DOCSLIB.ORG

Title Page Krüppel-Like Factor 9 (KLF9) Promotes Hepatic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Title Page Krüppel-Like Factor 9 (KLF9) Promotes Hepatic Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 1, 2021 MOL #93666 #93666 MOL 1 Department of Microbiology and Immunology (A.M.), College of of College (A.M.), Immunology and Microbiology of Department This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Molecular Pharmacology Fast Forward. Published on September 12, 2014 as DOI: 10.1124/mol.114.093666 Medicine, University of Illinois at Chicago, Chicago, IL 60612 60612 IL Chicago, Chicago, at of Illinois University Medicine, Molecular and Biology of Departments and Dynamics, Chromatin and Epigenetics of Laboratory 55905 (R.U.) MN Rochester, Clinic, Mayo Biology, Title page page Title during Expression 2D6 P450 (CYP) Cytochrome hepatic Promotes 9 (KLF9) Factor Krüppel-like Pregnancy in CYP2D6-humanized Mice Jeong Hyunyoung Urrutia, Raul McLachlan, Alan Zhang, Wei Pan, Xian Koh, Hye Kwi and (X.P Sciences of Biopharmaceutical Department H.J.), and (K.H.K Practice Pharmacy of Department 60612 IL Chicago, Chicago, at Illinois of University Pharmacy, of College H.J), (W.Z), Pediatrics of Department Molecular Pharmacology Fast Forward. Published on September 12, 2014
Load more

Recommended publications
  • Association Between C4, C4A, and C4B Copy Number Variations And
    www.nature.com/scientificreports OPEN Association between C4, C4A, and C4B copy number variations and susceptibility to autoimmune Received: 17 June 2016 Accepted: 04 January 2017 diseases: a meta-analysis Published: 16 February 2017 Na Li1, Jun Zhang2, Dan Liao2, Lu Yang2, Yingxiong Wang1 & Shengping Hou2,3 Although several studies have investigated the association between C4, C4A, and C4B gene copy number variations (CNVs) and susceptibility to autoimmune diseases, the results remain inconsistency for those diseases. Thus, in this study, a comprehensive meta-analysis was conducted to assess the role of C4, C4A, and C4B CNVs in autoimmune diseases in different ethnic groups. A total of 16 case-control studies described in 12 articles (8663 cases and 11099 controls) were included in this study. The pooled analyses showed that a low C4 gene copy number (GCN) (<4) was treated as a significant risk factor (odds ratio [OR] = 1.46, 95% confidence interval [CI] = 1.19–1.78) for autoimmune diseases compared with a higher GCN (>4). The pooled statistical results revealed that low C4 (<4) and low C4A (<2) GCNs could be risk factors for systemic lupus erythematosus (SLE) in Caucasian populations. Additionally, the correlation between C4B CNVs and all type of autoimmune diseases could not be confirmed by the current meta-analysis (OR = 1.07, 95% CI = 0.93–1.24). These data suggest that deficiency or absence of C4 and C4A CNVs may cause susceptibility to SLE. The complement system, which is involved in both innate and adaptive immunity, is characterized by triggered-enzyme cascades activated by alternative, lectin or classical pathways1.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • WO 2016/147053 Al 22 September 2016 (22.09.2016) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/147053 Al 22 September 2016 (22.09.2016) P O P C T (51) International Patent Classification: (71) Applicant: RESVERLOGIX CORP. [CA/CA]; 300, A61K 31/551 (2006.01) A61P 37/02 (2006.01) 4820 Richard Road Sw, Calgary, AB, T3E 6L1 (CA). A61K 31/517 (2006.01) C07D 239/91 (2006.01) (72) Inventors: WASIAK, Sylwia; 431 Whispering Water (21) International Application Number: Trail, Calgary, AB, T3Z 3V1 (CA). KULIKOWSKI, PCT/IB20 16/000443 Ewelina, B.; 31100 Swift Creek Terrace, Calgary, AB, T3Z 0B7 (CA). HALLIDAY, Christopher, R.A.; 403 (22) International Filing Date: 138-18th Avenue SE, Calgary, AB, T2G 5P9 (CA). GIL- 10 March 2016 (10.03.2016) HAM, Dean; 249 Scenic View Close NW, Calgary, AB, (25) Filing Language: English T3L 1Y5 (CA). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (30) Priority Data: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, 62/132,572 13 March 2015 (13.03.2015) US BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, 62/264,768 8 December 2015 (08. 12.2015) US DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, [Continued on nextpage] (54) Title: COMPOSITIONS AND THERAPEUTIC METHODS FOR THE TREATMENT OF COMPLEMENT-ASSOCIATED DISEASES (57) Abstract: The invention comprises methods of modulating the complement cascade in a mammal and for treating and/or preventing diseases and disorders as sociated with the complement pathway by administering a compound of Formula I or Formula II, such as, for example, 2-(4-(2-hydroxyethoxy)-3,5-dimethylphenyl)- 5,7-dimethoxyquinazolin-4(3H)-one or a pharmaceutically acceptable salt thereof.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Regulation of Xenobiotic and Bile Acid Metabolism by the Anti-Aging Intervention Calorie Restriction in Mice
    REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE By Zidong Fu Submitted to the Graduate Degree Program in Pharmacology, Toxicology, and Therapeutics and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. Dissertation Committee ________________________________ Chairperson: Curtis Klaassen, Ph.D. ________________________________ Udayan Apte, Ph.D. ________________________________ Wen-Xing Ding, Ph.D. ________________________________ Thomas Pazdernik, Ph.D. ________________________________ Hao Zhu, Ph.D. Date Defended: 04-11-2013 The Dissertation Committee for Zidong Fu certifies that this is the approved version of the following dissertation: REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE ________________________________ Chairperson: Curtis Klaassen, Ph.D. Date approved: 04-11-2013 ii ABSTRACT Calorie restriction (CR), defined as reduced calorie intake without causing malnutrition, is the best-known intervention to increase life span and slow aging-related diseases in various species. However, current knowledge on the exact mechanisms of aging and how CR exerts its anti-aging effects is still inadequate. The detoxification theory of aging proposes that the up-regulation of xenobiotic processing genes (XPGs) involved in phase-I and phase-II xenobiotic metabolism as well as transport, which renders a wide spectrum of detoxification, is a longevity mechanism. Interestingly, bile acids (BAs), the metabolites of cholesterol, have recently been connected with longevity. Thus, this dissertation aimed to determine the regulation of xenobiotic and BA metabolism by the well-known anti-aging intervention CR. First, the mRNA expression of XPGs in liver during aging was investigated.
    [Show full text]
  • Anti-C4B Monoclonal Antibody, Clone FQS3001(3) (DCABH-5883) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-C4B monoclonal antibody, clone FQS3001(3) (DCABH-5883) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Rabbit monoclonal to C4 Antigen Description This gene encodes the basic form of complement factor 4, part of the classical activation pathway. The protein is expressed as a single chain precursor which is proteolytically cleaved into a trimer of alpha, beta, and gamma chains prior to secretion. The trimer provides a surface for interaction between the antigen-antibody complex and other complement components. The alpha chain may be cleaved to release C4 anaphylatoxin, a mediator of local inflammation. Deficiency of this protein is associated with systemic lupus erythematosus. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. Varying haplotypes of this gene cluster exist, such that individuals may have 1, 2, or 3 copies of this gene. In addition, this gene exists as a long form and a short form due to the presence or absence of a 6.4 kb endogenous HERV-K retrovirus in intron 9. This GeneID and its associated RefSeq record represent a second copy of C4B found on ALT_REF_LOCI_7. Immunogen Synthetic peptide within Human C4 aa 1200-1300 (Cysteine residue). The exact sequence is proprietary. Note: this sequence is identical in both C4 subunits A (P0C0L4) and B (P0C0L5).Database link: P0C0L4 Isotype IgG Source/Host Rabbit Species Reactivity Human Clone FQS3001(3) Purity Tissue culture supernatant Conjugate Unconjugated Applications WB, ICC/IF Positive Control HepG2 cell lysate, HepG2 cells Format Liquid Size 100 μl 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Buffer pH: 7.20; Preservative: 0.01% Sodium azide; Constituents: 49% PBS, 50% Glycerol, 0.05% BSA Preservative 0.01% Sodium Azide Storage Store at +4°C short term (1-2 weeks).
    [Show full text]
  • Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag
    Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS.
