Strategies to study sex-determining in the mouse

Amy E. Johnson

A thesis submitted to the University of London in fulfilment of the requirements for the degree of Doctor of Philosophy.

May 2002

Division of Developmental Genetics, National Institute For Medical Research, The Ridgeway, Mill Hill, London, NW7 lAY. ProQuest Number: U643301

All rights reserved

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.

ProQuest U643301

Published by ProQuest LLC(2015). Copyright of the Dissertation is held by the Author.

All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC.

ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 This thesis is dedicated to my immediate family, Janice,

Clive, Molly, Matthew, Ben, Emma and my fiancé Geoff Table Of Contents

ACKNOWLEDGEMENTS ...... / ABSTRACT ...... IV 1 CHAPTER 1- GENERAL INTRODUCTION...... 1 lA SEX DETERMINATION...... 1 1.1.1 Drosophila and C-ele^ans ...... 1 1.1.2 Birds...... 3 1.1.3 Mammals...... 4 1.1.4 Reptiles ...... 4 E2 DIFFERENTIATION OF THE GONAD AND INTERNAL GENITALIA...... 5 1.2.1 Testis descent...... 6 13 CELL LINEAGES...... 7 L4 SOMATIC CELL DIFFERENTIATION...... 10 13 INDENTIFICATION OF THE TESTIS DETERMINING ...... 15 1.5.1 Biochemical Properties of SRY ...... 15 13 GENES REOUIRED FOR GONAD FORMATION...... 18 1.6.1 WT-1...... 18 1.6.2 STERIODOGENIC FACTOR 1 (SFl)...... 20 1.6.3 LHX9 ...... 21 1.6.4 M33...... 22 L7 GENETIC CONTROL OF TESTIS FORMATION...... 23 1.7.1 CAMPOMELIC DYSPLASIA AND S0X9 ...... 23 1.7.2 DM RTl...... 34 1.7.3 DESERT HEDGEHOG (Dhh)...... 35 1.7.4 TESTATIN...... 36 1.7.5 GATA-4 (see also AMH) ...... 37 1.7.6 FIBROBLAST GROWTH FACTOR 9 (FGF-9)...... 38 1.7.7 ANTI-MÜLLERIAN HORMONE (AMH)...... 39 L8 SUMMARY ...... 43 1^ GENES EXPRESSED DURING OVARIAN DEVELOPMENT...... 44 1.9.1 DOSAGE SENSITIVE SEX REVERSAL (DSS) and DAX-1 ...... 44 1.9.2 WNT-4 ...... 46 1.9.3 GDF-9 (‘Ooctyte-secreted growth factor’) ...... 47 1.10 AIMS OF THIS TH ESIS...... 49 2 CHAPTER 2 - ENGINEERING A S0X9 CONDITIONAL MUTATION.. 51 2.1 INTRODUCTION...... 51 2.1.1 Designing a conditional targeted mutation ...... 51 2.1.2 Inactivating Sox9 within the developing genital ridge ...... 53 22 MATERIALS AND METHODS...... 56 2.2.1 Cloning tecliniques and reagents used to generate the Sox9 targeting construct ...... 56 2.2.2 Bacteria used for amplification of Sox9 phage clone ...... 56 2.2.3 Liquid culture of bacteriophage ...... 56 2.2.4 Isolation of bacteriophage X DNA...... 57 2.2.5 Preparation of Epicurian Coli XL 10-Gold Ultracompetent Cells...... 57 2.2.6 Small and Large scale plasmid preparation...... 58 2.2.7 Restriction enzyme digestion of DNA ...... 58 2.2.8 Blue-white cloning Assay ...... 58 2.2.9 Quantification of nucleic acid concentrations ...... 58 2.2.10 Electrophoretic separation of DNA ...... 59 2.2.11 Extraction of DNA ...... 59 2.2.12 Blunt-ending, phosphatasing and ligation of DNA fragments ...... 60 2.2.13 Partial endonuclease digestion of DNA ...... 61 2.2.14 Colony Hybridization - Screening for recombinant plasmids ...... 61 2.2.15 Generating double-stranded loxP and Fit oligonucleotides for use in the Sox9 conditional targeting mutation ...... 62 2.2.16 Double Stranded DNA Sequencing ...... 64 2.2.17 TISSUE CULTURE TECHNIQUES AND TRANSFECTION ASSAYS ...... 65 23 RESULTS and DISCUSSION...... 67 2.3.1 Building the Sox9 conditional targeting vector ...... 67 2.3.2 Choosing a Reporter ...... 71 2.3.3 PGK-Neo ...... 71 2.3.4 Testing the function of Sox9'^^^ in vitro before gene targeting ...... 73 2.3.5 Checking the expression of the MmGFP reporter in vitro prior to gene targeting ...... 76 3 CHAPTER 3 - TARGETING THE S0X9 LOCUS INES CELLS USING THE CONSTRUCTPSOX9^^^^ ...... 78 3J_ INTRODUCTION...... 78 3.1.1 ES Cells...... 78 3.1.2 Gene targeting ...... 78 3.1.3 Choosing the correct Embryonic Stem cell line ...... 80 3.1.4 Differentiating Embryonic Stem cells in culture ...... 80 32 MATERIALS AND METHODS...... 82 3.2.1 Cell Lines...... 82 3.2.2 Electroporation ...... 83 3.2.3 Selection of transfected cells ...... 84 3.2.4 Extraction of DN A from ES cells (Death wish!) ...... 84 3.2.5 Southern blotting ...... 85 3.2.6 Hybridisation ...... 86 3.2.7 Cre-mediated recombination between two loxP sites ...... 86 3.2.8 Blastocyst injection of Sox9'"^'' targeted ES cells ...... 87 3.2.9 Pseudopregnant recipients ...... 87 3.2.10 Chromosomal analysis of targeted ES cells using metaphase spreads 88 M RESULTS & DISCUSSION...... 89 3.3.1 Gene Targeting ...... 89 3.3.2 Blastocyst Injection ...... 89 3.3.3 Karyotype Analysis and Mouse Painting ...... 90 3.3.4 Common Cliromosomal Abnormalities in ES Cells ...... 90 3.3.5 Targeting Sox9 - Part 2 ...... 94 3.3.6 Screening for both loxP sites ...... 94 3.3.7 Plasmid Contamination? ...... 97 3.3.8 Extraction of Genomic DNA from ES cells or problems with the hybridisation probe? ...... 98 3.3.9 Homologous Recombination and Random Integration ...... 98 3.3.10 Fluorescent In Situ Hybridisation on Metaphase Spreads ...... 100 3.3.11 Targeting Sox9 - Part Three ...... 105 3.3.12 Targeting Sox9 - Part Four ...... 106 3.3.13 The unobtainable goal ...... 106 4 CHAPTER 4 - GENERATING TRANSGENIC MICE TO DRIVE EXPRESSION OF CRE-^RECOMBINASE WITHIN THE GENITAL RIDGE 107 M INTRODUCTION...... 107 4.1.1 Cre mediated recombination ...... 107 4.1.2 Inactivating Sox9 Specifically within the Genital Ridge ...... 108 4.1.3 D axl...... 108 4.1.4 Sry ...... 110 4.1.5 Inducible Systems ...... I l l 4 2 MATERIALS AND METHODS...... 113 4.2.1 The Cloning of Dax-Cre ...... 113 4.2.2 The Cloning of Sry-Cre ...... 113 4.2.3 The Cloning of inducible Dax-Cre (Dax-CreER^^) ...... 113 4.2.4 Preparation of DNA for microiniection ...... 114 4.2.5 Superovulated mice ...... 114 4.2.6 Pro-nuclear Injection ...... 115 4.2.7 Pseudopregnant recipients ...... 115 4.2.8 ROSA26 Reporter mice (R26R) ...... 116 4.2.9 Preparation and administration of 4-hydroxy-tamoxifen (4-OHT) and tamoxifen (Tam) ...... 116 4.2.10 PCR Analysis of transgenic m ice ...... 117 4.2.11 X-gal Staining of embryos ...... 118 4 3 RESULTS...... 119 4.3.1 Dax-Cre mouse lines ...... 119 4.3.2 Sry-Cre Mouse lines ...... 120 4.3.3 Dax-Inducible Cre (PIC) ...... 128 4.3.4 Cre activity in the somatic cellsof the genital ridge in Sox9^^'^^mice.... 133 4.3.5 Do follicle cells and Sertoli cells share a common cell precursor? ...... 134 5 CHAPTER 5 - FINAL CONCLUSIONS ...... 137 5.1 The targeting strategy ...... 138 5.2 Gene Targeting ...... 138 5.3 Generating Cre mice ...... 139 5.4 The Past, Present and the Future ...... 141 5.4.1 Karyotyping ...... 141 5.4.2 Gene targeting ...... 141 5.4.3 Cre mouse lines ...... 145 5.5 Closing Statement ...... 150 6 APPENDIX ...... 153 ABBREVIATIONS...... 153 REFERENCES ...... 161 Figures & Tables

TABLE OF CONTENTS ...... 3 FIGURE A: MODEL OF HOW THE ODSEX MUTATION AFFECTS S0X9 EXPRESSION, ...... 31 FIGURE B: A MODEL FOR AMH TRANSCRIPTION IN SERTOLI CELLS OF THE MALE GONAD...... 42 FIGURE C: OVERVIEW: A WORKING MODEL OF SEX DETERMINATION48 FIGURE 1: BUILDING THE CONDITIONAL TARGETING CONSTRUCT PS0X9^^^^^...... 69 FIGURE 2: ENGINEERING THE SELECTION CASSETTE 1 ...... 70 FIGURE 3: PS0X9^^^^^ TARGETING CONSTRUCT,...... 74 FIGURE 4: TESTING THE FUNCTION OF THE LOXP AND FRT SITES USING E-COLI STRAINS 294-CRE AND 294-FLP ...... 75 FIGURE 5: C3H10T1/2 CELLS TRANSFECTED WITH PS0X9^^^^ AND POG231...... 77 FIGURE 6: KARYOTYPING AND G-BANDING OF CCE^S, ...... 92 FIGURE 7: FISH ANALYSIS ON SOXO^^’^^ TARGETED CCE^S ...... 93 FIGURE 8: CHECKING FOR 3 ' HOMOLOGOUS RECOMBINA TION ...... 95 FIGURE 9: CHECKING FOR BOTH LOXP SITES ...... 96 FIGURE 10: RANDOM INTEGRA TION OR HOMOLOGOUS RECOMBINA TION?...... 102 FIGURE 11: TANDEM ARRAY,...... 103 FIGURE 12: FISH ANALYSIS ON ABUS TARGETED WITH PSOX9^^^ ,„ 104 FIGURE 13: INACTIVA TING S0X9 SPECIFICALLY WITHIN THE DEVELOPING GENITAL RIDGE,...... 109 FIGURE 14: SCHEMA TIC REPRESENTA TION OF CONSTRUCTS: DAX- CRE, SRY-CRE AND DIC, ...... 121 FIGURE 15: EXPRESSION OF DAX-LA CZ IN THE PREHMPLANTA TION EMBRYO...... 122 FIGURE 16: CRE INDUCED LA CZ EXPRESSION WITHIN MOUSE LINE SRY-CREB ...... 125 FIGURE 17: TRANSIENT SRY-CRE TRANSGENIC MLCE ...... 126 FIGURE 18: DIC TRANSGENIC MICE ...... 130 TABLE lA: DICA AND DICB EMBRYOS INJECTED WITH 4-OHT 131 FIGURE 19: MODEL I,...... 146 FIGURE 20: MODEL H ...... 147 FIGURE 21: AL TERNA TIVE DESIGN FOR A S0X9 CONDITIONAL TARGETING CONSTRUCT...... 152 M l6 CULTURE MEDIUM ...... 158 M2 CULTURE MEDIUM...... 159 ANTICIPATED BREEDING AND EXPECTED PHENOTYPES ...... 160 Acknowledgements

Everyone knows that a thesis cannot be completed in isolation. I would like to thank the following people at NIMR.

Robin, for having enough confidence to offer me a PhD project, all that time ago! Ryohei,for rescuing me!! Clare, for teaching me all I know about cell culture, for help with numerous cell transfections and for putting up with all my silly questions. Ariel, thank-you for all the advice, the help with embryology and for making me laugh. Karine, for useful scientific discussions and for introducing me to Jeff Jones! Shanthi, for teaching me how to do chromosome painting and for making me eat all those chocolate bars! Silvana, for all the help and advice you gave me whilst writing this thesis - I owe you one! Morph, thanks for your help and advice with my Southern blotting problems and for cheering me up. Silvia thanks for all those scientific shortcuts. Claire, for all your help, good luck with your post-doc. Amanda, for introducing the mouse house to me, the numerous pronuclear injections you performed on my behalf and for some classic evenings at the Three

Hammers!!! Donald, for improving my memory and making me think before saying anything!! Thanks for teaching me how to do Blastocyst injections and for teaching me so much about animal husbandry. I hope you eventually get your cow. Richard, Cynthia and Papia, thanks for all your support. I’m sorry

I couldn’t get to know you all better. Melinda, for all your help proof reading this thesis and for your entertaining e-mails, I wish you all the best. Thanks to

Paul for all your help and encouragement. A big thank you to Tamara, who during her brief stay in the lab introduced me to Bill who has had enough confidence to wait almost two years for me to

complete my studies since offering me a wonderful job in Toronto - see you

soon.

To the Laidlaw Green crew, Mandy, we all knew you’d get that promotion!! I claim full responsibility for the champagne and balloons!! Dave, for looking after all my mice, Dani, for all those long meaning of life conversations, and for answering all my stupid questions whilst keeping a straight face. Pete, for always telling me exactly what you think! And for the ice cubes... Bob, you still haven’t got me back! ! And to Ore Rufian for performing pro-nuclear injections on my behalf.

Thanks to Ted Evans for help and advice with G-banding.

To everyone in photographies, in particular Joe, Lesley Frankand Mike, who have patiently corrected all my figures.

I must also thank all the members of the various ice hockey teams I’ve played for over the past four years for keeping me sane.

Thanks to Harvey, Laurie, Paul and Dave for allowing me to join Haringey ice hockey club, I enjoyed every minute of it.

Thanks to all the members (past and present) of the Bracknell Queen Bees.

Especially to Paul, Lyn and Vicki for taxing me on those long trips up to

Nottingham for GB training - you fed me up well! !

Thanks to all of the Oxford City Stars for entertainment value alone!! In particular, thanks to Cammy for having enough confidence in me to select me

11 for the squad and for putting up with all my moaning - 1 told you I’d finish this thesis eventually! !

I would also like to thank all the members of the Swindon Topcats for welcoming me back into the club and re-introducing me to Swindon’s social life, its like I’ve never been away!

Ill ABSTRACT

Sox genes encode transcription factors, which possess an HMG box DNA binding domain with a high level of homology to that of SRY, the product of the Y-linked mammalian testes determining gene. The Sox gene family comprises about 26 genes in the mouse and, like Sry; many are involved in cell fate decisions during embryogenesis, where they act in a range of different systems. At least one other member of the family is important for sex determination. Heterozygous mutations in S0X9 lead to the human dwarfism syndrome Campomelic Dysplasia. 75% of XY patients with this condition are sex reversed. In mice, high levels of Sox9 expression are correlated with testis development where it seems to be required for Sertoli cell differentiation. Gene targeting experiments in mice have shown that heterozygous Sox9 null mutations result in death shortly after birth, however no male to female sex reversal was observed. To overcome the issue with lethality, and to generate mice homozygous for a Sox9 null mutation within any tissue of choice, a conditional Sox9 targeting construct was engineered. From the first round of gene targeting in CCE ES cells, chimeras were generated; however no germ line transmission was achieved. Karyotype analysis revealed that a translocation event had occurred within the wild-type CCE ES cells. When gene targeting was repeated using the ABl ES cell line there was concurrently both random multiple copy integration and homologous recombination.

Fortunately, random integration occurred at an additional site in the genome, distinct from the endogenous gene on chromosome 11. Chimeras were

IV generated using these ES cell clones, with the intention of segregating the targeted Sox9 allele away from the random integrants.

To permit the conditional deletion of Sox9 in the developing gonads, transgenic mouse lines have also been generated using either Sry or Daxl regulatory

sequences to drive the expression of Cre recombinase. Daxl was found to be expressed in blastocysts as well as in the gonads; therefore the Daxl promoter was also used to drive expression of a tamoxifen-inducible Cre (Dax-CreER^^).

Cre activity within the transgenic mice carrying Sry-Cre, Dax-Cre or Dax-

CreER^^, has been tested after mating them to R26R indicator mice. The latter express the p-galactosidase reporter gene fi*om the ubiquitous Rosa26 regulatory region, but only after Cre-mediated excision.

In addition to understanding the role Sox9 plays in testis development, the availability of R26R mice made it possible to address a second question concerning cell fate; Male sex determination is triggered by expression of Sry in the undifferentiated, bipotential XY genital ridge where it is hypothesised to act by directing supporting cell precursors to develop as Sertoli cells rather than as follicle cells. However, the evidence that follicle cells are related by lineage to Sertoli cells is only circumstantial. To test this assumption, R26R mice were crossed with mice expressing either the Dax-CreER^^ or Sry-Cre transgenes. Cre expression in the supporting cell precursors would cause these cells and all their descendants, to permanently express p-galactosidase. In this way it should be possible to trace all the fates of the supporting cell precursors

V in both sexes and to provide definitive proof of the origin of follicle cells and their lineage relationship to Sertoli cells.

VI 1 CHAPTER 1- GENERAL INTRODUCTION

1.1 SEX DETERMINATION

Despite the fact that the occurrence of two sexes is nearly universal throughout

the animal kingdom, widely differing mechanisms operate to control sexual

dimorphism amongst different animal species. This is apparent in the way that

either the male or female sex-determining pathway is initiated, which can be

environmental or genetic.

1,1,1 Drosophila and C-elegans

In the huit fly Drosophila melanogaster and the nematode Caenorhabditis

elegans {C-elegans) a detailed genetic pathway has been established of the

genes involved in sex determination. In both of these organisms, somatic sex

determination, germ line sex determination, and dosage compensation (a

mechanism that equalises the expression of X chromosome genes in both

sexes) are linked by the ratio of X to autosomes (X:A). In

Drosophila, where the male is XY and the female XX, dosage compensation

occurs by doubling the transcription rate of X-linked genes in the male. The

X:A ratio controls the activation of a key gene Sex-lethal {Sxl), which

undergoes alternative splicing in a sex specific manner. In the female, where

the X: A ratio is 1, the Sxl transcript encodes a fully functional , which is

active from the beginning of . This embryonic protein

is essential to control the splicing pattern of a second sex specific Sxl transcript

as well as controlling gene splicing of downstream members of the X

1 chromosome dosage compensation and sex determination pathway [1]. In

males, where the embryonic Sxl transcript is not present, alternative splicing of

the sex specific Sxl transcript is not possible leading to the generation of a non­

functional protein [2].

In C-elegans, XO animals develop as males (low X:A ratio) and XX animals

develop as self-fertile hermaphrodites (high X:A ratio), dosage compensation is

achieved by down regulating transcription of genes on both hermaphrodite X

chromosomes. The direct target of the X: A signal is the master switch gene XO

lethal {xol-1). Xol-1 is similar to Sxl in that it co-ordinates sex determination

and dosage compensation. However, unlike Sxl that is functionally active in

females, xol-1 acts in males. The low X: A ratio in male C-elegans leads to high levels of xol-1 transcripts, whereas a high X: A ratio results in low levels oïxol-

1 in the hermaphrodite [3]. The regulatory genes in Drosophila and C-elegans

sex determination are unrelated at the molecular level with one exception, the sexual regulators mab-3 of C-elegans and doublesex {dsx) of Drosophila, which both encode that contain a novel DNA-binding motif called the

DM (for dsx and mab-3) domain. Both genes encode proteins that control sex- specific neuroblast differentiation and yolk protein gene transcription.

Importantly, expression of Drosophila dsx in mab-3 transgenic mutant C- elegans restores male development, suggesting that invertebrates share a common evolutionary origin of sexual development [4]. 1.1.2 Birds

In birds, females are the heterogametic sex, carrying one copy of the Z and W

sex chromosomes, whilst the males are homogametic (ZZ) [5]. Sex

determination in birds is not yet understood; it is not clear whether it is the presence of the female-specific W chromosome that triggers female

development, or the double dose of Z chromosomes that confers maleness. The

chicken DMRTl {doublesex- and 7wa6-5-related ) gene, which has been mapped to the Z chromosome [6], contains a highly conserved

DM domain. The protein it encodes is expressed in the developing gonad, expression is enhanced in the developing male relative to female gonads, [6, 7] suggesting that avian sex determination may be controlled by proteins generated from active genes on the Z chromosome. Higher levels of DMRTl in the ZZ avian embryo could lead to male development, with lower levels leading to female development [6] [7]. Alternatively, the prospect that the W chromosome carries a dominant determinant is possible. The recent identification of a W-linked PKCIW gene, also known as ASW (Avian Sex- specific W-linked), which is expressed in the female genital ridge prior to sexual differentiation, supports the notion that the W chromosome is sex determining [8]. On the other hand, both the Z and W chromosomes may be important, with the two sex chromosomes mediating different aspects of sex differentiation. A parallel to this can be found in marsupials, where the Y chromosome acts as a dominant testis-determining chromosome and the X

chromosome dosage determines the choice between pouch and scrotum [9].

1.1.3 Mammals

In mammals, males normally have a single X and Y chromosome while

females normally have two X chromosomes. In 1959, two independent groups

[10], [11] observed that XO Turners syndrome patients develop as females,

while XXY Klinefelters syndrome patients develop as males, while a third

group found the same is true in mice [12], This demonstrated that the Y

chromosome contains a dominant testis determining gene(s). This determinant

was designated the Testis Determining Factor (TDF) in humans and testis

determinant on the Y (Tdy) in mice. Although in mammals genetic sex is

established at the time of fertilisation, this decision is executed later on in

development, and coincides with the choice to make a testis or an ovary. Key

experiments performed by Alfred lost where the gonads of karotypically XX or

XY rabbit embryos were removed prior to sexual differentiation, demonstrated that although XX embryos were still able to undergo female development, XY

embryos required substances secreted by the testis in order to undergo male

development [13, 14].

1.1.4 Reptiles

In some vertebrate species, environmental factors are also critical for sex determination. Temperature-dependent sex determination has been observed for reptiles such as crocodiles, turtles and alligators, but its molecular basis is obscure. The sex of the embryo is dependent upon the egg incubation temperature. For male determination to occur, the American alligator

(Alligator mississippiensis) requires the optimum egg incubation temperature

to be at 33°C, with female determination occurring if the temperature lies

outside this range [15-17].

1.2 DIFFERENTIATION OF THE GONAD AND INTERNAL GENITALIA

The urogenital ridge consists of three segments, the pronephros, which

includes the adrenal primordium near the caudal end, the mesonephros, the

central region from which the gonad arises, and the metanephros, the posterior

region in which the kidney forms [18]. In mice, the genital ridge, the precursor

to the mammalian gonad, emerges on the ventro-medial surface of the

mesonephros by thickening of the coelomic epithelium (CE) from about 9.5dpc

[19]. In its undifferentiated form, the gonad contains germ cells, which

actively migrate into the genital ridge from the hindgut between 10.0-1 l.Odpc,

as well as two major bipotential somatic cell lineages, known as the supporting

cell precursors and the steroidogenic precursors [20]. The supporting cell

lineage differentiates to form Sertoli cells in the testis and follicle cells in the

ovary [21]. The steroidogenic precursor cells differentiate to form Leydig cells

in the testis and theca cells in the ovary ([22] & references therein). The gonad

also contains connective tissue cells that differentiate to form endothelial and

stromal tissue. In the mouse, the male gonad can clearly be recognised as a

testis by 12.5dpc [23]. In contrast, no signs of differentiation occur in the

developing ovary until several days later when follicle cells organize around

the oocytes [24]. The developing mesonephros contains two sets of ducts. The Müllerian ducts

arise as the CE invaginates and the Wolffian ducts derive from the mesonephric

duct. Only one of the two ductal systems will normally develop further in

mammals depending upon whether differentiation of the testis or ovary has

begun. In males, the developing testes produce Anti-Müllerian Hormone

(AMH) and testosterone. AMH induces regression of the Müllerian ducts and

testosterone induces the Wolffian ducts to differentiate in order to form the

epididymus, vas deferens and seminal vesicles, which contribute to the internal

male genital tract. In females, where both these hormones are absent, the

Wolffian duct degenerates and the Müllerian duct differentiates into the

oviduct, uterus and upper vagina [25].

i.2 1 Testis descent

In the fetus the male and female gonads initially develop at identical positions within the body, whilst in the adult the ovary is located close to the kidney and

the testis is found in the scrotum. Testis descent occurs in two stages, the first

stage occurs between 15.5 and 17.5dpc of mouse development and the second,

2-3 weeks after birth [26].

In humans, failure of complete testicular descent into the scrotum

(cryptorchidism) is one of the most frequent congenital abnormalities involving

-3% of male births. Cryptorchidism can lead to infertility, since for

spermatogenesis to occur, the lower temperature of the scrotum is required. In

addition, it is also associated with an increased risk of testicular tumors [26]. Mice deficient for Insl3, a member of the insulin-like hormone family, have

provided key insights into the role of InslS in testis descent. Heterozygote Insl3

mutant mice are viable, but show impaired development of the gubemaculum

ligament, a structure that is believed to mediate transabdominal descent of the

testis during male embryogenesis. Homozygote Insl3 mutant mice completely

lack this structure and instead form a long, thin elongated structure similar to

normal female gubemaculae, with the testes of these mutant animals moving

freely within the abdominal cavity [27] [28].

1.3 CELL LINEAGES

All organisms that reproduce sexually have the ability to form gametes. Both

types of gametes, the egg and the sperm, arise from primordial germ cells

(PGCs) that are set-aside early in embryogenesis. In many animals including

C-elegans and Drosophila, there is a defined area of the egg known as the

germ plasm; cells that inherit this localised cytoplasm during the very first

embryonic divisions give rise to PGCs. Although bona fide germ plasm has not

been identified in the eggs of fish and birds, experimental results point to

formation of PGCs during very early divisions of the zygote before embryonic

cells have become committed to specific fates [29]. It is currently unclear

whether mammalian PGCs are specified in this manner. In the mouse PGCs

appear to be induced de novo from the epiblast and can first be detected

midway through gastrulation, (~7-7.5dpc) [30]. They form a cluster of about 50

cells in the extraembryonic region, posterior to the primitive streak. As

gastrulation proceeds, PGC’s are carried passively inside the embryo. When the posterior visceral endoderm moves in to form the hindgut; PGC’s are swept

into it. From here they actively migrate through the gut epithelial layer,

probably through interactions with extracellular matrix proteins [31]. Once

leaving the gut wall, PGC’s travel up into the dorsal body wall before splitting

into two groups that migrate laterally before arriving in the genital ridges. As

migration proceeds, PGC’s establish contacts with both somatic cells and other

PGC’s; long filopodial processes have been observed to link them in extensive

networks causing them to accumulate in the genital ridge, where they work in

co-operation with laminin to form primary sex cords [31]. In the testes, PGC’s

stop mitotic proliferation at 13.5dpc and enter a quiescent period; blocked in

mitosis, which is resumed only after birth. PGC’s also stop proliferating in the

developing ovary at the same time. However, in contrast they enter meiotic prophase and pass through lepotene, zygotene and pachytene before arresting

in diplotene around the time of birth [32]. By the time PGC’s stop dividing,

they have been able to undergo some twelve successive doublings with each

genital ridge containing about 20,000 germ cells [33]. Although it is currently unclear as to what defines a , recent evidence points to a range of

factors involved. BMP-4 signalling has been shown to be required for germ cell

formation [34], as BMP-4 homozygote null embryos have neither allantois nor primordial germ cells. By injecting BMP-4 homozygote null ES cells into tetraploid blastocysts, it was demonstrated that BMP-4 produced in the extra embryonic ectoderm is required for an allantois to form and for germ cell specification [34]. Oct4 was first identified in mice as an embryonic stem cell and germ-line specific transcription factor [35], and is known to be crucial for the maintenance of embryonic cell totipotency during early embryonic development [36, 37]. Following gastrulation, PGC’s are the only embryonic cells that maintain Oct4 expression [38]. Most recently it has been shown that

Germ cell nuclear factor {GCNF) deficient embryos fail to restrict Oct4 expression to the germ line implying that GCNF expression inhibits Oct4 expression [39].

In male mice, the somatic differentiation of the testis is independent of the presence of PGC’s. Mouse mutants lacking germ cells such as Dominant White

Spotting (W), [40, 41] are still ahle to undergo testis differentiation. On the contrary in the female, while although supporting cell precursors are able to differentiate to form pre-follicle like cells, these aggregate into compact cord­ like mesenchymal condensations and differentiation does not precede any further. In adult females, the cords have degenerated and a streak ovary forms, thus in the absence of germ cells, pre-follicle cells are not maintained [42].

PGC’s differentiate in response to their environment. Entry into meiosis occurs at the same chronological time whether the germ cells are in the ovary or in ectopic sites, such as the adrenal, or even in aggregates with embryonic lung cells, irrespective of their chromosomal sex [32]. This implies that there must be some sort of a signal from the testis, which inhibits the entry of germ cells into meiosis and/or initiates development along the spermatogenic pathway

[43]. 1.4 SOMATIC CELL DIFFERENTIATION

The current model of sex determination suggests that expression of the testis-

determining gene initiates testes development by directing supporting cell

precursors to differentiate into Sertoli cells rather than follicle cells. This model

is based upon the fact that pre-Sertoli cells are the first male-specific cell type

to differentiate in the fetal testis [44] and that in XX<-»-XY chimeras, they are

the only cells of the testis to show a bias for the presence of the Y chromosome

[45]. A series of experiments have been performed towards understanding the

origin and mode of action of the Sertoli cell lineage. Sertoli cells were initially

believed to originate from the mesonephros. The importance of cell

contribution from the mesonephros for correct testis development to proceed

was illustrated by Buehr et al [46], who cultured fetal mouse testes in vitro,

with and without an attached mesonephros. At ll.Sdpc, testes cultured without

mesonephros remained essentially homogenous in appearance and testis cords

rarely appeared. In contrast, female genital ridges separated from their

mesonephros developed into small but essentially normal looking ovaries.

Subsequent experiments by Merchant-Larios et al [47] have shown that when

the gonad was separated from the mesonephros at ll.Sdpc and cultured alone,

the culture media accumulated AMH, a hormone secreted by Sertoli cells,

implying that by ll.Sdpc, the Sertoli cell precursor is present within the gonad.

Pax2 null mutants whose mesonephric tubules never develop into mature

tubules or make contact with cells of the gonadal primordium provided further

insight into Sertoli cell origin. In these mutants, testis organogenesis proceeds

normally, with all the representative cells present, including Sertoli cells,

10 suggesting that pre-Sertoli cells don’t originate from the mesonephric tubule

[48]. Dil labelling [49] has shown that in the male gonad, somatic cells arise from the CE between 15-17 t.s (~10.0-ll.0dpc) and enter the gonad, giving rise both to Sertoli cells and an unknown interstitial cell type. Bromodeoxyuridine

(BrdU) labelling of male genital ridges between ll.Sdpc and 12.5dpc has shown that migration of cells from the CE into the gonad occurs in two distinct stages. The first wave of proliferation, between 8-18 tail somites, consists of

SF-1 positive cells that are able to give rise to Sertoli cells. The second wave of proliferation, occurring between 19-25 tail somites, involves SF-1 negative cells, which appear unable to form to Sertoli cells [50]. Taking all this data, it seems that the supporting cell lineage arises from the CE although it is still not possible to rule out a contribution also from the mesonephros.

