DOCSLIB.ORG

Chem 109 C Bioorganic Compounds

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chem 109 C Bioorganic Compounds Chem 109 C Bioorganic Compounds Fall 2019 HFH1104 Armen Zakarian Office: Chemistry Bldn 2217 http://labs.chem.ucsb.edu/~zakariangroup/courses.html CLAS Instructor: Dhillon Bhavan [email protected] Midterm 3 stats Average 49.1 St Dev 14.1 Max 87.5 Min 15 test are available outside room 2135 (Chemistry, 2nd floor) in a box, sorted in alphabetical order, by color Final Course Grading Each test will be curved individually to 75% average Lowest midterm will be dropped Scores from 2 best M and the Final will be added Grades will be assigned according to the syllabus 22. Draw all reactions required to convert hexanoic acid to 3 molecules of acetyl CoA through 11 pt the β-oxidation cycles. Name all necessary coenzymes and enzymes. How many molecules of ATP and CO2 will be produced from hexanoic acid after its entire metabolism through all 4 stages ? O O hexanoic acid (hexanoate) Overview OVERVIEW o structures of DNA vs. RNA - ribose o structures of bases: Adenine, Uracil/Thymine, Guanine, Cytosine. “Enol forms” o hydrogen bonding between A-T(U) and G-C. H-donors/acceptors o Base complementarity o RNA strand cleavage assisted by the 2’-OH group in the ribose unit (cyclic PDE) o Deamination: RNA genetic instability o DNA replication o RNA synthesis: transcription. Template strand (read 3’ to 5’). Sense strand and the RNA primary structure (T −> U). o Protein synthesis: translation. mRNA determines the amino acid sequence. tRNAs are amino acid carriers. rRNA - part of ribosomes o no section 26.12, 26.13 DNA, RNA, etc. Structure and Classification • DNA: Deoxyribonucleic acid encodes hereditary information controls cell division and growth • RNA: Ribonucleic acid transcription and translation stores genetic information in viruses DNA, RNA, etc. Structure and Classification O P O- O P O- O base O base O O 5' 5' 2' 2' O O OH O P O- O P O- O base O base O O O O OH O P O- O P O- O base O base O O O O OH DNA RNA DNA, RNA, etc. Structure and Classification DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification DNA and RNA RNA DNA only only DNA, RNA, etc. Structure and Classification nucleosides = base + sugar NH2 NH2 N N N N N N N N O O HO HO HO HO OH 2'-deoxyadenosine adenosine PRACTICE PROBLEM Draw the structures and provide names for all other nucleosides DNA, RNA, etc. Structure and Classification nucleotides = base + sugar + phosphate O O O N N HN N HN HN N N N H2N N H2N N H2N N O O O O O P P -O O HO -O O O- O- HO O OH O OH - - 2'-deoxyguanosine O P O O P O - 5'-monophsphate O- O a deoxynucleotise guanosine 3'-monophosphate a ribonucleotide DNA, RNA, etc. Structure and Classification nucleotides = nucleoside phosphates NH2 NH2 N N O O N O O O O N O O dAMP P - P P P O O O O O O O- O- O- O- 2’-deoxy HO OH HO OH Adenosine cytidine cytidine Mono 5'-monophosphate 5'-triphosphate Phosphate CMP CTP NH2 NH2 N N PRACTICE PROBLEM 2 O O N O O O N O O P P P Draw the structures for: O O -O O O O- O- O- HO HO dCMP, UDP, dTTP 2'-deoxycytidine 2'-deoxycytidine 5'-monophosphate 5'-diphosphate dCMP dCDP DNA, RNA, etc. Structure and Classification dinucleotides 2 nucleotides oligonucleotides 3-10 nucleotides polynucleotides many (human DNA - 3,100,000,000 bp) NH2 N NH2 O O O O N O N P P P N -O O O O + - - - O O O O O O N N HO O P P P dCTP -O O O O O- O- O- HO dATP DNA, RNA, etc. NH2 N O O O O N O O O - P P P P P O O O O + - - - - - O O O O O O O- O- O NH2 - N O P O N O N O N HO CAGTAACCTGAGAACCAATCGGAA… primary structure DNA or RNA polymerase