Chem 109 C Bioorganic Compounds
Fall 2019 HFH1104
Armen Zakarian Office: Chemistry Bldn 2217 http://labs.chem.ucsb.edu/~zakariangroup/courses.html
CLAS Instructor: Dhillon Bhavan [email protected] Midterm 3 stats
Average 49.1
St Dev 14.1
Max 87.5
Min 15
test are available outside room 2135 (Chemistry, 2nd floor) in a box, sorted in alphabetical order, by color Final Course Grading
Each test will be curved individually to 75% average
Lowest midterm will be dropped
Scores from 2 best M and the Final will be added
Grades will be assigned according to the syllabus 22. Draw all reactions required to convert hexanoic acid to 3 molecules of acetyl CoA through 11 pt the β-oxidation cycles. Name all necessary coenzymes and enzymes. How many
molecules of ATP and CO2 will be produced from hexanoic acid after its entire metabolism through all 4 stages ?
O
O
hexanoic acid (hexanoate) Overview
OVERVIEW o structures of DNA vs. RNA - ribose o structures of bases: Adenine, Uracil/Thymine, Guanine, Cytosine. “Enol forms” o hydrogen bonding between A-T(U) and G-C. H-donors/acceptors o Base complementarity o RNA strand cleavage assisted by the 2’-OH group in the ribose unit (cyclic PDE) o Deamination: RNA genetic instability o DNA replication o RNA synthesis: transcription. Template strand (read 3’ to 5’). Sense strand and the RNA primary structure (T −> U). o Protein synthesis: translation. mRNA determines the amino acid sequence. tRNAs are amino acid carriers. rRNA - part of ribosomes
o no section 26.12, 26.13 DNA, RNA, etc. Structure and Classification
• DNA: Deoxyribonucleic acid encodes hereditary information controls cell division and growth
• RNA: Ribonucleic acid transcription and translation stores genetic information in viruses DNA, RNA, etc. Structure and Classification
O P O- O P O- O base O base O O 5' 5' 2' 2' O O OH
O P O- O P O- O base O base O O
O O OH
O P O- O P O-
O base O base O O
O O OH
DNA RNA DNA, RNA, etc. Structure and Classification
DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification
DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification
DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification
DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification
DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification
DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification
nucleosides = base + sugar
NH2 NH2 N N N N
N N N N O O HO HO
HO HO OH
PRACTICE PROBLEM Draw the structures and provide names for all other nucleosides DNA, RNA, etc. Structure and Classification nucleotides = base + sugar + phosphate
O O O N N HN N HN HN N N N H2N N H2N N H2N N O O O O O P P -O O HO -O O O- O- HO O OH O OH - - 2'-deoxyguanosine O P O O P O - 5'-monophsphate O- O
a deoxynucleotise guanosine 3'-monophosphate
a ribonucleotide DNA, RNA, etc. Structure and Classification nucleotides = nucleoside phosphates
NH2 NH2 N N
O O N O O O O N O O dAMP P - P P P O O O O O O O- O- O- O- 2’-deoxy HO OH HO OH Adenosine cytidine cytidine Mono 5'-monophosphate 5'-triphosphate Phosphate CMP CTP NH2 NH2 N N
PRACTICE PROBLEM 2 O O N O O O N O O P P P Draw the structures for: O O -O O O O- O- O- HO HO dCMP, UDP, dTTP 2'-deoxycytidine 2'-deoxycytidine 5'-monophosphate 5'-diphosphate dCMP dCDP DNA, RNA, etc. Structure and Classification dinucleotides 2 nucleotides oligonucleotides 3-10 nucleotides polynucleotides many (human DNA - 3,100,000,000 bp)
NH2 N
NH2 O O O O N O N P P P N -O O O O + - - - O O O O O O N N HO O P P P dCTP -O O O O O- O- O- HO
dATP DNA, RNA, etc.