In mammals, the ontogenesis of Leydig cell function involves at least two generations of cells [22]. The first generation arises during embryonic development and is responsible for the masculinization of the urogenital system. The second generation appears at the onset of puberty when the Leydig cells produce testosterone required for the onset of spermatogenesis and to maintain the male reproductive system. Leydig cells are derived from the steroidogenic cell precursors, and are localised to the interstitial space between the cords; currently the signal that triggers the initial differentiation is unknown

[51]. However, Vainio and colleagues [52] have recently shown that Wnt-4 is able to inhibit Leydig cell differentiation. Female mice carrying a likely null

11 allele of Wnt-4 frequently exhibited masculinization of internal organs. Further examination revealed that these mutant females expressed two members of the testosterone biosynthesis pathway. Since steroidogenesis in the fetal gonad is normally associated with Leydig cell formation, this data indicates that female- specific Wnt-4 signalling is required to prevent differentiation of Leydig cell precursors in the developing ovary [52]. Separation and culture of gonads, apart from the mesonephros, indicated that in addition to Sertoli cell precursors, the Leydig cell precursors are also present in the gonad by ll.Sdpc

[47]. Leydig cells express several neural-specific markers including neural cell adhesion molecule, neurofilament protein 200 and microtubular-associated protein, and have been postulated to have derived from the neural crest [22] although there is little or no direct evidence for this. More recent studies suggest that Leydig cell precursors appear in the mesonephros and then migrate into the gonad [22]. A group of cells detected by NCAM antibody staining has been seen to stream towards the gonad from a region at the anterior of the mesonephros [53]. RNA in situ experiments have shown that these cells express two common steroidogenic cell markers; Daxl and Sfl. When the migration and differentiation of these cells were traced they appeared, at least on a morphological level, to be Leydig cell precursors; however, these genes are also expressed by supporting cell precursors and no cell type specific markers have been successfully used to confirm this hypothesis [54].

As well as Sertoli and Leydig cell precursors, additional cell types including the peritubular myoid cells, are required to form the testis cords. Migration of

12 cells from the mesonephros has been shown to be critical for testis cord

formation [18] and are thought to act by prompting the somatic cells to

organise themselves into testis cord structures [20, 47, 55]. Evidence from

organ culture experiments confirmed that if migration was blocked by the placement of a filter membrane between the mesonephros and the gonad, then

cord formation did not occur [46]. Sandwich experiments using ‘blue’ gonads

from the transgenic mouse strain ROSA26 that ubiquitously express p~

galactosidase with a ‘white’ wild-type gonad, have been used to study the migration of cells from the mesonephros into the gonad in more detail [20]. By

coating Affigel beads with proteins extracted from 11.5-12.5dpc male gonads

and placing them against the coelomic epithelial edge of a wild-type ‘white’

XX gonad that is apposed to a ROSA26 ‘blue’ mesonephros, migration of

‘blue’ cells from the mesonephros into the ‘white’ XX gonad can be observed.

This provides evidence that migration into the male gonad acts via a diffusible chemo attractant. If these beads were treated with Proteinase K to break down the proteins before incubation, then migration was not induced. By assembling mesonephroi and gonads of different ages, the ability for sending or responding to the signal for cell migration was found to extend from 11.5dpc to at least

16.5dpc, however the proportion of migrating cells may vary [20]. Cells migrating into the gonad from the mesonephros include an endothelial cell population, myoepithelial cells that surround the vasculature and the peritubular myoid cells which are unique to the testis.

13 Peritubular myoid cells surround the seminiferous tubules and contain abundant cytoskeletal proteins including actin, myosin and desmin/vimentin.

They are known to help create the blood-testis-barrier and have been shown to play a role in contractions of the seminiferous tubule to aid the transport of spermatozoa in the tubular lumen. They also cooperate in the production and formation of the extra cellular matrix (ECM) by providing structural integrity to the seminiferous tubule [56], In vitro studies have demonstrated that peritubular myoid cells secrete a number of substances including ECM components and growth factors, some of which are known to affect Sertoli cell function [57, 58],

If testis determination is not triggered in the indifferent gonad during the receptive period, the default ovarian pathway proceeds [14], Studies on the developing ovary have not been as extensive as those on testis development.

Lineage studies [21] indicate that the supporting cell precursors differentiate to form follicle cells. Follicle cells provide support and sustenance to the germ cells by forming a basal lamina around the oocytes. Follicle-stimulating hormone (FSH) stimulates the follicle cells to multiply and to produce estrogen

[59].

The steroidogenic precursors differentiate into theca cells, which form the outer layer of the follicle. Luteinizing hormone produced by the anterior pituitary stimulates them to proliferate and synthesise androgen and estrogen

[60].

14 1.5 INDENTIFICATION OF THE TESTIS DETERMINING GENE

Several individuals have been found to possess visible deletions and

translocations of the Y chromosome [61, 62]. By mapping the chromosomal

abnormalities linked with sex reversal in humans, such as the loss of part of the

Y chromosome in XY females and gain of a Y chromosome fragment in XX

males, it was revealed by cytogenetic studies, that a specific region of the Y

chromosome is correlated with testis formation and subsequent male sexual

differentiation. The location of the Testis Determining Factor {TDF) was

eventually restricted to a 35kb region of the Y chromosome. Extensive

mapping of this region identified an open reading frame (ORF) [63-65], which

was designated SRY in humans. Mutations in the coding region of human SRY

correlated with the male to female sex-reversal phenotype. SRY showed

homology to a gene on the mouse Y chromosome which was designated Sry

(Sex Determining Region of the Y Chromosome) [63-65]. In mice, the analysis

of Sry expression established that it is expressed from 10.5-12.5dpc, a time

period in which the indifferent gonad begins to differentiate [66]. Additionally,

when Sry was introduced into fertilized mouse eggs, some of the

chromosomally female offspring were sex reversed; they were genetically

female (XX) but developed morphologically as males [67]. This experiment

provided proof that SRY is the testis determining gene and that it is the only

gene required on the Y chromosome to initiate testis determination.

1.5.1 Biochemical Properties o f SR Y

The Sry locus has a very unusual structure; it contains a long ORF of 2,739

base pairs (bp) and is flanked by a large inverted repeat of at least 17 kilobases

15 (kb) [68]. The Sry ORF contains an HMG-box binding motif of 237bp. The majority of transcripts comprise a single exon of 4,942bp, which initiates

283bp 5' of the HMG box and extends into the 3' arm of the inverted repeat.

The large ORF of mouse Sry (395 amino acids) is composed of a 79 amino acid HMG box flanked by a short N-terminal domain consisting of just two amino acids, and a 314 amino acid C-terminal domain, which is characterized by a glutamine/histidine rich repeat region. The human SRY ORF differs from the mouse, in that it is considerably smaller, consisting of only 204 amino acids with the HMG box flanked by a 57 amino acid N-terminal domain, and a 68 amino acid C-terminal domain which lacks the glutamine repeat [23].

The early events following Sry expression include rapid changes in the topographical organisation of various cell types that make up the developing gonad [23, 69]. However, the transient expression of Sry during embryogenesis suggests that it triggers the differentiation of supporting precursor cells into

Sertoli cells characteristic of the testes. Once Sertoli cells begin to differentiate they are thought to trigger the other gonadal cell lineages to follow the male pathway [23, 70].

To understand how SRY works, it is essential to identify the genes that act upstream and downstream from it during sex determination and differentiation.

This part of the introduction will therefore be divided into three main topics; firstly, genes, which are required for gonad development and are potential upstream factors interacting with SRY, will be discussed. Genes involved in

16 testis differentiation will be introduced as potential downstream targets of SRY and are discussed in the second section; the third and final section is dedicated to discussing genes thought to be involved in ovary differentiation.

17 1.6 GENES REQUIRED FOR GONAD FORMATION

Analysis of humans and mice deficient in certain factors has implicated roles

for the following genes in early gonad development and/or sex determination.

1.6.1 WT-1

Positional cloning strategies led to the identification of the WT-1 tumor

suppressor gene on human chromosome llp l3 . There are at least 24 different

isoforms of WT-1 with different isoforms being responsible for different

syndromes [71]. Three human syndromes are caused by mutations in WT-1:

Haploinsufficiency in WT-1 leads to WAGR (Wilms’ tumour, aniridia,

genitourinary anomaly, mental retardation). Denys-Drash syndrome, an

autosomal dominant disorder, usually arises from point mutations in the DNA-

binding domain with associated renal failure, Wilms’ tumour and

genital abnormalities [72-74]. Frasier syndrome arises from disruption of

correct gene splicing; patients have less severe renal dysgenesis and they do

not develop Wilms’ tumours but importantly exhibit XY

pseudohermaphroditism [75] [76] [77].

In the mature mouse gonad, Wt-1 expression is limited to the Sertoli cells in the

testis and follicle cells in the ovary. The crucial nature of Wt-1 in urogenital

development was demonstrated by mice homozygous for a Wt-1 deletion [78]

which die of renal failure and are devoid of kidneys and gonads. Histological

examination revealed that the urogenital ridge started to form but development

was arrested from ~12.0dpc although, germ cells did not seem to be affected.

To gain further insight into the role of Wt-1, transgenic mice carrying

18 mutations designed to prevent production of either the +KTS or -KTS Wt-1 isoforms, loss of which are known to be responsible for Frasier Syndrome and

Denys-Drash syndrome respectively, were generated via homologous recombination [79]. The only recorded difference between the two isoforms is the presence (+KTS) or absence (-KTS) of a lysine-threonine-serine motif between the 3"^^ and 4^^ zinc fingers [80]. The +KTS form is thought to be involved in RNA processing as it can bind RNA in vitro and associates with the spliceosome protein, whereas the -KTS isoform acts like typical transcription factor [81]. XY mice homozygous for a mutation preventing formation of the

+KTS isoform (Frasier mice) show complete male to female sex reversal, whereas XX homozygous mice have normal ovaries implying that the +KTS isoform has a critical role in testis determination for which the -KTS isoform cannot compensate [79], The expression levels of Sry in the Frasier mice were only one quarter that of normal levels, and Sox9 was absent. This knowledge led Andreas Schedl to hypothesize that the WT-1 +KTS isoform interacts with

Sry at the RNA level to regulate its expression levels. However, it is also possible that WT-1 plays an essential role in Sertoli cell formation and that the reduced expression levels of Sry and Sox9 are due to a decrease in Sertoli cell differentiation. Mice that are homozygous for the mutation preventing formation of the -KTS isoform (Denys-Drash mice), have a similar phenotype to Denys-Drash syndrome in humans; the mice die within 24hrs of birth, both sexes have small streak gonads and abnormal genital ducts. This demonstrates that the -KTS isoform is required for differentiation and survival of the

19 gonadal cells in both males and females. Expression levels of gonadal markers such as Daxl, Sox9 and Amh were low as expected. Unlike the Wt-1 null mice, both the Frasier (+KTS null) and the Denys-Drash (-KTS null) mice showed genital ridge development, revealing an essential requirement for Wt-1 in some form for the development of the genital ridge [79].

1.6.2 STERIODOGENIC FACTOR 1 (SFl)

Steriodogenic factor {Sfl) is a transcription factor also known as AD4BP (AD4 binding protein) that regulates the steroidogenic P-450 genes in steroidogenic tissues [82]. It is a member of the nuclear superfamily and shows a high similarity to the Drosophila orphan gene Fushi tarazu factor 1 (Ftz-fl) [82-84]. Sfl is expressed from 9.0dpc as the urogenital ridge forms in both sexes [85]. The levels of Sfl transcripts increase in the testicular cords, due to expression within the Sertoli cells, and in the interstitial space, from the Leydig cells [85]. In contrast, Sfl levels are low in the female gonad.

In vitro analysis by Shen et al [86], who removed the ligand-binding domain of

Sfl, has suggested that a ligand or co-factor (or both) is needed for Sfl function. In vivo analysis has confirmed that the sharp drop in Sfl transcripts in the developing ovary corresponds to the simultaneous period of peak Müllerian duct regression in males. This data suggests that the sexually dimorphic expression pattern of Sfl expression is critical for correct male differentiation.

In contrast, Sfl expression at this critical period would be deleterious to normal female differentiation [83, 86]. Sfl knockout mice lack adrenal glands and gonads and exhibit male to female sex reversal [87]. Closer examination of the

20 developing gonad revealed that normal development is observed until approximately ll.Sdpc after which the somatic cells die via apoptosis. This leads to pronounced degeneration of the developing gonads at approximately

12.5dpc. Without the production of hormones such as AMH and testosterone,

XY embryos develop as females [87].

Alterations within the SF-1 locus also affect sex determination in humans as shown by the discovery of a female patient with an XY karyotype. This was due to a mutation within exon 3 of SF-1, which encodes part of the DNA- binding domain that confers specificity to nuclear receptors in their regulation of target genes [88].

L6.3 LHX9

LHX9 is a member of the LIM domain family of transcription factors [89]. It is expressed in the embryonic nervous system, limbs, and pancreas, and in the urogenital ridge of XX and XY mouse embryos from

9.5dpc. Surprisingly, Lhx9 homozygous null mice show only a gonadal phenotype, which can be explained by the redundancy of Lhx9 and other LIM family members [90]. In Lhx9 mutant mice, the germ cells migrate correctly, but the somatic cells of the gonad fail to undergo rapid proliferation, leading to a complete lack of gonad formation. Mice lacking Lhx9 expression show decreased Sfl levels within the gonadal ridge although Wt-1 expression levels are normal. It is therefore likely that Lhx9 regulates Sfl expression and that Wt-

1 expression is representative of a second cell population [91]. Alternatively,

21 the lack of proliferation of somatic cells, the main source of Sfl expression in the testes, would also explain the decrease in Sfl levels [85].

1.6.4 M3 3

M3 3 is considered the mouse counterpart of the Poly comb gene since it is able to partially rescue the Drosophila Polycomb mutant phenotype [92]. Poly comb genes are required to maintain the correct expression of the Hox genes in

Drosophila [93]. In the mouse, targeted mutagenesis of M33 involving the replacement of the fifth exon with a neomycin cassette (which should result in a loss of function) causes variable levels of male-to female sex reversal.

Formation of the gonads is retarded in both sexes, with defects appearing at lO.Sdpc around the time of Sry expression in XY gonads. It is possible that

M33 XY mutants are sex-reversed either due to the disruption of genes upstream or downstream of Sry [94].

22 1.7 GENETIC CONTROL OF TESTIS FORMATION

Much of our understanding of sex determination has derived from cytogenetic

studies linking specific chromosomal defects to sex reversal. Although SRY is

the dominant controller of male sex determination, its transient expression

pattern within the developing testes strongly implies that its role is to activate

the male development cascade, which converts the bipotential gonad into a

testis. This section will look at genes that are expressed within the developing

gonad during testes formation.

1.7.1 CAMPOMELIC DYSPLASIA AND SOX9

Campomelic Dysplasia (CD) is characterised by skeletal anomalies including

bowed femora and tibiae, hypoplastic scapulae, 11 pairs of ribs, pelvic

malformations, and clubbed feet. Malformations including micrognathia,

retroglossia, cleft palate, narrow airways caused by tracheobronchial cartilage

defects, hypoplastic lungs and a bell-shaped thorax are also often present. Most

CD patients die soon after birth from respiratory distress. Interestingly, 75% of

XY CD sufferers are sex reversed [95]. Cytogenetic analyses of five XY sex

reversal translocation patients revealed that a region of chromosome 17 (q23-

25) was involved.

In 1994, the S0X9 gene was demonstrated to be the gene responsible for CD

[96] [97]. The Sox9 expression pattern during mouse embryonic development

23 and its localization to human chromosome 17, led to the search for mutations in S0X9 [95]. Varieties of mutations at the S0X9 locus have been identified.

These include translocations, deletions, missense mutations in the HMG box, frame shift mutations, and a splice-acceptor mutation [96, 98]. However, none of the patients contained mutations on both S0X9 alleles, suggesting that sex reversal and CD are due to haploinsufficiency of the S0X9 gene product. Yet, no correlation has been found between mutation type or position and severity of CD. A good example is the case described by Kwok and colleagues where two patients share the same S0X9 mutation, but one is an XY male and the other an XY female [97].

1.7. 1,1 HMG Box Proteins

S0X9, like SRY^ is a member of the HMG box family [99] [100]. High- mobility group (HMG) proteins were first defined by their electrophoretic behaviour on SDS-PAGE as a series of non-histone proteins able to interact non-specifically with DNA ([63] and references therein). Among this heterogeneous group, HMGl and HMG2 proteins containing two 80-amino acid domains, responsible for DNA binding and termed ‘HMG boxes’ were identified. This domain has since been found in a large number of apparently unrelated factors all able to bind DNA.

The HMG box super family can be separated into two clearly defined subfamilies: 1) the HMG/UBF family which, typically contain more than one

HMG box, bind DNA non-specifically [101] and; 2) the SOX/MATA/TCF

24 family, that all contain a single HMG box, consisting of transcription factors which bind to specific DNA sequences [102].

Members of the HMG/UBF family include the mitochondrial transcription factor MTTFl, the nucleolar transcription factor UBF, the structure specific recognition protein SSRPl, and the yeast nuclear histone protein NHP6 [103].

These HMG box proteins have been shown to bind to distorted DNA molecules such as four-way junctions with high affinity irrespective of their sequence [104, 105] [106].

The MATA/TCF/SOX family is made up of three subfamilies: yeast mating- type genes {MATA), T-cell transcription factors {TCF), and the 6"^-related genes {SOX), and are all able to bind to the minor groove of the A/T A/T C A

A A G-motif and induce a sharp bend [102]. MATA genes are found exclusively in fungi, whereas TCF genes appear to be restricted to animals.

The SOX family of genes is comprised of over 20 members; many of the SOX genes are conserved across evolution and have been described in a wide variety of organisms from Drosophila to humans [107]. The expression pattern of several of the Sox genes seems to be correlated with early cell fate decisions.

For example, Sry is expressed at a crucial point to commit the supporting cell precursors in the developing gonads to develop as Sertoli cells thus promoting testis development. The down regulation of Soxl, 2 and 3 in the developing neural system is linked to the differentiation of the neural precursors [108].

Sox4 is expressed in the immune system, in pre-B and pre-T cells prior to terminal differentiation [109]. In each case, expression patterns of these genes

25 implicate them in establishing cell fates. Sox9 is a member of the Sox gene group E [100]. This group also comprises Sox8 and 10 [99]. S0X9 maps to chromosome 17q25 in humans and 1 Iq in mice.

1.7,1.2 Sox9 expression during mouse embryogenesis

Like many of the Sox genes, Sox9 plays an important role during early development, with transcripts detected as early as 7.5dpc in the node, the mouse organiser. As development proceeds, Sox9 is expressed in a wide variety of tissues including prechordal mesoderm, prospective mid and hindbrain, rostral somites, the first branchial arch, and sites under going chrondogenesis [99, 110]. Whole mount in situ hybridisation shows Sox9 expression in the genital ridge of both XX and XY gonads from about lO.Sdpc.

By ll.Sdpc Sox9 expression is very abundant in genital ridges of XY embryos, where it is up regulated coincident with Sry expression, but is absent from XX embryos [111]. Sections of whole mounts of XY genital ridges indicated that by ll.Sdpc, Sox9 transcripts are localised to the somatic cells, by IS.Sdpc Sox9 expression is clearly seen to be confined to the testis cords, specifically within the Sertoli cells. Antibody staining used against S0X9 on sections of the developing gonads showed that S0X9 protein is generally localised to the cell nucleus. However, prior to ll.Sdpc, S0X9 protein is detected within the cell cytoplasm, independent of chromosomal sex. After ll.Sdpc, S0X9 protein is confined to the nucleus of Sertoli cells throughout fetal and adult life, [111,

112]. The location of Sox9 mRNA and protein in the Sertoli cells suggests a role for Sox9 in Sertoli cell differentiation and maintenance.

26 1.7.7.3 Biochemical properties o f Sox9

Mouse Sox9 encodes a 507 amino acid protein, including a 79 amino acid

HMG domain, that shares 96% homology with human S0X9. The HMG box of S0X9 contains two conserved nuclear localisation signals, which are able to function independently of one another to direct fusion proteins into the nucleus

[113].

The C-terminus of S0X9 is rich in both glutamine and proline residues, characteristic of some transcription factors [114, 115]. Cell transfection experiments carried out by Peter Sudbeck and colleagues [116], has shown that human S0X9 is able to transactivate transcription from a reporter plasmid through the DNA motif AACAAAG, a sequence recognized by members of the

SOX protein family. The transactivation domain was mapped to the C-terminal domain of S0X9 and resides within residues 402-509, with the C-terminal 44 residues being essential for maximum transactivation [116].

7.7.7.4 Sex determination and Sox9

Putative binding sites for several transcription factors involved in sex determination are present within the Sox9 regulatory regions. By fusing various lengths of the regulatory regions upstream from the Sox9 ORF to a luciferase reporter, residues -193 to -73 were found to be required for maximum luciferase activity. Nevertheless, this region could not account for sex and tissue specific regulation of Sox9 [117]. Elements required for this tight level of expression are probably located at more distal sites in the promoter. This is supported by the fact that some sex reversed CD patients have translocation

27 events some 950kb away from the S0X9 gene [118].

Chromosomal breakpoints in CD patients outside the S0X9 coding region have been simulated in transgenic mice using a 600kb YAC where lacZ had been incorporated as a reporter gene in frame with exon 1 of human SOX9 [119].

The 600kb YAC expresses lacZ in similar patterns to endogenous Sox9 within developing cartilage but importantly, does not show expression in the developing gonad. This data suggests that gonad specific regulatory elements either are outside of this region or have been disrupted by incorporation of lacZ into exon 1. Alternatively, it is possible that the promoter elements for gonad specific expression of S0X9 are different in mouse and human. When this

600kb YAC is reduced to 350kb and 75kb respectively, levels of Sox9 decrease dramatically particularly in sites undergoing chrondrogenesis revealing the probable positions in the Sox9 flanking regions of elements regulating S0X9 expression.

Recently, a transgenic mouse line carrying a Tyrosine (Tyr) minigene was found that exhibited two phenotypes micropthalmia and XX sex reversal, both assumed to have arisen from a dominant insertional mutation. The mutation was named Odsex (Ods, ocular degeneration with sex reversal). Analysis revealed a single insertion of two copies of the Tyr minigene approximately

1.3Mb upstream of S0X9 causing a 150kb deletion. All XX mice carrying this deletion were reported to develop as sterile males lacking Sry [118]. A model adapted from McElreavey et al 1993 [120] explaining how this deletion may effect Sox9 expression, has been proposed (shown schematically in figure A):

28 Sox9 expression begins in the indifferent gonad of both sexes, in ll.Sdpc wild- type XX gonads, Sox9 has been hypothesized to be down regulated by the binding of a repressor to its gonad-specific regulatory elements [118, 121]. In contrast, the presence of Sry in XY gonads at ll.Sdpc is thought to act by antagonizing this repressor, thus allowing Sox9 expression to be up regulated, and resulting in Sertoli-cell differentiation. Bishop et al have suggested that in the Odsex mutation, these cw-regulatory elements have been deleted so the repressor is unable to repress Sox9 expression in the developing genital ridge, causing it to be maintained in both XX and XY mice [118]. Despite the fact that this interpretation for how the Odsex mutation causes female to male sex reversal can be adapted very nicely to fit the model proposed by McElreavey et al, [120] it is equally possible that the action of the Tyr minigene itself exerts an effect upon Sox9 expression, and the male to female sex reversal phenotype is not caused by the 150kb deletion. To confirm that it is the DNA deletion itself rather than the transgenic insertion that causes female to male sex reversal, the 150kb region should be flanked by loxP sites, which will allow the deletion to be re-created by expressing Cre-recombinase.

To further clarify the role of Sox9 during sex determination, Vidal et al [122], have generated transgenic mice expressing Sox9 under the control of the Wt-1 promoter [123]. These mice showed Sox9 expression in both XX and XY gonads at lO.Sdpc, which resulted in female to male sex reversal. When this transgene was transmitted through the germ line by a fertile XY male, all XX transgenic animals were phenotypically male. In-situ analysis established the

29 expression of the Sertoli cell marker Amh. Histological analysis found that at

13.5dpc, the testes of XX transgenic animals are indistinguishable from XY wild-type littermates except that they lacked germ cells [124].

30 Figure A: Model of how the Odsex mutation affects Sox9

expression

Taken from [91]

At 10.5 dpc, Sox9 is expressed in the genital ridges of both male and female embryos. In wild-type XX gonads at 11.5 dpc (left), the binding of a repressor, or repressor complex, to gonad-specific regulatory elements (filled box) located 1.3

Mb upstream of Sox9, down regulates Sox9 expression. In wild-type XY gonads at 11.5 dpc (middle), this repressor binding is thought to be antagonised by SRY protein, leading to up regulation of Sox9 expression, followed by Sertoli-cell differentiation and testis formation. In the XX Ods/+ gonads at 11.5 dpc (right),

Sox9 cannot be repressed, because the gonad-specific elements for repressor binding have been deleted by the transgene insertion. As a result, Sox9 is expressed at sufficient levels to induce testis formation and subsequent male development.

31 XX XY XX Ods/+ Female Male Male

Sry

Gonad-specific 1 Repressors 1 regulatory elements 1 8

Sox9

Repressor binding Repressor binding Repressor inhibited by Sry can not bind Sox9 OFF Sox9 ON Sox9 ON In humans XX sex reversal has been observed in a single male patient with a rearrangement on chromosome 17 [125]. FISH analysis using a BAC clone containing S0X9 demonstrated that this individual had three copies of S0X9, one signal on the normal chromosome and two signals on the rearranged chromosome. PCR with SRY specific primers established that sex reversal was not caused by the presence of SRY making the S0X9 duplication the most likely cause of sex reversal. Interestingly, other XX females with duplications of regions of Chromosome 17 (which includes S0X9) do not exhibit sex reversal. This could be explained if, in order for male sex differentiation to occur, SOX9 has to be expressed at a critical threshold level. This level may vary from one individual to another reflecting the complex nature of mammalian sex determination and differentiation.

1.7. 1,5 Targeted mutations in mouse Sox9

In 1998, Bi and co-workers [126] looked at the effect of inactivating either one or both copies of Sox9. By replacing a 450bp fragment from exon 1 of Sox9

(including the 5' region of the HMG box and the translation start site) with an

IRES-lacZ-pA-loxP flanked PGKneobpA cassette, Sox9 was functionally inactivated. When chimeras were generated from blastocyst injection, the presence of the lacZ reporter led to the expression of P-galactosidase in a Sox9 specific pattern. To obtain germ line transmission, chimeras generated from injecting heterozygote null (+/-) ES cells into wild-type blastocysts were crossed with the out bred CD-I mouse line. All Sox9+l- pups died shortly after birth from respiratory problems; they possessed cleft palate, hypoplasia and

32 bending of many skeletal structures. When the testes from these animals were examined at 14.5dpc, lacZ was expressed in a male Sox9 specific pattern and the histological examination revealed no signs of sex-reversal. Chimeras generated from the injection of Sox9 null (-/-) ES cells into wild-type blastocysts were morphologically normal even when the neonates contained a

50% contribution from the Sox9-/~ ES cells. In situ hybridisation analysis revealed skeletal defects associated with CD although no sex reversal was seen. The skeletal abnormalities in -/- +/+ mutants seemed to be caused by delayed or defective pre-cartilaginous condensations due to the dosage insufficiency of Sox9 [127].

Developmentally compromised tetraploid blastocysts were used to obtain chimeras that were derived entirely from Sox9-/~ ES cells. In such chimeras, the tetraploid component is selected against in all lineages where the ES cells are able to differentiate normally. This allows the ES cells to take over the embryo proper and relegates the tetraploid component to the extraembryonic membranes [128]. No Sox9 transcripts were found in Sox9 -/- mutant ES cells indicating that a complete Sox9 null had been generated [127] (plus unpublished data). Unfortunately, since these embryos failed to survive past lO.Sdpc they could not provide information on the role that Sox9 plays during testes formation.

A Sox9 targeted mutation has also been generated by Alan Schafer and was characterised by Sara Morais Da Silva (AS, SMS and RLE unpublished data).

This mutation also caused disruption to the HMG box of Sox9 by replacing

33 exon 1 with a neomycin cassette. However, unlike the Sox9 mutation generated by Bi et al [126], the PGK-neo cassette could not be removed from correctly targeted ES clones prior to generating chimeras. Blastocyst injection of three correctly targeted clones yielded 11 chimeras with a 10-80% contribution from the ES cells although none showed an overt phenotype; the male chimeras were test mated to C57BL/6 females but germ line transmission was never achieved. When Sox9 +/- ES cells were injected into tetraploid blastocysts 27% were recovered, these embryos had a very severe phenotype dying around

8.5dpc; the most severely affected presented a strange round shape suggesting that gastrulation might be impaired; others showed retarded growth and severe posterior malformations [129].

L7.2 DM RTl

There are currently some indications that mammalian Dmrtl is important in testis development. Dmrtl is highly conserved and is expressed in the differentiating male genital ridges and adult testis of mammals, birds, reptiles and fish ([130] and references therein). In humans, DMRTl is located on chromosome 9p24.3, a region which, when hemizygous, is linked with defective testicular development and ensuing male to female sex reversal

[130]. In the mouse, Dmrtl is expressed in the early genital ridge of both XX and XY embryos but becomes testis specific from ~14.5dpc [130] [4, 7]. To investigate the possibility that DMRTl is the gene responsible for male to female sex reversal in humans, transgenic mice carrying a null mutation for

Dmrtl have been generated [130]. Although male mice carrying a heterozygous

34 null mutation for Dmrtl are normal, male mice that are homozygous for the null mutation showed a postnatal testis phenotype similar to the heterozygote mutation in humans, with severely hypoplastic testes containing disorganized seminiferous tubules and an absence of germ cells. There was also evidence of fatty degeneration of interstitial (Leydig) cells [130]. The similarities between the mouse and human phenotype suggests that reduced DMRTl expression may to some extent, be responsible for the defective testis differentiation caused by distal 9p deletions in humans. Surprisingly however, male to female sex reversal has not yet been seen in the Dmrtl deletion mice [130]. Although DMRTl still remains a good candidate, it is possible the human phenotype may be due to the combined loss of DMRTl and another gene on 9p. So far, two other DMRT genes have been mapped to this deletion.

1. Z3DESERT HEDGEHOG (Dhh)

Desert hedgehog {Dhh) is one of the three mouse hedgehog genes {Desert hedgehog, Indian hedgehog and Sonic hedgehog, which share a striking homology with the Drosophila segment polarity gene Hedgehog (Hh), a key regulator of pattern formation in embryonic and adult stmctures [131]. All encode secreted proteins thought to be involved in cell signaling. Dhh expression is initiated in

SertoH cells shortly after Sry expression, and persists in the testis of the adult.

Female mice homozygous for a Dhh-mi\[ mutation show no obvious phenotype, whereas males are viable but infertile, owing to a complete absence of mature sperm, signifying an important role for Dhh in the regulation of mammalian spermatogenesis.

35 To investigate if Dhh and Hh share similar regulatory pathways, the vertebrate homologue of the Drosophila patched gene {ptc) (also called Ptc in vertebrates) was used. Drosophila ptc encodes a multiple membrane-spanning protein that is transcriptionally activated but functionally inactivated by Hh. In the mouse, Ptc is expressed from ll.Sdpc in the male, but not in the female gonad, where it becomes restricted to the interstitial space during formation of the testis cords. No Ptc expression was seen in the Dhh mutant testes, consistent with a conservation in the hedgehog signaling pathway between flies and mice [132].

