Towards Cloning the Self-Incompatibility Genes
from Phalaris coerulescens
by
Xue-Yu Bian
A thesis submitted for the Degree of Doctor of Philosophy in the Faculty of Agricultural and
Natural Resource Sciences at Adelaide University
Department of Plant Science
Adelaide University
October 2001 Bian, X.-Y. 2001, Ph. D Thesis, The University of Adelaide. ii
A confocal picture showing the interaction between Phalaris pollen and stigma
Towards cloning the self-incompatibility genes from Phalaris coerulescens iii
TABLE OF CONTENTS
Abstract vii
Declaration viii
Acknowledgements ix
List of abbreviations xi
Chapter 1 Literature review 1
1.1 Self-incompatibility 3
1.2 Molecular advances in sporophytic self-incompatibility 5
1.3 Molecular advances in gametophytic self-incompatibility 7
1.3.1 S-RNase self-incompatibility system 8
1.3.2 Self-incompatibility in Papaveraceae 9
1.4 Self-incompatibility in Poaceae 10
1.4.1 A unique S-Z self-incompatibility system 11
1.4.2 Self-incompatibility reaction of the grasses 14
1.5 Strategies adopted to clone self-incompatibility genes 16
1.6 P. coerulescens as a model system for study of self-incompatibility in grasses 18
1.7 Aims 20
Chapter 2 General materials and methods 21
2.1 Materials 22
2.1.1 Plant materials 22
2.1.2 Reagents 22
2.2 Methods 23 Bian, X.-Y. 2001, Ph. D Thesis, The University of Adelaide. iv
2.2.1 General molecular methods 23
2.2.2 Genomic DNA protocols 24
2.2.3 RNA protocols 26
2.2.4 Plasmid protocols 27
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 31
3.1 Introduction 32
3.2 Materials and methods 33
3.2.1 Materials 33
3.2.2 Northern blot analysis 33
3.2.3 Preparation of Bm2 fusion protein 33
3.2.4 Western blot analysis 34
3.2.5 Cloning of cDNA homologues of Bm2 from the pollen-only mutants 37
3.2.6 Analysis of the S-linked thioredoxin sequence 37
3.3 Results 39
3.3.1 Mutations in pollen-only mutants are independent of Bm2 39
3.3.2 Functional prediction of Bm2 46
3.4 Discussion 48
Chapter 4 Genetic localisation of the S and Z loci 51
4.1 Introduction 52
4.2 Materials and methods 53
4.2.1 Mapping populations 53
4.2.2 Sources of RFLP probes 53
4.2.3 Parental screening and progeny segregation analysis 54 Towards cloning the self-incompatibility genes from Phalaris coerulescens v
4.2.4 Genotyping identified recombinants 55
4.2.5 Identification of AFLP markers closely linked to Z 57
4.3 Results 58
4.3.1 Parental screening and cross hybridisation tests 58
4.3.2 Segregation analysis and map construction 61
4.3.3 Distribution of recombinations in the S and Z tester populations 67
4.3.4 Fine mapping of the S and Z loci 67
4.3.5 Genotype confirmation of the critical recombinants between the flanking markers of
S and Z using pollination test 73
4.4 Discussion 75
4.4.1 Segregation distortion mapping 75
4.4.2 Genetic locations of S and Z 76
4.4.3 Theoretical analysis of the genetic and physical ratios around the S and Z loci 77
Chapter 5 Analysis barley and rice BAC clones orthologous to the S and Z regions 82
5.1 Introduction 83
5.2 Materials and Methods 85
5.2.1 Screening the barley BAC library 85
5.2.2 BAC plasmid extraction 86
5.2.3 Dot blot analysis of BAC clones 86
5.2.4 Southern fingerprinting analysis of BAC clones 86
5.2.5 Pulse field gel electrophoresis (PFGE) 87
5.2.6 Sample sequencing of Bm2 positive barley BAC clones 87
5.2.7 BLAST search NCBI databases 88
5.3 Results 88 Bian, X.-Y. 2001, Ph. D Thesis, The University of Adelaide. vi
5.3.1 Identification of barley BAC clones that hybridise to Bm2 and BCD266 cDNA
probes 88
5.3.2 Analysis of barley BAC clones orthologous to the S region 88
5.3.3 Overlapping and sub-cloning analysis of BAC clones orthologous to the Z region
96
5.3.4 Identification of rice BAC clones orthologous to the S and Z regions 100
5.4 Discussion 103
5.4.1 Limited usefulness of the barley BAC clones identified in this study 103
5.4.2 Identification of rice clones orthologous to the S and Z regions 106
Chapter 6 General discussion 110
Appendices 118
References 129
Towards cloning the self-incompatibility genes from Phalaris coerulescens vii
Abstract
Self-incompatibility (SI) is an important genetic mechanism to prevent the inbreeding of flowering plants and also an excellent system for studying cell-cell recognition and signal transduction. During evolution, several SI systems have been evolved. A unique SI system widely spreads in the grasses. In the grasses, two unlinked, multi-allelic loci (S and Z) determine
SI specificity. A putative self-incompatibility gene (Bm2) was previously cloned. In this study, the role of Bm2 in self-incompatibility was investigated first. The cDNA homologues of Bm2 were sequenced from two pollen-only mutants. The results indicated that Bm2 is not the one of
SI genes in Phalaris, but represents a subclass of thioredoxin h. Thus a map-based cloning strategy was then adopted to clone the SI genes from Phalaris. Fine linkage maps of the S and Z regions were constructed. RFLP probes from wheat, barley, oat and rye were screened and the S locus was delimited to 0.26 cM and the Z locus to 1.0 cM from one side using specially designed segregating populations. The S locus was located to the sub-centromere region of triticeae chromosome group 1 and the Z locus to the middle of the long arm of group 2. Finally, barley and rice bacterial artificial chromosome (BAC) clones corresponding to the S and Z region were identified to analyse the chromosome structures and to seek candidate SI genes. The abundant repetitive sequences in the identified barley BAC clones limit their usefulness. Identification of
Rice BAC clones orthologous to the S and Z regions open the gate to use rice genome information to clone SI genes from the grasses. A positive rice clone (139.9 kb) orthologous to the S region contained 19 predicted genes. Several of these genes might be involved in pollen tube germination and pollen-stigma interaction, which are the major parts of SI reaction. A positive clone (118.9 kb) orthologous to the Z region gave 16 predicted genes. The predicted genes on the outmost ends of these clones could be used to construct contigs to cover the S and Z regions and delimit the S and Z loci in the grasses. Bian, X.-Y. 2001, Ph. D Thesis, The University of Adelaide. viii
Declaration
The thesis contains no material which has been accepted for the award of any other degree or diploma in any university or other tertiary institute and that, to the best of my knowledge and belief, the thesis contains no material previously published or written by another person, except where due reference is made in the text of the thesis.
I give consent to this copy of my thesis, when deposited in the University Library, being available for loan and photocopying.
Xueyu Bian
October, 2001 Towards cloning the self-incompatibility genes from Phalaris coerulescens ix
Acknowledgements
I thank my supervisors, Prof. Peter Langridge and Dr Susan Barker for their care, encouragement and push, especially to Prof. Peter Langridge, who gave me the freedom to select my Ph. D. project. Many thanks are given to all the colleagues in the laboratory of
Prof. Peter Langridge and in Department of Plant Science for their help not only with the lab work but in all areas of life.
Thanks are given to Dr X. Li for providing the original Bm2 cDNA clone, its thioredoxin domain construct in pQE31 vector and rabbit polyclonal antiserum raised against the thioredoxin fusion protein; to Mr J. Juttner for providing some primers used for RT-PCR and two wild type cDNA sequences of the S linked thioredoxin; to Dr Chongmei Dong for her help in western analyses; to
Dr A. Harvey for his help with functional prediction of the S linked thioredoxin; to Dr D.
Hayman (Adelaide University, Australia) for providing the seeds of the S and Z tester populations and genotyping some of the potential recombinants, Mr Brendon King for his help with screening the barley BAC library.
The author would also like to thank Ms A. Friedrich, an honours student from Bonn University,
Germany, who took part in the project of mapping of the S and Z loci. Ms Friedrich helped to extract 273 DNA samples of the S tester population, screened some of the RFLP probes used in this thesis and provided some Southern data for mapping, which are indicated by underline in the partial linkage groups of S and Z. Ms Friedrich participated in the screening of the BAC library with Bm2 as well. Thanks are given to Ms J. Bai, a visiting scholar from Shanxi Agricultural
Research Academy, China, who helped to confirm the AFLP primer combinations on the parents and recombinants.
Bian, X.-Y. 2001, Ph. D Thesis, The University of Adelaide. x
I give my special thanks to the following scientists for their encouragement and kindness in provision of RFLP probes: Dr F.C.H. Franklin and Dr M. Gale from the United Kingdom; Dr P.
Wehling from Germany, Dr K. Hatakeyama and Dr M. Kussaba from Japan and Dr E. Newbigin from Australia.
Finally, I give thanks to my family, especially to my wife. Without their encouragement and love, this thesis could not be finished.
This work was supported by an Australian Overseas Postgraduate Research Scholarship and an
Adelaide University Scholarship.
Towards cloning the self-incompatibility genes from Phalaris coerulescens xi
List of abbreviations aa amino acid
ATP adenosine 5’-triphosphate
BAC: bacterial artificial chromosome
BCIP: 5-bromo-4-chloro-3-indolyl phosphate
BLAST: Basic Local Alignment Search Tool bp: base pair
BSA: bovine serum albumin
ºC: degree centigrade cDNA: complementary deoxyribonucleic acid
CHEF: contour-clamped homogeneous electric field
Ci: Curie
Da: Dalton dATP: 2’-deoxyadenosine 5’- triphosphate dCTP: 2’-deoxycytidine 5’- triphosphate
DEAE: diethylaminoethyl
DEPC: diethyl pyrocarbonate dGTP: 2’-deoxyguanosine 5’- triphosphate
DMF: dimethyl formamide
DMSO: dimethyl sulfoxide
DNA: deoxyribonucleic acid dNTPs: deoxyribonucleoside triphosphates
DTT: dithiothreitol dTTP: 2’-deoxythymidine 5’- triphosphate
EDTA: ethylene diamine tetraacetate acid
Bian, X.-Y. 2001, Ph. D Thesis, The University of Adelaide. xii
EMBL: European Molecular Biology Laboratory g: gram
HEPES: N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid
IPTG: isopropyl β-D-thiogalactopyranoside kb: kilobase kda: kiloDalton
M: molar
MOPS: 3-(N-morpholino) propane-sulfonic acid mRNA: messenger ribonucleic acid
NBT: nitroblue tetrazolium
OD600 optical density at 600 nm
ORF: open reading frame
PAC: P1-derived artificial chromosome
PAGE: polyacrylamide gel electrophoresis
RFLP: restriction fragment length polymorphism
RNA: ribonucleic acid
RNase: ribonuclease rpm: revolutions per minute rRNA: ribosomal ribonucleic acid
PFGE: pulsed-field gel electrophoresis
PMSF: phenylmethylsulfonyl fluoride
PVP: polyvinyl-polypyrrolidone
SDS: sodium dodecyl sulfate
SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis
Taq: Thermus aquaticus DNA (polymerase)
Towards cloning the self-incompatibility genes from Phalaris coerulescens xiii
TrisּCl tris(hydroxymethyl)aminomethane hydrochloride
UV: ultroviolet w/v: weight /volume
X-gal: 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside
YAC: yeast artificial chromosome
Chapter 1
Literature review
A self-incompatible grass species
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 2
Chapter 1 Literature review
The life cycle of a flowering plant alternates between a haploid generation (called the gametophyte) and a diploid generation (called the sporophyte). Via meiosis, mother spore cells produce haploid spore cells, which undergo cell proliferation and differentiation to develop into gametophytes. The female gametophyte is the product of the ovary, which together with the style and stigma comprises the pistil. The male gametophyte is the pollen, which is released from the anther when it matures (Raven et al., 1992). A complex set of cell- cell interactions is required to achieve fertilization. The pollen grain must be recognized by the pistil, take up water, and grow a pollen tube directionally through the style in order to deliver the sperm to the ovule (Gaude and McCormick, 1999).
Plants have a variety of mechanisms to distinguish pollen to ensure that only a certain kind of pollen can germinate on their stigmas. A pollen grain might be rejected, as it is genetically too different from the pistil. On the other hand, a pollen gain might be rejected as well as it is too closely related to the pistil. The later kind of recognition is called self-incompatibility
(SI). Self-incompatible flowering plants, while possessing normal male and female gametes, fail to form zygotes after self-pollination and cross-pollination with certain other plants of the same species.
Several reasons make SI a major focus of both genetic and molecular research. SI is an important genetic mechanism preventing inbreeding and gene pool simplification. SI Chapter 1 Literature review 3 provides an excellent system for studying cell-to-cell recognition and signal transduction. In addition, a good understanding of SI systems might enable plant breeders to produce hybrid varieties more easily (Franklin et al., 1995).
In this Chapter, the recent advances in molecular study of SI are reviewed. The genetic and molecular studies on SI in the grasses are discussed intensively, and strategies of cloning self- incompatibility genes are reviewed. Finally, the advantages of using Phalaris coerulescens as a model for the study of SI in the grasses are discussed.
1.1 Self-incompatibility
SI in flowering plants has been known for over a century. Darwin (1876) described it as a fascinating phenomenon. One-third to one-half of all flowering plant species have been reported as self-incompatible (Brewbaker, 1959). Before the 1990s, the studies had been focused on genetics of SI (Lewis, 1979; de Nettancourt, 1977). Since the 1990s, SI studies were focussed on the cloning of SI genes (Franklin et al., 1995; McCormick, 1998). Now, the research focus has turned to the understanding of molecular mechanisms of SI (Jordan et al.,
2000b; Nasrallah et al., 2000).
In the course of evolution, several different SI systems have been selected (Franklin et al.,
1995). According to the specificity determined by the diploid genotype of the pollen mother cells or the haploid genotype of the pollen, self-incompatibility can be classified into two major groups, sporophytic self-incompatibility (SSI) and gametophytic self-incompatibility
(GSI) respectively (Lewis, 1979). In the SSI systems, incompatibility occurs when either
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 4 allele in the pistil is the same as either allele in the pollen mother cells. In the GSI systems, any pollen that has the same allele as a pistil allele is incompatible.
The number of the loci determining SI specificity (called the S locus) varies from one system to another as well. In most species, regardless of whether SSI or GSI is displayed, a single multi-allelic locus determines self-incompatibility, for example, Brassicaceae (Bateman,
1955), Solanaceae (Tanksley and Loaiza Figueroa, 1985) and Papaveraceae (Lawrence et al.,
1978). In the Poaceae system, two multi-allelic loci, S and Z, are involved (Lundqvist, 1954;
Hayman, 1956). Sugar beet might have up to four multi-allelic loci determining self- incompatibility (Larsen, 1977).
Based on identification of pollen-only (pollen-part) and stigma-only (stigma-part) self- compatible mutants from Onagraceae and Rosaceae, Lewis (1951) first speculated that the S locus has three separate but closely linked parts: an S allele specificity part, a pistil activity part and a pollen activity part. Pollen-only mutation means that the pollen has lost its SI specificity whereas it is retained in the stigma of the same plant. Stigma-only mutation means that the stigma has lost it SI specificity whereas it is retained in the pollen of the same plant.
Pollen and stigma-only mutants were identified in a number of species (see review of
Franklin et al., 1995). It has been common accepted now that the S locus consists of the pollen S and stigma S genes that are very closely linked but discrete genes.
Self-incompatibility arose later than the separation of different families. Bateman (1952) argued that self-incompatibility systems arose independently many times with angiosperms.
The Brassicaceae and Convolvulaceae belong to sporophytic SI system, but different molecular mechanisms are involved (Kowyama et al., 2000). The closely related families Chapter 1 Literature review 5 also do not share the same system of self-incompatibility. The two close families, Solanaceae and Convolvulaceae are belonging to gametophytic and sporophytic system respectively and there is no evidence that they share the same molecular mechanism (Kowyama et al., 2000).
This is the reason why an S gene cloned from one SI system might not help cloning other S genes from different families. However, S-RNases are responsible for SI in three distantly related families, Solanaceae, Scrophulariaceae and Rosaceae (Igic and Kohn, 2001).
Self-incompatibility has been intensively reviewed recently. Matton et al. (1994) and Franklin et al. (1995) reviewed the recent genetic and molecular advances in SI studies, and these could be regarded as the introductory reviews on the topic.
1.2 Molecular advances in sporophytic self-incompatibility
Sporophytic SI has been found in Brassicaceae, Asteraceae and Convolvulaceae families
(Nettancourt, 1977). This kind of SI system is associated with dry papillate stigmas and tri- nucleate pollen and the self-pollen is inhibited before or just after germination (Heslop
Harrison and Shivanna, 1977). Most studies on molecular aspects of sporophytic SI have focused on species in Brassica. SI in Brassica is controlled by a multi-allelic locus (Bateman,
1955). Several genes involved in SI have been identified at this locus. Recent major progress in understanding SI has been made and reviewed in this family (Brugiere et al., 2000; Dixit and Nasrallah, 2001).
The first putative S gene, the S-locus glycoprotein gene (SLG), encodes a 55 kDa glycosylated polypeptide secreted into the papillary cell wall (Nasrallah et al., 1985). Even though the
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 6 direct involvement of SLG in self-incompatibility is questioned by recent findings (Cock et al., 2000), it did provide a starting point for the molecular study of SI in Brassica.
A major development in the study of SI in Brassica was the discovery of the S-receptor kinase gene (SRK) (Stein et al., 1991). This gene is predicted to encode a trans-membrane protein consisting of three domains: an extracellular domain with the recognition function for the S specificity, a single trans-membrane region and a cytoplasmic domain sharing homology with serine/threonine receptor kinases. By transforming self-incompatible plants of B. rapa with the SRK28 and SLG28 genes separately, Takasaki and co-workers (2000) showed that
SRK alone determines S haplotype specificity of the stigma, and that SLG acts to promote a full manifestation of the self-incompatibility response.
Nearly ten years after the cloning of SRK, the Brassica pollen S gene was cloned. Suzuki and his coworkers (1999) first put forward several candidate pollen S genes. Only a few months later, Schopfer et al. (1999) found a polymorphic, anther-expressed gene, which was named as SCR (S locus cysteine-rich). Loss-of-function and gain-of-function studies proved that the
SCR gene product is necessary and sufficient for determining pollen self-incompatibility specificity, possibly by acting as a ligand for the stigmatic receptor kinase (SRK)(Schopfer et al., 1999).
The identification of the substrate of SRK was a further major step in the study of SI. Stone and coworkers (1999) reported that a putative downstream effector for SRK is ARC1 (arm repeat protein), a protein that binds to the SRK kinase domain. The report showed that suppression of ARC1 mRNA levels in the self-incompatible B. napus W1 line is correlated with a partial breakdown of self-incompatibility, resulting in seed production. This provided Chapter 1 Literature review 7 strong evidence that ARC1 is a positive effector of the Brassica self-incompatibility response.
How do these genes interact with each other? Franklin-Tong and Franklin (2000) proposed a model for the Brassica SI reaction. They suggested that SCR was recognised by the extracellular region of the S receptor kinase (SRK), which resulted in activation of its intracellular Ser/Thr protein kinase domain. After activation, SRK phosphorylates ARC1, presumably initiating an intracellular signalling cascade within the papilla cell. It has been proposed that the signalling pathway might ultimately regulate the activity of aquaporins
(Dixit et al., 2001) in the stigmatic papillae to limit the availability of water to the incompatible pollen.
1.3 Molecular advances in gametophytic self-incompatibility
Gametophytic SI systems have been described in more than 60 families, including the
Solanaceae, Rosaceae, Scrophulariaceae, Papaveraceae and Poaceae (Gaude and McCormick,
1999; Newbigin et al., 1993). Recent studies of the Solanaceae, Rosaceae and
Scrophulariaceae suggest that they all share a similar self-incompatibility system (McCubbin and Kao, 1999). Papaveraceae and Poaceae appear to belong to two distinct self- incompatibility systems (Hayman, 1992a; Lawrence et al., 1978).
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 8
1.3.1 S-RNase self-incompatibility system
Unlike the sporophytic SI system, the stigmatic surface of Solanaceae is wet, growth of self- pollen tubes is retarded in the style and the tips of the pollen tubes often swell or burst (see review by Sims, 1993). The first breakthrough in identification of the S gene in the
Solanaceae came from the correlation of pistil proteins with S alleles in Nicotiana alata
(Bredemeijer and Blaas, 1981). The isolation and characterization of the S-protein led to the cloning and sequencing of the first S gene in N. alata (Anderson et al., 1986). Subsequently, a large number of cDNAs encoding the S proteins have been cloned (Ai et al., 1990; Ioerger et al., 1990). Sequence comparison has revealed that the S genes have five highly conserved regions (C1 to C5) and two highly variable regions (HVa and HVb) (Ioerger et al., 1991).
Two conserved regions show high homology with ribonuclease T2 of Aspergillus oryzae, and ribonuclease Rh of Rhizopus niveus (McClure et al., 1989).
Several pieces of evidence suggest that the S-RNase is required for the SI response. First, the
S-RNase was taken up by pollen tubes, and the S-allele specific degradation of pollen RNA occurred in vivo (Gray et al., 1991; McClure et al., 1990). Second, transformation experiments showed that the S-RNase controlled the self-incompatibility behaviour of the pistil (Lee et al., 1994). Inhibition of S3 protein synthesis in Petunia inflata plants of S2S3 genotype by the antisense S3 resulted in failure of the transgenic plants to reject S3 pollen.
Transgenic plants (the S1S2 genotype) that expressed S3 protein were able to reject S3 pollen
(Lee et al., 1994).
In contrast to the successful cloning of S-RNase (the stigma S-gene), the pollen S gene is still unknown. There are reports that there is little recombination around the S locus (Li et al.,
2000; McCubbin and Kao, 1999). Attempts have been made to use a map-based cloning Chapter 1 Literature review 9 strategy to find the pollen S genes. A BAC library of P. inflata was constructed as a tool to identify the pollen S gene (McCubbin et al., 2000). Harbord et al. (2000) suggested that using selectable markers in coupling with a functional S-allele would allow the pre-selection of recombination events around the S locus in Petunia.
In contrast to the SI system in the Brassica, the mechanism of SI in Solanaceae acts through a cytotoxic mechanism directly against pollen RNA (McClure et al., 1990), which stops self- pollen tube growth. As the pollen component of this system is unknown, two models were proposed: namely, that pollen S either acts as a gatekeeper allowing only its cognate S-RNase to enter the pollen tube; or that it acts as an inhibitor of non-cognate S-RNases (Kao et al.,
1996). Luu and his coworkers (2000) found accumulation of an S-RNase in the cytoplasm of all pollen-tube haplotypes using immunocytochemical labelling of pollen tubes growing in styles. This result provided experimental support for the inhibitor model.
1.3.2 Self-incompatibility in Papaveraceae
SI in Papaveraceae is gametophytic and controlled by a single, multi-allelic locus (Lawrence et al., 1978). However, it operates via a different mechanism to that of Solanaceae (Franklin
Tong et al., 1991). Using an in vitro pollen culture system for Papaver rhoeas (Franklin
Tong et al., 1988), a basic glycoprotein was identified, which exhibited the specific activity expected for the self-incompatibility gene product (Franklin Tong et al., 1989). Using oligonucleotides based on the N-terminal amino acid sequence of the S proteins, an S1 cDNA was cloned and showed complete linkage with the S locus (Foote et al., 1994). The recombinant S1 protein (S1e) produced in E. coli inhibited growth of S1 pollen in vitro, whereas it had no effect on non-S1 pollen. The amino acid sequences of the two S proteins
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 10 cloned from Papaver share 55.8% homology, having nine conserved regions interspersed with short variable regions (Walker et al., 1996). Several amino acid residues were identified in the predicted hydrophilic loop 6 of the P. rhoeas stigmatic S1 protein that are involved in the inhibition of S1 pollen (Kakeda et al., 1998). Mutations in this loop resulted in the complete loss of ability of the S protein to inhibit S1 pollen. This demonstrated that these residues play a crucial role in pollen recognition and may also participate in defining allelic specificity.
A model for the mechanism of SI response in Papaver was proposed (Franklin Tong et al.,
1992). The stigmatic glycoproteins act as signal molecules, which interact with receptors (the pollen component) on the pollen tube. Although, the pollen S gene has still not been identified, considerable information has been accumulated on the SI reaction. Rapid and transient phosphorylation in pollen proteins of P. rhoeas following contact with incompatible stigma suggests a role of protein kinase and phosphatases in the pollen-stigma interaction
(Rudd et al., 1997; Rudd et al., 1996). Snowman et al. (2000) reported that the actin cytoskeleton of incompatible pollen tubes was dramatically rearranged. DNA fragmentation was also reported in incompatible pollen after challenge with S proteins (Jordan et al., 2000a).
All information indicates a complex signaling pathway involved in the Papaver SI reaction.
1.4 Self-incompatibility in Poaceae
The grass family (Poaceae) is one of the most important plant families, including the cereal crops, sugar cane and many important forage crops (Watson, 1990). Self-incompatibility has been known in the grass family for a long time. At present, self-incompatible or predominantly cross-fertilizing species have been identified in five subfamilies of Poaceae Chapter 1 Literature review 11
(Baumann et al., 2000; Connor, 1979). There are 26 genera found to be self-incompatible or predominantly cross-fertilizing in Pooideae, 13 in Panicoideae, 5 in Chloridoideae, 2 in
Arundinoideae and 1 in Bambusoideae.
1.4.1 A unique S-Z self-incompatibility system
1.4.1.1 The detection of the S-Z system
The existence of a distinct self-incompatibility system in the grasses has been observed in many species. Lundqvist (1954) first reported that self-incompatibility of Secale cereale was under the gametophytic control of two unlinked multi-allelic loci, S and Z. Two years later,
Hayman (1956) confirmed the S-Z system in Phalaris. Now, the S-Z system has been found in eight species and might be present in a further eight (Table 1.1). The genetic studies are confined so far to the tribes of Aveneae, Poeae, and Triticeae, which belong to the Pooideae subfamily. Consequently, there is no literature on the genetics of self-incompatibility in other subfamilies. Whether the mechanism of self-incompatibility in this large family is a common one remains unclear.
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 12
Table 1.1 Genetic studies of incompatibility in grasses (Hayman, 1992)
Species Tribe References
Species in which the S-Z system has been identified Briza media Poeae Murray (1974) Dactylis aschersoniana Poeae Lundqvist (1965) Festuca pratensis Poeae Lundqvist (1955) Lolium perenne Poeae Cornish et al. (1979) Lolium multiflorum Poeae Fearon et al. (1983) Phalaris coerulescens Aveneae Hayman (1956) Secale cereale Triticeae Lundqvist (1954) Hordeum bulbosum Triticeae Lundqvist (1962a)
Species in which a gametophytic system has been identified Alopecurus myosuroides Aveneae Leach and Hayman (1987) Alopecurus pratensis Aveneae Weimarck (1968) Arrhenatherum elatius Aveneae Weimarck (1968) Deschampia flexuosa Aveneae Weimarck (1968) Holcus lanatus Aveneae Weimarck (1968) Phalaris arundinacea Aveneae Weimarck (1968) Cynosurus cristatus Poeae Weimarck (1968) Festuca rubra Poeae Weimarck (1968)
1.4.1.2 Features of the S-Z system
There are several important features of the grass SI system.
1. There is complementary interaction between S and Z alleles. A pollen grain is
incompatible when both its S and Z alleles are matched in the recipient pistil. A pollen
grain is compatible and fully functional with only an S or Z gene in common with the
stigma (Hayman, 1992).
2. There are reciprocal differences in the compatibility between parents (Leach, 1988).
The S1S1Z1Z2 × S1S2Z1Z2 is 50% compatible, while the reciprocal cross S1S2Z1Z2 ×
S1S1Z1Z2 is fully incompatible. The compatible degree can be 100% compatible
(S1S2Z1Z2 × S3S4Z3Z4), 75% compatible (S1S2Z1Z2 × S2S3Z2Z3), 50% compatible
(S1S2Z1Z2 × S1S3Z1Z2) and 0% compatible (S1S2Z1Z2 × S1S1Z1Z2). Chapter 1 Literature review 13
3. Polyploid grasses are as self-incompatible as their diploid relatives and parents. Only
one S-Z pair of alleles in the diploid pollen of tetraploid grasses need be matched in
recipient pistil for the self-incompatibility reaction to occur (Fearon et al., 1984;
Lundqvist, 1957).
