RHAMM, CD44 EXPRESSION and ERK ACTIVATION ARE LINKED in MALIGNANT HUMAN BREAST CANCER CELLS and ARE ASSOCIATED Wlth CELL Motlllty

Home , Protein S

RHAMM, CD44 EXPRESSION AND ERK ACTIVATION ARE LINKED IN MALIGNANT HUMAN BREAST CANCER CELLS AND ARE ASSOCIATED WlTH CELL MOTlLlTY

Frouz Frozan Paiwand

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Laboratory Medicine and Pathobiology University of Toronto

O Copyright by Frouz Frozan Paiwand 1999 National Library Bibliothèque nationale 1*1 of Canada du Canada Acquisitions and Acquisitions et Bibliographie Sewîes senrices bibliographiques 395 Wellington Street 395. rua Ws(lingt0ri OaawaON K1AW OFtswaON K1AONI canada CaMde

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de rnicrofiche/nlm, de reproduction sur papier ou sur format électronique.

The author retains owaership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. I dedicate this Master's thesis to my rnother, who is the source of my inspiration, and to rny family for their never-ending love and support. RHAMM, CD44 Expression and ERK Activation are Linked in Human Breast Cancer Cells and are Associated with Cell Motility

Frouz Frozan Paiwand Master of Science, 1999 Department of Laboratory Medicine and Pathobiology University of Toronto

ABSTRACT We assessed CD44 RHAMM,erk, and ras expression in human breast cancer ce11 lines that Vary as xenografts in nude mice. Compared to MCF-7 cells, MDA-MB-231 cells expressed higher levels of CD44, RHAMM,erk, and ras, showed higher levels of ce11 surface RHAMM, and displayed greater motility that was reduced by anti-RHAMM or anti-CD44 antibodies, or by a MEK inhibitor. These inhibitors also reduced the motility of mutant active ras-transfected MCF-IOA cells which, relative to wild-type ras or empty vector transfected cells, were more motile and had increased RHAMM, CD44 and activated erk expression. MDA-MB-23 1 cells and mutant ras-transfected MCF-1OA cells demonstrated nuclear CO-localizationof RHAMM and erk, whereas RHAMM and

CD44 CO-localizedto perinuclear regions or to ce11 processes. Co-immunoprecipitation of

RHAMM with both CD44 and erk was also observed. These resuIts suggest that

RHAMM and CD44 may coordinate signaling through the ras-MAP kinase pathway to control ce11 motility.

iii This thesis could not have been completed without the help and support of

numerous coworkers, colleagues, and friends.

1 am most thanldùl to my supervisor and mentor, Dr. Eva Turley, who not only

provided me with the material resources, technical training, and scientific guidance

needed to undertake the studies in which 1 participated, but who was also a source of encouragement far me to continuously srrive for excellence.

1 am also indebted to al1 the members of Dr. Turley's research group, past and present. My thanks extend especially to Lisa CoUis, Rene Hamson, JingBo A, Shwin

Zhang and Judy Edwards - with whorn I shared formative experiences as a graduate student - for their advice and support on issues both scientific and personal. For their friendship, stimulating discussions, and knowledge, L would also Iike to thank ail the other students, postdoctoral fellows, and associates who are the present members of the

Iaboratory.

1 would like to express my sincere thanks to the members of my thesis advisory cornmittee - Drs. Marlene Rabinovitch and Gabrielle Boulianne - for their invaluable guidance on the direction of my research project and maintainhg the standard of the

M.Sc. degree at the University of Toronto. As well, 1 thank the other members of my original examination committee - Dr. Fred Keeley and Dr. Howard Lipshitz - for their advice in regard to my previous research project.

To my mother and sister Leeza, and to al1 the members of my farnily, 1 owe gratitude for their continuous patience and support throughout the years of my univeaity education. It is to them that 1dedicate this thesis. Foremost among my fiiends deserving acknowledgement is Michael Levesque,

whose daily encouragement and advice nourished me in mcuIt times and inspired me to

wnte this thesis in order to progress frorn Muate studies to the educational.

professional, and personal oppoctunities that Lie beyond.

Finally, 1would like to acknowledge the financial support of Hyal Pharrnaceutical

Corporation, Mississauga, Ontario, Canada.

The studies described in this thesis were performed at the Department of

Cardiovascular Research at The Hospital for Sick Children, under the aegis of the

Graduate Department of Laboratory Medicine and Pathobiology at the University of

Toronto, during the years 1997- 1999. DEDICATION ...... , ...... ABSTRACT ...... 0...... ACKNOWLEDGEMENTS ...... TABLE OF CONTENTS ...... LIST OF TABLES ......

LIST OF FIGURES ...... -...... LIST OF ABBREVIATIONS ...... CEIAPTER 1. INTRODUCTION ...... 1. 1 . Extracellular Matrix and Tumorigenesis ...... 1. 1.1. Tumorigenesis and Metastasis ...... 1. 1.2. HA and Tumorigenesis ......