1,7,4 TESTATIN

Testatin was first isolated from the mouse gonad using a modified mRNA differential display technique [133]. Typically, differential displays (DD) are used to compare in different tissues, or in differently treated cells lines, and to isolate differently expressed cDNA’s [134] [135]. Recently

DD’s have been modified so they can be used for isolating genes that encode proteins with a signal peptide sequence. Although the signal peptide sequences are not very conserved, they normally contain stretches of leucine residues.

Since the most common codon for leucine in humans is CTG, a primer that corresponded to a poly- leucine stretch was designed; total RNA from 13.5dpc female and male mouse gonads and mesonephroi was isolated. SPDD was then used to isolate a testis-specific cDNA which, showed homology to a group of genes known as the family 2 cystatins encoding cysteine protease inhibitors.

The newly isolated gene showed homology to a group of genes known as the

36 family 2 cystatins encoding cysteine protease inhibitors and was named testatin

(testis-specific cystatin-related gene) [133].

Testatin is expressed from ll.Sdpc in the pre-Sertoli cells, the same lineage in which Sry is expressed. It is therefore possible that Sry could induce, but not maintain, testatin expression within the supporting cell lineage [136]. Since

Sox9 is also expressed in Sertoli cells it is another potential candidate for regulating testatin expression [133].

1.7.5 GATA-4 (see also AMH)

The GATA family of transcription factors is characterized by a highly conserved DNA binding domain consisting of two zinc fingers that direct binding to the nucleotide sequence (A/T) GATA (A/G). So far, six GATA transcription factors have been identified in vertebrates, these have been divided into two subfamilies based upon their expression patterns. GATA-1 -2 and -3 genes are predominately expressed in hematopoietic stem cells. GATA -

4, -5 and -6 genes are expressed in various mesoderm and endoderm derived tissues such as heart, liver, lung, gonad and gut where they play critical roles in regulating tissue specific gene expression. In the adult mouse, GATA-4 mRNA is expressed in the heart, lung, liver and small intestine as well as in the testes and ovary [137]. In the developing mouse gonad, GATA-4 is expressed in the somatic cells of both sexes from ll.Sdpc but later shows a sexually dimorphic expression pattern becoming restricted to Sertoli cells of the fetal testis and being down regulated in the ovary [138]. GATA-4 has been shown to physically interact with the nuclear receptor, SF-1, participating in the

37 regulation of AMH [139]. The Amh promoter contains a conserved GATA-4 binding site [140] which, if mutated to prevent GATA-4 binding, results in a

40% decrease in Amh activity in Sertoli cells [139].

1,7.6 FIBROBLAST GROWTH FACTOR 9 (FGF-9)

Fibroblast growth factors (FGFs) make up a large family of polypeptide growth factors that are found throughout the vertebrate subphylum. In humans, there are currently 22 identified members of FGFs sharing a 13-71% amino acid identity. During embryonic development, FGF’s have diverse roles in regulating cell proliferation, migration and differentiation. One member of the family, FGF9, has been implicated in sex determination and testicular organogenesis [141]. Mice that are homozygous for a targeted deletion of Fgf9

{Fg/9-/-) die at birth due to lung hypoplasia. Most XY mice lacking Fgf9 exhibited varying degrees of male to female sex reversal. Fgf9 null (-/-) mice show a lack of proliferation at the CE within the XY gonad leading to a decreased number of Sertoli cells and interstitial cells [141]. Since Sertoli cells appear to facilitate male sex determination at least in part by directing germ cells to enter mitotic arrest [142, 143], it is possible that if there are too few

Sertoli cells present in the developing testis then they will be unable to stop all germ cells from entering meiosis, resulting in ovarian development. Colvin et al [141] have demonstrated that exogenous FGF9 is able to induce mesonephric cell migration into ll.Sdpc XX gonads, indicating that migration of cells from the mesonephros may also be impaired in Fgf9-/~ embryos. Since blocking mesonephric cell migration has been shovm to impair testis cord

38 formation [55] [69], a combination of reduced proliferation from the CE and the mesonephros is probably the cause of XY sex reversal. It is already known that Sry is required for proliferation and mesonephric cell migration, [49] [50] and Fgf9 has been hypothesized to act along the same developmental pathway, downstream of Sry. Fgf9 expression begins shortly after the onset of Sry expression at 10.5dpc, although it is seen in both sexes (Blanche Capel personal communication). FGF9 is not required to induce Sox9 expression.

1.7.7 ANTI-MÜLLERIAN HORMONE (AMH)

During multiple pregnancies in cattle, the chorions and the blood vessels fuse.

This allows the exchange of blood between the fetuses and often leads to masculinization of a female twin which, is referred to as a freemartin by a male twin [144]. Freemartin cattle are characterized by variable features: the ovaries are reduced in size and sterile, and they frequently contain germ-cell less seminiferous tubules; the derivatives of the Müllerian ducts are more or less absent, and Wolffian ducts show varying degrees of masculine development although prostate and masculinized external genitalia are rare. The freemartin effect was thought to be caused by a testicular hormone, which normally governs the differentiation of the genital structures in the male embryo, being transferred to the female twin via the placenta causing it to become masculinized [145]. In preliminary in vitro experiments performed to test this hypothesis, it was demonstrated that the testes of a 59-day-old calf fetus is able to inhibit the Müllerian ducts in pieces of the genital tract taken from a 15dpc rat embryo. In the reciprocal experiment, a testis from a 15dpc rat embryo is

39 able to cause regression of the Müllerian duct of a 54-day-old calf embryo.

This implied that a discrete hormone(s) secreted by the testes is able to cause regression of the Müllerian ducts. This substance was named MIS (Mullerian

Inhibiting Substance), otherwise known as AMH. In 1974, Josso et al [146] demonstrated that AMH production is localized to the Sertoli cells of the testis.

Currently the AMH gene has been cloned in human[147], bovine [148], chick

[149], mouse [150], rat [151], and reptiles [152].

The human AMH gene contains five exons that encode a protein of 560 amino acids and is a member of the TGF-p family of growth factors [147]. In the mouse, Amh is first expressed in the Sertoli cells of the testis cords at 11.5dpc and is highly expressed in the testis until 7 days post partum (dpp) when the level of transcripts start to decrease [23]. In females, Amh is detected at a low level after birth in the granulosa cells of the follicle. When the human AMH gene was chronically expressed in mice using the mouse metallothionein-1 promoter [153], the majority of transgenic female mice lacked a uterus, oviducts and ovaries; closer examination of the few females retaining their ovaries revealed that they had become and masculinized resembled those of bovine freemartins [153]. Amh deficient male mice, generated by gene targeting, retain Müllerian duct-derived structures and are frequently sterile due to the persistence of the female reproductive organs, which obstructs the transfer of functional sperm along their normal pathway. Older male mice testes showed focal Leydig cell hyperplasia, which is consistent with a proposed role for Amh in regulating Leydig cells [153]. In contrast, Amh

40 deficient female mice were fully fertile. The Amh promoter has been shown to contain putative binding sites for SRY/S0X9 [154], SF1[86] and GATA-4

[140]. It is unlikely that SRY interacts directly with Amh in view of their expression patterns; Sry expression levels have peaked and are declining by the time Amh expression begins. In vitro assays have supported this hypothesis

[154]. The other potential protein that could bind to this site is S0X9, since its expression just precedes that of Amh in the mouse. In vitro studies in which the

S0X9 binding site in Amh has been mutated, demonstrated that S0X9 binding is essential for the initiation of Amh transcription [155]. SF-1 has been shown to bind in vitro to a nuclear site (AGGTCA) located in the

Amh promoter [86]. In vivo studies performed by Arango et al 1999 [156], illustrated that if mutations are introduced into the Amh promoter which abolish the proximal SFl site binding site, Amh transcription is still initiated normally, demonstrating that the SFl binding site in the Amh promoter is not required for the initiation of AMH transcription. However, SFl is probably responsible for subsequent AMH up regulation in the testis (see figure B).

Two other factors, WTl and GATA-4, have also been implicated in the regulation of Amh expression [157]. In vitro studies have revealed that the

WTl isoform that lacks KTS (-KTS) can potentate the activation of Amh transcription by SFl in tissue culture cells [158]. Additionally, a conserved

GATA-4 binding site has been located in the Amh promoter [159]. Expression studies have shown that both Wt-I and GATA-4 are expressed in the developing Sertoli cells of the testis.

41 Figure B: A Model for AMH Transcription in Sertoli Cells of the

Male Gonad

(Adapted from [110])

Current data implies that Amh transcription is initiated by S0X9 acting through the conserved HMG DNA binding site of the Amh promoter. In the absence of this site, no Amh transcription is initiated and the Müllerian ducts fail to regress.

Amh expression is upregulated by SFl binding to the nuclear hormone half site.

Additionally, a specific isoform of WTl has been shown to physically interact with SFl to synergistically up-regulate Amh transcription. In the absence of an

SFl-binding site, Amh levels decrease but are still adequate to cause complete regression of the Müllerian ducts. GATA-4 may also have a role in the initiation and/or regulation of Amh transcription and is able to bind in vitro to a conserved

GATA site in the Amh promoter.

42 WT1

SF-1 Sox9

CCAAGGTCA TGATAGCCCTTTGAGA

Sox9 SF-1

CCCTTTGAGA CCAAGGTCA TGATAG

Sox9 SF-1 GATA AMH

CCCTTTGAGA CCAAGGTCA TGATAG

Model for AMH Transcription in Sertoli Cells of the Male Gonad 1.8 SUMMARY

Classical genetic studies of mammalian sex determination have demonstrated

that the testis-determining factor, carried on the Y chromosome, is necessary

for activating a cascade of genes involved in male testes formation. Analysis of

human patients carrying mutations within the SRY gene, and the behaviour of

transgenic mice containing the Sry gene, have illustrated that SRY encodes the

testis determining factor and that it is the only gene required from the Y

chromosome to trigger male sex determination. The SRY protein is therefore

considered a positive regulator of male sex determination. SRY acts during a

critical period of gonadal differentiation to divert the normal default pathway

of gene activity that would otherwise lead to the development of the ovaries, to

one that leads to the development of testes. Of all the genes expressed in the

indifferent of gonad, evidence currently points towards SF-1 and/or WT-1 as

the most likely candidates to activate Sry expression ([160] and references

therein). Consensus binding sites for WT-1 and possibly SF-1 have been

located upstream of mouse Sry coding sequence [161] [162], [163]. The

physiological target gene(s) for SRY remain unknown although S0X9 is the

best candidate.

43 1.9 GENES EXPRESSED DURING OVARIAN DEVELOPMENT.

In the absence of SRY, ovarian development is initiated. The following section

will discuss genes that are differentially expressed during female sex

determination and have been implicated in ovarian development and

differentiation.

1.9.1 DOSAGE SENSITIVE SEX REVERSAL (DSS) and DAX-1

Duplications of the short arm of the human X chromosome have been

implicated in male to female sex reversal. The minimal duplication was

mapped to a 160kb region of chromosome Xp21, which includes the Adrenal

Hypoplasia Congenita (AHC) locus [164]. These patients are XY females with

a normal SRY gene, but they have a ‘double dose’ of all the gene products

within this 160kb region. This increased dose interferes with testis

development yet, critically; XY individuals that have deletions spanning this

entire region develop as males. This implies that genes within this 160kb

region are not involved in testis determination but may play an important role

in ovary determination. The 160kb region had previously been investigated for

the analysis of a contiguous syndrome characterized by AHC, glycerol kinase

deficiency and Duchenne muscular dystrophy. During this study, an

evolutionary conserved gene, designated DAXl (DSS-^^C critical region on

the X, gene 1) was isolated [165]. DAXl is a member of the nuclear hormone

receptor superfamily that retains the conserved ligand-binding domain but

lacks the typical zinc finger DNA-binding motif. This implies that DAXl

44 regulates gene expression through protein-protein interactions [165]. The mouse Dax-1 gene has been cloned and its expression pattern during early development studied [166]. Comparison of mouse and human DAXl revealed highly conserved regions (90-100% homology) separated by poorly conserved domains (40-50% homology). The expression pattern of Daxl in mice reveals that it is present in XX and XY indifferent gonads as well as in the adrenals and the hypothalamus. Daxl is expressed in the indifferent gonad until shortly after 10.5dpc. Its expression is maintained in the developing ovary but down regulated in the developing testis after 12.0dpc [166]. Evidence for Daxl being a feminizing factor arose from studies in mice carrying more than one copy 0Î Daxl as a transgene [121]. Transgenic XY mice expressing Daxl at 10 times normal levels, showed delayed testis development. Importantly, when the transgene is tested against mice carrying a Mus domesticus poschiavinus Y chromosome, which gives delayed testis cord formation of about 14hrs, sex reversal was seen. This finding suggests that Daxl and Sry act antagonistically in a dosage sensitive manner to regulate sex determination [121]. Data from Ito et al 1997, showed that on a protein level, DAXl is able to inhibit SF-1 mediated transactivation via its carboxy-terminal domain. SF-1 is known to be essential for gonad formation and shows a sexually dimorphic expression pattern, becoming up regulated in the differentiating testes. Moreover, SF-1 has been shown to interact synergistically with S0X9 to regulate Amh expression levels. Apart from Sertoli cells, Sf-1 and Daxl are always co-expressed. Swain et al have hypothesized that DAXl and SF-1 form heterodimers, with

45 DAXl acting to ensure that secondary testis determining genes, such as Sox9, are repressed in ovary development. In this example, SRY would act in XY gonads to prevent SF-1 and DAXl from forming heterodimers leaving SF-1 to bind to its target sequence. This model was tested by generating Daxl null mutant mice, surprisingly although these mice showed a defect in spermatogenesis neither ovary nor testis development was affected, implying that Daxl isn’t the only gene responsible for repressing male development in the mouse [167].

L9.2 WNT-4

The members of the Wnt family are vertebrate homologues of the Drosophilia segment polarity gene “wingless” that encode cell surface and extracellular matrix associated signaling proteins [168].

Wnt-4 is expressed in the mesonephros and the CE of the mouse between 9.5 and lO.Sdpc. At ll.Odpc, it is expressed in the CE as it invaginates to form the

Müllerian duct. When sexual differentiation starts to occur, Wnt-4 is down regulated in the male gonad but is maintained in the female gonad. Vainio et al

[52], generated Wnt-4 homozygote null mutant mice, which die shortly after birth due to kidney failure. Phenotypic examination demonstrated that although male and female heterozygotes are unaffected, Wnt-4 homozygote null females are masculinized, suggesting an important (dosage controlled) role for Wnt-4 in female sex determination [52].

46 1,9.3 GDF-9 COoctyte-secreted growth factor *)

Growth differentiation factor-9 (GDF-9) is a distant member of the TGF-P family. In the mouse, its expression is restricted to the oocytes [169]. Normally,

GDF-9 acts within follicles by binding to receptors on the surface of granulosa cells to regulate the expression of many gene products. Male mice carrying homozygous null mutations in Gdf-9 were fertile, with normal sized testes. In contrast, mutant females were infertile due to defects in folliculogenesis. Adult females had small ovaries, containing abnormal follicle cells, with associated oocyte degeneration [170]. Further studies found several markers of theca cells were absent, implying that in the absence of Gdf-9, the follicle cells are not able to recruit theca cells precursors. Thus, Gdf-9 plays an important role in growth and differentiation during early folliculogenesis [59].

Since the identification of Sry in 1990, the field of sex determination has exploded. Despite the enormous amount of investigative work in this field, we still don’t know the upstream targets of Sry. Based on our current understanding of the process we have devised a working model of sex determination (figure C). This Ph.D. project was designed to test the model by eliminating Sox9 from the male sex determination pathway.

47 Figure C: OVERVIEW: A WORKING MODEL OF SEX

DETERMINATION

(Adapted from [171])

In mammals, the formation of a bipotential gonad requires expression of Wt-1,

Sfl, Lhx 9 and M33 among others. Once the gonads are formed, Sry and Sox9 are known to be required in the XY gonad to initiate male sexual differentiation. In

XX embryos, where Sry is not expressed, ovarian development proceeds.

Although no ovarian determining gene equivalent to Sry has been found, Daxl is a possible candidate since it appears to act as an ‘anti-testis’ gene. Similarly, Wnt-

4 acts to suppress Leydig-cell differentiation in the ovary (as well as other functions). Once sex is determined, genes including Sfl, Wtl, Gata 4, Dhh, Fgf-9,

Testatin, Sox9 and Dmrtl act in the XY gonad to control sexual differentiation and to form a testis. The testis then secretes the hormones AMH from the Sertoli cells as well as testosterone and Insl3 from the Leydig cells. AMH and testosterone act to suppress female differentiation and to support male differentiation elsewhere in the body. The theca cells of the ovary are the female counterpart of the Leydig cells and secrete oestrogen.

48 Gonad Sex formation determination

Wtl Theca Sf1 ceils Lim1 Ovarv (YY\

Follicle intermediate ^ Bipotentiai Dax1 cells mesoderm gonad Lhx9 Leydig ^ Testosterone cells Insl3 M33 Sry Testis (XY) Sox9 Wnt4 Sertoli AMH Sf1 cells Wt1 Gata4 Dhh Sox9 Dmrtl testatin 1.10 AIMS OF THIS THESIS

The aim of this Ph.D. project was to address the role of Sox9 in mammalian sex

determination. Evidence suggests that Sox9 plays an essential role in male sex

determination in all vertebrates, where it is thought to be essential for Sertoli

cell formation. To investigate further, I wished to conditionally inactivate Sox9

in the mouse genital ridge at the point of sex determination. The embryonic

lethality associated with previous Sox9 null mouse mutations meant that in

order to achieve this goal, I had to not only generate a Sox9 conditional

mutation, using Cre-lox technology, but also create transgenic mice designed to

permit Cre-mediated recombination specifically within the developing gonad.

Transgenic mice, expressing Cre under the control of regulatory regions from

the Daxl and Sry genes, were produced for this purpose. Additionally, these

Cre mice should have enabled me to address a second question concerning sex

determination, one of cell fate. It has always been assumed that Sertoli cells

and follicle cells are derived from the supporting cell precursors, although

formal proof is lacking. Since both Daxl and Sry are expressed in the

supporting cell precursors, it is possible to breed transgenic mice driving Cre

under the control of the Daxl or Sry regulatory regions, with the ROSA26

Reporter (R26R) mouse line. These mice ubiquitously express lacZ, from the

ROSA26 locus but only after Cre-mediated recombination ([172] & see

chapter 4). Breeding mice carrying Cre recombinase under the control the

Daxl or Sry regulatory regions with the R26R mice, should lead to Cre

mediated recombination only in the somatic cells of the genital ridge. This

49 would cause the R26R mice to continually express lacZ in this cell lineage.

Provided follicle and Sertoli cells do originate from a common precursor then we would expect both to be expressing lacZ.

50 2 CHAPTER 2 - ENGINEERING A 5^0X9 CONDITIONAL MUTATION

2.1 INTRODUCTION

Although there is much evidence to implicate S0X9 in vertebrate sex

determination, its specific role in the pathway remains unclear. So far, two

independent groups have targeted the Sox9 locus [126, 129]. Both used a

traditional gene replacement strategy to substitute a region of Sox9

encompassing the initiation start site and part of the HMG box, with a PGK-

neo selection cassette, via homologous recombination [173]. Unfortunately,

S0X9 null mutants die during embryogenesis around lO.Sdpc, most probably

because of a cardiovascular problem (R Behringer personal communication).

This suggests that Sox9 plays a critical role in heart development but precludes

the analysis of the developing genital ridges.

Since it has proved impossible to study Sox9 fimction in mouse testis in this

way, we decided to change strategy and to engineer a conditional mutation of

the Sox9 gene in embryonic stem cells (ES).

2.1,1 Designing a conditional targeted mutation

In theory, conditional gene targeting will allow us to inactivate the gene of

interest in a specific cell type and at a specific time. The key tools for such a

sophisticated strategy are enzymes that can catalyse site-specific recombination

within the genome: Flp and Cre recombinases.

Cre recombinase was isolated from PI phage and directs recombination

between specific 34bp sequences known as loxP sites (locus of ‘x’ over in PI)

51 [174]. Flp recombinase was isolated from yeast Saccharomyces cervisiae. It works on the same principle as the Cre/lox system by directing recombination between specific 34bp sequences know as Frt (Flp recognition target) sites.

Currently, the Cre/lox system is generally the preferred choice, due to the different optimal reaction temperatures of the recombinases (37°C for Cre verses 30°C for Flp [175]). In 1998, Buchholz et al improved the thermostability of Flp by introducing four amino acid changes [176]. This collectively improved the in vitro recombination activity of the recombinase

(FlpE), some fourfold at 37°C and tenfold at 40°C when compared to wild-type

Flp. FlpE mouse strains have been shown to undergo maximum recombination in somatic and germ cells making FlpE a viable alternative to, and complement for, the Cre-lox system [176].

If two loxP or Frt sites are introduced in the same orientation into a genome such that they are flanking an essential part of a gene without affecting its function, then Cre or Flp-mediated recombination leads to deletion of the loxP- flanked (‘floxed’) or Frt-flanked segment, thereby inactivating the gene.

In addition to generating a conditional mutation, selection cassettes can be flanked by loxP or Frt sites allowing them to be removed by site-specific recombination following gene targeting.

In order to prevent loxP and/or Frt sites from interfering with the gene function prior to expression of the desired recombinase, they are usually inserted into non-coding regions of the gene. However, this policy cannot always guarantee against gene interference. When Postic et al [177] used three loxP sites to

52 generate a conditional Glucokinase (GK) mutation; they reported a persistent difference between the blood glucose level in mice that were homozygous for the GK conditional mutation and wild-type littermates, suggesting that the insertion of a loxP site had caused a slight attenuation in GK gene expression.

Expression of Cre or Flp in vitro has been shown to mediate recombination between degenerate loxP/Frt sites (pseudo-sites) [178], which have been identified within the mouse genome, although with reduced efficiency. An example of this can be seen in the recent paper by Schmidt et al [179], which suggests that high levels of Cre expression in developing spermatids can lead to male sterility in mice by inducing gross chromosomal rearrangements in spermatozoa, caused by Cre-mediated recombination between pseudo-loxP sites. Furthermore, pro-longed high levels of Cre expression (IpM of 4-OHT for 24-48hrs) in cultured mammalian cells, which expressed Cre under the control of the ROSA 26 promoter, but which lacked loxP sites, showed inhibited cell proliferation and caused genotoxic affects. These were characterised by the occurrence of micronuclei, aneuploidy, karyotypic abnormalities and Sister Chromatid Exchanges (SCE), [180] and are thought to have arisen from illegitimate recombination between pseudo-loxP sites.

Despite these caveats, the Cre/loxP recombination system is being used very successfully in mice.

2,1,2 Inactivating Sox9 within the developing genital ridge

To generate a conditional Sox9 targeting mutation, we decided to target the

Sox9 locus with a construct where a significant portion of the open reading

53 frame (ORF) of Sox9 was floxed by loxP elements. To avoid the possibility of gene interference from the selection cassette, PGK-neo, the opportunity was taken to flank the selection cassette with Frt sites. This way, chimeras could be generated with targeted ES cells either before or after Flp mediated recombination.

By breeding mice homozygous for floxed alleles of Sox9 with transgenic mouse strains expressing Cre under the control of a tissue specific promoter, it should be possible to inactivate Sox9 exclusively within the developing genital ridge without disrupting its gene function elsewhere. The limitation of this type of conditional gene inactivation is finding a tissue specific promoter with enough fidelity to drive the expression of Cre. Even if a promoter is weakly active at an early stage of development then a mosaic animal will be generated

[181] [182]. Potential promoters, which can be used to drive the expression of

Cre-recombinase in the genital ridge, will be discussed in chapter 4. In addition, a database has been established as a resource of information covering

Cre transgenic mouse lines that are readily available, or are currently being generated (www.msliri.on.ca/nagy).

The cloning steps involved in the generation of a conditional targeted mutation of Sox9, known as pSox9^^^^, are described in the materials and methods section. The completed construct is illustrated in Figure 1, (part 6) and Figure

3B.

54 This section describes the designing of the pSox9^°^^ targeting construct and discusses the choice of reporter and selectable marker. It also reports the results of in-vitro experiments performed prior to gene targeting to test the functionality of the construct.

55 2.2 MATERIALS AND METHODS

2.2.1 Cloning techniques and reagents used to generate the Sox9

targeting construct

The first step involved in generating a Sox9 conditional mutation was to extract

a 15kb genomic fragment encompassing the mouse Sox9 gene from Phage

clone XI5 as described below.

2.2.2 Bacteria used for amplification of Sox9 phage clone

A single colony of LE392 cells was cultured overnight on a gyratory shaker

(set to 250rpm) in 50ml LB, supplemented with 0.2% maltose and lOmM

MgS 0 4 . The cells were pelleted by centrifugation at 3000rpm for lOmin at 4°C

in a Sorvall rotor. The supernatant was discarded and the cells resuspended in

15ml of ice-cold lOmM MgS 0 4 .

2.2.3 Liquid culture of bacteriophage

For liquid culture, a bacteria to phage ratio of 1000:1 is required. The bacterial

OD600 = 1 for approximately 8x10^ cells/ml. A single plaque contains around

10^ plaque-forming units (pfu). Approximately 2x10^ pfu were added to 200pl

lOmM MgS 0 4 , containing approximately 2x10^ bacteria, and mixed gently

with a pipette tip. The mixture was incubated at 37°C with gentle shaking for

20min. This was then added to 500ml of LB (supplemented with 0.2% maltose,

lOmM MgS 0 4 ) and cultured overnight at 37°C with shaking (250rpm).

56 2.2.4 Isolation o f bacterioph age X DNA

After checking for lysis, 10ml of chloroform was added to the liquid culture.

50|il each of DNAsel and RNAseA (both at lOmg/ml) and 29g of NaCl were added and the mixture incubated with vigorous shaking (>300rpm) at 37°C for

30min. The contents were allowed to settle before being poured into two 500ml

Nalgene centrifuge bottles (leaving the chloroform behind) and centrifuged at

SOOOrpm for 20min to recover the phage. The supernatant was discarded and the pellet was resuspended in 3ml of SM buffer (Per liter: 5.8g NaCl, 2g

MgS 0 4 H2 O, 50ml IM Tris.HCl (pH 7.5), 5ml 2% (w/v) gelatin) before being transferred to a 30ml Corex tube. 1.5pl of DNAsel (lOmg/ml) and 30pl of

RNAse (lOmg/ml) was added and the mixture incubated for 30min at 37°C.

10% SDS, 120pl of 0.5M EDTA (pH 8.0) and 30pl of lOmg/ml Proteinase K

(PK) was then added before the culture was incubated at 68°C for 30min. DNA was extracted by isopropanol precipitation and centrifugation at 13,000rpm for

15min in a bench top centrifuge. The pellet was washed in 70% ethanol before being air-dried and resuspended in 500pl TE, pH 7.4 (lOmM Tris.HCl pH 7.4,

ImM EDTA pH 8.0).

2.2.5 Preparation ofEpicurian ColiXLIO-Gold Ultracompetent Cells.

Stratagene’s XL 10-gold ultracompetent cells were used for the transformations of the recombinant plasmids generated as per manufacturers protocol. These cells were chosen as they exhibit the Hte phenotype, which increases the transformation efficiency of large and ligated DNA molecules. Further stocks

57 of XL 10-gold competent cells were then prepared using the SEM method as described by Inoue efa/[183].

2.2.6 Small and Large scale plasmid preparation.

Small and large scale plasmid isolations were prepared using a standard alkaline lysis protocol as described in Molecular cloning: A laboratory manual

[184].

2.2.7 Restriction enzyme digestion of DNA

Restriction digests were carried out according to the specifications of the manufacturer of the particular restriction endonuclease (Boehringer Mannheim or New England Biolabs). DNA to be digested was diluted in sterile distilled water before the relevant restriction endonuclease was added at a concentration of lU/pg as recommended in Molecular cloning: A laboratory manual [184].

2.2.8 BluC’White cloning Assay

Blue-white colony selection was carried out essentially as described in the

Stratagene manual. All Stratagene’s pBS vectors contain the lacZ reporter gene and express p-galatosidase when plated onto a medium containing X-gal and

IPTG. Functional P-galactosidase (determined by blue colonies) is produced only for those transformants with plasmids containing uninterrupted reading frames. If this reading frame is disrupted (i.e. by insertion of foreign DNA) then the lacZ gene is interrupted, and white colonies result.

2.2.9 Quantification of nucleic acid concentrations

Rough estimates of nucleic acid concentrations were made by comparison of sample material with a standard on an agarose gel. Spectrophotometric

58 scanning at the wavelength of 260nm made more accurate determinations. An

A260 value of 1 represents a concentration of 50pg/ml for double stranded

DNA.

2.2.10 Electrophoretic separation of DNA

Following restriction endonuclease digestion, DNA samples were separated

using agarose gel electrophoresis in TAB buffer (40mM Tris-acetate (pH 7.0),

ImM EDTA). The concentration of agarose depended upon the size of

fragments that were to be separated, but generally, 1% gels were used. DNA

samples were loaded with Vio volume of 0.1% orange G and 50% glycerol into

the wells (unless otherwise stated). Ethidium bromide-stained DNA bands were

visually detected under a low intensity ultraviolet light and subsequently

photographed. In order to purify DNA fragments from agarose gels, the

QIAEX II gel extraction kit (from Qiagen) was used according to

manufacturers instructions.

2.2.11 Extraction o f DNA

Phenol/chloroform extraction was routinely used to remove contaminating

proteins from DNA following plasmid preparation and/or gel purification. To

do this, an equal volume of Tris.HCl (pH7.5) equilibrated phenol and

chloroform (1:1) was added to the DNA and mixed vigorously before the

phases were separated by centrifugation at 13,000rpm for 5min. The upper

(aqueous) phases were removed and the DNA recovered by precipitation with

ethanol. To one volume of DNA, Vio volume of 3M NaOAc (pH 5.2) and 2.5 volumes of ethanol were added. Following incubation at -20°C for >15min, the

59 sample was centrifuged again at 13,000rpm (at 4°C for 15min). The nucleic acid pellet was washed with 70% ethanol and air-dried prior to resuspension in

TE, pH 7.4.

2.2.12 Blunt-ending, phosphatasing and ligation of DNA fragments

If DNA fragments that needed to be ligated had been digested with different restriction enzymes, then the single-stranded overhangs generated were often not compatible and needed be blunt ended (filled in). To end-fill a 5’ overhang, the Klenow fragment of DNA polymerase was used as follows: O.IU of

Klenow per pi in a solution of lOmM Tris (pH7.4), 5mM MgCl 2 and ImM of each of the four dNTP’s were added to the DNA before being incubated at

37°C for 30min. A lOmin incubation at 75°C was used to stop the reaction. The

DNA was then purified using a phenol/chloroform extraction. To end-fill a 3’ overhang, T4 DNA Polymerase was used as follows: 5U of T4 DNA

Polymerase per pg of DNA (in a solution of 33mM Tris acetate (pH 7.9),

66mM potassium acetate, lOmM magnesium acetate, 0.5mM DTT, 0.1 mg/ml

BSA and lOOpM of each of the four dNTP’s). The DNA incubated at 37°C for

5min before the reaction was stopped by heating at 75°C for lOmin and the

DNA was purified by phenol/chloroform extraction.

