolved for three CCEs. The first, determined in 2005, was from a water soluble family member from the cyanobacteria

Synechocystis (strain sp. PCC6803), apocarotenoid oxygenase (ACO) (35). This structure revealed that the general fold adopted by this protein family is a seven- bladed β-propeller, and that the required non-heme ferrous iron cofactor is coordinated by four absolutely conserved histidine residues and three second shell glutamate residues. The structure determined for native RPE65 from Bos

taurus revealed a monotopic mode of membrane insertion for this protein (36).

The major hydrophobic patch on the protein surrounds the entrance of a tunnel

that leads to the active site of the enzyme defined by the iron cofactor. A

comparable finding was suggested with the solved crystal structure of maize

VP14 (37). Unlike ACO, there is only one tunnel through which retinoid substrate

and product can travel in RPE65. This observation suggests that retinoid

substrates enter the active site from the membrane and after metabolism the

products are released back into the membrane where they can diffuse for further

processing. The essential role of ferrous iron for enzymatic catalysis was

demonstrated for BCO1 and RPE65 (38, 39). Although the crystal structures of

ACO and RPE65 provide a structural framework for the isomerization and

oxidative cleavage reactions, the precise catalytic mechanism awaits future

structural and biochemical studies. From an enzymatic and chemical perspective,

several options are possible. Insights into this reaction mechanism have been

gained primarily by using 18O-labeled retinyl esters, bulk-labeled water, and

selected stereospecific reactions (36, 40-43). However, despite a significant

advancement in structural data, the precise mechanism of the isomerization and

oxidative cleavage reaction remains undetermined (44).

Once oxidatively cleaved, the aldehyde end group of retinal (RAL) can

either undergo catalytic reduction or oxidation to form retinol (ROL) or retinoic

acid (RA), respectively (45). Comparative analysis of apocarotenoid metabolism

revealed that these steps are catalyzed by related dehydrogenases in plants as

well as in animals (7). Additionally, the turnover of the plant hormone abscisic

acid is catalyzed by the same type of oxygenase (a cytochrome P450 or CYP

enzyme) used by vertebrates in RA catabolism (46). This parallel function of key

players in carotenoid and apocarotenoid metabolism is evolutionarily well

conserved throughout the kingdoms. Animals took advantage of this ancestral

gene pool to evolve enzymes specific for chromophore metabolism.

1.3 Absorption and transport of chromophore precursors

The small intestine is responsible for absorbing dietary lipids such as carotenoids and delivering them to the organism as triglyceride-rich lipoproteins

(Figure 1.2). Intestinal lipid absorption is a complex process that evidently

8 depends on membrane receptors/transporters (47). For carotenoids, it is now clear that scavenger receptors such as SR-B1 and CD36 facilitate their absorption (15, 48-50). Once absorbed, the provitamin A carotenoids are metabolized into RAL by BCO1 (51), and then converted into ROL and retinyl esters (RE) in a stepwise fashion (52). The resulting RE are then packaged into chylomicrons and subsequently are secreted into the lymph (53). A small fraction of these circulating RE are taken up by peripheral tissues in a process that likely involves lipoprotein lipase (54). The remaining REs are cleared by hepatocytes and hydrolyzed back to ROL (55) which is then transferred into hepatic stellate cells and esterified by the lecithin: retinol acyltransferase (LRAT) for storage (56).

In humans, a substantial amount, up to 40% of absorbed carotenoids, are not cleaved in the intestine (57), but rather, they, along with other lipids, become incorporated and associate with circulating lipoproteins(58, 59).

During fasting, ROL bound to the 21 kDa serum retinol binding protein

RBP (holo-RBP) is the major retinoid found in the circulation. The liver expresses

RBP, which is secreted from hepatocytes into the circulation in a ROL-dependent manner (Figure 1.2). Once in the blood, ROL-RBP forms a protein-protein complex with 55 kDa transthyretin (TTR) (57). TTR is required for normal blood

ROL homeostasis and prevents excessive loss of the relatively small RBP molecule by glomerular filtration (57, 60). Rbp-/- mice develop normally on retinoid sufficient diets, but suffer from visual chromophore deficiency early in life

(60). Later in life, this deficiency is corrected when animals are kept on vitamin A sufficient diets, indicating that, analogous to RA-dependent processes, other

9 blood retinoid transport systems can substitute for RBP-deficiency. Similarly, patients with RBP-deficiency display only mild ocular defects (61).

A receptor for the holo-RBP complex has recently been identified as being encoded by the stimulated by retinoic acid 6 (Stra6) gene (62). Mouse and cell culture studies showed that ROL uptake via this trans-membrane spanning protein is driven by metabolic conversion of ROL to RE by LRAT (63-65). These studies also provided biochemical evidence that the STRA6-dependent flux of

ROL between RBP and cells is bidirectional, indicating STRA6 as a retinoid transporter (63, 64). STRA6 is expressed in several, but not all retinoid metabolizing tissues, including the eyes (62). Interestingly, the liver as the major organ for retinoid storage does not express STRA6, indicating that this receptor is mainly required for the delivery of ROL from the liver to peripheral tissues.

STRA6 and RBP are responsible for a well-regulated transport system for

vitamin A that helps vertebrates to adapt to the fluctuating amounts of dietary

vitamin A in their natural environments (65, 66). However, it is not known as to

whether STRA6 is essential for vitamin A homeostasis of peripheral tissues (67).

Genetic studies in humans have provided evidence for this assumption.

Mutations in the STRA6 gene are associated with microophthalmic syndrome 9

(HMS9) that encompasses the Mathew-Wood and Spears Syndromes (68, 69).

This autosomal recessive disease is characterized by severe bilateral

microophthalmia that can be combined with various anomalies of the lung, heart,

diaphragm, kidneys, pancreas and gastrointestinal tract (68-70). Additionally,

mental retardation and brain anomalies have been reported for HMS9 patients

(68, 69, 71). Significantly, these anomalies are consistent with the established role of the vitamin A derivative, retinoic acid (RA), for embryogenesis and

organogenesis (72). But a clear genotype/phenotype association for STRA6

mutations has not yet been established (71). Homozygous mutations of STRA6

result in early lethality in most cases, but some long-term survivors have been

described in the literature (68-70).

Studies in cell culture show that disease-causing STRA6 missense

mutations either interfered with maturation and subcellular transport of STRA6

and/or significantly reduced ROL uptake activity (70, 73). Knockdown of STRA6

in the developing zebrafish revealed that this transporter is critical for embryonic

vitamin A homeostasis of oviparous vertebrates (63). Surprisingly, mice deficient

for STRA6 develop normally and only display ocular vitamin A deficiency (74).

Thus, the role of STRA6 in vertebrate biology remains to be further defined.

1.4 The “canonical” visual cycle

Once absorbed by vertebrate eyes, vitamin A must be converted to the

chromophore to establish and sustain vision. Individual steps in the canonical

visual cycle have been delineated in biochemical detail, and the function of key enzymes has been confirmed in mouse models (Figure 1.3). Mutations in genes encoding these proteins are associated with various blinding diseases in humans and are covered in the next chapter. In the disc membranes of rod outer segments (ROS), the light-sensitive protein rhodopsin exists as an integral

11 membrane protein, and the chromophore, 11-cis-retinal, is covalently bound via a

Schiff base linkage. Light induces a cis-to-trans isomerization of the protein- bound chromophore to initiate phototransduction (75). Hydrolysis of the Schiff base linkage by bulk water entering from the cytoplasmic side liberates the RAL photoproduct (76). Part of RAL is released into the disc lumen and must be transferred to the cytosol by ABCA4 (ATP-binding cassette transporter 4) (77).

The first step in the visual cycle involves reduction of RAL to ROL catalyzed by

retinol dehydrogenases (RDHs) - here acting as reductases (78, 79). Two

enzymes, RDH8 in photoreceptor outer segments and RDH12 in photoreceptor

inner segments, which belong to the short-chain dehydrogenase-reductase

family and employ NADPH as a cofactor, are mainly responsible for catalyzing

this reaction in mouse photoreceptors (80). Interestingly, the redundancy of

retinal reductase activity shown in mouse knockout models suggests that

photoreceptors contain additional functional RDHs other than RDH12 and RDH8

(81). This redundancy could be explained by the need for a large enzymatic

capacity in order to convert the chemically reactive aldehyde group of the

photoproduct to the corresponding alcohol under bright light conditions. After

bright light bleaching of rhodopsin, the photoproduct can exist in millimolar

concentrations within cells. The aldehyde group of the photoproduct can form

adducts with primary amino groups that exist in many cellular molecules,

including lipids, proteins, and ribonucleotides. The natural occurrence of such an

aberrant side reaction is documented by the presence of the bisretinoid A2E,

formed by a condensation reaction of two molecules of RAL with the membrane

12 lipid phosphatidylethanolamine. Ocular accumulation of A2E and A2E-mediated

redox reactions have been implicated in the pathology of eye diseases such as

age-related macular degeneration (82). The importance for rapid clearance of the

photoproduct is also demonstrated by the consequences of mutations in RDH12

and ABCA4 in humans (83, 84). Mouse models with impaired retinal clearance

have been established to characterize the underlying pathology (85). Several

mechanisms by which the photoproduct induces photoreceptor cell death have been proposed and may involve oxidative stress, action of Toll-like receptors,

and microglia activation (86-89).

ROL formed in ROS is transported to the RPE where it is esterified. This process

is facilitated by two retinoid-binding proteins: interphotoreceptor retinoid-binding

protein (IRBP) which binds retinoids in the extracellular space and cellular retinol-

binding protein-1 (CRBP1) located within retinal pigment epithelium (RPE) cells

(90, 91). The major ester synthase in RPE, LRAT (92, 93), comprises an

important role in ocular retinoid metabolism as it is required for the clearance of

ROL from the retinoid outer segments and for the uptake of ROL from the blood.

Due to their high hydrophobicity, all-trans-retinyl esters constitute a stable

storage form of vitamin A within internal membranes and oil droplet-like

structures called retinosomes (94). Additionally, all-trans-RE serves as substrate

for RPE65 which catalyzes the endothermic transformation of all-trans-retinoid to

its 11-cis conformation. The product of this isomerization reaction is 11-cis- retinol, which is subsequently oxidized in the final catalytic step of the visual cycle to 11-cis-retinal. Enzymatic activities of short chain

13 dehydrogenases/reductases (SDRs) such as RDH5, RDH10 and RDH11 are mainly responsible for this reaction (95), but additional 11-cis-RDHs may participate within the RPE (81). Newly synthesized and highly unstable 11-cis- retinal is protected by binding to cellular retinaldehyde-binding protein (CRALBP) that mediates its transport back to photoreceptor ROS where the chromophore can once again couple to opsin, thereby completing the cycle (96). Disrupting the enzymatic steps of chromophore regeneration in the RPE, especially those involving LRAT and RPE65, or a combination of both, has severe consequences for retinal health. The resulting chromophore deficiency causes slow progressive death of rods that is attributed to continuous activation of visual phototransduction by unliganded opsin (97). Moreover, disordered vectorial transport of cone visual pigments lacking bound-chromophore leads to very rapid cone degeneration (98).

1.5 An alternative visual cycle for cones

Vertebrate retinas employ two types of photoreceptors, rods and cones.

Cone photoreceptors mediate daylight vision and are critical for visual acuity and color discrimination (99). Cones operate under bright light that saturates rods, but rods still consume 11-cis-retinal under this condition. This scenario might require an additional cone-specific chromophore regeneration pathway to avoid the established competition for 11-cis-retinal between rods and cones (100).

Studies in lower vertebrates indicate that cone, but not rod, visual pigment regenerates in isolated neuronal retinas independent of the RPE (101). Recent work provided evidence for an intra-retinal pathway for cone visual pigment

regeneration in mammals (102). Biochemical analysis of cone-dominant

vertebrates led to proposal of a cone-specific pathway for chromophore

regeneration (103). This pathway may involve Müller glia cells where, in contrast

to the RPE, ROL is directly isomerized back to the 11-cis configuration. Finally,

NADP+/NADPH-dependent 11-cis-RDH activity found exclusively in cone

photoreceptors expedites regeneration of visual chromophore from 11-cis-retinol

(103, 104). Studies of the cone-dominated retinas of zebrafish larvae provided in vivo evidence for alternative pathways for cones. In this model, disruption of

RPE65 function, the canonical visual cycle isomerase, did not completely abolish chromophore regeneration (105). Additionally, genetic disruption of Müller glial cell-specific CRALBP did affect cone visual pigment regeneration in fish larvae

(106). However, the ultimate description of the alternative visual cycle will require the in vivo identification of genes that encode proteins responsible for its key enzymatic steps.

1.6 Concluding remarks

Substantial progress has been made in elucidating the metabolism of retinoids and carotenoids related to vision. These studies have revealed an intriguing evolutionary conservation of key components involved in the absorption of pro-vitamin A carotenoids, chromophore production and regeneration in

15 animals. Mutations in humans and homologous knockout animal models

demonstrate the overall physiological importance of these pathways. Moreover,

this knowledge has greatly facilitated the identification of disease-causing mutations within genes of the visual cycle. Defects in nearly every component of this cycle can cause human inherited retinal dystrophies ranging from mild ocular defects to fatal outcomes. Armed with this knowledge, researchers and clinicians have been able to set forth in trying to establish treatments for these dystrophies.

Gene therapy in animal models of blinding diseases such as retinitis pigmentosa has successfully replaced enzymes involved in chromophore regeneration and restored vision (107). Currently, dystrophies resulting from impaired chromophore synthesis have been shown to respond to supplementation with a readily available chromophore analog precursor (9-cis-retinyl acetate), and those derived from accumulation of toxic retinoid derivatives can be treated by inhibiting the visual cycle or limiting the supply of vitamin A to the eyes via pharmacological intervention (108, 109). Despite these advances, several questions remain open, including the mechanistic and structural basis for retinoid trans-to-cis isomerization. Recent progress provides hope that many inherited

retinal diseases will soon be treatable by pharmaceutical remedies. Only

progress in understanding the basic chemistry of vision can guarantee that

clinical studies will progress in parallel to benefit afflicted patients.

Here provide further characterization of the CCE family. Expression and purification protocols of recombinant human BCO1 establish a foundation that will be valuable for the continued structural and biochemical studies of this

16 enzyme. Analyses of the enzyme’s in vitro activity in varying detergents reveal several inhibitory detergents and provide optimal conditions for enzymological characterization. BCO1 is a soluble protein in both cells and tissue, but is able to interact with detergent micelles for substrate binding. Development of an improved bacterial expression method and enzymatic assay proves that BCO2 activity, asymmetrical cleavage of carotenoids, is conserved in primates as has been documented in rodents. Recombinant macaque BCO2 converts all macular pigments into apocarotenoids in an apparent carotenoid homeostatic process.

Animal and cell culture studies indicate that there is a link between BCO2 gene expression and oxidative stress that can be caused by excessive carotenoid accumulation. A protocol for the expression of NinaB in insect cells which provides large quantities of highly active enzyme, a staple of enzyme studies, was developed. Analyses with symmetrical and asymmetrical carotenoids indicate the presence of a bipartite system within the enzyme. This bipartite system is responsible for the preferential and specific isomerization of carotenoids across a 3-hydroxy-β-ionone ring side to optimally produce the visual chromophore. Experiments with acyclic carotenoids and apocarotenoids reveal that the system also accounts for the symmetrical oxidative cleavage to produce retinoids. Our analysis here of chromophore regeneration in wild-type and cone- only zebrafish larvae reveals a previously undetermined role of RPE65 in producing 11-cis-retinyl esters. This dark-dependent process establishes a reserve of visual chromophore pre-cursor for use under bright light conditions and in doing so maintain continuous vision. Only progress in understanding the

17 basic biology and chemistry of vision can guarantee that clinical studies will

progress in parallel to benefit afflicted patients.

FIGURES

Figure 1.1 Chemical structures of some of the main naturally occurring retinoids in mammals, and key enzymatic steps in retinoid metabolism. These reactions include (1) oxidative cleavage of double bonds, (2) oxidation of alcohols to aldehydes and aldehydes to acids, and aldehyde reduction to alcohols, (3) esterification of alcohol generating a retinyl ester, and (4) all-trans-to-cis isomerization of carbon-carbon double bonds.

Figure 1.2 Transport systems for retinoids in mammals. The scavenger receptor class B type 2 (SR-BI) mediates intestinal carotenoid absorption. Upon absorption, carotenoids such as β, β-carotene are oxidatively cleaved to all-trans-retinal (RAL) by the action of BCO1. The primary retinaldehyde (RAL) cleavage product is then successively converted to retinol (ROL) and retinyl esters (RE) by the action of retinol dehydrogenases and lecithin:retinol acyltransferase (LRAT) and diacylglycerol acyltransferase 1 (DGAT1). REs are packed into chylomicrons and secreted into the circulation. Parts of these REs are taken up by peripheral tissues in a lipoprotein lipase (LPL)-dependent manner. The majority of REs in chylomicron remnants are taken up by liver and stored in stellate cells in a LRAT-dependent manner. Retinoids are secreted from the liver in the form of ROL bound to RBP (holo-RBP). Holo-RBP forms a complex with transthyretin (TTR). Uptake into the retinal pigment epithelium (RPE) is accomplished by the membrane protein STRA6. Cellular accumulation of ROL is driven by esterification. The resulting REs serve as substrates for the retinoid isomerase RPE65 that catalyzes 11-cis-retinol formation.

Figure 1.3 The canonical visual cycle in the vertebrate eye. The picture shows a schematic overview of the canonical visual cycle. This cycle involves the rod outer segments (ROS) and the retinal pigment epithelium (RPE). Biochemical key steps of the canonical visual involves reduction of all-trans-retinal to all-trans-retinol, esterification of all-trans-retinol to retinyl ester, isomerization and ester bond cleavage to 11-cis-retinol, and oxidation of 11-cis-retinol to 11-cis-retinal. It should be noted that transport of retinoids in and between cells requires binding proteins such as intracellular and extracellular retinol-binding proteins and cellular retinaldehyde-binding protein , as well as the retinoid transporters ABCA4 and STRA6. These protein act at multiple sites of the cycle and are not figured. An important aspect in the visual cycle is to prevent the accumulating photoproduct, all-trans-retinal, to undergo condensation reactions forming, for instance, bisretinoids, which can have deleterious effects (explanations in main text).

CHAPTER 2: Expression and Purification of Human β, β-carotene-15, 15’-

monooxygenase (BCO1)

This chapter was previously published in Arch Biochem Biophys. *Kowatz, T.,

*Babino, D., Kiser, P., Palczewski, K., and von Lintig, J. 2013; 539; 214-222,

PMID: 23727499. *Co-first Authors

2.1 Introduction and Background

Vitamin A (all-trans-retinol, ROL) is critical for vision, embryonic development, cellular homeostasis and immunity (3, 72, 110, 111). For most of the world’s population, plant carotenoids such as β, β-carotene (BC) are the main dietary source of vitamin A (2, 112). Deficiency of this vitamin, especially in developing countries, leads to blindness in hundreds of thousands of children annually, as well as great increases in childhood morbidity (113). The amount of vitamin A obtainable from dietary BC depends mainly on two factors: the bioavailability of the ingested carotenoids and their conversion to vitamin A by endogenous enzymes (114, 115). This conversion is catalyzed by the enzyme

β,β-carotene-15,15´-monooxygenase (BCO1) located in intestinal enterocytes

(116, 117). The reaction yields two molecules of retinaldehyde (RAL) which can be converted to ROL (Figure 2.1A). BCO1 has been cloned from several vertebrate species, including chicken, mouse, human and zebrafish (8, 10, 118-

120). A rare missense mutation in human BCO1, as well as genetic disruption of

BCO1 in mice, result in highly elevated β, β-carotene blood levels and cause hypovitaminosis A (11, 12), indicating that BCO1 is the major enzyme for vitamin

A production. BCO1 only cleaves carotenoids with a non-substituted β-ionone ring and thus has limited substrate specificity for provitamin A carotenoids (8,

18). The enzyme has a slightly alkaline pH optimum (8, 121) and can be inhibited by various ferrous iron chelators and sulfhydryl alkylating compounds (8, 117,

121) as well as activated or protected by sulfhydryl reducing compounds (8, 117,

122-125). Because BCO1 activity could be inhibited by iron chelating agents but not by cyanide, an inhibitor of ferric protoporphyrin enzymes, this carotenoid oxygenase was classified early on as a non-heme iron oxygenase (8, 126).

BCO1 is a member of an evolutionary well-conserved family of double bond cleavage enzymes. (7). Besides BCO1, mammalian genomes encode the enzymes β,β-carotene- 9′, 10′-dioxgenase (BCDO2) (15) and retinal pigment epithelium-specific 65 kDa protein (RPE65) (127). In contrast to BCO1, BCMO2 cleaves carotenoids eccentrically at the C9, C10 double bond and shows a wide substrate specificity for carotenoids, including compounds with 3-hydroxy and 4- oxo-ionone ring substitutions (17, 18, 20). As a consequence, BCDO2 can interact with both β and ε-3-OH ring sites of carotenoids (17, 18) and even act on noncyclic carotenoids such as lycopene (16, 18). Studies in animals indicate that

BCDO2 plays a critical role in carotenoid homeostasis and for the prevention of oxidative stress caused by excess carotenoids (18, 20). BCDO2 is localized in mitochondria (18, 20) whereas BCO1 is a cytosolic enzyme (8, 117, 121), The differential localization of these carotenoid oxygenases in two different cell

23 compartments appears logical because both enzymes are expressed in the same cell types and share β,β-carotene as a common substrate. Consequently, if both enzymes were expressed in the same cell compartment they would compete for

β,β-carotene which then could decrease vitamin A production (128). RPE65 is a monotopic membrane protein present in the retinal pigmented epithelium (RPE) of vertebrates (127, 129). Mutations in its gene can cause visual chromophore deficiency and thus blindness in humans (24) and homologous mouse models

(25). But RPE65, unlike other members of the carotenoid cleavage oxygenase family, does not cleave carotenoids oxidatively. Instead, all-trans-retinyl esters are simultaneously cleaved and isomerized to 11-cis-retinol (6, 28, 127, 129-

132). This isomerase may use the Lewis acidity of Fe2+ which leads to a

polarization of the ester moiety to facilitate ester cleavage; the Lewis acidity of

the iron is possibly strengthened by the uncharged 4-His ligand environment

(129).

X-ray structures of three members of the CCO family have been determined so

far. The first was apocarotenoid-15,15´-oxygenase (ACO) from Synechocystis

sp. (35) followed by RPE65 (127) and Viviparous14 from plants (37). Their common structural motifs are a seven bladed β-propeller, an active site with the catalytic iron coordinated by four completely conserved His residues, and a hydrophobic tunnel which leads from the active site with its catalytic iron to the protein exterior (35, 37, 127, 133). It has been proposed that nonpolar patches that surround the active site tunnels of these enzymes are used to interact with membranes allowing the transfer of substrate which then can be transported to

24 the active site (35, 127). Superposition of RPE65 with ACO gives a rmsd of 2.5 Å

for 443 Cαs (127) indicating a marked overall similarity between the two

structures.

significant progress has been made towards characterizing this disease-relevant

family of non-heme iron oxygenases, the structural and function of BCO1, the

key enzyme for vitamin A formation have not yet been characterized in detail.

Critical questions regarding the catalytic mechanism and the interaction with its

lipophilic substrate remain to be answered. A prerequisite for such research is a

protocol that yields the protein in high amounts in a homogenous and

enzymatically active state. Here we report the recombinant expression of human

BCO1 in Spodoptera frugiperda 9 (Sf9) insect cells, its purification, its enzymatic

properties in the presence of several detergents and its oligomeric state.

Additionally, we showed that native BCO1 displayed similar properties to the

purified enzyme in the context of its presence in mammalian cell culture and

natural environment in mouse tissue.

2.2 Experimental Procedures

2.2.1 Materials

All-trans-β,β-carotene was purchased from Calbiochem (San Diego, CA).

Tetraethylene glycol monooctyl ether (C8E4), hexaethylene glycol monooctyl

ether (C8E6), n-octyl-β-D-thioglucopyranoside (OTG), n-dodecyl-β-D-

maltopyranoside (DDM) and 3-[(3-cholamidopropyl)dimethylammonio]-1-

propanesulfonate (CHAPS) were obtained from Affymetrix. Talon Co2+-resin was

from Clontech (Mountain View, CA). 25

Plasmid generation and cloning - The N-terminal TEV-cleavage site and 6x His- tag of the insect cell expression vector pFastBac HTa (Invitrogen) were deleted by site directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit,

Agilent Technologies) by using the primer pair 5´-

GCGCGGATCTCGGTCCGAAACCGCCATGGATCCGTTCAAAG-3´ and 5´-

CTTTGAATTCCGGATCCATGGCGGTTTCGGACCGAGATCCGCGC-3´

(Integrated DNA Technologies) to generate the vector, pFastBac HTa-del. The gene sequences for a TEV-cleavage site, 6x His- and 1D4-tags were attached at the 3’ end of the human BCO1 gene by carrying out two PCR reactions. In the first reaction 5´-CTGAATTCATGGATATAATATTTGGCAGGAATAGG-3´ was used as a forward primer and 5´-

CTGTCGACTCAGGCTGGAGCCACCTGGCTGGTCTCCGTATGATGATGATGA

TGATGG-3 (Invitrogen) as reverse primer, whereas in the second reaction the primers were 5´-CTGAATTCATGGATATAATATTTGGCAGGAATAGG-3´ forward and 5´-

ATGATGATGATGATGATGGCCCTGGAAATACAAGTTTTCGGTCAGAGGAGC

CCCGTGGCAG-3´ reverse (Invitrogen). The obtained insert was subcloned into

pFastBac HTa-del with Eco RI and SalI (Roche) used as restriction enzymes to

generate the construct, pFastBac HTa-del-BCO1. MAX EfficiencyR DH10Bac™

Competent Cells (Invitrogen) were then transformed with the obtained construct to generate the bacmid DNA.

2.2.2 Insect cell transfection, protein expression and purification

Spodoptera frugiperda 9 (Sf9) cells were transfected with bacmid DNA with

FuGENER 6 (Promega, Madison, WI) used as the transfection reagent.

Recombinant baculovirus was produced with the Bac-to-BacR Baculovirus

Expression System (Life Technologies, Grand Island, NY). Expression of carboxyl terminal tagged recombinant human BCO1 was carried out by adding either 5 mL, 1 mL, 0.2 mL, or 0.04 mL of baculovirus suspension to 60 mL Sf9 starter cultures (cell number 1.5 x 106) in 250 mL baffled flasks. Serum-free Sf-

900TM III SFM (Gibco) was employed as growth media. Cells grown at 27°C and

rotated at 115 rpm were harvested after 3 days and the pellets were frozen at -

80°C until further use.

The same conditions for soluble expression were reproduced at a larger scale for

purification (20 mL baculovirus was added to 800 mL Sf9 cell culture in a 2 L

baffled flask). Cell pellets (20-30 g) were re-suspended in 50 mL of sample buffer

containing 20 mM Tricine, pH 7.5, 1 mM Tris(2-carboxyethyl)phosphine

hydrochloride (TCEP/HCl), (Hampton Research) and one Complete EDTA free

Protease Inhibitor Cocktail Tablet (Roche). Lysis of cells was performed by 30

strokes of homogenization in a glass tissue grinder. The lysate was centrifuged

at 40,000 rpm for 1 hour at 4ºC (Beckman Coulter OptimaTML-90K

Ultracentrifuge). The supernatant was collected, transferred to 50 ml tubes and

kept on ice. Then it was loaded onto a 10 mL column containing 1.5 mL Talon

Co2+-resin suspension (Clontech) pre-equilibrated with 5 column volumes of ice cold buffer containing 250 mM NaCl, 20 mM Tricine, pH 7.5, and 1 mM TCEP.

After flow-through collection, the Talon column was first washed with 5 column volumes of ice cold buffer containing 250 mM NaCl, 20 mM Tricine, pH 7.5, and

1 mM TCEP and then with 5 column volumes of buffer containing 250 mM NaCl,

20 mM Tricine, pH 7.5, 1 mM TCEP and 1 mM imidazole. Finally BCO1 was eluted in ice cold buffer containing 250 mM NaCl, 20 mM Tricine, pH 7.5, 1 mM

TCEP and either 5 or 50 mM imidazole. Eluted BCO1 fractions were pooled and concentrated in a 30K AmiconR Ultra Centrifugal Filter (Millipore) before being

loaded onto a SuperdexTM 200 10/300 GL size exclusion column (GE Healthcare

Life Sciences). BCO1 fractions were eluted from the column in 0.5 mL fractions

at a flow rate of 0.4 mL/min. with buffer containing 100 mM NaCl, 20 mM Tricine,

pH 7.5, and 1 mM TCEP. Fractions containing purified enzyme were then pooled, concentrated in a 30K AmiconR Ultra Centrifugal Filter and stored on ice until

further use. To determine the monomeric state of purified human BCO1 a mix of

proteins (Bio-Rad Gel filtration Standard) with known molecular weights were run

simultaneously on the size exclusion column.