1.4.1.3 Genetic locations of S and Z
Markers or genes that are closely linked to either S or Z will show disturbed segregation in crosses where the pollen is only partially compatible with the stigma due to gametic selection.
Analysis of such crosses allows the identification of markers or genes linked to S or Z and the locations of self-incompatibility loci may be inferred from the linked markers or genes.
Leach (1988) described the statistical methods that can be used to analyse such disturbed segregation populations.
Cornish and his co-workers (1980) found linkage between S and the isoenzyme, phosphoglycoisomerase (PGI-2) in Lolium perenne. This linkage was also found in P. coerulescens, Festuca pratensis and S. cereale (Leach and Hayman, 1987). The S locus was located on chromosome 6 in Lolium and 1R in rye by linkage to PGI-2 and a leaf peroxidase
(Prx-7) (Lewis et al., 1980; Wricke and Wehling, 1985). For Z, linkage was found with the beta-glucosidase locus on chromosome 2R, with a recombination value of 14.4% (Gertz and
Wricke, 1989). Recently, the linkages between S and restriction fragment length polymorphism (RFLP) markers Xiag249 (2.7 cM) and Xpsr544 (4.5 cM) were described in rye by Senft and Wricke (1996). These two markers are located on chromosome 1R supporting the earlier work with isozymes. Voylokov and his co-workers (1998) reported that
S was closely linked to Xpsr634 on 1R and Z to Xbcd266 on 2R in S. cereale. Similar results were obtained in H. bulbosum (Kakeda, pers. comm. 2000). The linkage data therefore show
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 14 similar genetic organization of the S and Z loci in several grass genera. This suggests that the grasses might share a common and orthologous SI system at least in the Pooideae subfamily.
1.4.1.4 The Structure of S and Z loci
From the lesson of the single locus self-incompatibility systems, SI loci might at least contain pollen and stigmas S genes, which are physically linked. The genetic analysis of mutations, which result in break down of the self-incompatibility system, gives clues on the genetic structure of the S and Z loci. Lundqvist (1958, 1962b, 1968) carried out a series of studies in
S. cereale and identified a number of self-compatible mutants. He confirmed that at least two classes of mutants were “pollen-only” and occurred either at S or Z. The pollen-only mutants show loss of their self-incompatible function in pollen but retain the self-incompatible function in stigma. Varieties of pollen-only mutants were also identified from mutant trap experiments (Hayman and Richter, 1992) at the S and Z loci in P. coerulescens. No stigma- only mutants could be identified due to the characteristic of the mutant trap experiments.
1.4.2 Self-incompatibility reaction of the grasses
Several attempts have been made to understand the mechanism of self-incompatibility in grasses. Heslop-Harrison (1982) put forward a general hypothesis on the self-incompatibility reaction of grasses.
1. Pistil incompatibility factors are proteins (probably glycoproteins), with lectin-like
properties, present in the stigma surface secretions and in the transmitting tracts.
2. The binding specificity of these factors are such that they are complementary to sugar
sequences or arrays displayed by wall carbohydrate in the growth zone of
incompatible pollen tubes, but not complementary to those present in compatible
tubes. Chapter 1 Literature review 15
3. Binding at the tip of an incompatible pollen tube leads to a disruption of apical growth
by preventing the dissociation of the polysaccharide content of the wall precursor
bodies and interfering with the extension of polysaccharide micro-fibres in the sub
apical zone
A third locus, named T, affects self-incompatibility as well. Lundqvist (1968) suggested that self-fertility in rye might result from mutations at a locus other than S and Z. This suggestion was confirmed in L. perenne (Thorogood and Hayward, 1992), P. coerulescens (Hayman and
Richter, 1992) and S. cereale (Voylokov et al., 1993). The third locus was found linked to the
Esterase 5-7 gene complex from chromosome 5R in rye (Fuong et al., 1993). Hayman (1992) argued that there was no allelic variability at T as there had never been any evidence of more than two loci controlling the specificity of self-incompatibility. The author put forward two hypotheses on the function of the third locus. This locus might have formerly shown allelic variability and contributed to the specification of the pollen and style, but became fixed and is now silent. An alternative hypothesis was that the function of the third locus was not connected with specific recognition but was required for signal transduction in self- incompatibility reaction.
Wehling et al. (1994a) suggested that pollen protein phosphorylation was part of the signal transduction pathway of self-incompatibility in rye. A higher protein phosphorylation activity in germinated pollen was detected in the treatment of self-incompatible stigmatic extract than that of self-compatible. Separation of phosphorylated pollen proteins by SDS-PAGE revealed four major proteins in the MW range of 43-82 kDa that were differently phosphorylated in self-incompatible and self-compatible genotypes. These results led Wehling et al. (1994a) to
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 16 propose a model for a grass self-incompatibility that the stigma self-incompatibility components (acting as ligands) interact with their specific pollen receptors.
There are genetic and environmental factors affecting self-compatibility. It is a common observation that a small number of seeds are obtained in many self-incompatible grass species after self-pollination (Hayman, 1992a). The partial breakdown of self-incompatibility is referred to as pseudo-compatibility. Pseudo-compatibility has been investigated in S. cereale and F. pratensis (Lundqvist, 1958; Lundqvist, 1964). The author observed that the amount of seed set decreased with increased homozygosity at S or Z. Also there was a rank in the individual genes or gene pairs in their capacity to self-pollinate. Consistent results were observed in that S1 was more pseudo-compatible than S2, and Z3 more than Z4. Apart from genetic factors, environmental factors, such as high temperature and relative humidity, also cause pseudo-compatibility (Wilkins and Thorogood, 1992; Wricke, 1978). Normal seed set in the field of about 1% could be increased to 25% if temperatures reach as high as 30 to 35°C during flowering. The highest seed set was obtained if plants were exposed to high temperatures together with 60-80% relative humidity 2 to 4 days before anthesis. The relevance of the environmental interaction is unclear but may be due to direct inhibition of the
SI mechanism.
1.5 Strategies adopted to clone self-incompatibility genes
Self-incompatibility genes to date were mainly cloned by knowing their protein sequences.
The first putative SI gene was cloned from N. alata stylar-expressed cDNA libraries using oligonucleotides complementary to the N-terminal end of the purified S glycoprotein
(Anderson et al., 1986). A similar strategy was used to clone the S gene from P. rhoeas (Foote Chapter 1 Literature review 17 et al., 1994). However, the attempt to correlate the stylar protein patterns with the S and Z alleles failed for P. coerulescens (Tan and Jackson, 1988). By analysis of protein extracts from stigmas of four self-incompatible genotypes, protein patterns did vary between genotypes, especially within the molecular weight region of 43,000 to 97,000 Da and within the pI range of 5 to 7. These stigma-specific changes in protein pattern indicated a relationship between stigma proteins and self-incompatibility genotype. However, as two loci
(S and Z) are involved, particular proteins could not be precisely assigned to particular alleles.
The failure might be due to low abundance of the S and Z proteins in stigmas.
Another strategy that has been used to clone SI genes was differential screening. A cDNA clone was obtained by differential screening of a cDNA library made from stigma tissue of
Brassica oleracea (Nasrallah et al., 1985). Li et al. (1994) tried a differential screen of a cDNA library from mature P. coerulescens pollen. However, later evidence proved this effort failed to find any candidate for Z and just identified an S linked gene (Chapter 3) (Baumann et al., 2000; Langridge et al., 1999).
Self-incompatibility in the grasses shows some characteristics similar to those of sporophytic self-incompatibility (Heslop Harrison, 1979). Grass pollen is tri-nuclear, the stigma is dry and the incompatibility reaction is rapid, all of which are similar to the Brassica system.
DNAs from rye-inbred lines segregating at the S locus and homozygous at the Z locus were used as templates in polymerase chain reaction in an attempt to amplify homologous sequence using amplified with primers derived from the Brassica SLG sequences (Wehling et al.,
1994b). After denaturing gradient gel electrophoresis, a 280 bp PCR-fragment displayed a polymorphism correlated to the S genotypes. However, there have been no further publications extending this work.
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 18
A map-based cloning strategy has also been used to identify self-incompatibility genes.
Nucleotide sequencing of the regions that flank the SLG regions resulted in identification of S receptor kinase gene (Stein et al., 1991). This success was owed to its close linkage to SLG.
Another luck chose Brassica researchers again, where the first pollen S gene has been found.
Suzuki and his co-workers (1999) sequenced a PAC (P1-derived artificial chromosomes) clone and identified several candidate pollen S genes. By analysis of the sequence of the 13 kb region between SLG8 and SRK8, Schopfer et al. (1999) found that the pollen S gene (SCR8) is just about 4 kb from SRK8 in B. campestris. This result was confirmed by Takayama and co-workers (2000) that the physical distances between pollen S gene and stigma S gene varies from 1 kb to 10 kb. This is the only strategy that has not been tried in cloning of self- incompatibility genes in the grasses, although the close genetic linkage of the functions is clearly evident from the literature.
1.6 P. coerulescens as a model system for study of self-incompatibility in grasses
P. coerulescens is a perennial grass, which is endemic to in the Mediterranean region
(Watson, 1990). It can be clonally propagated, simplifying genotype identification and maintenance. The genetic control of self-incompatibility in P. coerulescens has been identified by Hayman (1956). A comprehensive collection of well-characterised wild types is available for study.
Cloning of self-incompatibility genes of grasses can help to understand the evolution of SI Chapter 1 Literature review 19 systems, to understand the mechanism of biological diversity, and to find out how to utilize of
SI in plant breeding. The map-based cloning strategy provides a means of obtaining all genes in the S and Z regions. Phalaris offers advantages for this approach for the following reasons.
1. A comprehensive collection of Phalaris SI genotypes and varieties of pollen-only
mutants identified from mutant trap experiments were available for study (Hayman,
1956; Hayman and Richter, 1992)
2. A putative self-incompatibility gene (Bm2) has been cloned from the mature pollen of
Phalaris (Li et al., 1994). The authors provided several lines of evidence to support
Bm2 representing S. It co-segregated with the S locus in about 120 individuals. The
gene was strongly expressed in the pollen. The deduced amino acid sequences of the
S1, S2 and part of the S4 alleles showed that the protein has a variable N terminus and
a conserved C terminus. It was proposed that the gene has two distinct sections, a
variable N terminus determining allele specificity and a conserved C terminus with
catalytic activity. Reduced thioredoxin activity was found in a self-fertile mutant of
Phalaris (Li, et al., 1996). Bm2 provided a good start point of SI study in Phalaris.
3. Compared with the other characterised self-incompatible species, such as Secale,
Lolium and Hordeum, P. coerulescens genome size is relatively small, with generic
mean 2C DNA value about 2.8 to 7.8 pg, which is just about 3 times more than the
rice genome size (Watson, 1990).
4. Comparative genetic studies have demonstrated that gene content and orders are
highly conserved, both at the map and megabase level, between different species
within the grass family (Devos and Gale, 1997). Thus, the RFLP probes that have
been mapped in other cereals can be easily transferred to Phalaris. Barley bacterial
artificial chromosomes (BAC) libraries and rice whole genomic sequences provide
powerful tools for map-based cloning endeavours.
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 20
Together, these facts indicate the strong rationale and useful materials available to study SI in this species.
1.7 Aims
The involvement of two unlinked loci determining self-incompatible specificity in the grasses present this as an important system to study. Self-incompatibility studies in the grasses are not as advanced as those of single locus systems. However, previous comprehensive genetic and initial molecular work on Phalaris self-incompatibility made it in advantageous starting point for further research.
The aims of the author’s Ph D project are to
1. to investigate the role of Bm2 in self-incompatibility.
2. to use RFLP probes from wheat, barley, oat and rye genetic maps to delimit the S and Z
loci of Phalaris.
3. to explore the possibility of using barley and rice BAC clones orthologous to the regions
of the S and Z loci to analyse the chromosome structure of these regions and to seek
candidate self-incompatibility genes.
Chapter 2
General materials and methods
Part of the S tester population of Phalaris coerulescens
Chapter 2 General materials and methods 22
Chapter 2 General materials and methods
2.1 Materials
2.1.1 Plant materials
Self-incompatible and mutants of P. coerulescens used in this study were derived from a collection in the Department of Genetics, The University of Adelaide (Hayman, 1956;
Hayman and Richter, 1992). As there were two alleles confirmed in both the S and Z loci, nine possible genotypes could be generated (Table 2.1.1). Self-incompatibility determines there must be at least one locus remaining heterozygous, so the genotypes of S1S1Z1Z1,
S2S2Z1Z1, S1S1Z2Z2, S2S2Z2Z2 do not exist in natural conditions. Five natural genotypes were available for this study: S1S1Z1Z2, S1S2Z1Z1, S1S2Z2Z2, S2S2Z1Z2 and S1S2Z1Z2. All the plants were kept in the glasshouse and re-potted each year.
Table 2.1.1 The possible combinations of the S and Z alleles Alleles Z1Z1 Z1Z2 Z2Z2 S1S1 X S1S1Z1Z2 X S1S2 S1S2Z1Z1 S1S2Z1Z2 S1S2Z2Z2 S2S2 X S2S2Z1Z2 X X: The combination does not exist.
2.1.2 Reagents
Chemicals were bought from BDH Laboratory supplies, U.K. Restriction enzymes and other modification enzymes were purchased from Roche Molecular Biochemicals, Germany.
Bacterial strain (DH5α) was ordered from Clontech, U.S.A. Primers were synthesised by Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 23
Gibco BRL, U.S.A. DNA molecular weight markers were λ DNA cut with Bst EII/Sal I, λ
DNA cut with Hind III and pUC19 DNA cut with Msp I.
2.2 Methods The general methods used in this study were according to Sambrook et al. (1989).
2.2.1 General molecular methods
Restriction digestion
Restriction enzyme digestion was carried out in a volume of 10 µl containing 1× SDB buffer
(33 mM Tris, pH 7.8 adjusted with glacial acetic acid, 65 mM potassium acetate, 10 mM magnesium acetate, 4 mM spermidine, 5 mM dithiothreitol), 1-10 µg DNA and 5 to 20 units of restriction enzyme. The mixture was incubated at 37°C for one hour.
Ethanol precipitation
DNA solution was mixed with 1/10 volume of 3M sodium acetate (pH 4.8) and 2.5 times volume of 100% ethanol. The mixture was frozen in liquid nitrogen, thawed at room temperature and centrifuged at 10,000 g at room temperature for 15 minutes. The DNA pellet was washed twice with 70% ethanol and air-dried. The pellet was dissolved in a suitable amount of 1× TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and stored at -20°C until use.
Polymerase chain reaction (PCR)
PCR amplifications were performed in a volume of 50 µl containing 50 ng template DNA, 2.5 units of Tag DNA polymerase (GIBCOBRL Company, USA), 1× reaction buffer (20 mM
Tris-HCl, pH8.4, 50 mM KCl), 1.5 mM MgCl2, 0.2 mM dNTPs, 0.2 µM primers. Chapter 2 General materials and methods 24
Amplifications were carried out in a Programmable Thermal Controller (MJR, USA) as follows: First, 94 °C for 3 minute; then 35 cycles of 94°C for 1 minute, 58°C for 1 minute and
72°C for 1.5 minutes; and followed by 72°C for 10 minutes.
Gel Electrophoresis
Agarose gel (1%) was prepared by melting agarose in 1× TAE buffer (50 mM Trizma base, 1 mM Na2EDTA, adjustment to pH 8.0 with glacial acetic acid). Each DNA sample was mixed with 1/5 volume of 6× Ficoll dye (15% Ficoll type 4000, 0.25% bromphenol blue, 0.25% xylene cyanol FF). After electrophoresis at about 5 volts per centimetre of gel in 1× TAE buffer, the gel was stained in nanopure water containing 1 µg/ml ethidium bromide in a plastic lunch box for 30 minutes on a rocking platform. The gel was rinsed briefly with nanopure water and DNA was visualised on a UV transilluminator.
Purification of DNA from agrose gel
Purification of DNA from agrose gel was with Qiagen Gel Extraction Kit (Qiagen, Germany).
2.2.2 Genomic DNA protocols
Genomic DNA Isolation
Isolation of genomic DNA from Phalaris leaves was according to the report of Guidet et al.
(1991). Leaf material (2.0 g) was frozen in liquid nitrogen and ground into powder with a mortar and pestle. The powder was mixed with 4 ml DNA extract buffer (1% sarkosyl, 100 mM Tris-HCl (pH8.5) 100 mM NaCl, 10 mM EDTA, 2% Polyvinyl-polypyrrolidone (PVP), insoluble) and 4 ml phenol/chloroform/iso-amyl-alcohol (25:24:1) for 15 minutes in a 10 ml tube and centrifuged at 4000 g for 10 minutes. The aqueous phase was re-extracted with 4 ml phenol/chloroform/iso-amyl-alcohol (25:24:1) for 10 minutes and centrifuged at 4000 g for 10 Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 25 minutes. The aqueous phase, 400µl 3M sodium acetate (pH4.8) and 4 ml iso-propanol were mixed thoroughly. The DNA was spooled out with a Pasteur pipette, washed with 2 ml 70% ethanol and air-dried. The pelleted DNA was resuspended in 350 µl R40 (40 µg/ml RNase A in TE buffer) at 4°C overnight and stored at –20 °C.
Gel blotting
About 10 µg genomic DNA was digested in a volume of 10 µl (containing 1× SDB buffer and
20 units concentrated restriction enzyme) at 37°C for at least 5 hours. After separation using
1% agarose gel, DNA was blotted to a piece of nylon Hybond N+ membrane using 0.4 M
NaOH according to the instructions of Amersham (UK).
Oligo-labelling of DNA probes
An M13 forward (M13F) and reverse (M13R) primer pair (M13F: 5’GTA AAA CGA CGG
CCA G; M13R: 5’CAG GAA ACA GCT ATG AC) was normally used to isolate inserts from plasmids. PCR conditions were the same as in Section 2.2.1. The PCR products were separated using 1% agarose gel and DNA fragments were cut and purified.
The oligo-labelling was carried out as follows. About 50 ng probe DNA, 0.3 µg 9 mer random primer mix and water were added into a 1.5 ml micro-centrifuge tube to a final volume of 7.5 µl. The mixture was boiled for three minutes and kept on ice for 5 minutes.
The oligo labelling reaction took place in 25 µl containing 75 mM Tris-HCl, pH 7.6, 75 mM
NaCl, 15 mM MgCl2, 2 ng/µl template DNA, 12 ng/µl 9-mer random primers, 30 µM dATP,
30 µM dTTP, 30 µM dGTP, 150 µg/ml BSA, 2 units of Klenow DNA polymerase and 40
µCi [α-32P] dCTP. After incubation at 37°C for 1 hour, the mixture was purified by a Chapter 2 General materials and methods 26
Sephadex G-100 mini-column. After boiling for five minutes and chilling in ice water for another five minutes, the probe was ready for use.
Hybridisation
Membranes were pre-hybridised in 10 ml pre-hybridisation solution (1.5× HSB (1× HSB: 0.6
M NaCl, 20 mM PIPES, 5 mM Na2EDTA, pH6.8), 20× Denhardt’s III (100× Denhardt's III:
2% bovine serum albumin (Fraction V, sigma), 2% Ficoll 400, 2% Poly-vinyl-pyrrolidone
360, 10% Sodium dodecyl sulfate (SDS)) and 0.5 mg/ml denatured sheared salmon sperm
DNA) at 65 °C for 2-6 hours. Hybridisation was carried out in 10 ml hybridisation solution
(1.5× HSB, 20× Denhardt’s III, 5.0% Dextran sulphate and 0.25 mg/ml denatured sheared salmon sperm DNA) at 65°C for 16-18 hours. Wash condition was at 65°C with stringency from 2× SSC (1× SSC: 150 mM NaCl, 15 mM tri-Sodium citrate) with 0.1% SDS to 0.5×
SSC with 0.1% SDS or 0.2× SSC with 0.1% SDS depending on the strength of the signal.
2.2.3 RNA protocols
Isolation of total RNA
Total RNA was extracted by TRIzol Reagent (GIBCO BRL Co.,USA). The method of extraction was simplified as follows: 50 mg of tissue was ground into a powder in an
Eppendorf tube with a pestle under liquid nitrogen. 1 ml TRIzol Reagent was added to the tube. After centrifugation at 10,000 g for 10 minutes at 4°C, the supernatant was mixed with
200 µl chloroform, incubated at room temperature for 5 minutes and then centrifuged at 9,000 g for 15 minutes at 4°C. The aqueous phase and 500 µl isopropanol were mixed and kept at room temperature for 10 minutes and then centrifuged at 10,000 g at 4°C for 10 minutes. The pellet was washed with 2 ml 70% ethanol, resuspended in 10 µl water and stored at -80°C for use. Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 27
Northern Blotting
About 8µg total RNA was separated on a 1.5% agarose gel containing 1× MOPS/EDTA (50 mM MOPS, 1 mM EDTA, pH7.0) and 1% formaldehyde. The RNA was transferred overnight to a nylon Hybond N+ membrane using 20× SSC. The membrane was dried at 80°C in a vacuum oven for 30 minutes and fixed under short wave UV for 7 minutes. Pre- hybridisation was carried out in 20 ml of 7.5× Denhardt’s Reagent (50× Denhart's reagent:
1% acetylated bovine serum albumin (Fraction V), 1% Ficoll 400, 1% Poly-vinyl-pyrrolidone
360), 5× SSPE (1× SSPE: 180 mM NaCl, 10 mM NaH2PO4, 1 mM EDTA, pH7.4), 0.5% SDS,
1 mg/ml denatured salmon sperm, and 45% formamide at 42°C overnight. Hybridisation was done in 5× Denhardt’s Reagent, 5× SSPE, 0.5% SDS, 0.5 mg/ml denatured salmon sperm
DNA, 2.5% dextran sulphate, and 45% formamide at 42°C for 48 hours. The membrane was washed at 65°C using solutions ranging from 2× SSC with 0.1% SDS to 0.5× SSC with 0.1%
SDS or 0.2× SSC with 0.1% SDS depending on the strength of the signal.
2.2.4 Plasmid protocols
Plasmid dephosphorylation
The vector was cut with an enzyme, precipitated by ethanol and dissolved in a suitable amount of 1× TE buffer. The dephosphorylation was carried out in a 20 µl volume containing
1× dephosphorylation buffer (50 mM Tris-HCl, 0.1 mM EDTA, pH 8.5), cut vector and 10 units of calf intestinal alkaline phosphatase (CIP). The mixture was incubated for 30 minutes at 37°C. After addition of 30 µl water, the mixture was extracted once with an equal volume of phenol/chloroform/iso-amylalcohol (25:24:1). The vector DNA was recovered by ethanol precipitation, dissolved in 1× TE with a final concentration of 50 ng/µl and stored at -20°C for use.
Chapter 2 General materials and methods 28
Ligation
The ligation was conducted in 10 µ1 containing 1× ligation buffer (66 mM Tris-HCl, 5 mM
MgCl2, 1 mM dithioerythritol, 1 mM ATP, pH 7.5), 50 ng dephosphorylated vector, 1 unit of
T4 DNA ligase and 100 ng compatible template. The mixture was incubated at 12°C overnight.
The purified PCR product was cloned into pGEM T-easy vector (Promaga) according to the instructions. A total 10 µl ligation reaction contained 20 mM Tris-HCl (pH7.6), 5 mM
MgCl2, 1 mM ATP, 5 mM dithiothreitol (DTT), 50 ng pGEMT-easy vector, 3 U T4 DNA ligase and about 150 ng purified PCR product. The mixture was incubated at 12°C overnight.
Transformation
The method for the preparation of frozen competent cells was adapted from the method of
Inoue et al. (1990). E. coli. "DH5α" was streaked onto an LB agar plate and the plate was incubated overnight at 37°C. About 10 colonies were picked with a sterile loop and inoculated in 250 ml of SOB medium (2% Tryptone Peptone, 0.5% Yeast extract, 0.06 %
NaCl, 0.02% KCl, 10 mM MgSO4·7H2O and 10 mM MgCl2) in a 2-litre flask to an OD600 of
0.6 at 18°C with vigorous shake (200-250 rpm) for about 36 hours. The cells were collected by centrifuging at 5000 g for 10 minutes at 4°C. The cells were resuspended in 80 ml of ice- cold transformation buffer (TB: 10 mM pipes, 55 mM MnCl2, 15 mM CaCl2, 250 mM KCl, adjust pH to 6.7 with KOH), kept on ice for 10 minutes and centrifuged at 2,500 g for 10 mins at 4°C. The pellet was gently resuspended in 20 ml of TB and DMSO was added with gentle swirling to a final concentration of 7%. The mixture was kept on ice for 10 minutes and then Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 29
0.5 ml aliquots were made. After being chilled by immersion in liquid nitrogen, the frozen competent cells were kept at -80°C for use.
The ligation mixture was added to 200 µl competent cells and gently mixed. The mixture was placed on ice for 30 minutes, then incubated at 42°C for exactly 1 minute without agitation and replaced on ice for another 5 minutes. After adding 400 µl SOB medium with 0.35%
(w/v) sterile glucose, the mixture was incubated at 37°C with gentle shaking for 1 hour.
Using a sterile spreader, 200 µl aliquots were spread onto LB plates (containing 50-100 ng/ml ampicillin, 0.004% X-gal and 0.1 mM IPTG). The plates were incubated at 37°C for 16 hours.
Plasmid DNA extraction
A single colony was picked and cultured in 2 ml LB medium containing the appropriate antibiotic selection at 37 °C overnight with vigorous shaking. The culture was centrifuged at
4000 g for 10 minutes at room temperature and the supernatant removed. The pellet was resuspended in 100 µl Plasmid solution I (50 mM glucose, 25 mM Tris-HCl (pH 8), 10 mM
EDTA). The mixture was kept on ice for 5 minutes. After 200 µl Plasmid solution II (0.2M
NaOH, 1% SDS) was added, the mixture was mixed gently by inversion and incubated on ice for 5 minutes. After 150 µl Plasmid solution III (3M sodium acetate, pH4.8) was added, the mixture was mixed gently by inversion and left on ice for 5 minutes. After centrifugation of
15 minutes at 10,000 g in a microcentrifuge, the supernatant was transferred to a fresh tube and an equal volume of phenol/chloroform/iso-amyl alcohol (25:24:1) was added and mixed well. After centrifugation at10,000 g for 15 minutes, the aqueous phase was transferred to a fresh micro-centrifuge tube and 1 ml 100% ethanol was added. After 15 minutes of full speed centrifugation, the supernatant was discarded. The pellet was washed with 1 ml 70% ethanol Chapter 2 General materials and methods 30 and dried under vacuum. The plasmid was dissolved in a volume of 30 µl R40 (40 µg/ml
RNase A in TE buffer).
Sequencing
Sequencing was performed by the Australian Genome Research Facility (AGRF, Australia).
Sequencing PCR was in total 12 µl with 0.4 µg plasmid, 0.32 pmoles primers and 4 µl ABI
BigDye Terminator reagent mix. Cycling conditions were as follows: step 1: 94°C for 3 minutes; step 2: 96 °C for 10 seconds; step 3: 50°C for 5 seconds; step 4: 60°C for 4 minutes, repeat steps 2 to 4 for another 24 times. Cleaning up was with normal ethanol precipitation.
Chapter 3
Characterisation of a putative
Phalaris S gene (Bm2)
An in vitro geminated pollen grain stained with florescence antibody against Bm2
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 32
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2)
3.1 Introduction
Self-incompatibility results through an interaction between pollen and the stigma. As reviewed in Chapter 1, the self-incompatibility locus must contain at least a pollen and a stigma S gene. In Phalaris, two unlinked, multi-allelic loci, S and Z, determine the specificity. Thus, there should be four genes controlling self-incompatibility; a pollen and a stigma S gene at the S locus, and a pollen and a stigma Z gene at the Z locus.
A putative S gene (Bm2) was cloned from mature pollen of P. coerulescens (Li et al., 1994).