To inhibit intramolecular ligation of vector without insert, blunt ended vector molecules (or those with the same sticky ends) were treated with alkaline phosphatase (from Promega) according to manufacturer’s instructions. Vector and insert fragments were mixed in a molar ratio of 1:3 and ligations were carried out at 16°C overnight in lOpl reactions using T4 ligase (100 ligation

60 units for cohesive reactions) containing one tenth volume of iOx ligase buffer

(200mM Tris.Cl (pH7.6), lOOmM MgCb, lOOmM dithiothreitol, ImM ATP).

The efficiency of blunt end cloning was increased by the addition of Poly- ethylene-glycol [185] and by using a high concentration of ligase

(2,000,000unit/|al).

2.2.13 Partial endonuclease digestion of DNA

Due to the cotnplexity and size of the Sox9 targeting vector, to create a irjiique

.site that was suitable for cloning, which would otherwise have led to the Sox9

DNA being cut more than once, a partial digest was performed This was done by digesting l ug of DNA m a total volume of 50ql containing 0.5 units of enzyme and placing it at 37'^C. 5pi aliquots were removed eyeiy lOmin, over a

90min period. All samples were immediately heat inactivated, before being run out on a TAB agarose gel Once it was establish how long it took the DNA to become Imearised (i.e. for one of the two restriction sites to be cleaved but not the other), the reaction was scaled up and repeated. Linearised DNA was gel purified and Klenow DNA polymerase (Promega) used to fill in the partially digested ends, destroying one of the two sites. The DNA v/as then transformed into Stratagene's XL 10-gold ultracompetent cells. Sequencing was used to identi ty clones where the desired restriction site had been destioyed.

2.2.14 Colony Hybridization - Screening for recombinant plasmids

Cloning difficulties sometimes required colony lifts to be performed in order to identif y recombinant plasmids. These were carried out as described in chapter

61 8; using the DIG System User's Guide for Filter Hybridisation, provided by

Boehringer Mannheim.

2,2.15 Generating double-stranded loxP and Frt oligonucleotides for

use in the Sox9 conditional targeting mutation

2,2.15.1 loxP Sites. loxP oligonucleotides were designed to contain sticky overhangs complementary to the DNA they were to be cloned into for increased cloning success. The opportunity was also taken to introduce new diagnostic sites into the oligonucleotides to allow clones, which had successfully incorporated the loxP oligonucleotide(s), to be easily identified by performing a restriction digest. Sequencing was then used to confirm the presence of a single, non­ mutated loxP site and to establish its orientation.

Each loxP oligonucleotide was chemically synthesised, purified by FPLC and phosphorylated by the commercial supplier OSWEL. To anneal complementary oligonucleotides, lOOpmol of each was mixed in a total volume of 19pl reaction buffer and Ipl of 20x annealing buffer (0.2M Tris-HCl pH

7.9, 40mM MgCl2, IM NaCl, 20mM EDTA) was added. The mixture was incubated at 90°C for 5mins, 65°C for 30mins, 37°C for Ihr before being left to cool at room temperature.

The oligonucleotides containing loxP sites are shown below. Sal I overhangs to facilitate cloning are represented in red and the diagnostic EcoRI site is in blue.

The (bp) depicted by * was changed from a C to an A so as to destroy the Sal I site endogenous to Sox9. A new Sal I was recreated at the 3’ end of

6? the oligonucleotide for use in later cloning steps.

^ TCGAA*GAAATAACTTCGTATAATGTATGCTATACGAAGTTATGAATTCG ^

^ GCTTTATTGAAGCATATTACATACGATATGCTTCAATACTTAAGCAGCT^

2,2.15.2 Frt Sites

Plasmid pFRT^ [186] was a gift from Susan Dymecki it contains two Frt sites

in direct orientation with a multiple cloning site engineered between them to

allow insertion of various DNA sequences. A single Frt site is shown below:

GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC ^

CTTCAAGGATAAGAGATCTTTCATATCCTTGAAG

6 1 2,2.16 Double Stranded DNA Sequencing

DNA sequencing was routinely used to: 1) check the fidelity of loxP and Frt sites, 2) confirm that a partial digestion and end-fill with Klenow DNA polymerase (Promega) had destroyed the correct restriction site and 3) to establish the orientation of various cloned DNA fragments.

Fluorescent cycle sequencing was performed using the ABI PRISM Dye

Terminator Cycle Sequencing Ready Reaction Kit with AmpliXaq DNA

Polymerase. Atypical sequencing reaction contained 0.5-1 pg ds plasmid DNA as the a template, 8pi of Terminator Ready Reaction Mix, 3.2 pmol of primer, and distilled water to a final volume of 20pl. Reactions were overlaid with mineral oil. The PGR reaction was performed on a hybaid PGR machine (25 cycles of 96°G for 30 seconds, 50°G for 15 seconds, 60°G for 4 minutes).

Reaction products were precipitated on ice for 10 minutes with 2.0pl of 3M

NaOAc (pH 5.2) and 50pl of 95% ethanol, to remove any unincorporated dye terminators.

After centrifugation at 14000rpm for 15 minutes, the pellet was washed once with 70% ethanol, air-dried and stored at -20°G until electrophoresis. The sequencing reaction extension products were analyzed using an ABI 373 or a

377 DNA sequencer.

64 2.3 TISSUE CULTURE TECHNIQUES AND TRANSFECTION ASSAYS

Once the pSox9^^^^ targeting construct was completed, the integrity of the loxP

and Frt sites and their ability to undergo recombination mediated by Cre and

Flp recombinase, was tested in an in vitro transfection assay.

2,3,1.1 C3H10T1/2 cells and Transfection assay

C3H10T1/2 fibroblast cells were grown on tissue culture grade plates in

minimum essential medium (MEM) containing Earles Salts purchased from

GIBCO and supplemented with 10% Fetal Calf Serum (FCS), 2mM L-

glutamine, 50ng/ml penicillin and 50ng/ml streptomycin (all purchased from

GIBCO).

Approximately twenty-four hours before transfection was due to take place,

C3H10T1/2 cells were plated out onto 35mm tissue culture grade plates at a

concentration of 1x10^ cells/plate and incubated at 37°C in a CO 2 incubator

until they were between 50 and 80% confluent.

For each transfection a total of Ipg of DNA was used containing 500ng of a

CMV-Cre expression plasmid, known as pOG231, (from S O'Gorman) and

500ng of pSox9^°^^ (linearised at its unique Xhol site), diluted in lOOpl of

serum free medium. In a separate reaction, 20pl of LipofectAMINE (GIBCO)

was diluted in lOOpl of serum free media before being added to the diluted

DNA and mixed well. Following a 45min incubation at room temperature,

which allowed DNA-liposome complexes to form, 0.8ml of serum free media

was added to each tube and mixed gently. Prior to addition of the diluted

DNA-liposome complexes, C3H10T1/2 cells were rinsed with Opti-MEM

65 (GIBCO). The cells were then incubated over night (o/n) at 37°C in a 5%

CO2 incubator. The following day, the complexes were replaced with complete growth medium and the cells were again incubated o/n as before.

For visualisation purposes, cells were removed from the tissue culture dish by tryspinisation, rinsed with Opti-MEM, and plated out onto slides. MmGFP expression was checked using a FITC filter. A mock transfection, with no

DNA, was performed as a negative control to determine the background level of fluorescence (see figure 4).

6 6 2.4 RESULTS and DISCUSSION

2.4.1 Building the Sox9 conditional targeting vector

A IS.Okb genomic fragment, encompassing the mouse Sox9 gene, was isolated

from A, 15 by Sal I and Xho I digestion. This generated two fragments a 9.0kb

Sal-Sal fragment (A) and a 5.0kb Sal-Xho fragment (B) (represented

schematically in Fig 1). The cloning for both fragments (A and B) was

performed using blue white selection on X-gal IPTG plates (see materials and

methods). Fragment A was cloned into pUC 19 BEX (see fig 1 Al). In order

to clone fragment B into pBS, a colony lift using the di-deoxygenin system

(DIG) was used (see materials and methods + fig 1 Bl). The EcoRI site in the

polylinker of pBS SK, containing fragment B, was destroyed by partial

digestion with EcoRI and end-filled to leave a single EcoRI site. Colonies that

contained only one EcoRI site were digested with a combination of enzymes to

determine which EcoRI site had been destroyed.

Cassette 1 (See Fig 2) containing a loxP site, a splice acceptor site, an MmGFP

reporter [187], and a neomycin selectable marker, under the control of the PGK

promoter [188], flanked with Frt sites, [186] was cloned into fragment B at its

remaining EcoRI site using a blunt end ligation. The efficiency of this cloning

step was increased by the addition of Poly-ethylene-glycol [185] and by using

a highly concentrated ligase (2,000,000unit/pl). Digestion and subsequent

sequencing was used to confirm the orientation (see steps B2 & B3). A second

loxP site was cloned into Fragment B at a unique Sal I site located in the first

intron (see fig 1 B4). Clones, which had successfully integrated a loxP site,

67 were identified using an EcoRI digest (see materials and methods). The fidelity

and orientation of the loxP site within each clone was confirmed by

sequencing. The final cloning stage involved religating fragments A and B

together to generate a 17kb construct (see fig 1 steps 4 & 5). This final cloning

step was very finstrating due to the large size of the two DNA fragments.

Initial attempts to clone fragment A into fragment B by dephosphorylating

fragment B proved unsuccessful. This problem was overcome by eliminating the dephosporylation step and by making sure that the ratio of fragment; A to fragment B was exactly equimolar. In addition, PEG was added to a final concentration of 15% and a high concentration ligase was used (2000,000 unit/pl). The completed targeting construct is known as pSox9^^^^ and is represented schematically in figure 3).

6 8 FIGURE 1 ; Building the conditional targeting construct pSox9 loxP

Phage clone X15 containing a 15kb genomic fragment encompassing the mouse

Sox9 gene was digested with Sal I and Xho I to generate two fragments; Fragment

A (9.5kb) and Fragment B (5.5kb).

Fragment A, containing the promoter and exon I of Sox9 was cloned into pUC19

BEX. (Al)

Fragment B, containing exons II, and III of Sox9 (including the putative polyadenylation site and 3’UTR), was cloned into pBS KS (Bl).

Partial digestion and fill in was used to eliminate the EcoRI site in the pBS KS polylinker (B2).

A GFP-neo selection cassette, containing a loxP site, a Splice Acceptor Site, an

MmGFP reporter and PGK-Neomycin flanked by Frt sites was cloned into the remaining EcoRI site (B3). (A schematic of the various steps involved in the generation of this cassette in shown in figure 2).

A second loxP site was cloned into Fragment B at its unique Sal I site. (B4)

Fragments A and B were religated to generate the mouse Sox9 conditional targeting vector which is known as pSox9^^^^ (5).

Gene targeting, into ES cells, was performed as described in the next chapter (6).

69 Sox 9 Conditional Knockout In vitro -6.0 Kb ■ (X)S E Xb 15.0 Kb Xb (X) u_ - I L - I )c15

Digest Sal-Xho and subclone fragments A and B A 9.5 kb

5.5 Kb 0 D igest with EcoRI

Clone in cassetteO at 3.0Kb

1.0 Kb E Xb 0 k I GFP Neo 1>

Clone in 2nd LOXP

Xb 8.0 Kb 0 k I gfp ri>r~Ni3i>

Religate 2 fragments

17,0 Kb I I J k I GFP ri> f~Ni5~t>

Targeting, homologous recombination S and selection using G418

k I GFP Neo 1>

S = Sail E = EcoRI Xb = Xbal X = Xhol ► = loxP site > = FRT site I = HMG box FIGURE 2: Engineering the Selection Cassette 1

Plasmid pFRT2 was obtained from Susan Dymecki [186]. The Neomycin gene including a promoter and terminator, was cloned into pFRT2 at its Avr II and Nhe

/sites (1).

The Neomycin gene, flanked with Frt sites, was removed after digestion with

EcoRI znà. cloned into a pBS vector containing MmGFP (2) before being digested with Hindlll, and cloned into a pBS SK vector containing a single loxP site (3).

Partial digestion and end fill was then used to eliminate the 3’ Hindlll site to allow a splice acceptor site to be introduced into the selection cassette at the remaining 5’//m^////site (4).

This cassette was inserted into Sox9 Fragment B at its unique EcoRI site (5).

70 Cloning Steps Involved in Making Cassette(T)

PGK PGK terminator (T) promoter (P) A N h WvW— Neo —'AAA//' AAAA/— Q — Q —'/AAAA p B S p F R T 2

Digest Avril and Nhel Blunt end and clone in Neo

E HIIIX

AA/W^ T Neo I P 0 --- /AAAA Q pBS Digest EcoRI Clone into vector containing GFP S V 4 0 pA N E Hill E HIIIX I I I I I I //AAA— GFP XH)l Neo P -Q—WAAAA Digest Hindlll and clone into pBS containing single LoxP S V 4 0 pA Hill E Hill GFP XHH Neo P~[fl[-^AAAAA @

Destroy Hindlll site in pBS polylinker, digest with Hindlll and clone in splice acceptor

S V 40 pA .H ill EMl AAAA/— -SA GFP ^ —Q- T Neo P -0 —>///// ( 4^

Digest Not I / Xhol and Blunt end and ligate into S o x 9

E E Xb Xb (X) I I I I V III onGFPVoTN^ n = FRT site Xb = Xbal V A = Avril P> = L oxP site Nh = N hel E = EcoRI SA = Splice Acceptor Hill = Hindlll (Adapted from plasmid stocks X = Xhol Brunelli and Rodriguez 1998 ) N = Notl 2.4.2 Ch oosing a Reporter

In order to monitor recombination between the two-loxP sites, an MmGFP reporter with a splice acceptor, was introduced into the Sox9 targeting construct immediately after the second loxP site (See figure 3B). Expression of Cre recombinase should simultaneously inactivate Sox9 by removing part of its

HMG box and the entire transactivation domain to bring MmGFP under the control of the Sox9 promoter. Following Cre-mediated recombination, MmGFP should be expressed in a Sox9 specific expression pattern providing a way to follow the expression of the recombined transgene, Sox9^^, at successive stages of development, even in the same living embryo (Figure 3E). From an experimental viewpoint, MmGFP was chosen above other reporters such a (3- galactosidase as results can be detected directly in live or fixed embryos bypassing the need to perform other steps to establish where and when the transgene is being expressed. MmGFP is based upon mGFP5 [189]. It is at least 50-fold brighter than wild-type GFP at 37°C and contains modifications to improve the folding of the protein and its solubility at higher temperatures.

Moreover, it has been shown to be non-toxic to mouse cells and not to perturb embryogenesis.

2.4.3 PGK-Neo

A positive selection marker was introduced in the targeting construct to allow selection of transfected cells after electroporation. PGK-Neo, a hybrid gene consisting of the phosphoglycerate kinase I promoter driving the neomycin

71 phosphotransferase gene, is the most commonly used selectable cassette.

However, previous studies have suggested that targeted mutations, which retain the PGK-neo cassette, may yield unexpected phenotypes due to the altered expression of neighbouring genes from the strong PGK promoter. One example of how dramatic an effect this can have was illustrated by Fiering et al

[190] who replaced the 5’DNAse hypersensitivity site 2 (5’HS2) of the Locus

Control Region (LCR) of the p-globin locus with a PGK-neo cassette. This resulted in considerably reduced expression of the globin gene with homozygotes dying in utero at the time point of fetal liver haematopoiesis.

Removal of the selection cassette by Flp-mediated site-specific recombination, restored viability and globin expression was essentially normal. This indicates that the PGK-neo cassette disrupted normal interactions between the LCR and downstream regulatory elements. Further examples of the unpredictable phenotypes that can be caused by selection cassette interference include the

Hoxd-10 knockout [191] and the granzyme B cluster mutants [192].

To avoid the possibility of potential interference from the PGK-neo cassette with Sox9 expression and the Sox9 conditional phenotype, a strategy was designed to enable the removal of the PGK-neo cassette in the recombinant ES cells or at later steps in the Sox9 conditional mice; the PGK-neo cassette inserted in the targeting construct was flanked by Frt sites in the same orientation (Figure 2 and 3B). This gave us the opportunity to eliminate the neo cassette if necessary, by expressing Flp recombinase. Any phenotype observed would then have to be a direct result of removing Sox9 from that tissue.

72 Although it is possible that the single Frt site that remains in the genome following Flp mediated recombination could have an affect on Sox9 if it interrupts a regulatory element, it is unlikely since the Frt sites were cloned downstream of the 3’UTR [99].

2,4,4 Testing the function of Sox^"^^ in vitro before gene targeting

Prior to gene targeting, pSox9^^^^ was tested to confirm that correct recombination could occur between loxP and Frt sites upon expression of their respective recombinases. This was done using two Esherichia colt strains

(294-Cre and 294-Flp), which express either Cre or Flp recombinase. By propagating pSox9^^^^ in both strains of E.coli, and extracting DNA, recombination competence between the two loxP sites and the two Frt sites were assayed for by digestion with EcoRI which showed a banding pattern distinct from unrecombined pSox9^°^^ [193]. Recombination between the two- loxP sites leads to deletion of a 3.2kb EcoRI fragment (Figure 4B & Bl), whilst recombination between the two Frt sites leads to the deletion of a 1.6kb EcoRI fragment (See figure 4C & Cl).

73 Figure 3: vSox9^^^^ Targeting Construct

A) Schematic diagram of the Sox9 genomic locus.

The three coding exons of Sox9 are shown as open boxes with the region

encoding the HMG box shown in red.

B) Schematic diagram of targeting vector.

The two-loxP sites are represented as pink triangles. Shaded in grey is the reporter

MmGFP, which includes a splice acceptor (SA). Shaded in blue is the neomycin gene driven by the PGK promoter. This cassette is flanked by Frt elements shown in yellow.

C) Schematic diagram of the mutated Sox9 locus (5ojcP-GFP-ueo) following homologous recombination with the targeting construct Sox9^^^^.

The position of the external 3’ probe (XB5.2) and the internal 5’ probe (IN5’) used in Southern blot analysis are indicated as a yellow and blue box respectively.

D) Schematic diagram of the mutated Sox9 locus following Flp-mediated recombination (5'ojc5^-GFP).

This recombinogenic event between the two Frt sites removes the selection cassette leaving behind a single Frt site.

E) Schematic diagram of the mutated Sox9 locus following Cre-mediated recombination (Sox9

This recombinogenic event between two loxP sites generates a Sox9 null allele leaving behind a single loxP site. B, BamHI; E, EcoRI\ Xb, Xba /; S* New

Sail site.

74 12.0kb

7.5kb

Xb E/Xb B Wild Type ______I— Allele £ □ — ID­ S’ probe 3 ’ probe X X X Xb 8 E Xb Xb Targeting . l - L _L_ )SAGFPpA Neo |Q-I ------// B Vector a - f c

X

B Xb B E Xb Xb S0X9 GFP-neo I I ] >SAGFPpA Neo

3.2kb S.Okb

FLP recombinase X

Xb E B E Xb S 0 X 9 G FP L _l_____ L_L ^ A G F P p A -7^

3.2kb 6.4kb

cre recombinase X

B Xb B E Xb S 0 X 9 G FP I I ^ A G F P p A Neo |Q - Figure 4: Testing the function of the LoxP and Frt sites using E-

coli strains 294-Cre and 294-FIp

pSox9^°^^ was transformed using two E-coli strains designed to express Cre- recombinase (294-Cre) or Flp recombinase (294-Flp). After being transformed in the desired strain, DNA was extracted and digested with EcoRI. Cre mediated recombination between the two-loxP sites, leads to loss of a 3.2kb EcoRI fragment (B + arrow). Flp mediated recombination between the two Frt sites, leads to loss of the 1.6kb EcoRI fragment (C + arrow). As a control, unrecombined pSox9^^^^ was always run in adjacent lanes on the gel. Figure A shows the sizes of the expected DNA fragments generated following digestion of unrecombined pSox^^^^ with EcoRI.

75 Testing the Fidelity of the LoxP and Frt Sites

Untransformed Sox9‘ X 1.6kb 4.0kb 3.2kb . 1.0kb 1.6kb

S0X9 - O - k } —C Z H >SAGFPpAf([rN e o

B Transformed with Cre X 1.6kb 4.0kb 1.0kb 1.6kb EE E S0X9^ GFPpA4^ . i h

C Transformed with Flp X 1.6kb 4.0kb 3.2kb I. I.Okb

SOX9 GFP O - k F - C

81 VI CL Ü n LL HI § cc o (3 CD O) CT) a> X XXX o O OO CO CO CO CO

1.6kb 3.2kb 2.4.5 Checking the expression o f the Mm GFP reporter in vitro prior to

gene targeting

To demonstrate that recombination between the two loxP sites activates

MmGFP a Sox9 expressing fibroblast cell line, C3H10T1/2, [117] was co­

transfected with the pSox9^^^^ targeting vector and pOG231 (see materials and methods). Cells that have incorporated pSox^°^^ and pOG231 should undergo

Cre-mediated recombination creating a fusion protein between the first exon 1

of Sox9 and MmGFP, causing MmGFP to be expressed in a Sox9 specific

expression pattern [189]. Twenty-four hours after the transfection, C3H10T1/2 cells were trypsinised and plated out onto slides so MmGFP expression could be detected by epifluorescence microscopy using a FITC filter. C3H10T1/2 cells that bad successfully integrated both pSox9^°^^ and pOG231 showed

MmGFP expression in the nucleus and the cytoplasm (see figure 5 A). A mock transfection, with no DNA, was performed as a negative control to determine the background level of fluorescence (see figure 5B). These experiments provided satisfactory evidence that both the loxP and Frt sites worked as anticipated. Recombination between the loxP sites was also shown to successfully activate expression of the MmGFP reporter in a Sox9 specific pattern. The next section will discuss the steps involved targeting of pSox9^°^^ into ES cells.

76 Figure 5: C3H10T1/2 cells transfected with 2inù pOG231

Delta vision images of C3H10T1/2 cells transfected with and pOG231, which encodes Cre-recombinase under the control of CMV. Cre-recombinase causes recombination between the two-loxP sites bringing MmGFP under the control of the Sox9 promoter (A). A mock transfection was performed as a negative control to determine the background level of fluorescence (B).

77

3 CHAPTER 3 - TARGETING THE SOX9 LOCUS IN ES CELLS USING THE CONSTRUCT pSOX9LOXP

3.1 INTRODUCTION

S .h l ES Cells

By 3.5dpc the mouse embryo is at the blastocyst stage and consists of two

distinct lineages, the inner cell mass (ICM) and the trophoectoderm. The

trophoectoderm is an epithelial monolayer of cells, that encloses the ICM

[194]. The ICM is a transient pool of pluripotent cells that are able to

differentiate into primitive extraembryonic endoderm and epiblast. The epiblast

gives rise to all the three primary germ layers of the developing fetus as well as

the primordial germ cells and the extraembryonic mesoderm during the process

of gastrulation. Although the presence of self-renewing pluripotent cells is

transient during development, embryonic stem cells (ES cells) can be derived

from the isolated ICM and maintained indefinitely in in vitro culture on a

fibroblast feeder layer and/or in the presence of Leukemia inhibitory factor

(LIE) [195] [196].

3,1.2 Gene targeting

Perhaps the most valuable method to study gene function and expression in

development has been the ability to introduce foreign DNA into the mouse

germ line. ES cells can be genetically modified in culture yet still remain

pluripotent allowing the regulation and function of genes to be studied in vivo.

Moreover, ES cells can be used to produce chimeric animals enabling the

78 mutation to be introduced into the germ line. This unique property permits the phenotypic effects of specific gene alterations to be characterised.

In order to insert exogenous DNA into the genome in a site directed manner, a targeting construct must be made from two regions of DNA (2-1 Okb) homologous to the gene of interest interrupted by a selectable marker such as the neomycin resistance gene (Neo^) [197].

One of the first genes to be inactivated via homologous recombination in ES cells was the hypoxanthine phosphoribosyl transferase (hprt) gene. Hprt was chosen since it is located on the X chromosome and is therefore only present as a single copy in XY ES cells and is expressed in ES cells. Hprt was disrupted by the insertion of a promoterless form of the neomycin resistance gene (Neo*) into its eighth exon. By integrating into the Hprt loci, Neo^ was brought under the control of the Hprt promoter. This way, clones that had successfully undergone homologous recombination expressed neomycin conferring resistance to G418, allowing them to be isolated [198]. To allow genes that are not expressed in ES cells to be isolated following gene targeting, a ubiquitous promoter is often used to drive expression of the selectable marker gene. A PGK promoter is most commonly used to drive the expression ofNeo^ and is normally included in the targeted mutation (See Chapter 2). However, this type of strategy means that ES cells that have integrated the targeted mutation anywhere in their genome will be isolated. Further analysis by

Southern blotting or PGR analysis is therefore required to distinguish clones

79 that have undergone homologous recombination from those that have undergone random integration.

3.1.3 Choosing the correct Embryonic Stem cell line

ES cells that are karotypically XY are generally used for targeting. It is anticipated that a high efficiency incorporation of the cultured XY ES cells will convert XX host embryos into phenotypic males. This allows stable mouse lines to be established much quicker. The most commonly used ES cells, such as CCE and ABl, are derived from the 129/Sv/Ev mouse strain, a strain from which ES cell lines are most easily established and which carries an agouti coat colour [199]. They also carry the PGKl^ allele, which is different from that of most lab strains, allowing a simple electophoretic test of the extent of contribution of the ES cell derivatives to chimaeras [180].

3.1.4 Differentiating Embryonic Stem cells in culture

ES cells are able to spontaneously differentiate into many different cell lineages in tissue culture [200]. The majority of ES cells are grown on a fibroblast feeder layer, which secretes LIE thereby maintaining them in their undifferentiated form. By removing the feeder layer and culturing ES cells on a bacterial grade culture dish, they are unable to adhere, causing them to clump together and generate a group of differentiating cells known as an embryoid body (EB). Within the first few days of differentiation, EB’s generate cells expressing genes indicative of endoderm and mesoderm. Following extended culture, haematopoietic, endothelial and neuronal lineages are formed [200].

80 It is often informative to generate EB’s fi*om targeted ES cells as their subsequent differentiation into various cell types can provide information of the role a particular gene plays in certain cell lineages. Moreover, under certain culture conditions ES cell differentiation can be directed along various pathways to generate neurons, glial cells, cardiac tissue as well as cells of osteogenic and haematopoietic lineages [200-202],

81 3.2 MATERIALS AND METHODS

The following section provides a detailed description of all techniques and

reagents used to target the Sox9 loci.

3.2.1 Cell Lines

3.2.1.1 CCE^s

The CCE embryonic stem cell-line used in the first round of targeting was

originally derived from XY 129/ Sv/Ev pre-implantation embryos [203]. They

possess the agouti coat colour (see intro). To prevent differentiation, CCE ES

cells must be cultured on a feeder layer (see below) at 37°C with 5% CO 2 in

Dulbecco’s Modified Eagles Medium (DMEM, from Gibco) supplemented

with 15% ES qualified serum (ESQ), 2mM L-glutamine, lOOunits/ml penicillin

lOOpg/ml Streptomycin (all Gibco) and 90pM p-mercaptoethanol (Sigma). To

passage the cells, they were washed with PBS (without Calcium and

Magnesium), treated with an appropriate volume of IX tryspin/EDTA (3mls

per 10cm plate) and returned to the incubator for 5 minutes until the cells had

lifted off from the plate. An equal volume of medium was then added to the

cells and a single cell suspension was obtained through vigorous pipetting.

Spinning at lOOOrpm for 5 minutes in a bench top centrifuge pelleted the cell

suspension. After spinning, the supernatant was aspirated off and the cell

pellet was re-suspended and plated out at the appropriate dilution.

8 2 3,2.L2 STO(Nys

To prevent the CCE ES cells from differentiating they require a factor known

as LIE, This is obtained by growing the CCE’s on top of a monolayer of

mitomycin treated, neomycin resistant, fibroblast cells (STO(N)s) known as

feeders [204]. Mitomycin acts by blocking mitosis; arresting STO cell

proliferation, yet still allows them to secret LIE. Eeeders were plated onto

10cm gelatinised plates at a density of 3 x 10^ per plate.

3.2J,3 ABVs

The ABl embryonic cell-line was originally derived from XY 129/ Sv/Ev pre­

implantation embryos [205]. A B l’s are cultured in the same way as the CCE

ES cells but require additional LIE (Sigma) in the ES cell media to prevent

differentiation (see above).

3.2.2 Electroporation

The targeting construct pSox9^^^^ was linearised at its unique Xhol site and gel purified. ES cells were trypsinized, washed in PBS and resuspended in PBS at

a concentration of 2 x 10^ cells per 0.8 ml. 20-30pg of targeting construct

was added to the cells in a Gene Pulser\Cuvette (0.4cm electrode

from Bio Rad) and electroporated at 960pE at 0.2 Kilovolts (KV). Each

aliquot of transfected cells was added to 10ml of fresh medium and split between five 10cm, pre-prepared feeder plates. As a control (mock) for the

0418 selection, 2 x 10^ cells were electroporated with no DNA and added to

10ml of fresh media. 2ml was plated onto one 10cm feeder plate.

83 3.2.3 Selection o f transfected cells

After transfection, the culture medium was replaced everyday. Two days after electroporation, cells were fed with ES media supplemented with 250pg/ml

G418 (supplied by PAA) for positive selection (i.e. clones which had incorporated pSox9^°^^). Selection was judged to be complete when the mock plate was clear of ES cells (approximately 7-10 days). Individual colonies of

ES cells were lifted from the plate and pipetted into one well of a 96 well plate containing 25pi of trypsin. After no more than 30 minutes, each 96 well plate was placed in a 37°C incubator for five minutes before the dispersed colony was added directly to a single well of a 96 well plate containing 200pl of medium and feeder cells. When the ES cells were confluent, they were passaged onto two further 96 well feeder plates and onto two gelatin coated 96 well plates without feeders. Once the ES cells were confluent, the 96 well feeder plates were frozen down whilst the gelatinized plates were used for extracting DNA for screening.

3.2.4 Extraction of DNA from ES cells (Death wish!)

To prepare DNA from ES cell cultures, the media was removed and the cells were washed in PBS. 50pl of freshly prepared lysis buffer (lOmM Tris

(pH7.5), lOmM EDTA (pH 8.0), lOmM NaCl, 0.5% Sarcosyl and 1 mg/ml of

Proteinase K (added just before use) was added to each well. These lysates were placed in a humidified chamber and incubated overnight at 60°C. The following day, an equal volume ethanol, to which 4M NaCl had been added to

84 give 75mM NaCl, was added and the plates were shaken gently at room

temperature for 30 minutes. The 96 well plates were then inverted to remove

the ethanol (the DNA should remain stuck to the plate). After washing five

times with ice cold 70% ethanol, the DNA was left to dry for 30 minutes,

before TE (20pl) was added to each well, and placed at 37°C for 30 minutes to

allow the DNA to resuspend.

3.2,5 Southern blotting

To check for homologous recombination, Southem blot analysis was

performed. Clones were digested with the appropriate restriction enzyme and

screened with both an external 3’ probe and an internal 5’ probe. To each

sample, a 2X digest mix (3 OU per well of the appropriate restriction enzyme,

2mM spermidine, 200mg/ml BSA and 5mg/ml RNAse A in a total volume of

25pi) was added. After two hours, a further 20pl of a IX digest mix (15U per

well of the same restriction enzyme, ImM spermidine, lOOmg/ml BSA and

2.5mg/ml RNAse A) was added to each well before being incubated overnight

at 37°C. DNA samples were loaded onto 0.7% (w/v) TAE/agarose gels

containing 0.2pg/ml ethidium bromide and separated via electrophoresis (60

volts for 8 hrs for a 25cm^ gel). Gels were photographed on a UV transilluminator alongside a ruler to allow the sizing of bands. Gels were then

depurinated by washing for 30 minutes in 0.25M HCl and denatured by washing twice for 30 minutes in 1.5M NaCl, 0.5M NaOH. Finally, 2 washes of

30 minutes in 1.5M NaCl, 0.5M Tris-HCl (pH 7.5) neutralized the gels, which were then capillary blotted overnight in 20X SSC onto Hybond N+ nylon

85 membranes (Amersham). After blotting, membranes were rinsed in 6X SSC

and UV cross-linked.