2.2.3 Enzymatic assays

Frozen Sf9 cell pellets (3-4 g) infected with human BCO1 baculovirus were re-

suspended in 13 mL sample buffer containing 200 mM NaCl, 20 mM Tricine, pH

7.5, 1 mM dithiothreitol (DTT), (Roche) and one Complete EDTA free Protease

Inhibitor Cocktail Tablet (Roche). Lysis of cells was performed by a 30 stroke homogenization in a glass tissue grinder. The lysate was centrifuged at 40,000 rpm for 1 hour at 4ºC (Beckman Coulter OptimaTML-90K Ultracentrifuge). The

supernatant (10 mL) was collected and the remaining pellet was dissolved in 10

28 mL of sample buffer. To monitor enzymatic activity in the presence of various detergents (tetraethylene glycol mono-octyl ether (C8E4), hexaethylene glycol

mono-octyl ether (C8E6), n-octyl-β-D-thioglucopyranoside (OTG), n-dodecyl-β-D- maltopyranoside (DDM) and 3-[(3-cholamidopropyl)dimethylammonio]-1- propanesulfonate (CHAPS) at different concentrations, detergent was added to the supernatant at the appropriate concentration and samples were kept on ice for 10 min. Enzymatic assays were carried out as previously described (126,

134).

2.2.4 Immunoblotting

Frozen 1 g Sf9 cell pellets (from 60 mL Sf9 cultures supplemented with either 5,

1, 0.2 or 0.04 mL BCO1 baculovirus) were each re-suspended in 10 mL of sample buffer containing 200 mM NaCl, 20 mM Tricine, pH 7.5, 1 mM dithiothreitol (DTT, Roche) and one Complete EDTA free Protease Inhibitor

Cocktail Tablet (Roche). Lysis of cells was performed by a 30 stroke homogenization in a glass tissue grinder. The lysates were centrifuged at 40,000 rpm (Beckman Coulter 50.2 Ti) for 1 hour at 4ºC (Beckman Coulter OptimaTML-

90K Ultracentrifuge). Supernatants (10 mL) were collected and the remaining pellets were each dissolved in 10 mL sample buffer. Equal amounts of supernatants and pellets were loaded on SDS-polyacrylamide gels and transferred to PVDF membranes. Blots were probed with an alkaline phosphatase conjugated monoclonal 1D4 antibody (Polgenix Inc.) diluted

1:10,000 in PBS and 5% milk powder for 1 hour and developed colorimetrically with Western Blue Stabilized Substrate for Alkaline Phosphatase. Protocols for

29 detection of BCO1 and lecithin: retinol acyl transferase (LRAT) were previously described (65, 120).

2.2.5 Triton X-114 phase separation experiments

RPE microsomes were prepared from bovine RPE as previously described

(135)Purified bovine serum albumin (BSA) was commercially obtained from

Thermo-Scientific (Rockford, IL.) and Talon-purified BCO1 was prepared as described above. All protein samples (0.5 to 1.0 mg/mL) were ultimately suspended in 200 μl of 10mM Tricine, pH7.4, 150 mM NaCl, and 1.0% Triton X-

114 at 0°C. Essentially, the phase separation experiments were performed as described by Bordier (136) except that 1.5% w/v of Triton X-114 was used to solubilize proteins instead of 1%. Also, after initial separation, the upper aqueous phase received 1% fresh Triton X-114 and after separation, the aqueous and detergent phases were equalized in volume by10% w/v Triton X-114 and the solubilization buffer, respectively. Equal volumes of each fraction were analyzed by SDS-PAGE followed by Coomassie staining.

2.2.6 BCO1 plasmid construction for expression in Cos7 cells

The full-length BCO1 open reading frame (ORF) was amplified with the Expand

High Fidelity PCR system (Roche, Indianapolis, IN). The amplified BCO1 cDNA product was then cloned in frame into the pCDNA 3.1 V5/His TOPO (Invitrogen,

Carlsbad, CA). Appropriate construction of the plasmid was verified by sequence analysis of both strands (Genomics Core Sequencing Facility, Case Western

Reserve University, Cleveland, OH). Monkey kidney COS7 cells were maintained in high-glucose DMEM supplemented with 10% fetal bovine serum (FBS), 1%

0 penicillin-streptomycin sulfate, and cultured at 37 C with 5% CO2. For BCO1 subcellular localization studies, COS7 cells were seeded at 50-70% confluence on glass coverslip in 6-well plates. The next day cells were transfected with 4-6

g of purified plasmid DNA by using LipofectAMINE 2000 (L2000) and OptiMEM as described previously (50). About 40-48 h post transfection, cells grown on coverslips were fixed in a freshly prepared mixture of 4% formalin in phosphate

buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM sodium phosphate

dibasic, 2 mM potassium phosphate monobasic at a pH of 7.4) for 20 min at

room temperature and processed as described before (50). Subcellular

localization of BCO1 in COS7 cells was achieved by exposure to the anti-V5 primary antibody followed by the anti-rabbit conjugated Alexa 594 secondary antibody. Cells were examined under a Zeiss LSM 510 UVMETA confocal microscope with an HCX Plan 40X numerical aperture 1.4 oil immersion objective lens. Images were acquired with Zeiss confocal software version 2.0 (Zeiss,

Jena, Germany).

2.2.7 Determination of the subcellular localization of BCO1 in mouse liver

Three twelve-week-old wild type mice with a C57/BL6;129Sv mixed genetic background were used for the described experiment. Mice were maintained at

24°C in a 12:12-h light-dark cycle with ad libitum access to food and water.

Animal procedures and experiments were approved by the Case Western

Reserve University Animal Care Committee and conformed to recommendations of both the American Veterinary Medical Association Panel on Euthanasia and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Mice were anesthetized by intraperitoneal injection of a mixture containing ketamine (80 mg/kg body weight) and xylazine (20 mg/kg body weight) in 10 mM sodium phosphate, pH 7.2, with 100 mM NaCl and blood was drawn directly from the heart after snipping the right atrium. Then mice were perfused with 10 ml of

PBS and killed by cervical dislocation. The liver was dissected out and homogenized with a polytron tissue homogenizer blender in 3 ml of buffer (750 mM sucrose, 1 mM DTT, MOPS, pH 7). For cytoplasm isolation, the homogenate was subjected to centrifugation at 16, 000 rpm in a Sorvall rotor 7017 at 4 ºC.

The supernatant contained the cytoplasmic fraction. Membranes were

resuspended in PBS and subjected to centrifugation at 40,000 rpm in a Ti50 in a

Beckman ultra-centrifuge. The pellet contained the microsomal fraction. Equal

amounts of protein from the cytoplasmic and microsomal fractions were used for

immunoblot analysis.

2.3 Results

2.3.1 Expression and enzymatic activity of human recombinant BCO1

Two sequential PCR reactions were carried out to attach the gene sequences for

a TEV-cleavage site, namely 6x His- and 1D4-tags at the 3´ end of the human

BCO1 open reading frame. The N-terminal TEV-cleavage site and 6x His tag,

intrinsic in the commercial vector, pFastBac HTa, were deleted by site directed

mutagenesis. N-terminal fusions were avoided owing to the observation that such

modifications of Nostoc. Sp. CCOs result in enzyme inactivation, possibly

indicating a role for this region in protein folding and stability or substrate binding

and/or cleavage. The BCO1 PCR product was finally cloned into the modified

32 insect cell expression vector. MAX Efficiency DH10Bac™ Competent Cells were

then transformed with the obtained construct to generate the bacmid DNA.

After generation of BCO1 baculovirus vector, expression of C-terminally tagged

recombinant human BCO1 was tested over 3 days by adding baculovirus to Sf9

starter cultures. After cells were harvested, the four pellets were dissolved in

equal amounts of sample buffer. The samples were homogenized in a glass

homogenizer by 30 strokes. A one hour centrifugation step at 40,000 rpm and

4°C was carried out to separate the soluble fraction (supernatant) from the

inclusion bodies (pellet). Then the volume of the supernatants was measured

and the pellets were re-suspended in the same volume of sample buffer. Equal

amounts of protein of all four supernatant and pellet fractions were loaded onto

SDS-polyacrylamide gels and transferred to PVDF membranes. Blots were

probed with an alkaline phosphatase conjugated 1D4 antibody and developed

colorimetrically with a substrate for alkaline phosphatase. Figure 2.1B illustrates

successful expression of recombinant human BCO1 under all tested conditions.

A stepwise increase of the amount of baculovirus did not increase BCO1

expression. Also, a significant amount of BCO1 was present in both the soluble

and pellet fractions (Figure. 2.1B). To determine which fraction was enzymatically

active, we used equal protein amounts from both fractions for activity assays with

β,β-carotene. This experiment was performed because BCO1 contains the same

conserved hydrophobic patch of non-heme iron oxygenases which is proposed to

dip into the membrane or micelles to enable transfer of the substrate so it can

reach the catalytic iron in the active site (35, 37, 127). Furthermore, it was

33 recently reported that RPE65 requires a membrane-like environment to be active

(129). Consequently, we assumed that BCO1 also could require a membrane- like environment for its carotenoid cleavage activity. However, robust activity of

BCO1 was only detected in the supernatant (Figure. 2.1C-E), in agreement with previously published data showing that soluble recombinant human BCO1 cleaves β,β-carotene (8). This result indicates that the insoluble fraction of the

BCO1 preparation represents a pool of misfolded protein rather than its

membrane bound form. With the soluble protein we determined linearity of the

enzymatic reaction with time. Under the applied conditions, the enzyme reaction

displayed a relatively short window of time linearity in product formation of about

10 min, kinetics that might be explained by limited substrate availability in the

enzymatic assay. We delivered β, β-carotene in 3% (w/v) OTG and have

previously shown that the maximum loading capacity of OTG micelles is 20 μM

(29). Next, we determined KM and VMAX values for the reaction. For this purpose, we incubated enzyme extracts in the presence of increasing amounts of β, β- carotene (2 µM to 20 µM) for eight min. The reaction was stopped by the addition of 2 M hydroxylamine in 50 % (v/v) methanol. Then substrate and product were extracted and subjected to HPLC analysis for the quantification of products. From assays performed in triplicate, we estimated the KM values to be 13.7 μM and

-1 -1 VMAX to be 392.4 pmol all-trans-retinal x min x mg protein .

2.3.2 Enzymatic activity of BCO1 soluble fraction in different detergents

Because other members of the non-heme iron oxygenase family require detergents for either their solubilization (RPE65, (127)) or crystallization (ACO,

(35)), human recombinant BCO1 activity was tested in the presence of several

different detergents. For each individual trial, a cell pellet of Sf9 infected with

human BCO1 baculovirus was re-suspended in sample buffer. Cells were lysed,

the lysate was centrifuged, and the supernatant was collected. To monitor

enzymatic activity in the presence of various nonionic detergents (tetraethylene

glycol monooctyl ether (C8E4), hexaethylene glycol monooctyl ether (C8E6), n-

octyl-β-D-thioglucopyranoside (OTG), n-dodecyl-β-D-maltopyranoside (DDM)

and the zwitterionic detergent, 3-[(3-cholamidopropyl)dimethylammonio]-1-

propanesulfonate (CHAPS) at different concentrations, tested detergents were added to the supernatant at three different concentrations related to their CMCs.

Results of these enzymatic assays are shown in Figure 2.2 and listed in Table

2.1. When the supernatant was incubated with increasing concentrations (0.5 x,

1 x and 2 x CMC) of the aliphatic detergents C8E4 and C8E6, enzymatic activity

significantly decreased as compared to the activity of the detergent-free

supernatant (Table 2.1). Only 12 % and 19 % of the original activity was retained

when C8E4 or C8E6 were added at 2 x their CMCs. Addition of the sugar-

containing detergents, OTG (one glucose molecule) or DDM (two mannose

molecules) had little negative effect on BCO1 activity relative to the untreated

supernatant (Table 2.1). Thus 93% of activity was retained when DDM was

added at 2 x CMC, and 83 % of activity still was retained when OTG was added

at a concentration of 1 x CMC. Only when OTG was added at a concentration of

2 x CMC did activity drop to 42 % (Table 2.1). This result could be explained by

the fact that OTG when dissolved in water lost its solubility when added to cold

(0-4°C) solutions. When increasing concentrations of OTG were added to the supernatant, more precipitation of protein was observed. When the recombinant

BCO1-containing supernatant was incubated with increasing concentrations of

the steroid detergent CHAPS, most of the enzymatic activity was retained (91%

at 1 x CMC, 83 % at 0.5 x CMC (Table 2.1). That lower activity was observed at

0.5 x CMC of CHAPS (Table 2.1) could be explained by compromised substrate

accessibility. Other studies of purified recombinant human BCO1 showed that the

enzyme is most active in the presence of OTG at concentrations higher than 0.5

mM. However, when CHAPS was used in these assays, only 3% of the initial

activity was retained (8). The discrepancy could arise because purified human

enzyme was used in the present study. Compromised enzymatic activity after

adding the aliphatic detergents C8E4 and C8E6 could result because these

detergents are much smaller than OTG, DDM and CHAPS and therefore could

bind to and inhibit the active site of BCO1. The available crystal structure of the

Synechocystis sp. apocarotenoid oxygenase ACO in complex with an active site

bound C8E4 detergent molecule supports this idea (35). Interestingly, RPE65 also

did not display activity after solubilization and purification with C8E4 (127, 129).

2.3.3 Isolation and determination of purified human BCO1 enzymatic

activity

BCO1 activity was found in the soluble protein fraction and the addition of

detergents failed to increase enzymatic activity. Therefore, we purified BCO1 in

detergent-free buffer. Frozen cell pellets of Sf9 cells infected with recombinant

BCO1 baculovirus were thawed and re-suspended as described in the Material

36 and Method section. After lysis, the soluble fraction was separated from inclusion

bodies by centrifugation and the supernatant was applied to a Co2+ column. Here

it was observed that recombinant human BCO1 could be purified almost free of

contaminating proteins as contrasted to its purification with a Co2+-resin. After the

column was washed, BCO1 was eluted first with 5 mM and then with 50 mM

imidazole. All eluted fractions contained highly pure protein (Figure. 2.3A).

Next, we determined if there was a difference in enzymatic activity between

fractions eluted in buffer containing 5 mM or 50 mM imidazole. Equal volumes of

fractions were used for enzymatic assays with β, β-carotene. Results clearly

showed that both conditions showed comparable high enzymatic activity as

assayed by quantification of the β, β-carotene cleavage product (18.5 pmoles x

min-1 x µg-1 enzyme and 14.8 pmoles x min-1 x µg-1 enzyme; Figure 2.3E and F,

respectively). From this data, we calculated the turnover number to be about 8.5

molecules of β, β-carotene x sec-1 and 7.5 molecules of β, β-carotene x sec-1,

respectively. All fractions containing BCO1 were then pooled, concentrated and

loaded onto a SuperdexTM 200 10/300 GL size exclusion column. The eluted

BCO1 fractions contained protein free of contaminants after this final purification

(Figure 2.3B). Fractions were pooled together and concentrated (Figure. 2.3C)

and 15 µg of this purified protein were used for enzymatic assays. Concentrated recombinant human BCO1 remained enzymatically active after the size exclusion purification step (Figure 2.3D-G). Notably the type of reducing agent included in

the purification buffers had a dramatic effect on enzymatic activity. When

ascorbic acid and/or DTT were the component(s) of all buffers instead of TCEP,

37 only low activity was detected after the Co2+-purification and this residual activity

was abolished after the final size exclusion step. This result agrees with

published data indicating that the relative activity of purified recombinant human

BCO1 was only 32% when DTT was a component of the enzymatic assays

instead of TCEP (8). TCEP also was the reducing agent of choice in assays with

another family member (137).

2.3.4 Determination of the oligomeric state of recombinant human BCO1

The oligomeric state of BCO1 was determined from the results of gel-filtration

assays. First, the SuperdexTM 200 10/300 GL size exclusion column was

equilibrated with a mix of proteins with known molecular weights. The elution

times of these standards then were compared with that of BCO1 (Figure. 2.4A).

A standard curve was generated plotting the elution volumes of the standard

proteins on the x- against the logarithm of their molecular weights on the y-axis.

With the elution volume of BCO1 (14 mL) used as the x-value for the formula y =

-0.2189x + 4.8392, the antilog (10) gave a result of 60 kDa for BCO1 (Figure.

2.4B). As the theoretical molecular weight of recombinant human BCO1 including its C-terminal TEV-, 6x His- and 1D4-tags is 65.2 kDa, we conclude that purified recombinant human BCO1 exists as a monomer in solution.

2.3.5 BCO1 exists as a soluble enzyme in cells and tissues

Recombinant human BCO1 was soluble and its enzymatic activity was not dependent on a membrane-like environment. This finding was surprising because the enzyme, like its family members, must access its lipophilic substrate in the cellular environment of mammalian tissues. The solved crystal structure of

RPE65 revealed that this enzyme contains a cluster of hydrophobic residues that may be involved in membrane binding (28). Three of those regions are modeled in Figure 2.5A. Sequence alignments of the three mammalian CCOs reveal regions with significant diversity that may underlie differential membrane binding affinity of these enzymes (Figure 2.5A). The mechanism by which CCOs bind membranes, facilitating access to their lipophilic substrates, is still a matter of debate. One proposed mechanism hypothesizes that hydrophobic interactions between amino acid side chains and the hydrophobic core of the lipid bilayer are responsible for membrane binding. Additional sequence comparisons and hydropathy plots of the fourth region, potentially involved in membrane anchoring, can be modeled as an amphipathic alpha helix that could favorably interact with membranes (Figure 2.5B). Such modeling is supported by the structures of ACO and VP14 which exhibit for the analogous regions of their sequences. The calculated zeroth (Ho) and first (μH) hydrophobic moments for

these structures are similar between BCMO I and RPE65 with BCMO I displaying

slightly higher overall hydrophobicity and RPE65 displaying a slightly higher

dipole moment. Hydrophobic moments were calculated according to (138). For

112 RPE65, posttranslational modifications such as palmitoylation of Cys have

been described (36). This Cys residue is conserved in BCO1 and may help

anchor the protein to membranes. Previous studies ((139), (140), (135)) have

demonstrated that RPE65 interacts with membranes, predominantly through

hydrophobic interactions. Here, we performed Triton X-114 phase separation

experiments as established by (136) on purified BSA, RPE microsomes, where

RPE65 is the single most abundant protein and Talon-purified recombinant

BCO1 (Figure 2.6A). As expected, the hydrophilic BSA exclusively partitioned to

the aqueous phase, lane b, and as reported previously, RPE65 partitioned to the detergent phase, lane c. In line with its observed solubility and activity in membrane-free environment, recombinant BCO1 was recovered entirely from the

aqueous phase. Lane a is the starting material independent of phase separation.

Also to consider, recombinant BCO1 was expressed as tagged protein which may result in aqueous solubility. To determine the localization of native BCO1, we cloned its cDNA into the mammalian expression vector, pCDNA3.1. The resulting BCO1 plasmid construct was transfected into COS-7 cells. Then, these cells were seeded on coverslips, fixed and immunostained for BCO1. Stained

cells were viewed after confocal imaging to determine the localization of BCO1.

This analysis revealed a cytoplasmic localization of this enzyme (Figure 2.6B), thereby corroborating our findings with the recombinant enzyme. To exclude that overexpression of BCO1 could give rise to cytoplasmic localization of BCO1, we

needed to analyze its localization in a mammalian tissue and used a freshly

dissected liver of a 12 week old mouse for this purpose. Mice express hepatic

BCO1 especially highly in Stellate cells (141). We homogenized the liver tissues

and subjected the cell homogenate to high-speed centrifugation to separate

soluble from membrane fractions. We re-solubilized the membrane pellet and subjected equal amounts of total protein of the membrane and soluble fraction to

immunoblot analysis. We used antisera against murine BCO1 and murine

lecithin: retinol transferase. The latter enzyme is a marker of Stellate cells and an

40 integral membrane protein (142, 143). BCO1 became detectable in the soluble

hepatic protein fraction, whereas the lecithin:retinol transferase was exclusively

present in the membrane fraction (Figure 2.6C). Thus, BCO1 is a soluble protein

in the context of its natural cellular environment.

2.4 Conclusions

We established a protocol to express and purify human BCO1 with high yield in

an enzymatically active form and showed that this enzyme is a soluble

monomeric protein. Moreover, the solubility of native BCO1 was confirmed in

mice and mammalian cells. The KM value for β, β-carotene with the purified enzyme was within the range of previous estimates (8, 13). However, the activity of this BCO1 preparation was much higher than described in previous studies.

The purified enzyme had a turnover rate of approximately eight molecules β, β-

carotene per second, a number exceeding by more than 10-fold the turnover

rates reported in previous studies of BCO1 (8) and other family members such as

RPE65 and NinaB (29, 144). The disparity between the previous and present

study results could be explained by the differing purification protocols and

detergents employed. Additionally, the previous study of BCO1 used substrate

concentrations that exceeded the loading capacity of OTG micelles by more than

10-fold (8). As we previously reported (29), the maximum loading capacity of a 3

% (w/v) OTG solution is 20 μM. Thus, most of the substrate was not dissolved in

micelles and likely not available to BCO1 in that study. The lower turnover rates

reported for RPE65 and NinaB might be explained by the reactions catalyzed by these enzymes. The latter proteins catalyze either isomerase or combined

41 carotenoid cleavage and isomerase reactions. The far more rapid conversion rate of β, β-carotene cleavage by BCO1 implies that the carotenoid cleavage

reaction displays faster kinetics than the rate-limiting isomerase reactions

catalyzed by the other enzymes. Moreover, it is noteworthy that purified BCO1

catalyzed β, β-carotene cleavage without the addition of any cofactors. Yet it

remains controversial as to whether these enzymes catalyze cleavage via a

mono- or dioxygenase reaction mechanism. Thus, a monooygenase reaction

mechanism has been proposed for chicken BCO1 (145). In contrast, a plant

family member catalyzes carotenoid cleavage employing a dioxygenase reaction

mechanism (146). Hence our finding that BCO1 did not require cofactors favors a

dioxygenase reaction mechanism because an additional electron donor for the

second oxygen atom would be required in a monooxygenase reaction.

Alternatively, the electrons could also come from the substrate if this reaction is

follows an internal monooxygenase mechanism. Investigation of recombinant

human BCO1 could answer this question because its high turnover rate would

allow short incubation times in labeling experiments to prevent oxygen exchange

between the product and bulk water.

We provided evidence that BCO1 is a soluble and monomeric protein.

Interestingly, this result does not agree with data published by Lindqvist and

Andersson (8) who proposed that purified recombinant human BCO1 migrated at

230 kDa on a Sephadex S-300 size exclusion column indicating that the protein

existed as a tetramer in its enzymatically active form. However, there was 1%

OTG (3.5 x its CMC) in the gel filtration buffer indicating that BCO1 was in

42 complex with micelles and therefore migrated at a higher molecular weight on the

size exclusion column (8). Indeed, a later study by Lindqvist and Anderson

considered this detergent effect and provided evidence that BCO1 is a monomer

(12). Data from another member of the family of non-heme iron oxygenases

support these results. Thus most of inclusion body purified and reconstituted

ACO from Synechocystis sp. eluted as a monomer with only a small amount as a

dimer from the final size exclusion column (35). After addition of

octylpolyoxyethylene (C8E4-8) the main peak shifted to a trimeric mass, probably because ACO forms a complex with detergent micelles. In both ACO crystal forms (two independent protein molecules in the asymmetric unit of iron-free

ACO crystals and four in the asymmetric unit of Fe2+ soaked crystals) an asymmetric association of the crystallographically independent molecules was

observed suggesting that this apocarotenoid oxygenase is a monomer as

demonstrated by size exclusion chromatography (35). The monotopic bovine

membrane protein RPE65 also migrated as a monomer in complex with a C8E4

detergent micelles on a size exclusion chromatogram (127). However, several

parallel-oriented RPE65 dimers were present in several different crystal forms

which suggest that the retinoid isomerase functions as a dimer in vivo (129).

The monomeric state of BCO1 has implications for rare and more common

genetic polymorphisms in the human BCO1 gene (12). Lindqvist and Anderson

have already proposed that the enzyme exists in this form and showed that haplo-insufficiency of BCO1 is associated with β, β-carotene accumulation and hypo-vitaminosis in a human subject (12). Studies in mouse models show that a

43 single copy of the other carotenoid oxygenase, BCDO2 also does not suffice to maintain carotenoid homeostasis (18). In contrast, haplo-insufficiency for RPE65 does not affect visual chromophore regeneration in mice (147) even though the turnover rate of RPE65 is relatively low (see above). RPE65 extracts its substrate from membranes and this substrate formation is catalyzed by the membrane anchored LRAT protein with very rapid kinetics (135). Yet little is known about

how true carotenoid oxygenases, such as BCO1, interact with their lipophilic

substrates. Substrate availability could be a limiting factor for vitamin A

production and could explain the consequences of haploid-insufficiency for this

enzyme.

Finally, structural data for BCO1, particularly in complex with its substrate,

product and inhibitors such as fenretinide should be a high priority. The overall

structure of different family members is well conserved. However, no clear

densities of a bound ligand have been collected in solved X-ray structures of

ACO, RPE65, or VP14 (35, 37, 127). Such data are critical to understand the

reaction mechanism and how the substrate is juxtaposed to the ferric iron in the

active center of the enzyme. Establishment of a protocol for the purification of

BCO1 in a homogenous and enzymatically highly active form is an important step

towards achieving such molecular insights. Comparison between BCO1 and

RPE65 would also allow identification of amino acid residues that participate in

the oxidative cleavage of the substrate versus the isomerization of the retinoid

product. Only progress in understanding the molecular mechanisms that underlie

44 the chemistry of vitamin A metabolism can guarantee that efforts to fight vitamin

A deficiency and eye diseases can advance in parallel.

TABLES

Table 2.1. Activity of human BCO1 soluble fraction in the presence of different detergents (equal amounts of soluble fraction from the same preparation were used)

aBCO1 activity was tested as described in Experimental Procedures.

FIGURES

Figure 2.1 BCO1 catalyzes the oxidative conversion of β,β-carotene to retinoids. Oxidative cleavage of β,β-carotene yields all-trans-retinal that can be either further oxidized to all-trans-retinoic acid or reduced to all- trans-retinol(vitaminA).

Figure 2.2 Baculovirus expression and enzymatic activity of human BCO1. A, Immunoblot of the soluble and pelleted fractions of human BCO1 baculovirus-infected Sf9 insect cell extracts. Blots were probed as described in “Materials and methods”. Precision Plus Protein™ Standard (indicated on left); supernatant (lane 1) and pellet (lane 2) from Sf9 cells infected with 5 mL BCO1 P3 baculovirus; supernatant (lane) and pellet (lane 5) from Sf9 cells infected with 1 mL BCO1 P3 baculovirus; supernatant (lane) and pellet (lane) from Sf9 cells infected with 0.2 mL BCO1 P3 baculovirus. Products of active recombinant human BCO1. Soluble (supernatant) and pellet fractions of Sf9 cell extracts infected with human BCO1 baculovirus were incubated with 20 μM all-trans-β,β-carotene at 28 °C. Lipids were extracted after 8 min and their separation was achieved by normal-phase HPLC. B, When only buffer was incubated with all-trans-β,β-carotene, no products were detected by HPLC monitored at 360 nm. C, When the supernatant was incubated with all-trans-β,β- carotene, significant amounts of all-trans-retinal were formed. During extraction all-trans-retinal was converted to the corresponding syn- and anti-oximes separated by HPLC and detected at 360 nm. D, When the pelleted fraction was incubated with all-trans-β,β-carotene, no product was observed after HPLC monitored at 360 nm. E, Spectrum of all-trans-retinal oxime (syn). F, Spectrum of all-trans-retinal oxime (anti). 1, all-trans-β,β- carotene. 2, all-trans-retinal oxime (syn). 3, all-trans-retinal oxime (anti).

Figure 2.3 Purification of human BCO1 and its enzymatic properties. SDS– polyacrylamide gel electrophoresis of Co2+ metal affinity chromatography purified BCO1 (A), further purification size exclusion chromatography (B), and concentrated sample after size exclusion chromatography (C). Products formed from all-trans-β,β-carotene by BCO1 after Co2+-column chromatography (E and F) compared with concentrated purified enzyme after size exclusion column chromatography (G). The enzyme was purified and assayed as described under “Experimental Procedures”. 1, all-trans- β,β-carotene. 2, all-trans-retinal oxime (syn). 3, all-trans-retinal oxime (anti). (H) Talon purified recombinant human BCO1 was incubated in the presence of increasing concentrations of β,β-carotene for 8 min at 28 °C. Purified recombinant human BCO1 displayed Michaelis–Menten kinetics.