Bm2 co-segregated with the S locus in a population of about 120 individuals and was abundantly expressed in mature pollen. Its protein showed high homology to thioredoxin h and had an allelic domain and a conserved catalytic domain. These findings suggested that
Bm2 was the pollen S gene of Phalaris. Hayman and Richter (1992) identified several pollen- only mutants, which made it feasible to test this assumption.
The aim of this chapter was to investigate the role of Bm2 in self-incompatibility in Phalaris.
The transcripts and proteins of Bm2 in two pollen-only mutants were analysed. Several errors in the sequences of the previous report (Li et al., 1994) were identified. The results indicated that Bm2 is not the pollen S gene of Phalaris but represents a new type of thioredoxin h. The possible role of the S-linked thioredoxin in self-incompatibility was investigated. The Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 33 research reported here corrects previous errors in the analysis of Bm2 and opens the way to adopting a new strategy for cloning the self-incompatibility genes of the grasses.
3.2 Materials and methods
3.2.1 Materials
° ° ° ° Two homozygous S pollen-only mutants (S1 S1 and S2 S2 ) and a wild type (S2S2) were used in these studies (Hayman and Richter, 1992). Pollen was collected in the glasshouse from
November to January. The collected pollen was frozen in liquid nitrogen and stored at -80°C for use.
3.2.2 Northern blot analysis
Total RNA extraction and gel blot analysis were carried out as detailed in Section 2.2.4 of
Chapter 2. Bm2 cDNA was used as probe.
3.2.3 Preparation of Bm2 fusion protein
Bm2 cDNA was constructed in the pQE-31 expression vector and transformed into E. coli
M15 (Li et al., 1995). The cloning procedure is illustrated in Figure 3.1 A. The purification of the fusion protein was according to the QIAGEN (Germany) instructions with some modification. A single colony was cultured with vigorous shaking overnight in 10 ml LB containing 25 mg/ml kanamycin and 100 µg/ml ampicillin at 37ºC. 5 ml overnight culture was added to 100 ml pre-warmed LB medium with the same antibiotics. The mixture was grown at 37ºC with vigorous shaking until the OD600 reached 0.6. A sample (1 ml) was taken as the non-induced control. Protein expression was induced by addition of IPTG to a final
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 34 concentration of 1mM, for additional culture for four hours. A second 1 ml sample was taken as the induced control. E. coli cells were collected by centrifugation at 4000 g for 10 minutes.
The pellet was frozen in liquid nitrogen and stored at -20°C.
The protein was purified using the 6× His/Ni-NTA resin purification system (QIAGEN,
Germany). The cell pellet was thawed for 15 minute on ice and resuspended in Buffer B (8 M urea, 0.1M NaH2PO4, 0.01 M Tris.HCl, pH 8.0) at 5ml per gram of wet pellet weight. The mixture was stirred on a rotary shaker at 200 rpm. The supernatant was added to 50% Ni-
NTA slurry (at 4ml supernatant to 1ml Ni-NTA slurry) and mixed gently at 200 rpm on a rotary shaker for 60 minutes. The mixture was added to a clean column. After washing two times with 4ml Buffer C (8 M urea, 0.1M NaH2PO4, 0.01 M Tris.HCl, pH 6.3), the recombinant protein was eluted by 0.5 ml Buffer D (8 M urea, 0.1M NaH2PO4, 0.01 M
Tris.HCl, pH 5.9) and 0.5 ml Buffer E (8 M urea, 0.1M NaH2PO4, 0.01 M Tris.HCl, pH 4.5).
Rabbit polyclonal antiserum against the fusion protein was prepared by Dr X. Li. The purified fusion protein (Figure 3.1B) was mixed with Bm2 rabbit polyclonal antiserum at a ratio of 1:1 (v/v) at room temperature for 30 minutes as a control in western blot analysis.
3.2.4 Western blot analysis
The Western analysis procedures were carried out according to the method reported by
Sambrook et al. (1989), but with some modifications. After being ground in liquid nitrogen, pollen (about 0.1 g) Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 35
308 (ATG) 351(Hind III) 700 (TGA) 862 (Dra I) A Bm2 cDNA Thioredoxin ORF
512 bp fragment
TOLP III III I I HI HI I I I I I I I I I I
l l t t c c h h Sa Sa Hind Hind Ps Bam Ps Bam Sa Kpnc Xma Sa Kpnc Xma Sp Sp
PT5 Lac O Lac O RBS ATG 6 x His MCS Stop Codons
pQE-31 (3462bp)
(QIAGEN, USA)
B M 1 2 3 Figure 3.1 The construction and expression of the S linked thioredoxin into pQE-31 97.4 expression vector (Li et al., 1995). 66.2 55.0 A: The original Bm2 cDNA was cut with Hind III and Dra I. After blunting ending with 42.7 Klenow, a 512 bp fragment was cloned into 40.0 the Sma I site. The TOLP primer (see Figure 31.0 3.2) was used to confirm the reading frame of the construct. 21.5 B: Expression of the fusion protein in E. coli. 14.4 M, middle range protein marker 1. Before IPTG inducing 2. After IPTG inducing 3. Purified fusion protein (indicated by arrow)
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 36
was mixed with 200 µl RIPA buffer (50 mM Tris.HCl, pH7.5, 150 mM NaCl, 1.0% Triton X-
100; 0.1% SDS, 5 mM EDTA, 3 mM MgCl2; before use, 0.5 mM PMSF and 10 µM leupeptin were added). The extract was mixed for 1 minute and centrifuged at 10,000 g for 10 minute at 4ºC. Ten µl supernatant and 10 µl 2× SDS protein loading buffer (125 mM Tris-HCl, pH6.8, 200 mM dithiothreitol, 4%, 0.2% bromophenol blue, 20% glycerol) was boiled for 3 minutes and chilled on ice prior to loading on the gel.
After separation of the pollen protein by 12% SDS-PAGE, the protein was transferred to nitrocellulose membrane (GeneWorks). All the following incubations were carried out with gentle agitation. The membrane was first blocked with 5% non-fat milk powder in TBS buffer (10 mM Tris·Cl, pH7.4, 150 mM NaCl) for 1 hour, then washed twice in TBS buffer with 0.05% Tween 20 for 10 minutes. The primary antiserum was added to TBS buffer with
1% BSA and 0.05% Tween 20 at a concentration of 1:500, and the diluted antibody solution was incubated with the membrane overnight at 4ºC. After washing three time in TBS with
0.05% Tween, the membrane was incubated with goat anti-rabbit IgG (H+L) alkaline phosphatase conjugate (Bio Rad, USA) in TBS (with 1% BSA and 0.05% Tween 20) at a concentration of 1:5000 for 1 hour at room temperature. After two washes in TBS with
0.05% Tween 20 and one wash with TBS only, the membrane was incubated in alkaline phosphatase buffer (APB: 100 mM NaCl, 5 mM MgCl2, 100 mM Tris·Cl, pH9.5) for 5 minutes. BICP and NBT (5% stock in DMF) were added to the APB to concentrations of
0.0165% and 0.033%, respectively. The chromogenic substrate mixture was incubated with the membrane and the colour reaction was carefully monitored. When the bands were of the desired intensity, the membrane was transferred to TBS with 2 mM EDTA to stop the reaction. Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 37
3.2.5 Cloning of cDNA homologues of Bm2 from the pollen-only mutants
Three PCR primers (Figure 3.2) were designed according to the Bm2 cDNA sequence (Li et al., 1997; Juttner, pers. comm., 1998). Total pollen RNA (about 5 µg) and XLP primer (0.3
µg) were mixed in an eppendorf tube, heated at 70 °C for 10 minutes and then chilled on ice for 5 minutes. The reverse transcription reaction was in a final volume of 20 µl, containing
50 mM Tris-HCl (pH8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 500 µM dNTPs and 400
U Superscript II RNase H- Reverse transcriptase (GIBCO BRL). The mixtures were incubated at 45°C for 1 hour and then precipitated with ethanol. The pellet was washed three times with 1 ml 70% ethanol. After air drying for 5 minutes, the pellet was redissolved in 10
µl water. The first strand cDNA (5 µl) was used in PCR amplification with the LUP and
TOLP primer pair. The PCR conditions and product cloning are as detailed in Section 2.2.1
& Section 2.2.4 of Chapter 2. Four different cDNA clones were sequenced to identify and correct any errors resulting from PCR errors.
3.2.6 Analysis of the S-linked thioredoxin sequence
The putative amino acid sequences were predicted by SeqED (Applied Biosystem, USA).
Protein motifs were predicted using PROSCAN (IBCP, France, http://npsa-pbil.ibcp.fr).
Multiple sequence alignments were done using the Pileup program at WebANGIS (ANGIS,
Australia). Protein modelling was carried out using SWISS-MODEL (an automated comparative protein modelling server at GlaxoSmithKline, Switzerland) (for reference see
(Peitsch, 1996)). The lower BLASTP limit for template selection was 10-8.
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 38
TOLP (738-719) LUP (62-82) XLP (806-786)
100 200 300 400 500 600 700 800 900
Bm2 cDNA, 889 bp 100 bp
Fig. 3.2 Schematic representation of the three primer locations in the Bm2 cDNA sequence
LUP (62-82): 5’-CTACGACCAGGAGAGGAGACC-3’ TOLP (738-719): 5’-TGGCTCGGCTCTACTTCTG-3’ XLP (806-786): 5’-GCGGAAAAGACAGGAAACTG-3’
XLP was used for reverse transcription to increase the specificity. LUP and TOLP were used for PCR amplification of cDNA homologs from both mutants.
Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 39
3.3 Results
3.3.1 Mutations in pollen-only mutants are independent of Bm2
To address the hypothesis that Bm2 was the pollen S gene of Phalaris, Bm2 was characterised in two homozygous S pollen-only mutants. First, total RNA from mature pollen was analysed by northern blot to detect whether the mutations of pollen-only mutants affect mRNA expression of Bm2 (Figure 3.3). The pollen-only mutants had the same abundance of Bm2 transcripts as wild type. This indicates that the mutations in pollen-only mutants involved in this study do not affect the transcript accumulation of Bm2.
Second, to indicate whether the lesions in pollen-only mutants affect Bm2 protein expression, total pollen protein of the two mutants and the wild type was analysed by protein gel blot analysis (Figure 3.4). Two different bands, ~50 kDa and ~14 kDa (the expected size), were always detected in antiserum treatment (Figure 3.4 A); no bands were detected in the same position in the antigen and antiserum interaction treatment (Figure 3.4 B). Although the 50 kDa band makes the results confusing, no difference detected at the 14 kDa bands between wide type and mutants does imply that the mutations do not affect Bm2 expression.
Third, Bm2 homologous cDNAs from two pollen-only mutants were amplified by RT-PCR, cloned and sequenced to identify possible lesions in the coding regions. Compared with the wild type cDNA sequences (Li et al., 1994), several differences were identified in the cDNA sequences of
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 40
1º 2º
2 S S
S 2 1º 2º S S S
A rRNA
B Bm2 transcripts (1.1 kb)
Figure 3.3 Northern blot detection of Bm2 transcripts
Total RNA samples (about 10µg each), one wild type and two pollen-only mutants homozygous at the S locus, were separated on a 1.5% agarose-formaldehyde gel and blotted to a nylon membrane.
A: The picture of rRNA stained with ethidium bromide B: The autoradiograph of the blot hybridised by 32P-labelled Bm2 cDNA Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 41
AB 1º 2º 1º 2º 2 2 S S S S S S 2 1º 2º 2 1º 2º S M S S S S S
97.4 66.2 55.0
42.7
40.0 31.0
21.5
14.4
Fig. 3.4 Protein gel blot analysis of Bm2
The total proteins were separated on an SDS-polyacrylamide gel, transferred to a nitrocellulose membrane and probed with rabbit polyclonal antibody raised by the thioredoxin fusion protein (A) and antibody-antigen mixture as a control (B).
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 42
pollen-only mutants (Figure 3.5). Two insertions (C and G) and three substitutions (T to C, G to A and T to C) were found in one allele. One insertion (G) and two substitutions (A to G, C to T) were found in the second allele. It is important to note that the G insertion occurred not only in both alleles but also at the same position. It seems unlikely that these mutations accumulated just in a single generation, so the original Bm2 cDNA clone was sequenced again (Figure 3.5). The insertion G in both alleles of the pollen-only mutants also exists in the Bm2 cDNA sequence. This indicated that there were sequence errors in the previous study (Li et al., 1994).
This conclusion was further confirmed by comparing Bm2 cDNA sequences from pollen-only mutants with those from another wild type line that is heterozygous at S (S12, J. Juttner, pers. comm., 1999; he named his two sequences as Trx1 and Trx2). Figure 3.6 gives the alignment of these Bm2 cDNA homologues. No insertion differences were identified. However, there were some substitutions. One transversion and one transition mutation were identified in allele 1. For allele 2, three mutations, one transversion and two transitions were identified.
There are three insertions and 5 transitions between S1 and S2 alleles. All these mutations are silent ones, as the four cDNA sequences had the same length (393 bp) of open reading frames and had identical deduced amino acid sequences (131 amino acids). The BLAST search results showed that this protein was highly homologous to the thioredoxin family
(pfam00085, NCBI) with an E value of 8×10-21.
These results indicate that the pollen-only mutations are independent of Bm2. The allelic domain was wrongly predicted due to the sequence errors in the previous study (Li et al., Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 43
1994). Therefore Bm2 is not a self-incompatibility gene of Phalaris but represents a subclass
of thioredoxin h.
62 126 S1º mutant CTACGACCAGGAGAGGAGACCGTCCACTGACCCCCACCACCACCACCACCGGAGACAGCGTTGC S1 wild type CTACGACCAGGAGAGGAGACCGTCCA-TGACCCCCACCACCACCACCACCGGAGACAGCGTTGC S2 wild type CTACGACCAGGAGAGGAGACCGTCCACTGACCCCCACCACCACCACC---GGAGACAGCGTTGC S2º mutant CTACGACCAGGAGAGGAGACCGTCCACTGACCCCCACCACCACCACC---GGAGACAGCGTTGC Bm2 cDNA CTACGACCAGGAGAGGAGACCGTCCACTGACCCCCACCACCACCACC---GGAGACAGCGTTGC Comparison ------*------+++------
127 187 S1º mutant CTTGCACGTTAATCCACCCAGCCGAGTTAAGGAGCCTCTTAATTGCCCGGAGATCCGCCA S1 wild type CTTGCACGTTAATCCACCCAGCCGAGTTAAGGAGCCTCTTAATTGCCCGGAGATCCGCCA S2 wild type CTTGCACGTTAATCCACCCAGCCGAGTTAAGGAGCCTCTTAATTGCCCGGAGATCCGCCA S2º mutant CTTGCACGTTAATCCACCCAGCCGAGTTAAGGAGCCTCTTAATTGCCCGGAGATCCGCCA Bm2 cDNA CTTGCACGTTAATCCACCCAGCCGAGTTAAGGAGCCTCTTAATTGCCCGGAGATCCGCCA Comparison ------
188 248 S1º mutant GGCTCGTCGTCTTCGTTTCCCTTCCCGCGGCTCTTGGCGCCAAAATCCCCGCTCCCGATC S1 wild type G-CTCGTCGTCTTCGTTTCCCTTCCCGCGGCTCTTGGCGCTAAAATCCCCGCTCCCGATC S2 wild type G-CTCATCGTCTTCGTCTCCCTTCCCGCGGCTCTTGGCGCCAAAATCCCCGCTCCCGATC S2º mutant GGCTCATCGTCTTCGTCTCCCTTCCCGCGGCTCTTGGCGCCAAAATCCCCGCTCCCGATC Bm2 cDNA GGCTCATCGTCTTCGTCTCCCTTCCCGCGGCTCTTGGCGCCAAAATCCCCGCTCCCGATC Comparison -*---+------+------*------
249 308 S1º mutant CAGGGCCTTCAGGGGGCCTTTTGCTCAGTGCTGCGTGCTAGTTTGTCGATTGAAGTTTA S1 wild type CAGGGCCTTCAGGGGGCCTTTTGCTCAGTGCTGCGTGCTAGTTTGTCGATTGAAGTTTA S2 wild type CAGGGCCTTCAGGGGGCCTTTTGCTCAGTGCTGCGTGCTAGTTTGTCGATTGAAGTTTA S2º mutant CAGGGCCTTCAGGGGGCCTTTTGCTCAGTGCTGCGTGCTAGTTTGTCGATTGAAGTTTA Bm2 cDNA CAGGGCCTTCAGGGGGCCTTTTGCTCAGTGCTGCGTGCTAGTTTGTCGATTGAAGTTTA Comparison ------
309 369 S1º mutant CAATGGGAGGCTGTGTGGGCAAGGATCGTGGCATTGTGGAAGACAAGCTTGATTTCAAAG S1 wild type CAATGGGAGGCTGTGTGGGCAAGGATCGTGGCATTGTGGAAGACAAGCTTGATTTCAAAG S2 wild type CAATGGGAGGCTGTGTGGGCAAGGATCGTGGCATTGTGGAAGACAAGCTTGATTTCAAAG S2º mutant CAATGGGAGGCTGTGTGGGCAAGGATCGTGGCATTGTGGAAGACAAGCTTGATTTCAAAG Bm2 cDNA CAATGGGAGGCTGTGTGGGCAAGGATCGTGGCATTGTGGAAGACAAGCTTGATTTCAAAG Comparison ------
370 430 S1º mutant GTGGGAATGTGCATGTCATAACTACCAAAGAGGACTGGGACCAGAAAATTGCAGAAGCAA S1 wild type GTGGGAATGTGCATGTCATAACTACCAAAGAGGACTGGGACCAGAAAATTGCAGAAGCAA S2 wild type GTGGGAATGTGCATGTCATAACTACCAAAGAGGACTGGGACCAGAAAATTGCAGAAGCAA S2º mutant GTGGGAATGTGCATGTCATAACTACCAAAGAGGACTGGGACCAGAAAATTGCAGAAGCAA Bm2 cDNA GTGGGAATGTGCATGTCATAACTACCAAAGAGGACTGGGACCAGAAAATTGCAGAAGCAA Comparison ------
431 491 S1º mutant ACAAGGATGGGAAAATTGTTGTGGCAAATTTCAGTGCTTCCTGGTGTGGGCCATGCCGTG S1 wild type ACAAGGATGGGAAAATTGTTGTGGCAAATTTCAGTGCTTCCTGGTGTGGGCCATGCCGTG S2 wild type ACAAGGATGGGAAAATTGTTGTGGCAAATTTCAGTGCTTCCTGGTGTGGGCCATGCCGTG S2º mutant ACAAGGATGGGAAAATTGTTGTGGCAAATTTCAGTGCTTCCTGGTGTGGGCCATGCCGTG Bm2 cDNA ACAAGGATGGGAAAATTGTTGTGGCAAATTTCAGTGCTTCCTGGTGTGGGCCATGCCGTG Comparison ------
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 44
492 552 S1º mutant TCATTGCACCTGTTTATGCTGAGATGTCAAAGACGTATCCTCAACTCATGTTCTTGACAA S1 wild type TCATTGCACCTGTTTATGCTGAGATGTCAAAGACGTATCCTCAACTCATGTTCTTGACAA S2 wild type TCATTGCACCTGTTTATGCTGAGATGTCAAAGACGTATCCTCAACTCATGTTCTTGACAA S2º mutant TCATTGCACCTGTTTATGCTGAGATGTCAAAGACGTATCCTCAACTCATGTTCTTGACAA Bm2 cDNA TCATTGCACCTGTTTATGCTGAGATGTCAAAGACGTATCCTCAACTCATGTTCTTGACAA Comparison ------
553 613 S1º mutant TTGATGTTGATGACCTAGTGGATTTCAGCTCAACATGGGACATCCGTGCAACCCCAACGT S1 wild type TTGATGTTGATGACCTAGTGGATTTCAGCTCAACATGGGACATCCGTGCGACCCCAACGT S2 wild type TTGATGTTGATGACCTAGTGGATTTCAGCTCAACATGGGACATCCGTGCAACCCCAACGT S2º mutant TTGATGTTGATGACCTAGTGGATTTCAGCTCAACATGGGACATCCGTGCGACCCCAACGT Bm2 cDNA TTGATGTTGATGACCTAGTGGATTTCAGCTCAACATGGGACATCCGTGCGACCCCAACGT Comparison ------*------
614 674 S1º mutant TCTTCTTCCTCAAGAATGGCCAGCAGATCGACAAGCTCGTCGGCGCCAACAAGCCTGAGC S1 wild type TCTTCTTCCTCAAGAATGGCCAGCAGATCGACAAGCTCGTTGGCGCCAACAAGCCTGAGC S2 wild type TCTTCTTCCTCAAGAATGGCCAGCAGATCGACAAGCTCGTCGGCGCCAACAAGCCTGAGC S2º mutant TCTTCTTCCTCAAGAATGGCCAGCAGATCGACAAGCTCGTTGGCGCCAACAAGCCTGAGC Bm2 cDNA TCTTCTTCCTCAAGAATGGCCAGCAGATCGACAAGCTCGTTGGCGCCAACAAGCCTGAGC Comparison ------*------
675 741 S1º mutant TCGAAAAGAAAGTACAAGCTCTTGGCGATGGCAGTTGACCGTGCTACAGAAGTAGAGCCGAGCCA S1 wild type TCGAAAAGAAAGTACAAGCTCTTGGCGATGGCAGTTGACCGTGCTACAGAAGTAGAGCCGAGCCA S2 wild type TCGAAAAGAAAGTACAAGCTCTTGGCGATGGCAGTTGACCGTGCTACAGAAGTAGAGCCGAGCCA S2º mutant TCGAAAAGAAAGTACAAGCTCTTGGCGATGGCAGTTGACCGTGCTACAGAAGTAGAGCCGAGCCA Bm2 cDNA TCGAAAAGAAAGTACAAGCTCTTGGCGATGGCAGTTGACCGTGCTACAGAAGTAGAGCCGAGCCA Comparison ------
Figure 3.5 Alignment of Bm2 homologous cDNA sequences
Sequences of S1 and S2 wild types were reported by Li and his co-workers (1994). The sequence of Bm2 cDNA is author’s version.
“*” indicates the discrepancies found “+” indicates the allelic differences
Primer sequences are underlined. Start and stop codes are bolded. Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 45
Mutant 1
Trx1
Trx2
Mutant 2
100 200 300 400 500 600 700
Insertion Un-translated regions
Transversion Translated regions
Transition 100 bp
Figure 3.6 Schematic representation of the alignment of cDNA of the S- linked thioredoxin from the pollen-only mutants and Trx1 and Trx2.
Trx1 (NCBI Accession No: AF159388) and Trx2 (NCBI Accession No: AF159389).
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 46
3.3.2 Functional prediction of Bm2
Several recent studies showed that thioredoxin h might be involved in the self-incompatibility reaction of Brassica (Bower et al., 1996; Cabrillac et al., 2001; Mazzurco et al., 2001).
Although, Bm2 is apparently not the S gene, it is closely linked to S and might have a functional role in the SI reaction of Phalaris. Therefore, functional prediction analysis was carried out.
The deduced amino acid sequence of Bm2 was analysed using programs at the ExPASy site to understand its basic characters. Bm2 was predicted to be a cytoplasmic protein with a pI of
5.11 and a molecular weight mass of 14.4 kDa. The predicted amino acid sequence had a conserved thioredoxin h active centre, WCGPC (54-58). Other interesting sites were predicted including a N-myristolation site (GGCVGK, 2-7), a N-glycosylation site (NFAS,
49-52) and two kinase II phosphorylation sites (TKED, 28-31; STWD, 90-93). However, their E-values reached only about 10-2 to 10-3.
Figure 3.7 shows the alignment of several thioredoxins identified by BLAST searches. The amino acids around the active site, WCGPC, were highly conserved. There was a tendency that amino acids in the C terminal regions were more conserved than the N terminus. The lengths of the N termini before the active centres varied greatly. Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 47
1 50 E.c. TRX ...... MSDKIIHL TDDSFDTDVL 18 A.t. TRX-h-1 ...... MASE... ..EGQVIACH TVETWNEQLQ 22 B.n. TRX-h-2 ...... MAAE... ..EGQVIGCH EIDVWAVQLD 22 B.n. TRX-h 1 ...... MAATAEV IPAGEVIACH TVEDWNNKLK 27 E.c. TRX2 MNTVCTHCQA INRIPDDRIE DAAKCGRCGH DLFDGEVINA TGETLD.KLL 49 A.t. TRX-h-2 ...... MG GALSIVFGSG EDATAAGTES SEPSRVLKFS SSARWQLHFN 42 P.c. TRX h ...... MGGCVGK DRGIVEDKLD FKGGNVHVIT TKEDWDQKIA 37 H.s. TRX-ADF ...... MVKQIE SKTAFQEALD 16
51 100 E.c. TRX KADGA...IL VDFWAEWCGP CKMIAPILDE IADEYQGKLT VAKLNIDQNP 65 A.t. TRX-h-1 KANESKTLVV VDFTASWCGP CRFIAPFFAD LAKK.LPNVL FLKVDTDELK 71 B.n. TRX-h-2 TAKQSNKLIV IDFTASWCPP CRMIAPVFAD LAKKFMSSAI FFKVDVDELQ 72 B.n. TRX-h 1 AAKESNKLIV IDFTAVWCPP CRFIAPIFVE LAKKHL.DVV FFKVDVDELA 76 E.c. TRX2 KDDLP...VV IDFWAPWCGP CRNFAPIFED VAQERSGKVR FVKVNTEAER 89 A.t. TRX-h-2 EIKESNKLLV VDFSASWCGP CRMIEPAIHA MADK.FNDVD FVKLDVDELP 90 P.c. TRX h EANKDGKIVV ANFSASWCGP CRVIAPVYAE MSKT.YPQLM FLTIDVDDLV 86 H.s. TRX-ADF AA..GDKLVV VDFSATWCGP CKMIKPFFHS LSEK.YSNVI FLEVDVDDCQ 63 **** *
101 150 E.c. TRX GTAPKYGIRG IPTLLLFKNG EVASATKVGA LSKGQLKEFL DANLA.... 110 A.t. TRX-h-1 SVASDWAIQA MPTFMFLKEG KILD..KVVG AKKDELQSTI AKHLA.... 114 B.n. TRX-h-2 NVAQEFGVEA MPTFVLIKDG NVVD..KVVG ARKEDLHATI AKHTGVATA 119 B.n. TRX-h 1 TVAQEFDVQA MPTFVYMKGE EKLD..KVVG AAKEEIEAKL LKHSQVAAA 123 E.c. TRX2 ELSSRFGIRS IPTIMIFKNG QVVDMLN.GA VPKAPFDSWL NESL..... 139 A.t. TRX-h-2 DVAKEFNVTA MPTFVLVKRG KEIE..RIIG AKKDELEKQV SKLRA.... 134 P.c. TRX h DFSSTWDIRA TPTFFFLKNG QQID..KLVG ANKPELEKKV QALGDGS.. 131 H.s. TRX-ADF DVASECEVKC TPTFQFFKKG QKVG..EFSG ANKEKLEATI NELV..... 105
Figure 3.7 The multiple alignment of several thioredoxin proteins These thioredoxin h amino acid sequences were aligned using Pileup and Pretty Box programs (GCG, USA). P.c TRX (P. coerulescens the S linked thioredoxin); A.t. TRX-h-1 (A. thaliana thioredoxin-h-1, P29448); A.t. TRX-h-2 (A. thaliana thioredoxin-h-2, Q3887); B.n. TRX-h-2(B. napus thioredoxin-h 2, AAB53694); B.n. TRX-h-1(B. napus thioredoxin-h 1, AAB53694); E.c. TRX(E. coli, thioredoxin, AAA24696); E.c. TRX 2 (E. coli, thioredoxin 2, AAB88587); H.s. TRX-ADF (H. sapiens ATL derived factor, P10599).
The black backgrounds indicate amino acids conserved in the majority of sequences, the grey backgrounds indicate those with similar properties, and dots represent gaps introduced to optimise the alignment. ***** indicate the active centre.