Synthesis: nucleotide triphosphates, 5’ 3’ DNA, RNA, etc. 5’ 3’ Facts about DNA ! double helix 3’ 5’ ! two anti-parallel strands A pairs with T, G pairs with C pairing through hydrogen bonds stacking interactions DNA, RNA, etc. Facts about DNA double helix two anti-parallel strands ! A pairs with T, G pairs with C pairing through hydrogen bonds stacking interactions DNA, RNA, etc. H Facts about DNA R O H N N N H N N ribose double helix N N ribose O two anti-parallel strands R-CH3, thymine adenine 2 hydrogen bonds A pairs with T, G pairs with C H ! pairing through hydrogen bonds N H O N N H N N ribose stacking interactions N N ribose O H N H cytosine guanine 3 hydrogen bonds DNA, RNA, etc. Facts about DNA double helix two anti-parallel strands A pairs with T, G pairs with C pairing through hydrogen bonds ! stacking interactions DNA, RNA, etc. PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A) How would the base pairing be affected if the bases existed in the “enol” form? DNA, RNA, etc. PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A) How would the base pairing be affected if the bases existed in the “enol” form? A D A D A H H A R O H N N N H O N D A N H N N N H N N ribose ribose N N N D N ribose O A ribose O H N A A A H cytosine guanine R-CH3, thymine adenine A D DNA, RNA, etc. PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A) How would the base pairing be affected if the bases existed in the “enol” form? D D A A D A H H R O H H N N R O H N N D N A N N N H N N ribose ribose N N N N ribose O A ribose O A A A A A R-CH3, thymine adenine R-CH3, thymine adenine “enol” form of T DNA, RNA, etc. PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A) How would the base pairing be affected if the bases existed in the “enol” form? D A H A N H O N A N H N N ribose N D N ribose O H N H A cytosine guanine A D DNA, RNA, etc. PRACTICE PROBLEM 7 If one of the strands of DNA has the following sequence of bases running in the 5’ → 3’ direction, GGACAATCTGC a. what is the sequence of bases in the complementary strand? b. what base is closest to the 5’-end in the complementary strand? DNA, RNA, etc. DNA is stable, RNA is not: chemical stability O P O- O P O- O P O- O base O base O base O O O 5' 2' :B O OH O O O O - - O P O- O P O P O O- O base O base O O 2',3'-phosphodiester B H + O OH O OH OH base O RNA O OH DNA, RNA, etc. DNA is stable, RNA is not: chemical stability O P O- O P O- O P O- O base O base O base O O O 5' 2' :B O OH O O O O - - O P O- O P O P O O- O base O base O O 2',3'-phosphodiester B H + O OH O OH OH base O RNA O OH DNA, RNA, etc. DNA is stable, RNA is not: genetic stability DNA has thymine, RNA has uracil NH2 OH O tautomerization H2O N N HN MUTATION ! O N O N O N R RNA RNA cytosine uracil spontaneous deamination DNA, RNA, etc. DNA is stable, RNA is not: genetic stability DNA has thymine, RNA has uracil NH2 OH O tautomerization H2O N N HN MUTATION ! O N O N O N R RNA RNA cytosine uracil spontaneous deamination NH2 OH O O tautomerization H2O N N HN HN NOT recognized as O N O N O N O N defect and repaired R DNA DNA DNA cytosine uracil, NOT found in DNA DNA, RNA, etc. spontaneous deamination NH2 O H2O N NH + NH3 N O N O H H cytosine PRACTICE PROBLEM 16 Adenine can be deaminated to hypoxanthine, and guanine can be deaminated to xanthine. Draw structures for the deamination products. DNA, RNA, etc. DNA (bio)synthesis strand separation, replication fork ! is called replication again, always in 5’ → 3’ direction ! done by DNA polymerase using the nucleotide triphosphates X-ray structure of rb69 gp43 + thymine glycol DNA, RNA, etc.