3.2.6 Hybridisation

The blotted membranes were placed in hybridisation tubes containing pre­

hybridisation mix (5X SSC, 5X Denhardts solution, 1% (w/v) SDS with

lOOpl/ml of freshly added denatured salmon sperm). The membranes were pre­

hybridised by placing them in a rotating hybridisation oven set at 65°C for

3hrs. Meanwhile, DNA probes were labeled with a^^P-dCTP using the

Megaprime DNA labeling kit (Amersham) as per manufactures protocol. To

remove any unincorporated nucleotides, each probe was passed through a G-50

Sephadex medium spin column [184]. Typically, the probes specific activity

was -lO^cpm/pg. Following pre-hybridisation, probes were denatured by

placing them at 100°C for 10 minutes and chilled on ice, before being added

directly to the pre-hybridisation mix and hybridised overnight at 65°C. The

following day, the membranes were washed in 2X SSC, 0.1% SDS for 5

minutes at 65°C, IX SSC, 0.1% SDS for 20 minutes at 65 °C and 0.5X SSC,

0.1% SDS for a further 20 minutes at 65°C. They were then exposed overnight

to a phosphor-imager screen.

3.2.7 Cre-mediated recombination between two loxP sites

Following Southem blot analysis, positive clones were further checked to see if

they had retained both loxP sites. To do this, each clone was transfected with

the supercoiled plasmid pOG231 (see section 2.3). If both loxP sites have

retained their fidelity, ubiquitous Cre expression will lead to recombination

8 6 between them (S.O’ Gorman, Salk Institute). This was assayed for by Southem blot analysis.

3.2.8 Blastocyst injection of Sox^^^^ targeted ES cells

Blastocysts were collected from C57BL/6 female mice at 3.5dpc as described by Robertson in Tetatocarcinomas and Embryonic Stem Cells [206]. ES cells for injection were trypinised as normal to generate a single cell suspension, before being resuspended in ES cell media supplemented with 20mM Hepes

(pH 7.0) and kept on ice until they were ready to be injected. Approximately

15 ES cells were injected into each blastocyst before they were transferred into the uterine horns of a 2.5dpc pseudopregnant FI (C57BL/6 x CBA) mouse. A rough estimate of the extent of contribution of the ES cells to the resulting live bom chimeras was obtained from the proportion of agouti verse black coat colour.

3.2.9 Pseudopregnant recipients

Pseudopregnant female mice, between 6 and 8 weeks old, were prepared by mating females with vasectomised males. Vasectomised males were prepared in the SPF facility of NIMR, pseudopregnant females were ordered as required.

The females were anaesthetized 2.5dpc after the recorded copulation plug date using an intraperitonal injection of 300pl of Avertin (l.Og 2.2.2- tribromoethanol dissolved in 0.5g tertiary amyl alcohol. To make a working solution, 1.2ml of this stock solution was dissolved in 100ml of boiling PBS and aliquots stored at -20°C). Eight injected blastocysts were then transferred

87 to each uterine horn using a capillary pulled needle cut to the appropriate diameter and angle.

3.2.10 Chromosomal analysis of targeted ES cells using metaphase

spreads

3.2.10.1 Karyotype analysis and G-Banding

Karotype analysis and G-banding of homologous recombinant ES cells was performed according to Robertson [206].

3.2.10.2 Chromosome Painting

Following G-banding analysis, the relevant chromosome paints purchased from

Cambio were used to identify desired chromosomes as described in manufacturers instructions.

3.2.10.3 Fluorescent In-Situ Hybridisation (FISH) on metaphase

spreads with biotin labeled probes

Metaphase spreads were prepared using standard methods following a 40 min treatment with colcemid [206]. FISH was performed according to Craig [207].

The Sox9 probe was generated using a BioNick DNA labelling system (Life

Technologies) and visualised using biotinylated anti-avidin and Fluorescein avidin DN (both from Vector Laboratories). 3.3 RESULTS & DISCUSSION

3.3.1 Gene Targeting

Following electroporation of pSox9^^^^, into CCE ES cells, 700 G418 resistant

colonies were picked and expanded. Seven of the 700 clones screened by

Southern analysis using an external 3’ probe (XB5.2) gave the correct size

BamHI fra.gmQnt that confirms external 3’ homologous recombination. Two of

the seven clones were shown to contain both loxP sites, as analysed by an

internal 5’ probe (INS’) and EcoRI digestion, these were named #C7A and

#1AB respectively. Despite an extensive search, the long 5’ arm of homology,

which spanned 13.7kb, made it impossible to find an informative restriction

site, which would have enabled us to distinguish between the targeted and wild

type Sox9 locus. Therefore, prior to injection, one of the Sox9^°^^ ES cell

clones, #C7A, was electroporated with the plasmid pOG231. Of the 200

colonies picked, Southem blot analysis demonstrated that one clone had

undergone Cre-mediated recombination demonstrating that both loxP sites

were present (See figure 5).

3.3.2 Blastocyst Injection

Clone #C7A was injected into C57BL/6 host blastocysts which were

transferred to pseudopregnant foster females. The foster females were allowed

to litter and the percentage of chimaerism was judged from the proportion of

agouti coat colour. The litter sizes were very small, with many the pups dying

soon after birth (n=5). Those that survived (n=9) showed a very low

percentage of chimaerism. In case clone #C7A had lost its developmental

89 pluripotency, clone #1AB was also injected into C57BL/6 host blastocysts but

this gave similar results.

3.3.3 Karyotype Analysis and Mouse Chromosome Painting

To investigate the reasons why both targeted ES clones generated poor

chimeras a karyotype analysis was done. The main population consisted of a

chromosome count of 40XY, however both targeted clones contained an

abnormal giant chromosome (see figure 6A). To establish if the presence of

this giant chromosome was because of targeting, karyotype analysis

was performed on wild-type ES cells and on some other targeted clones

generated in the lab that had used the same CCE stock. All clones tested

showed the same giant chromosome. G-banding (see figure 6B) demonstrated

that this had arisen via a translocation event. Almost all, apart from the extreme

distal segment, of Chromosome 6 was attached to almost all of Chromosome

11, apart from the C-band. In addition to this, each cell had one other copy of

Chromosome 6 and two copies of Chromosome 11, making them trisomie for most for Chromosome 11. Mouse chromosome painting was performed on metaphase spreads to visually show this fusion (Figure 7). Since the

endogenous Sox9 gene maps to mouse chromosome 11, there were three chromosomes where pSox9^°^^ could have integrated via homologous recombination.

3.3.4 Common Chromosomal Abnormalities in ES Cells

In 1997, Xin Liu et al [208] investigated the ability of an ES cell to contribute to the germ line. By looking at three independent cell lines, they discovered

90 that chromosomal abnormalities occur very frequently in ES cells, especially as the passage number (P) is increased. The most common chromosomal abnormality is trisomy eight which confers a growth advantage to ES cells causing them to rapidly ‘overgrow’ wild-type ES cells. When ES cells carrying trisomy eleven were compared to ES cells with a normal karyotype (of the same strain), a similar growth advantage was seen. The CCE ES cells used for targeting were P ll although the translocation was also found in the earliest available freeze (P9) from which this particular stock had arisen.

Checking back through the records had shown that this stock had been established separately from another CCE stock that had been used in the laboratory on previous occasions for gene targeting. This other stock had given germ line transmission at high frequencies and could not have contained the abnormal chromosome. Both stocks had originated from cells sent originally by Liz Robertson, but then expanded in the lab prior to freezing aliquots.

91 Figure 6: Karyotyping and G-banding of CCE’s

Karyotyping (A) and G-banding analysis (B) on metaphase spreads prepared from

targeted CCE’s demonstrated that a translocation event had occurred between chromosomes 6 and 11.

92 A Karotype of abnormal CCE's

"'-I# " <; ■

%»

B G-Banding of CCE^s reveals a translocation event between chromosomes 6 and 11

U )> It f{ 2

. * ii ii H li II 6 7 8 9 10 f *«■ • i \ i : I "ii ft 11 12 13 14 15 f % • • u H i* S. 16 |7 18 19 X V Figure 7: FISH analysis on targeted CCE’s

Multiprobe FISH (with Cambio paints) on Metaphase spreads stained with DAPI from Sox9 targeted CCE’s (B & D). Each clone contains a giant chromosome arising from a translocation event between chromosome 6 and 11 as well as one other copy of chromosome 6 and two further copies of chromosome 11.

Chromosome 6 is painted with Cy3 and Chromosome 11 with FITC.

As a control, paints for the X and Y chromosome were used (D). The X

Chromosome is painted with FITC and the Y Chromosome with Cy3.

93 Chromosome 6 , Chromosome 11

%

Y Chromosome X Chromosome # #

•• . • 3.3.5 Targeting Sox9 - Part 2

Although the Sox9 locus had been correctly targeted, the abnormal karyotype of the CCE ES cells required us to re-target Sox9. The ABl ES cell line was chosen for this second round of gene targeting, as we were able to easily obtain them and they had proven germ line competence. Moreover; they had been used by Bi et al [126] to successfully target Sox9.

Following gene targeting with pSox9^°^^, 1000 G418 resistant colonies were picked and screened by Southem blot analysis with the external 3’ probe,

XB5.2 (See figure 8). 113 of these clones were shown to have undergone homologous recombination using the 3’ flanking probe.

3.3.6 Screen ing for both loxP sites

All 113 clones were digested with EcoRI and screened with the internal 5’ probe, IN5’, to assay for the presence of the second loxP site. The screening revealed some unexpected results; two bands of the expected sizes indicating the presence of both a wild type and a targeted allele were present except that the targeted band was much more intense than that of the wild-type (see figure

9).

94 Figure 8: Checking for 3’ homologous recombination

Following electroporation with pSox9^°^^ and selection with G418, DNA was extracted from surviving clones. The DNA was digested with BamHI, used in

Southem blot analysis, and hybridised with the 3’ external probe XB5.2.

Homologous recombination at one of the Sox9 alleles should introduce a new

BamHI site into the Sox9 locus generating a positive fragment of 8kb and a wild- type fragment of 12kb. B, BamHI.

A schematic representation of mutant and wild type BamHI fragments recognised by the probe XB5.2 (Yellow box) is shown.

To maximise gel space, lanes were staggered as illustrated below

95 Generation ofSox9 mutant AB-1 ES Cell Lines

12.0 kb

8.0 kb

12.0 kb

B Wild Type Allele

B lox P B Sox9 SA G F P pA - N eo -7^

8.0kb Figure 9: Checking for both loxP sites

Southem blot analysis of wild type and mutant ABl ES cell DNA (previously shown to have undergone 3’ homologous recombination) digested with EcoRI and hybridised with the 5’ internal probe, 1N5’ to confirm the presence of both loxP sites. E, EcoRI.

Representation of the restriction map of clones containing both loxP sites.

Incorporation of a loxP site in the first intron is assayed for by the introduction of a new EcoRI site. Clones containing two loxP sites will contain a 7.5kb wild-type band and a 3.2kb targeted band.

96 Generation ofSox9 mutant AB-1 ES Cell Lines

5‘ Internal Probe (INS’)

i i 7.5kb 3.2kb

7 .5 k b

Wild Type Allele 5 ’ p ro b e

Sox9 lo x P ]-H} S A G F P pA - N eo

3.2kb If had successfully mutated one of the Sox9 loci, then each ES cell clone should contain two bands of equal intensity, one mutated copy of Sox9, which is represented by a 3.2kb band, and one wild type copy, represented by a

7.5kb band. Three possible reasons for the intensity difference between the targeted and wild type band on the Southem blots were considered, each of which is discussed below.

3.3.7 Plasmid Contamination?

Since screening for both loxP sites was performed with an internal probe, contamination from pSox9^°^^ plasmid DNA was considered as the first possibility to explain the difference in intensity between the bright-targeted band and the weak wild-type band (See figure 9). To investigate this possibility, two enzymes: Dpn I and Dpn 7 /were used. Although both enzymes recognize the same 4 bp restriction sites, Dpn I is only able to cleave DNA when its recognition site has undergone prokaryotic méthylation (i.e. it is only able to cleave plasmid DNA). In contrast Dpn II is blocked by dam méthylation making it unable to cleave plasmid DNA but capable of cleaving genomic DNA.

Plasmid DNA encoding pSox9^^^^ and DNA extracted from targeted ABl ES cells was digested with Dpn I and screened by Southem blot analysis, using the intemal probe (IN5’). (As a control genomic and plasmid DNA was also digested with Dpn II). Since Dpn Us unable to cut genomic DNA, we expected to see a single high molecular weight band representative of undigested

97 genomic DNA, in lanes containing ABl ES cell DNA. In contrast, in lanes containing plasmid DNA, we expected to see numerous bands of low molecular weight. If the DNA extracted from ABl ES cells had accidentally become contaminated with pSox9^°^^ plasmid DNA, then low molecular weight bands would be seen in lanes containing this genomic DNA. However, this was not the case. This experiment showed conclusively that plasmid contamination was not the reason for the discrepancy of intensity between the targeted and wild type bands.

3.3.8 Extraction of Genomic DNA from ES cells or problems with the

hybridisation probe?

A second way to explain the intensity difference between the targeted and wild type band on the Southem blot was that the crude preparation of genomic DNA

(direct from the 96 well plates) was not clean enough to be cleaved by EcoRI

(Personal communication from V. Episkopou). DNA was therefore re-prepared using phenol extraction and ethanol precipitated. Subsequent Southem blot analysis showed the same intensity problems. To mle out the possibility that the probe itself was the problem, several altemative 5’ probes were generated and used to probe identical blots. All gave the same result.

3.3.9 Homologous Recombination and Random Integration

Finally, the possibility that both homologous recombination and random integration had occurred within the same cell was investigated. Homologous recombination leads to the loss of all sequences extemal to the region of homology, including the vector. However, it is likely that if the pSox9^°^^

98 construct had integrated randomly into the ES cell genome then the pBlueScriptll (pBS) plasmid vector, would still be present. To test for this,

Southern blots that had previously been used to assay for external 3 homologous recombination, were stripped of their probe and re-probed using pBS. Hybridisation revealed a single band of either 6.0kb or S.Okb in most lanes with both bands present in some lanes (see figure 10). This data implied that as well as homologous recombination; the pSox9^^^^construct had also integrated elsewhere into the ES cell genome. Nevertheless, it was puzzling to find such discrete bands. We hypothesised that this banding pattern could be explained if, instead of integrating all over the genome, multiple copies pSox9^°^^ had been integrated at a single random site in a tandem array. In this way, an S.Okb fragment would be generated if the pSox9^°^^ construct had integrated into the genome in a head to tail orientation and the 6.0kb band would be generated if multiple copies had integrated in a head to head orientation, with both bands present if pSox9^°^^ had integrated in both orientations. This theory is represented schematically in figure 11.

It is unusual for both random integration and homologous recombination to occur within the same clone. Co-transformation of a targeting construct and a separate, selectable marker construct gave only 4% of ES cells showing integration of both [209]. This implies that once an ES cell had undergone homologous recombination it is very unlikely to also undergo random integration and vice versa.

99 3.3.10 Fluorescent In Situ Hybridisation on Metaphase Spreads

Each of the clones tested had both correct targeting, as shown by the 3’ flanking probe, and random integration, as revealed by the presence of concatamers and plasmid DNA. These could represent separate integration events, or, conceivably, a single event involving homologous recombination at the 3’ end and random integration at the 5’ end. The latter might occur if the 5’ homology was not perfect and could have been exacerbated by the presence of non-homologous vector sequences present on the 5’ end of the linearised- targeting vector. The only way to distinguish between these two alternatives and to ascertain where in the genome pSox9^°^^ had integrated was to perform

Fluorescent In Situ Hybridisation (FISH) on metaphase spreads prepared from targeted clones. Therefore, FISH using the pSox9^^^^ targeting vector as a probe, was carried out on two randomly selected clones shown to have undergone correct 3’ homologous recombination and on wild-type ABl’s as a control. One hundred spreads from each of the two targeted clones, as well as

100 spreads from the control slide, were screened. On the majority of the targeted spreads two faint signals predicted to be representative of two endogenous copies of Sox9 were located distally on separate chromosomes.

Additionally, a much brighter signal located near the centromere of a 3rd chromosome was seen (See figure 12A). Since Sox9 has been mapped to the distal region of chromosome 11 (69.5cM) it was possible to confirm the two faint FISH signals were endogenous Sox9 using chromosome paint to identify

Chrll (see figure 12B). This allowed us to conclude that as well as

100 homologous recombination; multiple copies of pSox9^°^^ had integrated into the genome at a single additional site. This knowledge has made it possible for us to generate chimeras with the intention of segregating the chromosome containing multiple copies of the away from the correctly targeted mutation amongst the offspring. Prior to blastocyst injection, there was no way to identify which of the ES colonies showing 3’ homologous recombination had integrated both loxP sites, however statistically, one in three colonies should have incorporated both loxP sites. Several chimaeras were made, however, to date none have shown germ line transmission.

101 Figure 10: Random integration or homologous recombination?

After stripping the blots containing targeted ABl ES cell DNA digested with

BamHI, they were re-probed with the plasmid probe, pBS. Hybridisation revealed discrete bands of 6.0kb or S.Okb, with both bands seen in some clones.

102 Head - Tail (S.Okb)

Head - Head (S.Okb)

Combination (S.Okb and S.Okb)

= pBS probe

= (also represented in blue) Generation ofSox9 mutant AB-1 ES Cell Lines

3' Exi'

Vector Probe

E/B B B E B I I H>e S A G F P pA - N eo

7.0K b Figure 11: Tandem Array

Schematic representation of the restriction map of clones containing random multiple copy integration site(s) showing how, if multiple copies of had been integrated into the genome in a tandem array, bands of 6.0kb and S.Okb would be generated.

103 Figure 12: FISH analysis on A Bl’s targeted with

A) FISH on Metaphase spreads prepared from two randomly selected Sox9 targeted ABl clones using pSox9^°^^ as a probe (A).

B) Multiprobe FISH for Chromosome 11 using Cambio paints, demonstrates that the multiple copy integration site is distinct from endogenous Sox9 loci on chromosome eleven (B). Chromosome 11 is painted with FITC.

As a control Chromosome 2 was painted with Cy3.

104

3.3.11 Targeting Sox9 - Part Three

Whilst carrying out the above analysis on the targeted ABl ES cells, two

further attempts were made to re-target the Sox9 locus. Although we have been

unable to discover why homologous recombination and random integration

was observed during the last targeting with the ABl cells and not with the first

experiment using CCE cells, we considered the possibility that the presence of

the non-homologous plasmid sequence located at the 5’ end of the pSox9^°^^

targeting construct may have increased the likelihood of random integration.

Therefore, to try and prevent multiple copies of pSox9^^^^ from integrating into

genome, and to increase the targeting efficiency, [210] pSox9^°^^ was

completely isolated from its vector sequences (pBS) using an Xhol/Notl

digest. Following targeting, 300 neomycin resistant colonies were picked and

screened via Southern blot analysis using the 3’ external probe XB5.2.

Unfortunately, none of the clones had undergone homologous recombination.

During the targeting, it was noted that following electroporation, the ES cells had begun to differentiate making them unsuitable for blastocyst injection. To confirm that it was not the presence of the pSox9^°^^ targeting construct causing the ABl ES cells to differentiate, they were electroporated with a control vector containing just the PGK-Neo cassette, but the same level of differentiation occurred. CCE ES cells were also tested but also showed rapid differentiation directly after electroporation. Others in the laboratory then experienced similar problems, which were not evident with normal growth and maintenance of ES cell cultures, but only in conditions where colonies were

105 being obtained. After testing the various components of the tissue culture medium, feeder cells etc, it was found that the stocks of fetal calf serum had become degraded. Prior to re-targeting, batch testing had to be performed in order to find a suitable alternative consignment of ESQ.

33,12 Targeting Sox9 - Part Four

This final targeting was performed using both A B l’s and CCE’s. pSox9^°^^ was again isolated from its plasmid vector. 1,300 clones were picked and screened using Southern blot analysis with the 3’ external probe XB5.2. None of these colonies showed external 3’ homologous recombination.

3.3,13 The unobtainable goal

Even though every effort was made to successfully target the Sox9 locus, a range of technical problems prevented me from obtaining germ line transmission. Four separate attempts were made to correctly target the Sox9 loci and some 3,300 colonies were screened by Southern Blot analysis.

Although the first round of targeting into CCE’s proved successful, germ line transmission was not possible due to an abnormal karyotype. In the second round of gene targeting, individual clones were demonstrated to have concurrently undergone both homologous and random integration. To circumvent this problem, before re-targeting, we isolated pSox9^°^^ from its plasmid. The third attempt may have failed because of sub-optimal culture conditions. However, the fourth targeting attempt also failed to yield any homologous recombinants. As yet we have no explanation for this.

106 4 CHAPTER 4 - GENERATING TRANSGENIC MICE TO DRIVE EXPRESSION OF CRE-RECOMBINASE WITHIN THE GENITAL RIDGE

4.1 INTRODUCTION

4.1.1 Cre mediated recombination

The targeting construct pSox9^°^^ was designed to achieve deletion of Sox9

following expression of Cre recombinase, providing a way to not only

circumvent the early lethality associated with the Sox9 deficiency, but also to

address the function of the gene in specific tissues and cell types. Tissue

specific recombination in vivo requires transgenic mice harboring the Sox9^°^^

allele to be crossed with a transgenic mouse line that expresses Cre in a tissue

specific manner. Progeny produced from this mating will have inactivated

Sox9 only in the tissue(s) that express Cre (Represented in figure 13).

Because of the male to female sex reversal associated with haploinsufficiency

mutations of S0X9 in humans, gene dosage is thought to play a critical role in

the early steps of gonadal development. Surprisingly though, male to female

sex reversal was not seen in Sox9 heterozygous mice [126]. This may reflect a

higher threshold for S0X9 during male sex determination in humans than mice

[119]. A similar difference in gene dosage sensitivity between humans and

mice can be seen in the case of Daxl. In humans a duplication of Daxl causes

male to female sex reversal however, XY mice expressing a Daxl transgene at

1 0 times normal levels showed only slight adverse effects on testicular

development [121]. This data indicates that sex determination in humans is

107 more sensitive to fluctuations in the levels of key sex determining genes than the mouse. We therefore considered it necessary to devise a means of obtaining both heterozygote and homozygote Sox9 tissue specific mutations.

4.1.2 Inactivating Sox9 Specifically within the Genital Ridge

To analyse the role of Sox9 during sex determination, genes that are expressed in the gonad at the right time and in the same cell lineage as Sox9 were considered as potential candidates to drive expression of Cre-recombinase.

4.1.3 D axl

Daxl is expressed in the somatic cells of the genital ridge in both sexes from lO.Sdpc increasing to a high level by ll.Sdpc. At 12.5dpc it is down-regulated in the male but maintained in the ovary ([166]+ Intro). To define the regulatory elements of the Daxl gene, Swain et al [121] inserted fragments of the mouse Daxl genomic DNA upstream of the lacZ gene and used it to generate transgenic mice. An 11-kb genomic fragment upstream of the Daxl start of transcription (in a construct named Dax-lacZ) consistently showed lacZ expression in the developing gonad identical to that of endogenous Daxl.

Importantly, lacZ expression was absent from other sites of endogenous Daxl expression such as the developing adrenal gland, hypothalamus and pituitary.

This 11 kb genomic fragment was therefore described as a genital ridge/gonad specific regulatory region of Dax 1 [121] and was considered the most suitable promoter to drive Cre expression in the genital ridge.

108 Figure 13: Inactivating Sox9 specifically within the developing

genital ridge

To spatially control the inactivation of Sox9, a mouse carrying the allele needs to be crossed with a mouse transgenic for a tissue-specifically expressed

Cre (left). This results in offspring carrying a Cre-mediated deletion of the gene in the corresponding tissue. To temporally control the timing of Cre-mediated recombination in a more widely expressed gene, a mouse carrying the Sox9^°^^ allele could be crossed with a transgenic mouse expressing an inducible form of recombinase (right). In order to try and restrict expression of Cre recombinase to the somatic cells of the genital ridge, the regulatory regions of DaxYand Sry were chosen.

109 Cre — Inducible Cre- Inducible Cre

Tissue specific- Tissue specific^, promoter promoter

Cre Cre

-K—

Specially restricted knock-out O Inducer

loxP site I Exon —^ V c t^ (C r ^ Active recombinase O Inducer © — 1 I Cre I Inactive recombinase

Temporally controlled knock-out Additionally, when this 11 kb genital-ridge specific region of the 'Daxl promoter was used to misexpress Sry in transgenic mice, female to male sex

reversal was seen in 75% of the XX live bom animals [121].

4,L4 Sry

Sry is expressed in the somatic cells of the XY genital ridge between lO.Sdpc -

12.5dpc. However, RT-PCR (Reverse Transcriptase Polymerase Chain

Reaction) has detected low levels of Sry transcripts in the pre-implantation embryo as early as the two cell stage [211]. Expression of Cre-recombinase at this early stage in development would inactivate Sox9 and re-capitulate the straight Sox9 knockout phenotype. Despite this risk, it was decided to generate a mouse line using the Sry regulatory region to drive Cre. In the event that early Sry expression did prove to be a problem then it could be overcome by using an inducible form of the transgene. A 14kb Sry genomic fragment is known to give XX male sex reversal in 60-75% of transgenic mice. This same regulatory region was also shown to give robust expression in the genital ridges of the human Alkaline Phosphatase (AAP) reporter gene in transgenic mice. Interestingly, AP activity was also seen in a small region of the brain

(Bar, Swain & RLE unpublished data).

The Daxl and Sry regulatory elements were considered the best candidates to drive expression of Cre recombinase within the somatic cells of the genital ridge during sex determination. Transgenic mice were therefore generated. To check Cre expression within these transgenic lines, we made use of the R26R

110 mouse line [172]. This mouse line is designed to continually express p-

galactosidase in tissues and cell types where Cre has been expressed (see

materials and methods).

As an alternative and complementary approach to these strategies, we also

decided to generate transgenic mice harboring an inducible form of Cre

recombinase.

4.1.5 Inducible Systems

There are two main ways to generate transgenic mouse lines where Cre

expression can be temporally and/or spatially controlled. The first is to infect

animals that are homozygous for a fioxed gene with a virus expressing Cre.

One way to do this is to generate lentiviral vectors, which would enable Cre to

be delivered to cells both in vitro and in vivo. Lentiviruses are enveloped RNA

viruses that belong to a family of complex retroviruses. In contrast to other

retroviral vector based viruses such as the Moloney murine leukemia virus, that

can only transduce dividing cells, lentiviruses are able to transduce both

dividing and non-dividing cells with high efficiency and are able to induce Cre-

mediated recombination of loxP sites. Pfeifer et al [212] have generated

lentiviral vectors carrying Cre recombinase which can mediate efficient loxP

specific recombination in a variety of target cells including neurons, hepatocytes and hematopoietic progenitors.

The second approach is to use a mouse line expressing a Cre transgene in an

inducible manner [213-215]. In 1996, Feil et al [216] fused Cre to the ligand binding domain (LED) of the (ER). To achieve tight control

111 over the function of the Cre-ER fusion protein, they introduced a mutation into the human estrogen receptor LED that allows it to bind to synthetic ligands tamoxifen (Tam) and 4-hydroxtamoxifen (4-OHT) but prevents it from binding to its natural ligand 17|3-estradiol (ERT).

The fusion protein strategy relies on inactivation of the recombinase by binding of the heat shock protein 90 (HSP90) - containing complex to the LED. In the absence of ligands 4-OHT or Tam, HSP90 prevents the Cre-ER fusion protein from entering the nucleus and thereby masking the enzymatic activity. Einding of the ligand releases the fusion protein from the complex and Cre activity is restored. A current limitation of this inducible-gene-targeting system is that

Cre-mediated recombination does not usually reach 100% efficiency, resulting in mosaic expression of the target gene [217].

Recently, Indra et al [218] have characterised a new ligand dependent recombinase, Cre-ER^^, that was mutated to increase its sensitivity to Tam and

4-OHT some ten-fold. To permit the conditional deletion of Sox9 in the developing gonads, transgenic mouse lines have been generated using the same

11 kb genital ridge specific region of the Daxl regulatory sequence to drive the expression of CreER^^.

112 4.2 MATERIALS AND METHODS

4.2.1 The Cloning o f Dax-Cre

(Amanda Albazerchi generated this construct).

The Dax I promoter [121] was digested with Sal I and Xho /, blunt ended and

desphorylated before being gel purified. Cre recombinase was isolated from

pOG231 (a gift from S O'Gorman, Salk Institute) following digestion with

Sma I and Sal I and blunt ended before being cloned downstream of the 11 kb

gonad specific region of the Dax 1 promoter [121]. The 13kb DNA fragment

was separated from its plasmid backbone using a Not I and Apa I digest prior to

pro-nuclear injection.

4.2.2 The Cloning o f Sry-Cre

(Graeme Penny generated this construct).

Briefly, p741 a plasmid subclone of L741 [63] encompassing a 14kb genomic

fragment of the mouse Sry gene, was digested with EcoRV to remove its

coding region. Cre recombinase was isolated from pOG231 (as above) and

blunt ended before being inserted into pL741 at its EcoRV site. Prior to pro-

nuclear injection, Sry-Cre was purified from its plasmid using a Sal I digest

4.2.3 The Cloning of inducible Dax-Cre (Dax-CreER^^)

The Dax-CreER^^ transgene was generated using a three-way ligation. Firstly

the Daxl promoter [121] was digested with Cla I and Sal I, before being

dephosphorylated and gel purified. The lack of suitable restriction sites

required pCreER^^ [219] to be digested with Sal I and Cla / releasing both the

Cre and ER^^ fragments. These two fragments were isolated and cloned into

113 the Dax 1 promoter vector. The 13.8kb DNA fragment was purified from its plasmid prior to pro-nuclear injection using a Sal I/Not I digest.

4.2.4 Preparation of DNA for microinjection

Following digestion with the appropriate restriction enzymes, linear DNA fragments were separated from their plasmid by gel electrophoresis. DNA was purified by electroelution and ethanol precipitated, before being resuspended in injection buffer (lOmM Tris-Cl (pH 7.6), O.lmM EDTA). The concentration was determined by running an aliquot of the solution on an agarose gel and then adjusted to between 5-lOng/pl.

4.2.5 Superovulated m ice

Naturally ovulating females will typically produce 8-15 eggs depending on the strain. To reduce the number of females needed for pro-nuclear injection, the mice were superovulated with pregnant mares’ serum gonadotrophin and human chorionic gonadotrophin [220]. This increases the number of eggs produced to 20-30 per animal. Following superovulation, the females were placed with an appropriate stud male. Copulation plugs were checked the following morning before the females were removed and their eggs collected by dissecting out the oviduct. The oviducts were dissected out into M2* medium. Forceps were used to rip open the oviduct and release the eggs.