1.2. The HA Binding Receptors: RHAMM and CD44 ......

1.2.3. Domains of CD44 Related to Ce11 Motility and Celi Cycle Control ......

1.2.5. RHAMM ...... 1. 2 . 6 . RHAMM Isoforms ...... ,...... 1.2.7. Domains of RHAMM Related to Ce11 Motility and Ce11 Cycle Control ...... 1.3. Tumor Progression is Associated with Elevated Expression of CD44 and RHAMM ...... ,...... 1.4. Hypothesis. Rationale. and Objectives of this Smdy ...... 23 I. MATERIALS AND METKODS ...... 25 II .1 . Cell Culture ...... ,., .....~.O...... 26 II .2 . Antibodies ...... ,...... ~...... 27 II .3 . Western Irnmunoblotting and Immunopr~cipitation ...... 28 II .4 . Time-lapse Cinemicrography ...... 30 II. 5. Flow Cytometry (FACS) ...... - ...... - .- - - - ...... II. 6. Immunofluorescence Staining ...... - .. - .. . - - .. .-...... - - III. RESULTS ...... III. 1. Antibodies Specifically Detect RHAMM ...... - - - ...... LII. 2. CeU Surface RHAMM Expression Varies with Time on the Surface of Human Breast Cancer Cells ...... -...... III. 3. Breast Cancer CeUs Express Several RHAMM bofonns ...... III. 4. RHAMM Overexpression is Associated with the Presence of Mutant Active ras ...... -. - - -.-. .... -...... - -. .-.. III. 5. RIIAMM Overexpression in MDA-MB-231, MCF-7,or MCF- 1OA CelIs Correlates with the Overexpression of ras, Presence of Active erk, and with High LRvels of CD44 ...... III. 6. RHAMM Co-distributes with erk and CD44 in Breast Cancer CeIls ...... - - - ...... -...... -. . . . -.. III. 7. RHAMM Co-irnmunoprecipitates with erk and CD44 in MDA-MB-23 1, MCF-7,and in ras-transfected Breast Epithelial Cells ...... - .. . -...... - .- - - -..-. -. . . - .. - .- - - ...... m. 8. RHAMM and CD44 are Required for the Locomotion of MDA-MB-23 Ceils and Ceils Transfected with Mutant Active ras ...... -. . - ...... -. - .-...... III. 9. Figures of Chapter III ...... -. . -...... - N. DISCUSSION .- ...... - .. - .- .. - .. - -.- - - - - .- - - .- ...... N.1. Ras and raderk Signaling Cascade in Breast Cancer Development ...... 69 N.2. CD44 and RHAMM, Co-receptors that Mediate Tumor Ce11 Motility through the ras/MAP Kinase Pathway ...... 73 W.3. RHAMM and CD44 Expression are Linked to ras Overexpression and erk Activation in Breast Cancer Cells and Breast Epithelial Cells Transfected with Mutant Active ras ...... - ...... 80 W.4. RHAMM CO-associateswith erk in MDA-MB-23 1 Cells and MCF-1OA Cells Transfected with Mutant Active ras ...... 8 1 IV. 5. RHAMM Co-associates with CD44 in Breast Cancer Cells and Breast Epitheliai CeiIs Transfected with Mutant Active ras ...... 83 IV. 6. A Mode1 of HA and its Receptoa in raslerk Signaling and Breast Cancer Development ...... 84 IV. 7. Future Studies ...... - ...... 88

vii V. REF'ERENCES ...... 91 VI. APPENDLX ...... *.....**.. ..-...... -...... ,...... 11 1 The DrosophUn RHAMM Homologue LIST OF TABLES CHAPTER 1. Table 1.1. HA Binding Pro teins ...... - .. . - - - ...... 8 CaAPTER IV. Table N. 1. Characteristics of Human Breast Epithelial Cell Lines .. ... 76 LIST OF FIGURES

Fig. 1.1. The Basic Repeating Disaccharide Sequence in HA ......

Fig. 1.2. The Family of Hyaladherins ...... , ...... Fig. 1.3. CD44 Exon Structure and RNA Splicing in Nonnal and Diseased Tissue ...... Fig. 1.4. Role of CD44 in Ce11 Motility and Proliferation ...... Fig. 1.5. RHAMM Isofonns ...... Fig. 1.6. RHAMM7sPredicted Secondary Stnicture ...... CHAPTER III. Fig. III. 1. Confirmation of the Specificities of RHAMM Antibodies-2 and -3 by Immunoblot Analysis ...... Fig. ïïï. 2. Detection of RHAMM Expression on the Surface of MDA-MB-23 1 and MCF-7 Cells by FACS Analysis ...... Fig. III. 3. Western Immunoblot Analyses of RHAMM Expression in MDA-MB-23 1 and MCF-7 Cells ...... Fig. III. 4. Western Imrnunoblot Analyses of RHAMM Expression in ras-transfected MCF- 1OA Cells ...... Fig. III. S. Western Immunoblot Analyses of Active erk, H-ras, and CD44 Expression in MDA-MB-23 1 and MCF-7 Cells ..... Fig. III. 6. Western Immunoblot Analyses of Active erk, H-ras, and CD44 Expression in ras-transfected MCF-IOA Cells ...... Fig. III. 7. Confocal Microscopic Analysis of RHAMM, erk and CD44 Expression in MDA-MB-23 I and MCF-7 Cells ..... Fig. III. 8. Confocal Microscopic Analysis of RHAMM, erk and CD44 Expression in ras-transfected MCF- IOA Cells ...... Fig. III. 9. Confocal Microscopic Analysis of CD44 and ras Expression in Breast Cancer Cell Lines and in ras-transfsted Breast Epithelial Cells ...... Fig. m. 10. Co-immunoprecipitation of RHAMM, erk, and CD44 ...... Fig. m. Il. Time-lapse Cinernicrography of MDA-MB-23 1 Cells and ras-transfected MCF-1OA Cells ...... CEIAPTER N. Fig. Ne1. Ras regufates a Cascade of Kinases ...... Fig. IV. 2. A Mode1 of HA and its Receptors in the raderk Signaiing Paîhway ...... - - - - -.- - - - .-...... 87 LIST OF ABBREVIATIONS

Ab Antibody BSA Bovine serum albumin CD44s Standard CD44 isofonn CD44v Variant CD44 isofom(s) cDNA Complementary DNA DMEM Dulbecco' s modified eagle' s medium DMSO Dimethyl suifoxide ECL Enhanced chemilurninescence ECM Extracellular matrix EDTA Ethylenediaminetetraacetate EGF Epidermai growth factor ER Estrogen receptor ERK Extraceiluiar signal regulated protein kinase ERM Ezrin, radixin, and moesin proteins FACS Flow cytometry FBS Fetal bovine semm FGF Fibroblast growth factor GABP Hyaluronan binding protein(s) GAG Glycosaminogl ycan GAP GTPase activating protein GD1 GDP dissociation inhibitor GPI Glycosylphophatidyl inositol GST Glutathione S-transferase GTP Guanine triphosphate HA Hyaluronan, hyaluronic acid, hyaluronate HAS Hyaluronan synthase HBSS Hank's balanced salt solution HRP Horseradish peroxidase IgG lmmunoglobulin

xii MABP Intracelluiar hyaluronic acid binding protein KDa Kilocialton mAb Monoclonal antibody MAP Mitogen activated protein MAPK Mitogen activated protein kinase MEK MAPWERK kinase MHC Major histocompatibility complex NK Natural killer (cells) OD Opticai density PAGE Polyacrylamide gel electrophoresis PCR Pol ymerase chain reaction PDGF Platelet-derived growth factor 4,5PrP2 4,s Phosphatidylinositol phosphate 2 PKC Protein kinase C PML Polymorphonuclear leukocytes PMSF Phenylmethylsulfonyl fluoride PTK Protein tyrosine kinase RACE Rapid amplification of cDNA ends RHAMM Receptor for hyaluronan mediated motility RHAMMs(m or h) Standard murine or human RHAMM RHAMM(A 1-5) RHAMM exons 1-5 deleted RIPA Radioimmunoprecipitation assay buffer RT-PCR Reverse transcriptase PCR SCD44 Soluble CD44 isofonn(s) SCLC Smail-ce11 lung cancer SDS Sodium dodecyl sulphate SH3 Src homology 3 TBST Tris-buffered saline containing Tween 20 TGF Turnor growth factor Tris Tris (hydroxymethy1)-aminomethane mc Trisrhodamine-isoth yiocyanate