Load more

Recommended publications
  • Chapter 23 Nucleic Acids
    7-9/99 Neuman Chapter 23 Chapter 23 Nucleic Acids from Organic Chemistry by Robert C. Neuman, Jr. Professor of Chemistry, emeritus University of California, Riverside [email protected] <http://web.chem.ucsb.edu/~neuman/orgchembyneuman/> Chapter Outline of the Book ************************************************************************************** I. Foundations 1. Organic Molecules and Chemical Bonding 2. Alkanes and Cycloalkanes 3. Haloalkanes, Alcohols, Ethers, and Amines 4. Stereochemistry 5. Organic Spectrometry II. Reactions, Mechanisms, Multiple Bonds 6. Organic Reactions *(Not yet Posted) 7. Reactions of Haloalkanes, Alcohols, and Amines. Nucleophilic Substitution 8. Alkenes and Alkynes 9. Formation of Alkenes and Alkynes. Elimination Reactions 10. Alkenes and Alkynes. Addition Reactions 11. Free Radical Addition and Substitution Reactions III. Conjugation, Electronic Effects, Carbonyl Groups 12. Conjugated and Aromatic Molecules 13. Carbonyl Compounds. Ketones, Aldehydes, and Carboxylic Acids 14. Substituent Effects 15. Carbonyl Compounds. Esters, Amides, and Related Molecules IV. Carbonyl and Pericyclic Reactions and Mechanisms 16. Carbonyl Compounds. Addition and Substitution Reactions 17. Oxidation and Reduction Reactions 18. Reactions of Enolate Ions and Enols 19. Cyclization and Pericyclic Reactions *(Not yet Posted) V. Bioorganic Compounds 20. Carbohydrates 21. Lipids 22. Peptides, Proteins, and α−Amino Acids 23. Nucleic Acids **************************************************************************************
    [Show full text]
  • Differential Effects of the Poly (ADP-Ribose)Polymerase (PARP
    British Journal of Cancer (2001) 84(1), 106–112 © 2001 Cancer Research Campaign doi: 10.1054/ bjoc.2000.1555, available online at http://www.idealibrary.com on http://www.bjcancer.com Differential effects of the poly (ADP-ribose) polymerase (PARP) inhibitor NU1025 on topoisomerase I and II inhibitor cytotoxicity in L1210 cells in vitro KJ Bowman*, DR Newell, AH Calvert and NJ Curtin Cancer Research Unit, University of Newcastle upon Tyne Medical School, Framlington Place, Newcastle upon Tyne NE2 4HH, UK Summary The potent novel poly(ADP-ribose) polymerase (PARP) inhibitor, NU1025, enhances the cytotoxicity of DNA-methylating agents and ionizing radiation by inhibiting DNA repair. We report here an investigation of the role of PARP in the cellular responses to inhibitors of topoisomerase I and II using NU1025. The cytotoxicity of the topoisomerase I inhibitor, camptothecin, was increased 2.6-fold in L1210 cells by co-incubation with NU1025. Camptothecin-induced DNA strand breaks were also increased 2.5-fold by NU1025 and exposure to camptothecin-activated PARP. In contrast, NU1025 did not increase the DNA strand breakage or cytotoxicity caused by the topoisomerase II inhibitor etoposide. Exposure to etoposide did not activate PARP even at concentrations that caused significant levels of apoptosis. Taken together, these data suggest that potentiation of camptothecin cytotoxicity by NU1025 is a direct result of increased DNA strand breakage, and that activation of PARP by camptothecin-induced DNA damage contributes to its repair and consequently cell survival. However, in L1210 cells at least, it would appear that PARP is not involved in the cellular response to etoposide-mediated DNA damage.