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 48
To further predict function, the amino acid sequence was sent to SWISS-MODEL to model the tertiary structure. The lower BLAST P (N) limit for template selection was 10-8. Ninety- two amino acids from the C terminus were modelled perfectly against human thioredoxin
(Tagaya et al., 1989). The target protein and the model fitted well (Figure 3.8 A), with overall positives of 67%. Four β sheets aligned in the middle of the predicted protein with three surrounding α helixes (Figure 3.8 B & C). The active centre was on a protruding loop.
The first 40 amino acids, for which no tertiary structure could be predicted by the model, were mostly hydrophilic and highly charged (3.8 D). This part might form a protein-protein interaction site (A. Harvey, pers. comm., 2001).
3.4 Discussion
Based on the previous results (Li et al., 1994; Li et al., 1996), we had assumed that Bm2 was the pollen S gene of Phalaris. Thus the experiments were focused on characterising Bm2 homologues of pollen–only mutants. Several errors in the published sequence were identified. These errors had led to incorrect predictions of ORFs, so that the 5’ un-translated region of the Bm2 gene was mistakenly interpreted as an allelic domain. In the corrected sequences, there were no amino acid differences found between alleles. It is accepted that the variable domains of the S genes determine the allelic specificity. It has been demonstrated that S-RNase hypervariable regions control allelic specificity in Solanaceae (Matton et al.,
1997). Kakeda et al. (1998) demonstrated directly that the hypervariable domain of P. rhoeas
S protein played a crucial role in pollen recognition and may also participate in defining allelic specificity (Kakeda et al., 1998). So, the conclusion can confidently be drawn that
Bm2 is not the S gene of Phalaris but represents a new kind of thioredoxin h. Bian, X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 49
A B
1
2 Active centre Helic 2 Sheet 3 Helic 1 Helic 3 Sheet 1 Sheet 2 sheet 4 C
+1.44 Phob 0 D
-1.87 1 Phil 20 40 60 80 100 120 140
Figure 3.8 Functional prediction of the S-linked thioredoxin
A: Comparison of the backbone structures of the target protein (the S-linked thioredoxin) and model protein Human thioredoxin (ADF factor)
B: Ribbon drawing of the predicted structure of the S-linked thioredoxin. Arrow 1 indicates a putative phosphorylation site and Arrow 2 the active centre.
C: Schematic illustration of the secondary structures along the amino acid sequence
D: Hydropathy plots of the deduced amino acid sequences (Vector NTI, USA)
Chapter 3 Characterisation of a putative Phalaris S gene (Bm2) 50
The plant thioredoxins varies in their structure and function (Rivera-Madrid et al., 1995).
Five different kinds of thioredoxin were found in Arabidopsis thaliana (Rivera Madrid et al.,
1995). This diversity allows the transduction of a redox signal into multiple pathways.
Bower et al. (1996) first reported that two members (THL-1 and THL-2) of the thioredoxin h family interacted with the kinase domain of a Brassica S locus receptor kinase (SRK). The interaction with SRK is restricted to one class of thioredoxin h proteins, which have a variant
WCPPC active site (Mazzurco et al., 2001). However, the S-linked thioredoxin h has the normal WCGPC active site. The S-linked thioredoxin was modelled against the human thioredoxin, an IL-2 receptor/Tac inducer (Tagaya et al., 1989). This thioredoxin might be involved in dithiol-reduction in the IL-2 receptor induction. It might be an interesting future project to investigate the involvement of the S-linked thioredoxin in the self-incompatibility reaction in Phalaris.
As a consequence of the results reported in this Chapter, the proximity of Bm2 to S became a question with the highest priority. The accurate measurement of physical and genetic linkage of Bm2 to S might provide evidence for the function of the S-linked thioredoxin and may be a good starting point for map-based cloning of the S genes from Phalaris. The following
Chapters describe how this new question was approached.
Chapter 4
Genetic localisation of
the S and Z loci
A stigma pollinated with partial incompatible pollen stained with cotton blue
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 52
Chapter 4 Genetic localisation of the S and Z loci
4.1 Introduction
Map-based cloning (Paterson and Wing, 1993; Wing et al., 1994) allows cloning of genes whose products have not identified. Several genes have been successfully cloned by this method. It consists of mapping a trait in a large segregating population, identifying a genomic contig that covers the target region and characterising candidate genes (Tanksley et al., 1995). The pre-requisite is a high-resolution genetic map of the target region.
Genetic mapping of wheat, maize, and rice and other grass species with common DNA probes has revealed remarkable conservation of gene content and gene order (Gale and Devos, 1998).
This offers great advantages of mapping of the S and Z loci in Phalaris. Mapping efforts to locate the S and Z loci in the grasses have been reviewed in Chapter 1, which show that the S locus is located on the short arm of chromosome 1 and Z at the middle of the long arm of chromosome 2 in all grass species where mapping has been undertaken.
The operation of a gametophytic self-incompatibility system leads to distorted segregation ratios for genes linked to self-incompatibility loci in a partially compatible cross (Leach,
1988). The distorted segregation ratios can be used to estimate the recombination frequencies between a self-incompatibility locus and closely linked marker (Leach and Hayman, 1987; Chapter 4 Genetic localisation of the S and Z loci 53
Wricke and Wehling, 1985). Thus, distorted segregating populations were used in our mapping efforts.
The aim of the work reported in this chapter was to construct fine maps of the S and Z loci using distorted segregating populations as the first step in map-based cloning of S and Z from
Phalaris. RFLP probes were selected from wheat, barley, oat and rye genetic maps in the regions corresponding to S and Z. The resolution of the S fine map reached 0.13 cM. These efforts form a solid basis for map-based cloning of the S and Z genes of Phalaris.
4.2 Materials and methods
4.2.1 Mapping populations
Two distorted segregating populations generated in 1993 were used in mapping the S and Z loci. One cross (S1S1Z1Z2 × S1S2Z1Z1, called the S tester population) resulted in a population with an identical genotype (S1S2) at the S locus. The genotypes of the Z locus were either
Z1Z2 or Z1Z1. All the progeny in the S tester population were named STA numbering from
STA1. The other cross (S1S2Z2Z2 × S2S2Z1Z2, called the Z tester population) gave a population with an identical genotype (Z1Z2) at the Z locus, and the genotypes of the S locus were either
S2S2 or S1S2. All the progeny in the Z tester population were named ZTB numbering from
ZTB1.
4.2.2 Sources of RFLP probes
Table 4.1 lists the sources and types of RFLP probes used in this chapter.
Table 4.1 Sources of RFLP probes used
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 54
Clones Clone types Sources ABC American barley cDNA A. Kleinhofs, Washington State University, USA ABG American barley genomic A. Kleinhofs, Washington State University, USA B4e Phalaris cDNA P. Langridge, Adelaide University, AUS BCD Barley cDNA M. Sorrells, Cornell University, USA Bm2 Phalaris cDNA P. Langridge, Adelaide University, AUS CDO Oat cDNA M. Sorrells, Cornell University USA cMWG Barley cDNA A. Graner, IPK, Germany IAG Rye genomic P. Wehling, IAC, Germany KSU T. tauschii genomic B. Gill, Kansas State University, USA MWG Barley genomic A. Graner, IPK, Germany PSR1-200 Wheat cDNA M. Gale, John Innes Centre, UK PSR 201- Wheat genomic M. Gale, John Innes Centre, UK S-papaver Papaver cDNA F.C.H. Franklin, The University of Birmingham, UK S-RNase 7 Nicotiana cDNA E. Newbigin, University of Melbourne, AUS SLG/SRK 45 Brassica cDNA K. Hatakeyama, Tohoku University, Japan SLG/SRK 23 Brassica cDNA M. Kusaba, MAFF, Japan WG Wheat genomic M Sorrells, Cornell University, USA
4.2.3 Parental screening and progeny segregation analysis
The detailed methods for genomic DNA extraction, gel blotting and hybridisation are explained in Section 2.2.3. The genomic DNAs of the parents (S1S1Z1Z2, S1S2Z1Z1 S1S2Z2Z2, and S2S2Z1Z2) were digested by Bgl II, Dra I, Eco RI, Eco RV and Xba I. The parents for both the S and Z tester populations were used in parental screening to help distinguish the alleles. The probes selected from the barley, wheat oat and rye maps in the regions of S and Z were tested for cross hybridisation and ability to detect polymorphisms.
The probes showing clear polymorphisms were used for mapping. Leach (1988) reported the methods on how to calculate the distance between a marker and the S gene using partially compatible populations. Figure 4.1 explains this theory. For example, in the S tester population (S1S1Z1Z2 × S1S2Z1Z1) only half of the pollen grains (S2) are compatible and the other half of pollen grains (S1) incompatible. Thus, all individuals in this population should have the identical genotype (S1S2) at S. If there is a recombination between a marker (M) and
S, M will be homozygous in the S tester population. The number of homozygous individuals Chapter 4 Genetic localisation of the S and Z loci 55 in the population determines the recombination frequency (r) between S and M in the population. The recombination frequency (r) equals homozygous individuals (a) divided by total individuals (n) in the population. An approximately 95% confidence interval equals
r ±1.96× r(1− r) / n .
The individuals showing maternal genotype for all markers tested were not included the calculation, as the small genetic regions being worked on meant that double recombinations were rare. If an individual is homozygous for the markers at one side of a self-incompatibility locus and heterozygous for the markers at the other side of the locus, it is a true recombinant; if an individual is homozygous for the markers on both sides of the test locus, it is probably contaminant resulting from self-pollination.
The chromosome behaves in the tester populations like those in reverse backcrosses. So, the backcross model with codominant markers and unique paternal genotype were selected in
Map Manager QTXb08/QTB29ppc program to analyse the populations. The Kosambi’s mapping function was used for calculation of genetic distances (Kosambi, 1944). Genetic distance (X) = ¼ Loge[(1+2r)/(1-2r)].
4.2.4 Genotyping identified recombinants
Genotyping by pollination was carried out as in the previous report (Hayman, 1956). Un- pollinated stigmas were dissected out and “planted” on medium (2% agar, 10% sucrose and
0.0001% boric acid). After pollination, the stigmas were kept in a moist environment at 25°C overnight, stained
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 56
M1 M1 M1 M2 X S1 S1 S1 S2
The maternal parent The paternal parent S1S1Z1Z2 S1S2Z1Z1
M1 M2 M1 M1 M2 S1 S2 S2 S1 S1
Stigma Compatible Incompatible pollen pollen
M1 M2 M1 M1 S1 S2 S1 S2
Individuals with no Individuals with a recombination between recombination between M and S M and S
Figure 4.1 Schematic representation of the S locus and the marker M behaviours in the S tester population
In this cross, the maternal parent produces gametes with an single genotype and
the paternal parent produce four different genotypes of gametes. However, only the pollen grains with S2 can germinate on the stigma, so all progeny in the population is heterozygous at the S locus. The individual with a recombination between S and M is homozygous at M. Chapter 4 Genetic localisation of the S and Z loci 57 with a drop of pollen stain solution (100 mg cotton blue in 100 ml lactic phenol) on a slide and counted germinated and un-germinated grains of pollen under a microscope after 24 hours (Watkins, 1925).
4.2.5 Identification of AFLP markers closely linked to Z
DNA samples with different SI genotypes were bulked according to Z, thus three bulks (Z11,
Z12 and Z22) were produced. Each bulk included 9 DNA samples, whose S genotypes were
S11, S12 or S22. S pollen only mutants were used when need occurred. AFLP reactions were done according to Vos et al. (1995) with some modifications. Figure 4.2 gives the sequences of both adaptors and primers used. Genomic DNA (1 µg) was digested and ligated with annealed adaptors in a volume of 60 µl containing 1× RL buffer (10 mM Tris base, pH7.5 adjusted with concentrated acetic acid, 10 mM magnesium acetate, 50 mM potassium acetate,
5 mM DTT), 5 U Pst I, 5 U Mse I, 0.83 µM Mse I annealed adaptors, 0.083 µM Pst I annealed adaptors, 0.2 mM ATP and 1 U of T4 DNA ligase. The samples were incubated at 37°C for 3 hours and then kept at 4°C overnight.
PstI primer 5’-GACTGCGTACATGCAG-3’
Pst I adaptors 5’-CTCGTAGACTGCGTACATGCA-3’ 3’CATCTGACGCATGT-5’
MseI adaptors 5’-TACTCAGGACTCAT-3’ 3’- GAGTCCTGAGTAGCAG-5’
Mse I primer 3’-AATGAGTCCTGAGTAG-5’
Figure 4.2 Sequences of the adaptors and primers used in AFLP analysis
Pre-amplification PCR was carried out in a final volume of 25 µl containing 1× PCR reaction
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 58
buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 75 ng Pst I + A primer, 75 ng Mse I + C primer, 1 U
Taq polymerase and 4 µl of the digestion and ligation sample. Samples were amplified as follows: 20 cycles of 94°C for 30 seconds, 56°C for 1 minute and 72°C for 1 minute.
End-labelling of the Pst I primer was done in a final volume of 10 µl containing 1× PNK buffer (25 mM Tris·Cl, pH 7.5, 10 mM MgCl2, 5 mM DTT, 0.5 mM spermidine), 50 ng Pst I
+ ANN primer, 2U T4 Kinase, 10 µCi [γ-32P] ATP. The selective PCR was carried out in a final volume of 20 µl containing 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 30 ng Mse
I+CNN primer, 30 ng Pst I+ANN primer (end-labelled: un-labelled = 1:5) and 0.5 U Taq polymerase.
The same amount of loading buffer (98% formamide, 10 mM Na2EDTA, 0.05% bromophenol blue and 0.05 xylene cyanol) was added to each selective PCR. The samples were heated at
90°C for three minutes and chilled on ice. Samples (3.5 µl) were separated on 6% polyacrylamide sequencing gel (containing 7.5 M urea) at 40 W in 1× TBE buffer (90 mM
Tris base, 90 mM boric acid and 2 mM Na2EDTA) for 2.5 hours. The gel was dried on a piece of Whatman paper for half an hour and exposed to X-ray film for 1 or 2 days at -20°C.
4.3 Results
4.3.1 Parental screening and cross hybridisation tests
99 RFLP probes that had been mapped to chromosomes 1 and 2 of barley, wheat and rye were tested for cross hybridisation and ability to detect polymorphisms in Phalaris parents
(Table 4.2). Oat and wheat cDNA probes gave more polymorphisms than cDNA probes from barley. In total, 66% percent of tested cDNA clones showed strong cross hybridisation and Chapter 4 Genetic localisation of the S and Z loci 59 detected polymorphisms between parents. Compared with tested cDNA probes, the genomic probes from wheat and barley gave a lower percentage, 55%, of RFLPs.
To answer the question whether the SI system in Phalaris shares any common characters with other SI systems, SLG, SRK, S-RNase and Papaver S gene were used as probes to hybridise with Phalaris genomic DNA (Table 4.2). As expected, no S cDNA probes cloned from other self-incompatibility systems cross hybridised with Phalaris DNA at low stringency (1× SSC with 0.1% SDS at 65°C).
Table 4.2 Cross-hybridisation and polymorphisms of RFLP probes
Name of Probe type Number of Number of probes % probes able to probes probes tested showing polymorphisms detect polymorphisms ABC Barley cDNA 6 1 17% BCD Barley cDNA 18 8 44% CMWG Barley cDNA 3 2 67% CDO Oat cDNA 23 20 87% PSR1-200 Wheat cDNA 9 8 89% Sub total of cDNA 59 39 66% clones
MWG Barley genomic 5 3 60% KSU T. tauschii genomic 12 7 58% PSR 201- Wheat genomic 16 9 56% WG Wheat genomic 5 2 40% Sub total of genomic 38 21 55% clones
ABG Barley genomic 1 1 100% B4e Phalaris cDNA 1 1 100% Bm2 Phalaris cDNA 1 1 100% IAG Rye genomic 1 0 0%
S-papaver Papaver cDNA 1 0 0% S-RNase 7 Nicotiana cDNA 1 0 0% SLG-45 Brassica cDNA 1 0 0% SRK-45 Brassica cDNA 1 0 0% Total 105 63 48.5%
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 60
2 1 2 2 B A Z Z Z Z 1 1 2 1
Z Z Z Z Some individuals from 1 2 2 2 S S S S
1 1 1 2 the S tester population S S S S
MPMPMP R 2 1 2 2
Z Z Z Z D
C 1 1 2 1 Z Z Z Z
1 2 2 2 Some individuals from S S S S
1 1 1 2 the Z tester population S S S S
MPMPMP RR
Fig. 4.3 Parental and progeny segregation RFLP analysis.
Genomic DNA from the parents and from the tester populations were digested with restriction enzymes and hybridised with [32P]-labelled probes. The arrows indicate the polymorphic bands. M and P represent the maternal parent and the paternal parent of the tester populations. R denotes recombinants identified in the populations.
A and B: RFLP analysis of PSR653 with Bgl II digestion. C and D: RFLP analysis of MWG503 with Dra I digestion.
.
Chapter 4 Genetic localisation of the S and Z loci 61
4.3.2 Segregation analysis and map construction
Probes revealing clear polymorphisms between parents were used to analyse a subset of 96 individuals from the S tester population to produce a preliminary linkage group of S (Figure
4.3 A and B). Recombinants show the maternal banding pattern. Table 4.3 shows segregation data for 10 probes. Xbm2, Xpsr634, Xbcd207 and Xpsr544 showed the paternal genotype in all 94 individuals, indicating no recombination. Xcdo1173 and Xcdo99 detected
4 and 7 recombinants respectively and Xpsr653 and Xbcd22 detected another 2 and 4 different recombinants respectively. These suggest that Xcdo1173 and Xcdo99 are located on one side of the S locus and Xpsr653 and Xbcd22 are located on the other side. An S partial linkage group (Figure 4.4 A) was constructed using these data. Xbm2, Xpsr634, Xbcd207 and
Xpsr544 co-segregated with S. Xpsr937 and Xcdo1173 were about 4.3 cM from S, with
Xpsr653 and Xbcd22 2.1 and 4.6 cM on the other side.
To confirm these results and get a better resolution of the markers co-segregating with S, further individuals (273) from the S tester population were analysed. At this stage, the S tester population consisted of 352 individuals (Table 4.4). Xbm2 still co-segregated with S;
Xpsr634 was about 0.57 cM away from S and Xpsr653 was about 1.14 cM away from S on the other side (Figure 4.4 B).
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 62
Table 4.3 Segregation data for markers linked to S in the S tester population of 94 individuals
Total 95% Maternal Paternal Recom- Recombination Stand Marker number confidential LOD types types binants frequencies errors # intervals Xcdo99 4 83 3 87 3.5 1.96 0.7 9.7 20.5 Xcdo1173 4 90 0 94 0 0 0 3.8 28.3 Xpsr937 4 90 4 94 4.3 2.08 1.2 10.5 21.1 S 0 94 0 94 0 0 0 3.2* 28.3 Xbm2 0 94 0 94 0 0 0 3.2* 28.3 Xpsr634 0 94 0 94 0 0 0 3.2* 28.3 Xbcd207 0 94 0 94 0 0 0 3.2* 28.3 Xpsr544 0 94 2 94 2.1 1.49 0.3 7.5 24.1 Xpsr653 2 92 2 81 2.5 1.72 0.3 8.6 20.3 Xbcd22 3 78 9 79 11.4 3.57 5.3 20.5 11.6 Xb4e 11 80
#: Two individuals (STA12 and STA66) showing the maternal genotype for all markers were not included in the calculation.
* The standard error was calculated by the method of Stevens (1942) as there is no recombination between markers and S Chapter 4 Genetic localisation of the S and Z loci 63
Table 4.4 Segregation data for markers linked to S in the S tester population with 352 individuals
95% Maternal Paternal Recom- Total Recombination Stand Marker # confidential LOD types types binants number frequencies errors intervals Xcdo99 16 320 11 332 3.31 0.98 1.7 5.9 79 Xcdo1173 13 333 11 345 3.19 0.95 1.6 5.7 82.7 Xpsr634 2 349 2 351 0.57 0.4 0.1 2.1 100.3 S 0 352 0 352 0 0 0 0.9* 106 Xbm2 0 352 1 351 0.29 0.28 0 1.6 102.7 Xpsr544 1 350 3 351 0.85 0.49 0.2 2.5 98.2 Xpsr653 4 347 32 341 9.38 1.58 6.3 12.5 56.5 Xb4e 34 308
#: 15 individuals showing maternal genotype for all markers were not included in the calculation.
*: The standard error was calculated by the method of Stevens (1942) as there is no recombination between Xbm2 and S.
Xpsr937 and Xbcd207 are not shown in the table as they had the same segregation data as Xcdo1173 and Xpsr544 respectively.
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 64
B A
Xcdo99 Xcdo99 3.5
Xpsr937, Xcd01173 3.31 4.3 S, Xbm2, Xbcd207 Xcdo1173 2.1 Xpsr634, Xprs544 Xpsr937 2.5 3.19 Xprs653 Xpsr634
Xbcd22 0.57 S, Xbm2 0.29 0.85 11.4 Xpsr544 Xbcd207
Xpsr653 Xb4e 9.38
Xb4e
Figure 4.4 Partial linkage maps of S
A: The partial linkage maps was constructed with 94 individuals of the S tester population.
B: The higher resolution map was constructed with 352 individuals of the S tester population, including information from Panel A.
The map distances are in centiMorgans calculated with Kosambi's mapping function. Chapter 4 Genetic localisation of the S and Z loci 65
For Z, ten RFLP markers were used to construct a genetic map with a total of 211 individuals from the Z tester population (Table 4.5 and Figure 4.5). No co-segregating markers were identified for Z. The most closely linked marker was Xbcd266, which was about 1.0 cM away from Z. The closest markers identified on the other side of Z was about 12.0 cM away.
Table 4.5 Segregation data for markers linked to Z in the Z tester population
Marker Maternal Paternal Recom- Total Recombination Stand 95% confidential LOD types types binants number# frequencies errors intervals 19 98 Xcdo665 3 115 2.6 1.49 0.5 7.6 28.6 Xcdo1335 34 173 5 199 2.5 1.11 0.8 5.9 49.8 Xcdo366 29 172 3 107 2.8 1.6 0.6 8.2 26.3 Xpsr126 18 94 4 105 3.8 1.87 1 9.8 24.2 Xcdo474 27 175 2 202 1.0 0.7 0.1 3.6 55.9 XksuF15* 25 184 0 209 0 0 0 1.4 62.9 XksuF2 25 184 25 209 12.2 2.24 7.6 16.4 29.7 Z 0 211 2 211 0.9 0.67 0.1 3.4 58.6 Xbcd266 2 209 11 205 5.4 1.57 2.7 9.6 43.1 Xcdo680 13 192
#: One individual showed maternal genotype for all markers was not included in the calculation.
* Xmwg503 is not shown in the table as it had the same segregation data as Xksuf2.
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 66
Xcdo665* 2.6 Xcdo1335
2.5 Xcdo366
2.8 Xpsr126
3.8 Xcdo474 1.0 Xksuf15, Xmwg503, Xksuf2
12.0
1.0 Z Xbcd266 5.4 Xcdo680
Figure 4.5 Genetic map of Z
The genetic map of the Z locus was constructed with 211 individuals of the Z tester population. The marker with * was based on 118 individuals of the Z tester population.
The map distances are centiMorgans calculated with Kosambi's mapping function. Chapter 4 Genetic localisation of the S and Z loci 67
4.3.3 Distribution of recombinations in the S and Z tester populations
To understand the recombination distributions, Map Manager QTB29ppc was used to analyse the S and Z tester populations. In the S tester population (Figure 4.6), the most useful individuals were types L and M, which define the genetic limits of the S locus between
Xpsr634 and Xpsr544 in this population. Types K to F define markers located away from S on one side, whereas types N to Q defined the marker locations away from S on the other side.
Nearly 80% of individuals (Type A) in the population did not give any information for mapping. In the Z tester population (Figure 4.6 B), there were more classes of recombinants than for the S tester population even though only about 211 individuals were tested, and uninformative individuals made up 44% of the whole population. Types S and T gave the genetic limit on one side of Z and types O, P, Q and R set the limit on the other side of Z.
Types from N to E and Types U to W give information on markers relatively far away from Z.
The recombinants, which delimited the S and Z loci regions, were used in further fine mapping efforts.
4.3.4 Fine mapping of the S and Z loci
To find further markers tightly linked to S, RFLP markers from wheat and barley were probed on the membrane containing the two parents and four recombinants from the S tester population (Figure 4.7 A). These screenings identified probes that both showed polymorphisms and were closely linked to S (Figure 4.7 B&C). Xpsr168, Xbcd762 and
Xwg811 were identified as co-segregating with S in the S tester population of 352 individuals.
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 68
A A B C D E F G H I J K L M N O P Q R S Xcdo99 Xcdo1173 Xpsr634 S, Xbm2 Xpsr544 Xpsr653
Xb4e 279 5 2 9 2 2 6 1 1 3 5 2 1 2 1 28 1 1 1
B A B C D E F G H I J K L M N O P Q R S T U V W X Y
Xcdo665 Xcdo1335 Xcdo366 Xpsr126 Xcdo474 Xmwg503* Z Xbcd266 Xcdo680 93 4 67 1 1 1 1 1 1 1 1 1 1 1 1 1 8 13 1 1 4 4 1 1 1
Heterozygous for the locus Homozygous for the locus detected, the paternal type detected, the maternal type
Genotypes of the loci detected not clear
Figure 4.6 The recombination distributions of the S and Z tester populations
A: The recombination distributions of the S tester population with 352 individuals.
B: The recombination distribution of the Z tester population with 211 individuals.
The letters on the top of the chromosomes denote the different types, and the numbers under the chromosome are number of different types. Chapter 4 Genetic localisation of the S and Z loci 69
S S S S STA52 STA198 STA 361 STA54 A 1 1 1 2
Xcdo1173
Xpsr634
S Xpsr544
Xpsr653
B C 1 2 1 2 A198 A361 A52 A54 A52 A54 A198 A361 S S S S 1 1 1 1 S S S ST ST ST ST S S S ST ST ST ST
Figure 4.7 Identification of RFLP markers tightly linked to the S locus using both parents and recombinants A: Schematic representation of the genotypes and recombinations of parents and recombinants used in the screening. Genomic DNA from the parents and recombinant lines were digested with restriction enzymes and hybridised with [32P]-labelled probes. B: RFLP analysis of PSR168 with Bgl II digestion C: RFLP analysis of BCD207 with Dra I digestion The arrows indicate the polymorphic bands
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 70
Xcdo1173 Xpsr634 S Xpsr653 Xbcd22
3.2 0.59 0.71 2.5 8 8 6 6 0 0 6 6 0 0 8 8 1 1 5 5 2 2 9 9 A27 A27 A52 A52 A57 A57 A19 A19 A30 A30 A62 A62 A82 A82 A88 A88 A23 A23 A36 A36 A52 A52 A98 A98 A98 A98 A76 A76 A89 A89 A34 A34 A54 A54 ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST ST A
X? B X?
C *? 1 2 S S 1 1
S S Group 1 Group 2 Group 3 Group 4
Figure 4.8 Southern patterns of markers tightly linked to S.
S1 S1 and S1 S2 were the parents used to constructed the S tester population. Group 1: recombinants between Xcdo1173 and S in the first part of population with 94 individuals. Group 2: all recombinants between Xpsr634 and S locus; Group 3: all recombinants between Xpsr653 and S. Group 4: recombinants between Xbcd22 and S in the first part of the S tester population with 94 individuals.
A: Dra I digestion of the genomic DNA probed with PSR168. B: Dra I digestion of the genomic DNA probed with WG811. C: Bgl II digestion of genomic DNA probed with Bm2.
?: represents a contaminant from self-pollination X: represents the recombinant identified
Chapter 4 Genetic localisation of the S and Z loci 71
d921 d921
d762 d762 Xbc Xbc
S, S,
Xpsr544, Xbcd207, Xbc Xpsr544, Xbcd207, Xbc Xbm2, Xbm2, Xwg811 Xwg811 Xpsr168 Xpsr168 Xpr653 Xpr653 Xpr634 Xpr634
X X X X X X X XXXX 0.52 0.13 0.13 0.13 0.52
Figure 4.9 The breakpoints of the critical recombinants identified in the S tester population with 844 individuals
X: showing recombination
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 72
In order to identify further recombinants and increase resolution of the map, another 492 individuals of the S tester population were probed using PSR634 and PSR653. Thus the size of the S tester population reached 844 individuals. Five individuals showed recombination between Xpsr634 and S; another 6 individuals showed recombination between S and Xpsr653.