Figure 2.4 BCO1 is a monomeric protein. (A) Size exclusion chromatogram of purified human BCO1 along with size exclusion standards, and (B) molecular mass calibration curve for the Superdex™ 200 10/300 GL column. 1, protein aggregates and bovine thyroglobulin (670 kDa). 2, bovine γ-globulin (158 kDa). 3. C-terminal tagged human BCO1 (65.2 kDa). 4, chicken ovalbumin (44 kDa). 5, horse myoglobin (17 kDa). 6, vitamin B12 (1.35 kDa). Elution volumes were plotted against absorption units at 280 nm. (B) Calibration curve generated with standards bovine thyroglobulin (670 kDa), bovine γ-globulin (158 kDa), chicken ovalbumin (44 kDa), horse myoglobin (17 kDa) and vitamin B12 (1.35 kDa). Elution volumes were plotted against logarithms of molecular weights of standards. The elution volume of 14 yielded a MW of 60 kDa for BCO1.

Figure 2.5 Comparison of putative membrane-interacting regions between mammalian CCOs. A, Sequence alignments of the three mammalian CCOs. Three regions identified as being involved in RPE65 membrane binding are shown as brown sticks (PDB accession code 4F2Z). Comparison of CCO sequences in these regions reveal a significant diversity that might underlie the differential membrane binding affinity of these enzymes. Strictly conserved residues are colored white on a boxed red background, whereas positions displaying sequence similarity across all three enzymes are colored red on a boxed white background. Residues underlined by black lines correspond to those shown as sticks. B, Sequence comparison and hydropathy plots of the fourth region potentially involved in membrane anchoring. This region of relatively high sequence conservation is disordered in all RPE65 crystal structures reported to date. However, the sequence can be modeled as an amphipathic alpha helix that could favorably interact with membranes. Such modeling is supported by the structures of ACO and VP14 which exhibit analogous regions of their sequences. The calculated zeroth (Ho) and first (μH) hydrophobic moments for these structures are similar between BCMO I and RPE65 with BCMO I displaying slightly higher overall hydrophobicity and RPE65 displaying a slightly higher dipole moment. The hydrophobic dipole vector is shown in the center of the helical wheel plot.

Figure 2.6 Partitioning of BCO1 in Triton X-114 phase separations and BCO1 solubility in tissues and cells. A, Pure BSA, RPE65 microsomes, and Talon-purified recombinant BCO1 were subjected to phase separation experiments as described under “Materials and methods”. These experiments show that BCO1 partitions into the aqueous phase similar to BSA and contrary to RPE65 which partitions into the detergent phase. Lanes: a, Input, indicates the pure proteins and RPE65 microsomes before phase separation, b, the aqueous phase, and c, the detergent phase. Arrowheads indicate the positions of corresponding proteins as labeled on top of each Coomassie stained gel. B, Immunostaining of human BCO1 (green) in Cos7 cells. The nucleus is stained with DAPI (blue). The merged image shows that BCO1 is located in the cytoplasm. C, Immunoblot analyses for BCO1 and LRAT in cytoplasmic and microsomal preparations of mouse liver. BCO1 was detected in the cytoplasmic fraction whereas LRAT localized to microsomes.

CHAPTER 3: Characterization of the Role of β-carotene-9, 10-dioxygenase

in Macular Pigment Metabolism

This chapter was previously published in J Biol Chem Babino,D., Palczewski, G., Widjaja-Adhi, M., Kiser, P.D., Golczak, M., von Lintig, J. 2015 Aug 25; PMID: 26307071

3.1 Introduction and Background

Carotenoids affect a rich variety of physiological functions in nature and are crucial for human health (148). For instance, the carotenoids zeaxanthin, lutein

and meso-zeaxanthin accumulate in high concentrations in the primate retina

(149) where these macular pigments (MP) lessen chromatic abbreviation and

filter phototoxic blue light. Certain carotenoids also are the major dietary source

for retinoids, which encompass all derivatives of vitamin A (all-trans-retinol)

(150). These carotenoid derivatives exert vital physiological functions as visual chromophore (11-cis-retinal) (151) and vitamin A hormone (all-trans-retinoic acid)

(152).

There is interest to enhance macular pigment levels because of emerging evidence that these compounds are beneficial to eye health (153). In general, a relatively linear increment of xanthophyll plasma levels is achieved during supplementation and that eventually reaches a plateau. Additionally, the density and concentration of macular carotenoids vary more than 10-fold among individuals (154). Moreover, plasma and tissue levels of xanthophylls may decline in certain disease states that are associated with oxidative stress such as cardiovascular disease and certain forms of cancer (153). However,

53 mechanism(s) that control plasma and tissue levels of these compounds remain to be defined.

Genetic studies in animals suggest that the β-carotene 9,10-dioxygenase

(BCO2) plays a critical role in controlling carotenoid tissue levels and preventing excess accumulation of these compounds. Eriksson et al. associated the yellow skin (carotenoids) in domesticated chickens with regulatory mutations that inhibit expression of the BCO2 enzyme in skin (155). In sheep, the yellow fat phenotype is caused by mutations in the BCO2 gene and a null mutation in the bovine

BCO2 gene causes a change in the β-carotene content in the cow’s milk (156,

157). Similarly, genetic disruption of BCO2 function in mice results in increased plasma and blood accumulation of these dietary pigments. Prolonged carotenoid supplementation of Bco2 knockout mice caused oxidative stress in tissues and the induction of stress-associated signaling pathways. In wild-type animals, a 7- fold increase in Bco2 mRNA expression averted this scenario (18).

For humans, conflicting results are reported in the literature whether

BCO2’s function was conserved during evolution (158, 159). A major drawback of a rigorous biochemical analysis of this enzyme is the lack of methodology allowing for expression of recombinant BCO2s in active forms. Additionally, little is known about the regulation of BCO2 gene expression though the protein is differentially expressed in various human tissues (160). Hence, we have established novel methods and tools to enzymatically characterize BCO2s from different mammalian species. Additionally, we employed human cell lines and mouse models to respectively study the transcriptional regulation and function of

54 this protein in carotenoid homeostasis of blood and tissues. The picture that emerges verifies the critical role that BCO2s play in this process and indicates that oxidative stress in chronic disease induces BCO2 and carotenoid breakdown in tissues and blood.

3.2 Experimental Procedures

3.2.1 Three-Dimensional Structure Models

All protein models were prepared through the fully automated protein structure homology-modeling server, SWISS-MODEL, using retinal pigment epithelium protein of 65 kDa (RPE65) (PDB 4F2Z) as their template (161). Amino acids 109-

126, which were not present in the deposited coordinates, were modeled in an alpha helical conformation in accordance with the experimental electron density map. Molecular graphics and analyses were performed with the UCSF Chimera package (162).

3.2.2 Plasmid Constructs for Bacterial and Eukaryote Expression

Total RNA, prepared according to (163), was a gift from Dr. Brian Kevany. Total

RNA was isolated from ~50 mg of fixed tissue using the RNAeasy Mini Kit

(Qiagen) and stored at -80°C. 1 μg of total RNA was reverse transcribed with the

SupeScript One-Step RT-PCR for LongTemplates system. This cDNA library was used to amplify truncated macaque bco2 with the following primers: 5’ – GCC

ATC TTT GGG CAG TGT CGG - 3’ (Forward) and 5’ – TTA GAT GGG TAT GAA

GGT ACC ATG G - 3’ (Reverse). This set of primers included the addition of a

STOP codon. To amplify full length macaque BCO2 (MaBCO2) cDNA encoding the NP_001271880 variant of MaBCO2 with an N-terminal extension, the following PCR reaction was carried out using the forward primer 5’ – AAG GAG

GAA TAA ACC - 3’ and the reverse primer 5’ – GAT GGG TAT GAA GGT ACC

ATG GAA TCC - 3’. The amplified macaque BCO2 cDNAs were then cloned in frame into pBAD TOPO TA (Invitrogen, Grand Island, NY, USA) for bacterial expression and pcDNA 3.1/V5-His TOPO (Invitrogen) for eukaryote expression.

All PCRs were carried out with the Expanded High Fidelity PCR system (Roche,

Indianapolis, IN, USA). All plasmid constructs were verified by sequence analysis

(Genomics Core Sequencing Facility, Case Western Reserve University,

Cleveland, OH, USA).

3.2.3 Transient Transfection and Immunofluorescence

HepG2 cells (American Type Culture Collection) were transiently transfected with corresponding vectors carrying the various amplified BCO2 cDNA isoforms of murine, human and macaque. All transfections and immunofluorescence were performed as previously described in (159). HepG2 cells (American Type Culture

Collection) were maintained in DMEM with 10% FBS and 10 U/mL penicillin- streptomycin antibiotics, at 37°C with 5% CO2. For immunofluorescence HepG2

cells were grown on polylysine-treated glass coverslips to 50–70% confluence

and then transfected with purified plasmid DNA using X-tremeGENE HP (Roche)

transfection reagent. 24 h post-transfection cells were fixed in a solution of 10%

formalin phosphate in phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, and 1.4 mM KH2PO4, pH 7.4; PBS) overnight at 4 °C. Afterwards,

56 cells were washed and permeabilized with 0.1% Triton X-100 (Roche) in PBS

(PBS-T) and blocked with 10% bovine albumin and 5% goat serum (Sigma

Sigma Life Science, St. Louis, MO) in PBS-T (blocking buffer). Cells were then

incubated overnight at 4 °C in blocking buffer containing a mouse anti-V5 serum

(to detect BCO2; Invitrogen) and rabbit anti-COX IV serum (Cell Signaling,

Boston, MA USA) diluted 1:200. Following, cells were washed and incubated at

room temperature with anti-mouse and anti-rabbit secondary antibody

conjugated to Alexa 594 and Alexa 488 (Life Technologies, Grand Island, NY,

USA), respectively, diluted 1:400 in blocking buffer. DAPI was used to stain nuclei. Confocal images were acquired with a Zeiss LSM 510 META laser scanning confocal microscope (Carl Zeiss MicroImaging, Jena, Germany) by using a multiline argon laser (excitation 488 and 594 nm) or a 405 diode laser

(excitation 405 nm) with a 63X C-Apochromat, NA 1.2-O objective.

3.2.4 Expression of Murine and Macaque BCO2 in E.coli.

Protein expression was performed as described in (15) with some modifications.

BL21 (DE3) competent E. coli (New England BioLabs, Ipswich, MA) were transformed with the expression vectors for full length and truncated macaque

BCO2 as described above. These bacterial cells were also transformed with the expression vectors for murine BCO2 as reported previously in (1). Bacteria were grown at room temperature with constant shaking at 200 rpm until an OD600 of

0.4 was reached. Protein expression was induced with L-arabinose with a final concentration of 0.02%. At the point of induction, FeSO4 and ascorbic acid were

added to a final concentration of 5 μM and 10 mM, respectively and the

57 temperature was decreased to 10°C. Protein expression was allowed to proceed for two days and cells were then collected by centrifugation at 4500 x g for 15 mins and cell pellets were stored at -80°C until needed or immediately submitted for in vitro enzyme assays.

3.2.5 Purification and Quantification of BCO2

Cell pellets obtained from the procedure as described above were thawed on

ice. Cells pellets were re-suspended in buffer containing 20 mM Tricine, pH 7.5,

1 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP/HCl), (Hampton

Research) and one Complete EDTA free Protease Inhibitor Cocktail Tablet

(Roche) at 4 mL per gram. Lysis was performed by three passages on a cold

french press while collecting lysates on iced tubes. The cell lysate was then

subjected to centrifugation at 100,000 x g at 4°C for 30 minutes. The supernatant was collected, transferred to 50 ml tubes and kept on ice. Then it was loaded onto a 10 mL column containing 1.5 mL of Talon Co2+-resin suspension

(Clontech) pre-equilibrated with 5 column volumes of ice cold buffer containing

250 mM NaCl, 20 mM Tricine, pH 7.5, and 1 mM TCEP. After flow-through collection, the Talon column was first washed with 5 column volumes of ice cold buffer containing 250 mM NaCl, 20 mM Tricine, pH 7.5, and 1 mM TCEP and then with 5 column volumes of buffer containing 250 mM NaCl, 20 mM Tricine, pH 7.5, 1 mM TCEP and 1 mM imidazole. Finally BCO2 was eluted in ice cold buffer containing 250 mM NaCl, 20 mM Tricine, pH 7.5, 1 mM TCEP and either 5 or 50 mM imidazole. Eluted BCO2 fractions were pooled and concentrated in a

30K Amicon® Ultra Centrifugal Filter (Millipore) before being loaded onto a

Superdex™ 200 10/300 GL size exclusion column (GE Healthcare Life

Sciences). Enzyme fractions were eluted from the column in 0.5 mL fractions at a flow rate of 0.4 mL/min. with buffer containing 100 mM NaCl, 20 mM Tricine, pH

7.5, and 1 mM TCEP. Fractions containing purified enzyme were then pooled, concentrated to desired concentrations in a 30K Amicon® Ultra Centrifugal Filter and stored on ice until further use. Western blotting of this purified enzyme at varying concentrations were run concurrently with Talon Co2+- purified murine

and primate BCO2 for quantification. Quantification of expressed BCO2 protein

was performed using Image J and the known concentrations of the purified

standards as well as with Bradford assays.

3.2.6 In Vitro Enzyme Activity Assay

Cell pellets were thawed on ice and their net weight was determined. Lysing

reagent was prepared by combining 50 mL of B-PER Bacterial Protein Extraction

Reagent (Life Technologies, Grand Island, NY) with one protease inhibitor

cOmplete ULTRA Mini EDTA-free Tablet (Roche, Mannheim, Germany), final

concentration of 2 mM ascorbic acid solution (Sigma Life Science), 1mM TCEP

(Thermo Scientific, Rockford, IL), 20 U of DNase I recombinant, RNase-free

DNase I. Per gram of bacterial pellet 4 mL of lysing reagent was used to lyse

cells and solubilize recombinant proteins. Cell pellets were gently vortexed with

lysing reagent and allowed to incubate at room temperature for 10 min. The cell

lysate was then cooled on ice and subjected to centrifugation at 100,000 x g at

4°C for 30 mins for the purposes of western blot analysis. For enzymatic activity

assays, whole cell lysates were used and carried out as previously described in

(8) and (32), but with the following modifications. 2, 2-dioctylpropane-1, 3-bis-β-

D-maltopyranoside or decyl maltose neopentyl glycol (DMN) micelles loaded with

zeaxanthin were prepared as follows: 33 μL 3% DMN detergent solution was mixed with 10 μM (final concentration) of Z, dissolved in acetone, in a 2-mL

Eppendorf tube. This mixture, substrate, was then dried in a Speedvac

(Eppendorf vacufuge plus). To substrate, 100 μL of cell lysate was added and

vortexed vigorously for 20 s and placed on an Eppendorf thermo-shaker for 15

min at 300 rpm. Control assays were performed with un-induced E.coli cell pellet

lysates. The reaction was stopped by adding 100 μL of water and 400 μL of

acetone. Lipids were extracted by adding 400 μL of diethyl ether and 100 μL

petroleum ether, vortexed for 3 x 10 s period, centrifuged at 15000 g for 1 min and finally collected the resulting organic phase. The extraction was performed twice and the collected organic phase dried by Speedvac. Dried supernatant was re-dissolved in mobile phase, 90:10 (hexane:ethyl acetate) and subjected to either HPLC or LC-MS analysis.

3.2.7 HPLC and LC-MS System

HPLC analysis was carried out with an Agilent 1260 Infinity Quaternary HPLC system (Santa Clara, CA, USA) equipped with a pump (G1312C) with an integrated degasser (G1322A), a thermostat column compartment (G1316A), an autosampler (G1329B), a diode-array detector (G1315D), and online analysis software (Chemstation). The analyses were carried out at 25 °C using a normal-

phase Zorbax Sil (5 μm, 4.6 x 150 mm) column (Agilent Technologies, Santa

Clara, CA) protected with a guard column with the same stationary phase.

Carotenoid and apocarotenoid separation was achieved using an isocratic composition of 70:30 (v:v) of hexane: ethyl acetate. For -carotene and xanthophyll separation from animal tissues, a step gradient of 1% ethyl acetate in hexane over 5 min followed by 10 min with 10% ethyl acetate in hexane and then

18 min with 30% ethyl acetate in hexane was used. The flow rate for all systems was 1.4 ml/min. Detection of carotenoids and apo-carotenoids was performed at

420 nm wavelength. For LC-MS analyses, the eluate was directed into a LXQ linear ion trap mass spectrometer (Thermo Scientific, Waltham, MA) through atmospheric pressure chemical ionization (APCI) source working in the positive mode. To ensure optimal sensitivity, the instrument was tuned with zeaxanthin as well as apo-carotenoids. Identification of BCO2 cleavage products was based on retention time, mass, and spectral characteristics to that of a known standard of

10′-β-apocarotenal (BASF, Ludwigshafen, Germany) and previously published reports (134, 164).

3.2.8 Animals, husbandry and experimental diets

Animal procedures and experiments were approved by the Case Western

Animal experiments were carried out using β,β-carotene 15,15’-dioxygenase

(Bco1) knock-out, Bco2-/-, and Bco1-/-/Bco2-/- (DKO) mice with a C56/BL6; 129Sv

mixed genetic background. Feeding experiments were performed as previously

described in (165). In all experiments, mice were maintained at 24°C in a 12- to

12-h light-dark cycle and had free access to food and water. During the breeding and weaning periods (up to 5 weeks of age), mice were maintained on breeder chow containing ~29000 IU vitamin A/kg diet (Prolab RMH 3000; LabDiet, St.

Louis, MO, USA). After 5 weeks of age, mice were fed with an experimental diet containing a mixture of -carotene and zeaxanthin (25 and 75 mg/kg diet for each carotenoid, respectively) for 10 weeks. The diet contained no other source

of vitamin A except for -carotene. After 10 weeks of dietary intervention, mice

were fasted overnight and anesthetized by intraperitoneal injection of a mixture

containing ketamine 15 mg, Xylazine 3 mg, Acepromazine 0.5 mg and sterile

water or saline, with a dose of 0.2 ml/25 g of mouse body weight. Blood was

drawn directly from the heart by cardiac puncture under deep anesthesia. Mice

were then perfused with 20 mL of PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM

Na2HPO4, 1.4 mM KH2PO4, pH 7.3) and killed by cervical dislocation for further

tissue collection.

3.2.9 Extraction of Carotenoids from Animal Tissues

Carotenoids were extracted from tissues of mice (n=5 per genotype and diet)

under a dim red safety light (600 nm) and quantified by HPLC as described

previously in (165). 100 µL of serum in 200 µl of PBS or 1 whole eye

homogenized in 200 µl PBS and 100 µL hydroxylamine were extracted using

300 µL of methanol, 600 µl of acetone, 300 µL of diethyl ether and 400 µL of

hexane. The organic phase was removed and the extraction was repeated with

additional 500 µL of hexanes. After centrifugation, organic layers were collected,

pooled and dried in a SpeedVac (Eppendorft, Hamburg, Germany) at 30 °C and

62 re-dissolved in HPLC mobile phase solvent. For saponification, gonadal white

adipose tissues were homogenized in 200 µL of 30% KOH in water then

incubated with 100 µL of 12% pyrogallol (Sigma-Aldrich, St. Louis, MO) in ethanol and 1 mL ethanol for 1 h at 60°C. After saponification, 2 mL of ethanol and 2 mL of H2O were added and samples were extracted twice with 3 mL of

diethyl ether/hexane (2:1, stabilized with 1% ethanol). The organic layers were

collected, pooled and evaporated in a SpeedVac (Eppendorf, Hauppauge, NY,

USA) until nearly dry. The second extraction solution was then added to the nearly dry solution. The extraction solution was composed of 200 µL of water,

200 µL of methanol, 400 µl of acetone, 250 µL of diethyl ether, and 400 µL of

hexane. The organic phase was then removed and the extraction was repeated

with 500 µL of hexanes. After centrifugation, organic layers were collected,

pooled and dried in a SpeedVac (Eppendorf, Hauppauge, NY, USA) at 30oC and re-dissolved in corresponding HPLC mobile phase solvent.

3.2.10 Induction of BCO2 and Real Time PCR

HepG2 cells (American Type Culture Collection) were maintained in DMEM with

10% FBS and 10 U/mL penicillin-streptomycin antibiotics, at 37°C with 5% CO2.

Cells were grown in poly-lysine treated dishes until 50-70% confluence. To measure relative BCO2 levels, cells were washed with PBS, and then incubated in 5mM hydrogen peroxide in PBS for 5 minutes. Following, cells were washed in

DMEM to remove excess hydrogen peroxide. Cells were then maintained in

DMEM, 1 μM zeaxanthin 0.1% dimethyl sulfoxide in DMEM, or 0.5mM hydrogen peroxide in DMEM for 4 hours. Media was then aspirated and RNA collected

63 using Trizol reagent (Life Technologies, Grand Island, NY). RNA was transcribed to cDNA using High-Capacity RNA-to-cDNA Kit (Life Technologies). This cDNA

was then used for quantitative real time PCR using TaqMan Gene Expression

Master Mix (Life Technologies) and GAPDH (control) and BCO2 probes (Life

Technologies) as previously described (159). Measurements in relative levels of

BCO2 mRNA levels were normalized to levels of GAPDH and were taken as biological duplicates and technical quadruplets.

3.3 Results

3.3.1 Structural comparison between rodent and primate BCO2s

Besides BCO2, the human genome encodes two other carotenoid cleavage

oxygenase (CCO) family members, RPE65 and the β-carotene 15,15’-

dioxygenase (BCO1), both of which are critical for human retinoid metabolism

(128). Sequence alignments revealed that the most pronounced difference

between human BCO2 and other family members is a long N-terminal leader

sequence for mitochondrial import (159) (Figure 3.1). This N-terminal extension

is also present in other primate BCO2s, e.g., the predicted MaBCO2 but is

absent in murine BCO2 (MuBCO2) (18, 159). Pairwise alignment scores,

performed using Clustal W (166), reveal that the primate BCO2s shared a 96%

amino acid sequence identity with each other and 81% with MuBCO2 when

excluding the N-terminal leader sequence (Figure 3.1). The primate BCO2s also

share an average ~42% sequence identity with human RPE65 and ~41% with

human BCO1 (Figure 3.1). Four key histidine residues (RPE65180, 241, 313, 527)

64 responsible for the ligation of an iron co-factor are conserved in all CCOs (Figure

3.1). Excluding the N-terminal extension, the major difference between primate

BCO2s and other family members, including rodent BCO2s, is the presence of a four amino acid residue long insertion, GKAA169-172. Recently, it was proposed that this primate specific insertion is responsible for their inactivation by sterically interfering with substrate binding.

To investigate the putative structural changes brought on by the absence or presence of these four amino acids, we modeled wild type and chimeric (with

deleted insertion) human and macaque BCO2 as well as MuBCO2 (SWISS-

MODEL) using the recently solved crystal structure of enzymatically active

bovine RPE65 as template (167). The electron density maps calculated from this

new data set indicate that the region containing the insertion (amino acids 109-

126 of bovine RPE65) adopts an alpha-helical conformation (Figure 3.1A). Upon

homology modeling of BCO2 based on this extended template, no marked

structural difference between HuBCO2 and MuBCO2, including the region with

the GKAA insertion, were observed for the proteins (Figure 3.1A). The predicted

basic structural fold was a rigid seven-bladed β-propeller covered by a half- dome. A highly conserved structural space in the active site domain near the four conserved histidines (only two are shown in the figure) ligated the iron co-factor.

The GKAA extension (green) in HuBCO2 is shown here as a loop that did not

significantly change the overall fold of the alpha-helix depicted in red or any of

the other features noted here at the opening of the substrate tunnel. As can be

seen in our model, this loop was instead localized away from the substrate tunnel

65 and would not pose an obstruction to the substrate entrance of the enzyme as

previously proposed (158).

Notably, the integrity of all these portions of the human enzyme was

retained in the chimeric model with the deleted GKAA insertion (HuBCO2GKAA)

(Figure 3.1B (blue)). Overall, the same observations hold true in the predicted

structures of MaBCO2 (Figure 3.1C) and the chimeric protein with the deleted

GKKA insertion (MaBCO2GKAA) (Figure 3.1C). Slight differences in the

positioning of the membrane binding domains became detectable, but did not

play a role in altering the main structure of the substrate tunnel leading to the

active site. The positioning of the GKAA portion for the macaque enzyme differed

slightly from the human, but did not alter the alpha-helical structure, which

corresponded to macaque amino acids 151-168 and 109-126 for bovine RPE65.

Together, modeling of different BCO2s using the novel RPE65 template did not reveal any structural differences that would suggest that the presence of the

GKAA insertion in primate BCO2’s causes an inactivation of the enzymes.

Homology models for RPE65 and MaBCO2 have been deposited as supplementary data 1 and 2, respectively.

3.3.2 Effect of Detergents on Enzyme Activity

We and others showed that the assay conditions significantly influence the activity of RPE65 and BCO1 (8, 168, 169). Therefore we turned our attention to improve the fundamental enzyme activity assay for recombinant BCO2 expressed in an E. coli system. To do so, we focused on recombinant MuBCO2 which previously showed convincing turnover of carotenoid substrates in such

66 tests (18). Here, we were able to recapitulate similar results under the previously established conditions as noted in Figure 3.2. It has been our experience that

CCO’s activity greatly relies on the manner in which the enzyme is solubilized and how substrate is delivered to the enzyme. For this purpose, CCOs are

solubilized during cell lysis with detergent and carotenoids delivered to the

enzyme via detergent micelles (6, 15, 16). Predominantly we have used β-D-1-

thioglucopyranoside for this multiple task as the use of other detergents has shown to cause a decrease in enzymatic activity (168, 169). We wondered if an alternate detergent would improve MuBCO2 activity. A screen of several detergents showed a decrease in enzyme activity (Figure 3.2B, inset), but the use of one detergent, DMN, resulted in a 4-fold increased production of the cleavage product 3-hydroxy-β-10’-apocarotenal (10Apo) from zeaxanthin cleavage, Figure 3.2B (dashed trace). Conversely, the substrate level strongly decreased when the enzyme was assayed in this manner. Thus, the use of the detergent DMN to solubilize protein and create substrate delivery micelles significantly increased recombinant MuBCO2’s enzymatic activity.

3.3.3 Biochemical Characterization of Macaque BCO2

Most recently (159), our laboratory provided evidence of an active, recombinantly expressed HuBCO2 in β-carotene producing E. coli (15). Albeit, the experimental

conditions resulted in very modest turnover of this enzyme, requiring mass

spectrometry for detection of the -10’-apocarotenal product, it did provide proof

of the human enzyme’s activity. However, our attempts to assay recombinant

HuBCO2 or other primate BCO2 proteins in cell-free systems have failed thus

67 far. Successful expression of active recombinant enzymes in E.coli systems must

overcome a multitude of hurdles (170). Perhaps the greatest obstacle has been

the production of soluble, hence functional, proteins and the avoidance of the

formation of insoluble aggregates known as inclusion bodies (171). We

speculated that this problem could explain the lack of activity when trying to

characterize enzymatic properties of the HuBCO2 recombinant protein

expressed in E. coli. To investigate this possibility, we expressed the human 579

amino acid long protein variant (579H) in E. coli and found upon centrifugal

fractionation and western blot analysis that the enzyme was present in the

insoluble fraction (Figure 3.3A). The same protocol applied to MuBCO2 revealed

that expression of this enzyme produced equal quantities of soluble and insoluble

protein (Figure 3.3A). Enzyme activity assays of the collected insoluble MuBCO2

fraction incubated with substrate failed to produce cleavage products that were

detected from the soluble fraction (Figure 3.3B, black trace). Re-suspended

insoluble HuBCO2 also failed to cleave zeaxanthin in vitro (Figure 3.3B, grey

trace). The production of a significant amount of soluble, functional murine

protein and the exclusive production of insoluble HuBCO2, in this E. coli system,

may explain, in part, the discrepancy between their reported enzymatic activities

(15, 158, 159). Though refolding procedures of inclusion bodies have been

successfully used to study a bacterial CCO (35, 169), so far, our best attempts at

refolding HuBCO2 did not produce functional protein. Therefore, we focused our

efforts on characterization of MaBCO2 activity.

Previously, we showed that the N-terminal leader sequence of HuBCO2 is removed during mitochondrial import and not required for enzyme activity (159).

To confirm this observation for the macaque enzyme, we expressed the full length MaBCO2 and an N-terminally truncated MaBCO2 (trMaBCO2) in the human hepatoma cell line, HepG2 as C-terminal V5 tagged proteins.

Immunostaining and confocal imaging revealed that MaBCO2 variant was distributed in similar patterns as the mitochondrial marker protein COX IV (Figure

3.3C). In contrast, staining for trMaBCO2 did not merge with the mitochondrial marker protein, indicative that the N-terminal leader is mandatory for the import process. Thus, to better mimic the native protein and the murine enzyme which lacks the N-terminus, we expressed MaBCO2 in E. coli without the N-terminal

domain. Notably, this truncated enzyme also contained vector derived fusion tags

similar to the previously tested recombinant murine BCO2. To increase its

solubility, we additionally expressed trMaBCO2 at low temperature (10°C) for an

extended period of two days. Western blot analysis showed that using this

technique produced soluble trMaBCO2 protein (Figure 3.2A). While levels of

soluble murine protein were not achieved, our efforts relayed a more promising

result as obtained above with the largely insoluble recombinant HuBCO2.