    [Show full text]
  • Type of the Paper (Article
    Supplementary Material A Proteomics Study on the Mechanism of Nutmeg-induced Hepatotoxicity Wei Xia 1, †, Zhipeng Cao 1, †, Xiaoyu Zhang 1 and Lina Gao 1,* 1 School of Forensic Medicine, China Medical University, Shenyang 110122, P. R. China; lessen- [email protected] (W.X.); [email protected] (Z.C.); [email protected] (X.Z.) † The authors contributed equally to this work. * Correspondence: [email protected] Figure S1. Table S1. Peptide fraction separation liquid chromatography elution gradient table. Time (min) Flow rate (mL/min) Mobile phase A (%) Mobile phase B (%) 0 1 97 3 10 1 95 5 30 1 80 20 48 1 60 40 50 1 50 50 53 1 30 70 54 1 0 100 1 Table 2. Liquid chromatography elution gradient table. Time (min) Flow rate (nL/min) Mobile phase A (%) Mobile phase B (%) 0 600 94 6 2 600 83 17 82 600 60 40 84 600 50 50 85 600 45 55 90 600 0 100 Table S3. The analysis parameter of Proteome Discoverer 2.2. Item Value Type of Quantification Reporter Quantification (TMT) Enzyme Trypsin Max.Missed Cleavage Sites 2 Precursor Mass Tolerance 10 ppm Fragment Mass Tolerance 0.02 Da Dynamic Modification Oxidation/+15.995 Da (M) and TMT /+229.163 Da (K,Y) N-Terminal Modification Acetyl/+42.011 Da (N-Terminal) and TMT /+229.163 Da (N-Terminal) Static Modification Carbamidomethyl/+57.021 Da (C) 2 Table S4. The DEPs between the low-dose group and the control group. Protein Gene Fold Change P value Trend mRNA H2-K1 0.380 0.010 down Glutamine synthetase 0.426 0.022 down Annexin Anxa6 0.447 0.032 down mRNA H2-D1 0.467 0.002 down Ribokinase Rbks 0.487 0.000
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al
    US 201500 72349A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis et al. (43) Pub. Date: Mar. 12, 2015 (54) CANCER BOMARKERS AND METHODS OF (52) U.S. Cl. USE CPC. G0IN33/57484 (2013.01); G0IN 2333/705 (2013.01) (71) Applicant: University Health Network, Toronto USPC ......................................... 435/6.12: 435/7.94 (CA) (57) ABSTRACT A method of evaluating a probability a Subject has a cancer, (72) Inventors: Eleftherios P. Diamandis, Toronto diagnosing a cancer and/or monitoring cancer progression (CA); Ioannis Prassas, Toronto (CA); comprising: a. measuring an amount of a biomarker selected Shalini Makawita, Toronto (CA); from the group consisting of CUZD1 and/or LAMC2 and/or Caitlin Chrystoja, Toronto (CA); Hari the group CUZD1, LAMC2, AQP8, CELA2B, CELA3B, M. Kosanam, Maple (CA) CTRB1, CTRB2, GCG, IAPP, INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, KLK3, NPY, (21) Appl. No.: 14/385,449 PSCA, RLN1, SLC45A3, DSP GP73, DSG2, CEACAM7, CLCA1, GPA33, LEFTY1, ZG16, IRX5, LAMP3, MFAP4, (22) PCT Fled: Mar. 15, 2013 SCGB1A1, SFTPC, TMEM100, NPY, PSCA RLN1 and/or SLC45A3 in a test sample from a subject with cancer; (86) PCT NO.: PCT/CA2O13/OOO248 wherein the cancer is pancreas cancer if CUZD1, LAMC2, S371 (c)(1), AQP8, CELA2B, CELA3B, CTRB1, CTRB2, GCG, LAPP (2) Date: Sep. 23, 2014 INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, DSP GP73 and/or DSG2 is selected; the cancer is colon cancer if CEACAM7, CLCA1, GPA33, LEFTY 1 and/ Related U.S. Application Data or ZG16 is selected, the cancer is lung cancer if IRX5, (60) Provisional application No.
    [Show full text]
  • Supporting Information for Proteomics DOI 10.1002/Prca.200780101
    Supporting Information for Proteomics DOI 10.1002/prca.200780101 Paul Cutler, Emma L. Akuffo, Wanda M. Bodnar, Deborah M. Briggs, John B. Davis, Christine M. Debouck, Steven M. Fox, Rachel A. Gibson, Darren A. Gormley, Joanna D. Holbrook, A. Jacqueline Hunter, Emma E. Kinsey, Rabinder Prinjha, Jill C. Richardson, Allen D. Roses, Marjorie A. Smith, Nikos Tsokanas, David R. Will, Wen Wu, John W. Yates and Israel S. Gloger Proteomic identification and early validation of complement 1 inhibitor and pigment epithelium-derived factor: Two novel biomarkers of Alzheimer’s disease in human plasma ª 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.clinical.proteomics-journal.com Supplementary Table 1: Complete list of proteins identified from spots derived from 2D gel analysis of human plasma. Each protein was observed to be in a spot showing altered expression between Alzheimer’s disease and matched control by statistical methods as described in the Methods section. Each protein is identified by the gene description and the HUGO gene symbol. The number of “changing” spots in which this protein was observed is also given. HUGO Human Gene Number of Gene Description Symbol Spots alpha-1-B glycoprotein; A1BG 5 alpha-2-macroglobulin A2M 7 afamin; AFM 1 angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGT 4 alpha-2-HS-glycoprotein AHSG 3 albumin ALB 90 alpha-1-microglobulin/bikunin precursor; AMBP 1 annexin A1 ANXA1 1 amyloid P component, serum APCS 3 apolipoprotein A-I APOA1 14 apolipoprotein A-IV APOA4 2 apolipoprotein E APOE 2 apolipoprotein
    [Show full text]