Markers (Bm2, BCD762, PSR168 and WG811) that detected no recombination in the small population were probed on these recombinant lines (Figure 4.8). One line (STA928), showing the maternal genotype for all these markers, was proved to be a contaminant in Section 4.3.5.
Xpsr168 detected a recombination (STA525) of the 6 recombinants between S and Xpsr653
(Figure 4.8A). Xwg811 detected a different recombination (STA306) of the 5 recombinants between Xpsr634 and S (Figure 4.8 B). Xbm2 still co-segregated with S (Figure 4.8 C). These results enabled to construct a fine map of the S region (Figure 4.9) with a resolution of 0.13 cM (one recombinant from a population of 844 individuals).
The strategy described above was also used to identify RFLP markers linked to Z. However, none were identified. Therefore, the AFLP technique was used to obtain more closely linked markers. A total of 128 primer combinations was screened by bulked segregant analysis
(BSA), but only 12 primer combinations showed potential polymorphisms. Figure 4.10A shower AFLP patterns of a primer pair on bulks. Further analysis was done on the 12 potential primer combinations on both parents of the Z tester population and recombinants.
Unfortunately, only one primer combination (Pst I ACA/Mse I CCT) gave the expected pattern, indicating a location between Xbcd266 and Xcdo680 (Figure 4.10 B&C). This suggests that the AFLP marker was not more closely linked to Z than Xbcd266.
Chapter 4 Genetic localisation of the S and Z loci 73
4.3.5 Genotype confirmation of the critical recombinants between the flanking markers of S and Z using pollination test
The S and Z genotypes of the key recombinant lines were tested to ensure that these lines had the expected genotypes and had not resulted from pollen contamination (Table 4.6). The individuals (STA12, STA66, STA928 and ZTB126) showing maternal genotype were contaminants from self-pollination, but the other individuals fit the expected genotypes.
Table 4.6 Genotyping of critical recombinants by pollination test
♂ 24A 85-2-5 1—3 1-3 etc. genotypes appraisal ♀ S2S2Z1Z2 S1S2Z2Z2 S1S2Z1Z1 S1S1Z1Z2 identified
STA 12 100% C 50% C N. A. N. A. S1S1Z1Z2 contaminant
STA66 100%C 50% C 0% C N. A. S1S1Z1Z2 contaminant
STA306 50% C 100% C 0% C N. A. S1S2Z1Z1 recombinant STA361 0% C 0% C N.A. 0% C S1S2Z1Z2 recombinant STA525 50% C 100% C N.A. 50% C S1S2Z1Z1 recombinant STA620 0% C 0% C N.A. 0% C S1S2Z1Z2 recombinant STA826 0% C 0% C N.A. 0% C S1S2Z1Z2 recombinant STA928 100% C 50% C 50% C N. A. S1S1Z1Z2 contaminant STA989 50% C 100% C N.A. 50% C S1S2Z1Z1 recombinant
ZTB126 50% C 0% C 100% C 50% C S1S2Z2Z2 contaminant ZTB168 0% C 50% C N.A. 100% C S2S2Z1Z2 recombinant ZTB177 0% C 0% C 0% C N.A. S1S2Z1Z2 recombinant C: indicating compatible; N. A.: indicating pollination test not applied
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 74
C A B
7
1 2 2 3 9 14 68 0 Z Z Z Z 3 6 1 1 2 3 1 2 2 1 2 2 B1 B B 177 B1 B Z Z Z Z Z Z Z TB60 Z Z Z T 1 1 2 T T 1 1 2 TB114 TB39 TB 17 TB168 Z Z Z Z Z Z ZT Z Z ZT Z Z Z Z Z Z Z Z
Xcdo665
Xcdo1335
Xcdo366
Xpsr126
Xcdo474
Xmwg503
Z
Xbcd266
Xcdo680
Figure 4.10 Identification of AFLP markers closely linked to Z
A: Pst I ACA/Mse I CCT primer combination show polymorphisms among Z1Z1, Z1Z2, Z2Z2 and Z3Z3 bulks. The Arrows indicate polymorphic bands.
B: Schematic representation of the genotypes of parents and recombinants used in Panel C. The different colours represent different genotypes
C: Confirmation of Pst I ACA/Mse I CCT primer combination on the Z tester parents and critical recombinants. Arrows indicate the polymorphic bands, which suggest that the bands detected by this primer combination were located at the same position as Xbcd266 Chapter 4 Genetic localisation of the S and Z loci 75
4.4 Discussion
4.4.1 Segregation distortion mapping egregation distortion associated with S or Z has been used previously to identify markers linked to the self-incompatibility loci (Leach and Hayman, 1987). Leach (1988) reported an extensive exploration of the types of crosses, methods of linkage estimation, progeny size and controls needed for accurate analysis of distorted segregation ratios. The work reported in this chapter represents the mapping of oat, wheat, barley and rye RFLP probes on Phalaris distorted segregating populations. This led to the construction of the high resolution maps of
S and Z regions. The S locus was delimited to within 0.25 cM with two flanking markers, and the Z locus to within 1.0 cM from one direction only. This opens the way for map-based cloning of the S and Z genes.
The advantages of using such populations for mapping S and Z are significant. The first advantage is that it saves a huge amount of time that would be need to genotype all individuals in large populations. When the population reaches a certain size, such as 1000 individuals, it is extremely difficult to genotype all individuals in the population. The second advantage is that this kind of population enables detection of contaminating individuals from cross-pollination. This is important as even a few contaminants would cause major inaccuracies when fine mapping. The contaminating levels of different batches of lines used in this study range from 0.2% to 5.1% for S, and from 0% to 1% for Z. These might be caused by the environmental conditions when the crosses were made. It is a common observation that in many self-incompatible grass species a few seeds are obtained after “self- pollination” (Hayman, 1992a; Gusford, pers. comm., 2001). The normal seed set of self-
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 76 pollination is about 1% and could be increased to 25% at temperatures of 30 to 35ºC. The highest selfing seed set was obtained for rye when exposed to the high temperatures together with 60-80% relative humidity 2 to 4 days before anthesis (Wricke, 1978).
Because of the high level of selfing contaminants identified in the populations used in this work, the real double recombinants on both sides of S and Z might have been lost. However, the limitation is probably trivial. The recombination rate between Xcdo1173 and Xpsr653 is
6.4%, and the map distance is 6.4 cM calculated by Kosambi’s mapping function. The rate of double recombination is about 0.035%, which means only 1 double recombination in 2869 individuals. The two flanking markers of Z showed a recombination rate of about 12.9 %.
The distance between these two markers is 13.1 cM. Thus the double recombination rate in this region is only 0.2%, which means there could be only about 1 double recombinant in 500 individuals of the Z tester population. The loss of one double recombinant would not make a large difference in the predicted genetic distances.
Another limitation of using this kind of populations is that only meiosis in microspore mother cells was tested, and the meiotic events in the megaspore mother cells were not detectable. A report has shown that the meiosis frequencies in the microspore and megaspore mother cell are different (Kearsey et al., 1996).
4.4.2 Genetic locations of S and Z
The Triticeae consensus and rye genetic maps were compared with the S and Z linkage maps
(Figures 4.11 and 4.12) to obtain information on the S and Z locations on chromosomes.
From this comparison, the S locus is located on the short arm of chromosome 1 close to the Chapter 4 Genetic localisation of the S and Z loci 77 centromere, and the Z locus in the middle of the long arm of chromosome 2. These locations are consistent with the report of Voylokov et al. (1998) on the map position of S and Z in rye.
These findings support the hypothesis that the S-Z self-incompatibility system might be common in the Pooideae subfamily. As reviewed Chapter 1, plants from the same family possess a common self-incompatibility system in dicots, the locations of S and Z loci in
Phalaris could be very useful for self-incompatibility study in the grasses generally.
4.4.3 Theoretical analysis of the genetic and physical ratios around the S and Z loci
The genome size of the Phalaris genus is relatively small, with a generic mean 2c DNA value from 2.8 to 7.8 pg (Watson, 1990). Viinikka (1993) examined three species of Phalaris and found that the chromosomes of P. coerulescens were the smallest, with a total haploid C- banded length of 31 µm. So, one can assume that the genomic size of P. coerulescens is close to 2.8 pg, which can be translated into 1400 Mbp/1C (with 1pg is about 1000 Mbp (Bennett and Smith, 1976). According to Kosambi's mapping function (Kosambi, 1944), the average distance per chromosome is about 150 cM, so the maximum total genetic length of Phalaris chromosomes is about 1050 cM. The average physical and genetic ratio is therefore about
1.33 Mb/cM.
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 78
Xcdo99 Xmwg913
3.31 9.7 5 Xcdo1173 Xpsr937 Xpsr937 2.9 10 Xpsr634 3.19 Xpsr634 Xpsr634 S, Xbm2 0.5 Xmsh2 1.7 0.57 S, Xbm2 0.29 Xpsr544 0.85 Xmwg506 14.0 Xbcd207 5 Xpsr653 9.38
Xmwg2077 Xb4e
AACB C
Figure 4. 11 Comparison of the S linkage map of Phalaris with Triticeae consensus and rye genetic maps
A: Simplified consensus map 1 of Triticeae with conserved segments from homologous rice chromosomes superimposed. The arrowhead indicates the centromere location (Deynze et al., 1995).
B: The S linkage map of P. coerulescens (Figure 4.4 B)
C: 1R partial genetic map of Secale cereale (Korzun et al., 2001)
Chapter 4 Genetic localisation of the S and Z loci 79
4 Xcmwg699 10.5 Xcdo665* 2.6 10 Xcdo1335 Xiag167 2.5 Xcdo366 Xpsr932 14.0 2.8 Xpsr126 7 3.8 Xcdo474 1.0 4.7 Xksuf11, Xksu2 12.0 Xmwg503 Z Xbcd266 1.0 Z 11.3 Xbcd266 4 5.4 Xcdo680 Xcmwg720
AB C
Figure 4.12 Comparison of the Z linkage map of Phalaris with Triticeae consensus and rye genetic maps
A: Simplified consensus map 2 of Triticeae with conserved segments from homologous rice chromosomes superimposed. The arrowhead indicates the centromere location (Deynze et al., 1995).
B: The Z linkage map of P. coerulescens (Figure 4.5)
C: 2R partial genetic map of Secale cereale (Korzun et al., 2001)
Bian, X.-Y. 2001. Ph. D. Thesis, The University of Adelaide 80
Reduced recombination is characteristic of the pericentric region of the large Triticeae chromosomes (Kunzel et al., 2000; Pedersen et al., 1995). The S locus is located in the sub- centromere region. Provided that there is about 4-fold suppression in this region (Kunzel et al., 2000), so the physical and genetic ratio at the S locus might be 5.6 Mbp/cM. Bm2 co- segregated with the S locus in a population with 844 individuals (only 844 meiotic events detected). In the population, there is still only 57% chance of resolving markers 0.1 cM apart.
At a 95% confidence interval, the maximum genetic distance of Bm2 from S is about 0.35 cM
(Stevens, 1942), which might cover about a 1.86 Mbp region. Even if one assumes that if there is no recombination suppression at the S locus, the distance separating S from the closest marker might be about 476 kb.
As for Z, the situation is no better. The Z locus is located in the middle region of the long arm of chromosome 2. If one assumes there is no recombination suppression in this region, the physical and genetic ration is about 1.33 Mb/cM. Provided a marker co-segregating with Z in a population with only about 211 individuals (211 meiotic events), the probability of resolving markers within 0.1 cM is about 19%. The 95% confidence interval is about 1.4 cM, so the distance between Z and the closest marker might be about 1.96 Mbp.
The chance of a positive lambda clone (no alternative library available for Phalaris, with insert sizes of about 20 kb) covering the locus is only 1.1%. However, the S and Z loci are located at the conserved homologous regions of the rice and Triticeae. Thus, the available
BAC libraries of barley and diploid wheat (http://www.genome.clemson.edu; Chapter 4 Genetic localisation of the S and Z loci 81 http://hbz.tamu.edu) and rice genome sequence data (Sasaki and Burr, 2000) could be helpful to clone the self-incompatibility genes of Phalaris.
Chapter 5
Analysis of barley and rice BAC clones
orthologous to the S and Z regions
Autoradiograph of barley BAC library membrane hybridized with 32P-labeled Bm2 cDNA
Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 83
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z regions
5.1 Introduction
The ratio of physical to genetic distances is a critical parameter for a map-based cloning strategy. Bacterial artificial chromosome (BAC) (Shizuya et al., 1992) and P1-derived artificial chromosome (PAC) (Ioannou et al., 1994) libraries provide good alternatives for analysis of complex genomes and physical mapping. The BAC/PAC vectors are propagated in E. coli as single copy super-coiled plasmids (Kim et al., 1992). There is no significant difference in restriction patterns of inserts after growth for over 100 generations in liquid media (Woo et al., 1994). The method for BAC DNA isolation is similar to the standard plasmid isolation techniques (Sambrook et al., 1989). However, it is unlikely that a Phalaris
BAC library will be available in the near future for map-based cloning work due to difficulties in the technique and limitations of funding (as discussed in Chapter 4).
The grasses could be considered as a single genetic system, as the gene content and gene order among grasses shows remarkable conservation (Gale and Devos, 1998). It should be possible to isolate genes that have been mapped precisely on the genetic map in one species by map-based cloning in another genome. Recently, a number of BAC libraries have become available for public use (http://www.genome.clemson.edu; http://hbz.tamu.edu), such as rice,
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 84 barely and cotton. In addition, the International Rice Genome Sequencing Project (IRGSP) provides extremely valuable information on progress in the sequencing of the rice genome
(Sasaki and Burr, 2000). Thus characterisation of BAC clones in model species could be helpful in understanding gene content in the S and Z regions
Several reasons make the barley BAC library the first option. Firstly, even though cultivated barley is self-compatible, its close relative, Hordeum bulbosum L., is self-incompatible and the S-Z self-incompatibility system has been demonstrated in this species (Lundqvist, 1962a).
Self-compatible barley might have been the result of mutations in the self-incompatibility genes and there might still be S and Z homologs in the barley genome. This situation has been reported in Lolium (Thorogood and Hayward, 1992) and rye (Lundqvist, 1959).
Secondly, even though barley has a relatively large genome, the ratios of physical to genetic distances are different along the barley chromosomes (Kunzel et al., 2000). Finally, when the author started the work reported in this Chapter, no rice genome sequence was available for the orthologous regions of S and Z.
The aims of the work in this chapter were to explore the possibility of using the barley BAC clones (Druka et al., 2000) and the rice genome sequence (Sasaki and Burr, 2000) to predict the ratio of physical to genetic distance in the S and Z regions and to seek candidate SI genes.
Bm2 and BCD266 cDNA clones, which have been mapped to the S and Z regions respectively
(Chapter 3), were used to screen a barley BAC library. The abundant repetitive sequences, which occupied the major part of identified BAC clones, limited the usefulness of these clones. The sequences of the markers closely linked to S and Z were used to BLAST search NCBI databases.
The rice clones identified by Bm2 and BCD266 denote the rice genomic regions orthologous to the S and Z regions. These results open the possibility of map-based cloning self-incompatibility Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 85 genes of the grasses with the aid of rice genome sequence information. The Bm2 positive rice clone contained several genes that might be involved in pollen tube germination and pollen- stigma interaction. The role of these genes and their involvement in the self-incompatibility reaction needs further study.
5.2 Materials and methods
5.2.1 Screening the barley BAC library
A total of 17 barley BAC library filters (6.5 times genome equivalent barley BAC library constructed from Hordeum vulgare var. Morex) were obtained from Clemson University
(Druka et al., 2000) (http://www.genome.clemson.edu/). This barley BAC library was constructed via cloning of Hind III partial digested barley genomic DNA into the Hind III site of the pBeloBAC11 vector (CVU51113).
BAC filters were pre-hybridised in 30 ml of hybridisation buffer (0.5 M Na2HPO4, pH 7.2,
7.5% SDS, 1 mM EDTA, 70 µg/ml sheared, denatured salmon sperm DNA) at 65°C overnight. The hybridisation was done in 30 ml hybridisation buffer with denatured [α-32P]- labelled probes at 65°C for 17 hours. The filters were washed twice in the bottles with 2×
SSC containing 0.1% SDS at 65°C for 20 minutes. The later washes were done at room temperature with the stringency of 1× SSC with 0.1% SDS or 0.5× SSC with 0.1% SDS depending on the signals. After being wrapped in food packing film, the filters were exposed to Fuji X-ray films at -80°C for 4 days. The addresses of positive clones were identified according to the instructions provided by the Clemson University Genomics Institute.
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 86
5.2.2 BAC plasmid extraction
BAC clones, obtained as stab cultures, were streaked on a plate of LB medium with 12.5
µg/ml chloramphenicol and cultured at 37°C overnight. A single colony was cultured in 5 ml
LB medium with 12.5 µg/ml chloramphenicol at 37°C with vigorous shaking for about 16 hours. BAC plasmid extraction was the same as in Section 2.2.4 of Chapter 2, except that 3M potassium acetate was used instead of 3M sodium acetate.
5.2.3 Dot blot analysis of BAC clones
Dot blot analysis was carried out to confirm positive identification of barley BAC clones.
BAC plasmid DNA (5 µl) and 5 µl 20× SSC were boiled for 3 minutes and chilled on ice for
3 minutes. The mixture (1 µl) was dotted on a Hybond N+ membrane and left to dry for 10 minutes. The DNA was cross-linked to the nylon membrane using 125 mJ of UV light in a
BioRad GS gene linker. The hybridisation was the same as detailed in Section 2.2.2 of
Chapter 2 except that pre-hybridisation solution was also used in the hybridisation. The washes were to 0.1 × SSC with 0.1% SDS at 65°C.
5.2.4 Southern fingerprinting analysis of BAC clones
BAC plasmid DNA (10 µg) was digested with Hind III to release the BAC vector and digest the insert. After blotting to a membrane, the restriction fragments were hybridised with the same radio-labelled BAC plasmids to reveal all restriction fragments. The size of fragments was calculated by Gel-Pro Analyzer (Media Cybernetics, USA).
Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 87
5.2.5 Pulse field gel electrophoresis (PFGE)
To estimate the insert length of BAC clones, BAC plasmid DNA (10 µg) was digested with
Not I to release the insert. Restriction fragments were separated in 1% (w/v) agarose gels
(14°C, 15 hours, 150 V, ramped from 1 to 14 seconds) using a contour-clamped homogeneous electric field (CHEF DR III system, BioRad, USA). The electrophoresis buffer was 0.5× TBE
(45 mM Tris-borate, pH 8.0, 1 mM EDTA). The Lambda ladder PFG marker was bought from BioLabs Inc (England).
5.2.6 Sample sequencing of Bm2 positive barley BAC clones
The Bm2 positive BAC clones were partially digested by Sau 3A. The digestion solution
(200 µl) with 50 µg BAC clone DNA was divided into 50, 40, 40, 40 and 30 µl portions. 25
U Sau 3A was mixed well into the 50 µl sample. Ten microliters of this mix was then transferred to the 40 µl sample and mixed. The same procedure was repeated in the next three samples. In this way, the five samples contained 0.5, 0.1, 0.02, 0.004, and 0.0008 U/µl Sau
3A respectively. All samples were incubated at 37°C for 40 minutes. The reaction was stopped by heating samples at 65°C for ten minutes. Then the samples were separated on a
1% agarose gel. The fragments from 1.9 to 0.7 kb were cut, purified and cloned into the pBluescript KS+ vector cut with Bam HI. A total of 396 sub-clones were randomly selected.
The sub-clones were digested with Eco RI and Xba I to release inserts from the plasmid.
After gel fractionation and blotting, the membranes were probed with radio-labelled barley genomic DNA (about 5 ng) or BAC vector DNA (50 ng). The sub-clones that showed no or weak hybridisation were sequenced from the T7 primer. The sequences were assembled with
Vector NTI Suite (InforMax, USA). The contig sequences were used to search NCBI databases for homologs.
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 88
5.2.7 BLAST search NCBI databases
To identify rice contigs orthologous to the S and Z regions, the sequences of the RFLP probes linked to S or Z were used to search databases at NCBI using BLASTN and TBLASTX algorithms (Altschul et al., 1997). The sequences of the probes PSR168, PSR544 and
PSR653 were provided by M. Gale (John Innes Centre, UK). The Bm2 cDNA sequence was described in Chapter 3. The CDO1173, BCD762, BCD207, BCD921, BCD266 and
CDO6680 cDNA sequences were obtained from GrainGenes (http://wheat.pw.usda.gov/).
The annotation of the identified rice contigs was done using RiceGAAS (Rice Genome
Automated Annotation System, http://rgp.dna.affrc.go.jp/Analysis.html).
5.3 Results
5.3.1 Identification of barley BAC clones that hybridise to Bm2 and BCD266 cDNA probes
Bm2 co-segregated with S and BCD266 was the closest marker to Z (Chapter 4). To obtain the barley BAC clones orthologous to the S and Z regions, the Bm2 and BCD266 cDNA clones were used to screen the BAC filters. Only 9 of 17 filters were screened using Bm2 and all 17 filters using BCD266. A total of 28 hybridisation BAC clones were identified. After dot blot analysis, Bm2 hybridised 259G2 (G2) and 578M2 (M2) and BCD266 to 7 clones:
35J8 (BAC1), 358N7 (BAC31), 366E19 (BAC33), 415H3 (BAC40), 439I20 (BAC43),
444O24 (BAC45) and 668M24 (BAC85).
5.3.2 Analysis of barley BAC clones orthologous to the S region
G2 and M2 BAC clones were fingerprinted by Hind III digestion (Figure 5.1 A). The Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 89 common restriction fragments indicated that these two clones overlapped. Figure 5.1 B shows that Bm2 hybridised to two common fragments of G2 and M2.
G2 and M2 were sized by PFGE (Figure 5.1 C). The restriction enzyme Not I was used to release the insert from the vector. Apart from the vector bands, two fragments were identified for two clones, which indicate that there is a Not I site in both G2 and M2 inserts. G2 and M2 had inserts of 118.6 and 84.5 kb respectively (Figure 5.1 C); thus the minimum length covered by these two clones was 118.6 kb.
5.3.2.1 Sample sequencing of G2 and M2
As Bm2 co-segregated with S, genes located on these two BAC clones might help to identify markers closely linked to S and candidate genes for S. G2 and M2 clones were therefore randomly sub-cloned and sequenced.
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 90
AB C G2 M G2 M2 G2 M2 M M2
kb kb 194.0 14.4 145.5 97.0 7.2 V 48.5 4.8 23.1 4.3 9.42 3.7 6.55 V 3.1 2.7 4.36 2.3 1.9
1.4 1.3 2.32 2.03
0.7 0.5
Figure 5.1 Fingerprinting and size analysis of Bm2 positive BAC clones
A: Ethidium bromide-stained agarose gel showing the restriction fragments of G2 and M2 digested with Hind III
B: The autoradiograph of the Southern blot of gel (A) probed with Bm2 cDNA. Arrows indicate Bm2 positive bands.
C: Ethidium bromide-stained PFGE gel showing the restriction patterns of G2 and M2 digested with Not I; with arrows indicating the fragments of inserts, G2: 102.6 kb + 16.0 kb = 118.6 kb; M2: 54 kb + 30.5 kb = 84.5 kb
M: molecular weight marker in kb; V: BAC vector Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 91
To get a representative coverage of these two clones, a randomly sub-cloned library was constructed. G2 and M2 clones were partially digested with Sau 3A (Figure 5.2 A). The Sau
3A concentration of 0.004 U/µl (lane 7,8) gave the partial digestion with major fragments within 0.7 to 1.9 kb. The restriction fragments (0.7 to 1.9 kb) from Lanes 7 & 8 were cut and cloned in pBluescript KS+ vector. A total of 398 sub-clones (named MS1 to MS198 and BS1 to BS198) were randomly selected and cut with Eco RI and Xba I (Figure 5.2B) to release inserts. After being probed with BAC vector (data not shown), 332 sub-clones were proved not to contain BAC vector. The average insert size was 0.86 kb with a range from 0.3 to 2.5 kb. The total length of these sub-clones was about 284 kb, so these sub-clones provided a two fold coverage of G2 and M2 clones.
After being probed with barley total genomic DNA, the clones showed differences in hybridisation intensity (Figure 5.2 C). Highly intensive hybridisation was assumed to represent highly repetitive sequences. Ninety clones that showed no or weak hybridisation were sequenced in one direction. The average sequence length (range from 200 to 750 bp) was about 640 bp with 0.5% errors.
The 90 short sequences were assembled into 43 contigs (C1 to C43) using Vector NTI. The lengths of contigs were from 200 to 1800 bp and G+C contents were from 27 to 60%. The total length of the 43 contigs was 28 kb, which gives ~20% coverage of G2 and M2 BAC clones.
All 43 contigs were used to search the NCBI non-redundant databases for homologs using
BLASTN algorithm. Table 5.1 lists 26 contigs that showed significant homology to the entries in NCBI. Six different contigs were highly homologous to the BARE-1
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 92 retrotransposon (Vicient et al., 1999), and another six contigs were highly homologous to the
BAGY-1 retrotransposon (Panstruga et al., 1998). Eleven contigs were highly homologous to non-coding barley genomic DNA. Two contigs showed high homology to dispersed repeat sequences of barley and wheat. One contig detected Bm2 cDNA. These results suggest that there might not be other single copy genes on G2 and M2 BAC clones.
The sub-clones of the remaining 17 contigs, which did not hit any homologs in the databases, were used to probe the Phalaris genomic DNA. However, none gave clear Southern patterns.
Figure 5.3 shows two examples of RFLP analysis of these sub-clones. These results indicate that no sub-clones could be used for mapping. Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 93
Table 5.1 BLASTN search results of the contigs assembled from G2 and M2 sub-clones
Contigs Species Hits Score, E-value Accession C11 P. coerulescens Bm2 204,4e-50 AF159389 C19 H. vulgare BARE-1 LTR 218, 3e-54 Z84541 C39 H. vulgare BARE-1 retrotransposon 75.8, 3e-11 AY013246 C4 H. vulgare BARE-1 retrotransposon 876, 0.0 AY013246 C21 H. vulgare BARE-1 retrotransposon 323, 6e-86 Z17327 C6 H. vulgare BARE-1 retrotransposon 252, 2e-64 Z17327 C31 H. vulgare BARE-1 retrotransposon 910, 2.8e-33, Z17327 C13 T. aestivum dispersed repeat sequence 91.7, 5e-16 X63514 C17 H. chilense dispersed repeat sequence 71.9, 4e-10 X70051 C16 H. vulgare BAGY-1 retrotransposon 85.7,3e-14 Y14573 C20 H. vulgare BAGY-1 retrotransposon 153,1e-34 Y14573 C28 H. vulgare BAGY-1 retrotransposon 180, 3e-43 Y14573 C30 H. vulgare BAGY-1 retrotransposon 660, 0.0 Y14573 C37 H. vulgare BAGY-1 retrotransposon 200, 7e-49 Y14573 C42 H. vulgare BAGY-1 retrotransposon 180, 6e-43 Y14573 C44 H. vulgare retrotransposon-like sequence 153,1e-34 U76261 C1 H. vulgare genomic DNA 117,3-e16 AY013246 C2 H. vulgare genomic DNA 117, 3e-16 AY013246 C22 H. vulgare genomic DNA 135,3e-29 AY013246 C12 H. vulgare genomic DNA 113,1e-22 AF078801 C3 H. vulgare genomic DNA 123.0,1e-025 AF078801 C43 H. chilense genomic DNA 173, 5e-25 AF028277 C38 H. vulgare genomic DNA 121, 6e-25 AF254799 C27 H. vulgare genomic DNA 185, 2.4e-59 AF254799 C29 H. vulgare genomic DNA 722.0, 0 AF254799 C34 H. vulgare genomic DNA 174.0, 2e-041 AF254799
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 94
1 2 3 4 5 6 7 8 9 10
A
1.9 kb
0.7 kb
B vector 1.9 kb
0.7 kb
C
1.9 kb
0.7 kb
Figure 5.2 Sub-cloning and sequencing of G2 and M2
A: Sau 3A partial digestion. G2 and M2 Plasmid DNA (~ 5 µg) was digested with different concentrations of Sau 3A for 40 minutes. Lane 1 and 2 was 0.5 U/µl; Lane 3 and 4 0.1 U/µl; Lane 5 and 6: 0.02 U/µl; Lane 7 and 8: 0.004 U/µl; Lane 9 and 10: 0.0008 U/µl.