Culmulus cells were removed from the zygotes by the addition of hyaluronidase to a final concentration of 300mg/ml to the M2. Once freed from the cumulus cells, the eggs were rinsed six times in M2 and twice in M l 6 * before being transferred to small drops of M l 6 (covered with mineral oil to

114 prevent evaporation) and placed at 37°C in a 5% CO 2 incubator, until ready for injection. The eggs were then placed in a drop of M2 in a glass slide under oil.

(*For the composition of M2 and Ml 6 please see appendix).

4.2.6 Pro-nuclear Injection

To generate stable lines, DNA was injected at a concentration of 5ng/pl into the pronuclei (usually the male) of (C57BL/6 x CBA) FI fertilised eggs. To generate transient lines, DNA was injected at Sng/pl in (C57BL/6 x CBA) FI

R26R oocytes, following the protocol essentially as described by Hogan et al

[221].

4.2.7 Pseudopregnant recipients

Pseudopregnant female mice, between 6 and 8 weeks old, were obtained by mating females with vasectomised males. Vasectomised males are available from the SPF facility at NIMR, and therefore pseudopregnant females were ordered as required. Day of plug (0.5dpc) females were anaesthetized by intraperitonal injection of 300pl of Avertin (l.Og 2.2.2-tribromoethanol dissolved in 0.5g tertiary amyl alcohol. To make a working solution, 1.2ml of this stock solution was dissolved in 100ml of boiling PBS and aliquots stored at -20°C). Microinjected embryos were then transferred through the infundibulum into the oviduct, using a glass capillary pulled and cut to the appropriate diameter and angle. Approximately 15 embryos, in a small volume of M2, were transferred into each oviduct.

115 4.2.8 ROSA26 Reporter mice (R26R)

R26R transgenic mice have an inactive lacZ gene inserted into the ROSA26 locus via homologous recombination. LacZ expression is triggered only in cells expressing Cre-recombinase since a fioxed strong transcriptional termination sequence (TTS) prevents it expression. Expression of Cre causes excision of the TTS leading to lacZ expression [172]. Since lacZ will also be expressed in all the descendents of these cells, it provides a means to monitor Cre expression and to analyze cell lineages during development. Two further

ROSA26 Cre reporter transgenic mouse lines have been generated by inserting

EYFP (Enhanced Yellow Fluorescent Protein) or ECFP (Enhanced Cyan

Fluorescent Protein) into the ROSA26 locus, preceded by a loxP-flanked stop sequence [222]. Unlike the R26R mice, these mouse lines provide a way to monitor the consequences of Cre expression in living tissue.

4.2.9 Preparation and administration of 4-hydroxy-tamoxifen (4-

OHT) and tamoxifen (Tam)

Since 4-OHT is difficult to dissolve in sunflower oil, ethanol was added to lOmg of 4-OHT (Sigma) to obtain a lOmg/lOOpl 4-OHT suspension. A lOmg/ml 4-OHT solution was then prepared by addition of sunflower oil

(Sigma) sonicated and stored at 4 °C for up to 1 month or long term at -20° C.

A single i.p. injection of lOOpl of lOmg/ml 4-OHT was performed on pregnant mice when the embryos at lO.Sdpc. Embryos were harvested and analyzed between 12.5-16dpc. A single injection of Tamoxifen (Tam), at the same

116 concentration as 4-OHT, has been shown to induce Cre activity as efficiently

[217] and was used as an alternative to 4-OHT in later experiments. Stocks of lOmg/ml Tam were made in exactly the same way.

4.2.10 PCR Analysis of transgenic mice

Yolk sac tissue was retained for PCR genotyping following dissection of embryos. If stable lines were generated, then tail biopsies from 3-week-old mice were taken. The tissue was placed in lOOpl of tail lysis buffer (lOmM

NaCl, lOmM Tris (pH 7.5), ImM EDTA, 1% SDS, lOmg/ml proteinase K) and incubated overnight at 55°C. Following phenol/chloroform extraction, samples were spun at 13,000rpm for 5 minutes. 0.4pl of DNA was added to 19.6pl of

PCR mix (2pl lOX Buffer (No MgCh), 1.2pl MgCl] (25mM), l.Opl (lOOng) of each of the relevant primers (listed at the end of this section), 0.16pl dNTP’s

(25mM), 0.1 pi RE Taq, (Thermoprime Plus DNA Polymerase 5U/pl) 4pl

Betaine (5M) and 11.14pl dH 2 0 ). The samples were denatured for 3min at

94°C, followed by forty cycles of dénaturation at 94°C (30 sec), annealing at

50°C (30 sec) and primer extension at 72°C (40 sec). A final extension cycle was performed at 72°C (2 min). The resulting PCR products were loaded onto a TAE-buffered 2% agarose gel for electrophoresis (30min at 80 volts). Primers

0DB42 and 0DB43 were used to assay the presence of the Cre transgene. To distinguish heterozygote R26R mice from homozogyotes, primers Rl, R2 were used to identify the targeted ROSA26 locus whilst primers Rl and R3 amplified the wild-type ROSA26 locus. Typically, all three primers were used together.

117 0DB42 GGCGGATCCGAAAAGAAAA-^’

0DB43 ^’-CAGGGCGCGAGTTGATAGC- ’

Rl ^’-AAAGTCGCTCTGAGTTGTTAT-^’

5 ’ R2 -GCGAAGAGTTTGTCCTCAACC-

R3 ^ ’-GGAGCGGGAGAAATGGATATG-^ ’

4.2.11 X-gal Staining of embryos

Embryos were dissected in PBS and fixed in ice cold 4% paraformaldehyde

(PFA) in PBS for 30 minutes. After 3x20min washes in PBS containing 0.02%

NP-40, embryos were placed in staining solution, consisting of: 1 mg/ml X-gal

(Promega), 2mM MgCl], 4mM KferroCN, 4mM KferriCN in PBS. The embryos were incubated in the dark overnight at 37°C before being washed three times the following morning in PBS containing 0.02% NP-40 and being post fixed in 4% PFA.

118 4.3 RESULTS

4,3,1 Dax-Cre mouse lines

To test Cre activity in the Dax-Cre transgenic lines, we made use the R26R

mouse line [172]. Cre mediated lacZ expression allows us to monitor the

efficiency and specificity of the Cre transgene and can be used as a lineage

tracer for the specific cell types in which Cre is expressed. Transient

experiments were performed by injecting Dax-Cre directly into the pronucleus

of oocytes from the R26R female mice (see materials and methods). Embryos

were harvested between 12.5 and 13.5dpc and stained for lacZ. Surprisingly,

the transgenic Dax-Cre/KICR. embryos were stained for lacZ in all tissues

suggesting that Cre recombinase from the Dax-Cre transgene was expressed

early in development. This would cause Cre-mediated recombination in most

cells and lead to widespread expression of p-galactosidase. This hypothesis is

supported by Yu et al [167] (and are our own unpublished data), who found it

impossible to generate undifferentiated Daxl null ES cells using standard

means, suggesting an essential requirement for Daxl in ES cells. Since ES

cells are isolated from the ICM of 3.5dpc embryos, we speculated that Daxl

may be expressed in the pre-implantation embryo. To test the activity of the

Daxl promoter used in the generation of the Cre line, we analysed a mouse

transgenic line generated by Amanda Swain when she was in the laboratory,

expressing p-galactosidase under the control of the same llkb Daxl promoter

[121]. Daxl- lacZ homozgygote stud males were mated with superovulated FI

females. Embryos were harvested at the single cell stage and cultured. This

119 enabled lacZ staining to be performed on embryos ranging from the 2-cell stage to the blastocyst stage. Daxl- lacZ expression was seen beginning in the late morula; strong lacZ expression was seen in the blastocyst (See figure 9).

Expression of Daxl in the pre-implantation embryo meant that a Dax-Cre mouse line would not suitable to use in conjunction with a Sox9 conditional mouse.

4.3.2 Sry-Cre Mouse lines

To generate stable mouse lines, the Sry-Cre transgene was injected into

(C57BL/6 X CBA) FI oocytes. From a total of 23 animals, PCR analysis showed that three of these were transgenic, (all of which were females). These were designated mSry-CreA, mSry-CreB and mSry-CreC respectively. To establish whether Cre was expressed within the Sry expression domain, all three transgenic females were test mated with homozygote R26R stud males.

As soon as the females littered, the neonates were culled and organs taken and stained for lacZ expression. PCR analysis was performed concurrently to check for the presence of the Cre transgene. None of the transgenic pups taken from lines Sry-CreA (n=16) and Sry-CreC (n=5) showed any lacZ staining implying that although the transgene was transmitted it was not expressed. A single male neonate (from two litters of n=4) from Sry-CreB showed patchy lacZ expression in the heart, kidney lungs and gonads (See figure 17).

120 Figure 14: Schematic representation of constructs: Dax-Cre, Srv-

Cre and DIC.

A) Dax~Cre: The 11 kb genital ridge specific regulatory region of the Dax 1

promoter (shown in red) [163] was linearised using a Sal HXho I digest. Cre-

recombinase (shown in yellow), was isolated from pOG231, and cloned

downstream of the Dax 1 promoter. A Not I/Apa I digest was used to remove

the plasmid sequence from this transgene prior to pro-nuclear injection.

B) DIC: The DIC transgene was created using a three-way ligation. The Dax 1

promoter (shown in red) was digested with Cla I and Sal I. Cre-ER^^ was

digested with Sal I and Cla I to release both the Cre and fragments

(shown in blue). Cre and ER^^ respectively were then cloned behind the Dax

1 promoter. A Sal I/Not I digest was used to remove the plasmid sequence

from this transgene prior to pro-nuclear injection.

C) Sry-Cre: p741, encompassing a 14kb genomic fragment of mouse Sry gene,

(shown in red) was digested with EcoRV, to remove its coding region. Cre

recombinase (shown in yellow) was isolated from pOG231 and cloned into

the EcoRV site. A Sal I digest was used to remove the plasmid sequence from

this transgene prior to pro-nuclear injection.

121 Schematic representation of ConstructsDAX-Cre, Sry-Cre and DIC

11 .OkbDAX Regulatory Region A DIC-Cre CRE PA

11 .OkbDAX Regulatory Region B DIC CRE ERT2 PA

Sry Regulatory Region (8246) (8714) (0) (1 4 6 2 5 ) C Sry-Cre CRE ^H(CAG)n PA I

Initiation of transcription

Key:

□ PolyAdenylation site Remaining Sry coding sequence

□ Glutamine repeats a CRE Recombinase CRE ERT2 Figure 15: Expression of Dax-lacZ in the pre-implantation

embryo

Pre-implantation embryos from mice transgenic for Dax-lacZ demonstrate that

Dax-lacZ is expressed in the Morula and Blastocyst.

A) LacZ stained Morula from control wild type mouse

B) LacZ stained Morula from Dax-lacZ transgenic mouse

C) LacZ stained Blastocyst from control wild type mouse

D) LacZ stained Blastocyst from Dax-lacZ transgenic mouse

122 DaxV.LacZ is expressed in pre-implantation embryos To determine if lacZ expression was confined to a particular cell lineage, these organs were sectioned. Strong lacZ staining was seen in the testis but histological examination showed that this was not confined to a specific cell lineage (See figure 16). It had been hoped that by placing Cre under the control of the Sry promoter, expression within the testis would be limited to the Sry expression domain with lacZ staining localized to the testis cords. Instead, lacZ expression appeared to be expressed in the interstitial space.

In addition to generating stable mouse lines, transient experiments were performed by injecting the Sry-Cre transgene directly into fertilized homozygote R26R oocytes. Embryos were harvested between 13.5dpc and

14.5dpc and stained for lacZ. From a total of 23 embryos harvested, PCR analysis showed that 3 animals were transgenic. One embryo AA 6 , showed strong lacZ expression over the forehead, the front of the face and down the spine (figure 17). Histological examination revealed no expression internally

(data not shown). Embryo KM5 showed ubiquitous lacZ expression making it likely that Cre expression occurred in the pre-implantation embryo (figure 17).

The third embryo KM 12, showed no lacZ expression (data not shown).

In total, 46 embryos were examined from both transient and stable lines; 6 animals were transgenic but only three expressed the transgene. In mouse, endogenous Sry is expressed for a limited period between lO.Sdpc and 12.0dpc in XY genital ridges and is confined to the somatic cells [ 6 6 ]. Sry expression has also been claimed to occur in pre-implantation embryos [ 2 1 1 ].

Unfortunately, since none of the Sry-Cre transgenic embryos showed the same

123 lacZ expression pattern, it made it impossible to assess the suitability of this transgene for use in conjunction with a Sox9 conditional mouse line. Embryo

KM5, which ubiquitously expressed lacZ, implied that Sry was expressed in the pre-implantation embryo. Alternatively, lacZ expression over the front of the forehead and face, as seen in embryo AA 6 suggested that Sry is expressed in the skin. The patchy lacZ expression seen in the heart, liver, lung and gonad of the mouse line Sry-CreB suggested that Sry is expressed within many different tissues and organs.

124 Figure 16: Cre induced lacZ expression within mouse line Sry-

CreB

Neonates were culled between PI and P3 and genotyped using tail DNA for PCR analysis. A single transgenic mouse from the Sry-CreB mouse line, showed lacZ staining indicative of Cre excision, within the gonads, kidneys, heart and lungs.

Histological examination revealed that in the gonad, lacZ expression was largely confined to the interstitial cells.

s = testis tubule; i = interstitial cell; p = proximal convoluted tubule; g = glomerula; c = cardiac Muscle; b = bronchial; a = alveoli

1cm = 83 pM

125 Gonad A#

ilm v Kidney

Heart

Lung #.-L Figure 17: Transient Sry-Cre transgenic mice

Transient experiments were performed by injecting the Sry-Cre transgene directly into R26R oocytes. Embryos were harvested as 12.5dpc.

A) Mouse AA6 showed lacZ staining across the forehead, front of face, and down the spinal cord. Further examination revealed no lacZ staining in any internal organs including the gonads.

B) Mouse KM5 was completely stained for lacZ. All internal organs were also

stained.

126

For any conclusions to be made, it is important to establish more Sry-Cre

mouse lines that consistently express Cre within the same domain. It is likely

that the unexpected expression patterns seen in the mice carrying the Sry-Cre

transgene are due to positional affects. These can often occur when a transgene

is introduced to a new chromosomal location. For instance, if the transgene

integrates in the proximity of an endogenous enhancer or silencer, then

expression of the transgene can be increased or inhibited respectively. It is also

possible for transgenes to become ‘high jacked’ by the regulatory elements of

other genes causing them to be expressed within an entirely different domain.

Similarly, if the transgene inserts near a region of condensed, inactive

chromatin then it will also often be silenced. Alternatively, a second

explanation for the problem we experienced might be due to the Cre gene

itself. Previous experiments conducted within our laboratory, using transgenic

mice carrying the lacZ reporter gene under control of the same 14kb flanking

sequences, failed to obtain lacZ expression within the Sry domain [163]. It was postulated that the presence of lacZ might have altered the regulation of Sry

thus destabilizing the transcript by disturbing the spatial arrangement required

for the interaction of different regulatory elements; this might be especially the

case if an interaction between the two sides of the inverted repeat is required

for correct expression. Additionally, the Sry 3’ UTR is known to include a region with four ATTTA sequences that are often associated with message

instability [23]. Finally, it is pertinent to consider that the Cre sequence is

127 prokaryotic. Previous experiments conducted by Artelt et al [223] have

indicated that prokaryotic sequences may not be totally compatible with

eukaryotic gene expression. LacZ and neo, which are both prokaryotic genes,

have been proposed to act as weak transcriptional silencers. It is possible that

the combination of the weak Sry promoter coupled with the incompatibility of

prokaryotic Cre sequence prevents expression of the Sry-Cre transgene. Other

Sry transgenes generated in the laboratory using a epitope or driving /zAP

have successfully recapitulated the Sry expression pattern (I Barr and R Sekido

unpublished data).

4,3.3 Dax-Inducible Cre (DIC)

To overcome the problem of early Daxl expression, Cre was fused with a mutated form of the ligand-binding domain (LED) of the human estrogen receptor (ER), resulting in a tamoxifen-dependent Cre recombinase (Cre-

ER^^), and placed under the control of the Daxl promoter. To generate stable mouse lines, the Dax-Inducible-Cre {DIG) transgene was injected into the pro­ nucleus of (C57BL/6 X CBA) FI oocytes, a total of 27 animals were bom. PCR analysis showed that two male mice, named mDICA and mDICB, respectively were transgenic. To establish the expression pattern of Cre in these mice, they were mated with homozygote R26R mice. To induce Cre expression, pregnant females from this intercross were given a single i.p injection of l.Omg 4-OHT at lO.Sdpc. By this time, the chorio-allontoic placental connection has been established, which is thought to increase the availability of ligand to the embryo [217]. Additionally, since Daxl expression begins in the genital ridge

128 at 10.5dpc and peaks at ll.Sdpc, it was anticipated that a single i.p injection of

4-OHT at lO.Sdpc of gestation would induce rapid Cre expression within 12hrs

[217]. Embryos were harvested between 13.5 and 16.5dpc. At IS.Spdc

although the testes are easily distinguishable, the ovaries remain

undifferentiated. However, By 16.5dpc the follicle cells of the ovary can be

identified ([224] and references therein). At 13.5dpc, embryos were opened

and the gut removed to ensure that the internal organs would be exposed to the

X-gal staining solution. However at 16.5dpc, the embryos were considered too

large for efficient lacZ staining of the internal organs, therefore we opted to

dissect the gonads away from the embryo prior to lacZ staining. From 7

injected DICA mice, 76 embryos were recovered, 27 of which were transgenic.

From 8 injected DICE mice, 75 embryos were harvested, 34 of which were transgenic (see table lA). The vast majority of transgenic animals showed no lacZ expression and were indistinguishable from their wild-type littermates.

Some embryos (n=9) showed faint staining, which was restricted to the anterior part of the mesonephros with some expression extending into the gonad (See

17). Expression data from Swain, et al [121] obtained from using the same

11 kb Daxl promoter to drive expression of lacZ has already demonstrated that

Dax-lacZ, is expressed in somatic cells of the indifferent genital ridge that are destined to become Sertoli cells. Despite using the same llkb regulatory region of the Daxl promoter, none of the transgenic DIC mice harvested showed lacZ expression within developing Sertoli cells.

129 Figure 18: DIC transgenic mice

Males from both DIC lines were crossed with R26R females and given an i.p injection of Img of tamoxifen at lO.Sdpc to induce Cre expression.

A) Embryos were dissected out at 12.5dpc and genotyped using the yolk sac for

PCR analysis.

B) This embryo was taken from an untreated mother. Without tamoxifen treatment no lacZ staining is seen.

C&D) Embryos stained for lacZ expression, weak staining can be seen in the genital ridge, no other internal organs were stained.

hi = hind limb; f t = forelimb; g = gonad

No discernible difference was seen between the two DIC mouse lines

130 B

400bp TABLE lA: DICA and DICB embryos injected with 4-OHT

Transgenic Mice injected Total Total

line intraperitoneally Embryos Transgenic

with 4-OHT @ recovered Embryos

lO.Sdpc

DICA 7 76 27

DICE 8 75 34

In addition to generating stable mouse lines, transient experiments were performed by injecting the DIC transgene directly into fertilized homozygote

R26R oocytes. The embryo-recipient females were injected with lOOpl of 4-

OHT (lOmg/ml) at lO.Sdpc of gestation. Embryos were harvested between

IS.Sdpc and 14.5dpc and stained for lacZ. From a total of 11 embryos harvested, PCR analysis showed that only a single mouse was transgenic, but no lacZ staining was seen. There are many reasons why the DIC mice failed to show lacZ expression within the gonad. It is possible that a single injection of

4-OHT was not able to induce translocation of DIC from the cytoplasm to the nucleus. This appears unlikely since Danielian et al [217] have successfully induced Cre-mediated recombination in transgenic mice that express Cre within the Wntl expression domain of the embryonic nervous system.

Moreover, Danielian et al [217] used Cre-ER™, which is reported to be

131 approximately 10 times less sensitive to tamoxifen treatment than Cre-ER^^

[218, 219]. However, it is important to recognize that different systems may be differently sensitive to 4-OHT treatments. To date, Cre-ER^^ has been used successfully to inactivate the mouse retinoid X-receptor-a in mouse adipocytes

[225] and in the epidermis [218]. However, in both cases, Cre mediated recombination was not required until after birth allowing several i.p injections of 4-OHT to be performed over a five-day period. Unfortunately, due to the anti-estrogenic properties of tamoxifen, it was not possible to perform consecutive injections on DIC embryos. Cre-ER^^ has been activated by 4-

OHT in utero by Vallier et al, [226] who used a bistronic gene trap expression vector designed to co-express Cre-ER^^ and lacZ when stably integrated into

ES cells under the control of an endogenous promoter (GTET-ES cells).

GTEV-ES cells express lacZ, which serves as an indicator of where Cre is being expressed. Although Cre is expressed and translated, it is only active after induction with 4-OHT. To determine whether GTEV-E^ cell lines were able to regulate the expression of a transgene in response to 4-OHT, two

GTEV-ES cell clones were electroporated with an inducible gene trap vector

(pIGTE-/zAP). />IGTE-/îAP was designed to contain a floxed hygro^EGEP fusion gene and the AAP gene. After integration downstream of an active promoter, GTEV-ES cells continually express EYE? and are resistant to hygromycin B. Cre-mediated recombination, via 4-OHT treatments, led to expression of AAP but removed the hydro'^-EYEP ftision gene.

132 To determine if hAP expression could be activated in utero, GTEVUGTE-E^ cells were injected into blastocysts, and an i.p injection of Img 4-OHT was administered to the foster mothers on the seventh day of gestation. Chimeric embryos, identified at lOdpc by lacZ staining, showed strong /zAP expression in virtually all tissues. These experiments are able to confirm that under the right conditions a single i.p injection of Img 4-OHT is able to induce Cre-ER^^ recombinase within developing embryos.

To check that there is not a problem with the DIC construct and to confirm that under the correct conditions, 4-OHT is able to cause Cre activity within the

Daxl expression domain, Daxl expression in the pre-implantation embryo could be exploited. In theory, if DIC x R26R mouse lines were generated, then embryos could be harvested at the single cell stage, and cultured in media containing 4-OHT. The increased levels of 4-OHT should enable DIC to be translocated from cytoplasm to the nucleus where Cre mediated recombination within the blastocyst would lead to ubiquitous lacZ expression. Two groups

[180, 226] have shown that ES cells can be cultured at concentrations of up to

IpM 4-OHT for up to 48hrs although this has been shown to affect the proliferation rate.

4.3.4 Cre activity in the somatic cells of the genital ridge in Sox9^^^^

mice

Once the Sox9^°^^ locus is transmitted through the germ line, we had intended to cross heterozygous and homozygous Sox9^°^^ mice with mice that are

133 homozygous for either the DIC or Sry-Cre transgene. In these mouse lines, Cre

activity should be restricted to the somatic cells of the genital ridge. By

limiting Cre-mediated recombination to this cell lineage, the problem of

embryonic lethality associated with the non-conditional inactivation of Sox9

should be overcome [127]. Data from Bi et al [126] suggests that XY mice

carrying only a single active copy of Sox9 within the somatic cells of the

genital ridge should develop fully functional testes. To test the requirement for

Sox9 in Sertoli cell differentiation, homozygous Sox9^°^^ mice will be crossed

with mice that are homozygous for DIC or Sry-Cre mice. Based upon our

working hypothesis, (see figure C) we would anticipate that by removing Sox9

from the somatic cells of the genital ridge, Sertoli cell precursors would instead

differentiate into follicle cells resulting in male to female sex reversal. We

would not expect to see any phenotype in XX Sox9^°^^ heterozygous or

homozygous mice since Sox9 is not thought to play a role in ovarian formation

(See Appendix for a complete breeding programme).

4,3,5 Do follicle cells and Sertoli cells share a common cell precursor?

In addition to providing Cre mouse lines for use in conjunction with the

Sox9^°^^ mouse line, the DIC and Sry-Cre Cre lines were also designed to

establish whether Sertoli cells and follicle cells have a common precursor.

Since Daxl and Sry are expressed within pre-Sertoli cells, it would have been possible to cross either the DIC and/or Sry-Cre mice with R26R mice. Cre

expression within the Sertoli cell precursors of an R26R embryo would cause these cells to continually express lacZ. If Sertoli and follicle cells arise do

134 indeed arise from the same precursor then lacZ expression would have been

seen in both the Sertoli and follicle cells. Evidence that Sertoli cells and follicle

cells originate from a common precursor has been provided recently from

transgenic mice that express EGFP under the control of the Sry promoter [21].

However, this work can be criticised at several levels. To prove conclusively

that follicle cells and Sertoli cells have a common precursor, the authors

needed to show; 1) That the Sry-EGFP transgene is expressed exclusively in

the somatic cells of the genital ridge, in a similar expression pattern to

endogenous Sry, and 2) That the cells expressing Sry-EGFP become either

Sertoli cells (in the case of a testis) or follicle cells (in the case of an ovary).

All studies were performed with only single homozygous transgenic mouse

line (Tg92). When the temporal and spatial expression of Sry-EGFP in

undifferentiated genital ridges was examined, EGFP was shown to be confined

to the genital ridge and was not detected in mesonephros or the developing

metanephric kidney, however EGFP expression was so faint that an anti-GFP

antibody was required to visualize it. Moreover, EGFP expression was found in

15.5dpc, PI and P28 XX and XY gonads. Since in wild-type XY gonads,

endogenous Sry expression is not detected after 12.5dpc, the Sry-EYFP

transgene is not expressed in a similar pattern to that of endogenous Sry. To

determine what cell type in the gonad Sry-EGFP is expressed in, a number of

marker proteins were examined in whole-mount urogenital ridges. Two proteins (GATA-4 & WT-1) known to be present in somatic cells were used to

confirm that Sry-EGFP expression is confined to somatic cells of the gonad. To

135 ensure that cells expressing Sry-EGFP were Sertoli cells, AMH and EGFP

expression was examined in a 13.5dpc XY gonad using anti-AMH and anti-

GFP antibodies respectively. The authors claimed that in an XY gonad all

EGFP expressing cells co-express AMH, yet some cells clearly appear to be

expressing EGFP but not AMH. Moreover, whilst AMH expression appears to

localize to the Sertoli cells, EGFP expression appears to be seen throughout the

Sertoli cells and the enclosed germ cells. Most importantly, the fundamental

problem with these experiments is that from lO.Sdpc, the Sry-EGFP transgene

is continually expressed in both XX and XY embryos ensuring the EGFP

protein is repeatedly renewed. Since EGFP is found in the follicle and Sertoli

cells of PI XX and XY embryos, EGFP must be being independently expressed

in both cell lineages and therefore cannot be used as a lineage tracer to prove

that follicle cells and Sertoli cells come from the same cell precursor. In

summary, 1) The expression of the Sry-EGFP transgene does not mimic

endogenous Sry expression. 2) Whilst Sry-EGFP may be expressed in the

somatic cells of the indifferent gonad, the data presented does not provide

satisfactory evidence to conclude that in the developing testis, all cells

expressing Sry-EGFP develop into Sertoli cells. 3) Since Sry-EGFP is

continually being expressed in both the Sertoli and follicle cells, how can it possibly be used as a lineage tracer? It would be insightful to see if the 5’ regulatory region used to drive expression of EGFP is able to cause sex reversal when used to drive expression of Sry.

136 5 CHAPTER 5 - FINAL CONCLUSIONS

In humans, mutations in S0X9 cause campomelic dysplasia (CD), a skeletal

malformation syndrome. Seventy-five percent of XY patients exhibit sex

reversal, implying that S0X9 plays and important role in male sex

determination. SRY and S0X9 are believed to work in conjunction with each

another to divert cells of the supporting cell lineage down the Sertoli, or male,

cell differentiation pathway. This theory is supported by the expression pattern

of Sox9 in the mouse and its strong up-regulation during testes differentiation

[111]. Sertoli cell specific expression of S0X9 protein has been confirmed by

immunohistochemistry [111, 112]. Additionally Sox9 is able to cause female to

male sex reversal if misexpressed in XX mouse gonads and when the gene is

duplicated in humans [122].

The primary aim of this thesis was to definitively test the requirement of Sox9

for Sertoli cell formation. A conditional targeting mutation was designed to

inactivate Sox9 within the supporting cell precursors of the genital ridge. This

task can essentially broken down into 4 sections; the first was to design and

generate a conditional targeting vector (Chapter 2). The second was to

successfully integrate the conditional mutation into the ES genome via

homologous recombination (Chapter 3). The third challenge was to create

chimeric animals carrying this mutation (Chapter 3). The fourth and ultimate

goal of this Ph.D. was to conditionally inactivate Sox9 specifically within the

somatic cells of the genital ridge during sex determination (Chapter 4).

137 5.1 The targeting strategy

In chapter 2, the design and construction of the Sox9 conditional targeting

mutation (pSox9^°^^) is described. During cloning, a conscious effort was made

to overcome any foreseeable problems. The PGK-neo cassette was designed

with Frt sites flanking it so that it could be easily removed by expressing Flp

recombinase. To avoid the risk of gene interference from the loxP sites, they

were cloned strategically into non-coding regions of Sox9. Cre-mediated

recombination should have generated a null allele of the Sox9 gene. This

occurs by concurrently removing half of the HMG box, which should prevent

S0X9 from binding DNA [102] as well as the entire transactivation domain,

which is essential for S0X9 function [116]. An MmGFP reporter was included

so that expression of the recombined transgene could be monitored

immediately in live and fixed embryos. Prior to gene targeting, the fidelity of

the loxP and Frt sites and the ability for Cre-mediated recombination to

activate MmGFP expression was tested in vitro.

Although this aspect of the thesis was achieved successfully, this type of

construct can be difficult to make, as in this case. This delayed the onset of the

next phase of the project. The complexity of the construct could also have

compromised the targeting efficiency and the analysis of recombinants (see

below).

5.2 Gene Targeting

The second part of this Ph.D. thesis involved introducing pSox9^°^^ into ES

cells via homologous recombination. The first successful attempt at targeting

138 the Sox9 allele necessitated screening 700 colonies, 7 of which had undergone

homologous recombination, but only 2 were found to contain both loxP sites.

Blastocyst injection of both clones generated poor chimeras that failed to give

germ-line transmission. Further investigation revealed that the batch of wild

type ES cells used for the electroporation exhibited an abnormal karyotype

(Chapter 3, section 3.3.3). The second targeting into ABl ES cells involved

screening 1000 ES colonies. Southern analyses established that -10% of the

targeted ABl ES cells had integrated the conditional Sox9 mutation via 3’

homologous recombination. Further Southern analysis, using a variety of

internal probes, showed a dramatic difference in the intensity of wild type and

targeted bands. FISH analysis illustrated that in addition to homologously

incorporating the Sox9 conditional mutation into their genome, each clone had

also randomly incorporated multiple copies of the targeting construct in a

‘tandem array’ at a single additional site (Chapter 3, section 3.3.10). Chimeras

have been generated using these ES cell clones, with the intention of

segregating the targeted Sox9 allele away from the random integrants, but at

this time, germ line transmission has not been achieved. Two further attempts

were made to successfully re-target the Sox9 loci, but both proved

unsuccessful; the possible reasons for this are discussed in Chapter 3 section

3.3.13.