xiii CHAPTER I

INTRODUCTION 1.1. Extraceiluiar Mntrix and Tumorigenesis

1.1.1. Tumorigenesis and Metastasis

Breast cancer wiil stnke one of every eight women in her Iifetime in North

Amenca. Although the last 20 years have produced several advances in the areas of early

breast cancer detection and therapeutic management, the incidence of this disease has

increased and rnortality has not decreased. It is likely that thtough a clearer

understanding of the molecular mechanismis underlying breast cancer development,

progression, and metastasis we will eventually be able to alter these numbers

significantly. There are many changes at the genetic level that are associated with bteast

cancer. They include the overexpression, remangement, or amplification of normal

cellular genes and proto-oncogenes, mutations that result in activation of oncogenes or

inactivation of suppressor genes, and loss of genetic material that presumably represents the loss of suppressor genes.

Cancer is a multi-step process with several sequential cellular alterations occurring before complete maiignant transformation results. A current mode1 for multistage carcinogenesis was developed by Vogelstein for colon cancer (Vogelstein et al., 1988;

Fearon and Vogelstein, 1990; Fearon et al., 1990), a number of genetic and phenotypic changes have however been identified in breast cancer (Dickson and Lippman, 1997;

Walker et al., 1997). For instance, suppressor gene expression may be lost from loci on at

least three genes such as pS3, BRCA1&2, and RB1 and mutation, activation, or

overexpression of many oncogenes such as c-erbB1, cerB/HEWneu, ras, c-myc and

Met cornmonly occur during the development of human colon cancer (Dickson and

Lippman, 1997; Waiker et al., 1997). These accumulated genetic alterations result in the progression of colon cancer from non-cancerous adenoma to invasive colon cancer. It is

apparent that a single alteration of one gene does not result in cancer, and it seems iikely

that for each cancer either a different combination of progressive alterations are involved

or the same alterations lead to differing phenotypes depending on target tissue specificity.

The route to breast cancer is not as well mapped as that to colon cancer, but by studying

the genetic changes occming at each level of breast ceIl growth scientists are beginning

to identify important participants in this process.

It is metastases fiom the primary tumor, as opposed to the original tumor, which usually kiIl the patient, and local regional lymph nodes are the most common and earliest

sites of metastasis of breast tumors. Many features of cancer including tumor ceil motility, increased ECM degradation, changes of tumor ce11 adhesion, proliferation and angiogenesis are required to create a metastatic deposit (Mareel et al., 1993; Weiss, 1994;

Levine et al., 1995; Price et al., 1997).

A variety of molecules have been shown to be important for the metastatic properties of tumor cells. These include autocrine production of cell adhesion and motility factors, growth factors and growth hormone receptors, interferons and components of ECM [e-g. hyaluronan (HA) ] (Turley et al., 199 1; Turley, 1992; Levine et al., 1995; Kantor and Zetter, 1996; Pnce et al., 1997). Collectively these factors regulate the ability of cancer cells to first detach from the primary tumor mass, invade the l ymphatic system, then spread throughout the bldstream (Tuszynski et al., 1996).

Tumor ce11 motility is required for the metastatic cells to intravasate, extravasate, and travel to target sites (Fidler et al., 1978; Liotta, 1986; Koop et al., 1996; Price et al.,

1997). Endothelial ce11 migration is also required for tumor anchored angiogenesis (Folkman et al., 1998). In addition to the above factors, degradation of the extracellular matrix (ECM), which depends on the balance of activated proteinases, matrix metalloproteinases (MMPs), and theu naturdly occurring inhibitors in the tissue, is likewise important for the metastatic process (Torre and Fulco, 1996; Andreasen et al.,

1997; Price et al., 1997).

1.1.2. HA and Tumorigenesis

Hyaluronan (also called hyaluronic acid, hyaluronate, or HA), a high-molecular- weight glycosaminoglycan, is implicated in various physiological functions, including maintenance of matrix structure, water homeostasis and ce11 proliferation, differentiation and locomotion (Laurent and Fraser, 1992; Turley et al., 1992; Savani et al., 1995b;

Catterail et al., 1995; Knudson, 1996; Collis et al., 1998). HA is a negatively charged, unbranched, high molecular weight single long-chah polysaccharide consisting of repeating disaccharide units, D-glucuro~cacid and N-acetyl-D-glucosamine, linked by

B 1-3 and 1-4 glycosidic Linkages (Fige Ie 1.). In solution, HA presents as an expanded stiffened helical prirnary configuration and exhibits multiple hydrophiIic and hydrophobic sites within each molecule. Its secondas, structures, where hydrophobic and hydrophilic segments altemate, is formed by intramolecular hydrogen bonds (Scott et al., 1989). This altemate occurrence of clustered hydrophobic and hydrophilic segments in HA structure provides the basis for the interactions between HA and the plasma membrane and its receptors, and also for HA to aggregate (Scott, 1989, 1992). Fig. 1.1. The Basic Repeating Disaccharide Sequence in HA

The role of HA in turnorigenesis has ken suggested by a number of experimental findings both in vitro and in vivo (Victor et al., 1999). For instance, HA promotes mammary carcinoma ce11 locomotion in vitro (Tanabe et al., 1993; Torre and Fulco,

1993; Auvinen et al., 1997), and HA production has been shown to correlate with the invasive and metastatic capability of both mouse mammary carcinoma ceIl lines and some human breast cancer ce11 lines (Angeiio et al., 1982; Sommers et al., 1994; Wang et al., 1996; Naoke et al., 1999). hcreased expression of HA has been correlated with poor differentiation both in adenocarcinorna ce11 lines and in tumor stroma of ductal breast cancer (Auvinen et al., 1997; Ropponen et al., 1998). Higher levels of HA have been found in the sera of breast cancer patients, and these levels correlate with breast cancer progression and response to chemotherapy (Classen et al., 1995). Furthemore, HA was found to increase in tumors, paaicularly in invasive areas, in cornparison with normal tissues (Bertrand et al., 1992, 1997; Itano et al., 1999).

via a complex site known as the iink module (Kohda et al., 1996). RHAMM is a

prototype of ceU-associated hy aladherins that occur at mu1 tiple cellular loci, including the

ce11 surface, cytoplasm and nucleus and are characterized by the lack of a trammembrane

signal sequence or iink module (Table 1. 1.). Rather, HA binds to hyaladhenns via

simple motifs of basic amino acids (Yang et al., 1994; Kohda et al., 1996). The

mechanisms by which these proteins are released and bound to the cell surface are

unknown.