B: Ethidium bromide stained agarose gel showing insert sizes of sub-clones digested with Eco RI and Xba I
C: Southern blot of the Gel (B) probed with 32P labelled total barley genomic DNA.
Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 95
A B
Bgl II Dra I Xba I Bgl II Dra I Xba I 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 (kb) 14.4
7.2
4.8 4.3
3.7 3.1 2.7 2.3 1.9
1.4 1.3
0.7 0.5
Figure 5.3 Southern blot of the sub-clones from G2 and M2
Genomic DNA from four different genotypes (1: S1S1Z1Z2; 2: S1S2Z1Z1; 3: S1S2Z2Z2 ; 4:S2S2Z1Z2 ) were digested with indicated restriction enzymes and hybridised with [32P]-labelled probes.
A: RFLP analysis of MS176
B: RFLP analysis of MS58
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 96
5.3.3 Overlapping and sub-cloning analysis of BAC clones orthologous to the Z region
The seven barley BAC clones detected by BCD266 were fingerprinted by Hind III digestion
(Figure 5.4 A) to obtain overlapping information for these clones. To reveal all the restriction fragments, the gel blot was hybridised with radio-labelled BAC plasmids (Figure 5.4 B).
Figure 5.4 C shows that BCD266 hybridised to a common fragment (14.4 kb) of all seven clones.
Figure 5.4 A & B shows that the seven clones overlapped significantly. BAC1 and BAC85 had unique fragments, so these fragments were the outmost ends. BAC43 and BAC33 showed almost identical restriction fragments. The remaining 3 clones showed a high degree of similarity. Table 5.2 shows the sizes of unique bands and common bands of these clones.
The order of these BAC clones was determined via the overlapping information (Figure 5.5).
The total length covered by these clones was about 158 kb. Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 97
Table 5.2 The Hind III fragment sizes of BCD266 positive BAC clones
Length of Number of Clones BAC1 BAC43 BAC43 BAC45 BAC40 BAC31 BAC85 fragments fragments 16.2 16.2 1 14.3 14.3 14.3 14.3 14.3 14.3 14.3 14.3 6 13.4 13.4 1 12.2 12.2 12.2 2 10.5 10.5 10.5 10.5 10.5 10.5 10.5 5 8.7 8.7 8.7 8.7 8.7 4 6 6 6 6 6 6 6 5 5.1 5 1 5 5 1 4.9 4.9 4.9 4.9 4.9 4.9 4.9 5 4.4 4.4 4.4 4.4 4.4 4.4 4.4 5 4.3 4.3 4.3 4.3 4.3 3 4.2 4.2 1 4.1 4.1 4.1 4.1 4.1 4.1 4.1 5 4 4 1 3.7 3.7 3.7 3.7 3.7 3.7 3.7 3.7 6 3.5 3.5 3.5 3.5 3.5 3.5 3.5 5 3.1 3.1 3.1 3.1 3.1 3.1 3.1 3.1 6 3 3 3 3 3 4 2.8 2.8 2.8 2.8 2.8 2.8 2.8 2.8 6 2.6 2.6 2.6 2.6 2.6 2.6 2.6 2.6 6 2.5 2.5 2.5 2.5 3 2.3 2.3 2.3 2.3 2.3 2.3 2.3 2.3 6 2.1 2.1 2.1 2.1 2 2 2.0 1 1.9 1.9 1 1.8 1.8 1.8 1.8 1.8 4 1.6 1.6 1.6 1.6 1.6 1.6 1.6 1.6 6 1.5 1.5 1.5 1.5 1.5 1.5 1.5 5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 5 1.4 1.4 1 1.3 1.3 1.3 1.3 1.3 1.3 1.3 1.3 6 1.2 1.2 1.2 1.2 1.2 1.2 1.2 1.2 4 1.1 1.1 1.1 1.1 1.1 1.1 1.1 1.1 6 Total length 110.9 79.3 79.3 88.2 70.4 96.1 94.8 158
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 98
A B C BAC 1 BAC 1 BAC 1 BAC 1 BAC 1 BAC 1 M BAC 1 BAC33 BAC33 BAC40 BAC40 BAC33 BAC33 BAC33 BAC33 BAC33 BAC40 BAC40 BAC31 BAC40 BAC31 BAC40 BAC40 BAC43 BAC45 BAC85 BAC43 BAC45 BAC85 BAC31 BAC31 BAC31 BAC31 BAC31 BAC43 BAC45 BAC85 BAC43 BAC45 BAC85 BAC43 BAC45 BAC85 BAC43 BAC45 BAC85 BAC43 BAC45 BAC85
kb 14.4 7.2 4.8 4.3 3.7 3.1 2.7 2.3 1.9 1.4 1.3
0.7 0.5
Figure 5.4 Analysis of BAC clones hybridised by BCD266
A: Ethidium bromide stained-agarose gel showing the restriction patterns of BAC1, BAC31, BAC33, BAC40, BAC43, BAC45 and BAC85 digested with Hind III.
B: The auto-radiograph of gel (A) blot hybridised with radiolabelled plasmids of these seven BAC clones
C: The autoradiograph of Southern blot of the gel (A) probed with BCD266
M: Molecular length markers in kb Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 99
158 kb
1.2
SA1, 18.1(2) 2.1 6.8(2) 36.4 (8) BCD266, 32.8. (9) 13.5 (3) 12.2 SB1, 34.9(7)
BAC1, 110.9 kb
BAC43, 79.3 kb
BAC33, 79.3 kb
BAC45, 88.2 kb BAC40, 70.4 kb
BAC31, 96.1 kb
BAC85, 94.8 kb
Figure 5. 5 Overlapping analysis of BCD266 positive BAC clones
The top rectangle represents the contig built via analysis of the Hind III restriction patterns of the BCD266 positive clones as shown in the Figure 5.4 A& B and Table 5.2. The numbers indicate the length of fragments in kb and the numbers in brackets indicate the numbers of different fragments. The outmost ends are designed as SA1 and SB1.
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 100
Xbcd266 was about 1 cM away from Z, so only the outmost ends (SA1 and SB1) were sub- cloned into pBluescript KS+ with Sau 3A complete digestion. Forty-eight sub-clones were randomly selected from SA1 and SB1 libraries respectively. After being probed with barley genomic DNA, eight sub-clones showed no or weak hybridisation from the SA1 library and
11 from the SB1 library. All these 19 sub-clones were probed on the Phalaris genomic DNA.
However, no sub-clones showed mappable polymorphic hybridisation patterns. Figure 5.6 A and B give two representatives of RFLP analysis of these sub-clones. The smear patterns indicated that these clones contain repetitive sequences.
5.3.4 Identification of rice BAC clones orthologous to the S and Z regions
The sequences of eight markers (PSR168, PSR544, PSR653, CDO1173, BCD762, BCD207,
BCD921 and Bm2) of the S linkage map (Chapter 4) were used to search the NCBI databases using BLASTN and TBLASTX algorithms to detect rice clones orthologous to the S region.
However, only Bm2 and CDO1173 detected rice clones with significant E values. One rice
BAC clone (Accession No: AC084817, Clone No: P0419C04) was detected with Bm2 with an E value of 8×10-22 and positives of 94% (120/127). The other rice BAC clone (Accession
No: AC079357; Clone No: P0033D06) was detected with CDO1173 with an E value of 3×10-
24. Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 101
AB Bgl II Dra I Xba I Bgl II Dra I Xba I 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 (kb) 14.4 7.2
4.8 4.3 3.7 3.1 2.7 2.3 1.9 1.4 1.3
0.7 0.5
Figure 5.6 Southern blot of the subclones from SA1 and SB1
Genomic DNA from four different genotypes (1: S1S1Z1Z2; 2: S1S2Z1Z1; 3: S1S2Z2Z2 ; 4:S2S2Z1Z2 ) were digested with indicated restriction enzymes, blotted onto a filter and hybridised with [32P]-labelled probes.
A: A representative Southern picture of subclones from SA1 region
B: A representative Southern picture of subclones of SB1 region
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 102
These two rice BAC clones are located on rice chromosome 5 and are 14 cM apart
(http://genome.sinica.edu.tw). The genetic position of P0419C04 on chromosome 5 is at 31 cM and P0033D06 is at 17 cM. The physical distance between these two clones in rice is about 2,420 kb (Saji et al., 2001). Based on the genetic distances between Bm2 and
CDO1173 being 4 cM (as calculated from Chapter 4), 600kb of the rice orthologous region would cover about 1 cM genetic distance in Phalaris.
As Bm2 co-segregated with S in Phalaris, the rice clone (P0419C04) detected by Bm2 was analysed further with the aid of RiceGAAS (Rice Genome Automated Annotation System, http://rgp.dna.affrc.go.jp/Analysis.html). The clone had not been fully sequenced and there were four gaps. The order of the pieces is believed to be correct as given; however the sizes of the gaps between them are not known. Figure 5.7 gives the 19 predicted genes on this rice contig (139.9 kb). The gene density was about 7 kb per gene. The prediction needs further confirmation.
The sequences of CDO680 and BCD266 of the Z linkage group were used to search the NCBI databases using BLASTN and TBLASTX algorithms. A rice BAC clone (H0212B02,
Accession No: AL442007) was hit with BCD266 with an E value of 5×10-11. CDO680 hit a rice clone (H0421H08; Accession No: AL442117) with an E value of 10-13. These two clones were located on rice chromosome 4 (http://rgp.dna.affrc.go.jp/cgi-bin/statusdb/seqcollab assign.pl?lab=NCGR).
However, the genetic and physical distances between these two BAC clones could not be found due to insufficient progress in sequencing. The clone (H0212B02) detected with Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 103
BCD266 was completely sequenced and annotated. Figure 5.8 gives the locations of 16 predicted genes on the 118.9 kb region. The gene density was 7.4 kb per gene. The genes located at the ends might be useful in obtaining markers more closely linked to Z.
5.4 Discussion
5.4.1 Limited usefulness of the barley BAC clones identified in this study
The aim of identifying barley BAC clones orthologous to the S and Z regions was to develop markers that could be mapped on Phalaris genetic maps to measure the ratio of physical to genetic distances in these regions. Bm2 and BCD266 were used to screen the barley BAC library. Two positive clones were detected with Bm2 and seven positive clones with
BCD266. However, none of the sub-clones developed from the barley BAC clones gave mappable RFLP markers on Phalaris genomic DNA. There are several possible reasons for these results. First, although conservation has been found among the grasses, it appears to be limited to genes. A comparison of the rice and barley DNA sequences revealed the presence of four conserved regions, containing four predicted genes (Dubcovsky et al., 2001).
Avramova et al. (1996) reported that a bacterial artificial chromosome (BAC) clone containing sorghum genomic DNA was selected using a maize Adh1 probe. The 165 kb sorghum BAC was tested for hybridisation to a set of clones representing the contiguous 280 kb of DNA flanking Adh1 in maize. None of the repetitive maize DNAs hybridised, but most of the low-copy-number sequences did. A low-copy-number sequence that did cross- hybridise was found to be a gene, while one that did not was found to be a low-copy-number retrotransposon that was named “Reina” (Avramova et al., 1996).
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 104 ] na n ] ia ei t al o ] ana i th n s al i ei ana h t ch pr i t o n ri s pr ei dops hal u-
t o G4 s t opsi Gl abi si ress a/ id p e pr Ar b [ st v Al a i r ido n at A ei t ab ersal ] o ase v a s Ar s put [ o tiv r nase [ uni si e pr ] sp e p v t ei n sa t o r na a o d o ati a z i p tra y e put v hal al pr ans Or ti r t e Arabi n i a e [ is e t e m nas d r as
put i s e ops k t g th o i l- id p n y b in ei x t s ont ans o p r sacchari t Ara c a [ e no r pr n c carbo o i ] o e g e m t m ri o u e t th h pr recept en beros cal es r eti h t um tu nes on t o i rep e l p
Al . hy [ d g n G4 e e t tio c to i nas G3 li rip ed G1 al c
r . s b e p an k n i tr th .9 e
t 5 o 3 of of n 1 n l pr t o a u i t m ctio a o e t s n abo bo s i 2 a r e dir ] w Bm prese ig ana te th i Bm2 re l a nt h c a t c h i i ti t d co is ] w s i ma in va h ed i t t t
dops f a c ws e o o t a s abi e sche th h Ar g [ T
) de e arr Oryz n [ i
e e r ] e o as k ot Th i s . r at l tal len s ana o G2 - c i p p n re 5.7 o i l ] ke tig e 419C04 a i hal t l ans n 0 n o t - n r ans s t a r n i ei t i Figu (P The to co l G1
pr t a l e o h a opsi tha m ) pr id s n y c r o i phat s v s ei jo cal a t o a e o Arab eti h dops
[ h endo t n a m e ph i abi s iv po cal pr o i y Ar y at h [ m hmani thet put s o p Lei y ( h Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 105
n ei t o r n p ei t n i cal o r i e t et o h e pr t k facto i
l po n - y o B2 pr n
i i h os hur ript y p c
l m
ans su ig r h g i n t ont h tion of ai c m e o d n o direc ric ei e t o m n r o ei the t p h o e te r v cal a i i p t s on the a et t h cal t ne i ndic pu e et e po i h s t as hy l 6 o po r ted g y d h ic D26 hy d arrow l e y BC ac e/ . The as p the pr i l n on of bp long ei i t o r tat n e p e s ik l - e pre BCD266 h feras c re bout 118969 s i n s a ran t a ei l mat t ed wit o ny r he w ct o f p r e ) te k cu i va l u th o i l - t g e ) de e a The sc ng on. a s nas eras i f e l le yz UDP- s 5.8 ta e rag an Or s e a o r ( a t
cerat p l n n y ly das e 0212B02 as s ei t o xi d og og o c Figure (H The t transcripti h te u dr p l pr ia s y e g pero c o h s o h a cal i p de n ss et a ki - h t ll o a p w hy
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 106
Second, in this study, two different kinds of retrotransposons (BARE-1 and BAGY-1) were identified in the barley BAC clones detected by Bm2, which might occupy a proportion of
G2 and M2 clones. Retrotransposons are mobile genetic elements that transpose through reverse transcription of an RNA intermediate (Kumar and Bennetzen, 1999). They are ubiquitous in plants and comprise over 50% of nuclear DNA content. Four novel retrotransposons, designated Nikita, Sukkula, Sabrina, and BAGY-2 and several units of the known BARE-1 element have been identified in a 66-kb contiguous sequence of barley
(Shirasu et al., 2000).
Thirdly, the abundant repetitive sequences, which occupied the major part of the barley BAC clones orthologous to the S and Z regions, suggest that the gene densities of the barley BAC clones might be very low. As there is an assumption that the total genes in flowering plants is about 35,000 (Miklos and Rubin, 1996), and the genome size of barley is 5×109 (Bennett and
Smith, 1991), the average gene density of barley is about 143 kb/gene. It is therefore quite possible that there are no genes, other than the marker genes, in the barley BAC clones identified in this study.
Finally, conservative regions between barley and Phalaris in the identified BAC clones might not be represented in the sub-clones selected in this study. It may still be possible that some parts on the BAC clones can be mapped on Phalaris genetic maps.
5.4.2 Identification of rice clones orthologous to the S and Z regions
The purpose of identifying rice contigs orthologous to the Phalaris S and Z regions was to Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 107 obtain some clues on the ratio of physical to genetic distances in these regions and to seek candidate self-incompatibility genes. The sequences of markers on the S and Z linkage maps were used to search NCBI databases. Bm2 and CDO1173 hit two linked rice clones, which are located in rice chromosome 5. BCD266 and CDO680 hit rice BAC clones that are in rice chromosome 4. The identification of rice regions orthologous to the S and Z regions provide a starting point of map-based cloning of SI genes via the aid of rice genome sequence information.
It was found that a rice contig of 600 kb could cover 1 cM genetic distance in the S region of
Phalaris. As the Phalaris genome is at least three times larger than that of rice (Chapter 4), the physical and genetic ratio in Phalaris is more than 1.8 megabase/cM. This is higher than the genome average ratio of 1.3 megabase/cM. This result supports the expectation that recombination rate might be suppressed in the S region.
One limitation of this calculation is that a large rice physical distance was used. The ratios of physical to genetic distances are not even along genome, even in small physical regions. It was found the relationship between physical and genetic distance can deviate by one or two orders of magnitude in the different regions of the barley genome (Buschges et al., 1997). A similar situation was seen in a 550 kb of apple genome region, in which the physical to genetic ratios varied largely (Patocchi et al., 1999).
When the sequences of the seven markers (PSR168, PSR544, PSR653, CDO1173, BCD762,
BCD207, BCD921 and Bm2) in the S linkage map were used in BLAST search in NCBI, only
Bm2 and CDO1173 detected rice contigs. One reason why the other probes could not detect significant clones might be that the sequence project of rice chromosome 5 was not completed
Chapter 5 Analysis of barley and rice BAC clones orthologous to the S and Z loci 108 at the time of the searches. Another reason might be that some probes (PSR544 and PSR653) are wheat genomic probes, which are less conserved between species. The third reason might be that the sequences used in BLAST search were the partial sequences of the probes.
When the rice sequencing project (Sasaki and Burr, 2000) is completed, it will be feasible to use rice contigs to cover the entire S and Z regions. At a 95% confidence interval, the maximum genetic distance of Bm2 from S is about 0.35 cM (Stevens, 1942). If the micro- colinearity is conserved, the distance between Bm2 and S would be within a 210 kb of rice physical fragments. Other clones, which overlap with Bm2 positive BAC clones, would be needed. The predicted genes on the outmost ends of this contig could be used to limit the rice physical region orthologous to the S region. One could use the rice contig sequences to predict genes. Homologs of these genes in Phalaris could be identified, and study of the expression pattern of these genes would shed light on the functions of these genes.
Alternatively, the identified rice BAC clones could be used as probes to screen the Phalaris stigma and pollen cDNA libraries. The expression patterns of identified cDNA clones should give some clues of their function. This method has been used to search for expressed sequences in a 76-kb SLG/SRK region of the S-9 haplotype of Brassica campestris and successfully predict the candidates for the pollen S gene (Suzuki et al., 1999).
The limitation of using rice contigs to seek candidate S genes is that the homologs of SI genes might not be present in the rice genome. Although there may be SI in wild rice (Nayar, 1967;
Oka and Morishima, 1967), the genetics of the wild rice system has not been determined. On the other hand, cultivated rice varieties are self-compatible. In the Brassicaceae, the deletion of SI genes has been proposed as a mechanism for the evolution of autogamy in the Bian X. –Y. 2001. Ph. D. Thesis, The University of Adelaide 109
Arabidopsis (Conner et al., 1998). A similar process may have led the loss of SI in cultivated rice. If a large deletion has caused SI loss, then the markers developed from rice sequences may not be sufficiently close to allow identification of SI genes from Phalaris. Another problem may be that micro-colinearity may breakdown in the region of the SI genes. Kusaba and his co-workers (2001) reported that the S locus of Arabidopsis lyrata occupies a different chromosomal location to the Brassica S locus. Similar situation has been reported by
Strommer and his co-workers (2000) reported that That is, the S locus in these two closely related species show evidence of a complex evolutionary history characterised by translocations and gene duplications. Recent studies at the gene level have demonstrated that micro-colinearity of genes is less conserved than originally predicted (Keller and Feuillet,
2000). Small-scale rearrangements and deletions complicate the micro-colinearity between closely related species, such as rice and other grasses.
Chapter 6
General discussion
Pollen tubes
T T
S2 Z2 S1 Z2 Stigmas Z2 S1 Z2 S1 Z2 S1 Z2
S1 Z1 Z1 S2
ComCompatatiiblble InIncommppatatiblele
A diagram showing self-compatible and self-incompatible reactions of the S-Z system
Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 111
Chapter 6 General discussion
Self-incompatibility is an important genetic mechanism preventing inbreeding and gene pool simplification. Several different SI systems have been developed during the course of flowering plant diversification. The grasses possess a unique SI system, which is under the control of two unlinked loci, S and Z. As reviewed in Chapter 1, P. coerulescens provides a model plant to study SI in the grasses. Li et al. (1994) identified a putative S gene (Bm2) from mature pollen of P. coerulescens using a differential screening technique. Bm2 was proposed as the pollen S gene, as it co-segregated with S, had a highly conserved thioredoxin domain and an allelic domain, and was strongly expressed in mature pollen.
The first aim of this project was to test the assumption that Bm2 was the pollen S gene of
Phalaris. However, the isolation and sequencing of Bm2 homologous cDNAs from two S pollen-only mutants provided data that conflicted with previously published results (Chapter
3). Several errors in the sequences of the previous report (Li et al., 1994) were identified and the allelic domain was shown to have been wrongly predicted. In the corrected sequences,
Bm2 has the thioredoxin domain only and no amino acid differences were identified between the alleles studied. As discussed in Chapter 3, it is assumed that the variable domains of the S genes determine the allelic specificity. On this basis, Bm2 could not be the S gene of Phalaris but represents a new type of thioredoxin.
There are still several lines of evidence suggesting that Bm2 may be still involved in the SI
Chapter 6 General discussion, Appendices and References 112 reaction of Phalaris. First, detection of Bm2 mRNA in the vicinity of the pollen tube and stigma interaction in an incompatible pollination (Baumann et al., 2000) suggests involvement of Bm2 in the SI reaction. Second, Bm2 co-segregated with S in a large population (Chapter 4). Hayman (1992b) argued that any genes involved in the SI reaction must be located at S, Z or T, or closely linked to these loci as no other loci were identified in a comprehensive search for mutations affecting the SI in Phalaris. Third, several recent studies showed that thioredoxin h might be involved in the self-incompatibility reaction of
Brassica (Cabrillac et al., 2001, Mazzurco et al., 2001, Bower et al., 1996). However, the role of the S-linked thioredoxin in the SI reaction of Phalaris needs further study.
The removal of Bm2 as a candidate S gene in Phalaris meant that it was necessary to reinstate the search for S and Z. Several strategies had been tried to clone SI genes from the grasses
(Chapter 1), but all had failed. The aim of this project was thus to explore the possibility of using a map-based cloning strategy to clone the SI genes from the grasses.
The first requirement of map-based cloning is a reliable fine map in the target region. To map
S and Z, tester populations were developed. The type of populations constructed enables one to map the target locus and readily distinguish recombinants from contaminants. At the initial mapping stage, it was thought that there might be two recombinants between Bm2 and S in the
96 individuals of the S tester population. These two recombinants proved to be contaminants by pollination tests and Southern results of other markers linked to S. In rye, Wehling (pers. comm.) also identified three putative recombinants between Bm2 and S in a population of 107 individuals. Unfortunately, the testing and confirmation of such putative recombinants is very difficult to achieve in rye, an annual, relative to the perennial, Phalaris. Therefore, the apparent recombination between Bm2 and S in rye cannot be given great weight. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 113
Using RFLP probes developed from wheat, barley, oat and Phalaris, partial linkage maps of the regions surrounding S and Z were constructed (Chapter 4). Xpsr634, Bm2 and Xpsr544 were closely linked to or co-segregated with S. Xbcd266 was found linked to Z. Similar results have been found in rye (Voylokov et al., 1998) and Hordeum bulbosum (K. Kakeda, pers. comm.). These results add further support to the conservation of gene order in the S and Z regions in the grasses. The conservation of an S locus region during the speciation of a family has been seen in other self-incompatibility systems. The co-localization of CP100 (a cDNA marker linked to the S locus of potato), peroxidase and the S-locus in Petunia revealed synteny around the S locus between four members of the Solanaceae (ten Hoopen et al.,
1998). A high degree of colinearity at the sub-megabase scale between the two homeologous regions of the S locus has been found in the crucifer family (Conner et al., 1998). These results support the conclusion that self-incompatibility arose early in the diversification of plants and a single self-incompatibility system exists within a family.
Fine maps of the S and Z regions were developed. Bm2 co-segregated with S in 844 individuals of the S tester population (Chapter 4). Several lines of evidence suggest that the S region of the grasses is highly conserved and shows little sequence diversity. Firstly, no variation was found in the Bm2 predicted amino acid sequences from two different alleles.
Secondly, Bm2 proved to be very difficult to map in wheat or barley (data not shown). An extensive collection of mapping populations with corresponding molecular maps are available in this laboratory as part of the Australian molecular marker programs. However, no RFLP polymorphisms could be identified between the parents used to constructed these populations.
The high level of sequence conservation can be extended to the Z region. It has been hard to find polymorphic RFLP and AFLP markers for Z. These results support the assumption that
Chapter 6 General discussion, Appendices and References 114 self-incompatibility genes had been recruited from ancestral gene families during the early stages of angiosperm evolution and, since that time, new alleles have arisen at a low rate (Xue et al., 1996). It has been estimated, from a Lolium perenne population, that there are over 17 alleles at each locus (Fearon et al., 1994). Wang et al. (2001) proposed that intragenic recombination contributed to the generation of the allelic diversity of the S-RNase gene
(Wang et al., 2001) and mutations have been found to generate new alleles in a self- incompatible population (Matton et al., 1999). Therefore, there must have been a period of high recombination when the S (and Z) allele diversity was generated. However, these genes then appear to have been fixed and shielded from further diversification.
The S locus is located to the short arm of chromosome 1 close to the centromere (Chapter 4) where the recombination rate is reduced compared with more distal regions (Pedersen et al.,
1995). Locations of S in a conserved region of genome might be helpful to maintain its intactness through minimising further allele generation and keeping the pollen and stigma S genes closely linked. Ten Hoopen et al. (1998) argued that a sub-centromeric localisation of the S locus in Petunia was helpful in maintaining a functional S allele by preventing separation of pollen-S from the stigma S-RNase.
Self-incompatibility is a complex reaction involving several genes. As reviewed in Chapter 1, there are at least three loci involved in the SI reaction in Brassica with the S locus responsible for initiating the SI reaction. In the grasses, both S and Z are responsible for triggering SI through allelic recognition. In addition to S and Z, a third non-allelic locus, T, has been shown to be involved in the SI reaction in Phalaris and all the T mutants identified were pollen-only mutants (Hayman and Richter, 1992b). This result suggests that the SI reaction might take place in pollen. The T gene product may provide a component in the signal Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 115 transduction pathway that follows pollen-stigma recognition. Although Wehling and co- workers (1994a) proposed that receptor protein kinases might be the products of S or Z, there are no further results to support this hypothesis.
The second requirement for map-based cloning is the construction of a physical contig to cover the target region. As discussed in Chapter 4, there were no Phalaris BAC libraries available, but the gene content and gene order among grasses shows remarkable conservation
(Gale and Devos, 1998). Therefore it is possible to isolate the target genes in the orthologous regions of other grass species. Homologs of the SI genes were assumed to be presented in cultivated barley as its close relative, H. bulbosum, has the SI system (Lundqvist, 1962a).
Barley BAC clones orthologous to the S regions were identified using the Bm2 cDNA.
However, sample sequencing of the BAC clones suggests that retrotransposons occupy the major part of the BAC clones, limiting their usefulness for the identification of markers closely linked to S and seeking candidate genes for S. Once again, these results suggest that the S region has a low gene density and little sequence diversity.
Several lines of future research could now be proposed. Firstly, identification of the rice genome regions orthologous to the S and Z regions opens the gate to use rice genome sequencing information to clone SI genes from Phalaris. There have been reports of SI in wild rice (Nayar, 1967, Oka and Morishima, 1967), although there has been no recent literature on this system. Ideally the genetics of the putative wild rice SI system should be determined. When the rice sequencing project (Sasaki and Burr, 2000) is completed, it will be feasible to use rice contigs to cover the entire S and Z regions. The genes predicted in rice genome are useful not only to develop markers closely linked to S and Z, but also to seek candidate genes for self-incompatibility. If the rice contigs do not contain SI gene homologs,
Chapter 6 General discussion, Appendices and References 116 differential display (Liang and Pardee, 1992), cDNA-AFLP (Bachem et al., 1996), or
Restriction Fragment Differential Display (RFDD-PCR) (www.displaysystems.com) could be used to analyse the mRNA profiles of different S and Z genotypes. The candidate bands could be cloned and mapped.