5.3 Generating Cre mice

In anticipation of generating mice carrying the Sox9 conditional mutation,

transgenic mice able to drive tissue specific expression of Cre-recombinase in

139 the developing gonad had to be generated. Our first choice was to use the Dax

1 promoter since the genital ridge/gonad specific regulatory region of Dax 1 promoter had previously been characterized, and was readily available in the lab [166]. This proved to be a poor option as we later demonstrated that Daxl is expressed within the pre-implantation embryo. This made the Dax-Cre mouse line unsuitable for crossing with a Sox9 conditional mouse (see Figure

15). To overcome this limitation, and to gain temporal and spatial control over

Cre expression, a tamoxifen-inducible form of Cre recombinase, (CreER^^), was cloned downstream of the same 11 kb Dax 1 promoter. Two independent mouse lines were generated, {DICA & B), which were crossed with homozygous R26R mice. To induce Cre-mediated recombination, pregnant mice were given a single i.p. injection of Img 4-OHT at lO.Sdpc of gestation, embryos were harvested between 13.5 and 16.5dpc. Although PCR confirmed that many transgenic animals were recovered, lacZ staining demonstrated that none of these animals were expressing Cre in the somatic cells of the genital ridge.

Three transgenic Sry-Cre mouse lines were also produced to drive Cre expression in the genital ridge. When these mice were crossed with homozygous R26R mice, one of the lines, Sry-CreB, showed lacZ expression but this was mainly confined to the interstitial cells of the gonad. However, lacZ expression was also seen in the heart, kidney and lung.

Due to a combination of time constraints and unsatisfactory results from both the D ie and Sry-Cre mouse lines, transient experiments were performed to see

140 whether, under the correct conditions, either promoter would be suitable to

drive Cre expression within the genital ridge during sex determination (as

described in chapter 4). The repeated low number and poor condition of

fertilized R26R oocytes resulted in only 4 transgenic mice being recovered,

none of which allowed us to ascertain the suitability of either promoter.

5.4 The Past, Present and the Future

5.4.1 Karyotyping

The experiments executed during this Ph.D highlight some of the potential

pitfalls and technical considerations involved in generating a conditional allele.

Although other batches of CCE’s were clearly euploid and had given germ line

transmission, the abnormal karotype observed in the CCE’s during the first

round of gene targeting reveals the obvious importance of routinely

karyotyping ES cells. A great deal of time was spent screening and analyzing

the CCE ES clones and performing blastocyst injections. If we had karyotyped

the cells before targeting, we would have known instantly that these cells were

not able to give us germ line transmission.

5.4.2 Gene targeting

Despite addressing and overcoming the problems with the first round or

targeting, the second round of gene targeting did not yield the straightforward

results expected. We are now fairly confident that we know what happened

during the second targeting event, however the question of why it happened is

still unknown. Experiments performed by Paul Hasty [197] and Thomas and

Capecchi [227] implied that an exponential relationship between target

141 homology and targeting frequency exists. Although the targeting frequency depends ultimately upon the gene being targeted, we had assumed that the high level of homology between the pSox9^^^^ targeting construct and Sox9 loci would have made gene targeting a routine task.

In the 15 years since gene targeting via homologous recombination (HR) was first demonstrated in vertebrate cells, [227-229] it has been used extensively to create mouse models for human diseases. The success or failure of gene targeting relies upon the cells enzymatic machinery to accomplish Homologous

Recombination (HR). HR is initiated at double-strand DNA breaks (DSB’s) which have been acted on by single-stranded exonuclease. However, because a chromosomal break is lethal if left unrepaired, cells also employ a dominant

‘back-up’ mechanism for HR known as nonhomologous end joining (NHEJ).

The principle barrier to facilitate gene targeting in vertebrate cells is not the low frequency of HR but the high frequency of NHEJ. Our current understanding of HR is based on a model proposed by Szostak [230]. HR can be thought of in terms of three key steps: strand exchange, branch migration and resolution. Strand exchange involves pairing of the broken DNA end with the homologous region of its sister chromatid, followed by strand invasion to form a DNA crossover or Holliday junction. This process generates regions of heteroduplex DNA made up of DNA strands from the different sister chromatids. During branch ligation, the Holliday junction is translocated along the DNA moving the heteroduplex away from the original crossover site.

Finally, the Holliday junction intermediate is resolved by cleavage of the

142 junction to form separate duplex DNA molecules again. We rely on this repair mechanism during gene targeting. When the targeting construct DNA is integrated into the genome via electroporation, it is thought to act in one of two ways; it is possible that the linearized ends of the gene-targeting vector could act as a DSB within the genome, which are repaired by interacting with intact homologous sequences in the genome. An alternative is that the gene-targeting construct participates in HR mediated repair as an intact DNA template (i.e. taking the place of the DNA template normally offered by the sister chromatid). This model is supported by the fact that gene-targeting frequencies increase with the length of overall homology on the targeting construct.

Furthermore, targeting efficiency was increased by an order of two magnitudes when DSB were introduced into rodent cells [231].

In 1982 Folger et al [232] demonstrated the ability of mammalian cells to ligate DNA fragments irrespective of the sequence or topology at their ends by coinjecting two fragments, one bearing the coding sequence for HSV-tk gene and the other bearing its promoter sequence. In order for cells to express thymidine kinase, the two fragments had to be correctly ligated in the recipient cell. Folger observed a productive ligation in almost every cell that received an injection, establishing that the efficiency of joining two free ends of any DNA molecules together is extremely high. Additionally, Folger demonstrated that the number of gene copies integrated into the genome is generally dependent upon the quantity of DNA injected although it can vary from transformant to transformant. Based upon original ideas by Folger, I have proposed the

143 following models to explain how multiple copies of the Sox9 targeting vector integrated at a single additional site in the ES cell genome. Both models work upon the understanding that copies of the DNA construct containing the Sox9 targeting mutation {pSox9^°^^) were present in excess. Model I (figure 19) works on the principle that as well as undergoing HR, a single copy of the pSox9^^^^ was incorporated into the genome by NHEJ, subsequent copies of the pSox9^°^^ then integrate at this site by homologous recombination. Model II

(figure 20) is based upon the idea that multiple copies of pSox9^°^^ form a concatemer that is then integrated as an entire unit into the chromosome. It should be possible to test which (if any) method of integration occurred during the second attempt to target Sox9 using the following principles; during gene targeting, DNA is removed from the ends of the targeting vectors by exonuclease degradation prior to integration [233]. If a single copy of the pSox9^^^^ had integrated into the genome and others then integrated at the same point via HR (Model I), we would expect to find evidence of exonuclease activity at the ends of each individual copy of the pSox9^^^^, if however a concatemer containing multiple copies of the pSox9^°^^ formed first, which was then integrated into the genome as a complete unit, we would expect to find evidence of exonulease activity only at the 5’ end of the first copy and at the 3’ end of the last copy of pSox9^°^^. In theory, to test this hypothesis, quantitative

PCR could be carried out using primers designed to amplify small regions of

DNA (~20bp) from the 5’ or 3’ ends of pSox9^^^^.

144 5.4.3 Cre mouse lines

Initially, it was hoped that the Cre mouse lines required for use in conjunction with this project would be generated whilst stable Sox9-/-^ and Sox9-/~ mouse lines were being established. Unfortunately, the complications that arose during gene targeting prevented a more detailed analysis from being performed on the

Sry-Cre and DIG mouse lines. Ideally, RT-PCR should be carried on ll.Sdpc gonads of DIG and Sry-Gre transgenic mice, (when Sry and Daxl are highly expressed) to establish if either transgene is expressed. Both constructs also need to be re-injected so that many more lines can be established and a consistent expression pattern must be observed.

145 Figure 19: Model I

In Model I, a single plasmid molecule is integrated into the host chromosome.

Subsequent plasmid molecules then integrate at the same site via homologous recombination to generate a head-to tail concatemer.

146 Model I

or

host DNA

BY RANDOM INTEGRATION

or

BY HOMOLOGOUS RECOMBINATION Figure 20: Model II

In Model II a head to tail concatemer is generated by homologous recombination prior to integration into the host chromosome as an entire unit.

147 Model II

or

BY RANDOM INTEGRATION

host DNA If neither mouse line is suitable for use with a Sox9 conditional mouse, then gene targeting could then be performed. However, since the Y chromosome has never been successfully targeted, an Sry-Cre mouse line may be difficult to generate in this manner. Although it is technically possible to target Daxl, its expression in the pre-implantation embryo means that an inducible targeting construct would need to be generated. The matter is further complicated because Daxl is essential for ES cell survival and male fertility [167] making it an unfavourable option.

If neither the Sry nor Dax inducible Cre line are suitable for crossing with a

Sox9 conditional mouse, transgenic mice expressing Cre under the control of the Sfl or Amh promoter could be used to drive tissue specific expression of

Cre in the developing gonads. The advantage of using Sfl is that it is expressed at 9.0dpc in the urogenital ridge before Sox9 expression begins. Thus, unlike the Dax 1 and Sry promoters that would drive Cre expression after Sox9 expression has begun, the Sfl promoter will drive Cre expression in the genital ridge before Sox9 expression is initiated. Unfortunately, we did not have access to this promoter at this time [85] [87] However, gene targeting could potentially be used to introduce Cre into the Sfl locus.

Gene targeting, to generate mice that express Cre under the control of the Amh promoter, is currently being carried out in Richard Behringer’s laboratory.

It had been anticipated that production of Sox9 conditional mouse lines would have provided the answer to many important questions concerning male sex

148 determination; the first was to confirm that Sox9 is an absolute requirement for

Sertoli cell formation. The second was to address if a critical level of Sox9 is required for Sertoli cell formation and to estimate what this level might be.

Depending upon the availability of the Cre expressing mouse lines discussed, we should have been able to inactivate Sox9 expression in the gonad at different points of sex determination, ranging from 9.0dpc - 12.5dpc. This type of versatility would allow several questions concerning the role of Sox9 in

Sertoli cell differentiation and maintenance to be answered. An Sfl-Cre line could be used to provide answers concerning the role of Sox9 in gonad formation, although the knowledge that in Sox9-/~ embryos generated by Bi et al are able to form a urogenital ridge (Personal communication with R

Behringer) makes it unlikely that Sox9 plays a critical role in this process. By using the Sry and Daxl regulatory regions to drive expression of Cre, an initial wave of Sox9 expression would have been present in XX and XY gonads but the male specific upregulation, which is thought to be required in the XY gonad for Sertoli cell differentiation, would be absent. Finally, an Amh-Cre mouse line would have enabled us to establish the role of Sox9 in Sertoli cell maintenance.

The current model for sex determination suggests that expression of Sry in the bipotential genital ridge initiates testis development by directing the supporting cells to develop as Sertoli cells rather than follicle cells. Although there is much circumstantial evidence including the recent data presented by Albrecht and Eicher (see discussion in section & [21]) to suggest that Sertoli and follicle

149 cells share a common precursor, we do not yet know what is happening on a

genetic level during Sertoli cell differentiation. Available evidence implies that

SRY interacts directly with Sox9 to up regulate it; SOX9 then activates

expression of Amh etc. Based upon this working hypothesis, we would expect

Sry expression to be unaltered in XY Sox9-/- mice.

Since Sox9 expression is required to cause differentiation of Sertoli cells and to

activate Amh expression, we would expect Amh expression to be abolished in

the gonads of Sox9-/~ XY mice. By preventing the supporting cell precursors

from differentiating into Sertoli cells we would expect to see varying levels of

male to female sex reversal.

Following Cre-mediated deletion of Sox9, morphological analysis would need

to be carried out on these mice after sex determination. First, in-situ analysis

should be performed to establish that there are no Sox9 transcripts present in

the XY gonad. Instead, we would expect MmGFP to be seen in the Sox9

expression domain unless, of course it is required to maintain its own

transcription. Additionally, a correlation between the timing and extent of Cre-

mediated removal of Sox9 from the genital ridge as well as the morphology of

the testis, ovaries or ovotestis should be established. Any delay in testes

formation should be noted. Ultimately, karotyping or genotyping for the Y

chromosome must be undertaken to see if mice generated in this project are

indeed XY females.

5.5 Closing Statement

150 Although the aim of this project was not fulfilled, the problems encountered throughout this Ph.D. and the resulting experiments designed to overcome them have required me to look critically at the system of HR in mammahan cells and question how much we really know about the process. Perhaps a more valuable lesson has been learnt towards understanding the nature of science and by showing the ability to logically determine what went wrong and to try and understand the reasons behind it. The pSox^°^ construct is currently being sequenced. In the event that a translocation, deletion or integration has been introduced, then an alternative

Sox9 targeting strategy has been devised, which would reduce the overall length of the construct to 12kb and allow homologous recombination to be checked with both

5’ and 3’ external probes using a BamHI digest. (This re-designed targeting vector, along with suitable external 5’ and 3’ probes is illustrated schematically in figure

21).

It is encouraging to note that several labs are working on ways to simplify the process of gene targeting. One way to improve gene targeting would be to selectively damage the targeted gene by inducing DSB’s thus stimulating HR.

Alternatively, it should be possible to up-regulate genes involved in HR or down regulate genes involved in NHEJ. Many candidate genes for enhancing gene targeting have been identified. One example is RAD52 that encodes a protein involved in strand transfer, which has already been knocked out in mouse ES cells.

The RAD52 deficient cells showed a 2-fold decrease in gene targeting, [234] [235] conversely, over expression of RAD52 in monkey cells stimulates HR 3- 5 fold

[236]. Similarly, candidate genes for depressing NHEJ have been identified. Mouse

151 ES cells that are deficient in Ku70, a subunit of the DNA-dependent protein kinase, show a reduction NHEJ.

152 Figure 21: Alternative design for a Sox9 conditional targeting

construct

A) Schematic diagram of the Sox9 genomic locus.

The three coding exons of Sox9 are shown as open boxes with the region encoding the HMG box shown in red.

B) Schematic representation of the new improved targeting vector

The two-loxP sites are represented as pink triangles, shaded in grey is the reporter

MmGFP, which includes a splice acceptor (SA). Shaded in blue is the neomycin gene driven by the PGK promoter. This cassette is flanked by two Frt elements shown in yellow. By reducing the length of the 5’ arm of homology, it is possible to use external 5’ and 3’ probes (shown in yellow) to check for homologous recombination. An advantage of this targeting construct is that a single Southern blot containing targeted ES cell genomic DNA digested with BamHI can be used to confirm that homologous recombination has occurred at both the 5’ and 3’ arms.

153 Conditional Targeted Disruption ofS o x 9

12.0kb

Wild Type 1 / / 1 II 1 Allele □ I J 5’ probe 3’ probe X X X * 3 Xb B E Xb L Xb B Targeting ^SAGFPpA-^ Neo J B Vector ■7^ 5’ probe

7.0kb S.Okb APPENDIX

ABBREVIATIONS

ABl- Alan Bradley 1. ES cells ABP - ^ d ro g en binding grotein {PRIVATE } AHC - Adrenal hypoplasia congenita AMH - ^ti-Miillerian hormone ASW - Avian Sex-specific W-linked BAC - Bacterial artificial chromosome bp - base pair BMP- Bone morphogenic protein BSA - Bovine serum albumin BrdU - Bromodeoxyuridine C - Celsius CE - colemic epithelium CD - Campomelic dysplasia Chr - Chromsome Cpm - counts per minute DAXl - DSS-AHC critical region on the X, gene 1 DD - Differential display DDS - Denys-Drash syndrome DHH - Desert hedgehog D ie - Dax inducible cre DIG - Dideoxygenin DM DOMAIN - Doublesex and Mab-3 DMEM - Dulbecco's modified Eagle's medium DMRT- Doublesex and Mab-3 related transcription factor DNA - Deoxyribonucleic acid dNTP - Deoxyribonucleaside triphosphate àpc - days post coitum dpp - days post partum

154 DSB - Double strand break DSS - Dosage sensitive sex reversal DSX - doublesex DTT - Dithiothreitol EB - Embryoid body ECFP - Enhanced cyan fluorescent protein EDTA - Ethylenodiamino tetracetic ELP - Embryonal long terminal repeat-binding protein ER - Estrogen receptor ERT 17p - Estradiol ESQ - ^ cell Qualified ES cells - Embryonic Stem cells EYFP - Enhanced yellow fluorescent protein PCS - Fetal calf serum FGF - Fibroblast growth factor FISH - Fluorescent In-situ hybridisation FITC - Fluorescein isothiocyanate Floxed - Flanked with loxP sites FLPC - Fast lipoprotein chromatography Frt - Flp recognition site FSH - follicle-stimulating hormone FTZ-Fl - Fushi tarazu factor 1_ g - gram GDF - Growth differentiation factor GCNF - Germ cell nuclear factor GK - Glucokinase hAP - Human alkaline phosphatase Hh - hedgehog HMG - High mobility group HOX - Homeo box Hprt - Hypoxanthine phosphonbosyl transferase

155 HSV-tk - Herpes simplex vims thymidine kinase HS2 - Hypersensitivity site HR - Homologous recombination Hrs - Hours kb - kilobase 1 - litre i.p - Intraperitonially IPTG - Isopropyl-1-thio-p-D-galactosidase LED - Ligand binding domain LCR - Locus control region INSL3 - Insulin-like 3 1RES - Internal ribosome entry site LEF-1 - Lymphoid enhancer-binding factor 1 LHX - LIM-homeobox LIE - Leukaemia inhibitory factor LoxP - Locus of ‘X’ over in PI M - Molar MATA - Yeast mating-type gene mg - milligram ml - millilitre mM - milimolar min - minute MIS - Müllerian inhibiting substance MTTFl - mitochondrial transcription factor NCAM - Neural cell adhesion molecule NHEJ - Non-homologous end joining NHP6A - yeast nuclear histone protein NP-40 - Nonidet P-40 OCT -Octamer binding protein Ods - Odsex, ocular degeneration with sex reversal OHT - Hydroxytamoxifen

156 0/n - Overnight ORF - Open reading frame P - Passage pA - Polyadenylation PFA - Paraformaldehyde PTC - Patched PAX - Paired box PBS - Phosphate-buffered saline PCR - Polymerase chain reaction PGC - Primordial germ cells Pfu - plaque forming units PGK - Phosphoglycerate kinase PKCIW - Protein kinase C inhibitor on the W chromosome PMDS - Persistent Müllerian duct syndrome R26R - ROSA26 Reporter RNA - Ribonucleic acid rpm - revolutions per minute RT - Room temperature RT-PCR - Reverse transcription-PCR SA - ^ lic e acceptor SCE - Sister chromatid exchanges SDS - dodecyl sulfate sec - second SFl - ^ SPDD - Signal peptide differential display SOX-SRY/Srybpx SRY - Sex determining region-Y chromosome SSC - Sodium chloride/sodium citrate buffer SSRPl - structure recognition protein SXL- Sex lethal TAE - Tris/acetate (buffer)

157 Tam - Tamoxifen TCP - T-cell specific factor TDF - Testis determining factor - Y chromosome Tdy - Testis determining Y gene TE-Tris/EDTA buffer TESTATIN - Testis specific cystain related gene TGF - Transforming growth factor TTS - Transcriptional termination sequence Tyr - Tyrosine minigene UBF - Upstream binding factor UTR - Unfranslated region V -V o lt W - Dominant white spotting WAGR - Wilms’ tumour, aniridia, genitourinary abnormalities and mental retardation WNT - Wingless-type WTl - Wilms' tumour 1 Xgal - 5-bromo-4-chloro-3-indolyl-p-D-galactosidase X O L-X O lethal YAC- yeast artificial chromosome

158 M l 6 Culture Medium

M l6 is a modified Krebs-Ringer bicarbonate solution and is very similar to

Whitten’s medium [237].

Compound g/Iitre

NaCl 5.533

KCl 0.356

CaCl2*2H20 0.252

KH2PO4 0.162

MgSO^#7H20 0.293

NaHCOj 2.101

Sodium lactate 2.610

Sodium Pyruvate 0.036

Glucose 1.000

BSA 4.00

PeniciUin G»potassium salt 0.060

(final conc., lOOunits/ml

Streptomycin sulfate 0.050

(final con., 50pg/ml)

Phenol Red 0.010

Glass distilled H2O up to 1 litre

159 M2 Culture Medium

This is a modified Krebs-ringer solution with some bicarbonate substituted with HEPES buffer [238].

Component g/litre

NaCl 5.533

KCl 0.356

CaCl2*2H2Ü 0.252

MgS0^#7H20 0.293

NaHCOj 0.349

HEPES 4.969

Sodium lactate 2.610

Sodium Pyruvate 0.036

Glucose 1.000

BSA 4.000

Penicillin G»potassium salt 0.060

Streptomycin sulfate 0.050

Phenol Red 0.010

Distilled H2O Up to 1 litre

160 Anticipated breeding and expected phenotypes

1. Parents: XX Srv:Cre/Srv:Cre +/+ 9 x XY+/+,

Offspring

XX Sry:Cre/+,Sox9'°'^/+ ? The Sox9'°"^ will become Sox9^^ in the early gonad, but should still give normal females*. XY Sry:Cre/+, Sox9^'"'^/+ ?? The Sox9‘°^ will become Sox9^^ in the early gonad, which might lead to sex reversal to give females (i.e. they will be heterozygous for Sox9, equivalent to human CD patients, but only in somatic cells of the gonad).

2. Parents: XX Sry:Cre/+, Sox9'°’^’/+ ? x XY +/+, Sox9'°’^/Sox9'°’^ S

Offspring

XX +/+, Sox9‘“’^/+ Ç XY +/+, Sox9'“’^/+ S XX +/+, Sox9'‘”^/Sox9'‘”^ $ XY +/+, Sox9''”^/Sox9‘‘’^

XX Sry:Cre/+, Sox9'‘”^/+ ?* XY Sry:Cre/+, Sox9'‘”^/+ ? XX Sry:Cre/+, Sox9'"’^/Sox9''”^ ?* XY Sry:Cre/+, Sox9'°^/Sox9'“’^ ? These mice will be homozygous for Sox9'“ '” in the gonad and should develop ovaries if our hypothesis is correct. REFERENCES

1. Parkhurst, S.M., D. Bopp, and D. Ish-Horowicz, X:A ratio, the primary sex- determining signal in Drosophila, is transduced by helix-loop-helix proteins. Cell, 1990. 63(6): p. 1179-91. 2. Bell, L.R., et al.. Sex-lethal, a Drosophila sex determination switch gene, exhibits sex-specific RNA splicing and sequence similarity to RNA binding proteins. Cell, 1988. 55(6): p. 1037-46. 3. Hodgkin, J., Drosophila sex determination: a cascade o f regulated splicing. Cell, 1989. 56(6): p. 905-6. 4. Raymond, C.S., et al.. Evidence for evolutionary conservation o f sex- determining genes. Nature, 1998. 391(6668): p. 691-5. 5. Bloom, S.E., G. Povar, and D.B. Peakall, Chromosome preparations from the avian allantoic sac. Stain Technol, 1972. 47(3): p. 123-7. 6. Nanda, I., et al.. Conserved synteny between the chicken Zsex chromosome and human includes the male regulatory gene DMRTl: a comparative (re)view on avian sex determination. Cytogenet Cell Genet, 2000. 89(1-2): p. 67-78. 7. Raymond, C.S., et al.. Expression ofDmrtl in the genital ridge o f mouse and chicken embryos suggests a role in vertebrate sexual development. Dev Biol, 1999. 215(2): p. 208-20. 8. Griffiths, R., S. Daan, and C. Dijkstra, Sex identification in birds using two CHD genes. Proc R Soc Lond B Biol Sci, 1996. 263(1374): p. 1251-6. 9. Renffee, M.B., J.L. Harry, and G. Shaw, The marsupial male: a role model for sexual development. Philos Trans R Soc Lond B Biol Sci, 1995. 350(1333): p. 243-51. 10. Ford, C.E., Jones, K.W, Polani, P.E. De Almeida, J.C and Briggs, J.H, A sex-chromosome anomaly in a case of gonadal dysgenesis (Tumers Syndrome). Lancet i, 1959: p. 711-713. 11. Jacobs, P.A.a.S., J. A, A case o f human intersexuality having a possible XXY sex-determining mechanism. Nature, 1959.183: p. 302-303. 12. Welshons, W.J.a.R., L.B, The Y chromosome as the bearer o f male determining factors in the mouse. Proc Natl Acad Sci USA, 1959. 45: p. 560-566. 13. Jost, A., et al.. Studies on sex differentiation in mammals. Recent Prog Horm Res, 1973. 29: p. 1-41. 14. Jost, A., Becoming a male. Adv Biosci, 1973. 10: p. 3-13. 15. Westem, P.S., et al.. Temperature-dependent sex determination in the American alligator: AMHprecedes S0X9 expression. Dev Dyn, 1999. 216(4-5): p. 411-9. 16. Deeming, D.C. and M.W. Ferguson, Environmental regulation o f sex determination in reptiles. Philos Trans R Soc Lond B Biol Sci, 1988. 322(1208): p. 19-39. 17. Forbes, T.R., Studies on the reproductive system o f the alligator. IV. Observations on the development of the gonad, the adrenal cortex and the Mullerian duct. Cont Embryol, 1940. 28: p. 129-156.

162 18. Capel, B., The battle o f the sexes. Mech Dev, 2000. 92(1): p. 89-103. 19. McLaren, A., Sex determination in mammals. Trends Genet, 1988. 4(6): p. 153-7. 20. Martineau, J., et al.. Male-specific cell migration into the developing gonad. CurrBiol, 1997. 7(12): p. 958-68. 21. Albrecht, K.H. and E.M. Eicher, Evidence that Sry is expressed in pre- Sertoli cells and Sertoli and granulosa cells have a common precursor. Dev Biol, 2001. 240(1): p. 92-107. 22. Lejeune, H., R. Habert, and J.M. Saez, Origin, proliferation and differentiation ofLeydig cells. J Mol Endocrinol, 1998. 20(1): p. 1-25. 23. Hacker, A., et al.. Expression of Sry, the mouse sex determining gene. Development, 1995.121(6): p. 1603-14. 24. McLaren, A., Germ cells and germ cell sex. Philos Trans R Soc Lond B Biol Sci, 1995. 350(1333): p. 229-33. 25. Behringer, R.R., The mullerian inhibitor and mammalian sexual development. Philos Trans R Soc Lond B Biol Sci, 1995. 350(1333): p. 285- 8; discussion 289. 26. Hutson, J.M., et al.. Hormonal control of testicular descent and the cause o f cryptorchidism. Reprod Fertil Dev, 1994. 6(2): p. 151-6. 27. Nef, S. and L.F. Parada, Hormones in male sexual development. Genes Dev, 2000.14(24): p. 3075-86. 28. Zimmermann, S., et al., Mouse Leydig insulin-like (Ley I-L) gene: structure and expression during testis and ovary development. Mol Reprod Dev, 1997. 47(1): p. 30-8. 29. Matova, N. and L. Cooley, Comparative aspects o f animal oogenesis. Dev Biol, 2001. 231(2): p. 291-320. 30. Ginsburg, M., M.H. Snow, and A. McLaren, Primordial germ cells in the mouse embryo during gastrulation. Development, 1990. 110(2): p. 521-8. 31. Gomperts, M., et al.. Interactions between primordial germ cells play a role in their migration in mouse embryos. Development, 1994.120(1): p. 135- 41. 32. McLaren, A. and D. Southee, Entry of mouse embryonic germ cells into meiosis. Dev Biol, 1997.187(1): p. 107-13. 33. Tam, P.P. and M.H. Snow, Proliferation and migration o f primordial germ cells during compensatory growth in mouse embryos. J Embryol Exp Morphol, 1981. 64: p. 133-47. 34. Lawson, K. A., et al., Bmp4 is required for the generation ofprimordial germ cells in the mouse embryo. Genes Dev, 1999. 13(4): p. 424-36. 35. Scholer, H.R., et al., Oct-4: a germline-specific transcription factor mapping to the mouse t-complex. Embo J, 1990. 9(7): p. 2185-95. 36. Nichols, J., A. Smith, and M. Buehr, Rat and mouse epiblasts differ in their capacity to generate extraembryonic endoderm. Reprod Fertil Dev, 1998. 10(7-8): p. 517-25. 37. Niwa, H., [Self-renewal and differentiation o f ES cells]. Hum Cell, 2000. 13(4): p. 161-75. 38. Nichols, J., et al.. Formation of pluripotent stem cells in the mammalian

163 embryo depends on thePOU transcription factor Oct4. Cell, 1998. 95(3): p. 379-91. 39. Fuhrmaim, G., et al., Mouse germline restriction o f Oct4 expression by germ cell nuclear factor. Dev Cell, 2001.1(3): p. 377-87. 40. Geissler, E.N., et al.. Genetic analysis of the dominant white-spotting (W) region on mouse chromosome 5: identification o f cloned DNA markers near W. Proc Natl Acad Sci USA, 1988. 85(24): p. 9635-9. 41. Geissler, E.N., M.A. Ryan, and D.E. Housman, The dominant-white spotting (W) locus o f the mouse encodes the c-kit proto-oncogene. Cell, 1988. 55(1): p. 185-92. 42. McLaren, A., Development o f the mammalian gonad: the fate o f the supporting cell lineage. Bioessays, 1991.13(4): p. 151-6. 43. McLaren, A., Mammalian germ cells: birth, sex, and immortality. Cell Struct Funct, 2001. 26(3): p. 119-22. 44. Magre, S. and A. Jost, Sertoli cells and testicular differentiation in the rat fetus. J Electron Microsc Tech, 1991.19(2): p. 172-88. 45. Palmer, S.J. and P.S. Burgoyne, In situ analysis o f fetal, prepuberal and adult XX-—XY chimaeric mouse testes: Sertoli cells are predominantly, but not exclusively, XY. Development, 1991.112(1): p. 265-8. 46. Buehr, M., et al.. Proliferation and migration o f primordial germ cells in We/We mouse embryos. Dev Dyn, 1993.198(3): p. 182-9. 47. Merchant-Larios, H., N. Moreno-Mendoza, and M. Buehr, The role o f the mesonephros in cell differentiation and morphogenesis o f the mouse fetal testis. Int J Dev Biol, 1993. 37(3): p. 407-15. 48. Karl, J. and B. Capel, Three-dimensional structure o f the developing mouse genital ridge. Philos Trans R Soc Lond B Biol Sci, 1995. 350(1333): p. 235-42. 49. Capel, B., et al.. Migration o f mesonephric cells into the mammalian gonad depends on Sry. Mech Dev, 1999. 84(1-2): p. 127-31. 50. Schmahl, J., et al., Sry induces cell proliferation in the mouse gonad. Development, 2000.127(1): p. 65-73. 51. Black, W.H. and K. Christensen, Differentiation in interstitial cells and Sertoli cells in fetal guinea pig testes. Am J Anat, 1969. 124(2): p. 211-37. 52. Vainio, S., et al.. Female development in mammals is regulated by Wnt-4 signalling. Nature, 1999. 397(6718): p. 405-9. 53. Mayerhofer, A., et al.. The neural cell adhesion molecule (NCAM) provides clues to the development o f testicular Leydig cells. J Androl, 1996.17(3): p. 223-30. 54. Merchant-Larios, H. and N. Moreno-Mendoza, Mesonephric stromal cells differentiate into Leydig cells in the mouse fetal testis. Exp Cell Res, 1998. 244(1): p. 230-8. 55. Buehr, M., S. Gu, and A. McLaren, Mesonephric contribution to testis differentiation in the fetal mouse. Development, 1993.117(1): p. 273-81. 56. Raychoudhury, S.S., et al.. Collagen biosynthesis in cultured rat testicular Sertoli and peritubular myoid cells. Life Sci, 1992. 51(20): p. 1585-96. 57. Hadley, M.A., et al. Extracellular matrix regulates Sertoli cell