Fig. 1.2. The Family of Hyaiaâherins

RHAMM Table 1.1. HA Binding Proteias

HYALADHERINS LINa MODULE [B(X7)Bl nfwllF COVALENT CONTRIBUTION CONTRIBUTION LINgAGE cdc37 none major none apparent P68 none major none apparent I 1 1 RHAMM 1 none 1 major 1 none apparent HBP (hepatocyte not de termineci not determined none apparent binding protein) CD44 major present, minor 1 none apparent 1 1 I VersicadHyaIumnectin 1 major I present, minor I none apparent

pp I major 1 pment, minor 1 none apparent 1 1 1 1 Neurocan 1 major 1 present, minor I none apparent 1 I 1 Brevican major I present, minor I none apparent I1 1 I Link protein I major I present, minor I none apparent Fibrinogen not determined not detennined none apparent Trypsin inhibitor none present but importance major not determined The binding mechanism and affinities of the hyaladherins to hyaluronan via the hic module, smaii basic amho acidic motifs, or covalent linkages. PP~WP~~et al., 1999

1.2. The HA Binding Receptors: RHAMM and CD44

Both RHAMM and CD44 are encoded as single genes @alchau et al., 1980;

Gunthert et al., 199 1; Ghaffari et al., 1995, Entwistle et al.; 1995; Wang et al., 1996;

Ponta et al., 1998; Fieber et al., 1999), but occur as multiple protein foms due to extensive alternative RNA splicing and pst-translational modification.

1.2.1. CD44

CD44 was first described as a ce11 surface molecule of T-lymphocytes, granulocytes, and cortical thymocytes (Kohda et al., 1996), rediscovered as the phagocytic glycoprotein-1 (Pgp-1) (Mackay ei al., 1988) and GP90Hemies (Goldstein et ai, 1989), and later identifid as a widely-expressed protein which functions as a major receptor for HA (UnderIùll et al., 1987; Adoet al., IWO). CD44 is a multifimctional receptor involved in cellcell and cell-ECM adhesion, i.e. cell motility, tmcking, lymph node homing, lymphocyte activation, presentation of chemokines and growth factors to traveling cells, and transmission of these growth signals (LesIey et al., 1993). As well,

CD44 participates in the endocytic uptake and intracellular degradation of HA (Culty et al., 1994; Hua et al., 1993), and in the transmission of signals mediating hematopoiesis and apoptosis (Ayroldi et al., 1995) that are relevant to wound repair and tumor progression.

CD44 ligands other than HA include the ECM components collagen 1 and N

(Wayner et al., 1987), fibronectin (Jalkanen and Jalkanen, 1992), laminin (Radotra et al.,

1994), and the chondroitin sulfate modified invariant chah of class II major histocompatibility complex (MHC) (Naujokas et al., 1993), mucosal addressin (Picker et al,, 1989), serglycin (Toyama et al., 1995) and osteopontin (Weber et al., 1996).

Consti tutivel y, the molecule is predominantly expressed in regions of active ce11 growth

(Mackay et al,, 1994), and is, notably, highly expressed in skin (Tammi et al., 1988), and in metastatic breast tumor cells (Culty et al., 1994)-

1.2.2. Structure of CD44

Sequence conservation of CD44 between rat, mouse, horse, dog, cow, hamster, baboon, and human exceeds 708 (Naor et al., 1997). The human CD44 gene contains 50-

60 kb of genornic DNA and consists of at least 20 known exons (Screaton et al., 1992,

Ponta et al., 1998). Exons 1 to 16 encode the extracellular domain of the protein, exon 18 Exon: u Distribution: Phyriological Role

Full Length OQQPDOOOOOOOOOOOQQOO -apical ectodermal ndge CD44v of keratinocytes OPOPP 000000000P0I l - human keratinocytes Standard (CD44s) long tail -lymphocyte homing Standard (CD44s) short tail -ceIl migration -immune response -HA receptor -tumor progression

Pige1.3 CD44 exon structure and RNA aplicing in normal and diaeared tiaaue. The figure dao shows known tiaaue distribution and potentirl physiologicrl roles. The leader peptide (LP), transmembnne domain (TM) and cytoplmmic tail (CT) portion8 are indicated The rhaded exon 10 is believeâ to be important in conferring invasive ibilitiea in tranaformed cella. Modified From: Paiwand et al., 1999. encodes a shoa transmembrane domain, and exons 19 and 20 encode the cytoplasmic

domain (Fig. 1. 3.). Exon 5a to 14 are altematively spliced, leading to a number of

different potential isoforms with tremendous variability in the sequence of their

extracellular domain (Tolg et al., 1993). Exons 19 and 20 are also altematively spiiceâ,

leading to two potential cytoplasmic tails (Lokeshwar et al., 1991). Post-translational

modification by N-glycosylation (Mackay et al., 1988, Bartoiazzi et al., 1996), 0-

giycosyiation (Dasgupa et al., 1996, Bennett et al., 1995) and glycosaminoglycanation

with heparin sulfate (Jackson et al., 1995) and chondroitin sulfate (Sleeman et al., 1997)

create additional structural and îùnctional diversity. In totd, there are 20 known isoforms

of different molecular sizes (85-230 kDa) (Naor et a[., 1994). Several experimental

studies suggest that expression of the 85 kDa CD44 (standard isoform), promotes tumor

progression (S y et al., 1991 ; Hart et al., 1994).

1.2.3. Domaias of CD44 Related to CeIi Motility and Cell Cycle Control

A key domain relevant to ce11 cycle control and motility mediated by CD44 is the

HA binding domain. This domain of CD44 is homologous to the HA binding structure

recently characterized in link protein by NMR (Fig. 1.3. and Table 1. 1.) (Bajorath et al.,

1998). Interestingly, mutation of key basic amino acids within this structure which

resemble RHAMM HA binding sites (Yang et al., 1994) block the ability of CD44 to

sustain proliferation (Bajorath et al., 1998) but have little affect on HA binding, in contrast to RHAMM, where mutation of these basic amino acids ablates HA binding

(Hyman et al., 1991; Yang et al., 1994). The solution structure of the link module from

human TSG-6 consists of two alpha helices and two anti-parallei beta sheets arranged around a large hydmphobic core (Kohda et aL, 1996)- Jhterestingly, not a11 CD44- expressing cells are able to bind HA, but this property can be acquired or can oçcur transiently (Hyman et al., 199 1). The abiiity of HA to bind to CD44 is regulated by both protein conformation, rather iike integrin activation, and by glycosylation patterns. Thus,

CD44 can be stîmuIated to bind HA by phorbol esters, anti-CD44 antibodies, or deglycosylation (Zheng et al., 1995). Blocking anti-CD44 mAbs studies suggest that topography of the CD44 epitopes and their orientation toward the HA binding site determine the ability of antibodies to interfere with HA binding (Lokeshwar et al., 199 1,

Galandrini et al., 1993). Clustering of CD44 proteins, which is dependent upon cytoskeletal proteins, also seems important to its ability to bind HA (Galandrini et al.,

1993). Certain cells (including some B and T ce11 lines) appear constitutively able to bind

HA. However, further studies are required to define the molecular mechanisms that result in -/KA interactions as well as to assess the impact that these interactions have on ce11 behavior relevant to tumorigenesis.