Secondly, map-based cloning of T should be helpful in elucidating the mechanism of the SI reaction. The tester populations used in Chapter 4 were useful in producing the S and Z linkage maps. However, the absence of allelic variation at T makes this approach impractical
(Hayman, 1992a). T could be mapped using a population produced from “selfing” of heterozygous individuals at T, using the functional and mutated formes as two the alleles, but genotyping of progeny plants would be needed. This approach has been used in rye to map the SI loci (Voylokov et al., 1998).
A third approach would be further analysis of a possible link between SI and protein phosphorylation. Loss of SI in self-compatible (SC) mutants in rye was associated with a significantly decreased basic phosphorylation activity in untreated pollen grains as compared to SI genotypes. Separation of phosphorylated pollen proteins by SDS-PAGE revealed four major proteins in the MW range of 43-82 kDa that were differently phosphorylated in SI versus SC genotypes as well as in cross versus self-treated pollen grains (Wehling et al.,
1994a). In addition, protein phosphorylation/dephosphorylation, which is carried out by protein kinases and phosphatases, has a very important role in signal transduction (Sopory and Munshi, 1998). Involvement of protein phosphorylation in self-incompatibility reaction has been found in Brassica (McCubbin and Kao, 2000, Cabrillac et al., 2001) and Papaver
(Jordan et al., 2000).
Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 117
In conclusion, several important advances have been made during the project. Analysis of
Bm2 cDNA homologs in pollen-only mutants corrected previous errors in the study of
Phalaris SI and opened the way to adopt a new strategy for cloning the SI genes of the grasses. Construction of fine maps of the S and Z region using distorted segregating populations provided information on the genetic locations of S and Z, shed light on the evolution of SI in the grasses and set a starting point for the map-based cloning of these genes. Identification of the rice genome regions orthologous to the S and Z regions opens the possibility of using the rice genome sequence identify SI candidate genes and generate new markers closely linked to S or Z.
Appendices
Appendix A: Solutions and buffers
100× Denhardt's III: 2% bovine serum albumin (Fraction V, sigma), 2% Ficoll 400, 2% Poly-vinyl-pyrrolidone 360 and 10% Sodium dodecyl sulfate
1× Dephosphorylation buffer : (50 mM Tris-HCl, 0.1 mM EDTA, pH 8.5)
6× Ficoll dye: 15% Ficoll type 4000, 0.25% bromphenol blue, 0.25% xylene cyanol FF
1× HSB: 0.6 M NaCl, 20 mM PIPES, 5 mM Na2EDTA pH6.8 with NaOH
1× ligation buffer: (66 mM Tris-HCl, 5 mM MgCl2, 1 mM dithioerythritol, 1 mM ATP, pH 7.5)
Luria-Bertaini Medium (LB) : 1% Bacto Tryptone, 0.5% Yeast extract and 0.5% NaCl, Adjust pH to 7.5 with NaOH and Autoclave
PBS: 8.1 mM NaH2PO4, 1.5 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, ph7.5
1× SDB buffer: 330 mM Tris, pH 7.8 adjusted with concentrated acetic acid, 650 mM Potassium acetate, 100 mM Magnesium acetate, 40 mM Spermidine, 50 mM Dithiothreitol
1× SSC:150 mM NaCl, 15 mM tri-Sodium citrate
1× SSPE:180 mM NaCl, 10 mM NaH2PO4, 1 mM EDTA, pH=7.4
SOB medium : 2% Tryptone Peptone, 0.5% Yeast extract, 0.06 % NaCl, 0.02% KCl, 10 mM
MgSO47H2O & 10 mM MgCl2
1× TAE buffer: (50 mM Trizma base, 1 mM Na2EDTA, adjustment of pH 8.0 with glacial acetic acid
TBS buffer:10 mM Tris·Cl, pH7.4, 150 mM NaCl
1× TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA
Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 119
Appendix B- End-sequences of some probes
PSR168 insert size = 1.3kb
PSR168 Forward cagtttgtgacagagaatgtagttgagaaggagctgtcattaagtgagga ggttttggctgaaaagtacaaggacaggctgcagagttcttacaatggtt tagaacatgaggtattctccaaaatccttcgtggcctgtctggtgctaaa gtgacgaggccaagcacattccgcagttgtcaagatggatatgccgtgaa atcatcacttaaagctgaagatggattgctgtatcctcttgaaaaggctt tttctttttgccaaagcccccgacactcattctgcatgaggagattgagt atgttgaatttgagcgccatggtgctggtggtgctagtatgtcatctcac tattttgatcttctggtcaagctaaagaatgatcaagaacatctctatca gaaatatacaaaggaatgaataccataacccttcaacttcggcagtg
PSR168 Reverse tttttttttttttttttttttttttttgcagaaaaaggttgcacaagcag ggtgcgaataaaacacctgtcacatgtgctgacagctcttagcaaagtaa acatcaccttggaacctacatatcctaactgttgtttgttaactcagaaa cgtagggatcacacctcaacagtcactacagcaagatagatcggatgcct acttgtaccatgactcgaaagtatgctcctttcgacatcggccaatcttc caattcaatcggacgatccatctgcagagtccacgtctacaggagccgca ccagcgccgcggtaggcagcagactcctctgcatagcgtttcttatccac ttgggactgctcaacgtatggctgcttctcctcagctgacatcttttgcc acttctctccaagcttctttgcaa
PSR544 insert size = 1.9kb
PSR544 Forward ctcatataacaatattacaacctcggtagaagggctaggatttagatcac gcaataaaacatgcaacgtaatcaggagacctgatacaaaaatatatata tgataaaagaaattactaagaaaataacatggggactacgggaaatgttc ccatattccatgaattggcattcaaaacttattactacctccattccggt gaataaagcatgcgcgcatttcaaaatttaactttgtccgtcaatttaac caacaaacataagttatgcgacttaaaaattataccattgaaaagttctt ccgaatatgaattcattagtataataacttttgtcacacataccccacat ttagttgtttaaattgatagtccaagttcaattttggaatacatgtgtgc ggtattcgttggaatggaggagcattttccttacagaaaccgaggacgca tctatgcacttgctgactcatgacttgcagtgctaactcgacttttagtg ccacattatttttg
PSR544 Reverse tgtgttggatattcatgtagtatttggcatattaatacttctgataatgg cagacaaaagttctattgaaagaaactggtaacatttgaaagaacctgat ttacctaagagcagcgttgatcttcttccataccccttcagtaaagtaat ttggatatgtagtcttgccttcctgaacctccagcatgaatgcccgatca cattcattagacgtagagtttgtagaagatgcttttttccgcaatatagc ttatgcccagttagtgttgaatcatttccactttttttactacacatttg tcttcatgatcaggtgtctgttgatgtgtacatgccctgttataaggctg tttatatagtgatgtcgaaacagatttacgtgttgagtttatgtaggaga actggatat
PSR653 insert size = 3kb
Chapter 6 General discussion, Appendices and References 120
PSR653 Forward gaaaatccattttttctctgttgagatagtgcacccttatcctattttat ggttataattttttgatatcttcagtactatggaaatatactgctttatg acttcaggcattttaagtttatactttgtgattcaacaggtccacagctg atttaatatttacttaatcgtcctgtagcacatccacatgcattggattg ttctctgcacaaagatgcttgatatgcacttcaaatacttttctgttaaa ctattagcttacatctttttgcaggacatccatgatggattagatttttc agagcatgaagatgttagatattcatttggactcttttctgttaaatttt ccactgatgggcgggagttgttgctggcagtaatgatgattcaatatatg tctacgaccttcaggcaaacaaagtgacattgcgtttgcctgcccataca gtatgatattattttttctctcgggtgtatcttcttaaatatttgcctga tcacatttcttgggtt
PSR653 Reverse taagcaatatgtcaatcgagcacaaaaaatggattaagcagactgcctgt tgcttaagacatacccatcagcattggatgtcattttccggatgtcccac atcttaatagcttgatcttttccatttgatatgaaacatctaccatctcc acggctgtcaatatgagtaatgccatgcagatgtccagtcaaaaccccag ccgcttcccctgtggacaaacaacgtctgtcccagacctgaagacaggct accaggatcacataccacaaagtttctaagattaaaaaaagttaagaata atttttta
Provided Prof. M. Gale Comparative Genetics Unit John Innes Centre Norwich Research Park UK Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 121
Appendix C: Probes used in Chapter 4
Days of Probes Proviser Locus P/N Counting exposure Polymorphic enzymes ABC0153 Bian Z N 500 3 ABC0157 Bian Z N 800 3 ABC0160 Andrea S N 800 4 ABC0165 Andrea Z P 900 4 BGL II, DRA I, xba I ABC0171 Andrea Z N 1000 4 ABC0252 Bian Z N 600 3 ABG072 Bian Z P 2000 6 Eco RI, Eco RV AWBMA017 Andrea Z N 100 4 B4e Andrea S P 900 5 BGL II BCD01072 Bian S N 600 3 BCD01124 Bian S N 600 3 BCD012 Bian S P 1500 4 DraI , EcorV BCD0127 Andrea S N 500 3 BCD0135 Andrea Z N 900 5 BCD01796 Bian S N 800 5 BCD0200 Andrea S N 800 4 BCD0207 Bian S P 1000 5 DraI , Xba I BCD022 Andrea S P 300 4 Eco R V BCD0249 Bian S N 800 5 BCD0266 Bian Z P 1000 9 EcorRI, HindIII, Sac I, XbaI BCD0334 Andrea Z P 900 4 BGLII,DRAI,XBAI,ECOR V BCD0386 Andrea S N 800 5 BCD0410 Andrea Z N 100 4 BCD0454 Andrea S N 900 4 BCD0512 Andrea Z P 800 4 BGLII, DRAI BCD0921 Bian S P 500 4 DraI EcorI BCD098 Andrea Z P 800 3 DRA , Eco R 5 BG00123 Andrea Z P 800 4 ECOR I, ECO R V CDO0105 Andrea S P 2000 5 DRA I, xba I, Hind III CDO01158 Andrea Z P 200 2 xba I, Eco R V CDO01173 Bian S P 700 4 BGL II, Eco R I, Eco R V CDO01188 Andrea S P 1000 3 BGL II, xba I CDO01335 Andrea Z P 1000 4 BGLII, DRAI, xba I CDO036 Andrea S P 300 4 BGL II, DRA I CDO0366 Andrea Z P 1000 4 BGL II, DRA I, Hind III, Eco R I CDO0373 Andrea Z P 300 3 BGL II, xba I, Bam H I, Eco R V CDO0395 Andrea S P 1500 3 xba I, CDO0426 Andrea Z N 700 3 CDO0474 Andrea Z P 900 4 BGL II, DRA I
Chapter 6 General discussion, Appendices and References 122
Days of Probes Provider Locus P/N Counting exposure Polymorphic enzymes CDO0524 Andrea Z N 200 2 CDO0534 Andrea Z P 400 2 BGL II, BamHI,EcoRI,EcoRV CDO0572 Andrea Z P 1000 5 BGl II, DRA I, xbaI, Hind III, Eco R I CDO0580 Andrea S P 900 3 BGLII,DRAI,xbaI, BamH I, Eco R V CDO0588 Andrea Z P 800 4 BGL II, DRa I, xba I, Eco R I CDO0618 Bian S N 750 4 CDO0665 Andrea Z P 200 4 BGLII,DRAI xbaI,EcoR5 CDO0678 Andrea Z P 700 5 BGL II, DRA I, xbaI CDO0680 Andrea Z P 600 5 DRA I, Eco R V CDO078 Andrea Z N 100 4 CDO098 Andrea Z P 2000 5 DRA I, xba I, Eco R V CDO099 Andrea S P 800 3 BGL II, DRA I, Eco R I, Eco R V cMWG660 Andrea S P 1500 4 Bgl II, Dra I, Eco R V cMWG720 Bian Z N 1000 8 cMWG733 Andrea S P 1000 4 Bgl II,Dra I, xba I, Hind III IAG79 Bian S N 2000 3 KSUb7 Bian Z N 2000 3 KSUD014 Andrea S P 400 3 BGL II. ECO R 1 KSUD022 Andrea Z N 1000 3 KSUE018 Bian S P 500 5 DRA I, xba I, Eco R V KSUE019 Andrea Z P 1000 3 BGL II,DRA I,xbaI,EcoRI KSUF002 Andrea S P 1000 4 BGL II, xba I KSUF002 Andrea Z P 1000 4 BGL II, BamHI,EcoRI,EcoRV KSUF0041 Andrea Z N 600 2 KSUF0043 Andrea Z N 700 3 KSUF015 Andrea Z P 800 4 BGL II, Hind II, Eco R I KSUF022 Andrea Z P 1000 3 xba I KSUH0009 Andrea S N 1500 4 MWG0503 Bian Z P 1000 6 Dra I MWG0820 Andrea S N 1500 6 MWG0913 Bian S P 500 7 EcorV MWG0982 Andrea Z N 700 4 MWG506 Andrea S P 600 4 DRAI,xbaI, ECO R V PSR01200 Andrea S P 1500 4 BGL II, xba I PSR0121 Andrea S P 600 5 BGL II, xba1, Hind III, Eco R I PSR0126 Andrea Z P 800 4 DRA I PSR0129 Andrea Z P 400 3 BGL II, Eco R V PSR0151 Andrea S P 1500 4 BGL II, DRAI,xbaI,Eco R V PSR0151 Andrea Z P 1500 4 xba I, BamHI
Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 123
Days of Probes Provider Locus P/N Counting exposure Polymorphic enzymes PSR0158 Bian S P 400 3 BGL II, xba I, Eco R V PSR0161 Andrea S N 1000 5 PSR0162 Andrea S P 800 3 BGL II, DRA I PSR0168 Bian S P 1500 1 Bgl II, Dra I PSR0381 Andrea S P 1000 5 DRA I, Hind III PSR0391 Bian S P 300 2 BGL II, xba I PSR0393 Andrea Z P 700 4 DRA I PSR0540 Andrea Z N 300 3 PSR0544 Andrea Z P 800 4 Dra I PSR0596 Bian S N 1000 3 PSR0601 Andrea S P 900 3 BGL II, DRA I, xba I, Eco R I, Eco R V PSR0609 Andrea Z N 800 4 BGL II, DRA I, xba I, BamH I, Eco R I, Eco R V PSR0626 Bian S N 500 5 PSR0634 Andrea S P 600 9 Bgl II, PSR0653 Andrea S P 500 4 BGL II PSR0929 Bian S N 200 4 BGL II, DRA I, XBA I, ECO R I, ECO R V PSR0932 Bian Z N 400 4 BGL II, DRA I, xba I, BamH I, Eco R I, Eco R V PSR0934 Bian S P 300 4 DRA I PSR0937 Bian S P 800 9 Bgl II, Dra I PSR0949 Bian S N 600 6 SLG-45 Bian S/Z N 1000 7 S-papver Bian S/Z N 1000 7 SRK-45 Bian S/Z N 1500 7 S-RNase 7 Bian S/Z N 500 7 WG00184 Andrea Z N 300 3 WG0605 Bian N 1500 5 WG0645 Andrea Z P 200 4 BGL II, xba I, Eco R V WG0789 Bian S P 1000 5 Bgl II, Dra I, Xba I WG0983 Andrea S N 900 4
Chapter 6 General discussion, Appendices and References 124
Appendix D: G2 and M2 subclones and contigs assembled
Clones Insert size Sequence length Contigs Contig lengh GS102 1.3 690 C1 690 GS102 1.3 690 C1 0 GS170 1 682 C1 0 GS170 1 682 C1 0 GS1 0.8 663 C10 660 GS1 0.8 663 C10 0 MS1 0.9 662 C10 0 MS1 0.9 662 C10 0 MS107 1 676 C11 0 MS107 1 676 C11 0 MS5 1.2 642 C11 0 MS5 1.2 642 C11 0 GS132 0.7 589 C12 750 GS132 0.7 589 C12 0 MS113 0.6 651 C12 0 MS113 0.6 651 C12 0 MS116 0.5 650 C12 0 MS116 0.5 650 C12 0 MS140 1.1 679 C12 0 MS140 1.1 679 C12 0 MS119 2 780 C13 780 MS119 2 780 C13 0 MS134 1 780 C13 0 MS134 1 780 C13 0 MS136 1 680 C13 0 MS136 1 680 C13 0 MS148 0.5 683 C14 650 MS148 0.5 683 C14 0 MS67 0.7 621 C14 0 MS67 0.7 621 C14 0 GS119 0.4 437 C15 1800 GS119 0.4 437 C15 0 GS130 0.6 570 C15 0 GS130 0.6 570 C15 0 GS138 1.6 730 C15 0 GS138 1.6 730 C15 0 GS187 0.6 689 C15 0 GS187 0.6 689 C15 0 MS173 0.6 679 C15 0 MS173 0.6 679 C15 0 MS38 1 683 C15 0 MS38 1 683 C15 0
Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 125
Clones Insert size Sequence length Contigs Contig lengh MS139 2 683 C16 850 MS139 2 683 C16 0 MS167 1.6 687 C16 0 MS167 1 687 C16 0 MS115 1.5 658 C17 650 MS115 1.5 658 C17 0 MS191 1.3 685 C17 0 MS191 1.3 685 C17 0 MS108 1 655 C18 650 MS108 1 655 C18 0 MS176 1 686 C18 0 MS176 1 686 C18 0 MS177 1 677 C18 0 MS177 1 677 C18 0 MS18 0.6 591 C19 690 MS18 0.6 591 C19 0 MS34 0.7 601 C19 0 MS34 0.7 601 C19 0 GS104 0.8 736 C2 700 GS104 0.8 736 C2 0 GS113 0.6 695 C2 0 GS113 0.6 695 C2 0 GS52 0.6 696 C2 0 GS52 0.6 696 C2 0 MS187 1 673 C20 680 MS187 1 673 C20 0 MS71 0.8 674 C20 0 MS71 0.8 674 C20 0 MS190 1.2 687 C21 950 MS190 1.2 687 C21 0 MS61 0.5 561 C21 0 MS61 0.5 561 C21 0 MS194 0.6 616 C22 700 MS194 0.4 616 C22 0 MS55 735 C22 0 MS55 735 C22 0
Chapter 6 General discussion, Appendices and References 126
Clones Insert size Sequence length Contigs Contig lengh GS115 0.7 701 C23 700 GS115 0.7 701 C23 0 GS142 0.6 449 C24 449 GS142 0.6 449 C24 0 GS145 1 651 C26 651 GS145 1 695 C26 0
GS150 0.5 167 C27 167 GS150 0.5 167 C27 0 GS152 0.4 321 C28 321 GS152 0.4 321 C28 0 GS191 1.2 693 C29 693 GS106 0.6 605 C3 800 GS106 0.6 605 C3 0 GS166 0.7 691 C3 0 GS166 0.7 691 C3 0 GS2 0.6 664 C30 664 GS2 0.6 664 C30 0 GS22 0.6 214 C31 214 GS22 0.6 214 C31 0 GS53 0.5 295 C32 295 GS53 0.5 295 C32 0 GS63 0.5 613 C33 613 GS63 0.5 613 C33 0 GS68 1 300 C34 300 GS68 1 300 C34 0 GS82 0.7 688 C36 688 GS82 0.7 688 C36 0 GS89 0.7 653 C37 653 GS89 0.7 653 C37 0 MS104 0.5 757 C38 757 MS104 0.5 757 C38 0 MS131 1.3 682 C39 682 MS131 1.3 682 C39 0 GS108 0.5 559 C4 560 GS108 0.5 559 C4 0 MS27 0.5 545 C4 0 MS27 0.5 545 C4 0 MS141 1.3 601 C40 601 MS141 1.3 601 C40 0
Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 127
Clones Insert size Sequence length Contigs Contig lengh MS149 0.5 359 C41 359 MS149 0.5 359 C41 0 MS158 0.7 687 C42 687 MS158 0.7 687 C42 0 MS2 1.3 676 C43 676 MS2 1.3 676 C43 0 MS37 0.5 565 C44 565 MS37 0.5 565 C44 0 MS88 0.7 683 C45 683 MS88 0.7 683 C45 0 GS134 2 690 C5 1000 GS134 2 690 C5 0 MS50 0.8 674 C5 0 MS50 0.8 674 C5 0 GS112 0.7 689 C6 800 GS112 0.7 689 C6 0 GS121 1.3 688 C6 0 GS121 1.3 688 C6 0 GS129 0.7 692 C6 0 GS129 0.7 692 C6 0 GS158 0.6 688 C6 0 GS158 0.6 688 C6 0 GS167 0.5 659 C6 0 GS167 0.5 659 C6 0 GS184 0.9 658 C6 0 GS184 0.9 658 C6 0 GS195 0.8 695 C6 0 GS195 0.8 695 C6 0 GS69 0.8 702 C6 0 GS69 0.8 702 C6 0 GS75 0.7 698 C6 0 GS75 0.7 698 C6 0 MS103 0.8 688 C6.1 732 MS103 0.8 688 C6.1 0 MS35 0.5 384 C6.1 0 MS35 0.5 384 C6.1 0
Chapter 6 General discussion, Appendices and References 128
Clones Insert size Sequence length Contigs Contig lengh GS136 0.8 667 C7 650 GS136 0.8 667 C7 0 GS163 0.9 675 C7 0 GS163 0.9 675 C7 0 GS175 0.8 654 C7 0 GS175 0.8 654 C7 0 GS181 0.7 675 C7 0 GS181 0.7 675 C7 0 GS29 0.7 687 C7 0 GS29 0.7 687 C7 0 GS7 1.9 690 C7 0 GS7 1.9 690 C7 0 GS72 0.7 690 C7 0 GS72 0.7 690 C7 0 MS163 0.9 691 C8 800 MS163 0.9 691 C8 0 MS182 0.7 684 C8 0 MS182 0.7 684 C8 0 MS76 0.8 681 C8 0 Ms76 0.8 681 C8 0 MS153 0.7 708 C9 802 MS153 0.7 708 C9 0 MS159 0.6 729 C9 0 MS159 0.6 729 C9 0 MS90 0.8 757 C9 0 MS90 0.8 757 C9 0
References
Ai, Y., Singh, A., Coleman, C. E., Ioerger, T. R., Kheyr Pour, A. and Kao, T. H. (1990) Self-
incompatibility in Petunia inflata: isolation and characterization of cDNAs encoding
three S-allele-associated proteins. Sexual Plant Reproduction 3, 130-138.
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman,
D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Research 25, 3389-3402.
Anderson, M. A., Cornish, E. C., Mau, S. L., Williams, E. G., Hoggart, R., Atkinson, A.,
Bonig, I., Grego, B., Simpson, R., Roche, P. J., Haley, J. D., Penschow, J. D., Niall, H.
D., Tregear, G. W., Coghlan, J. P., Crawford, R. J. and Clarke, A. E. (1986) Cloning
of cDNA for a stylar glycoprotein associated with expression of self-incompatibility in
Nicotiana alata. Nature 321, 38-44.
Avramova, Z., Tikhonov, A., SanMiguel, P., Jin, Y. K., Liu, C. N., Woo, S.-S., Wing, R. A.
and Bennetzen, J. L. (1996) Gene identification in a complex chromosomal continuum
by local genomic cross-referencing. Plant Journal 10, 1163-1168.
Bachem, C. W., van der Hoeven, R. S., de Bruijn, S. M., Vreugdenhil, D., Zabeau, M. and
Visser, R. G. (1996) Visualization of differential gene expression using a novel
method of RNA fingerprinting based on AFLP: analysis of gene expression during
potato tuber development. Plant Journal 9, 745-753.
Bateman, A. J. (1955) Self-incompatibility systems in angiosperms. III Cruciferae. Heredity
9, 53-68. Chapter 6 General discussion, Appendices and References 130
Baumann, U., Juttner, J., Bian, X. Y. and Langridge, P. (2000) Self-incompatibility in the
grasses. Annals of Botany 85, 203-209.
Bennett, M. D. and Smith, J. B. (1991) Neclear DNA amounts in angiosperms. Philosophical
Transactions of the Royal Society of London, B Biological Sciences 334, 309-345.
Bower, M. S., Matias, D. D., Fernandes Carvalho, E., Mazzurco, M., Gu, T., Rothstein, S. J.,
Goring, D. R. and Gu, T. S. (1996) Two members of the thioredoxin-h family interact
with the kinase domain of a Brassica S locus receptor kinase. Plant Cell 8, 1641-1650.
Bredemeijer, G. M. M. and Blaas, J. (1981) S-specific proteins in styles of self-incompatible
Nicotiana alata. Theoretical and Applied Genetics 59, 185-190.
Brewbaker, J. L. (1959) Biology of the angiosperm pollen grain. Indian Journal Genetic
Plant Breeding 19, 121-133.
Brugiere, N., Cui, Y. H. and Rothstein, S. J. (2000) Molecular mechanisms of self-recognition
in Brassica self-incompatibility. Trends in Plant Science 5, 432-438.
Buschges, R., Hollricher, K., Panstruga, R., Simons, G., Wolter, M., Frijters, A., Vandaelen,
R., Vanderlee, T., Diergaarde, P., Groenendijk, J., Topsch, S., Vos, P., Salamini, F.
and Schulzelefert, P. (1997) The Barley Mlo gene - A novel control element of plant
pathogen resistance. Cell 85, 695-705.
Cabrillac, D., Cock, J. M., Dumas, C. and Gaude, T. (2001) The S-locus receptor kinase is
inhibited by thioredoxins and activated by pollen coat proteins. Nature 410, 220-223.
Cock, J. M., Cabrillac, D., Giranton, J. L., Pastuglia, M., Ruffio-Chable, V., Miege, C.,
Dumas, C. and Gaude, T. (2000) Investigating the molecular mechanism of the self-
incompatibility response in Brassica. Annals of Botany 85, 147-153.
Conner, J. A., Conner, P., Nasrallah, M. E. and Nasrallah, J. B. (1998) Comparative mapping
of the Brassica S locus region and its homeolog in Arabidopsis. Implications for the
evolution of mating systems in the Brassicaceae. Plant Cell 10, 801-812. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 131
Connor, H. E. (1979) Breeding systems in the grasses: a survey. New Zealand Journal of
Botany 17, 547-574.
Cornish, M. A., Hayward, M. D. and Lawrence, M. J. (1979) Self-incompatibility in ryegrass.
I. Genetic control in diploid Lolium perenne L. Heredity 43, 95-106.
Cornish, M. A., Hayward, M. D. and Lawrence, M. J. (1980) Self-incompatibility in ryegrass.
III. The joint segregation of S and PGI-2 in Lolium perenne L. Heredity 44, 55-62.
Darwin, C. (1876) Effects of cross and self fertilisation in the vegetable kingdom, John
Murry: London.
Devos, K. M. and Gale, M. D. (1997) Comparative genetics in the grasses. Plant Molecular
Biology 35, 3-15.
Deynze, A. E. v., Nelson, J. C., Yglesias, E. S., Harrington, S. E., Braga, D. P., McCouch, S.
R. and Sorrells, M. E. (1995) Comparative mapping in grasses. Wheat relationships.
Molecular and General Genetics 248, 744-754.
Dixit, R. and Nasrallah, J. B. (2001) Recognizing self in the self-incompatibility response.
Plant Physiology 125, 105-108.
Dixit, R., Rizzo, C., Nasrallah, M. and Nasrallah, J. (2001) The Brassica MIP-MOD gene
encodes a functional water channel that is expressed in the stigma epidermis. Plant
Molecular Biology 45, 51-62.
Druka, A., Kudrna, D., Han, F., Kilian, A., Steffenson, B., Frisch, D., Tomkins, J., Wing, R.
and Kleinhofs, A. (2000) Physical mapping of the barley stem rust resistance gene
rpg4. Molecular & General Genetics 264, 283-290.
Dubcovsky, J., Ramakrishna, W., SanMiguel, P. J., Busso, C. S., Yan, L., Shiloff, B. A. and
Bennetzen, J. L. (2001) Comparative sequence analysis of colinear barley and rice
bacterial artificial chromosomes. Plant Physiology 125, 1342-1353.
Chapter 6 General discussion, Appendices and References 132
Fearon, C. H., Cornish, M. A., Hayward, M. D., Lawrence, M. J. and S, O. D. (1994) Self-
incompatibility in ryegrass. X. Number and frequency of alleles in a natural
population of Lolium perenne L. Heredity 73, 254-261.