    [Show full text]
  • Evidence Suggests That RNA Was a Product of Evolution
    Putting together the pieces: Evidence suggests that RNA was a product of evolution Brian Cafferty and Nicholas V. Hud, Georgia Institute of Technology, Atlanta, GA, USA For the past four decades, prebiotic chemists have attempted to demonstrate the formation of RNA polymers by plausible prebiotic reactions. There have been notable advances, but to be certain, the spontaneous formation of RNA remains a grand challenge in origins of life research. From a different perspective, there are reasons to seriously consider the possibility that RNA is a product of evolution. If so, there may have never been a prebiotic mechanism that produced RNA polymers. We subscribe to this latter view and hypothesize that RNA is the penultimate member of continuous lineage of genetic polymers, with DNA being the ultimate member of this lineage. In this essay, we briefly summarize the case for why RNA is likely the descendant of one or more pre-RNA polymers that spontaneous assembled on the prebiotic earth. Nucleosides are each an assemblage of a nucleobase and a ribose sugar, whereas nucleotides, the monomeric units of RNA, are phosphorylated nucleosides (Figure 1). Prebiotic chemists have typically sought to form RNA in a seQuential fashion, starting with the formation of nucleotides, followed by their polymerization (Figure 1). However, of the four canonical RNA bases (adenine, cytosine, guanine, uracil), only adenine has been found to react with ribose in a model prebiotic reaction to produce nucleosides in appreciable yields (i.e., about 2%). The other three canonical nucleobases do not produce nucleosides when dried and heated with ribose. This apparent roadblock in RNA synthesis motivated the Orgel laboratory and, more recently, Sutherland and co-workers, to investigate the possibility that the nucleobases were first formed on a pre-existing sugar.
    [Show full text]
  • Inhibition by Cyclic Guanosine 3':5'-Monophosphate of the Soluble DNA Polymerase Activity, and of Partially Purified DNA Polymer
    Inhibition by Cyclic Guanosine 3':5'-Monophosphate of the Soluble DNA Polymerase Activity, and of Partially Purified DNA Polymerase A (DNA Polymerase I) from the Yeast Saccharomyces cere visiae Hans Eckstein Institut für Physiologische Chemie der Universität, Martinistr. 52-UKE, D-2000 Hamburg 20 Z. Naturforsch. 36 c, 813-819 (1981); received April 16/July 2, 1981 Dedicated to Professor Dr. Joachim Kühnauon the Occasion of His 80th Birthday cGMP, DNA Polymerase Activity, DNA Polymerase A, DNA Polymerase I, Baker’s Yeast DNA polymerase activity from extracts of growing yeast cells is inhibited by cGMP. Experiments with partially purified yeast DNA polymerases show, that cGMP inhibits DNA polymerase A (DNA polymerase I from Chang), which is the main component of the soluble DNA polymerase activity in yeast extracts, by competing for the enzyme with the primer- template DNA. Since the enzyme is not only inhibited by 3',5'-cGMP, but also by 3',5'-cAMP, the 3': 5'-phosphodiester seems to be crucial for the competition between cGMP and primer. This would be inconsistent with the concept of a 3'-OH primer binding site in the enzyme. The existence of such a site in the yeast DNA polymerase A is indicated from studies with various purine nucleoside monophosphates. When various DNA polymerases are compared, inhibition by cGMP seems to be restricted to those enzymes, which are involved in DNA replication. DNA polymerases with an associated nuclease activity are not inhibited, DNA polymerase B from yeast is even activated by cGMP. Though some relations between the cGMP effect and the presumed function of the enzymes in the living cell are apparent, the biological meaning of the observations in general remains open.
    [Show full text]
  • ATP Structure and Function
    ATP: Universal Currency of Cellular Energy All living things including plants, animals, birds, insects, humans need energy for the proper functioning of cells, tissues and other organ systems. As we are aware that green plants, obtain their energy from the sunlight, and animals get their energy by feeding on these plants. Energy acts as a source of fuel. We, humans, gain energy from the food we eat, but how are the energy produced and stored in our body. A living cell cannot store significant amounts of free energy. Excess free energy would result in an increase of heat in the cell, which would result in excessive thermal motion that could damage and then destroy the cell. Rather, a cell must be able to handle that energy in a way that enables the cell to store energy safely and release it for use only as needed. Living cells accomplish this by using the compound adenosine triphosphate (ATP). ATP is often called the “energy currency” of the cell, and, like currency, this versatile compound can be used to fill any energy need of the cell. How? It functions similarly to a rechargeable battery. When ATP is broken down, usually by the removal of its terminal phosphate group, energy is released. The energy is used to do work by the cell, usually by the released phosphate binding to another molecule, activating it. For example, in the mechanical work of muscle contraction, ATP supplies the energy to move the contractile muscle proteins. Recall the active transport work of the sodium-potassium pump in cell membranes.