1.2.4. CD44 Signaüng

SignaLing through CD44 involves protein tyrosine kinase (PTK), transcription factor, and cytoskeletal players. This diversification of signaling is not surprishg given the multiple effects CD44 has on cells. For instance, substrate-attached cells such as fibroblasts and keratinocytes use HA/CD44 interactions for ce11 adhesion and motility, as well as proliferation and HA metabolism. in white cells, HNCD44 interactions are required for lymphocyte homing and activation by cytokines during infiltration into tissues. However, the sipalhg pathways that are responsible for these effects are only beginning to be understood.

In T and B cells, NK cells, PMLs and macrophages, HA-bound CD44 stimulates protein tyrosine phosphorylation, calcium infiux and gene activation (Naujokas et al.,

1993; Galandrini et aL, 1996; Pericle et al., 1996). Blocking monoclonal CD44 antibody studies indicate that HNCD44 interactions are important for cytotoxic effector functions in these cells, as well as for ceii proliferation and cytokine secretion which are responses that are key to tumorigenesis (Webb et al., 1990; Gaiandrini et al., 1993; Pericle et al.,

1996). The cytoplasmic domain of CD44 binds to active Lck and Fyn kinases within protein-nch GPI islands in T celis and endothelial ceils (Funaro et al., 1994; Iïangumaran et al., 1998), and these islands appear to be necessary for CD44 to generate a protein tyrosine kinase signal. In both substrate-attached cells and in lymphocytes, CD44 also participates in the transmission of growth factor-mediated signals (Naor et al., 1991;

Bourguignon et al., 1993; Sommer et al., 1995; Taher et al., 1996). CD44 is also required for signaling through growth factor receptors such as her2neu (Bourguignon et al., 1997)

(Fig. 1.4.)

CD44 appears to modiw signais available to the ce11 at least in part by regulating the structure of the actin cytoskeleton via interactions between the cytoplasmic domain of

CD44 and actin binding proteins. These interactions appear to be dynamically regulated and result from modifications of the CD44 intracellular domain, including altemate splicing of variant exons, PKC-mediated phosphorylation, acylation by acyl-tramferase, palrnitoylation, and GTP binding (Naor et al., 1997). Part of the ability of CD44 to regulate ce11 motility is due to its direct binding to ERM proteins, namely ezrin, radixin, and moesin (Tsukita et al., 1994, Hirao et al., 1996). ERM proteins are thought to control the distribution of other adhesion molecules on the ce11 surface and to link actin to the plasma membrane, especially in ceIl surface projections (Vaheri et al., 1997). hoand colleagues (Hirao et al., 1996) have provided strong evidence that CD44 functions within a signaling cascade downstream of Rho. Rho belongs to the family of srnail GTPases, including ras, rac, and cdc42 that regulate important actin-relatecl events (Takaishi et al.,

1993; Hotchin et al., 1996). This group speculates thai activated Rho causes an upregulation of PIP-5 hase leading to increased ce11 membrane bound 4,s-PIP2 levels which then promotes CD44ERM complex formation. CD44 may further regulate the

Rho-GDP dissociation inhibitor (GD0 as it tightly binds to the CDWERM complex. It is presently unclear, however, whether Rho-GD1 recmits Rho to the plasma membrane to be activated or sequestered (Araki et al., 1990; Tsukita et al., 1994; Takai et al., 1995).

Fig. 1.4. Role of CD44 in Ceii Motility and ProiiTecation

From: Kalish et al,, 1999 1 1 Prolifcmtioii Motility & Invasion RHAMM is member of a group of cell-associated hyaladherins that occur at several cellular loci and thaî perform multiple functions in regulating cell motility and the ce11 cycle (Turley et al., 1982, 1994; Mobapatra et al., 1996; Toole et al., 1997; Assmann et al., 1998; Hofmann et al., 1998; Wang et al., 1998)- For instance, ceii surface forms of

RHAMM are transiently expressed in most ceus but are nevertheless key to regulating ce11 motility as detennined by anthdy blocking expenments (Boudreau et ai., 1991;

Hardwick et al., 1992; Samuel et al., 1993; Hall et al., 1994, 1995; Pilarski et al., 1994;

Turley et al., 1994; Nagy et al., 1998; Savani et al., 199Sa; 199%; Masellis-Smith et al.,

1996; Delpech et al., 1997; Zhang et al., 1998). Intracellular foms of this class of hyaladherins, including RHAMM, bind to and chaperone signaling molecuies involved in regulating ce11 cycle and cell motility (Fig. 1.2.) (Grarnmatikakis et al., 1995, Masellis et al., 1996; Kimura et al., 1997). These types of hyaladherins may also perform functions within the nucleus. Such hyaladherins typically lack a link module for binding HA but rather utilize short sequences encodhg basic amino acid motifs (Table 1.1.) (Yang et ai-,

1994) which are required for ce11 motility and proliferation (Samuel et al., 1993; Sherman et al., 1994). Even though they are present on the ceil surface (Samuel et al., 1993;

Sherman et al., 1994; Grarnmatikakis et al., 1995; Kimura et al., 1997; Bajorath et al.,

1998; Crainie et al., 1999) this cIass of hyaladherins is also characterized by an absence of both signal sequences and transmernbrane domains. Therefore, the moiecular basis for their subcellular distribution is not yet clear. Based upon their modular and dynamic subcetlular location and the different mechanisms by which they bind to HA, these proteins likely regulaie cell motility and the ceU cycle in a manner that is fundamentally distinct from the more well characterked HA receptor, CD44

RHAMM was originally isolated fiom supernatant media of nonconfluent embryonic chick heart fibroblasts (TurIey et al., 1992). Subsequently. it was found intracellularly and on the ceil surface (Hardwick et al., 1992; Hall et al., 1994, 1995;

