Paper Received: the Four Species Were Found to Be D
Total Page：16
File Type：pdf, Size：1020Kb
JEB Journal of Environmental Biology Website : www.jeb.co.in ISSN: 0254-8704 (Print) ISSN: 2394-0379 (Online) E-mail : [email protected] CODEN: JEBIDP Molecular phylogenetic analysis of mango mealybug, Drosicha mangiferae from Punjab Geetika Banta, Vikas Jindal*, Bharathi Mohindru, Sachin Sharma, Jaimeet Kaur and V.K. Gupta Insect Molecular Biology Laboratory, Department of Entomology, Punjab Agricultural University, Ludhiana - 141 004, India Corresponding Author Email: [email protected] Abstract Mealybugs (Hemiptera: Pseudococcidae) are major pests of a wide range of crops and ornamental plants worldwide. Their high degree of morphological similarity makes them difficult to identify and limits their study and management. In the present study, four Indian populations of mango Publication Info mealybug (mango, litchi, guava from Gurdaspur and mango from Jalandhar) were analyzed. The mtCOI region was amplified, cloned, the nucleotide sequences were determined and analysed. All Paper received: the four species were found to be D. mangiferae. The population from Litchi and Mango from 12 May 2014 Gurdaspur showed 100% homologus sequence. The population of Guava-Gurdaspur and Mango- Jalandhar showed a single mutation of 'C' instead of 'T' at 18th and 196 th position, respectively. Revised received: Indian populations were compared with populations from Pakistan (21) and Japan (1). The 13 April 2015 phylogenetic tree resulted in two main clusters. Cluster1 represent all the 4 populations of Punjab, India, 20 of Pakistan (Punjab, Sind, Lahore, Multan, Faisalabad and Karak districts) with Accepted: homologous sequences. The two population collected from Faisalabad district of Pakistan and Japan made a separate cluster 2 because the gene sequence used in analysis was from the COI-3p 22 April 2015 region. However, all the other sequence of D. mangiferae samples under study showed a low nucleotide divergence. The homologus mtCO1 sequence of Indian and Pakistan population concluded that the genetic diversity in mealybug population was quite less over a large geographical area. Keywords Diversity, Drosicha mangiferae, Mango mealybug, Phylogenetic tree Introduction Coccoidae is a serious, dilapidating, polyphagus, dimorphic and notorious pest of mango in India and neighboring Mango (Mangifera indica L.), known as the king of countries. Its nymphs and female bugs suck plant sap from fruits, is an important commercial crop grown in tropical and roots, tender leaves, petioles and fruits leading to fruit drop. sub-tropical countries (Abdullah and Shamsulaman, 2008). These bugs also exude sticky honey dew over the mango tree Mango crop is subjected to a number of diseases and insect leaves, on which sooty mold fungus develops which pests at all stages of its development i.e. from nursery to ultimately reduces the photosynthetic efficiency of tree consumption of fruits. The crop is attacked by about 492 (Pruthi and Batra, 1960 ). species of insects, 17 species of mites and 26 species of nematodes world wide of which 188 species have been reported All plant parts viz., trunk, branch, twig, leaf, petiole, from India (Tandon and Verghese, 1985; Srivastava, 1998). flower and fruit are attacked by different pests among which Among these, mealybugs (Hemiptera: Pseudococcoidae) are mealybugs are the important pest of mango. Twenty species important group of phytophagous insects that cause significant of mango mealybug have been reported of which D. Onlinemangiferae (G.), D. Copystebbingi (G.) and Rastrococcus damage worldwide (Miller et al., 2002). iceryoides (G.) are considered to be key destructive species Mango mealybug (Drosicha mangiferae), also of mangoes in subcontinent of South East Asia (Karar et al., known as giant mealy bug belonging to superfamily 2012). The mango mealybugs (R. iceryoides and R. invadens) © Triveni Enterprises, Lucknow (India) Journal of Environmental Biology, Vol. 37, 49-55, January 2016 50 G. Banta et al. have been reported on a number of economically important microcentrifuge tube. The suspension was incubated at 65°C plants causing economic damage in fruit crops, ornamental for 45 min and then thoroughly mixed with equal volume of plants and forest trees (Moore, 2004; Sundararaj and Devaraj, Sevag solution (chloroform: isoamyl alcohol:: 24:1) by 2010). vortexing. The suspension was centrifuged at 12,000 rpm for 5 min at room temperature. The upper aqueous layer was Identification of scale insects to the species level is carefully transferred to fresh microcentrifuge tube and the often challenging due to their small size. DNA barcoding is a extracted DNA was precipitated by adding equal volume of taxonomic system structured on sequence information from a ice-cold