Having established that the trMaBCO2 enzyme can be expressed in E.

coli in a soluble form, we set out to test its enzymatic activity. As control, we

tested MuBCO2 in parallel. To identify trMaBCO2 and MuBCO2 activity, we

employed a LC-MS-based method that directly detects products of BCO2-

catalyzed oxidative cleavage of zeaxanthin. UV-Vis HPLC analyses revealed the

69 presence of two distinct products generated by both enzymes, one at retention

time ~10 mins and the second at ~15 mins, Figure 3.4A (left and right, MuBCO2

and trMaBCO2 respectively). Spectral characteristics (Figure 3.4B) and retention

time analysis indicated that the first product was 10Apo, as expected from our

initial trials with MuBCO2 (Figure 3.2B). The second product’s spectral

characteristic (Figure 3.4B) is consistent with that of 3-hydroxy--ionone and

present in both MuBCO2 and trMaBCO2 trials. Mass spectra from extracted-ion

chromatograms (XIC) (Figure 3.4C), provided further evidence that the peaks at

10 min in the chromatogram can be attributed to 10Apo as the m/z=393.28 was

consistent with the calculated [MH]+ ion (Figure 3.4C left, inset). XIC’s for

m/z=209.18 [MH] + (Figure 3.4D and inset) provided confirmation that the peak at

16 min corresponded to 3-hydroxy--ionone.

We proceeded to investigate the enzyme activity of both Mu and

trMaBCO2 using lutein and meso-zeaxanthin as substrates. We anticipated that

cleavage of lutein by BCO2 could produce five distinct products depending on

the preference of the enzyme for the -ionone or -ionone ring (Figure

3.5A).These products could be comprised of 10Apo, 3-hydroxy--ionone, 3-

hydroxy--10’-apocarotenal (-10Apo), 3-hydroxy--ionone, and rosafluene (not depicted), Figure 3.5A. The enzymatic assays for both the murine and primate

BCO2 produced two detectable products, 10Apo and -10Apo (Figure 3.5B). The identity of 10Apo was deciphered from retention time and UV/Vis spectral characteristics. While a standard of -10Apo was not available for comparison, we previously detected this compound in (18) via MS analysis. Here, the

70 retention time and the blue-shift in the spectrum’s maximum absorbance (Figure

3.5C, left), indicating a break in the double bond conjugation across the apocarotenoid backbone, are consistent with our previous observations. The production of 10Apo and -10Apo by MuBCO2 was greater than that of trMaBCO2 by roughly 2.5 times. Both Mu and trMaBCO2 seem to preferentially cleave lutein on the -ring side to produce 10Apo as the production of 10Apo was

3 times the production of -10Apo (Figure 3.5B). Next, incubation of E.coli cell lysate expressing MuBCO2 with meso-zeaxanthin produced one detectable product with our HPLC system. This product, as identified by retention time and spectral characteristics, was found to be 10Apo (Figure 3.6A, dashed trace). The same product was observed when trMaBCO2 expressing E.coli lysates were incubated with meso-zeaxanthin (Figure 3.6A, grey trace). With this detection method, it remains unclear as to whether the cleavage of meso-zeaxanthin is preferred on the (3R,3'R) or (3R,3’S) side. Under these experimental conditions, the production of 10Apo was 1.5 times greater by MuBCO2 cleavage than that of trMaBCO2. Finally, we attempted to use -cryptoxanthin to determine Michaelis contants and turnover rates for the enzymes (Figure 3.6B). This asymmetric carotenoid is preferentially converted to -10’-apocarotenal through removal of 3- hydroxy--ionone. Initial rate of the enzymatic reaction measured at various substrate concentrations was used to assess the apparent KM and Vmax values.

Both the macaque and murine enzymes revealed similar KM values of approx. 42

μM (Figure 3.6B). For determining Kcat, we purified murine BCO2. We then used

known amounts of this protein as standard to quantify BCO2 amounts in cell

71 lysates by quantitative western blots. This analysis revealed that the macaque

BCO2 enzyme has a slightly higher turnover rate at 20 min-1 compared to the

murine’s at 14 min-1.

3.3.4 Knockout of BCO2 leads to Systemic Tissue Accumulation

Recently, it has been proposed that inactivity of BCO2 provides a mechanism for

the concentration of xanthophylls (1 mM versus 1 to 6 M in serum and tissues)

in the primate retina. This hypothesis was supported by the observation that

BCO2-deficient mice display zeaxanthin in the retina, whereas wild type mice do

not despite abundant expression of putative zeaxanthin and meso-zeaxanthin

binding proteins (158). To scrutinize this theory, we compared body distribution

of zeaxanthin and -carotene in Bco1-/-, Bco2-/-, and DKO mice. Mice (n = 5 per

genotype) were subjected to feeding with a diet that contained -carotene and

zeaxanthin together (25 and 75 mg/kg, respectively). After 10 weeks of

intervention, we determined carotenoid levels of serum and peripheral tissues

(eyes and gonadal fat) in different mouse genotypes (Figure 3.7). If, as proposed

by others (158), the BCO2 genotype would determine ocular xanthophyll levels,

zeaxanthin but not -carotene should specifically accumulate in the retina.

Additionally, zeaxanthin concentration should be much higher in the eyes when

compared to serum and other tissues. HPLC analyses revealed that both -

carotene and zeaxanthin accumulated in the murine retina, respectively in a

BCO1 and BCO2-dependnet manner (Figure 3.7A and B, far right). As previously

reported (165), zeaxanthin existed in the form of its oxidized didehydro-

metabolites and was highest in DKO mice which display increased intestinal

carotenoid absorption (Figure 3.7A, far right). We obtained the same genotype

dependent carotenoid accumulation pattern when we analyzed gonadal white

adipose pads. However, there was a marked difference in carotenoid levels.

While ocular levels were well below serum levels, carotenoids were highly

concentrated in white adipocytes over serum (more than 10-fold in DKO mice).

Thus, we conclude that adipose tissues concentrate carotenoids under

conditions of CCO-deficiency.

3.3.5 Human BCO2 Expression is Oxidative Stress Responsive

Previously, we reported that carotenoid accumulation in cells and tissues can

cause oxidative stress (18, 20). Endogenous BCO2 gene expression or forced

expression of BCO2 transgene protects human cells against such insult (18, 20).

Though BCO2 is tissue specifically expressed in humans (160), little is known

about how the gene is regulated. To investigate this, we employed human

HepG2 cells. This cell line has been successfully used to study carotenoid and

retinoid metabolism in our and other laboratories (18, 65, 159). In a first set of

experiments, we incubated cells in the presence of zeaxanthin dissolved in THF

in a final concentration of one M. After different time intervals we harvested cells

and isolated RNA for qRT-PCR analyses. These analyses revealed that HuBCO2

expression was time-dependently increased. Thus, as previously reported for mouse liver (18), HuBCO2 mRNA expression was induced by carotenoids in this

hepatic cell model (Figure 3.8). We next wondered whether HuBCO2 mRNA

expression might be responsive to reactive oxygen species. These damaging

73 compounds are produced when the mitochondria electron chain is perturbed by carotenoids (18). We treated HepG2 cells with hydrogen peroxide to mimic this stress and measured HuBCO2 mRNA expression. Q-RT-PCR analyses revealed

that HuBCO2 mRNA levels increased up to 200-fold in HepG2 cells subjected to

hydrogen peroxide (Figure 3.8). Thus, we provided evidence that HuBCO2

mRNA expression is a regulated process and is responsive to oxidative stress.

3.4 Conclusions

Absorption of dietary carotenoids and distribution to tissues exemplifies

the discriminatory nature of carotenoid metabolism. From the large number of

dietary carotenoids just about ten are present in human plasma (172) and only

two are selectively accumulated in the human retina (149). The published reports

that MPs are inversely associated with the prevalence of age-related macular

degeneration (173, 174) instigated trials seeking to increase their concentration

in the human retina (175, 176). In general, it was reported that a relatively linear

increment of xanthophyll serum levels was achieved during supplementation and

that eventually these levels reached a plateau. When supplementation was

discontinued, a steep decline in serum concentrations was reported with baseline

levels ultimately being restored. In response to this supplementation, the macular

pigment optical density also increased to varying degrees (177). If the trend

observed in serum where to hold true, then a clearance of the MP until baseline

levels were achieved would occur. This indicates a relatively fast clearance of

excessive supplemented xanthophyll. Evidence from animal studies

74 demonstrates that BCO1 and BCO2 play a critical role for this process. In

humans, mutations in the BCO1 gene cause hyper--carotenemia (12) but

patients with BCO2 mutations have not yet been reported. Recently, Li et al.

postulated that accumulation of the human macular pigment is caused by

inactivation of BCO2 resulting from the loss of an alternate splice site in the

human gene (158). This hypothesis was based on the observation that

xanthophylls are present in the retina of BCO2-deficient but not wild-type mice

and on the absence of HuBCO2 enzymatic activity in a zeaxanthin accumulating

E.coli test system. However, this proposal is surprising since the overall

sequence and structure of human BCO2 is evolutionarily well conserved. In fact,

our previous analysis showed that recombinant HuBCO2 in -carotene producing

E.coli cells was able to produce low amounts of apocarotenoid metabolites (159).

The discrepancy between the outcomes of these studies can possibly be

explained by the inherent difficulty in studying this family of enzymes in vitro. We

therefore set out to examine the probability that primate enzyme characterization

is limited by the current expression methods and enzyme assays. Additionally,

we analyzed, in mouse mutants, how BCO2-deficiency affected carotenoid

homeostasis of the eyes.

First, an in silico inquiry into the structural models of the murine and

primate CCOs did not produce significant differences that indicate that the

primate BCO2 enzymes would be rendered inactive. These findings gave

credence to our hypothesis that the setback in primate BCO2 characterization lay

in the biochemical methodology. The choice of detergents to properly solubilize

CCOs in water based buffers has been shown to be a critical factor as several detergents greatly inhibit CCO activity (168, 169). A screen of several detergents

for MuBCO2 activity identified DMN as an optimal choice in maintaining a

functionally, soluble protein. It was not surprising to find that our initial trials of

primate protein expression in E.coli produced only insoluble protein as

recombinant protein misfolding in bacterial cells seems to be the norm (170). The

expression of many recombinant proteins at lower temperatures has been a

successful technique at limiting their in vivo aggregation (178). Using this

technique we were able to produce soluble trMaBCO2, but not HuBCO2.

However, given the high degree of homology between the primate enzymes,

MaBCO2 characterization should provide an identical biochemical insight into

HuBCO2. Using these newly developed techniques we were able to assay cleavage of the MP by trMaBCO2. Determination of apparent KM values with the

model substrate -cryptoxanthin revealed comparable values for primate and murine BCO2s. Similarly, the specific turnover rates were roughly 20 s-1 and 14 s-

1 for primate and murine BCO2, respectively. This finding suggests that the

enzymes display comparable affinity to this substrate, assuming that Michaelis-

Menten kinetics can be applied and the oxidative cleavage is the rate limiting

step of the reaction.

Despite positive associations to health benefits as anti-oxidants and blue

light filters, carotenoids have been reported to act as pro-oxidants under high

oxygen tension and high concentrations (179). In acting as reactive oxygen

species scavengers, carotenoids undergo oxidation and generate various

76 oxidation products (180, 181). Carotenoid supplementation studies, in humans

and monkeys, have demonstrated a significant increase of these metabolites,

which include didehydro-derivatives, in serum and ocular tissues (182, 183).

Since carotenoids are ubiquitous and their amounts can be abundant in food,

mechanisms must have evolved that counteract such a scenario. We showed

previously in mice and human cell lines that carotenoid homeostasis is tightly

regulated. The primary regulation takes place at the level of intestinal absorption and is regulated via retinoid- and ISX-signaling (165, 184). The secondary regulation is performed at the tissue level and involves CCOs. Genetic ablation of

these regulatory processes in Bco2-/- and DKO mice fed a combination of

zeaxanthin and BC resulted in an amassing, including the retina, of zeaxanthin

mostly in its didehydro-derivative form. If indeed BCO2 inactivation drives

specific accumulation of xanthophylls to ocular tissues, it would be expected that

Bco2-/- and DKO mice would have selectively greater fold increases of

zeaxanthin levels in the retina over other tissues as observed in primates. In a

study where macaques were first deprived of xanthophylls and then re-

supplemented, zeaxanthin accumulated 4.6-fold greater in the retina over serum,

whereas in fat, a 2.2-fold over serum was reported (185). In primates, the

distribution of the MP within the retina is assumed to undergo an additional

selective mechanism due to its ordered dispersion (149, 186). Also, it would be

expected that this accumulation occurs singularly with xanthophylls, but Bco1-/-

and DKO mice fed the same combination of zeaxanthin and BC diet also

amassed BC in their retinas. Consequently, we showed the unregulated intake of

carotenoids, carotenes and xanthophylls alike, causes a systemically

indiscriminate accumulation of these compounds. We have previously shown in

mice that this accumulation can cause oxidative stress in tissue. Similarly,

carotenoids and their metabolites, including those derived from zeaxanthin and

lutein can induce oxidative stress (20, 187). It is not known whether xanthophylls

play a role in the mitochondria, but it is clear that mitochondrial BCO2 expression

plays a role in their controlled accumulation in this organelle. When we treated

hepatic human cells with zeaxanthin, HuBCO2 mRNA expression was

significantly induced. Additionally, when these cells were exposed to hydrogen

peroxide, a highly reactive oxygen species, HuBCO2 mRNA levels increased up

to 200-fold providing additional evidence that HuBCO2 expression is responsive

to oxidative stress. This sophisticated regulation manages the chemistry and

biology of compounds that act as anti- and pro-oxidants dependent on the

subcellular localization and concentration. This finding may provide an

explanation for the low carotenoid status of patients affected by chronic disease

since they generally are associated with inflammation and oxidative stress.

In summary, we provide evidence that primate BCO2s are active enzymes

and that they are able to cleave all of the three major macular pigment

xanthophylls. Also, further evidence that BCO2 expression is a regulated process

controlled in part by induction of oxidative stress within mitochondria is provided.

Together these findings effectively postulate that while carotenoids play physiologically beneficial roles in human health, their possible excessive

78 accumulation, which has shown to cause harmful cellular pathologies, is restrained by the actions of BCO2.

FIGURES

Figure 3.1 Sequence and structure homology of CCOs. Alignment of bovine RPE65, human BCO1, human BCO2, macaque BCO2 and murine BCO2. The GKAA-primate insertion is boxed in green, membrane binding domains in magenta, and the previously unresolved 109-121 AA region is boxed in red. All structures are modeled using bovine RPE65 (tan) as template and are aligned facing into the active site with the Fe2+ iron cofactor denoted as an orange sphere. Comparison of 3D structures of A, human BCO2 (light blue) and murine BCO2 (yellow), B, chimeric human BCO2 (blue) and C, wild-type (light purple) and chimeric (orange) macaque BCO2. The 4-AA insertion in primate BCO2s, GKAA, is colored green. The previously unresolved 109- 126 AA region is colored red while the presumed plasma membrane binding sites are highlighted in magenta.

Figure 3.2 Detergent affects CCO enzyme activity. A, Schematic of BCO2’s oxidative cleavage of zeaxanthin. B, HPLC chromatogram comparing murine BCO2’s in vitro activity when performed with OTG (grey trace) or DMN (dashed trace) detergent. The black trace shows control. Relative activities, measured as the production of 10Apo, comparing different detergents is shown in the inset. C, UV/Vis absorbance spectra of the product, 10Apo and substrate, zeaxanthin. OTG (n-octyl beta-D- thioglucopyranoside), DMN (decyl maltose neopentyl glycol ), C8E4 (tetraethylene glycol monooctyl ether), C8E6 (hexaethylene glycol monooctyl ether).

Figure 3.3 Recombinant expression, enzyme activity and cellular localization of BCO2s. A, Western blot of soluble (S) and insoluble (I) centrifugal fractions from lysed bacteria expressing recombinant (from left to right) human, murine and macaque BCO2. B, Insoluble fraction of HuBCO2 expressed in E.coli is inactive. HPLC chromatograms of lipid extracts of in vitro enzyme activity assays of soluble MuBCO2 (dashed trace), insoluble MuBCO2 (black trace) and insoluble HuBCO2 (grey trace) on zeaxanthin. UV spectra of 10Apo and zeaxanthin. C, Confocal images of HepG2 cells transfected with full length (top panel) and truncated (bottom panel) macaque BCO2 encoding plasmids. Immunostaining was performed with anti-V5 antibody for BCO2 (red) and anti-COX IV antibody (green). Nuclei were stained with DAPI (blue). Only the full length MaBCO2 shows co-localization with COX IV in merged images.

Figure 3.4 Enzymatic activity assays of murine and macaque BCO2. A, HPLC analysis of lipid extracts isolated from in vitro enzyme assays of recombinant murine (left) and macaque (right) BCO2 and zeaxanthin. B, The resulting oxidative cleavage products, 10Apo (3-hydroxy--10’- apocarotenal) and -io (3-hydroxy--ionone), as well as the substrate, were identified in part by retention time and known absorption spectra. C, Mass spectra (left and right respectively as murine and macaque) from XICs identifying the peaks at ~10 min with a m/z=393.28 as 10Apo (right inset) and D, the peaks at ~16 min with a m/z=209.18 as -io (right inset).

Figure 3.5 BCO2 cleaves lutein from both the β and ε ring sides at both the 9, 10 and 9’, 10’ double bonds. A, Schematic of BCO2’s oxidative cleavage of lutein showing four of the possible five products. Rosafluene is not depicted. B, HPLC chromatograms of lipid extracts of in vitro enzyme activity assays of MuBCO2 (dashed trace) and trMaBCO2 (grey trace) on lutein (L). The black trace shows control. C, UV spectra of  -10Apo (3- hydroxy--10’-apocarotenal), 10Apo (3-hydroxy--10’-apocarotenal) and lutein.

Figure 3.6 Comparison of MaBCO2 and MuBCO2 enzymatic activity on meso-zeaxanthin (MZ) and β-cryptoxanthin (Crypto). A, HPLC chromatograms of lipid extracts of in vitro enzyme activity assays of MuBCO2 (dashed trace) and trMaBCO2 (grey trace) on MZ. The black trace shows control. UV spectra of 10Apo and MZ. B, Sample HPLC chromatogram displaying BCO2’s cleavage activity on Crypto. Dashed box shows BCO2’s preference for cleaving on the 3-carbon hydroxylated ring side to produce -10’-apocarotenal (-10Apo) and 3-hydroxy--ionone. Inset, quantitative western blot analyses of BCO2 protein amounts in lysates. Three different amounts of purified MuBCO2 ( a, b and c respectively correspond to 0.12, 0.06 and 0.03 μg of protein) were used to quantify MuBCO2 (Mu) and MaBCO2 (Ma) protein amounts in cell lysates. Lower panel, enzyme kinetic analyses of MuBCO2 and MaBCO2 comparing KM and Vmaxvalues for Crypto. Values were calculated using Origin 9

85 software. Values represent means ± S.E. of at least two independent assays.

Figure 3.7 Carotenoid accumulation in tissues of CCO knockout mice. Total xanthophyll A, and -carotene B, concentrations in serum, whole eyes and gonadal white adipose tissue of CCO knockout mice, Bco1-/-, Bco2-/-, and respective DKO kept on a diet containing -carotene and zeaxanthin. Connecting crossbars indicate ratios of eye and gWAT carotenoid levels compared to serum. Far right charts, A and B respectively show retinal concentrations of 3,3’-didehydrozeaxanthin and -carotene. Values indicate means ± SD from at least five female mice. Mean with different letters (a and b) differ significantly. Statistical significance was assessed by one-way ANOVA followed by Scheffe tests using software Origin 9, with threshold of significance set at P < 0.05. n.d., not detectable.

Figure 3.8 Oxidative stress induces BCO2 expression in human hepatic cells. Relative HuBCO2 mRNA levels measured when treated with vehicle control, zeaxanthin, hydrogen peroxide, zeaxanthin in combination with hydrogen peroxide and extended period of hydrogen peroxide treatment. BCO2 transcript levels were weighted against 18s mRNA levels.

CHAPTER 4: Mechanism of chromophore production by the prototypical carotenoid oxygenase NinaB

At the time of preparation of this thesis this chapter was submitted for publication.

4.1 Introduction and Background

Carotenoids and their derivative retinoids are elegant examples of nature’s engineering exploits in harvesting light. The π-conjugated electron system and its attenuation to optimally interact with light, underlies their function in pigmentation, photosynthesis, and photon absorption in visual systems. In plants, for example, zeaxanthin associates, non-covalently, with light-harvesting complex II and protects against light overexposure by quenching excess excitation energy (188).

Symmetrical enzymatic conversion of carotenoids into oxidized retinoids, allows covalent binding via a retinylidene Schiff base to proteins involved in harvesting light energy. This strategy is found in all three domains of life: archae, bacteria and eukaryota. Halobacterium salinarum uses all-trans-retinylidene as the chromophore for bacteriorhodopsin which converts light energy into a proton gradient that, in turn, drives ATP synthesis (189). This system relies on cyclic photoisomerization between all-trans and 13-cis-retinal to drive the gradient pump.

Cis-trans isomerization cycling of the retinylidene chromophore also lies at the heart of metazoan vision (190). In this process, animals face the challenge of synthesizing and recycling the cis-chromophore in a light-independent manner

(44, 191). In vertebrates, synthesis of the chromophore has been divided

88 between two enzymes of structurally related non-heme iron carotenoid cleavage

oxygenases (CCO). Among the more than 600 naturally occurring carotenoids,

β,β-carotene-15,15′-dioxygenase (BCO1) cleaves carotenoids with at least one

β-ionone ring (provitamin A) symmetrically to produce all-trans-retinal. The primary cleavage product is reduced and ultimately converted to all-trans-retinyl esters by lecithin: retinol acyltransferase (LRAT) (93, 118, 192). Then, isomerization of all-trans-retinyl esters into 11-cis-retinol is carried out by the

other CCO family member, the retinal pigment epithelium-specific 65 kDa protein

(RPE65) (28, 130, 131). Loss-of-function mutations in RPE65 cause devastating blinding diseases such as Leber congenital amaurosis and retinitis pigmentosa

(24, 193). A third vertebrate CCO, carotenoid-9’, 10’-dioxygenase (BCO2), localizes to the mitochondria where it cleaves carotenoids asymmetrically at the

C9, C10 double bond (15). Mounting evidence to suggest that BCO2 tailors asymmetric provitamin A carotenoids by removing the non-canonical ring site and in doing so, control the homeostasis of non-provitamin A (18, 159, 164, 194).

Despite genetic, biochemical, and structural data collected on this family of

enzymes, the molecular foundation of substrate specificity, regio-selectivity of

oxidative cleavage, and catalytic mechanism governing their physiological roles

have remained a topic of debate (195-199).

Insects exclusively utilize carotenoids for chromophore production in the dark

and their genomes encode a single CCO family member encoded by the NinaB

gene (denoting neither inactivation nor after potential mutant B) (6, 34, 126, 200).

A well-defined and exclusive role of NinaB in insect vision is to convert 3-OH-β,

3-OH-β -ionone or β, β-ionone carotenoids, depending on the species, into the

visual chromophore, 11-cis-retinal (201). Similar to RPE65 in humans, mutations

in the NinaB gene in Drosophila, renders these insects blind (201). We previously

showed that NinaB’s reaction is carried out in a single step, wherein a carotenoid

substrate is converted into virtually, equimolar amounts of 11-cis and all-trans

retinoid isomers (126). Thus, NinaB’s isomerooxygenase catalytic mechanism

presents a unique opportunity to characterize key features that separate the two

enzymatic actions of metazoan CCOs, oxidative cleavage and trans-cis

isomerization of a carbon double bond.

4.2 Experimental Procedures

4.2.1 Expression of NinaB and Cell Lysis

NinaB (Galleria mellonella) was expressed in one of two ways. First, 800 mL of

Sf9 cells at a concentration of 1.6 x 106 cells / mL were infected with NinaB

baculovirus and incubated at 28°C while shaking at 100 rpm for two days. Cells

then were centrifuged at 4500 x g for 15 mins and cell pellets were stored at -

80°C. Frozen Sf9 cell pellets (~4 g) infected with human NinaB baculovirus were re-suspended in 10 mL of 20 mM Tricine (pH 7.5) sample buffer containing

200 mM NaCl, 1 mM dithiothreitol (DTT, Roche, Mannheim, Germany), one

protease inhibitor cOmplete ULTRA Mini EDTA-free Tablet (Roche, Mannheim,

Germany), 1 mM TCEP and decyl maltose neopentyl glycol (DMN). Cells were

lysed in a glass homogenizer with 20 strokes. The lysate was centrifuged at

100,000 g for 1 h at 4 °C (Beckman Coulter Optima™L-90K Ultracentrifuge). The

supernatant (10 mL) was collected and kept on ice until purification. Second,

XL1-Blue E.coli cells were transformed with the expression vector for NinaB.

Bacteria were grown at room temperature with constant shaking at 200 rpm until

an OD600 of 0.6 was achieved. Protein expression was induced with L-arabinose

at a final concentration of 0.02%. At the point of induction, FeSO4 and ascorbic

acid were added to a final concentration of 5 μM and 10 mM, respectively and

the temperature was decreased to 25°C. Protein expression proceeded for six

when cells were collected by centrifugation at 4500 g for 20 min and cell pellets

were stored at -80°C. Cell pellets were thawed on ice and their net weight was determined. Lysing reagent was prepared by combining 50 mL of B-PER

Bacterial Protein Extraction Reagent (Life Technologies, Grand Island, NY) with one protease inhibitor cOmplete ULTRA Mini EDTA-free Tablet (Roche,

Mannheim, Germany), final concentration of 2 mM ascorbic acid solution (Sigma

Life Science), 1mM TCEP (Thermo Scientific, Rockford, IL), 20 U of recombinant,

RNase-free DNase I. The manufacturer’s recommendation of 4 mL of lysing

reagent per 1 gram of cell pellet was used to lyse and re-suspend cells. Re-

suspended cell pellets were gently vortexed and allowed to incubate at room temperature for 10 min. The cell lysate was then cooled on ice and subjected to centrifugation at 100,000 g at 4°C for 30 min.

4.2.2 NinaB Purification

The supernatant containing NinaB, was loaded onto a 50 mL column containing

1.5 mL TALON Co2+-resin suspension (Clontech) pre-equilibrated with 5 column

91 volumes of ice cold sample buffer. After flow-through collection, the TALON® column was washed with 1 column volume of ice cold buffer containing sample buffer and then with 1 column volume of sample buffer containing 1 mM imidazole. NinaB was eluted with cold sample buffer containing 50 mM imidazole

(elution buffer). Aliquots of eluted NinaB fractions were collected for gel analysis.

All eluted NinaB fractions were pooled and concentrated in a 30K AmiconR Ultra

Centrifugal Filter (Millipore) before being loaded onto a SuperdexTM 200 10/300

GL size exclusion column (GE Healthcare Life Sciences). NinaB fractions were eluted from the column in 0.5 mL fractions at a flow rate of 0.4 mL/min. with

sample buffer. Aliquots of these fractions were also collected for gel analysis.

Fractions containing purified enzyme were then pooled, concentrated within a

30K AmiconR Ultra Centrifugal Filter. To determine the monomeric state of

purified NinaB, a mix of proteins (Bio-Rad Gel filtration Standard) with known

molecular weights were run simultaneously on the size exclusion column.

4.2.3 Three Dimensional Structural Modeling

Homology models of Galleria NinaB, based on the structure of RPE65 (PDB

accession code 4F2Z) and apocarotenoid oxygenase (PDB accession code

2BIW) were generated using the Phyre2 webserver (The Phyre2 web portal for

protein modeling, prediction and analysis. Active site residue locations were

consistent between these models. The ACO-based model was used for analysis

owing to its preserved dual access to the active site, which is present in the

alkene-cleaving CCO structures described to date. The structural model was

visualized using PyMOL (Schrodinger).

4.2.4 Enzymatic Assays

Enzymatic assays were carried out as previously described (8) and (32). DMN

micelles loaded with substrate were prepared as follows: 33 μL 3% DMN

detergent solution was mixed with 10 μM (final concentration) of substrate,

dissolved in acetone, in a 2-mL Eppendorf tube. This mixture was then dried in a

Speedvac (Eppendorf Vacufuge Plus). To substrate, 100 μL of cell lysate was

added and vortexed vigorously for 20 s and then placed on an Eppendorf

thermo-shaker set at 28°C for 8 min at 300 rpm. Control assays were performed

with un-induced E.coli cell pellet lysates. Reactions were stopped by adding 100

μL of water and 400 μL of acetone. Lipids were extracted by adding 400 μL of diethyl ether and 100 μL petroleum ether, then vortexed for 3 x 10 s periods, centrifuged at 15,000 x g for 1 min and finally the resulting organic phase was collected. The extraction was performed twice and the collected organic phase was dried in a Speedvac. The dried supernatant then was re-dissolved in mobile phase, 70:30 hexane:ethyl acetate and subjected to either HPLC or LC-MS analysis.