Zhang et al., 1998; Masellis-Smith et al., 1996; Crainie et al., 1999). Tt has emerged as a key regulator of HA-mediated motility and cytoskeletal remodeiing (Entwistle et ai.,

1996). Since HA has been considered to act at the surface to regulate ce11 function, most studies have focused on the functions of surface-associated RHAMM and this fonn of

RHAMM has been shown to play a role in growth factor responses (Samuel et al., 1993;

Zhang et al., 1998), mocility (Turley et al., 1994; Masellis-Smith et al., 2996; Toole et al., 1997) and ce11 cycle (Mohapatra et al., 1996). Since, as noted above, RHAMM's location at the ce11 surface is often dynamic and transient, in particular decreasing rapidly after plating (Samuel et al., 1993; Zhang et al., 1998), it may function to initiate events reIevant to ce11 motility, uniilce CD44 which may sustain this cellular function. Severai recent reports showing an absence of ce11 surface RHAMM (Teder et al., 1997; Assmann ef al., 1998; Hofinann et al., 1998; Weiss et al., 1998) underscore the transient nature of this protein and emphasize the need for careful timed analyses to detect expression.

1.2.6. REAMM Isoforms

Two murine RHAMM cDNAs were originally isolated from fibroblasts

(Entwistle et al., 1995; Hofmann et al., 1998), both of which contained in-hestart and upstream stop codons and therefore appeared to represent full-length cDNA. Later, isotation of a human RHAMM cDNA, which was longer than these mutine RHAMM transcripts in its 5' terminus, was isolated and has been cautiously designated the fuii- length standard fonn of RHAMM (Wang et al., 1996). The sequence of this human cDNA was recently confirmed (Assmann et al., 1998) and a murine homologue of this

RHAMM form has been reported (Hofmann et al., 1998; Fieber et al., 1999).

The standard RHAMM mRNA transcript encodes the largest intraceUular

RIHAMM protein, 85 kDa (human) and 95 kDa (murine), that has been designated standard RHAMM, (Fig. 1. 5.). Evidence is accumulating for the existence of multiple alternative spliced variants of the standard fom, (Fig. 1.5.) (Wang et al., 1996; Assmann et al., 1998; Hofmann et al., 1998; Crainie et al., 1999). This includes the presence of multiple RNA vanscripts detected via primer extension, 5' RACE,and RT-PCR of poly

A mRNA populations isolated fiom 3T3 cells, malignant B ceils and breast cancer cells and the occurrence of several protein bands of molecular weights predicted by the above

RNA transcripts, as detected in Westem analysis using both monoclonal and polyclond anti-murine RHAMM antibodies (Entwistle, 1995; Assmann et al., 1998, Hofmann et al.,

1998; Crainie et al., 1999). These results suggest that RHAMM, Iike CD44 is subject to extensive al temative splicing. The standard form of RHAMM reacts with mtibodies 1, 2 and 3 shown in Fig. III. 1. Shorter RHAMM forms detected by Westem blots react only with Ab-2 and Ab-3, and therefore appear to represent N-terminal tnincations of the standard form. These RHAMM forms are maximally expressed early after plating at subconfluency. These proteins of 60-73 Dahave been reported by other laboratories, nevertheless, they usually represent minor forms of RHAMM protein (Hall et al., 1995;

Masellis-Smith et al., 1996; Nagy et al., 1998; Crainie et al., 1999). RHAMM Idorms Figo 1.5. RHAMM hfolltl~are generated by alternative spliciag of the standard RHAMMs mRNA transcript. Several shorter, activated fonns of RHAMM have also been reported, and these may be generated either by separate MA transcripts, intemai start codon usage of the standard RHAMM ttanscript, or proteolysis of the standard RHAMM protein.

Harrison adTdey et al., 1999

1. 2. 7. Domains of RaAMM Related to Ceii Motility and Cell Cycle

Control

Surface FZHAMM regulates signals generated by both HA (Turley et al., 1982;

1994; Mohaptra et al., 1996; Delpech et al., 1997) and growth factors such as PDGF

(Zhang et al., 1998) and TGF-p (Samuel et al., 1993). Structural and hinctional analysis

of RHAMM indicates this protein is largely coiled coil a-helices separated by linear

stretches often preceding functional domains (Fig. 1. 6.). The coiled coil structure may

permit self-association, which would provide a rationale for the effectiveness of mutant

RHAMM foms to act as dominant negative hinction suppressors (Hall et al., 1995).

Experiments using exon-specific antibodies suggest that D2-D5 domains are each

required for RHAMM-promoted ce11 motility and for passage through the ce11 cycle (Hall et al., 1994; Mohapatra et al., 19%; Piang et al., 1998). Deletion or mutation of any one

of these domains is sufficient to ablate the ability of RHAMM to signal aad the ability of

RHAMM overexpression to transfomi fibroblasts (Entwistle et al., 1996). In murine

ceIIs D 1 negatively regulates the ability of shorter RHAMM forrns to activate erk kinase

(Zhang et al., 1998). RHAMM thus resembles oncogenes such as raf, which can be

activated by removal of peptide sequences.

The N-terminal Dl domain unique to RHAMMs that negatively regulates the

function of downstream RHAMM sequences is an entirely novel sequence, and the

manner in which it regulates the function of D2-D5 is not yet clear (Zhang et al., 1999). It

is charactenzed by the presence of an SH3 domain and multiple erkl phosphorylation

sites. It is possible that Dl may cover at least one of RHAMM's downstream domains by binding to an accessory, regulatory protein. Alternatively, the SH3 binding domain rnay place RHAMMs in a separate subceilutar cornpartment from RHAMM(A1-5), restricting access of erk 1, for instance, the key substrates that are required for signaling motiiity and ce11 cycle progression. D2 encodes an imperfèct leucine zipper, and has been shown to permit binding of ce11 surface RHAMM to fibronectin in the extracellular matrix, an interaction that is required for the formation of podosomes, enhancement of celi motility, and release of metalloproteinases (Cheung et al., 1999). D3 of intracellular RHAMM mediates an association between RHAMM and MEK 1, forrning a RHAMM/MEK l/erkl cornplex detected following imrnunoprecipitation of RHAMM (Zhang et al., 1998). This interaction is indirect since MEK does not bind to RHAMM in vitro. hterestingly, D3 encodes a 7 amino acid sequence, VSLEKEL, that is present in another MEKl binding protein, MP-1 (Zhang et al., 1999). D4 is a 21 amino acid sequence repeated up to 8 times in murine RHAMM, and is required for full binding of erkl to RHAMM.

Antibodies to this domain added to the culture medium promote ce11 motility and focal contact turnover, mimicking the effect of hyaluronan and indicating that this domain is also important to the function of ce11 surface RHAMM.