164 differentiation, testicular cord formation, and germ cell development in vitro. J Cell Biol, 1985.101(4): p. 1511-22. 58. Maekawa, M., K. Kamimura, and T. Nagano, Peritubular myoid cells in the testis: their structure and function. ArchHistol Cytol, 1996. 59(1): p. 1-13. 59. Matzuk, M.M., Revelations o f ovarian follicle biology from gene knockout mice. Mol Cell Endocrinol, 2000.163(1-2): p. 61-6. 60. Kotsuji, F. and T. Tominaga, The role of granulosa and theca cell interactions in ovarian structure and function. Microsc Res Tech, 1994. 27(2): p. 97-107. 61. Buhler, E.M., A synopsis o f the human Y chromosome. Hum Genet, 1980. 55(2): p. 145-75. 62. Goodfellow, P., S. Darling, and J. Wolfe, The human Y chromosome. J Med Genet, 1985. 22(5): p. 329-44. 63. Gubbay, J., et al., A gene mapping to the sex-determining region o f the mouse Y chromosome is a member o f a novel family o f embryonically expressed genes. Nature, 1990. 346(6281): p. 245-50. 64. Gubbay, J., et al.. Normal structure and expression o f Zfy genes in XY female mice mutant in Tdy. Development, 1990,109(3): p. 647-53. 65. Sinclair, A.H., et al., A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature, 1990. 346(6281): p. 240-4. 66. Koopman, P., et al.. Expression o f a candidate sex-determining gene during mouse testis differentiation. Nature, 1990. 348(6300): p. 450-2. 67. Koopman, P., et al., Male development o f chromosomally female mice transgenic for Sry. Nature, 1991. 351(6322): p. 117-21. 68. Gubbay, J., et al.. Inverted repeat structure o f the Sry locus in mice. Proc Natl Acad Sci USA, 1992. 89(17): p. 7953-7. 69. Tilmann, C. and B. Capel, Mesonephric cell migration induces testis cord formation and Sertoli cell differentiation in the mammalian gonad. Development, 1999.126(13): p. 2883-90. 70. Lovell-Badge, R. and A. Hacker, The molecular genetics o f Sry and its role in mammalian sex determination. Pbilos Trans R Soc Lond B Biol Sci, 1995. 350(1333): p. 205-14. 71. Scbamborst, V., A.J. van der Eb, and A.G. Jocbemsen, WTl proteins: functions in growth and differentiation. Gene, 2001. 273(2): p. 141-61. 72. Pelletier, J., et al., Germline mutations in the Wilms' tumor suppressor gene are associated with abnormal urogenital development in Denys-Drash syndrome. Cell, 1991. 67(2): p. 437-47. 73. Hastie, N.D., Wilms' tumour gene and function. Curr Opin Genet Dev, 1993.3(3): p. 408-13. 74. Little, M.H., et al.. Evidence that WTl mutations in Denys-Drash syndrome patients may act in a dominant-negative fashion. Hum Mol Genet, 1993. 2(3): p. 259-64. 75. Barbaux, S., et al.. Donor splice-site mutations in WTl are responsible for Frasier syndrome. Nat Genet, 1997. 17(4): p. 467-70. 76. Klamt, B., et al., Frasier syndrome is caused by defective alternative

165 splicing o f WTl leading to an altered ratio o f WTl +/-KTS splice isoforms. Hum Mol Genet, 1998. 7(4): p. 709-14. 77. Kikuchi, H., et al., Do intronic mutations affecting splicing o f WTl exon 9 cause Frasier syndrome? J Med Genet, 1998. 35(1): p. 45-8. 78. Kreidberg, J.A., Gene targeting in kidney development. Med Pediatr Oncol, 1996. 27(5): p. 445-52. 79. Bowles, J. and P. Koopman, New clues to the puzzle o f mammalian sex determination. Genome Biol, 2001. 2(9): p. REVIEWS 1025. 80. Laity, J.H., H.J. Dyson, and P.E. Wright, Molecular basis for modulation o f biological function by alternate splicing o f the Wilms' tumor suppressor protein. Proc Natl Acad Sci USA, 2000. 97(22): p. 11932-5. 81. Little, M., G. Holmes, and P. Walsh, WTl: what has the last decade told us? Bioessays, 1999. 21(3): p. 191-202. 82. Lala, D.S., D. A. Rice, and K.L. Parker, Steroidogenic factor I, a key regulator o f steroidogenic enzyme expression, is the mouse homolog o f fushi tarazu-factor I. Mol Endocrinol, 1992. 6(8): p. 1249-58. 83. Ikeda, Y., SF-1: a key regulator o f development and function in the mammalian reproductive system. Acta Paediatr Jpn, 1996. 38(4): p. 412-9. 84. Luo, X., et al.. Steroidogenic factor 1 (SF-1) is essential for endocrine development andfunction. J Steroid Biochem Mol Biol, 1999. 69(1-6): p. 13-8. 85. Ikeda, Y., et al.. Developmental expression o f mouse steroidogenic factor-1, an essential regulator o f the steroid hydroxylases. Mol Endocrinol, 1994. 8(5): p. 654-62. 86. Shen, W.H., et al.. Nuclear receptor steroidogenic factor 1 regulates the mullerian inhibiting substance gene: a link to the sex determination cascade. Cell, 1994. 77(5): p. 651-61. 87. Luo, X., Y. Ikeda, and K.L. Parker, A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell, 1994. 77(4): p. 481-90. 88. Mader, S., et al.. Three amino acids of the oestrogen receptor are essential to its ability to distinguish an oestrogen from a glucocorticoid-responsive element. Nature, 1989. 338(6212): p. 271-4. 89. Bertuzzi, S., et al.. Characterization ofLhx9, a novel LIM/homeobox gene expressed by the pioneer neurons in the mouse cerebral cortex. Mech Dev, 1999. 81(1-2): p. 193-8. 90. Birk, O.S., et al.. The LIM homeobox gene Lhx9 is essential for mouse gonadformation. Nature, 2000. 403(6772): p. 909-13. 91. Ottolenghi, C., et al.. Absence o f mutations involving the LIM homeobox domain gene LHX9 in 46,XYgonadal agenesis and dysgenesis. J Clin Endocrinol Metab, 2001. 86(6): p. 2465-9. 92. Muller, J., S. Gaunt, and P. A. Lawrence, Function o f the Polycomb protein is conserved in mice andflies. Development, 1995.121(9): p. 2847-52. 93. Pearce, J.J., P.B. Singh, and S.J. Gaunt, The mouse has a Polycomb-like chromobox gene. Development, 1992. 114(4): p. 921-9. 94. Katoh-Fukui, Y., et al., Male-to-female sex reversal in M33 mutant mice.

166 Nature, 1998. 393(6686): p. 688-92. 95. Tommerup, N., et al., Assignment of an autosomal sex reversal locus (SRAl) and campomelic dysplasia (CMPDl) to 17q24.3-q25.1. Nat Genet, 1993. 4(2): p. 170-4. 96. Wagner, T., et al.. Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene S0X9. Cell, 1994. 79(6): p. 1111-20. 97. Kwok, C., et al.. Mutations in S0X9, the gene responsible for Campomelic dysplasia and autosomal sex reversal Am J Hum Genet, 1995. 57(5): p. 1028-36. 98. Foster, J.W., et al.. Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-r elated gene. Nature, 1994. 372(6506): p. 525-30. 99. Wright, E., et al.. The Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat Genet, 1995. 9(1): p. 15-20. 100. Pevny, L.H. and R. Lovell-Badge, Sox genes find their feet. Curr Opin Genet Dev, 1997. 7(3): p. 338-44. 101. Laudet, V., D. Stehelin, and H. Clevers, Ancestry and diversity of the HMG box superfamily. Nucleic Acids Res, 1993. 21(10): p. 2493-501. 102. Giese, K., J. Cox, and R. Grosschedl, The HMG domain o f lymphoid enhancer factor 1 bends DNA and facilitates assembly o f functional nucleoprotein structures. Cell, 1992. 69(1): p. 185-95. 103. Baxevanis, A.D. and D. Landsman, The HMG-1 box protein family: classification and functional relationships. Nucleic Acids Res, 1995. 23(9): p. 1604-13. 104. Ferrari, S., et al., SRY, like HMGl, recognizes sharp angles in DNA. Embo J, 1992. 11(12): p. 4497-506. 105. Bianchi, M E., M. Beltrame, and G. Paonessa, Specific recognition o f cruciform DNA by nuclear protein HMGl. Science, 1989. 243(4894 Pt 1): p. 1056-9. 106. Kuhn, A., et al.. Functional differences between the two splice variants o f the nucleolar transcription factor UBF: the second HMG box determines specificity o f DNA binding and transcriptional activity. Embo J, 1994. 13(2): p. 416-24. 107. Denny, P., et al., A conserved family of genes related to the testis determining gene, SRY. Nucleic Acids Res, 1992. 20(11): p. 2887. 108. Pevny, L.H., et al., A role for SOXl in neural determination. Development, 1998.125(10): p. 1967-78. 109. van de Wetering, M., et al., Sox-4, an Sry-like HMG box protein, is a transcriptional activator in lymphocytes. Embo J, 1993. 12(10): p. 3847-54. 110. Ng, L.J., et al., S0X9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Dev Biol, 1997. 183(1): p. 108-21. 111. Morais da Silva, S., et al., Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat Genet, 1996.14(1): p. 62-8.

167 112. Kent, J., et al., A male-specific role for S0X9 in vertebrate sex determination. Development, 1996. 122(9): p. 2813-22. 113. Sudbeck, P. and G. Scherer, Two independent nuclear localization signals are present in the DNA-binding high-mobility group domains o f SRY and SOX9. J Biol Chem, 1997. 272(44): p. 27848-52. 114. Courey, A.J. and R. Tjian, Analysis o f Spl in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif Cell, 1988. 55(5): p. 887-98. 115. Mermod, N., et al.. The proline-rich transcriptional activator o f CTF/NF-I is distinct from the replication and DNA binding domain. Cell, 1989. 58(4): p. 741-53. 116. Sudbeck, P., et al.. Sex reversal by loss o f the C-terminal transactivation domain o f human S0X9. Nat Genet, 1996.13(2): p. 230-2. 117. Kanai, Y. and P. Koopman, Structural andfunctional characterization o f the mouse Sox9 promoter: implications for campomelic dysplasia. Hum Mol Genet, 1999. 8(4): p. 691-6. 118. Bishop, C.E., et al., A transgenic insertion upstream o f is associated with dominant XXsex reversal in the mouse. Nat Genet, 2000. 26(4): p. 490-4. 119. Wunderle, V.M., et al.. Deletion o f long-range regulatory elements upstream o f S0X9 causes campomelic dysplasia. Proc Natl Acad Sci USA, 1998. 95(18): p. 10649-54. 120. McElreavey, K., et al., A regulatory cascade hypothesis for mammalian sex determination: SRY represses a negative regulator o f male development. Proc Natl Acad Sci USA, 1993. 90(8): p. 3368-72. 121. Swain, A., et al., Daxl antagonizes Sry action in mammalian sex determination. Nature, 1998. 391(6669): p. 761-7. 122. Vidal, V.P., et al., Sox9 induces testis development in XXtransgenic mice. Nat Genet, 2001. 28(3): p. 216-7. 123. Moore, A.W., et al., Y AC transgenic analysis reveals Wilms' tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mech Dev, 1998. 79(1-2): p. 169-84. 124. Hunt, P. A., et al.. Germ cell loss in the XXY male mouse: altered X- chromosome dosage affects prenatal development. Mol Reprod Dev, 1998. 49(2): p. 101-11. 125. Huang, B., et al.. Autosomal XXsex reversal caused by duplication of SOX9. Am J Med Genet, 1999. 87(4): p. 349-53. 126. Bi, W., et al., Sox9 is required for cartilage formation. Nat Genet, 1999. 22(1): p. 85-9. 127. Bi, W., et al., Haploinsuffîciency o f Sox9 results in defective cartilage primordia and premature skeletal mineralization. Proc Natl Acad Sci U S A, 2001.98(12): p. 6698-703. 128. Nagy, A., et al.. Derivation o f completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci USA, 1993. 90(18): p. 8424-8. 129. Morais da Silva, S., Sox9: an Sry related gene involved in sex

168 determination, 'm Division o f Developmental Genetics. 1998, University College London: London, p. 206. 130. Raymond, C.S., et al., Dmrtl, a gene related to worm andfly sexual regulators, is required for mammalian testis differentiation. Genes Dev, 2000.14(20): p. 2587-95. 131. Echelard, Y., et al.. Sonic hedgehog, a member o f a family ofputative signaling molecules, is implicated in the regulation o f CNSpolarity. Cell, 1993. 75(7): p. 1417-30. 132. Bitgood, M.J., L. Shen, and A.P. McMahon, Sertoli cell signaling by Desert hedgehog regulates the male germline. Curr Biol, 1996. 6(3): p. 298-304. 133. Tohonen, V., C. Osterlund, and K. Nordqvist, Testatin: a cystatin-related gene expressed during early testis development. Proc Natl Acad Sci USA, 1998. 95(24): p. 14208-13. 134. Liang, P. and A.B. Pardee, Differential display. A general protocol. Mol Biotechnol, 1998.10(3): p. 261-7. 135. Ion, A., et al., A novel mutation in the putative DNA helicase XH2 is responsible for male-to-female sex reversal associated with an atypical form o f the ATR-X syndrome. Am J Hum Genet, 1996. 58(6): p. 1185-91. 136. Kanno, Y., et al., A cystatin-related gene, testatin/cresp, shows male- specific expression in germ and somatic cells from the initial stage o f murine gonadal sex-differentiation. Int J Dev Biol, 1999. 43(8): p. 777-84. 137. Molkentin, J.D., The zinc finger-containing transcription factors GATA-4, - 5, and -6. Ubiquitously expressed regulators o f tissue-specific gene expression. J Biol Chem, 2000. 275(50): p. 38949-52. 138. Tremblay, J.J., N.M. Robert, and R.S. Viger, Modulation o f endogenous GATA-4 activity reveals its dual contribution to Mullerian inhibiting substance gene transcription in Sertoli cells. Mol Endocrinol, 2001. 15(9): p. 1636-50. 139. Tremblay, J.J. and R.S. Viger, Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol, 1999.13(8): p. 1388-401. 140. Viger, R.S., et al.. Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator o f the Mullerian inhibiting substance promoter. Development, 1998.125(14): p. 2665-75. 141. Colvin, J.S., et al., Male-to-female sex reversal in mice lacking fibroblast growth factor 9. Cell, 2001.104(6): p. 875-89. 142. Burgoyne, P.S., et al.. Cell-autonomous action o f the testis-determining gene: Sertoli cells are exclusively XY in XX-—XY chimaeric mouse testes. Development, 1988.102(2): p. 443-50. 143. Mittwoch, U., Sex determination and sex reversal: genotype, phenotype, dogma and semantics. Hum Genet, 1992. 89(5): p. 467-79. 144. Jost, J.P. and M. Avemer, Gene regulation in mammalian cells: a model for the interaction o f steroids and 3',5-cyclic AMP. J Theor Biol, 1975. 49(2): p. 337-44.

169 145. Jost, A., Perchellet, J.P, Prepin, J and Vigier, B, ed. The prenatal development o f bovine freemartins. Symposium on Intersexuality, ed. R. Reinbom. 1975, Berlin: Springer-Verlag. 392-406. 146. Josso, N., Mullerian-inhibiting activity o f human fetal testicular tissue deprived o f germ cells by in vitro irradiation. Pediatr Res, 1974. 8(8): p. 755-8. 147. Cate, R.L., et al.. Isolation o f the bovine and human genes for Mullerian inhibiting substance and expression o f the human gene in animal cells. Cell, 1986. 45(5): p. 685-98. 148. Picard, J.Y., et al.. Cloning and expression o f cDNA for anti-mullerian hormone. Proc Natl Acad Sci USA, 1986. 83(15): p. 5464-8. 149. Eusebe, D., et al.. Cloning and expression o f the chick anti-Mullerian hormone gene. J Biol Chem, 1996. 271(9): p. 4798-804. 150. Munsterberg, A. and R. Lovell-Badge, Expression o f the mouse anti- mullerian hormone gene suggests a role in both male and female sexual differentiation. Development, 1991.113(2): p. 613-24. 151. Haqq, C., et al., Isolation o f the rat gene for Mullerian inhibiting substance. Genomics, 1992.12(4): p. 665-9. 152. Pieau, C., M. Dorizzi, and N. Richard-Mercier, Temperature-dependent sex determination and gonadal differentiation in reptiles. Cell Mol Life Sci, 1999. 55(6-7): p. 887-900. 153. Behringer, R.R., et al.. Abnormal sexual development in transgenic mice chronically expressing mullerian inhibiting substance. Nature, 1990. 345(6271): p. 167-70. 154. Haqq, CM., et al.. Molecular basis o f mammalian sexual determination: activation o f Mullerian inhibiting substance gene expression by SRY. Science, 1994. 266(5190): p. 1494-500. 155. De Santa Barbara, P., et al.. Direct interaction o f SRY-relatedprotein S0X9 and steroidogenic factor 1 regulates transcription o f the human anti- Mullerian hormone gene. Mol Cell Biol, 1998.18(11): p. 6653-65. 156. Arango, N.A., R. Lovell-Badge, and R.R. Behringer, Targeted mutagenesis o f the endogenous mouse Mis gene promoter: in vivo definition o f genetic pathways o f vertebrate sexual development. Cell, 1999. 99(4): p. 409-19. 157. Tremblay, J.J. and R.S. Viger, Nuclear receptor Dax-1 represses the transcriptional co-operation between GATA-4 and SF-I in Sertoli cells. Biol Reprod, 2001. 64(4): p. 1191-9. 158. Nachtigal, M.W., et al., Wilms’ tumor 1 and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell, 1998. 93(3): p. 445-54. 159. Watanabe, K., et al.. Endogenous expression o f Mullerian inhibiting substance in early postnatal rat sertoli cells requires multiple steroidogenic factor-1 and GATA-4-binding sites. Proc Natl Acad Sci USA, 2000. 97(4): p. 1624-9. 160. Koopman, P., M. Bullejos, and J. Bowles, Regulation o f male sexual development by Sry and Sox9. J Exp Zool, 2001. 290(5): p. 463-74. 161. Koopman, P., S ^ and Sox9: mammalian testis-determining genes. Cell Mol

170 Life Sci, 1999. 55(6-7): p. 839-56. 162. Hacker, A., Gene expression during testis determination in the mouse, in Department o f Developmental Genetics. 1995, University of London: London, p. 182. 163. Narvaez-Padilla, V.M., Expression and regulation o f sex determining genes in the mouse, 'm Department o f Developmental Genetics. 1996, University College London: London, p. 142. 164. Bardoni, B., et al., A dosage sensitive locus at chromosome Xp21 is involved in male to female sex reversal. Nat Genet, 1994. 7(4): p. 497-501. 165. Zanaria, E., et al.. An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature, 1994. 372(6507): p. 635-41. 166. Swain, A., et al.. Mouse Daxl expression is consistent with a role in sex determination as well as in adrenal and hypothalamus function. Nat Genet, 1996.12(4): p. 404-9. 167. Yu, R.N., et al.. Role of Ahch in gonadal development andgametogenesis. Nat Genet, 1998. 20(4): p. 353-7. 168. Martin, G., Making a vertebrate limb: new players enter from the wings. Bioessays, 2001. 23(10): p. 865-8. 169. McGrath, S.A., A.F. Esquela, and S.J. Lee, Oocyte-specific expression o f growth/differentiation factor-9. Mol Endocrinol, 1995. 9(1): p. 131-6. 170. Dong, J., et al.. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature, 1996. 383(6600): p. 531-5. 171. Zarkower, D., Establishing sexual dimorphism: conservation amidst diversity? Nat Rev Genet, 2001. 2(3): p. 175-85. 172. Soriano, P., Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet, 1999. 21(1): p. 70-1. 173. Capecchi, M.R., Altering the genome by homologous recombination. Science, 1989. 244(4910): p. 1288-92. 174. Sauer, B. and N. Henderson, Site-specific DNA recombination in mammalian cells by the Cre recombinase o f bacteriophage PI. Proc Natl Acad Sci USA, 1988. 85(14): p. 5166-70. 175. Buchholz, P., et al.. Different thermostabilities o f FLP and Cre recombinases: implications for applied site-specific recombination. Nucleic Acids Res, 1996. 24(21): p. 4256-62. 176. Rodriguez, C.I., et al., High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat Genet, 2000. 25(2): p. 139-40. 177. Postic, C., M. Shiota, and M.A. Magnuson, Cell-specific roles o f glucokinase in glucose homeostasis. Recent Prog Horm Res, 2001. 56: p. 195-217. 178. Thyagarajan, B., et al.. Mammalian genomes contain active recombinase recognition sites. Gene, 2000. 244(1-2): p. 47-54. 179. Schmidt, E.E., et al.. Illegitimate Cre-dependent chromosome rearrangements in transgenic mouse spermatids. Proc Natl Acad Sci USA, 2000. 97(25): p. 13702-7. 180. Loonstra, A., et al.. Growth inhibition and DNA damage induced by Cre

171 recombinase in mammalian cells. Proceedings- National Academy of Sciences USA, 2001. 98(16): p. 9209-9214. 181. Lewandoski, M., K.M. Wassarman, and G.R. Martin, Zp3-cre, a transgenic mouse line for the activation or inactivation of loxP-flanked target genes specifically in the female germ line. CurrBiol, 1997. 7(2): p. 148-51. 182. Guo, C., W. Yang, and C.G. Lobe, A Cre recombinase transgene with mosaic, widespread tamoxifen-inducible action. Genesis, 2002. 32(1): p. 8- 18. 183. Inoue, H., H. Nojima, and H. Okayama, High efficiency transformation o f Escherichia coli with plasmids. Gene, 1990. 96(1): p. 23-8. 184. Russell, J.S.a.D., Molecular cloning: A laboratory manual. Third ed, ed. N. Irwin. 2001: Cold Spring Harbour Laboratory Press. 185. Upcroft, P. and A. Healey, Rapid and efficient methodfor cloning o f blunt- endedDNA fragments. Gene, 1987. 51(1): p. 69-75. 186. Dymecki, S.M., Flp recombinase promotes site-specific DNA recombination in embryonic stem cells and transgenic mice. Proc Natl Acad Sci USA, 1996. 93(12): p. 6191-6. 187. Ikawa, M., et al., 'Green mice' and their potential usage in biological research. FEES Lett, 1998. 430(1-2): p. 83-7. 188. Adra, C.N., P.H. Boer, and M.W. McBumey, Cloning and expression o f the mouse pgk-1 gene and the nucleotide sequence o f its promoter. Gene, 1987. 60(1): p. 65-74. 189. Siemering, K.R., et al.. Mutations that suppress the thermosensitivity o f green fluorescent protein. CurrBiol, 1996. 6(12): p. 1653-63. 190. Fiering, S., et al., Targeted deletion of 5'HS2 o f the murine beta-globin LCR reveals that it is not essential for proper regulation o f the beta-globin locus. Genes Dev, 1995. 9(18): p. 2203-13. 191. Rijli, F.M., et al.. Insertion o f a targeting construct in a Hoxd-10 allele can influence the control ofHoxd-9 expression. Dev Dyn, 1994. 201(4): p. 366- 77. 192. Pham, C.T., et al.. Long-range disruption of gene expression by a selectable marker cassette. Proc Natl Acad Sci USA, 1996. 93(23): p. 13090-5. 193. Buchholz, F., P.O. Angrand, and A.F. Stewart, A simple assay to determine the functionality o f Cre or FLP recombination targets in genomic manipulation constructs. Nucleic Acids Res, 1996. 24(15): p. 3118-9. 194. Rossant, J., Stem cells from the Mammalian blastocyst. Stem Cells, 2001. 19(6): p. 477-82. 195. Evans, M.J. and M.H. Kaufinan, Establishment in culture o f pluripotential cells from mouse embryos. Nature, 1981. 292(5819): p. 154-6. 196. Williams, R.L., et al.. Myeloid leukaemia inhibitory factor maintains the developmental potential o f embryonic stem cells. Nature, 1988. 336(6200): p. 684-7. 197. Hasty, P., J. Rivera-Perez, and A. Bradley, The length o f homology required for gene targeting in embryonic stem cells. Mol Cell Biol, 1991. 11(11): p. 5586-91. 198. Capecchi, M.R., The new mouse genetics: altering the genome by gene

172 targeting. Trends Genet, 1989. 5(3): p. 70-6. 199. Schwartzberg, P.L., S.P. Goff, and E.J. Robertson, Germ-line transmission o f a c-abl mutation produced by targeted gene disruption in ES cells. Science, 1989. 246(4931): p. 799-803. 200. Keller, G.M., In vitro differentiation o f embryonic stem cells. Curr Opin Cell Biol, 1995. 7(6): p. 862-9. 201. Desbaillets, I., et al., Embryoid bodies: an in vitro model o f mouse embryogenesis. Exp Physiol, 2000. 85(6): p. 645-51. 202. Li, M., et al.. Generation ofpurified neural precursors from embryonic stem cells by lineage selection. CurrBiol, 1998. 8(17): p. 971-4. 203. Bradley, A., et al.. Formation o f germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature, 1984. 309(5965): p. 255-6. 204. Robertson, E.J., Using embryonic stem cells to introduce mutations into the mouse germ line. Biol Reprod, 1991. 44(2): p. 238-45. 205. Bradley, A., Developmental potential o f murine pluripotential stem cells. Basic Life Sci, 1991. 57: p. 83-97; discussion 97-9. 206. Robertson, E.J., ed. Embryo-derived stem cell lines. In Tetatocarcinomas and Embryonic Stem Cells, ed. E.J. Robertson. 1987, Oxford: IRL Press. 71-112. 207. Bickmore, W.A., ed. Chromosome Structural Analysis. A Practical Approach, ed. B.D. Hames. 1999. 208. Liu, X., et al.. Trisomy eight in ES cells is a common potential problem in gene targeting and interferes with germ line transmission. Dev Dyn, 1997. 209(1): p. 85-91. 209. Reid, L.H., et al.. Cotransformation and gene targeting in mouse embryonic stem cells. Mol Cell Biol, 1991.11(5): p. 2769-77. 210. Sarig, R., et al.. Increased efficiency o f homologous recombination in ES cells by cleavage at both ends of homology in the targeting vector. Transgenic Res, 2000. 9(2): p. 79-80. 211. Zwingman, T., et al.. Transcription o f the sex-determining region genes Sry and Zfy in the mouse preimplantation embryo. Proc Natl Acad Sci USA, 1993. 90(3): p. 814-7. 212. Pfeifer, T., et al.. Characterisation ofhumic substances using atmospheric pressure chemical ionisation and electrospray ionisation mass spectrometry combined with size-exclusion chromatography. J Chromatogr A, 2001. 926(1): p. 151-9. 213. Orban, P.C., D. Chui, and J.D. Marth, Tissue- and site-specific DNA recombination in transgenic mice. Proc Natl Acad Sci USA, 1992. 89(15): p. 6861-5. 214. Kuhn, R., et al.. Inducible gene targeting in mice. Science, 1995. 269(5229): p. 1427-9. 215. Schwenk, F., U. Baron, and K. Rajewsky, A cre-transgenic mouse strain for the ubiquitous deletion o f loxP-fianked gene segments including deletion in germ cells. Nucleic Acids Res, 1995. 23(24): p. 5080-1. 216. Feil, R., et al.. Ligand-activated site-specific recombination in mice. Proc Natl Acad Sci USA, 1996. 93(20): p. 10887-90.

173 217. Danielian, P.S., et al., Modification o f gene activity in mouse embryos in utero by a tamoxifen-inducible form o f Cre recombinase. Curr Biol, 1998. 8(24): p. 1323-6. 218. Indra, A.K., et al.. Temporally-controlled site-specific mutagenesis in the basal layer o f the epidermis: comparison o f the recombinase activity o f the tamoxifen-inducible Cre-ER(T) and Cre-ER(T2) recombinases. Nucleic Acids Res, 1999. 27(22): p. 4324-7. 219. Feil, R., et al.. Regulation o f Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem Biophys Res Commun, 1997. 237(3): p. 752-7. 220. Ertzeid, G. and R. Storeng, Adverse effects o f gonadotrophin treatment on pre- and postimplantation development in mice. J Reprod Fertil, 1992. 96(2): p. 649-55. 221. Hogan, B.L., F. Costantini, and B. Lacy. Manipulating the Mouse Embryo. in Cold Spring Harbour Laboratory. 1986. New York. 222. Srinivas, S., et al., Cre reporter strains produced by targeted insertion o f EYFP and ECFP into the ROSA26 locus. BMC Dev Biol, 2001.1(1): p. 4. 223. Artelt, P., et al.. The prokaryotic neomycin-resistance-encoding gene acts as a transcriptional silencer in eukaryotic cells. Gene, 1991. 99(2): p. 249-54. 224. Swain, A. and R. Lovell-Badge, Mammalian sex determination: a molecular drama. Genes Dev, 1999.13(7): p. 755-67. 225. Imai, T., et al.. Impaired adipogenesis and lipolysis in the mouse upon selective ablation o f the alpha mediated by a tamoxifen- inducible chimeric Cre recombinase (Cre-ERT2) in adipocytes. Proc Natl Acad Sci USA, 2001. 98(1): p. 224-8. 226. Vallier, L., et al.. An efficient system for conditional gene expression in embryonic stem cells and in their in vitro and in vivo differentiated derivatives. Proc Natl Acad Sci USA, 2001. 98(5): p. 2467-72. 227. Thomas, K.R. and M.R. Capecchi, Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell, 1987. 51(3): p. 503-12. 228. Smithies, O., et al.. Insertion o f DNA sequences into the human chromosomal beta-globin locus by homologous recombination. Nature, 1985. 317(6034): p. 230-4. 229. Thomas, K.R. and M.R. Capecchi, Introduction o f homologous DNA sequences into mammalian cells induces mutations in the cognate gene. Nature, 1986. 324(6092): p. 34-8. 230. Szostak, J.W., et al.. The double-strand-break repair model for recombination. Cell, 1983. 33(1): p. 25-35. 231. Liang, F., et al.. Chromosomal double-strand break repair in Ku80-deficient cells. Proc Natl Acad Sci USA, 1996. 93(17): p. 8929-33. 232. Folger, K.R., et al.. Patterns o f integration o f DNA microinjected into cultured mammalian cells: evidence for homologous recombination betxveen injected plasmid DNA molecules. Mol Cell Biol, 1982. 2(11): p. 1372-87. 233. Henderson, G. and J.P. Simons, Processing o f DNA prior to illegitimate recombination in mouse cells. Mol Cell Biol, 1997.17(7): p. 3779-85.

174 234. Rijkers, T., et al., Targeted inactivation o f mouse RAD52 reduces homologous recombination but not resistance to ionizing radiation. Mol Cell Biol, 1998.18(11): p. 6423-9. 235. Yamaguchi-Iwai, Y., et al.. Homologous recombination, but not DNA repair, is reduced in vertebrate cells deficient in RAD52. Mol Cell Biol, 1998.18(11): p. 6430-5. 236. Park, M.S., Expression o f human RAD52 confers resistance to ionizing radiation in mammalian cells. J Biol Chem, 1995. 270(26): p. 15467-70. 237. Whitten, W.K., Embryo Medium. Nutrient requirements for the culture o f preimplantation embryos in vitro. Adv Biosci, 1971. 6: p. 129-141. 238. Quinn, P., C. Barros, and D.G. Whittingham, Preservation of hamster oocytes to assay the fertilizing capacity o f human spermatozoa. J Reprod Fertil, 1982. 66(1): p. 161-8.

175