isopropanol in the presence of 1/10th volume of 2.5 short stretch of core DNA sequence (Santos and Faria, 2011). mM sodium acetate solution. The precipitated DNA was A region of approximately 658-bp of the mitochondrial gene collected in pellet by centrifugation. DNA pellet was washed cytochrome c oxidase I (COI) was proposed as the barcode with 70% ethanol, air dried at room temperature and source to identify and delimit all animal species (CBOL, dissolved in 100 ml TE (Tris EDTA, 100 mM) buffer Consortium for the Barcode of Life, available at containing DNAse free pancreatic RNAse (10 mg ml−1 ) and http://www.barcoding.si.edu/DNABarCoding.htm). It stored at −20 °C until used. The quality of isolated DNA was involves sequencing of this particular portion of DNA, determined using horizontal agarose (0.75% agarose followed by comparison with other sequences previously containing ethidium bromide 1 mg ml-1 ) gel electrophoresis in deposited in the database. Species are identified by matching 1× Tris–acetate–EDTA buffer at 75 V for 1 hr. DNA bands the obtained sequence with sequences of known identity were visualized and recorded using a UV Gel Documentation already in the database (Hebert et al., 2003). system (Ultra Cam). DNA barcoding, nucleotide sequencing of PCR amplification : Mitochondrial cytochrome oxidase I mitochondrial cytochrome oxidase I (mtCOI) gene, has been (mtCOI) gene region from total DNA of mealybug nymph also established as standard for species level identification of was PCR amplified with specific primers set (F- mealybugs. However, only few reports on molecular attcaaccaatcataaagatattgg and R taaacttctggatgtccaaaaaatca) identification, genetic relationships and species composition (Hajibabaei et al., 2006). Each PCR reaction mixture in mealybugs on various host plants across different consisted of insect DNA- 10 ng, primers (10 μM)- 1.0 μl each, geographical areas is available. Among mango mealybug, 10× Taq reaction buffer- 2.0 μl, Taq polymerase 2 U, 5 mM the ITS and CO1 gene of different mealybug species from dNTPs mix- 1.0 μl and distilled water to make- 20 μl. PCR Pakistan has been studied by Ashfaq et al. (2011). Keeping in amplification was accomplished in a programmable DNA view the severity of the problem and importance of molecular thermolcycler (Mastercycler Gradient, Eppendorf) using PCR techniques in identification of insects at species level as program: 95°C- 5 min (95°C- 1 min, 52°C- 1min, 72°C- 2 mentioned above, the present study was conducted to min)×30 cycles, 72°C-10 min, and stored at 4°C. PCR product genetically characterize the composition of mango mealybug was analyzed by horizontal agarose gel electrophoresis by co- species and asses the molecular phylogenetic relationship of running a molecular weight standard (100 bp DNA ladder mango mealybug, D. mangiferae infesting mango in Punjab plus, Fermentas, Life Sciences) along with the samples. and other parts of the world. Cloning and sequencing of mtCO1 gene : Amplified PCR Materials and Methods product was purified from agarose gel block using 'QIAquick Gel Extraction Kit' (Qiagen) as per manufacturer's protocol. Collection of mealybug population : The nymphal The purified DNA fragment was cloned in a sequencing populations of mango mealybug were collected from three different hosts viz., mango, litchi and guava from two vector pTZ57R/T using 'InsT/A Clone PCR product cloning locations of Punjab i.e. Gurdaspur (adjoining Pakistan kit' (Fermentas Life Sciences) and transformed into border) and Jalandhar (Table 1). The nymphs were preserved Escherichia coli DH5α host cells. Inserted DNA (amplified in absolute alcohol in glass vials (15mm dia and 50mm PCR product) in the respective recombinant clones was height) till further used for isolation of genomic DNA. custom sequenced for both strands, using sequencing services of M/S Xcelris (Ahmedabad, India). Final sequence Extraction of total DNA : Single individual nymph from of all the individual mtCOI gene fragments from mealybug each population was thoroughly washed with sterile double populations were edited using DNA software Chromaslite distilled water followed by 90% ethanol. The genomic DNA 201 and CLC Sequence Viewer 6.5.4 (CLC bio A/S) and was extracted from single nymph using standardOnline cetyl submitted to BOLD databaseCopy and GenBank (Table 1). trimethyl ammonium bromide (CTAB) method (Cubero et al., 1999). Two nymphs from each population were used as Molecular analysis of mtCOI sequences for genetic two replications. The nymph was ground with a micropestle variation and phylogeny: All the mtCO1 sequences in the presence of 0.5 ml of 2% CTAB buffer in 1.5 ml representing four different populations were aligned using CLC Journal of Environmental Biology, January 2016 Molecular phylogenetic analysis of mango