The first reported functional domains of RHAMM were its hyaluronan binding motifs present in D5, which encode sequences of basic amino acids that are also cornmon to other intracellular hyaladhe~s,such as cdc37 and p68 (Entwistle et al., 1996). The abiiity of HA to signal motilïty via RHAMM irnplies that the HA binding domains are also necessary for signal transduction (Hall et al., 1994, 1995). On intraceliular RHAMM forms, D5 mediates binding of erkl to RHAMM. It therefore appears that cell surface

E2KAMM binds to hyaluronan via the D5 domain, while intracellular forms of RHAMM utilize this site to bind to erkl. This is consistent with evidence that mutations in this domain in intracellular RHAMM fonns block activation of erkl (Hail et al., 1995).

Sugar transport signatures are present in the N-terminus of v5 and in the carboxy- terminal sequence common to ail RKAMM foms, and may be required for transport of hyaluronan into the ceII (Collis et al., 1998). Furthemore, a cyclin signature present in al1 foms is consistent with the involvement of RHAMM in the ce11 cycle (Mohapatra et al.,

1996). However, the protein partnea and the precise molecular function of these intriguing homologies are not yet clear. Finally, RHAMM contains many potential sites for post-translational modifications, including N-glycosylation sites, myristoylation sites, and notably, multiple serine-threonine phosphorylation sites. The effects that these modifications might have on subcellular localization and protein interactions remain to be determined. Fig. 1.6. RBAMM'sPredictedSecondary Structure

Dl- is a novel protein domain that negatively regulates the ability of RHAMM sequence to promote activation of erkl kinase. D2- encodes an imperfect leucine zipper that is required for RHAMM- mediate ce11 rnotility and pcdosame formation- D3-is a novel sequence that is requîred for interaction of intraceiiular RHAMM with MEKl, De- is a novel sequence that is repeated up to 8 times in the murine protein and contributes to the binding of erkl to intracellular RHAMM. DS-encodes hyaiuronan binding motifs that are responsibte for interaction of hyaluronan with ce11 surface RHAMM and erkl binding to intracellular RHAMM. Hamson and Turley et ai.; 1999

1.3. Tumor Progression is Associated with Elevated Expression of CD44

and RHAMM

In 1989, Stamenkovic and colleagues (Stamenkovic et al., 1989) found that a

variety of carcinoma ce11 lines and solid tumors overexpressed the CD44 gene. In 1991,

Gunthert and colleagues (Gunthert et al., 1991) discovered that an isoform of CD44,

when inserted into the genetic sequence of a non-metastasizing tumor, gave it metastatic

properties. These initial discoveries indicating that CD44 was involved in the metastatic

process led to the large amount of research into the possible mechanisms and the degree

of involvernent of CD44 Today's literatwe indicates that most human cancers with

metastatic properties tend to express increased Ievels of CD44 (Hart et al., 1991; Sy et al., 1991; Sneath et al., 1998; HemraGayol and Jothy, 1999). In hematopoietic

malignancies, the levels of CD44 expression correlate with tumor dissemination into

lymph nodes (Roos et al., 1991). High levels of CD44 expression have been also noted in

solid tumors such as melanoma (Hart et al., 199 1; Thomas et ai., 1993; Guo et al., 1994),

gastric carcinoma (Washington et al., 1994; Gunthert et ai.. 1995), colon carcinoma

(Heldin and Pertoft, 1993), rend carcinoma (Gunthert et al., 1995) and non-Hodgkin's

lymphoma (Staurder et al., 1995)- Depending on the cell type and perhaps also on the

local microenvironment of the ce11 undergoing malignant transformation, dif5erent

CD44v expression has been correlated with more advanced tumor stage and possibly with

poor prognosis of many but not dl Nmor types. For example, in the case of non-

Hodgkin's lymphomas (Stawder et al., 1995) and colon carcinoma (Mulder et al, 1997), expression of CD44v6 is correlated with poor prognosis, whereas CD44v4-v10 is

sufficient to promote metastatic behavior in pancreatic carcinoma ceils (Sleeman et al.,

1997). However, contradictory data is found regarding the correlation between CD44 expression and cancer progression in breast carcinoma

Like CD44 RHAMM expression is variable depending on ce11 type. While

RHAMM expression is absent or at low levels in non-transformed confluent cells in vitro and in normal most fully-differentiated tissues in vivo (Turley et ai., 1989; Pilarski et al.,

1994, 1999; Zhang et al., 1998; Cheng et al., 1999), it is markedly up-regulated in

fibroblasts following TGF-8 stimulation (Samuel et al.. 1993) and expression of the ras

oncogene (Turfey et al., 1991; Hardwick et al., 1992; Turley et al., 1993; Hall et al.,

1995). Enhanced expression of RHAMM is observed in diseased cells such as fibroblasts

following injury (Savani et al., 19951, 199%; Paiwand et al., 1999), in smdl ce11 lung carcinoma (SCK) celis, in adenocarcinornas, squamous ce11 carcinomas, and large cell carcinomas (Teder et al., 1995). RHAMM overexpression has also been linked to late stage astrocytoma (J. Rutka, personal communication), and to poor prognosis in lung adenocarcinorna associated with the presence of mutant active ras (M-S.Tsao, personal communication). Moreover, RHAMM expression in breast cancer is linked to outcome associated with lymph node metastasis capabilities and is an independent prognostic factor for poor outcome (Wang et al., 1998). Finaliy, RHAMM has been reported to be overexpressed in malignant versus benign human pancreatic tumor cells (Abetamann et al., 1996). In al1 these studies, high levels of RHAMM mRNA expression correlated with the aggressiveness of tumor cells, poorly differentiated phenotype, and a high metastatic potential when injected into nude rnice (Abetamann et al., 1996; Wang et al.,

1998; Pilarski et al., 1994, 1999).

1.4. Hypothesis, Rationale, and Objectives of this Study

Several reports suggest that expression of both CD44 (Jamal et al., 1994; Penno et al., 1994; Kogerman et al.' 1996) and RHAMM (Hall et al., 1995; Wang et al., 1998) appear to be regulated by mutant active ras overexpression. The ras oncogene and the activation of the raderk signaling pathway have been implicated in breast cancer development (El-Ashry and Lippman, 1994). Molecular mechanisms responsible for increased activation or expression of MAP kinase in breast cancer in the absence of mutant ras forms have not ken clearly defined, although dues may be provided by observations that both CD44 (Jamal et al., 1994; Penno et al., 1994; Kogerman et al.,

1996) and RHAMM are associated with erk activation and activity of genes regulated by erk (Bourguignon et al., 1997; Wang et al., 1998, Yu and Stamenkovic, 1999).