    [Show full text]
  • Questions with Answers- Nucleotides & Nucleic Acids A. the Components
    Questions with Answers- Nucleotides & Nucleic Acids A. The components and structures of common nucleotides are compared. (Questions 1-5) 1._____ Which structural feature is shared by both uracil and thymine? a) Both contain two keto groups. b) Both contain one methyl group. c) Both contain a five-membered ring. d) Both contain three nitrogen atoms. 2._____ Which component is found in both adenosine and deoxycytidine? a) Both contain a pyranose. b) Both contain a 1,1’-N-glycosidic bond. c) Both contain a pyrimidine. d) Both contain a 3’-OH group. 3._____ Which property is shared by both GDP and AMP? a) Both contain the same charge at neutral pH. b) Both contain the same number of phosphate groups. c) Both contain the same purine. d) Both contain the same furanose. 4._____ Which characteristic is shared by purines and pyrimidines? a) Both contain two heterocyclic rings with aromatic character. b) Both can form multiple non-covalent hydrogen bonds. c) Both exist in planar configurations with a hemiacetal linkage. d) Both exist as neutral zwitterions under cellular conditions. 5._____ Which property is found in nucleosides and nucleotides? a) Both contain a nitrogenous base, a pentose, and at least one phosphate group. b) Both contain a covalent phosphodister bond that is broken in strong acid. c) Both contain an anomeric carbon atom that is part of a β-N-glycosidic bond. d) Both contain an aldose with hydroxyl groups that can tautomerize. ___________________________________________________________________________ B. The structures of nucleotides and their components are studied. (Questions 6-10) 6._____ Which characteristic is shared by both adenine and cytosine? a) Both contain one methyl group.
    [Show full text]
  • Induced Structural Changes in a Multifunctional Sialyltransferase
    Biochemistry 2006, 45, 2139-2148 2139 Cytidine 5′-Monophosphate (CMP)-Induced Structural Changes in a Multifunctional Sialyltransferase from Pasteurella multocida†,‡ Lisheng Ni,§ Mingchi Sun,§ Hai Yu,§ Harshal Chokhawala,§ Xi Chen,*,§ and Andrew J. Fisher*,§,| Department of Chemistry and the Section of Molecular and Cellular Biology, UniVersity of California, One Shields AVenue, DaVis, California 95616 ReceiVed NoVember 23, 2005; ReVised Manuscript ReceiVed December 19, 2005 ABSTRACT: Sialyltransferases catalyze reactions that transfer a sialic acid from CMP-sialic acid to an acceptor (a structure terminated with galactose, N-acetylgalactosamine, or sialic acid). They are key enzymes that catalyze the synthesis of sialic acid-containing oligosaccharides, polysaccharides, and glycoconjugates that play pivotal roles in many critical physiological and pathological processes. The structures of a truncated multifunctional Pasteurella multocida sialyltransferase (∆24PmST1), in the absence and presence of CMP, have been determined by X-ray crystallography at 1.65 and 2.0 Å resolutions, respectively. The ∆24PmST1 exists as a monomer in solution and in crystals. Different from the reported crystal structure of a bifunctional sialyltransferase CstII that has only one Rossmann domain, the overall structure of the ∆24PmST1 consists of two separate Rossmann nucleotide-binding domains. The ∆24PmST1 structure, thus, represents the first sialyltransferase structure that belongs to the glycosyltransferase-B (GT-B) structural group. Unlike all other known GT-B structures, however, there is no C-terminal extension that interacts with the N-terminal domain in the ∆24PmST1 structure. The CMP binding site is located in the deep cleft between the two Rossmann domains. Nevertheless, the CMP only forms interactions with residues in the C-terminal domain.