4.2.5 Isotope Labeling Experiments

18 18 For labeling experiments with H2 O, NinaB cell lysate was mixed with H2 O in a

20:80 (v:v) ratio, respectively. Assays were carried out as described above.

18 Labeling experiments with O2 were performed in 10-mL screw-capped glass

vials with a gas-tight Teflon septum. All volumes in the preparation of substrate

micelles were increased 5-fold and dried accordingly in the glass vial and kept on

ice. NinaB cell lysate (500 μL) was added to the glass vial and the mixture was

18 saturated with O2 by aerating the solution on ice for 1 min with a release syringe

placed into the septum. Then, after removal of the release syringe, the solution

18 was saturated with O2 once more for 2 min. The sample was vortexed and

incubated at 28°C for 8 min while magnetically stirred. Reactions were stopped

by adding 200 μL of water and 800 μL of acetone. This mixture was separated

equally into two 2 mL Eppendorf tubes for lipid extraction. Lipids were extracted

as described above with 400 μL of diethyl ether and 500 μL petroleum ether and subjected to LC-MS analyses.

4.2.6 HPLC and LC-MS Systems

HPLC analyses were carried out with an Agilent 1260 Infinity Quaternary HPLC system (Santa Clara, CA, USA) equipped with a pump (G1312C) with an integrated degasser (G1322A), a thermostatted column compartment (G1316A), an autosampler (G1329B), a diode-array detector (G1315D), and online analysis software (Chemstation). Analyses were performed at 25 °C using a normal-phase

Zorbax Sil (5 μm, 4.6 x 150 mm) column (Agilent Technologies, Santa Clara, CA) protected with a guard column. Carotenoid and retinal separation was achieved

using an isocratic composition of 70:30 (v:v) of hexane: ethyl acetate. The flow

rate for all systems was 1.4 ml/min. Detection of carotenoids and apo-

carotenoids was performed at 420 nm wavelength. For LC-MS analyses, the

eluate was directed into a LXQ linear ion trap mass spectrometer (Thermo

Scientific, Waltham, MA) through atmospheric pressure chemical ionization

(APCI) source working in the positive mode. To ensure optimal sensitivity, the

instrument was tuned with zeaxanthin as well as with retinal standards.

4.3 Results

4.3.1 Expression, Purification and Enzymatic Activity Assay of NinaB

Expression of active, recombinant NinaB containing an N-terminal His-tag was

achieved with the baculovirus expression system and Sf9 insect cells (Figure 4.1

A and B). Enzyme assays testing the isomerooxygenase activity (Figure 4.2A) of

the recombinant enzyme on carotenoids showed robust enzymatic activity

(Figure 4.2B and Figure 4.1B, blue traces). After Talon Co2+ purification, a

modest level of protein activity remained (Fig.S1B and C). Enzymatic activity after gel filtration could not be detected.

4.3.2 Protein Structure Analysis and Characterization of Binding Cleft

Residues

3D homology structures of NinaB, using the crystal structures of RPE65 (PDB

4F2Z) and ACO (PDB 2BIW) as templates, were generated using Phyre2 (202)

(Fig.1C). This model predicted a basic structural fold consisting of a rigid seven-

bladed β-propeller similar to other CCOs. A structural space in the active site

domain near the four absolutely-conserved histidines ligated to the iron co-factor

was present. Also present was the presumed dual substrate entry and product

exit membrane tunnel solved in RPE65; however the ACO-based NinaB model

predicts a secondary opening that is connected to the substrate binding site and

the membrane tunnel (Figure 4.2C, blue mesh).

Previously, it was reported that a set of residues within the binding cleft of RPE65

attenuate the production of different cis-isomers, specifically 11- and 13-cis

(197). Some of these residues were conserved in the NinaB substrate tunnel

(Figure 4.2C), but production of 13-cis-retinal by NinaB has not been documented. Mutating two of these conserved residues, F106L and T151S in

NinaB (Figure 4.2C), diminished the enzymatic activity as measured by the production of 11-cis-retinal to 40 and 50% of control levels, respectively (Figure

4.2D). However, these mutations did not give rise to the production of 13-cis- retinal. Mutation of F309 and Y330, two aromatic residues also present within the binding cleft and not conserved in RPE65, into leucine, abolished the enzyme’s activity entirely.

4.3.3 NinaB’s Bipartite Substrate Recognition Site.

Previously characterized substrates of NinaB and their kinetic analyses suggested that NinaB specifically interacted with a single ring site to carry out its enzymatic action (126). To study this further, we carried out enzymatic studies on the asymmetrically, engineered substrate, all-trans-3’-dehydrolutein (Figure 4.3 and Figure 4.4A and B). Incubation for 20 s produced only two of four possible products, all-trans-3’-dehydro-ε-retinal and 11-cis-3-hydroxy-retinal (b and e respectively, Figure 4.3C). Longer incubations of 2 to 15 min did produce the alternative products, i.e. 11-cis-3’-dehydro-ε-retinal and all-trans-3-hydroxyretinal in approximately equimolar amounts (a and d respectively, Figure 4.3), but a consistent preferred production of all-trans-3’-dehydro-ε-retinal and 11-cis-3- hydroxy-retinal was observed. With this asymmetrical carotenoid, NinaB showed a catalytic preference for isomerization on 3-OH-β-ionone ring sides as opposed to 3’-dehydro-ε-ring sides. This indicated that NinaB’s substrate tunnel contains a

96 dual binding site that recognizes both ends of carotenoids for proper transverse placement in the active site.

To test our hypothesis of a dual binding mechanism further, we tested NinaB’s activity on apocarotenoids. NinaB cell lysate enzymatic assays with 3-hydroxy-β- apo-8’-carotenal (Figure 4.4C) and β-apo-8’-carotenal did not produce detectable products under two trialed methodologies. Inhibition studies were also carried out, but apocarotenoid standards were unable to inhibit β, β-carotene cleavage by NinaB. This indicates that the binding affinities of these apocarotenoids are magnitudes lower than those of carotenoids with two cyclohexyl rings and that recognition by NinaB’s A and B domains is required for catalysis.

The lack of cleavage activity on apocarotenoids seemed to indicate that two cyclohexyl rings are required for binding and subsequent cleavage. To investigate this, we subjected all-trans-lycopene to NinaB enzymatic activity assays and subjected lipids extracted in the presence of hydroxylamine to

UV/Vis-LC and LC-MS analysis. This analysis revealed the production of apo-

12’-lycopenal and apo-12’-lycopenal oxime, (Figure 4.4D-F) with confirmed m/z’s of 351.24 [MH]+ and 366.24 [MH]+, respectively (Figure 4.4E). Due to the volatile nature of the second product, apo-11-lycopenal, UV/Vis detection was not

possible, but the extracted ion MS chromatogram with m/z=234.24 [MH]+, the oxime derivative, demonstrated its enzymatic production (Figure 4.5, red plot).

These data suggest that cyclohexyl rings provide the necessary binding sites responsible for 15, 15’ cleavage and 11-cis isomerization specificity. Effectively, it appears that a certain molecular diameter is required for oxidative cleavage to

97 occur as the shorter retinoid compounds have at least one cyclohexyl ring, but still are not cleaved or isomerized. We wondered what would occur if we provided the enzyme optimal binding sites, dual 3-OH-β-ionone rings, but altered the π-conjugation across the carbon backbone. For this, we used 15, 15’- dehydrozeaxanthin (Figure 4.6A) and found that this carotenoid with a triple bond across C15-C15’ does not undergo isomerization or cleavage when subjected to

NinaB. It is unclear if the double bond is required for proper binding and/or

absolutely mandatory for isomerooxygenase activity.

To try and assess the extent of this recognition site across carotenoids we subjected 20, 20’-di-nor-β-carotene to enzymatic assays (Figure 4.7). Incubation with NinaB cell lysates produced two products: 11-cis-20-nor-retinal and all-trans-

20-nor-retinal. The dual lack of methyl groups at carbons 20 and 20’ did not affect NinaB’s enzymatic activity, further suggesting that the rings contain the major points of substrate recognition.

4.3.4 Elucidation of NinaB’s Reaction Mechanism

To determine NinaB’s oxygenase mechanism, we conducted heavy isotope

18 18 labeling experiments with both H2 O and O. Heavy isotope incorporation into

18 the all-trans-3-hydroxyretinal product formed under H2 O was tracked by LC-MS

(Figure 4.8A-C) and found to be time-dependent. For the longest incubation

period tested, 60 min, a 15% of 18O incorporation into all-trans-3-hydroxyretinal

was recorded whereas only 4% was observed for our standard 8 min testing

condition (Figure 4.8A-C). This indicated that the 18O incorporated into all-trans-

3-hydroxyretinal is due to enzyme independent oxygen exchange of the aldehyde

98 with heavy water as opposed to enzymatic incorporation. Monooxygenase-type mechanisms require 50:50 incorporation of molecular oxygen and oxygen from

bulk water into the product. These results clearly indicated that the oxidative

cleavage does not follow a monooxygenase mechanism; therefore we proceeded

to test if the catalysis is performed via a dioxygenase mechanism. Mass

spectral analysis of the cleavage reaction performed for 8 min under an 18O

atmosphere showed an equal ratio of 18O incorporation into both products. The

percent of incorporation, as determined by the ratio of the integrals of the

extracted ion chromatograms of 18O-isotopologue to total isotopologues, was

58.4% for 11-cis-3-hydroxyretinal and 58.3% for all-trans-3-hydroxyretinal (Figure

4.8D). Theoretically, incorporation of molecular 18O should reach 100%, but

incomplete labeling can be attributed to partial degassing of the reaction buffer.

These observations provide evidence of a dioxygenase reaction mechanism for

this particular CCO as has been shown for others (146, 198).

The unique isomerization across the trans 11, 12-double bond into a cis isomer

has only been reported for NinaB and RPE65. However, these enzymes have

very distinct substrates; all-trans-retinyl esters for RPE65 and carotenoids with

two cyclohexyl rings of several possible configurations for NinaB. Biochemical

and structural studies on RPE65 have led to proposed mechanisms of

isomerization of the retinyl ester substrate (195-197). Poliakov et al. and

Redmond et al. have provided evidence that the isomerization reaction may

occur via a radical cation intermediate stabilized around the 11, 12-carbon

double bond by specific residues (196, 197). These residues are conserved in

NinaB (F106 and T151) and, as shown earlier, play a role in the enzymatic yield

of 11-cis-isomers (Figure 4.2D). To investigate the possibility that NinaB’s

isomerization mechanism may also occur via a radical cation intermediate,

enzyme reactions were probed in the presence of aromatic spin traps (Figure

4.9). All spin traps tested inhibited NinaB’s activity but to varying degrees. The

most potent inhibitor was N-tertiary-butyl nitrone (PBN) followed by 2, 2-dimethyl-

1-oxido-4-phenylimidazol-1-ium (DMPIO) and least potent was nitrosobenzene

(NOB) (Figure 4.9). At equimolar levels of substrate, in this instance 20 μM of β-

carotene, PBN reduced the enzyme’s activity by 30% whereas at 100 μM, the activity was reduced by 60%. It remains unclear why the levels of inhibition by these spin traps differ.

4.4 Conclusions

An expression system for NinaB that produces highly-active protein was established and used to characterize the enzyme’s substrate specificity and

reaction mechanism. NinaB was found to contain two domains within its structure, coined here as A and B-domains. The A-domain performs the specific

C11, C12 cis-isomerization and preferentially binds 3-OH-β-ionone rings sites.

The B-domain maintains a trans configuration in the resulting retinoid product.

Concurrent binding of carotenoids containing two cyclohexyl rings to both

domains is required for specific isomerization and oxidative cleavage, to produce

the essential retinoids for insect vision.

NinaB exclusively catalyzes the formation of 11-cis-retinal as opposed to Rpe65

which has been reported to produce 13-cis-retinal (197). We have evidence to

100

propose that NinaB’s substrate tunnel contains a bipartite recognition site which

is responsible for both isomerization across the 11, 12-carbon double bond or maintenance of an all-trans geometry of the retinoid product. Although, these sites recognize various carotenoid end-groups, one side displays a greater affinity for 3-OH-β-ionone rings across which isomerization preferentially takes

place. Proper binding of carotenoids with two cyclohexyl rings, symmetrical or asymmetrical, into both recognition sites provides the necessary alignment for oxidative cleavage across the 15, 15’-carbon double bond. When presented with lycopene, an acyclic carotenoid, cleavage occurs asymmetrically across the 11,

12-double bond. Also, we found that NinaB cannot oxidatively cleave apocarotenoids, further establishing this enzyme’s need for two rings to produce retinoids. Thus, we conclude that the asymmetry of NinaB’s bipartite substrate binding and catalytic domains ensure production of chromophore with a correct geometry as it is required for maturation of insect visual pigments (203). In vertebrates, this task is distributed among three distinct family members: BCO1

cleaves at C15,C15’, BCO2 removes non-canonical ring sites, and RPE65

isomerizes the C11, C12 double bond. We speculate that this separation evolved

to enable continuous re-isomerization of the cis- chromophore after bleaching.

Our present study together with previous biochemical (146, 196, 197), structural

(129) and computational (204) analyses allow us to propose a detailed

mechanism for catalysis by NinaB. The catalytic mechanism comprises an initial

isomerization followed by oxidative cleavage (Figure 4.10). Zeaxanthin, the

natural, symmetrical substrate of NinaB (Galleria mellonella), would be taken up

101

from membranes and discriminately aligned across the structurally defined tunnel. Site-directed mutagenesis of residues F106L and T151S, which line the tunnel, attenuated the enzyme’s activity but maintained oxidative and isomerization specificity (Figure 4.2C and D). Mutating the aromatic residues,

F309L and Y330L completely ablated enzyme activity, revealing their requirement for catalysis. As with other CCOs, it seems that the presence of aromatic residues in the substrate cleft of NinaB is needed to provide resonance stabilization across the carotenoid double bonds (35, 195, 205). As with many other non-heme iron oxygen-activating enzymes (206), the 2+ oxidation state of

iron allows binding of molecular O2 and subsequent activation by a single

electron transfer to produce a superoxide anion. At this stage, the inherent nature

of carotenoids as antioxidants (204, 207) causes the15, 15’ double bond to

attack the superoxide to quench the free radical. This forms a C15-O bond and a

stable radical across the extensive π-electron backbone that allows the formation

of a cis-configuration, a process that has precedence in non-heme iron

dioxygenases (208). Rotation of the C11-C12 bond from a trans to cis-

configuration occurs due to the radical being partially stabilized across C11 from

complimentary interactions with F106 and T151, as evidenced by structural data

from RPE65 (195). Then, an electron transfer to reconstitute iron (II) produces a

stabilized carbocation on substrate C15, priming an attack by oxygen to form a

dioxetane intermediate. Quantum chemical analyses of ACO’s reaction

mechanism, favors a dioxetane over an epoxide intermediate, despite both the

proposal that both lead to a dioxygenase labeling pattern (204). The heavy

102 isotope labeling data provided here clearly show that NinaB is a dioxygenase and therefore its catalytic mechanism may involve a dioxetane intermediate. The final step in this reaction constitutes dioxetane rearrangement which effectively produces 3-OH-11-cis and 3-OH-all-trans-retinal.

103

FIGURES

Figure 4.1 Purification and tests for enzymatic activity of NinaB on β,β- carotene. (A) Coomasie stained SDS-PAGE gels showing purity of recombinant NinaB after purification with Talon Co2+ resin and gel filtration chromatography with a Superdex 200 100/300 GL column. (B) HPLC profiles at 360 nm of lipid extracts from in vitro tests for enzymatic activity from NinaB cell lysate (blue trace) and Talon purified (red trace). (C) UV/Vis spectra of corresponding peaks in (B) peak. a, β,β-carotene; b, 11-cis- retinal; c, all-trans-retinal.

104

Figure 4.2 Identification of key amino acid residues of NinaB’s catalytic domain. (A) Scheme of zeaxanthin’s oxidative cleavage and isomerization by NinaB. (B) HPLC profiles at 420 nm of lipid extracts from in vitro tests for enzymatic activity from NinaB cell lysate (blue trace) and control (black trace) with corresponding peak spectra. (C) NinaB structural model highlighting, in orange, residues within the substrate binding tunnel (blue mesh). (D) Effects site-directed mutagenesis on residues shown in (C) on NinaB catalytic activity as measured by the percent production of 11-cis- retinoids when compared to wild-type NinaB. Values given are the mean ± S.D. (error bars) of three independent measurements. 11-RAL, 11-cis-3- hydroxyretinal; all-RAL, all-trans-3-hydroxyretinal, Z, zeaxanthin; WT, wild- type; ND, Not Detectable.

105

Figure 4.3 Analysis of NinaB’s enzymatic action on all-trans-3’- dehydrolutein. (A) HPLC profiles at 420 nm of lipid extracts from timed in vitro tests for enzymatic activity from NinaB cell lysate. (B) Graphical representation of compound percentage from data shown in (A). (C) Chemical structures of the resulting products detected from in vitro enzymatic activity of NinaB on all-trans-3’-dehydrolutein.a, 11-cis-3’- dehydro-ε-retinal; b, all-trans-3’-dehydro-ε-retinal; c, 11-cis-3-hydroxyretinal; d, all-trans-3-hydroxy-retinal (D) Corresponding UV/Vis spectra of detected peaks in (A).

106

Figure 4.4 Regio-selectivity of oxidative cleavage and geometric isomerization. (A) Schematic representing the preferred stereoselectivity of NinaB on the asymmetric carotenoid, all-trans-3’-dehydrolutein. (B) HPLC profile at 420 nm of lipid extracts from in vitro enzymatic assays with all- trans-3’-dehydrolutein after 15 min incubations at 28°C. The graph gives the composition of different cleavage products (a, 11-cis-3’-dehydro-ε- retinal; b, all-trans-3’-dehydro-ε-retinal; c, 11-cis-3-hydroxy-retinal; d, all- trans-3-hydroxy-retinal) as percent of total products. (C) HPLC profiles at 420 nm of lipid extracts from in vitro assays of NinaB cell lysate (blue trace) and control (black trace) with the apocarotenoid, 3-hydroxy-β-apo-8’- carotenal. (D) Schematic of all-trans-lycopene’s asymmetrical oxidative cleavage by NinaB. (E) HPLC chromatogram of lipid extracts at 360 nm of lipid extracts from in vitro enzymatic assays of NinaB and lycopene. Insets: UV spectra of the substrates and products. (F) Mass spectral analysis of the lipid extracts from (E). apo-12, all-trans-apo-12’-lycopenal; 12’-oxime, all-trans-apo-12’-lycopenal oxime.

107

Figure 4.5 Extracted ion chromatograms of lipid extracts from NinaB cell lysate in vitro enzymatic assays with lycopene. Inset, mass spectrum analysis identifying apo-11-lycopenal as a product of lycopene oxidative cleavage by NinaB.

108

Figure 4.6 Test for NinaB enzymatic activity with 15, 15’- dehydrozeaxanthin. (A) Chemical structure of 15, 15’-dehydrozeaxanthin. (B) HPLC profiles at 360 nm of lipid extracts from in vitro tests for enzymatic activity from NinaB cell lysate (dashed trace) and control (solid trace). Inset, UV/Vis spectra of 15, 15’-dehydrozeaxanthin.

109

Figure 4.7 Analysis of NinaB’s enzymatic action on 20, 20’-di-nor-β- carotene. (A) HPLC profiles at 360 nm of lipid extracts from in vitro tests for enzymatic activity from NinaB cell lysate (dashed trace) and control (solid trace). (B) Schematic depicting of the catalytic action on 20, 20’-di-nor-β- carotene by NinaB. (C) UV/Vis spectra of the corresponding products and the substrate in (A).

110

Figure 4.8 The isomerooxygenase reaction proceeds via a dioxygenases reaction mechanism. (A) Analysis of oxygen exchange, from heavy isotope 18 water (H2 O) (blue trace), into the all-trans-retinoid product over time 16 compared to naturally abundant, H2 O water (black trace). (B) Mass spectra of resulting retinoid isotopologues of water exchange after a 60 16 min incubation period with H2 O. (C) Mass spectra of resulting retinoid isotopologues of water exchange after a 60 min incubation period with 18 18 H2 O. (D) LC-MS analysis of O2 incorporation into the all-trans and 11-cis- retinoid products of zeaxanthin cleavage and isomerization by NinaB.

111

Figure 4.9 NinaB reaction is inhibited by various spin traps. (A) Enzymatic activity of NinaB in the presence of incremental concentrations of spin trap compounds. The activity is given in percent normalized to assays lacking spin traps. Each point value represents the mean ± S.D. (error bars) of three independent measurements. (B) Chemical structures of the spin traps used in (A). NOB, nitrosobenzene; DMPIO, 2,2-dimethyl-1-oxido-4- phenylimidazol-1-ium; PBN, N-tert-Butyl-a-phenylnitrone.

112

Figure 4.10 Schematic representation of the proposed catalytic mechanism for NinaB.

113

CHAPTER 5: The Role of 11-cis-Retinyl Esters in Vertebrate Cone Vision

This chapter was previously published in FASEB J: Babino, D., Perkins, B.D., Kindermann, A., Oberhauser, V., von Lintig, J., 2015 Jan;29(1). PMID: 25326538

5.1 Introduction and Background

The vertebrate retina accommodates two different types of photoreceptors with rod and cone-like morphology. The more sensitive rods offer visual perception at dim light (scotopic) conditions, whereas cones mediate high resolution color vision under bright light (photopic) conditions (209). Despite this functional difference, both photoreceptors’ visual pigments use the same vitamin A-derived chromophore, 11-cis-retinal (11-RAL) to mediate phototransduction (151). This process begins when light absorption causes an 11-cis to all-trans isomerization of the protein-bound retinylidene chromophore. This conformational change triggers a G-protein mediated signaling cascade that eventually leads to a neuronal response (210). The photoproduct all-trans-RAL (at-RAL) is then released from the protein moiety of visual pigments by hydrolysis, converted to all-trans-retinol (at-ROL) and reisomerized into 11-RAL through a multi-step biochemical pathway (211, 212).

The regeneration pathway for chromophore is termed the visual or retinoid cycle

(213) and has been extensively studied in rod dominated bovine and mice eyes

(214). This canonical visual cycle involves two cellular compartments, the photoreceptor outer segments (POS) and the closely associated retinal pigment epithelium (RPE). In the RPE, the light-independent reisomerization reaction of

114

the chromophore is achieved by a two-step enzymatic reaction (215, 216). At-

ROL is converted into all-trans-retinyl esters (at-RE) by the action of lecithin

retinol acyltransferase (LRAT) (217). At-REs are then processed into 11-cis-

retinol (11-ROL) by a retinoid isomerase encoded by the retinal pigment

epithelium-specific 65-kDa gene (Rpe65) (26-28). This isomerohydrolase reaction is regarded as the rate limiting step in the visual cycle (144, 147).

The response kinetic of cones significantly differs from rods. Following light flashes that generate similar membrane currents, cones recover sensitivity approximately 10-fold faster than rods (218). Moreover, the rod photoresponse is

saturated at photoisomerization rates above 500 per second (219) but cones remain responsive to light at photoisomerization rates up to 1,000,000 per second (220). This may necessitate specific mechanism(s) that accommodate the different regeneration rates of the two types of photoreceptors.

A hallmark of eyes with high resolution color vision, including human eyes, is the existence of 11-cis-retinyl esters (11-RE). Biochemical studies in chicken and ground squirrel suggest that these vitamin A derivatives are critical for cone visual pigment regeneration (103, 221). However, the role of 11-REs for cone vision is not well defined (103, 221) and lacks description in live animals with cone rich retinas.

The eyes of the zebrafish (Danio rerio) larva are amenable for genetic and pharmacological manipulations and have been successfully used to study various aspects of photoreceptor development (101). Similar to tetrapods,

115 teleosts display cone and rods with different adaptive properties to varying degree of illumination (222, 223). Previously, (224, 225) we characterized key components of the canonical visual cycle of the fish, including LRAT, RPE65 and the cellular RAL binding protein (CRALBP) (63, 105, 106, 226). We now took advantage of the fish to clarify the role of 11-RE for visual pigment regeneration under photopic conditions.

5.2 Materials and Experimental Procedures

5.2.1 Fish Maintenance and Strains

Rearing, breeding and staging of zebrafish (Danio rerio) were bred and maintained under standard conditions at 28°C (227). The XOPS:mCFP transgenic line has been described previously (228). Wild-type zebrafish were composed of AB/TL and TU strains. The stages of the embryos in days post- fertilization were logged from time of fertilization and larvae were used around the same time of day when experiments permitted. Embryos used for two-photon microscopy and in situ hybridization experiments were raised in the presence of

200 μm 1-phenyl-2-thiourea (PTU) (Sigma-Aldrich) in order to inhibit pigmentation. Animal procedures and experiments were approved by the Case

Western Reserve University Animal Care Committee and conformed to recommendations of the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

116

5.2.2 TPM imaging

TMP images were obtained with a Leica TCS SP5 confocal MP system (Wetzlar,

Germany) equipped with an upright DM6000 CFS stand and a tunable laser

Vision S, (Coherent, Santa Clara, California) Ti-Saphire femtosecond laser.

Laser light at 730 nm was focused on the sample with a 20x1.0 NA water immersion Leica objective. Two−photon excited fluorescence was collected by the same lens and, after filtering excitation light by a Chroma ET680sp filter

(Chroma Technology Corp., Bellows Falls, Vermont), the beam was directed to

HYD detector in a non−descanned manner. Emission spectra were obtained with

TCS SP5 spectrally−sensitive HyD detector in a descanned configuration. For imaging eye structures in the intact eye in living Zebra fish laser light penetrated through the front of the eye. TPM 3D reconstructions were analyzed off−line with

Leica LAS AF 3.0.0.

5.2.3 Light Treatments of Zebrafish Larvae

For all light treatment experiments, zebrafish larvae were placed into 60 X 15 mm sized Petri dishes that were wrapped on the bottom and sides with reflective aluminum foil. Controlled illumination was achieved with a Cold-Light Haloid

Lamp Unit HL-150A (AmScope) and luminous emittance was measured using a

Lux Light Meter 401025 (Extech Instruments). Temperature readings of the water in which fish were placed were taken before, during and after light treatments to protect against overheating. Upon the different illumination regimens, larvae were immediately collected, sacrificed on ice and stored at −80 °C prior to high- performance liquid chromatography (HPLC) analysis devoid of any water. Unless

117

otherwise noted, 100 larvae per experiment were used and at least 3 trials were

performed per experiment. Total amounts of retinoids were then averaged per total numbers of larvae used. In some experiments, larval heads were severed from the rest of the bodies while others used whole bodies for retinoid analysis.

5.2.4 Retinylamine synthesis and treatments

Ret-NH2 was synthesized as described previously (108). Prior to the

experiments, Ret-NH2 was dissolved in ethanol and added to the egg-water of 5

dpf larvae to obtain a final concentration of 5 μM. The incubation times of

treatment with Ret-NH2 depended on the experiment and are described in the

Results section accordingly.

5.2.5 HPLC analysis of retinoids of zebrafish larvae

For extraction of retinoids, zebrafish larvae were thawed on ice and subsequently

transferred to a glass homogenizer in 200 μl 2 M NH2OH, 400 μl of methanol

were added and the larvae were homogenized for 2 minutes. This mixture was left at room temperature for 10 minutes before being transferred to a 2 mL

Eppendorf microcentrifuge tube. 800 μl of acetone were added to the

homogenized solution. Then, 500 μl of hexane were added and vigorously

vortexed. After centrifugation at 5000 g, the upper phase was collected. The extraction was repeated once more and the collected organic phases were dried

using a rotary speedvac system. The dried pellet was dissolved in HPLC solvent.

Retinoid analyses were performed with a normal phase Zorbax Sil (5 μm, 4.6 ×

150 mm) column (Agilent Technologies, Santa Clara, CA). For retinyl ester

separation, a linear gradient of 0.5% ethyl acetate in hexane over 15 minutes

118 followed by 20 minutes of 10% ethyl acetate in hexane was used with a continuous flow rate of 1.4 ml/min with detection at 325 nm. After each run, a 10 minute equilibration period of 0.5% ethyl acetate in hexane was added. For molar quantification of retinoids, the HPLC was previously scaled with the pattern compounds ROL, RE (Sigma), BC (Calbiochem).

5.2.6 Immunohistochemistry

Whole larvae were submerged in paraformaldehyde (4% in phosphate-buffered saline, pH 7) overnight at 4°C. After rehydration into 80% Hanks’ buffered saline solution, samples were cryoprotected in 20% sucrose 4°C until larvae became completely submerged and then 30% sucrose overnight at 4°C. Whole samples were mounted in OCT medium (Miles Scientific, Elkhart, IN) and frozen on a methanol, dry ice liquid bath. 10-µm sections were cut on a cryostat, mounted on gelatin-coated glass slides, and allowed to air dry at room temperature for 2 hours. After two washes in PBS and two washes in PBST (0.05% Tween-20), slides were blocked in PBST containing 1% BSA for 1 hour at room temperature.