Fearon, C. H., Hayward, M. D. and Lawrence, M. J. (1983) Self-incompatibility in ryegrass.
V. Genetic control, linkage and seed-set in diploid Lolium multiflorum Lam. Heredity
50, 35-45.
Fearon, C. H., Hayward, M. D. and Lawrence, M. J. (1984) Self-incompatibility in ryegrass
VII. The determination of incompatibility genotypes in autotetraploid families of
Lolium perenne L. Heredity 53, 403-413.
Foote, H. C. C., Ride, J. P., Franklin-Tong, V. E., Walker, E. A., Lawrence, M. J. and
Franklin, F. C. H. (1994) Cloning and expression of a distinctive class of self-
incompatibility (S-) gene from Papaver rhoeas L. Proceedings of the National
Academy of Sciences of the United States of America 91, 2265-2269.
Franklin, F. C. H., Lawrence, M. J. and Franklin-Tong, V. E. (1995) Cell and molecular
biology of self-incompatibility in flowering plants. International Review of Cytology
158, 1-64.
Franklin Tong, V. E., Atwal, K. K., Howell, E. C., Lawrence, M. J. and Franklin, F. C. H.
(1991) Self-incompatibility in Papaver rhoeas: there is no evidence for the
involvement of stigmatic ribonuclease activity. Plant, Cell and Environment 14, 423-
429.
Franklin Tong, V. E., Lawrence, M. J. and Franklin, F. C. H. (1988) An in vitro bioassay for
the stigmatic product of the self-incompatibility gene in Papaver rhoeas L. New
Phytologist 110, 109-118.
Franklin Tong, V. E., Ruuth, E., Marmey, P., Lawrence, M. J. and Franklin, F. C. H. (1989)
Characterization of a stigmatic component from Papaver rhoeas L. which exhibits the Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 133
specific activity of a self-incompatibility (S-) gene product. New Phytologist 112, 307-
315.
Franklin Tong, V. E. and Franklin, F. C. H. (1992) Gametophytic self-incompatibility in
Papaver rhoeas L. Sexual Plant Reproduction 5, 1-7.
Franklin-Tong, V. E. and Franklin, F. C. H. (2000) Self-incompatibility in Brassica: The
elusive pollen S gene is identified! Plant Cell 12, 305-308.
Fuong, F. T., Voylokov, A. V. and Smirnov, V. G. (1993) Genetic studies of self-fertility in
rye (Secale cereale L.). 2. The search for isozyme marker genes linked to self-
incompatibility loci. Theoretical and Applied Genetics 87, 619-623.
Gale, M. D. and Devos, K. M. (1998) Comparative genetics in the grasses. Proceedings of the
National Academy of Sciences of the United States of America 95, 1971-1974.
Gaude, T. and McCormick, S. (1999) Signaling in pollen-pistil interactions. Cell &
Developmental Biology 10, 139-147.
Gertz, A. and Wricke, G. (1989) Linkage between the incompatibility locus Z and a beta-
glucosidase locus in rye. Plant Breeding 103, 255-259.
Gray, J. E., McClure, B. A., Bonig, I., Anderson, M. A. and Clarke, A. E. (1991) Action of
the style product of the self-incompatibility gene of Nicotiana alata (S-RNase) on in
vitro-grown pollen tubes. Plant Cell 3, 271-283.
Guidet, F., Rogowsky, R., Taylor, C., Song, W. and Langridge, P. (1991) Cloning and
characterisation of a new rye-specific repeat sequence. Genome 34, 81-87.
Harbord, R. M., Napoli, C. A. and Robbins, T. P. (2000) Segregation distortion of T-DNA
markers linked to the self-incompatibility (S) locus in Petunia hybrida. Genetics 154,
1323-1333.
Hayman, D. L. (1956) The genetic control of incompatibility in Phalaris coerulescens Desf.
Australian Journal of Biological Sciences 9, 321-331.
Chapter 6 General discussion, Appendices and References 134
Hayman, D. L. (1992) The S-Z incompatibility system. In Grass evolution and domestication
(Ed, Chapman, G. P.) Cambridge University Press: Cambridge, pp. 117-137.
Hayman, D. L. and Richter, J. (1992) Mutations affecting self-incompatibility in Phalaris
coerulescens Desf. (Poaceae). Heredity 68, 495-503.
Heslop Harrison, J. (1979) Pollen-stigma interaction in grasses: a brief review. New Zealand
Journal of Botany 17, 537-546.
Heslop Harrison, Y. and Shivanna, K. R. (1977) The receptive surface of the angiosperm
stigma. Annals of Botany 41, 1233-1258.
Heslop-Harrison, J. (1982) Pollen-stigma interaction and cross-compatibility in the grasses.
Science 215, 1358-1364.
Igic, B. and Kohn, J. R. (2001) Evolutionary relationships among self-incompatibility
RNases. Proceedings of the National Academy of Sciences of the United States of
America 98, 13167-13171.
Inoue, H., Nojima, H. and Okayama, H. (1990) High efficiency transformation of Escherichia
coli with plasmids. gene 96, 23-28.
Ioannou, P. A., Amemiya, C. T., Garnes, J., Kroisel, P. M., Shizuya, H., Chen, C., Batzer, M.
A. and de Jong, P. J. (1994) A new bacteriophage P1-derived vector for the
propagation of large human DNA fragments. Nature Genetics 6, 84-89.
Ioerger, T. R., Clark, A. G. and Kao, T. H. (1990) Polymorphism at the self-incompatibility
locus in Solanaceae predates speciation. Proceedings of the National Academy of
Sciences of the United States of America 87, 9732-9735.
Ioerger, T. R., Gohlke, J. R., Xu, B. and Kao, T.-H. (1991) Primary structural featuress of the
self-incompatibility protein in Solanaceae. Sexual Plant Reproduction 4, 81-87. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 135
Jordan, N. D., Franklin, F. C. H. and Franklin-Tong, V. E. (2000a) Evidence for DNA
fragmentation triggered in the self-incompatibility response in pollen of Papaver
rhoeas. Plant Journal 23, 471-479.
Jordan, N. D., Ride, J. P., Rudd, J. J., Davies, E. M., Franklin-Tong, V. E. and Franklin, F. C.
H. (2000b) Inhibition of self-incompatible pollen in Papaver rhoeas involves a
complex series of cellular events. Annals of Botany 85, 197-202.
Kakeda, K., Jordan, N. D., Conner, A., Ride, J. P., Franklintong, V. E. and Franklin, F. C. H.
(1998) Identification of residues in a hydrophilic loop of the Papaver rhoeas S protein
that play a crucial role in recognition of incompatible pollen. Plant Cell 10, 1723-
1731.
Kao, T., McCubbin, A. G. and Kao, T. H. (1996) How flowering plants discriminate between
self and non-self pollen to prevent inbreeding. Proceedings of the National Academy
of Sciences of the United States of America 93, 12059-12065.
Kearsey, M. J., Ramsay, L. D., Jennings, D. E., Lydiate, D. J., Bohuon, E. J. R. and Marshall,
D. F. (1996) Higher recombination frequencies in female compared to male meioses in
Brassica oleracea. Theoretical and Applied Genetics 92, 363-367.
Keller, B. and Feuillet, C. (2000) Colinearity and gene density in grass genomes. Trends in
Plant Science 5, 246-251.
Kim, U.-J., Shizuya, H., de Jong, P., Birren, B. and Simon, M. I. (1992) Stable propagation of
cosmid sized human DNA inserts in an F factor based vector. Nucleic Acids Research
20, 1083-1085.
Korzun, V., Malyshev, S., Voylokov, A. V. and Borner, A. (2001) A genetic map of rye
(Secale cereale L.) combining RFLP, isozyme, protein, microsatellite and gene loci.
Theoretical & Applied Genetics 102, 709-717.
Chapter 6 General discussion, Appendices and References 136
Kosambi, D. D. (1944) The Estimation of map distances from recombination values. Annals
of Eugenics 12, 172-175.
Kowyama, Y., Tsuchiya, T. and Kakeda, K. (2000) Sporophytic self-incompatibility in
Ipomoea trifida, a close relative of sweet potato. Annals of Botany 85, 191-196.
Kumar, A. and Bennetzen, J. L. (1999) Plant retrotransposons. Annual Review of Genetics 33,
479-532.
Kunzel, G., Korzun, L. and Meister, A. (2000) Cytologically integrated physical restriction
fragment length polymorphism maps for the barley genome based on translocation
breakpoints. Genetics 154, 397-412.
Kusaba, M., Dwyer, K., Hendershot, J., Vrebalov, J., Nasrallah, J. B., and. Nasrallah. M. E.
(2001) Self-incompatibility in the genus Arabidopsis: Characterization of the S locus
in the outcrossing A. lyrata and its autogamous relative A. thaliana. Plant Cell 13,
627-643
Langridge, P., Baumann, U. and Juttner, J. (1999) Revisiting and revising the self-
incompatibility genetics of Phalaris coerulescens. Plant Cell 11, 1826.
Larsen, K. (1977) Self-incompatibility in Beta vulgaris L. I. Four gametophytic
complementary S-loci in sugar beet. Hereditas 85, 227-248.
Lawrence, M. J., Afzal, M. and Kentick, J. (1978) The genetical control of self-
incompatibility in Papaver rhoeas. Heredity 40, 239-253.
Leach, C. R. (1988) Detection and estimation of linkage for a co-dominant structural gene
locus linked to a gametophytic self-incompatibility locus. Theoretical and Applied
Genetics 75, 882-888.
Leach, C. R. and Hayman, D. L. (1987) The incompatibility loci as indicators of conserved
linkage groups in the Poaceae. Heredity 58, 303-305. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 137
Lee, H. S., Huang, S. S. and Kao, T. H. (1994) S proteins control rejection of incompatible
pollen in Petunia inflata. Nature 367, 560-563.
Lewis, D. (1951) Structure of the self-incompatibility gene. III. Types of spontaneous and
induced mutation. Heredity 5, 399-414.
Lewis, D. (1979) Sexual Incompatibility in plants, Edward Arnold Ltd, London.
Lewis, E. J., Humphreys, M. W. and Coton, M. F. (1980) Chromosome location of two
isozyme loci in Lolium perenne using primary trisomics. Theoretical and Applied
Genetics 57, 237-239.
Li, J. H., Nass, N., Kusaba, M., Dodds, P. N., Treloar, N., Clarke, A. E. and Newbigin, E.
(2000) A genetic map of the Nicotiana alata S locus that includes three pollen-
expressed genes. Theoretical and Applied Genetics 100, 956-964.
Li, X., Nield, J., Hayman, D. and Langridge, P. (1996) A self-fertile mutant of Phalaris
produces an S protein with reduced thioredoxin activity. Plant Journal 10, 505-513.
Li, X., Paech, N., Nield, J., Hayman, D. and Langridge, P. (1997) Self-incompatibility in the
grasses: evolutionary relationship of the S gene from Phalaris coerulescens to
homologous sequences in other grasses. Plant Molecular Biology 34, 223-232.
Li, X. M., Nield, J., Hayman, D. and Langridge, P. (1994) Cloning a putative self-
incompatibility gene from the pollen of the grass Phalaris coerulescens. Plant Cell 6,
1923-1932.
Li, X. M., Nield, J., Hayman, D. and Langridge, P. (1995) Thioredoxin activity in the C
terminus of Phalaris S protein. Plant Journal 8, 133-138.
Liang, P. and Pardee, A. B. (1992) Differential display of eukaryotic messenger RNA by
means of the polymerase chain reaction. Science 257, 967-971.
Lundqvist, A. (1954) Studies on self-sterility in rye, Secale cereale L. Hereditas 40, 278-294.
Chapter 6 General discussion, Appendices and References 138
Lundqvist, A. (1955) Genetics of incompatibility in Festuca pratensis Huds. Hereditas 47,
542-652.
Lundqvist, A. (1957) Self-incompatibility in rye. II Genetic control in the autotetraploid.
Hereditas 44, 193-265.
Lundqvist, A. (1958) Self-incopatibility in rye. IV. Facotrs relating to self-seeding. Hereditas
44, 139-256.
Lundqvist, A. (1959) The origin of self-compatibility in rye. Hereditas 46, 1-19.
Lundqvist, A. (1962a) Self-incompatibility in Hordeum bulbosum L. Hereditas 48, 138-152.
Lundqvist, A. (1962b) The nature of the two-loci incompatibility system in grasses. I. The
hypothesis of a duplicative origin. Hereditas 48, 153-168.
Lundqvist, A. (1964) The nature of the two-loci incompatibility system in grasses. IV.
Interaction between the loci in relation to pseudo-compatibility in Festuca pratensis
Huds. Hereditas 52, 221-234.
Lundqvist, A. (1965) Self-incompatibility in Dactylis aschersoniana Graebn. Hereditas 54,
70-87.
Lundqvist, A. (1968) The mode of origin of self-fertility in grasses. Hereditas 59, 413-426.
Luu, D. T., Qin, X. K., Morse, D. and Cappadocia, M. (2000) S-RNase uptake by compatible
pollen tubes in gametophytic self-incompatibility. Nature 407, 649-651.
Matton, D. P., Doan Trung, L., Qin, X. K., Laublin, G., M, O. B., Maes, O., Morse, D., and
Cappadocia, M. (1999) Production of an S RNase with dual specificity suggests a
novel hypothesis for the generation of new S alleles. Plant Cell 11, 2087-2097.
Matton, D. P., Maes, O., Laublin, G., Qin, X. K., Bertrand, C., Morse, D. and Cappadocia, M.
(1997) Hypervariable domains of self-incompatibility RNases mediate allele-specific
pollen recognition. Plant Cell 9, 1757-1766. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 139
Matton, D. P., Nass, N., Clarke, A. E. and Newbigin, E. (1994) Self-incompatibility: How
plants avoid illegitimate offspring. Proceedings of the National Academy of Sciences
of the United States of America 91, 1992-1997.
Mazzurco, M., Sulaman, W., Elina, H., Cock, J. M. and Goring, D. R. (2001) Further analysis
of the interactions between the Brassica S receptor kinase and three interacting
proteins (ARC1, THL1 and THL2) in the yeast two-hybrid system. Plant Molecular
Biology 45, 365-376.
McClure, B. A., Gray, J. E., Anderson, M. A. and Clarke, A. E. (1990) Self-incompatibility in
Nicotiana alata involves degradation of pollen rRNA. Nature 347, 757-760.
McClure, B. A., Haring, V., Ebert, P. R., Anderson, M. A., Simpson, R. J., Sakiyama, F. and
Clarke, A. E. (1989) Style self-incompatibility gene products of Nicotiana alata are
ribonucleases. Nature 342, 955-957.
McCormick, S. (1998) Self-incompatibility and other pollen-pistil interactions. Current
Opinion in Plant Biology 1, 18-25.
McCubbin, A. G. and Kao, T. H. (1999) The emerging complexity of self-incompatibility (S-)
loci. Sexual Plant Reproduction 12, 1-5.
McCubbin, A. G. and Kao, T. H. (2000) Molecular recognition and response in pollen and
pistil interactions. Annual Review of Cell & Developmental Biology 16, 333-364.
McCubbin, A. G., Zuniga, C. and Kao, T. H. (2000) Construction of a binary bacterial
artificial chromosome library of Petunia inflata and the isolation of large genomic
fragments linked to the self-incompatibility (S-) locus. Genome 43, 820-826.
Miklos, G. L. G. and Rubin, G. M. (1996) The role of the genome project in determining gene
function: Insight from model organisms. Cell 86, 521-529.
Murray, B. G. (1974) Breeding system and floral biology in the genus Briza. Heredity 33,
285-292.
Chapter 6 General discussion, Appendices and References 140
Nasrallah, J. B., Kao, T. H., Goldberg, M. L. and Nasrallah, M. E. (1985) A cDNA clone
encoding an S-locus-specific glycoprotein from Brassica oleracea. Nature 318, 263-
267.
Nasrallah, M. E., Kandasamy, M. K., Chang, M. C., Stadler, Z., Lim, S. and Nasrallah, J. B.
(2000) Identifying genes for pollen-stigma recognition in crucifers. Annals of Botany
85, 125-132.
Nayar, N. M. (1967) Prevalence of self-incompatibility in Orysa barthii cheval: Its bearing on
the evolution of rice and related taxa. Genetica 38, 521-527.
Nettancourt, D. d. (1977) Incompatibility in angiosperms, Springer: Berlin.
Newbigin, E., Anderson, M. A. and Clarke, A. E. (1993) Gametophytic self-incompatibility
systems. Plant Cell 5, 1315-1324.
Oka, H. I. and Morishima, H. (1967) Variations in the breeding systems of a wild rice, Oryza
perennis. Evolution 21, 249-258.
Panstruga, R., Buschges, R., Piffanelli, P. and Schulze Lefert, P. (1998) A contiguous 60 kb
genomic stretch from barley reveals molecular evidence for gene islands in a monocot
genome. Nucleic Acids Research 26, 1056-1062.
Paterson, A. H. and Wing, R. A. (1993) Genome mapping in plants. Current Opinion in
Biotechnology 4, 142-147.
Patocchi, A., Vinatzer, B. A., Gianfranceschi, L., Tartarini, S., Zhang, H. B., Sansavini, S.
and Gessler, C. (1999) Construction of a 550 kb BAC contig spanning the genomic
region containing the apple scab resistance gene Vf. Molecular and General Genetics
262, 884-891.
Pedersen, C., Giese, H. and Linde Laursen, I. (1995) Towards an integration of the physical
and the genetic chromosome maps of barley by in situ hybridization. Hereditas 123,
77-88. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 141
Peitsch, M. C. (1996) ProMod and Swiss-Model: Internet-based tools for automated
comparative protein modelling. Biochemical Society transactions 24, 274-279.
Raven, P. H., Evert, R. F. and Eichhorn, S. E. (1992) Biology of plants, Worth Publisher,
New York.
Rivera Madrid, R., Mestres, D., Marinho, P., Jacquot, J. P., Decottignies, P., Miginiac
Maslow, M. and Meyer, Y. (1995) Evidence for five divergent thioredoxin h
sequences in Arabidopsis thaliana. Proceedings of the National Academy of Sciences
of the United States of America 92, 5620-5624.
Rivera-Madrid, R., Mestres, D., Marinho, P., Jacquot, J. P., Decottignies, P., Miginiac-
Maslow, M. and Meyer, Y. (1995) Evidence for five divergent thioredoxin h
sequences in Arabidopsis thaliana. Proceedings of the National Academy of Sciences
of the United States of America 92, 5620-5624.
Rudd, J. J., Franklin, F. C. H. and Franklintong, V. E. (1997) Ca2+-independent
phosphorylation of a 68 kda pollen protein is stimulated by the self-incompatibility
response in Papaver rhoeas. Plant Journal 12, 507-514.
Rudd, J. J., Franklin, F. C. H., Lord, J. M. and Franklintong, V. E. (1996) Increased
phosphorylation of a 26-kd pollen protein is induced by the self-incompatibility
response in Papaver rhoeas. Plant Cell 8, 713-724.
Saji, S., Umehara, Y., Antonio, B., Yamane, H., Tanoue, H., Baba, T., Aoki, H., Ishige, N.,
Wu, J. Z., Koike, K., Matsumoto, T. and Sasaki, T. (2001) A physical map with yeast
artificial chromosome (YAC) clones covering 63% of the 12 rice chromosomes.
Genome 44, 32-37.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A laboratory
Manual, Cold Spring Harbor Laboratory Press: New York.
Chapter 6 General discussion, Appendices and References 142
Sasaki, T. and Burr, B. (2000) International Rice Genome Sequencing Project: The effort to
completely sequence the rice genome. Current Opinion in Plant Biology. 3, 138-141.
Schopfer, C. R., Nasrallah, M. E. and Nasrallah, J. B. (1999) The male determinant of self-
incompatibility in Brassica. Science 286, 1697-1700.
Senft, P. and Wricke, G. (1996) An extended genetic mapof rye (Secale cereale L.). Plant
Breeding 115, 508-510.
Shirasu, K., Schulman, A. H., Lahaye, T. and Schulze Lefert, P. (2000) A contiguous 66-kb
barley DNA sequence provides evidence for reversible genome expansion. Genome
Research 10, 908-915.
Shizuya, H., Birren, B., Kim, U.-J., Mancino, V., Slepak, T., Tachiiri, Y. and Simon, M.
(1992) Cloning and stable maintenance of 300-kilobase-pair fragments of human
DNA in E. Coli using an F-factor-based vector. Proceedings of the National Academy
of Sciences of the United States of America 89, 8794-8797.
Sims, T. L. (1993) Genetic regulation of self-incompatibility. Critical Reviews in Plant
Sciences 12, 129-167.
Snowman, B. N., Geitmann, A., Clarke, S. R., Staiger, C. J., Franklin, F. C. H., Emons, A. M.
C. and Franklin-Tong, V. E. (2000) Signalling and the cytoskeleton of pollen tubes of
Papaver rhoeas. Annals of Botany 85, 49-57.
Sopory, S. K. and Munshi, M. (1998) Protein kinases and phosphatases and their role in
cellular signaling in plants. Critical Reviews in Plant Sciences 17, 245-318.
Stein, J. C., Howlett, B., Boyes, D. C., Nasrallah, M. E. and Nasrallah, J. B. (1991) Molecular
cloning of a putative receptor protein kinase gene encoded at the self-incompatibility
locus of Brassica oleracea. Proceedings of the National Academy of Sciences of the
United States of America 88, 8816-8820.
Stevens, W. L. (1942) Accuracy of mutation rates. Journal of Genetics 43, 301-307. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 143
Stone, S. L., Arnoldo, M. A. and Goring, D. R. (1999) A breakdown of Brassica self-
incompatibility in ARC1 antisense transgenic plants. Science 286, 1729-1731.
Gerats, A.G.M.; Strommer, J.; Sanago, M.; Molnar, S. J. (2000) A gene-based RFLP map of
petunia. Theoretical and Applied Genetics 100, 899-905.
Suzuki, G., Kai, N., Hirose, T., Fukui, K., Nishio, T., Takayama, S., Isogai, A., Watanabe, M.
and Hinata, K. (1999) Genomic organization of the S locus: Identification and
characterization of genes in SLG/SRK region of S-9 haplotype of Brassica campestris
(syn. rapa). Genetics 153, 391-400.
Tagaya, Y., Maeda, Y., Mitsui, A., Kndo, N., Matsui, H., Hamuro, J., Brown, N., Arai, K.-I.,
Yokota, T., Wakasugi, H. and Yodoi, J. (1989) ATL-derived factor (ADF), an IL-2
receptor/Tac inducer homologous to thioredoxin; possible involvement of dithiol-
reduction in the IL-2 receptor induction. European Molecular Biology Organization
journal 8, 757-764.
Takasaki, T., Hatakeyama, K., Suzuki, G., Watanabe, M., Isogai, A. and Hinata, K. (2000)
The S receptor kinase determines self-incompatibility in Brassica stigma. Nature 403,
913-916.
Takayama, S., Shiba, H., Iwano, M., Shimosato, H., Che, F. S., Kai, N., Watanabe, M.,
Suzuki, G., Hinata, K. and Isogai, A. (2000) The pollen determinant of self-
incompatibility in Brassica campestris. Proceedings of the National Academy of
Sciences of the United States of America 97, 1920-1925.
Tan, L. W. and Jackson, J. F. (1988) Stigma proteins of the two loci self-incompatible grass
Phalaris coerulescens. Sexual Plant Reproduction 1, 25-27.
Chapter 6 General discussion, Appendices and References 144
Tanksley, S. D., Ganal, M. W. and Martin, G. B. (1995) Chromosome landing - a paradigm
for map-based gene cloning in plants with large genomes. Trends in Genetics 11, 63-
68.
Tanksley, S. D. and Loaiza Figueroa, F. (1985) Gametophytic self-incompatibility is
controlled by a single major locus on chromosome 1 in Lycopersicon peruvianum.
Proceedings of the National Academy of Sciences of the United States of America 82,
5093-5096. ten Hoopen, R., Harbord, R. M., Maes, T., Nanninga, N. and Robbins, T. P. (1998) The self-
incompatibility (S) locus in Petunia hybrida is located on chromosome III in a region,
syntenic for the Solanaceae. Plant Journal 16, 729-734.
Thorogood, D. and Hayward, M. D. (1992) Self-incompatibility in Lolium temulentum L.: its
genetic control and transfer into L. perenne L. and L. multiflorum Lam. Heredity 68,
71-78.
Vicient, C. M., Suoniemi, A., Anamthawat Jonsson, K., Tanskanen, J., Beharav, A., Nevo, E.
and Schulman, A. H. (1999) Retrotransposon BARE-1 and its role in genome
evolution in the genus Hordeum. Plant Cell 11, 1769-1784.
Viinikka, Y. and Kallio, M. (1993) C-banded chromosomes of three Phalaris species.
Caryologia 46, 47-52.
Voylokov, A. V., Fuong, F. T., Smirnov, V. G. and Voilokov, A. V. (1993) Genetic studies of
self-fertility in rye (Secale cereale L.). 1. The identification of genotypes of self-fertile
lines for the Sf alleles of self-incompatibility genes. Theoretical and Applied Genetics
87, 616-618.
Voylokov, A. V., Korzun, V. and Borner, A. (1998) Mapping of three self-fertility mutations
in rye (Secale cereale L.) using RFLP, isozyme and morphological markers.
Theoretical and Applied Genetics 97, 147-153. Bian, X.-Y. 2001. Ph D. Thesis, The University of Adelaide 145
Walker, E. A., Ride, J. P., Kurup, S., Franklintong, V. E., Lawrence, M. J. and Franklin, F. C.
H. (1996) Molecular analysis of two functional homologues of the S-3 allele of the
Papaver rhoeas self-incompatibility gene isolated from different populations. Plant
Molecular Biology 30, 983-994.
Wang, X., Hughes, A. L., Tsukamoto, T., Ando, T. and Kao, T. H. (2001) Evidence that
intragenic recombination contributes to allelic diversity of the S-RNase gene at the
self-incompatibility (S) locus in Petunia inflata. Plant Physiology 125, 1012-1022.
Watkins, A. E. (1925) Genetic and cytological studies in wheat. II. Journal of Genetics 15,
323-366.
Watson, L. (1990) The grass family, Poaceae. In Reproductive Versatility in the Grasses (Ed,
Chapman, G. P.) Cambridge University Press: Cambridge, pp. 1-31.
Wehling, P., Hackauf, B. and Wricke, G. (1994a) Phosphorylation of pollen proteins in
relation to self-incompatibility in rye (Secale cereale L.). Sexual Plant Reproduction
7, 67-75.
Wehling, P., Hackauf, B. and Wricke, G. (1994b) Identification of S-locus linked PCR
fragments in rye (Secale cereale L.) by denaturing gradient gel electrophoresis. Plant
Journal 5, 891-893.
Weimarck, A. (1968) Self-incompatibility in the Gramineae. Hereditas 60, 157-166.
Wilkins, P. W. and Thorogood, D. (1992) Breakdown of self-incompatibility in perennial
ryegrass at high temperature and its uses in breeding. Euphytica 64, 65-69.
Wing, R. A., Zhang, H. B. and Tanksley, S. D. (1994) Map-based cloning in crop plants.
Tomato as a model system: I. Genetic and physical mapping of jointless. Molecular
and General Genetics 242, 681-688.
Chapter 6 General discussion, Appendices and References 146
Woo, S. S., Jiang, J. M., Gill, B. S., Paterson, A. H. and Wing, R. A. (1994) Construction and
characterization of a bacterial artificial chromosome library of Sorghum bicolor.
Nucleic Acids Research 22, 4922-4931.
Wricke, G. (1978) Pseudo-self-compatibility in rye and its utilization in breeding. Zeitschrift
fur Pflanzenzuchtung 81, 140-148.
Wricke, G. and Wehling, P. (1985) Linkage between an incompatibility locus and a
peroxidase isozyme locus (Prx7) in rye. Theoretical and Applied Genetics 71, 289-
291.
Xue, Y. B., Carpenter, R., Dickinson, H. G. and Coen, E. S. (1996) Origin of allelic diversity
in Antirrhinum S locus RNases. Plant Cell 8, 805-814.