    [Show full text]
  • Disclosing the Essentiality of Ribose-5-Phosphate Isomerase B In
    www.nature.com/scientificreports OPEN Disclosing the essentiality of ribose-5-phosphate isomerase B in Trypanosomatids Received: 04 January 2016 Joana Faria1,2, Inês Loureiro1,2, Nuno Santarém1,2, Pedro Cecílio1,2, Sandra Macedo-Ribeiro2,3, Accepted: 10 May 2016 Joana Tavares1,2,* & Anabela Cordeiro-da-Silva1,2,4,* Published: 27 May 2016 Ribose-5-phosphate isomerase (RPI) belongs to the non-oxidative branch of the pentose phosphate pathway, catalysing the inter-conversion of D-ribose-5-phosphate and D-ribulose-5-phosphate. Trypanosomatids encode a type B RPI, whereas humans have a structurally unrelated type A, making RPIB worthy of exploration as a potential drug target. Null mutant generation in Leishmania infantum was only possible when an episomal copy of RPIB gene was provided, and the latter was retained both in vitro and in vivo in the absence of drug pressure. This suggests the gene is essential for parasite survival. Importantly, the inability to remove the second allele of RPIB gene in sKO mutants complemented with an episomal copy of RPIB carrying a mutation that abolishes isomerase activity suggests the essentiality is due to its metabolic function. In vitro, sKO promastigotes exhibited no defect in growth, metacyclogenesis or macrophage infection, however, an impairment in intracellular amastigotes’ replication was observed. Additionally, mice infected with sKO mutants rescued by RPIB complementation had a reduced parasite burden in the liver. Likewise, Trypanosoma brucei is resistant to complete RPIB gene removal and mice infected with sKO mutants showed prolonged survival upon infection. Taken together our results genetically validate RPIB as a potential drug target in trypanosomatids.
    [Show full text]
  • Modeling of the Hydration Shell of Uracil and Thymine
    Int. J. Mol. Sci. 2000, 1, 17-27 International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.org/ijms/ Modeling of the Hydration Shell of Uracil and Thymine Oleg V. Shishkin1,2, Leonid Gorb2 and Jerzy Leszczynski2* 1Department of Alkali Halide Crystals, Institute for Single Crystals, National Academy of Sciences of Ukraine, 60 Lenina Avenue., Kharkiv 310001, Ukraine 2Computational Center for Molecular Structure and Interactions, Department of Chemistry, Jackson State University, P.O. Box 17910, 1325 Lynch Street, Jackson, MS 39217, USA E-mail: [email protected] *Author to whom correspondence should be addressed. Received: 4 January 2000 / Accepted: 30 March 2000 / Published: 4 March 2000 Abstract: The molecular geometry of complexes of uracil and thymine with 11 water mole- cules was calculated using the density functional theory with the B3LYP functional. The standard 6-31G(d) basis set has been employed. It was found that the arrangement of water molecules forming a locked chain around the nucleobases significantly differs for uracil and thymine. The presence of a methyl group in thymine results in strong non-planarity of the hydrated shell. The existence of C-H...O hydrogen bonds between the water molecules and the hydrophobic part of the nucleobases is established. Interactions with water molecules cause some changes in the geometry of uracil and thymine which can be explained by the contribution of a zwitter-ionic dihydroxy resonance form into the total structure of the molecules. Keywords: Uracil, Thymine, Hydration, Molecular structure, Hydrogen bonds, Density functional theory. Introduction Since Franklin and Gosling [1] examined the first fibers of DNA it has been known that DNA oc- curs in vivo in the hydrated form.
    [Show full text]
  • Abiotic Synthesis of Purine and Pyrimidine Ribonucleosides in Aqueous Microdroplets
    Abiotic synthesis of purine and pyrimidine ribonucleosides in aqueous microdroplets Inho Nama,b, Hong Gil Nama,c,1, and Richard N. Zareb,1 aCenter for Plant Aging Research, Institute for Basic Science, Daegu 42988, Republic of Korea; bDepartment of Chemistry, Stanford University, Stanford, CA 94305; and cDepartment of New Biology, Daegu Gyeongbuk Institute of Science and Technology (DGIST), Daegu 42988, Republic of Korea Contributed by Richard N. Zare, November 27, 2017 (sent for review October 24, 2017; reviewed by Bengt J. F. Nordén and Veronica Vaida) Aqueous microdroplets (<1.3 μm in diameter on average) containing In a recent study, we showed a synthetic pathway for the 15 mM D-ribose, 15 mM phosphoric acid, and 5 mM of a nucleobase formation of Rib-1-P using aqueous, high–surface-area micro- (uracil, adenine, cytosine, or hypoxanthine) are electrosprayed from a droplets. This surface or near-surface reaction circumvents the capillary at +5 kV into a mass spectrometer at room temperature and fundamental thermodynamic problem of the condensation re- 2+ 1 atm pressure with 3 mM divalent magnesium ion (Mg )asacat- action (12). It has been suggested that the air–water interface alyst. Mass spectra show the formation of ribonucleosides that com- provides a favorable environment for the prebiotic synthesis of prise a four-letter alphabet of RNA with a yield of 2.5% of uridine (U), biomolecules (12–17). Using the Rib-1-P made in the above 2.5% of adenosine (A), 0.7% of cytidine (C), and 1.7% of inosine (I) during the flight time of ∼50 μs.