Slides were then incubated in primary antibody for 1 hour at room temperature in a humidified chamber. After two washes in PBST, slides were then incubated in the appropriate fluorescent dye-conjugated secondary antibody for 1 hour at room temperature in the dark. Slides were washed two times in PBST, two times in PBS, counterstained with DAPI (4′, 6-diamidino-2-phenylindole; Sigma-Aldrich,

St. Louis, MO) and mounted with Prolong® Gold antifade reagent (Invitrogen,

Eugene, OR). Sections were examined under a Zeiss LSM 510 UVMETA confocal microscope with an HCX Plan 40× numerical aperture 1.4 oil immersion

119 objective lens. Images were acquired with Zeiss confocal software version 2.0

(Zeiss, Jena, Germany) and later processed with Adobe Photoshop CS5.1

(Adobe Systems, San Jose, CA, USA).

The following primary antibodies and dilutions were used: RPE65 (1:100 dilution), a monoclonal antibody that recognizes the protein RPE65a and

RPE65b; Zpr-1 (1:20 dilution), a monoclonal antibody that recognizes red and green cones (Zebrafish International Resource Center or ZIRC); anti-rhodopsin

(1:100 dilution), a monoclonal antibody that recognizes rod photoreceptor outer segments. Alexa Fluor 488 goat anti-mouse and 594 goat anti-mouse (Jackson

ImmunoResearch, West Grove, PA) secondary antibodies were all used at a

1:100 dilution.

5.2.7 Whole-mount in situ hybridization and immunostaining

Whole-mount in situ hybridization was performed as previously described (229), using RPE65a and RPE65b. Whole-mount antibody labelling was performed according to Solnica-Krezel & Driever (1994), except that the methanol fixation step was omitted. For RPE65 staining, an antiserum raised against recombinant zebrafish RPE65a was used in a dilution of 1:300. For this purpose, recombinant zebrafish RPE65a was purified upon heterologous expression in E. coli. One milligram of purified RPE65a protein was used to raise a polyclonal antiserum in rabbits (Eurogentec, Brussels, Belgium). For secondary-antibody staining, a Cy3 goat antirabbit IgG (Sigma, Germany; 1:500) was used.

120

5.2.8 Optokinetic response assays

Visual behavior was assayed as described in (230).

121

5.3 Results

5.3.1 Chemical identification and localization of 11-REs

Dark adapted eyes of zebrafish larvae and adults contain high levels of retinyl esters (105, 231). To assess the incidence and distribution of different RE stereoisomers in 5 days post fertilization (dpf) zebrafish larvae, we performed

HPLC analyses and multi-photon excitation fluorescence microscopy (MPM).

Using an adjusted linear gradient (232), we achieved detection and separation of

11- and at-REs (Fig. 5.1A). The stereoisomers existed in approximately equal molar amounts in the dark adapted larval eyes. The other major ocular retinoid was 11-RAL. Additionally, we detected small amounts of at-RAL and at-ROL.

Previously (105), our laboratory established the identification of these retinoids, extracted from zebrafish larvae, by using their spectral characteristics as compared to authentic standards (Fig. 5.1B).

Once having established the presence of 11-REs within the larval eyes, we proceeded to identify the ocular cell layer to which these compounds localize.

Given the minute size of the zebrafish larva, physical dissection of hundreds of eyes to separate the RPE from the retina would be difficult. This procedure, even in larger specimens, is vulnerable to a high occurrence of cross-contamination.

Previously, retinosomes, clusters of REs with phospholipids and helper proteins, were visualized in live mice by using a 730 nm femptosecond (fs) laser (233). We followed suit by subjecting zebrafish larvae eyes, in situ, to the same in vivo two- photon fluorescence microscopy technique. Scanning across the zebrafish larval eye, from the surface of the eye to the RPE, demonstrated that retinosomes were

122 exclusively detected in the RPE (Fig. 5.1C). Intense fluorescence across the surface of the eye could not be attributed to any particular chemical or anatomical feature and is most likely the result of an intrinsic autofluorescence in this region. Across the lens, some fluorescent particles are clearly visible in the images, but spectral analysis of these regions revealed that they did not concur with characteristic spectra reported earlier for retinosomes (233). Similarly, small, faint fluorescent particles in the inner nuclear layer could not be attributed to retinosomes by spectral analysis. It was only in the region of the RPE, right most

TPM image (Fig. 5.1C), where subcellular structures are visible with the bright fluorescent spots indicating retinosomes. Normalized fluorescence spectrum obtained as a function of wavelength of these bright fluorescent regions, encircled in red, (Figs. 5.2A and B) parallels spectra shown in (233) that were identified as at-REs. The slight discrepancy in the emission spectrum may be due to the mixture of 11- and at-RE esters found in zebrafish as opposed to the exclusively detectable amounts of at-RE esters in mice which was the model used in the cited literature.

HPLC analysis of extracted retinoids from adult zebrafish eyes revealed a consistent accumulation of 11- and at-REs similar to larvae (Fig. 5.3A). A saponification of ocular retinoid extracts provided further identification of 11- and at-REs with their respective conversion to 11-ROL and at-ROL (Fig. 5.3A) as identified by their spectral characteristics (Fig. 5.3B). To distinguish between 11- and at- RE and to confirm their localization to the RPE, we dissected the eyes of adult fish into retina and RPE. Since this procedure is vulnerable to a high

123

occurrence of cross-contamination, we performed immunoblot analysis for

RPE65 and Zrp1, respectively, RPE and retina marker proteins. This staining

revealed the strong enrichment of either marker protein in respective fractions

(Fig. 5.3C). HPLC analysis with lipid extracts from isolated retina and RPE

showed that 11- and at-RE mainly existed in the RPE fraction thus corroborating

the conclusions from the microscopic analysis of the larval eyes (Fig. 5.3D).

5.3.2 Time and light intensity-dependent variation of ocular 11-RE levels

Having identified and localized11-REs to the RPE, we set out to address

the possible role that they play in larval zebrafish vision. We subjected 5 dpf fish

larvae to varying light treatments in order to test 11-RE’s dependency on time

and luminous emittance. Upon exposing dark adapted animals (12 hours) to a

continuous illuminance of 1000 lux in time steps up to one hour and

subsequently performing HPLC retinoid analysis, we observed that the

concentration of 11-REs steadily decreased over time from about 1.4 pmol/head to about 0.24 pmol/head (Fig. 5.4A). In comparison, average levels of 11-RAL continuously decreased for about 30 minutes until a steady state was achieved at which point, levels of 11-RAL were maintained above 1.7 pmol/head and on average levels even began to slightly increase after 30 minutes (Fig. 5.4A). In testing illuminance dependency, larvae were exposed to varying degrees of light intensity, dark adapted, 1,000 lux, or 20,000 lux for a set amount of time, 2 minutes. For the period tested, as was observed in time dependent experiments,

levels of 11-RAL decreased as a result of photopigment bleaching (Fig. 5.4B). As

expected, an increase in production of all-trans-retinoid isomers was correlated

124

with light intensity (Fig. 5.4B). The levels of 11-REs were inversely correlated

with light intensity and an exposure to highly intense light significantly bleached

the 11-RE pool.

5.3.3 11-REs regenerate in the dark and are dependent on RPE65 enzyme

function

Previously (105), our laboratory used retinylamine (Ret-NH2), a potent inhibitor of

RPE65 (108), to determine the role of this enzyme in vision of 5 dpf zebrafish

larvae. One particular detail that was not scrutinized during that study was the

effect that RPE65 inhibition had on 11-RE levels. To determine this effect, if any,

larvae were subjected to varying light treatments in the absence (control) or

presence of Ret-NH2. When larvae were treated with a constant illuminance of

1000 lux in time intervals up to one hour, in the presence of Ret-NH2, the bleaching process of 11-REs was not altered compared to control groups (Fig.

5.5A). To determine if RPE65 inhibition had an effect on 11-RE synthesis during dark adaptation, bleached larvae (1000 lux for one hour) were placed in darkness for a period of 14 hours, in the absence or presence of Ret-NH2, and 11-RE

levels recorded throughout (Fig. 5.5B). Here, we discovered that 11-REs regeneration during dark adaptation took place in control larvae, but was absent

in larvae treated with Ret-NH2. This finding indicated that RPE65 is required for

the regeneration of 11-REs during dark adaptation. As assurance for this

assumption, we performed HPLC analysis on 11-RAL levels under the same

conditions. Bleaching experiments demonstrated that when treated with Ret-NH2,

125

larvae were unable to reach steady state levels of chromophore under constant

illumination as opposed to control groups (Fig. 5.5C).

Seemingly, the data indicated that 11-RE production was achieved, at least in

part, by the same molecular players of the canonical visual cycle responsible for

at-RE and 11-RAL production. In order to delineate this process further, we

supplemented live, Ret-NH2 treated larvae with 11-ROL, the immediate product

of RPE65’s enzymatic activity. For this purpose, larvae were bleached for a

period of 12 hours under an illumination of 1000 lux and were then dark adapted

for 5 hours under three different conditions: in the presence of Ret-NH2, in the presence of 2 µM of 11-ROL, or in the presence of both Ret-NH2 and 11-ROL

(Fig. 5.5D). Similar to treatments described previously, 11-ROL was dissolved in

DMSO and pipetted into petri dishes holding the live larvae. As observed previously, larvae treated with Ret-NH2 were unable to regenerate 11-RE to

control levels. Treatment with 11-ROL caused a surge in the production of both

at- and 11-REs, with a greater than 5 time fold increase in 11-RE production over

control larvae. The concomitant increase of both 11- and at-RE is likely explained

by some thermal isomerization of 11-ROL in the fish water. When Ret-NH2-

inhibited larvae were treated with 11-ROL, production of 11-REs achieved the

same levels as with treatment with 11-ROL alone. This finding demonstrated that

RPE65’s catalysis product 11-ROL is readily converted into 11-RE in the larval

eyes.

126

5.3.4 The XOPS:mCFP zebrafish transgenic line displays a functional cone- only retina

Some electroretinogram (ERG) and optomotor response studies suggest that zebrafish rod photoreceptors are not functional in 5 dpf larvae (223, 234, 235).

However, other studies report that cone and rod functional circuitry and photoreceptor synaptic terminals are distinguishable in the 5 dpf fish eyes (225,

236). We showed that 11-RE were synthesized and recycled in the larva eyes.

To provide definite evidence that 11-RE and RPE65 are required for cone visual pigment regeneration, we employed the XOPS:mCFP (XM) transgenic zebrafish line (228). In the XM line, the cytotoxic effect of a rod-targeted fluorescent reporter gene causes degeneration of rods. To evaluate the effect of rod degeneration on general eye morphology and cone function, we examined standard histological sections and performed optokinetic response (OKR) tests.

First, we established that protein levels of RPE65 were not altered in the XM line as compared to wild-type larvae by immunoblot analysis (Fig. 5.6A).

Immunohistochemistry for RPE65 determined an intact RPE and retinal lamination in the XM line similar to wild-type zebrafish (Fig. 5.6B, top panels). We then performed immunostainings against double cones (ZPR1 staining, Fig.

5.6B, bottom panels) and rods (Rhodopsin (Rho) staining, Fig. 5.6C) to determine whether the distribution and/or morphology of the photoreceptors was affected in in the XM line. Double cone morphology and distribution was identical in the wild-type and XM zebrafish larvae. As expected and previously reported

(228), rod photoreceptor cells were virtually undetectable at 5 dpf in the XM line

127

(Fig. 5.6C). Considering that an intact morphology, despite rod degeneration, may not necessarily assure visual function, we performed optokinetic response tests on the XM line and wild-type to compare visual performance. Visual response of the larvae was measured in two ways, as eye velocity versus angular velocity of a moving grating and versus the change in contrast of that grating at a set velocity (Fig. 5.6D). A significant difference between the XM and wild-type larvae in their OKR was not found indicating that cone visual function was not altered due to rod photoreceptor degeneration.

5.3.5 Retinoid analysis of XOPS:mCFP mutants

Having established that the XM zebrafish line was a functional cone-only model, we set out to determine if 11-REs are mandatory for cone photoreceptor functioning. Overnight, dark adapted 5 dpf XM larvae that were placed in time steps up to 1 hour under an illumination of 2000 lux showed similar ocular retinoid dynamics as wild-type larvae. 11-RAL levels achieved a steady state after 30 minutes, whereas 11-RE levels continually decreased during illumination

(compare Figs. 5.4A and 5.7A). Experiments with various light intensity also proved analogous as 11-RE levels decreased with increasing luminance without reaching a steady state within the period tested (Fig. 5.7B). Hence, the bleaching of 11-REs in the wild-type and XM models were time- and intensity-dependent and attributable to cone photoreceptors.

5.3.6 Analyses of RPE65-inhibited XOPS:mCFP eyes/ Ret-NH2

Having established that 11-REs support cone photoreceptor function, we proceeded to analyze the effect of Ret-NH2 inhibition on this process. The

128

production of the retinylamide demonstrated that Ret-NH2 was readily absorbed

by the larval eyes of XM mutants (Fig. 5.8A). In HPLC analyses, retinoids were then once again identified by elution time and spectral characteristics (Fig.

5.8A,B). From the previous experiment with wild type larvae (Fig. 5.8B), it was

surprising to find that even when exposed for an extended time period to bright

light Ret-NH2-treated larvae still maintained low levels of 11-RE and 11-RAL.

This finding might be explained by several scenarios: One being that even high amounts of Ret-NH2 (5 μM) did not completely inhibit RPE65 activity. Another

was that the period of light exposure for the set intensity was not sufficient to

completely bleach out 11-REs and 11-RAL. Finally, the existence of an alternate,

RPE65-independent pathway may account for the lack of a complete bleach of

11-REs and 11-RAL. To distinguish between these possibilities, dark adapted

larvae (12 hours) were subjected to 2000 lux illuminance for 7 hours in the

presence or absence of Ret-NH2. In these experiments, larvae were pre-exposed

to Ret-NH2 in the dark for one hour to allow efficient binding of the inhibitor to its

target. Immediately after bright light treatments, larvae were subjected to HPLC analysis for retinoids. Under these conditions, 11-RE levels were absent in illuminated larvae treated with Ret-NH2 (Fig. 5.8C). 2000 lux illuminance was

used here, as opposed to 1000 lux used earlier, in order to increase the likely- hood of bleaching out visual pigments. In comparison, 11-RE levels were significantly decreased in Ret-NH2, untreated larvae when compared to dark

adapted control animals, but were still detectable (Fig. 5.8C). Accordingly, 11-

RAL levels also were highly reduced in RetNH2-treated larvae, whereas steady

129 state levels were maintained in controls (Fig. 5.8C). Thus, a complete bleaching of 11-RE and a nearly one of 11-RAL was achieved by inhibiting RPE65 in the cone-only retina under constant bright light illumination.

5.4 Conclusions

Continuous vision requires an incessant regeneration of chromophore. This is achieved through a stepwise enzyme catalyzed chemical transformation cascade of the photoproduct, at-RAL back to 11-RAL, in a pathway referred to as the visual cycle. The canonical visual cycle has been resolved in exquisite molecular detail in rod dominant animals such as mice and bovine (237), but lacks major inquiry in species with cone rich retinas. Cones operate under light conditions that saturate rods, but rods still consume 11-RAL. This scenario may require a specific mechanism to avoid competition for 11-RAL between different photoreceptor types.(101)

A hallmark of eyes with high resolution color vision, including the human eyes, is the existence of relatively high levels of 11-RE, a vitamin A derivative whose role had yet to be defined in vision. How this vitamin A metabolite is synthesized and whether it can support cone vision was the question of this study. Our analyses revealed that 11-REs existed in the RPE of dark-adapted eyes of both 5 dpf larvae and adult zebrafish. This conclusion was drawn based on the chemical and physical properties of retinoids as compared to standards as well as on mechanical and microscopic dissection of retina and RPE. The optic approach employed MPM, a noninvasive imaging modality that has previously been established to monitor REs and retinoid condensation products in live mouse eye

130

(233). In the 5 dpf larval eyes, the levels of 11-REs were comparable to that of

at-RE, also known to be present in the RPE as storage pools for chromophore

production. Previous studies have reported that hydrolysis of 11-RE occurs in

both homogenates of human retinal epithelial cells (238) and bovine retinal pigment epithelium (239). In the former report, the hydrolysis of the 11-cis isomer was 20 times greater than that of the all-trans isomer as measured in vitro. Since it has been reported that cones recover sensitivity approximately 10-fold faster than rods, a quicker turnover of 11-RAL would be necessary to maintain uninterrupted vision (218, 240). Thus, if the hydrolysis kinetics of 11-RE were to hold true in vivo, the faster hydrolysis of 11-REs would provide a source of chromophore for cones under immediate and continuous bright light conditions.

Our time dependent experiments under constant, bright illumination provided evidence of this assumption (Fig. 5.4A and Fig. 5.7A). In both wild type and XM larvae, there was an initial bleaching of 11-RAL for a period of 30 minutes with an

average ~1.7-fold decrease in levels. However, after this initial drop, levels of 11-

RAL achieved a steady-state, while levels of 11-REs continued to diminish to

nearly undetectable levels. Seemingly, the steady state levels of 11-RAL were

achieved both by continuous recycling of the photoproduct through the canonical

visual cycle and the hydrolysis of 11-REs, as seen by the inhibition by Ret-NH2

(Fig. 5.5C and Fig. 5.8C). Additionally, this process was shown to be light intensity dependent with increased illuminance (10-fold), for a constant time period, causing a bleaching of 11-REs while maintaining 11-RAL levels similar to dark control (Fig. 5.4B and Fig. 5.7B).

131

To begin elucidating the process by which 11-REs were generated in the

zebrafish eyes, we looked to evaluate the role that molecular players within the

canonical visual cycle played on 11-RE levels. In a previous report, we used

gene knock-down techniques and pharmacological means to study the role of

RPE65 in zebrafish vision and found that disruption and inhibition of RPE65 led

to reduced levels of 11-RAL, but we did not examine the role that RPE65 played

on 11-REs (105). Here we scrutinized this role and found that inhibition of RPE65

in 5 dpf zebrafish larvae, by Ret-NH2, prohibited regeneration of 11-REs in the dark, in both wild-type and XM zebrafish larvae that had been bleached of 11-

REs (Fig. 5.5B). When treated in conjunction with 11-ROL, zebrafish exposed to

Ret-NH2, were able to generate levels of 11-RE exceeding control amounts by

almost 6-fold (Fig. 5.5D). The supplied 11-ROL is most likely acted upon by

LRAT, lecithin:retinol acyltransferase, to produce the pools of 11-REs found in

the RPE (226). 11-REs levels were only exhausted when Ret-NH2 treated XM

fish were kept under constant bright light for a period of 7 hours (Fig. 5.8C). This

gives further credence that in zebrafish larvae the enzymes of the canonical

visual cycle play a major role in sustaining cone vision. This finding revises the

interpretation of the data of our previous study in zebrafish. In larvae with partial

knockdown of RPE65 and treated with Ret-NH2 some 11-RAL persisted after 20

min illumination. In light of our current study, this 11-RAL more likely stemmed

from the 11-RE pool synthesized by the residual RPE65 than from an RPE65-

independent pathway. Thus, like in mice, RPE65 is indispensable for cone vision.

It remains to be investigated whether RPE65 dependent synthesis of the 11-RE

132 pool also contributes to sustained cone vision in eyes of diurnal mammals including humans.

The hydrophobic nature of retinoids limits their solubility and diffusion. Thus animals have evolved specific binding proteins for these compounds. These binding proteins protect retinoids from chemical modification and vice versa, their surrounding from the chemical reactivity of these compounds. The role of

CRALBPs as a substrate carrier that chaperones 11-RAL in the visual cycle is imperative to proper functioning of the visual cycle (241, 242). CRALBP knockout mice display a reduction in 11-RAL production and dark adaptation along with an increased accumulation of at-REs (243). In zebrafish, two paralogs of the cralbp gene are encoded, cralbp a and b, each expressed differentially in the RPE and to Müller glia cells, respectively (106, 244). Knock-down of either, with antisense morpholinos, produced larvae whose 11-RAL regeneration ability was diminished and larvae targeted to reduce levels of CRALBP in Müller glia cells (Cralbp b) showed significant visual impairment. The existence of separate CRALBP proteins lends itself to our proposed ‘11-cis-retinyl ester cycle’ in which 11-REs, whose production is dependent on RPE65, serve as precursors of 11-RAL for cones. This pathway would rely on all presently known molecular players of the canonical visual cycle and also rely on an unidentified 11-RE-specific light- dependent hydrolase (Fig. 5.9). The production of 11-RE provides a pool of chromophore precursors that can be utilized under bright light luminance when the relatively slow RPE65 catalyzed isomerization reaction becomes rate limiting

(144, 147). Under this condition, 11-REs would be hydrolyzed to produce 11-

133

ROL which would subsequently be oxidized by cis-stereoisomer specific retinal

dehydrogenases into 11-RAL. This newly produced 11-RAL would be protected from isomerization and helped be shuffled to cones by binding to CRALBPs (Fig.

5.9).

Notably, RDH5 knock-out mice, that lack most of the 11-cis-RDH activity in the

RPE, undergo abnormal accumulation of 11-cis and 13-cis-retinyl esters (245).

Excessive amounts of 11-ROL, due to a lack of RDH5 activity, would be most likely esterified by LRAT explaining the increased levels of 11-RE in the RDH5 -/- mice despite the fact that 11-REs normally do not accumulate in this nocturnal animal. In humans, several mutations in the RDH5 gene cause a rare form of human night blindness, autosomal recessive fundus albipunctatus (246) and some patients with fundus albipunctatus develop progressive cone dystrophy

(247, 248).

In summary, our finding of continued recycling of 11-REs by components of canonical visual cycle in the RPE well into adulthood clearly indicates the importance of this pathway in zebrafish vision. We showed that their bleaching process under bright light illumination parallels a continued supply of 11-RAL in order to maintain cone vision in wild-type and a cone-only model. This mechanism elegantly and efficiently supplies cones with chromophore under the varying light conditions present in natural environments.

134

FIGURES

Figure 5.1 11-cis-retinyl esters localize to the retinal pigment epithelium (RPE) in zebrafish larvae. (A) Representative HPLC chromatogram at 325 nm of lipophilic extracts of 5-days post fertilization zebrafish larvae. (B) Spectral characteristics of extracted retinoids from zebrafish larvae. (C) In vivo two-photon microscopy images of different layers of the zebrafish larval eye. Retinosomes were exclusively detected in the RPE (far right image). 1, 11-cis-retinyl esters (11-RE); 2, all-trans-retinyl esters (at-RE); 3, syn 11-cis-retinal oxime (syn 11-RAL); 4, syn all-trans-retinal (all-RAL); 3’, anti 11-cis-retinal oxime (anti 11-RAL).

135

Figure 5.2 Multi–photon excitation of a 5 dpf zebrafish larval eye at 730 nm produced emission spectra indicating presence of retinosomes. (A) TPM image of an intact zebrafish larva RPE at 730 nm. The fluorescent green structures are retinosomes containing 11-cis- and all-trans-REs. (B) Fluorescence emission spectra from the region in the RPE encircled in red in Panel A, left.

136

Figure 5.3 11-cis-retinyl esters localize to the retinal pigment epithelium in adult zebrafish eyes. (A) Representative HPLC chromatogram at 325 nm of control (solid line) and saponified (dashed line) lipophilic extracts of adult zebrafish eyes. (B) Spectral characteristics of extracted retinoids, identified in Panel A, from zebrafish eyes. (C) Immunoblot analysis of RPE65 and ZPR1 levels in isolated RPE and retina (RET) from adult zebrafish eyes. Contamination of each laminar marker in the non-corresponding layer indicates difficulty in separating the RPE and retinal layers. (D) 11-RE and at-RE levels (mean ± SD, n ≥ 3 eyes). 11-RE levels were predominantly recorded in the RPE with minimal levels found in the retina most likely from cross-contamination from dissections. 1, 11-cis-retinyl esters (11-RE); 2, all-trans-retinyl esters (at-RE), 3, 11-cis-retinol (11-ROL), 4, all-trans-retinol (at-ROL).

137

Figure 5.4 The consumption of 11-cis-RE, in wild-type zebrafish larvae, is time and light intensity dependent. (A) Quantification, by HPLC, of 11-cis- RE and 11-cis-RAL levels of overnight dark-adapted 5 dpf zebrafish larvae when placed under light treatment (1000 lux) for 1 hour. (B) Retinoid profile of overnight dark-adapted, illuminated with 1,000 lux for 2 minutes, and illuminated at 20,000 lux for 2 minutes 5 dpf larvae. All values given are an average (mean ± SD, n ≥ 3 experiments) of at least three independent experiments for each condition with 100 larvae per experiment. Statistical significance was tested by applying a two-tailed Student's t test to each illuminance treatment when compared to the dark control. * p < 0.003, ** p < 0.03.

138

Figure 5.5 11-RE regeneration in wild-type zebrafish occurs in the dark and is prevented by inhibition of RPE65. (A) Quantification, by HPLC, of 11-RE levels of overnight dark-adapted 5 dpf wild type zebrafish larvae when placed under light treatment (1000 lux) for 1 hour in the presence and absence (control) of Ret-NH2. (B) Quantification, by HPLC, of 11-RE levels of light-adapted (1000 Lux) wild type zebrafish larvae, subsequently set to dark adapt in the presence and absence (control) of Ret-NH2. Levels were recorded throughout a 14 hour period. 11-REs only regenerated in the absence of RetNH2. (C) Quantification, by HPLC, of 11-RAL levels of overnight dark-adapted 5 dpf wild type zebrafish larvae when placed under light treatment (1000 lux) for 1 hour in the presence and absence (control) of RetNH2. (D) Levels of 11-RE and at-RE of larvae that were light-adapted for 12 hours (1000 Lux) and then dark-adapted for 5 hours under various conditions; control, the presence of Ret-NH2 (5 µM), presence of 11-ROL (2 µM), and both Ret-NH2 and 11-ROL. All values given are an average (mean ± SD, n ≥ 3 experiments) of at least three independent experiments for each condition with 100 larvae per experiment. Statistical significance was tested by applying a two-tailed Student's t test to each illuminance treatment when compared to the dark control. * p < 0.008, ** p < 0.05, *** < 0.0005.

139

Figure 5.6 The XOPS:mCFP zebrafish line is a cone-only model. (A) Immunoblot analysis for RPE65 in protein extracts derived from ten heads of 5-dpf wild type and XOPS:mCFP transgenic zebrafish larvae. (B) Cross retinal sections from 5-dpf larvae, XOPS:mCFP ( XM) and wild-type(Wt) labeled with, in the upper panels, Rpe65 (labeling RPE65 in the RPE) and zpr-1) antibodies, in the lower panels, (labeling double cones). (C) Immunostaining for rhodopsin (green). (D) Eye movements triggered by a wide range of stimulus speeds (left panel) and varying contrast (right panel) showed no significant differences between Wt (blue) and XOPS:mCFP (red) zebrafish.

140

Figure 5.7 The consumption of 11-cis-RE, in the XOPS:mCFP transgenic zebrafish larvae, is time and light intensity dependent. (A) Quantification, by HPLC, of 11-cis-RE and 11-cis-RAL levels of overnight dark-adapted 5 dpf zebrafish larvae when placed under light treatment (2000 lux) for 1 hour. (B) Retinoid profile of overnight dark-adapted, illuminated with 2000 lux for 2 minutes, and illuminated at 20,000 lux for 2 minutes 5 dpf larvae. All values given are an average (mean ± SD, n ≥ 3 experiments) of at least three independent experiments for each condition with 100 larvae per experiment. Statistical significance was tested by applying a two-tailed Student's t test to each illuminance treatment when compared to the dark control. * p < 0.003, ** p < 0.001.

141

Figure 5.8 11-RE regeneration in the XOPS:mCFP zebrafish line is prevented by inhibition of RPE65 and can be completely bleached-out with continuous light treatment. (A) Representative HPLC chromatograms at 325 nm of lipophilic extracts of 5-days post fertilization zebrafish larvae in the presence and absence (control) of Ret-NH2. (B) Spectral characteristic of retinylamide, metabolite of Ret-NH2. (C) Retinoid profile of XM zebrafish after dark adaption for 12 hours, placed in the presence or absence of Ret- NH2 under illumination (2000 Lux) for 7 hours. After light treatment, 11-RE levels, in zebrafish exposed to Ret-NH2, were not detectable via HPLC analysis. . All values given are an average (mean ± SD, n ≥ 3 experiments) of at least three independent experiments for each condition with 100 larvae per experiment. Statistical significance was tested by applying a two-tailed Student's t test to each illuminance and pharmacological treatment when compared to the dark control. * p < 0.013, ** p < 0.0001. 1, 11-cis-retinyl esters (11-RE); 2, all-trans-retinyl esters (at-RE); 3, syn 11-cis- retinal oxime (syn 11-RAL); 4, syn all-trans-retinal (all-RAL); 3’, anti 11-cis- retinal oxime (anti 11-RAL); 5, retinylamide.