NH2 N
O O O O N O O O - P P P P P O O O O + - - - - - O O O O O O O- O- O NH2 - N O P O N O N O N
HO
CAGTAACCTGAGAACCAATCGGAA… primary structure
DNA or RNA polymerase
Synthesis: nucleotide triphosphates, 5’ 3’ DNA, RNA, etc. 5’ 3’ Facts about DNA
! double helix 3’ 5’ ! two anti-parallel strands
A pairs with T, G pairs with C pairing through hydrogen bonds stacking interactions DNA, RNA, etc.
Facts about DNA double helix two anti-parallel strands
! A pairs with T, G pairs with C pairing through hydrogen bonds stacking interactions DNA, RNA, etc.
H Facts about DNA R O H N N
N H N N ribose double helix N N ribose O two anti-parallel strands R-CH3, thymine adenine
2 hydrogen bonds A pairs with T, G pairs with C
H ! pairing through hydrogen bonds N H O N
N H N N ribose stacking interactions N N ribose O H N H cytosine guanine
3 hydrogen bonds DNA, RNA, etc.
Facts about DNA double helix two anti-parallel strands
A pairs with T, G pairs with C
pairing through hydrogen bonds
! stacking interactions DNA, RNA, etc.
PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A)
How would the base pairing be affected if the bases existed in the “enol” form? DNA, RNA, etc.
PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A)
How would the base pairing be affected if the bases existed in the “enol” form?
A D A D A H H A R O H N N N H O N D A N H N N N H N N ribose ribose N N N D N ribose O A ribose O H N A A A H cytosine guanine R-CH3, thymine adenine A D DNA, RNA, etc.
PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A)
How would the base pairing be affected if the bases existed in the “enol” form?
D D A A D A H H R O H H N N R O H N N D N A N N N H N N ribose ribose N N N N ribose O A ribose O A A A A A R-CH3, thymine adenine R-CH3, thymine adenine “enol” form of T DNA, RNA, etc.
PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A)
How would the base pairing be affected if the bases existed in the “enol” form?
D A H A N H O N A N H N N ribose N D N ribose O H N H A cytosine guanine A D DNA, RNA, etc.
PRACTICE PROBLEM 7 If one of the strands of DNA has the following sequence of bases running in the 5’ → 3’ direction,
GGACAATCTGC a. what is the sequence of bases in the complementary strand? b. what base is closest to the 5’-end in the complementary strand?
DNA, RNA, etc.
DNA is stable, RNA is not: chemical stability
O P O- O P O- O P O- O base O base O base O O O 5' 2' :B O OH O O O O - - O P O- O P O P O O- O base O base O O 2',3'-phosphodiester B H + O OH O OH OH base O
RNA O OH DNA, RNA, etc.
DNA is stable, RNA is not: chemical stability
O P O- O P O- O P O- O base O base O base O O O 5' 2' :B O OH O O O O - - O P O- O P O P O O- O base O base O O 2',3'-phosphodiester B H + O OH O OH OH base O
RNA O OH DNA, RNA, etc.
DNA is stable, RNA is not: genetic stability
DNA has thymine, RNA has uracil
NH2 OH O tautomerization H2O N N HN MUTATION ! O N O N O N R RNA RNA cytosine uracil
spontaneous deamination DNA, RNA, etc.
DNA is stable, RNA is not: genetic stability
DNA has thymine, RNA has uracil
NH2 OH O tautomerization H2O N N HN MUTATION ! O N O N O N R RNA RNA cytosine uracil
spontaneous deamination
NH2 OH O O tautomerization H2O N N HN HN NOT recognized as O N O N O N O N defect and repaired R DNA DNA DNA cytosine uracil, NOT found in DNA DNA, RNA, etc.
spontaneous deamination
NH2 O H2O N NH + NH3 N O N O H H
cytosine
PRACTICE PROBLEM 16 Adenine can be deaminated to hypoxanthine, and guanine can be deaminated to xanthine. Draw structures for the deamination products. DNA, RNA, etc. DNA (bio)synthesis strand separation, replication fork ! is called replication again, always in 5’ → 3’ direction ! done by DNA polymerase using the nucleotide triphosphates
X-ray structure of rb69 gp43 + thymine glycol DNA, RNA, etc. DNA (bio)synthesis strand separation, replication fork ! is called replication again, always in 5’ → 3’ direction ! done by DNA polymerase using the nucleotide triphosphates