    [Show full text]
  • Guanosine-Based Nucleotides, the Sons of a Lesser God in the Purinergic Signal Scenario of Excitable Tissues
    International Journal of Molecular Sciences Review Guanosine-Based Nucleotides, the Sons of a Lesser God in the Purinergic Signal Scenario of Excitable Tissues 1,2, 2,3, 1,2 1,2, Rosa Mancinelli y, Giorgio Fanò-Illic y, Tiziana Pietrangelo and Stefania Fulle * 1 Department of Neuroscience Imaging and Clinical Sciences, University “G. d’Annunzio” of Chieti-Pescara, 66100 Chieti, Italy; [email protected] (R.M.); [email protected] (T.P.) 2 Interuniversity Institute of Miology (IIM), 66100 Chieti, Italy; [email protected] 3 Libera Università di Alcatraz, Santa Cristina di Gubbio, 06024 Gubbio, Italy * Correspondence: [email protected] Both authors contributed equally to this work. y Received: 30 January 2020; Accepted: 25 February 2020; Published: 26 February 2020 Abstract: Purines are nitrogen compounds consisting mainly of a nitrogen base of adenine (ABP) or guanine (GBP) and their derivatives: nucleosides (nitrogen bases plus ribose) and nucleotides (nitrogen bases plus ribose and phosphate). These compounds are very common in nature, especially in a phosphorylated form. There is increasing evidence that purines are involved in the development of different organs such as the heart, skeletal muscle and brain. When brain development is complete, some purinergic mechanisms may be silenced, but may be reactivated in the adult brain/muscle, suggesting a role for purines in regeneration and self-repair. Thus, it is possible that guanosine-50-triphosphate (GTP) also acts as regulator during the adult phase. However, regarding GBP, no specific receptor has been cloned for GTP or its metabolites, although specific binding sites with distinct GTP affinity characteristics have been found in both muscle and neural cell lines.
    [Show full text]
  • Thymine, Uracil and Adenine 21
    CHAPTER 4: THYMINE, URACIL AND ADENINE 21 CHAPTER 4: THYMINE, URACIL AND ADENINE 22 CHAPTER 4: THYMINE, URACIL AND ADENINE 4.1 THYMINE Not only the pyrimidines present in the nucleic acids (cytosine, uracil and thymine) but also a great number of other pyrimidine derivatives play a vital role in many biological processes. In most biological systems vitamin B1 (derivative of 2-methyl-4- aminopyrimidine) occurs as its coenzyme, the specie that functions in biological systems [106]. Another pyrimidine alloxan was intensively studied [64,65] due to cause diabetes when administrated in laboratory animals. A number of pyrimidines derivatives are antimetabolites, been of clinical interest in cancer chemotherapy. 4.1.1 TAUTOMERISM AND PK VALUE Thymine exists in two tautomeric forms the keto and the enol form, where the keto form is strongly favored in the equilibrium. O OH H C H C 3 4 3 5 3NH N 6 2 1 N O N OH H Keto Enol Figure 4.1: Tautomeric forms for thymine. At alkaline pH the hydrogen N(3) for thymine is removed, indicating the weak basicity of the ring nitrogen. CHAPTER 4: THYMINE, URACIL AND ADENINE 23 O O H3C H3C 4 pKa=9.5 4 - 5 N 5 3NH 3 2 6 2 6 1 1 N O N O H H Figure 4.2: Ionization constant for thymine. Arrow indicates the dipole moment. 4.1.2 ADSORPTION OF THYMINE ON AU(111) AND AU POLYCRISTALLINE The adsorption of pyrimidines (uracil, thymine, and cytosine) on electrode surfaces had been carefully investigated in many studies in the recent years [24,51,52,54-56].
    [Show full text]