142

Figure 5.9 Proposed 11-cis-retinyl ester cycle in the cone-rich zebrafish retina. Within the RPE, under dark conditions, RPE65 would form 11-ROL in a canonical fashion and subsequently, this 11-ROL, would be esterified by LRAT for storage in retinosomes in the form of 11-RE. An unidentified light- dependent hydrolase would hydrolyze 11-RE into 11-RAL when demand for the chromophore would arise. The newly formed 11-RAL would be shuffled from the RPE to Müller glia cells via a CRALBP a dependent manner and then to the cone photoreceptors via CRALBP b. In the cones, 11-RAL would bind to cone opsins to form the cone opsin pigment molecules for use in phototransduction. Recycling of the released chromophore, at-RAL, would proceed in a canonical fashion.

143

CHAPTER 6: Summary and Future Directions

Successful production and recycling of visual chromophore (11-cis-retinal)

is essential for photoreceptor cell function and survival. This involves two

fundamental steps: oxidative cleavage of the carotenoid precursor and geometric

isomerization of the cleavage product. To accomplish this synthesis, vertebrates

employ two different enzymes of the carotenoid cleavage enzyme family. Here

we expressed human BCO1, responsible for the symmetrical oxidative cleavage

of provitamin A carotenoids, in Spodoptera frugiperda 9 insect cells with an N-

terminal 6-His tag recombinant protein. The enzyme was purified to homogeneity

by a combination of Co2+ metal affinity and gel filtration chromatography.

Recombinant BCMO1 is a soluble protein that followed Michaelis-Menten kinetics with a KM of 14 µM for β, β-carotene. Though addition of detergents failed to

increase BCO1 enzymatic activity, short chain aliphatic detergents such as C8E4 and C8E6 decreased enzymatic activity probably by interacting with the substrate

binding site. Thus we purified BCO1 in the absence of detergent. Purified BCO1

was a monomeric soluble protein, highly active, did not require cofactors and

displayed a turnover rate of 8 molecules β, β-carotene per second. The solubility of BCO1 was confirmed in mouse liver and mammalian cells. Establishment of a protocol that yields highly active homogenous BCO1 is an important step towards

clarifying the lipophilic substrate interaction, reaction mechanism and structure of

this vitamin A forming enzyme. Despite numerous trials, no diffraction-quality crystals of this protein could be produced. Further efforts should be made to crystallize the protein. RPE65 crystallization was only successful after purification

144 of the enzyme from a natural source. This method may also prove successful for the crystallization of BCO1. The crystal structure of this CCE with bound substrate or inhibitor would provide insight into the family’s mode of specific substrate recognition and make a distinction between the oxidative cleavage reaction and isomerization. Also of great interest is to understand how this physiologically soluble enzyme is able to attain its hydrophobic substrate, ,  carotene from the membrane environment. From our findings, it is clear that the enzyme interacts with detergent micelles, which mimic a cell membrane environment, to act upon carotenoids and retinoids but their direct interaction with membranes is still unknown. Putative to this family is the occurrence of s- palmitoylation which may help in binding to membranes for substrate extraction.

The established expression and purification protocols now allow for mass spectrometry analysis of this enzyme and its possible post-translational modifications, including s-palmitoylation.

Animals deficient in BCO2 highlight the enzyme’s critical role in carotenoid clearance as accumulation of these compounds occur in tissues. Inactivation of the enzyme by a four amino acid long insertion was recently proposed to underlie xanthophyll concentration in the macula of the primate retina. We, here focused on comparing primate and murine BCO2s’ properties. We demonstrated that the enzymes display a conserved structural fold and subcellular localization. Low temperature expression and detergent choice significantly affected binding and turnover rates of the recombinant enzymes with various xanthophyll substrates, including the unique macula pigment meso-zeaxanthin. Mice with genetically

145

disrupted carotenoid cleavage oxygenases displayed adipose tissue rather than

eye-specific accumulation of supplemented carotenoids. Studies in a human

hepatic cell line revealed that BCO2 is expressed as an oxidative stress induced

gene. Our studies reported here provide evidence that BCO2’s enzymatic

function is conserved in primates and link regulation of BCO2 gene expression

with oxidative stress that can be caused by excessive carotenoid

supplementation. We now have a protocol in place for the characterization of a

primate BCO2, but it must now be optimized for analysis on the human enzyme

which to date has yet to be characterized in vitro. This ultimate feat would help cement BCO2’s role in processing carotenoids in human physiology. The accumulation of certain carotenoids in human tissues is well noted and their concentrations have been correlated with healthy and disease states, but the role that BCO2 plays in these observations is unknown. Carotenoid supplementation is a rising million dollar industry throughout the world and continues to be run without oversight. While certain health benefits have been associated with carotenoid consumption several supplementation studies have also shown detrimental effects of supplementation to certain populations, namely smokers.

Only through basic understanding of BCO2’s role in carotenoid homeostasis can beneficially controlled and individualized supplementation be developed.

Insects catalyze the vitamin A forming reaction with a single polypeptide encoded by the NinaB gene. However, it remains to be learned just how these two chemical reactions are catalyzed by a single enzyme. Additionally, NinaB’s catalysis provides a unique opportunity to decipher the reaction mechanism of all

146 three vertebrate CCEs.Here, we analyzed the biochemistry of this prototypical family member. Using various asymmetrical carotenoids we demonstrate that this

CCE possesses an inherent bipartite substrate recognition system that defines the regio-specificity of oxidative cleavage and geometric isomerization. This requires a minimum molecular diameter on the carotenoids which are cleaved and isomerized. Analyses with acyclic and cyclic carotenoid substrates revealed that the specificity of oxidation across the 15, 15’ double bond depends on the presence of two cyclohexyl rings. Experiments with synthetic substrate analogs showed that the methyl group pattern of the polyene backbone plays an insignificant role. Mutagenesis studies along the substrate binding tunnel detected four amino acids that play critical roles in the enzyme’s activity. Heavy isotope labeling experiments clearly demonstrated that oxidative cleavage is performed via a dioxygenase mechanism. Inhibition of NinaB’s enzymatic activity by spin traps suggests the reaction proceeds via a radical/carbocation intermediate. Overall, these findings provide the biochemical foundation of chromophore synthesis by NinaB that lies at the heart of insect vision. Future work should be focused on the crystallization of the enzyme as comparison of its structure to already solved CCE structures may provide detailed information of the superfamily’s substrate recognition and catalytic mechanisms. More work should also be performed on the enzyme’s catalysis on synthetic substrates with modified polyene chains and altered ring structures. Insect preference to use retinal or the 3-hydroxy retinal form is also not yet understood. NinaB can convert both forms, but analysis of different species of NinaB may show that, among

147

species, the enzyme has different kinetics that favor one form versus the other.

The expression protocol set forth here has also shown to be a useful tool in

determining the function of individual amino acids and can be used to continue

probing residues of interest. Perhaps the most important work, however, will be to develop a purification protocol that maintains enzyme activity of purified NinaB.

A cycle of cis-to-trans isomerization of the chromophore is intrinsic to vertebrate vision where rod and cone photoreceptors mediate dim and bright light vision, respectively. Day light illumination can greatly exceed the rate at which the photoproduct can be recycled back to chromophore by the canonical visual cycle. Thus, additional supply pathway(s) must exist to sustain cone-dependent vision. Two-photon microscopy revealed that the eyes of the zebrafish (Danio rerio) contain high levels of 11-cis-retinyl esters within the retinal pigment epithelium. HPLC analyses demonstrate that 11-cis-retinyl esters are bleached by bright light and regenerated in the dark. Pharmacological treatment with all- trans-retinylamine, a potent and specific inhibitor of the trans-to-cis reisomerization reaction of the canonical visual cycle (RPE65 inhibition), impeded the regeneration of 11-cis-retinyl esters. Intervention with 11-cis-retinol restored the regeneration of 11-cis-retinyl esters in the presence of all-trans-retinylamine.

We employed the XOPS:mCFP transgenic zebrafish line with a functional cone- only retina to directly demonstrate that this 11-cis-retinyl ester cycle is critical to maintain vision under bright light conditions. Thus, our analyses reveal that a dark-generated pool of 11-cis-retinyl ester helps to supply photoreceptors with chromophore under the varying light conditions present in natural environments

148

and is dependent on the CCE, RPE65. In the zebrafish further characterization

with a newly synthesized RPE65 mutant strain is now possible. The lack of

RPE65 in the fish should not only affect all-trans-RE regeneration, but also that

of 11-cis-REs. In vitro enzyme activity of isolated RPE microsomes, specifically

for 11-cis- retinyl ester hydrolase (11-cis-REH), from zebrafish eyes with 11-cis-

REs should also be conducted. The accumulation and hydrolysis of 11-cis-REs

has been documented from human donor eyes, but the dark regeneration

pathway that we have described here has not been investigated. With the advent

of non-invasive two-photon microscopy, screening of the 11-cis-RE pool in

humans may be possible in the future. A protocol that differentiates between the

fluorescence of all-trans and 11-cis-retinyl esters needs to be developed to

screen for the generation and light-dependent hydrolysis of the esters.

The work presented here has established protocols for future structural

and molecular work in CCE biochemistry. Our findings from applying the outlined

protocols have furthered our understanding of the CCE family’s enzyme kinetic

properties, substrate recognition, identified primate BCO2 as an active enzyme

that parallels murine activity, added to the knowledge of CCE catalytic mechanisms and identified the role that RPE65 plays in the dark-dependent regeneration of 11-cis-REs for use under bright illumination. Together, these findings all lead to a better understanding of the individual roles that each CCE

plays in vision.

149

REFERENCES

1. Wolf G (2001) The discovery of the visual function of vitamin A. J Nutr

131(6):1647-1650.

2. Underwood BA (2004) Vitamin A deficiency disorders: international efforts

to control a preventable "pox". J Nutr 134(1):231S-236S.

3. Travis GH, Golczak M, Moise AR, & Palczewski K (2007) Diseases

caused by defects in the visual cycle: retinoids as potential therapeutic

agents. Annu Rev Pharmacol Toxicol 47:469-512.

4. Sparrow JR (2010) Bisretinoids of RPE lipofuscin: trigger for complement

activation in age-related macular degeneration. Adv Exp Med Biol 703:63-

74.

5. Schwartz SH, Tan BC, Gage DA, Zeevaart JA, & McCarty DR (1997)

Specific oxidative cleavage of carotenoids by VP14 of maize. Science

276(5320):1872-1874.

6. von Lintig J & Vogt K (2000) Filling the gap in vitamin A research.

Molecular identification of an enzyme cleaving beta-carotene to retinal. J

Biol Chem 275(16):11915-11920.

7. Moise AR, von Lintig J, & Palczewski K (2005) Related enzymes solve

evolutionarily recurrent problems in the metabolism of carotenoids. Trends

Plant Sci 10(4):178-186.

8. Lindqvist A & Andersson S (2002) Biochemical properties of purified

recombinant human beta-carotene 15,15'-monooxygenase. The Journal of

biological chemistry 277(26):23942-23948.

150

9. Wyss A, et al. (2001) Expression pattern and localization of beta,beta-

carotene 15,15'-dioxygenase in different tissues. Biochem J 354(Pt

3):521-529.

10. Redmond TM, et al. (2001) Identification, expression, and substrate

specificity of a mammalian beta-carotene 15,15'-dioxygenase. J Biol

Chem 276(9):6560-6565.

11. Hessel S, et al. (2007) CMO1 deficiency abolishes vitamin A production

from beta-carotene and alters lipid metabolism in mice. J Biol Chem

282(46):33553-33561.

12. Lindqvist A, Sharvill J, Sharvill DE, & Andersson S (2007) Loss-of-function

mutation in carotenoid 15,15'-monooxygenase identified in a patient with

hypercarotenemia and hypovitaminosis A. The Journal of nutrition

137(11):2346-2350.

13. Leung WC, et al. (2008) Two common single nucleotide polymorphisms in

the gene encoding {beta}-carotene 15,15'-monoxygenase alter {beta}-

carotene metabolism in female volunteers. Faseb J.

14. Ferrucci L, et al. (2009) Common variation in the beta-carotene 15,15'-

monooxygenase 1 gene affects circulating levels of carotenoids: a

genome-wide association study. Am J Hum Genet 84(2):123-133.

15. Kiefer C, et al. (2001) Identification and characterization of a mammalian

enzyme catalyzing the asymmetric oxidative cleavage of provitamin A.

The Journal of biological chemistry 276(17):14110-14116.

151

16. Hu KQ, et al. (2006) The biochemical characterization of ferret carotene-

9',10'-monooxygenase catalyzing cleavage of carotenoids in vitro and in

vivo. The Journal of biological chemistry 281(28):19327-19338.

17. Mein JR, Dolnikowski GG, Ernst H, Russell RM, & Wang XD (2010)

Enzymatic formation of apo-carotenoids from the xanthophyll carotenoids

lutein, zeaxanthin and beta-cryptoxanthin by ferret carotene-9',10'-

monooxygenase. Arch Biochem Biophys 506(1):109-121.

18. Amengual J, et al. (2011) A mitochondrial enzyme degrades carotenoids

and protects against oxidative stress. FASEB journal : official publication

of the Federation of American Societies for Experimental Biology

25(3):948-959.

19. Ford NA, Clinton SK, von Lintig J, Wyss A, & Erdman JW, Jr. (2010) Loss

of carotene-9',10'-monooxygenase expression increases serum and tissue

lycopene concentrations in lycopene-fed mice. J Nutr 140(12):2134-2138.

20. Lobo GP, Isken A, Hoff S, Babino D, & von Lintig J (2012) BCDO2 acts as

a carotenoid scavenger and gatekeeper for the mitochondrial apoptotic

pathway. Development 139(16):2966-2977.

21. Hamel CP, et al. (1993) Molecular cloning and expression of RPE65, a

novel retinal pigment epithelium-specific microsomal protein that is post-

transcriptionally regulated in vitro. J Biol Chem 268(21):15751-15757.

22. Mata NL, et al. (2004) Rpe65 is a retinyl ester binding protein that

presents insoluble substrate to the isomerase in retinal pigment epithelial

cells. J Biol Chem 279(1):635-643.

152

23. Xue L, Gollapalli DR, Maiti P, Jahng WJ, & Rando RR (2004) A

palmitoylation switch mechanism in the regulation of the visual cycle. Cell

117(6):761-771.

24. Marlhens F, et al. (1997) Mutations in RPE65 cause Leber's congenital

amaurosis. Nature genetics 17(2):139-141.

25. Redmond TM, et al. (1998) Rpe65 is necessary for production of 11-cis-

vitamin A in the retinal visual cycle. Nat Genet 20(4):344-351.

26. Moiseyev G, Chen Y, Takahashi Y, Wu BX, & Ma JX (2005) RPE65 is the

isomerohydrolase in the retinoid visual cycle. Proc Natl Acad Sci

102(35):12413-12418.

27. Redmond TM, et al. (2005) Mutation of key residues of RPE65 abolishes

its enzymatic role as isomerohydrolase in the visual cycle. Proc Natl Acad

Sci 102(38):13658-13663.

28. Jin M, Li S, Moghrabi WN, Sun H, & Travis GH (2005) Rpe65 is the

retinoid isomerase in bovine retinal pigment epithelium. Cell 122(3):449-

459.

29. Oberhauser V, Voolstra O, Bangert A, von Lintig J, & Vogt K (2008) NinaB

combines carotenoid oxygenase and retinoid isomerase activity in a single

polypeptide. Proc Natl Acad Sci 105(48):19000-19005.

30. Hardie RC & Raghu P (2001) Visual transduction in Drosophila. Nature

413(6852):186-193.

31. Wang T & Montell C (2007) Phototransduction and retinal degeneration in

Drosophila. Pflugers Arch 454(5):821-847.

153

32. Voolstra O, et al. (2006) The Drosophila class B scavenger receptor

NinaD-I is a cell surface receptor mediating carotenoid transport for visual

chromophore synthesis. Biochemistry 45(45):13429-13437.

33. von Lintig J, Dreher A, Kiefer C, Wernet MF, & Vogt K (2001) Analysis of

the blind Drosophila mutant ninaB identifies the gene encoding the key

enzyme for vitamin A formation invivo. Proc Natl Acad Sci 98(3):1130-

1135.

34. Voolstra O, et al. (2010) NinaB is essential for Drosophila vision but

induces retinal degeneration in opsin-deficient photoreceptors. The

Journal of biological chemistry 285(3):2130-2139.

35. Kloer DP, Ruch S, Al-Babili S, Beyer P, & Schulz GE (2005) The structure

of a retinal-forming carotenoid oxygenase. Science 308(5719):267-269.

36. Kiser PD, Golczak M, Lodowski DT, Chance MR, & Palczewski K (2009)

Crystal structure of native RPE65, the retinoid isomerase of the visual

cycle. Proc Natl Acad Sci 106(41):17325-17330.

37. Messing SA, et al. (2010) Structural insights into maize viviparous14, a

key enzyme in the biosynthesis of the phytohormone abscisic acid. Plant

Cell 22(9):2970-2980.

38. Poliakov E, Gentleman S, Cunningham FX, Jr., Miller-Ihli NJ, & Redmond

TM (2005) Key role of conserved histidines in recombinant mouse beta-

carotene 15,15'-monooxygenase-1 activity. J Biol Chem 280(32):29217-

29223.

154

39. Moiseyev G, et al. (2006) RPE65 is an iron(II)-dependent

isomerohydrolase in the retinoid visual cycle. J Biol Chem 281(5):2835-

2840.

40. Deigner PS, Law WC, Canada FJ, & Rando RR (1989) Membranes as the

energy source in the endergonic transformation of vitamin A to 11-cis-

retinol. Science 244(4907):968-971.

41. Jang GF, McBee JK, Alekseev AM, Haeseleer F, & Palczewski K (2000)

Stereoisomeric specificity of the retinoid cycle in the vertebrate retina. J

Biol Chem 275(36):28128-28138.

42. McBee JK, et al. (2000) Isomerization of all-trans-retinol to cis-retinols in

bovine retinal pigment epithelial cells: dependence on the specificity of

retinoid-binding proteins. Biochemistry 39(37):11370-11380.

43. Jang GF, et al. (2001) Characterization of a dehydrogenase activity

responsible for oxidation of 11-cis-retinol in the retinal pigment epithelium

of mice with a disrupted RDH5 gene. A model for the human hereditary

disease fundus albipunctatus. J Biol Chem 276(35):32456-32465.

44. von Lintig J, Kiser PD, Golczak M, & Palczewski K (2010) The biochemical

and structural basis for trans-to-cis isomerization of retinoids in the

chemistry of vision. Trends Biochem Sci 35(7):400-410.

45. Redmond AD (1985) Seizures in asystole. Annals of emergency medicine

14(11):1126.

155

46. Kushiro T, et al. (2004) The Arabidopsis cytochrome P450 CYP707A

encodes ABA 8'-hydroxylases: key enzymes in ABA catabolism. Embo J

23(7):1647-1656.

47. Wang DQ (2007) Regulation of intestinal cholesterol absorption. Annu Rev

Physiol 69:221-248.

48. van Bennekum A, et al. (2005) Class B scavenger receptor-mediated

intestinal absorption of dietary beta-carotene and cholesterol.

Biochemistry 44(11):4517-4525.

49. Reboul E & Borel P (2011) Proteins involved in uptake, intracellular

transport and basolateral secretion of fat-soluble vitamins and carotenoids

by mammalian enterocytes. Prog Lipid Res 50(4):388-402.

50. Lobo GP, et al. (2010) ISX is a retinoic acid-sensitive gatekeeper that

controls intestinal beta,beta-carotene absorption and vitamin A production.

FASEB J 24(6):1656-1666.

51. Lobo GP, et al. (2013) Genetics and diet regulate vitamin A production via

the homeobox transcription factor ISX. J Biol Chem.

52. Wongsiriroj N, et al. (2008) The molecular basis of retinoid absorption: a

genetic dissection. J Biol Chem 283(20):13510-13519.

53. Paik J, et al. (2004) Vitamin A: overlapping delivery pathways to tissues

from the circulation. J Nutr 134(1):276S-280S.

54. van Bennekum AM, et al. (1999) Lipoprotein lipase expression level

influences tissue clearance of chylomicron retinyl ester. J Lipid Res

40(3):565-574.

156

55. Goodman DW, Huang HS, & Shiratori T (1965) Tissue Distribution and

Metabolism of Newly Absorbed Vitamin a in the Rat. J Lipid Res 6:390-

396.

56. O'Byrne SM, et al. (2005) Retinoid absorption and storage is impaired in

mice lacking lecithin:retinol acyltransferase (LRAT). J Biol Chem

280(42):35647-35657.

57. Episkopou V, et al. (1993) Disruption of the transthyretin gene results in

mice with depressed levels of plasma retinol and thyroid hormone. Proc

Natl Acad Sci 90(6):2375-2379.

58. Castenmiller JJ & West CE (1998) Bioavailability and bioconversion of

carotenoids. Annu Rev Nutr 18:19-38.

59. Johnson EJ & Russell RM (1992) Distribution of orally administered beta-

carotene among lipoproteins in healthy men. Am J Clin Nutr 56(1):128-

135.

60. Quadro L, et al. (1999) Impaired retinal function and vitamin A availability

in mice lacking retinol-binding protein. Embo J 18(17):4633-4644.

61. Seeliger MW, et al. (1999) Phenotype in retinol deficiency due to a

hereditary defect in retinol binding protein synthesis. Invest Ophthalmol

Vis Sci 40(1):3-11.

62. Kawaguchi R, et al. (2007) A membrane receptor for retinol binding

protein mediates cellular uptake of vitamin a. Science 315(5813):820-825.

157

63. Isken A, et al. (2008) RBP4 disrupts vitamin A uptake homeostasis in a

STRA6-deficient animal model for Matthew-Wood syndrome. Cell Metab

7(3):258-268.

64. Kawaguchi R, et al. (2011) Receptor-Mediated Cellular Uptake

Mechanism That Couples to Intracellular Storage. ACS Chem Biol

6(10):1041-1045.

65. Amengual J, Golczak M, Palczewski K, & von Lintig J (2012)

Lecithin:retinol acyltransferase is critical for cellular uptake of vitamin A

from serum retinol-binding protein. The Journal of biological chemistry

287(29):24216-24227.

66. Blomhoff R, Green MH, Berg T, & Norum KR (1990) Transport and

storage of vitamin A. Science 250(4979):399-404.

67. Blaner WS (2007) STRA6, a Cell-Surface Receptor for Retinol-Binding

Protein: The Plot Thickens. Cell Metab 5(3):164-166.

68. Golzio C, et al. (2007) Matthew-Wood syndrome is caused by truncating

mutations in the retinol-binding protein receptor gene STRA6. Am J Hum

Genet 80(6):1179-1187.

69. Pasutto F, et al. (2007) Mutations in STRA6 Cause a Broad Spectrum of

Malformations Including Anophthalmia, Congenital Heart Defects,

Diaphragmatic Hernia, Alveolar Capillary Dysplasia, Lung Hypoplasia, and

Mental Retardation. Am J Hum Genet 80(3):550-560.

158

70. Casey J, et al. (2011) First implication of STRA6 mutations in isolated

anophthalmia, microphthalmia, and coloboma: a new dimension to the

STRA6 phenotype. Hum Mutat 32(12):1417-1426.

71. Chassaing N, et al. (2009) Phenotypic spectrum of STRA6 mutations:

from Matthew-Wood syndrome to non-lethal anophthalmia. Hum Mutat

30(5):E673-681.

72. Rhinn M & Dolle P (2012) Retinoic acid signalling during development.

Development 139(5):843-858.

73. Kawaguchi R, Yu J, Wiita P, Honda J, & Sun H (2008) An essential ligand-

binding domain in the membrane receptor for retinol-binding protein

revealed by large-scale mutagenesis and a human polymorphism. J Biol

Chem 283(22):15160-15168.

74. Ruiz A, et al. (2012) Retinoid content, visual responses and ocular

morphology are compromised in the retinas of mice lacking the retinol-

binding protein receptor, STRA6. Invest Ophthalmol Vis Sci 2012 Mar 30.

[Epub ahead of print].

75. Arshavsky V (2002) Like night and day: rods and cones have different

pigment regeneration pathways. Neuron 36(1):1-3.

76. Jastrzebska B, Palczewski K, & Golczak M (2011) Role of bulk water in

hydrolysis of the rhodopsin chromophore. J Biol Chem 286(21):18930-

18937.

159

77. Tsybovsky Y, Molday RS, & Palczewski K (2010) The ATP-binding

cassette transporter ABCA4: structural and functional properties and role

in retinal disease. Adv Exp Med Biol 703:105-125.

78. Haeseleer F, Huang J, Lebioda L, Saari JC, & Palczewski K (1998)

Molecular characterization of a novel short-chain

dehydrogenase/reductase that reduces all-trans-retinal. J Biol Chem

273(34):21790-21799.

79. Rattner A, Smallwood PM, & Nathans J (2000) Identification and

characterization of all-trans-retinol dehydrogenase from photoreceptor

outer segments, the visual cycle enzyme that reduces all-trans-retinal to

all-trans-retinol. J Biol Chem 275(15):11034-11043.

80. Maeda A, Crabb JW, & Palczewski K (2005) Microsomal glutathione S-

transferase 1 in the retinal pigment epithelium: protection against oxidative

stress and a potential role in aging. Biochemistry 44(2):480-489.

81. Maeda A, et al. (2007) Redundant and unique roles of retinol

dehydrogenases in the mouse retina. Proc Natl Acad Sci 104(49):19565-

19570.

82. Zhou J, Jang YP, Kim SR, & Sparrow JR (2006) Complement activation

by photooxidation products of A2E, a lipofuscin constituent of the retinal

pigment epithelium. Proc Natl Acad Sci 103(44):16182-16187.

83. Janecke AR, et al. (2004) Mutations in RDH12 encoding a photoreceptor

cell retinol dehydrogenase cause childhood-onset severe retinal

dystrophy. Nat Genet 36(8):850-854.

160

84. Allikmets R, et al. (1997) Mutation of the Stargardt disease gene (ABCR)

in age-related macular degeneration. Science 277(5333):1805-1807.

85. Maeda A, Maeda T, Golczak M, & Palczewski K (2008) Retinopathy in

mice induced by disrupted all-trans-retinal clearance. J Biol Chem.

86. Maeda A, et al. (2009) Involvement of all-trans-retinal in acute light-

induced retinopathy of mice. J Biol Chem 284(22):15173-15183.

87. Henderson L, et al. (1985) Diagnosis of ataxia-telangiectasia by T-

lymphocyte cloning assay. Lancet 2(8466):1242.

88. Elsworth JD, Redmond DE, Jr., Ruthven CR, & Sandler M (1985)

Phenylacetic acid production in dominant and non-dominant vervet

monkeys. Life sciences 37(18):1727-1730.

89. Kocsis JH, et al. (1985) Depressive behavior and hyperactive

adrenocortical function. The American journal of psychiatry 142(11):1291-

1298.

90. Redmond TM, et al. (1985) Isolation and characterization of monkey

interphotoreceptor retinoid-binding protein, a unique extracellular matrix

component of the retina. Biochemistry 24(3):787-793.

91. Edwards RB & Adler AJ (1994) Exchange of retinol between IRBP and

CRBP. Exp Eye Res 59(2):161-170.

92. Saari JC & Bredberg DL (1989) Lecithin:retinol acyltransferase in retinal

pigment epithelial microsomes. J Biol Chem 264(15):8636-8640.

161

93. Batten ML, et al. (2004) Lecithin-retinol acyltransferase is essential for

accumulation of all-trans-retinyl esters in the eye and in the liver. The

Journal of biological chemistry 279(11):10422-10432.

94. Imanishi Y, Batten ML, Piston DW, Baehr W, & Palczewski K (2004)

Noninvasive two-photon imaging reveals retinyl ester storage structures in

the eye. J Cell Biol 164(3):373-383.

95. Haeseleer F, et al. (2002) Dual-substrate specificity short chain retinol

dehydrogenases from the vertebrate retina. J Biol Chem 277(47):45537-

45546.

96. Saari JC & Bredberg DL (1987) Photochemistry and stereoselectivity of

cellular retinaldehyde-binding protein from bovine retina. J Biol Chem

262(16):7618-7622.

97. Woodruff ML, et al. (2003) Spontaneous activity of opsin apoprotein is a

cause of Leber congenital amaurosis. Nat Genet 35(2):158-164.

98. Zhang H, et al. (2008) Trafficking of membrane-associated proteins to

cone photoreceptor outer segments requires the chromophore 11-cis-

retinal. J Neurosci 28(15):4008-4014.

99. Mustafi D, Engel AH, & Palczewski K (2009) Structure of cone

photoreceptors. Prog Retin Eye Res 28(4):289-302.

100. Samardzija M, et al. (2009) In conditions of limited chromophore supply

rods entrap 11-cis-retinal leading to loss of cone function and cell death.

Human molecular genetics 18(7):1266-1275.

162

101. Fleisch VC & Neuhauss SC (2010) Parallel visual cycles in the zebrafish

retina. Prog Retin Eye Res 29(6):476-486.

102. Wang JS & Kefalov VJ (2009) An alternative pathway mediates the mouse

and human cone visual cycle. Curr Biol 19(19):1665-1669.

103. Mata NL, Radu RA, Clemmons RC, & Travis GH (2002) Isomerization and

oxidation of vitamin a in cone-dominant retinas: a novel pathway for

visual-pigment regeneration in daylight. Neuron 36(1):69-80.

104. Casper RC, et al. (1985) Somatic symptoms in primary affective disorder.

Presence and relationship to the classification of depression. Archives of

general psychiatry 42(11):1098-1104.

105. Schonthaler HB, et al. (2007) Evidence for RPE65-independent vision in

the cone-dominated zebrafish retina. Eur J Neurosci 26(7):1940-1949.

106. Fleisch VC, Schonthaler HB, von Lintig J, & Neuhauss SC (2008)

Subfunctionalization of a retinoid-binding protein provides evidence for two

parallel visual cycles in the cone-dominant zebrafish retina. J Neurosci

28(33):8208-8216.

107. Maguire AM, et al. (2008) Safety and efficacy of gene transfer for Leber's

congenital amaurosis. N Engl J Med 358(21):2240-2248.

108. Golczak M, Kuksa V, Maeda T, Moise AR, & Palczewski K (2005)

Positively charged retinoids are potent and selective inhibitors of the trans-

cis isomerization in the retinoid (visual) cycle. Proc Natl Acad Sci U S A

102(23):8162-8167.

163

109. Maeda T, et al. (2009) Loss of cone photoreceptors caused by

chromophore depletion is partially prevented by the artificial chromophore

pro-drug, 9-cis-retinyl acetate. Human molecular genetics 18(12):2277-

2287.

110. Hall JA, Grainger JR, Spencer SP, & Belkaid Y (2011) The role of retinoic

acid in tolerance and immunity. Immunity 35(1):13-22.

111. Noy N (2010) Between death and survival: retinoic acid in regulation of

apoptosis. Annu Rev Nutr 30:201-217.

112. Sommer A & Vyas KS (2012) A global clinical view on vitamin A and

carotenoids. Am J Clin Nutr 96(5):1204S-1206S.

113. Sommer A (2008) Vitamin a deficiency and clinical disease: an historical

overview. The Journal of nutrition 138(10):1835-1839.

114. Lietz G, Lange J, & Rimbach G (2010) Molecular and dietary regulation of

beta,beta-carotene 15,15'-monooxygenase 1 (BCMO1). Arch Biochem

Biophys 502(1):8-16.

115. von Lintig J (2010) Colors with functions: elucidating the biochemical and

molecular basis of carotenoid metabolism. Annu Rev Nutr 30:35-56.

116. Goodman DS & Huang HS (1965) Biosynthesis of Vitamin a with Rat

Intestinal Enzymes. Science 149:879-880.

117. Olson JA & Hayaishi O (1965) The enzymatic cleavage of beta-carotene

into vitamin A by soluble enzymes of rat liver and intestine. Proc Natl Acad

Sci U S A 54(5):1364-1370.

164

118. Wyss A, et al. (2000) Cloning and expression of beta,beta-carotene

15,15'-dioxygenase. Biochem Biophys Res Commun 271(2):334-336.

119. Paik J, et al. (2001) Expression and characterization of a murine enzyme

able to cleave beta-carotene. The formation of retinoids. J Biol Chem

276(34):32160-32168.

120. Lampert JM, et al. (2003) Provitamin A conversion to retinal via the

beta,beta-carotene-15,15'-oxygenase (bcox) is essential for pattern

formation and differentiation during zebrafish embryogenesis.

Development 130(10):2173-2186.

121. von Lintig J & Vogt K (2004) Vitamin A formation in animals: molecular

identification and functional characterization of carotene cleaving

enzymes. The Journal of nutrition 134(1):251s-256s.

122. Lakshmanan MR, Chansang H, & Olson JA (1972) Purification and

properties of carotene 15,15'-dioxygenase of rabbit intestine. Journal of

lipid research 13(4):477-482.

123. Singh H & Cama HR (1974) Enzymatic cleavage of carotenoids.

Biochimica et biophysica acta 370(1):49-61.

124. Inesi G, Goodman JJ, & Watanabe S (1967) Effect of diethyl ether on the

adenosine triphosphatase activity and the calcium uptake of fragmented

sarcoplasmic reticulum of rabbit skeletal muscle. The Journal of biological

chemistry 242(20):4637-4643.

165

125. Fidge NH, Smith FR, & Goodman DS (1969) Vitamin A and carotenoids.

The enzymic conversion of beta-carotene into retinal in hog intestinal

mucosa. The Biochemical journal 114(4):689-694.

126. Oberhauser V, Voolstra O, Bangert A, von Lintig J, & Vogt K (2008) NinaB

combines carotenoid oxygenase and retinoid isomerase activity in a single

polypeptide. Proceedings of the National Academy of Sciences of the

United States of America 105(48):19000-19005.

127. Kiser PD, Golczak M, Lodowski DT, Chance MR, & Palczewski K (2009)

Crystal structure of native RPE65, the retinoid isomerase of the visual

cycle. Proceedings of the National Academy of Sciences of the United

States of America 106(41):17325-17330.

128. Lobo GP, Amengual J, Palczewski G, Babino D, & von Lintig J (2012)

Mammalian carotenoid-oxygenases: key players for carotenoid function

and homeostasis. Biochim Biophys Acta 1821(1):78-87.

129. Kiser PD, et al. (2012) Structure of RPE65 isomerase in a lipidic matrix

reveals roles for phospholipids and iron in catalysis. Proceedings of the

National Academy of Sciences of the United States of America

109(41):E2747-2756.

130. Redmond TM, et al. (2005) Mutation of key residues of RPE65 abolishes

its enzymatic role as isomerohydrolase in the visual cycle. Proceedings of

the National Academy of Sciences of the United States of America

102(38):13658-13663.

166

131. Moiseyev G, Chen Y, Takahashi Y, Wu BX, & Ma JX (2005) RPE65 is the

isomerohydrolase in the retinoid visual cycle. Proceedings of the National

Academy of Sciences of the United States of America 102(35):12413-

12418.

132. Nikolaeva O, Takahashi Y, Moiseyev G, & Ma JX (2009) Purified RPE65

shows isomerohydrolase activity after reassociation with a phospholipid

membrane. FEBS J 276(11):3020-3030.

133. Bertoni G (2010) Maize viviparous14: structure meets function. The Plant

cell 22(9):2925.

134. Maeda T, et al. (2011) Dietary 9-cis-beta,beta-carotene fails to rescue

vision in mouse models of leber congenital amaurosis. Mol Pharmacol

80(5):943-952.

135. Golczak M, Kiser PD, Lodowski DT, Maeda A, & Palczewski K (2010)

Importance of membrane structural integrity for RPE65 retinoid

isomerization activity. J Biol Chem 285(13):9667-9682.

136. Bordier C (1981) Phase separation of integral membrane proteins in Triton

X-114 solution. The Journal of biological chemistry 256(4):1604-1607.

137. Marasco EK, Vay K, & Schmidt-Dannert C (2006) Identification of

carotenoid cleavage dioxygenases from Nostoc sp. PCC 7120 with

different cleavage activities. The Journal of biological chemistry

281(42):31583-31593.

167

138. Eisenberg D WR, Terwilliger TC, Wilcox W. (1982) Hydrophobic moments

and protein structure. Faraday Symposia of the Chemical Society 17:109-

120.

139. Hamel CP, et al. (1993) A developmentally regulated microsomal protein

specific for the pigment epithelium of the vertebrate retina. J Neurosci Res

34(4):414-425.

140. Bavik CO, Busch C, & Eriksson U (1992) Characterization of a plasma

retinol-binding protein membrane receptor expressed in the retinal

pigment epithelium. The Journal of biological chemistry 267(32):23035-

23042.

141. Shmarakov I, et al. (2010) Hepatic stellate cells are an important cellular

site for beta-carotene conversion to retinoid. Arch Biochem Biophys

504(1):3-10.

142. Golczak M, et al. (2012) Structural basis for the acyltransferase activity of

lecithin:retinol acyltransferase-like proteins. J Biol Chem 287(28):23790-

23807.

143. Moise AR, et al. (2008) Stereospecificity of retinol saturase: absolute

configuration, synthesis, and biological evaluation of dihydroretinoids. J

Am Chem Soc 130(4):1154-1155.

144. Lyubarsky AL, et al. (2005) Mole quantity of RPE65 and its productivity in

the generation of 11-cis-retinal from retinyl esters in the living mouse eye.

Biochemistry 44(29):9880-9888.

168

145. Leuenberger MG, Engeloch-Jarret C, & Woggon WD (2001) The Reaction

Mechanism of the Enzyme-Catalyzed Central Cleavage of beta-Carotene

to Retinal This research was supported by F. Hoffmann-La Roche AG and

the Swiss National Science Foundation. We are grateful to F. Hoffmann-

La Roche AG for a generous gift of carotenoids and Dr. Claus Bornemann

for preliminary experiments. Angew Chem Int Ed Engl 40(14):2613-2617.

146. Schmidt H, Kurtzer R, Eisenreich W, & Schwab W (2006) The carotenase

AtCCD1 from Arabidopsis thaliana is a dioxygenase. The Journal of

biological chemistry 281(15):9845-9851.

147. Wenzel A, et al. (2005) The retinal G protein-coupled receptor (RGR)

enhances isomerohydrolase activity independent of light. J Biol Chem

280(33):29874-29884.

148. Moise AR, Al-Babili S, & Wurtzel ET (2014) Mechanistic aspects of

carotenoid biosynthesis. Chemical reviews 114(1):164-193.

149. Bone RA, Landrum JT, Fernandez L, & Tarsis SL (1988) Analysis of the

macular pigment by HPLC: retinal distribution and age study. Invest

Ophthalmol Vis Sci 29(6):843-849.

150. Sommer A & Vyas KS (2012) A global clinical view on vitamin A and

carotenoids. The American Journal of Clinical Nutrition 96(5):1204S-

1206S.

151. Palczewski K (2006) G protein-coupled receptor rhodopsin. Annual review

of biochemistry 75:743-767.

169

152. Chambon P (1996) A decade of molecular biology of retinoic acid

receptors. FASEB journal : official publication of the Federation of

American Societies for Experimental Biology 10(9):940-954.

153. Krinsky NI & Johnson EJ (2005) Carotenoid actions and their relation to

health and disease. Mol Aspects Med 26(6):459-516.

154. Bhosale P, Zhao da Y, & Bernstein PS (2007) HPLC measurement of

ocular carotenoid levels in human donor eyes in the lutein

supplementation era. Invest Ophthalmol Vis Sci 48(2):543-549.

155. Eriksson J, et al. (2008) Identification of the yellow skin gene reveals a

hybrid origin of the domestic chicken. PLoS Genet 4(2):e1000010.

156. Vage DI & Boman IA (2010) A nonsense mutation in the beta-carotene

oxygenase 2 (BCO2) gene is tightly associated with accumulation of

carotenoids in adipose tissue in sheep (Ovis aries). BMC Genet 11:10.

157. Berry SD, et al. (2009) Mutation in bovine beta-carotene oxygenase 2

affects milk color. Genetics 182(3):923-926.

158. Li B, et al. (2014) Inactivity of human beta,beta-carotene-9',10'-

dioxygenase (BCO2) underlies retinal accumulation of the human macular

carotenoid pigment. Proceedings of the National Academy of Sciences of

the United States of America 111(28):10173-10178.

159. Palczewski G, Amengual J, Hoppel CL, & von Lintig J (2014) Evidence for

compartmentalization of mammalian carotenoid metabolism. FASEB

journal : official publication of the Federation of American Societies for

Experimental Biology 28(10):4457-4469.

170

160. Lindqvist A, He YG, & Andersson S (2005) Cell type-specific expression of

beta-carotene 9',10'-monooxygenase in human tissues. J Histochem

Cytochem 53(11):1403-1412.

161. Biasini M, et al. (2014) SWISS-MODEL: modelling protein tertiary and

quaternary structure using evolutionary information. Nucleic acids

research 42(Web Server issue):W252-258.

162. Pettersen EF, et al. (2004) UCSF Chimera--a visualization system for

exploratory research and analysis. Journal of computational chemistry

25(13):1605-1612.

163. Mustafi D, et al. (2013) Evolutionarily conserved long intergenic non-

coding RNAs in the eye. Hum Mol Genet 22(15):2992-3002.

164. Amengual J, et al. (2013) Two carotenoid oxygenases contribute to

mammalian provitamin A metabolism. J Biol Chem 288(47):34081-34096.

165. Widjaja-Adhi MA, Lobo GP, Golczak M, & Von Lintig J (2015) A genetic

dissection of intestinal fat-soluble vitamin and carotenoid absorption. Hum

Mol Genet.

166. Larkin MA, et al. (2007) Clustal W and Clustal X version 2.0.

Bioinformatics 23(21):2947-2948.

167. Kiser PD, et al. (2012) Structure of RPE65 isomerase in a lipidic matrix

reveals roles for phospholipids and iron in catalysis. Proceedings of the

National Academy of Sciences of the United States of America

109(41):24.

171

168. Kowatz T, Babino D, Kiser P, Palczewski K, & von Lintig J (2013)

Characterization of human beta,beta-carotene-15,15'-monooxygenase

(BCMO1) as a soluble monomeric enzyme. Arch Biochem Biophys

539(2):214-222.

169. Sui X, et al. (2014) Analysis of carotenoid isomerase activity in a

prototypical carotenoid cleavage enzyme, apocarotenoid oxygenase

(ACO). The Journal of biological chemistry 289(18):12286-12299.

170. Baneyx F (1999) Recombinant protein expression in Escherichia coli. Curr

Opin Biotechnol 10(5):411-421.

171. Baneyx F & Mujacic M (2004) Recombinant protein folding and misfolding

in Escherichia coli. Nat Biotechnol 22(11):1399-1408.

172. Khachik F, et al. (1997) Identification, quantification, and relative

concentrations of carotenoids and their metabolites in human milk and

serum. Anal Chem 69(10):1873-1881.

173. Seddon JM, et al. (1994) Dietary carotenoids, vitamins A, C, and E, and

advanced age-related macular degeneration. Eye Disease Case-Control

Study Group. JAMA 272(18):1413-1420.

174. Bone RA, et al. (2001) Macular pigment in donor eyes with and without

AMD: a case-control study. Invest Ophthalmol Vis Sci 42(1):235-240.

175. Landrum JT, et al. (1997) A one year study of the macular pigment: the

effect of 140 days of a lutein supplement. Exp Eye Res 65(1):57-62.

172

176. Schalch W (1992) Carotenoids in the retina--a review of their possible role

in preventing or limiting damage caused by light and oxygen. EXS 62:280-

298.

177. Schalch W, et al. (2007) Xanthophyll accumulation in the human retina

during supplementation with lutein or zeaxanthin - the LUXEA (LUtein

Xanthophyll Eye Accumulation) study. Arch Biochem Biophys 458(2):128-

135.

178. Vasina JA & Baneyx F (1997) Expression of aggregation-prone

recombinant proteins at low temperatures: a comparative study of the

Escherichia coli cspA and tac promoter systems. Protein Expr Purif

9(2):211-218.

179. Palozza P, Serini S, Di Nicuolo F, Piccioni E, & Calviello G (2003)

Prooxidant effects of beta-carotene in cultured cells. Mol Aspects Med

24(6):353-362.

180. Hurst JS, Saini MK, Jin GF, Awasthi YC, & van Kuijk FJ (2005) Toxicity of

oxidized beta-carotene to cultured human cells. Exp Eye Res 81(2):239-

243.

181. Prasain JK, Moore R, Hurst JS, Barnes S, & van Kuijk FJ (2005)

Electrospray tandem mass spectrometric analysis of zeaxanthin and its

oxidation products. J Mass Spectrom 40(7):916-923.

182. Khachik F, Bernstein PS, & Garland DL (1997) Identification of lutein and

zeaxanthin oxidation products in human and monkey retinas. Invest

Ophthalmol Vis Sci 38(9):1802-1811.

173

183. Khachik F, et al. (2006) The effect of lutein and zeaxanthin

supplementation on metabolites of these carotenoids in the serum of

persons aged 60 or older. Invest Ophthalmol Vis Sci 47(12):5234-5242.

184. Lobo GP, et al. (2013) Genetics and diet regulate vitamin A production via

the homeobox transcription factor ISX. The Journal of biological chemistry

288(13):9017-9027.

185. Johnson EJ, Neuringer M, Russell RM, Schalch W, & Snodderly DM

(2005) Nutritional manipulation of primate retinas, III: Effects of lutein or

zeaxanthin supplementation on adipose tissue and retina of xanthophyll-

free monkeys. Invest Ophthalmol Vis Sci 46(2):692-702.

186. Bone RA, et al. (1997) Distribution of lutein and zeaxanthin stereoisomers

in the human retina. Exp Eye Res 64(2):211-218.

187. Kalariya NM, Ramana KV, Srivastava SK, & van Kuijk FJ (2008)

Carotenoid derived aldehydes-induced oxidative stress causes apoptotic

cell death in human retinal pigment epithelial cells. Exp Eye Res 86(1):70-

80.

188. Ballottari M, et al. (2014) Regulation of photosystem I light harvesting by

zeaxanthin. Proceedings of the National Academy of Sciences of the

United States of America 111(23):E2431-2438.

189. Haupts U, Tittor J, & Oesterhelt D (1999) Closing in on bacteriorhodopsin:

progress in understanding the molecule. Annual review of biophysics and

biomolecular structure 28:367-399.

174

190. Wald G (1968) Molecular basis of visual excitation. Science

162(3850):230-239.

191. Wald G (1974) Proceedings: Visual pigments and photoreceptors--review

and outlook. Exp Eye Res 18(3):333-343.

192. Liu L & Gudas LJ (2005) Disruption of the lecithin:retinol acyltransferase

gene makes mice more susceptible to vitamin A deficiency. The Journal of

biological chemistry 280(48):40226-40234.

193. Bowne SJ, et al. (2011) A dominant mutation in RPE65 identified by

whole-exome sequencing causes retinitis pigmentosa with choroidal

involvement. European journal of human genetics : EJHG 19(10):1074-

1081.

194. Babino D, et al. (2015) Characterization of the role of beta;-carotene-9,10-

dioxygenase in macular pigment metabolism. The Journal of biological

chemistry.

195. Kiser PD, et al. (2015) Catalytic mechanism of a retinoid isomerase

essential for vertebrate vision. Nature chemical biology 11(6):409-415.

196. Poliakov E, et al. (2011) Aromatic lipophilic spin traps effectively inhibit

RPE65 isomerohydrolase activity. Biochemistry 50(32):6739-6741.

197. Redmond TM, Poliakov E, Kuo S, Chander P, & Gentleman S (2010)

RPE65, visual cycle retinol isomerase, is not inherently 11-cis-specific:

support for a carbocation mechanism of retinol isomerization. The Journal

of biological chemistry 285(3):1919-1927.

175

198. Dela Sena C, et al. (2014) The human enzyme that converts dietary

provitamin a carotenoids to vitamin a is a dioxygenase. J Biol Chem

289(19):13661-13666.

199. Leuenberger MG, Engeloch-Jarret C, & Woggon W-D (2001) The

Reaction Mechanism of the Enzyme-Catalyzed Central Cleavage of β-

Carotene to Retinal. Angewandte Chemie International Edition

40(14):2613-2617.

200. Seki T, et al. (1986) A fly, Drosophila melanogaster, forms 11-cis 3-

hydroxyretinal in the dark. Vision Res 26(2):255-258.

201. von Lintig J, Dreher A, Kiefer C, Wernet MF, & Vogt K (2001) Analysis of

the blind Drosophila mutant ninaB identifies the gene encoding the key

enzyme for vitamin A formation invivo. Proceedings of the National

Academy of Sciences of the United States of America 98(3):1130-1135.

202. Kelley LA, Mezulis S, Yates CM, Wass MN, & Sternberg MJ (2015) The

Phyre2 web portal for protein modeling, prediction and analysis. Nature

protocols 10(6):845-858.

203. Ozaki K, Nagatani H, Ozaki M, & Tokunaga F (1993) Maturation of major

Drosophila rhodopsin, ninaE, requires chromophore 3-hydroxyretinal.

Neuron 10(6):1113-1119.

204. Borowski T, Blomberg MR, & Siegbahn PE (2008) Reaction mechanism of

apocarotenoid oxygenase (ACO): a DFT study. Chemistry (Weinheim an

der Bergstrasse, Germany) 14(7):2264-2276.

176

205. Chander P, Gentleman S, Poliakov E, & Redmond TM (2012) Aromatic

residues in the substrate cleft of RPE65 protein govern retinol

isomerization and modulate its progression. The Journal of biological

chemistry 287(36):30552-30559.

206. Costas M, Mehn MP, Jensen MP, & Que L, Jr. (2004) Dioxygen activation

at mononuclear nonheme iron active sites: enzymes, models, and

intermediates. Chemical reviews 104(2):939-986.

207. Palozza P & Krinsky NI (1992) beta-Carotene and alpha-tocopherol are

synergistic antioxidants. Arch Biochem Biophys 297(1):184-187.

208. Spence EL, Langley GJ, & Bugg TDH (1996) Cis−Trans Isomerization of a

Cyclopropyl Radical Trap Catalyzed by Extradiol Catechol Dioxygenases:

Evidence for a Semiquinone Intermediate. Journal of the American

Chemical Society 118(35):8336-8343.

209. Rodieck RW (1998) The first steps in seeing (Sinauer Associates,

Sunderland Massachussets).

210. Burns ME & Baylor DA (2001) Activation, deactivation, and adaptation in

vertebrate photoreceptor cells. Annual review of neuroscience 24:779-

805.

211. McBee JK, Van Hooser JP, Jang GF, & Palczewski K (2001)

Isomerization of 11-cis-retinoids to all-trans-retinoids in vitro and in vivo. J

Biol Chem 276(51):48483-48493.

212. Lamb TD & Pugh EN, Jr. (2004) Dark adaptation and the retinoid cycle of

vision. Prog Retin Eye Res 23(3):307-380.

177

213. Wald G (1968) The molecular basis of visual excitation. Nature

219(156):800-807.

214. von Lintig J (2012) Metabolism of carotenoids and retinoids related to

vision. J Biol Chem 287(3):1627-1634.

215. Bernstein PS, Law WC, & Rando RR (1987) Isomerization of all-trans-

retinoids to 11-cis-retinoids in vitro. Proc Natl Acad Sci U S A 84(7):1849-

1853.

216. Rando RR (1991) Membrane phospholipids and the dark side of vision. J

Bioenerg Biomembr 23(1):133-146.

217. Ruiz A, et al. (1999) Molecular and biochemical characterization of lecithin

retinol acyltransferase. J Biol Chem 274(6):3834-3841.

218. Perry RJ & McNaughton PA (1991) Response properties of cones from

the retina of the tiger salamander. The Journal of physiology 433:561-587.

219. Baylor DA, Nunn BJ, & Schnapf JL (1984) The photocurrent, noise and

spectral sensitivity of rods of the monkey Macaca fascicularis. The Journal

of physiology 357:575-607.

220. Schnapf JL, Nunn BJ, Meister M, & Baylor DA (1990) Visual transduction

in cones of the monkey Macaca fascicularis. The Journal of physiology

427:681-713.

221. Mata NL, Ruiz A, Radu RA, Bui TV, & Travis GH (2005) Chicken retinas

contain a retinoid isomerase activity that catalyzes the direct conversion of

all-trans-retinol to 11-cis-retinol. Biochemistry 44(35):11715-11721.

178

222. Malchow RP & Yazulla S (1986) Separation and light adaptation of rod

and cone signals in the retina of the goldfish. Vision Res 26(10):1655-

1666.

223. Bilotta J, Saszik S, & Sutherland SE (2001) Rod contributions to the

electroretinogram of the dark-adapted developing zebrafish. Dev Dyn

222(4):564-570.

224. Suzuki SC, et al. (2013) Cone photoreceptor types in zebrafish are

generated by symmetric terminal divisions of dedicated precursors. Proc

Natl Acad Sci U S A 110(37):15109-15114.

225. Fadool JM (2003) Development of a rod photoreceptor mosaic revealed in

transgenic zebrafish. Dev Biol 258(2):277-290.

226. Isken A, et al. (2007) Sequestration of retinyl esters is essential for retinoid

signaling in the zebrafish embryo. J Biol Chem 282(2):1144-1151.

227. Westerfield M (1994) The zebrafish book : a guide for the laboratory use

of zebrafish (Brachydanio rerio) (M. Westerfield, Eugene, OR) p 2.1.

228. Morris AC, Schroeter EH, Bilotta J, Wong RO, & Fadool JM (2005) Cone

survival despite rod degeneration in XOPS-mCFP transgenic zebrafish.

Invest Ophthalmol Vis Sci 46(12):4762-4771.

229. Hauptmann G & Gerster T (1994) Two-color whole-mount in situ

hybridization to vertebrate and Drosophila embryos. Trends Genet

10(8):266.

179

230. Rinner O, Rick JM, & Neuhauss SC (2005) Contrast sensitivity, spatial

and temporal tuning of the larval zebrafish optokinetic response. Invest

Ophthalmol Vis Sci 46(1):137-142.

231. Schonthaler HB, et al. (2005) A mutation in the silver gene leads to

defects in melanosome biogenesis and alterations in the visual system in

the zebrafish mutant fading vision. Dev Biol 284(2):421-436.

232. Van Hooser JP, et al. (2002) Recovery of visual functions in a mouse

model of Leber congenital amaurosis. J Biol Chem 277(21):19173-19182.

233. Palczewska G, et al. (2010) Noninvasive multiphoton fluorescence

microscopy resolves retinol and retinal condensation products in mouse

eyes. Nat Med 16(12):1444-1449.

234. Saszik S, Bilotta J, & Givin CM (1999) ERG assessment of zebrafish

retinal development. Vis Neurosci 16(5):881-888.

235. Clark D (1981) Visual responses in developing zebrafish. Ph.D. (University

of Oregon).

236. Schmitt EA & Dowling JE (1999) Early retinal development in the

zebrafish, Danio rerio: light and electron microscopic analyses. J Comp

Neurol 404(4):515-536.

237. Kiser PD, Golczak M, & Palczewski K (2014) Chemistry of the retinoid

(visual) cycle. Chemical reviews 114(1):194-232.

238. Blaner WS, Das SR, Gouras P, & Flood MT (1987) Hydrolysis of 11-cis-

and all-trans-retinyl palmitate by homogenates of human retinal epithelial

cells. J Biol Chem 262(1):53-58.

180

239. Mata JR, Mata NL, & Tsin AT (1998) Substrate specificity of retinyl ester

hydrolase activity in retinal pigment epithelium. J Lipid Res 39(3):604-612.

240. Baylor DA, Lamb TD, & Yau KW (1979) The membrane current of single

rod outer segments. The Journal of physiology 288:589-611.

241. Winston A & Rando RR (1998) Regulation of isomerohydrolase activity in

the visual cycle. Biochemistry 37(7):2044-2050.

242. Stecher H, Gelb MH, Saari JC, & Palczewski K (1999) Preferential release

of 11-cis-retinol from retinal pigment epithelial cells in the presence of

cellular retinaldehyde-binding protein. J Biol Chem 274(13):8577-8585.

243. Saari JC, et al. (2001) Visual cycle impairment in cellular retinaldehyde

binding protein (CRALBP) knockout mice results in delayed dark

adaptation. Neuron 29(3):739-748.

244. Schonthaler HB, et al. (2008) The zebrafish mutant lbk/vam6 resembles

human multisystemic disorders caused by aberrant trafficking of

endosomal vesicles. Development 135(2):387-399.

245. Driessen CA, et al. (2000) Disruption of the 11-cis-retinol dehydrogenase

gene leads to accumulation of cis-retinols and cis-retinyl esters. Mol Cell

Biol 20(12):4275-4287.

246. Yamamoto H, et al. (1999) Mutations in the gene encoding 11-cis retinol

dehydrogenase cause delayed dark adaptation and fundus albipunctatus.

Nat Genet 22(2):188-191.

247. Nakamura M, Hotta Y, Tanikawa A, Terasaki H, & Miyake Y (2000) A high

association with cone dystrophy in Fundus albipunctatus caused by

181

mutations of the RDH5 gene. Invest Ophthalmol Vis Sci 41(12):3925-

3932.

248. Cideciyan AV, et al. (2000) Rod and cone visual cycle consequences of a

null mutation in the 11-cis-retinol dehydrogenase gene in man. Vis

Neurosci 17(5):667-678.

182