Furthemore, both CD44 and RHAMM have ken linked to formation of invadopodia

(Bourguignon et al., 1998a; B. Yang, personal communication), consistent with a role in

tumor metastasis and progression.

In this thesis, it is hypothesized that RHAMM and CD44 expression, and erk

activation are linked in the motility of several human breast cancer cell lines that Vary in their aggressiveness in nude mice.

Therefore, this project was designed to fuKiJl the foilowing objectives:

A) To determine if levels of RHAMM, CD44 and active erk are higher in the more

motile and aggressive ce11 lines.

B) To assess if the expression of mutant active ras, erk, CD44 and RHAMM are

correlated.

C) To test the biologicd effects of blocking erk activity in these aggressive ceU lines.

D) To investigate if RHAMM and erk, as well as RHAMM and CD44 CO-distributeand

CO-associateon more aggressive ce11 lines.

E) To further understand the signaling events downstrearn of the ras pathway which

involves RHAMM and CD44 CHAPTER II

MATERIALS AND METHODS II. 1. Ceil Culture

Human breast carcinoma ce11 lines MDA-MB-23 1 and MCF-7 were obtained

from American Type Culture Collection (Manassas, VA) and were cultured in

Dulbecco's Modified Eagle's Medium (DMEM) (Gibco BRL, Burlington. Ootano)

supplemented with 10% (v/v) heat-inactivated fetal bovine serurn (FBS) (Hyclone

Laboratories Inc., Logan, UT) and IO mM HEPES (Sigma Chernical Co., St. Louis, MO),

at pH 7.2.

Immortalized normal human breast epitheliai ce11 lînes MCF-lOA transfected with

the empty pH106 plasmid containing the neomycin cesistance gene, MCF-1OA ceïïs

transfected with human H-ras protooncogene, or with human mutant H-ras oncogene

mutated at (G12-V12). were a kind gift of Dr. Channing Der (North Carolina) and grown

as described by Soule et al. (1990), and Basolo et al. (1991). Bnefly, the ceils were

grown in DMEMIF-12 (1:l) supplemented with 5% equine serum, 0.1 @mi cholera

toxin, 10 pg/d insulin (Gibco BRL), 0.5 pghl hydrocortisone (Sigma) and 0.02 pg/ml epidermal growth factor (Coilaborative Research Inc., Pdo Alto, CA).

Al1 ce11 lines were routinely maintained on plastic tissue culture plates (Costar,

Cambridge, MA) at 37OC in a 95% air, 5% CO2 atmosphere in a 98% humidity- controlled incubator. MDA-MB-23 1 and MCF- 1OA-mutant active ras cells were

passaged every 2-3 days while MCF-7, MCF- 1OA-empty vector, and MCF-1OA-

protooncogene ras cell lines were passaged every 4-5 days prior to their reaching

confluency. To subculture, ce11 were washed with phosphate-buffered saline (PBS) then

detached with a non-enzymeceil-dissmiation solution (Dissociation Medium, Sigma). Al1 experiments were conducted with 50% subconfluent cells and analysis done at 2-24 hours as indicated foilowing subculturing in growth medium.

II. 2. Antibodies

Polyclonal RHAMM antibodies (Zymed, San Diego, CA) used in this study were prepared against the foilow ing sequences: antibody - 1 was prepared against peptide sequence KSKFSENGNQKN (aa150-162) of human RHAMM (Wang et al., 1996;

Assmann et al., 1998), antibody-2 was prepared against VSIEKEKlDEKS (aa.217-229) of human RHAMM; and antibody-3 was prepared against the peptide sequence

QLRQQDEDFR corresponding to a.& 543-553 of human RHAMM. These peptides were chosen for antibody preparation based on favorable surface probability, hydrophilicity, and antigenic index, using protein analysis software Antheprot 2.9g. Candidates were then analyzed using Prosite software for potential pst-secondary modification sites that may interfere with antibody recognition of native proteins and based upon these analysis, the optimal sequences indicated above were selected, Antibodies were prepared in three month old New Zealand white rabbits. To determine antibody specificity, anti-RHAMM antibody-2 pre-incubated with lûû-fold excess glutathione-S-transferase (GST)-RHAMM fusion protein linked to beads (1 pg antibdy-2/20 pi of beads) was incubated for 1 hr at

4 OC on a rotator, then centrihged for 5 minutes. The resulting supernatant was used to probe the membranes. Non-immune rabbit IgG was used as control.

Monoclonai antibodies to p2 1ras and the MAP kinase (erk 1) were purchased from

Oncogene Science (Cambridge, MA) and an anti-CD44 antibody (Hemes3) was the kind gift of Dr. Sirpa Jaikanen (University of Kuopio, Finiand). For immunoblottiag detection, horseradish peroxidase (HRP)-conjugated goat

anti-mouse IH+L) IgG was purchased from Bio-Rad Laboratones (Hercules, CA), and

donkey HRP-conjugated anti-rabbit IgG specific to F(abT)2fragment was purchased from

Amersham Canada (Oakviiie, Ontario). Al1 other fluorochrcme-conjugated secondary

antibodies were specific to the F(ab7)* fragment of primary antibodies and were obtained form Jackson ImmunoResearch Laboratones (West Grove, PA).

II. 3. Western Immunoblotting and Imrnunoprecipitation

Cells were plated at 50% subconfluence for 12 hours, after celi plating, were washed with ice-cold PBS, lysed with ice-cold RIPA lysis buffer (25 rnM Tris-HCl, pH

7.2, 0.1 % SDS, 1% Triton-X-100, 1% sodium deoxycholate, 0.15 M NaCl, 1 nM EDTA, and 50 mM HEPES [pH 7-31) containing the protease inhibitors leupeptin (1 pg/ml), phenylmethylsulfonyl fluoride PMSF, 2 mM), pepstatin A (1 glrnl), aprotinin (0.2

TlU/rnl) and 3,4-dicholoroisocoumarin (200 mM), sodium orthovanadate, and 1 mM NaF

(1 rnM) (Sigma). Ce11 lysates were then micro-centrifuged at 13,000 g for 20 minutes at

4OC (Heraeus Biofuge 13, Baxter Diagnostics, Mississauga, Ontario) after standing for 20 minutes on ice. Protein concentrations of the supematants were determineci using the DC protein assay (Bio-Rad). 10 pg of total protein from each ce11 lysate was loaded and separated by electrophoresis on a 10% SDS-PAGE gel together with prestained molecular weight standards (Gibco BRL). Following electrophoresis, and transfer to nitrocellulose membranes (Bio-Rad) in a buffer containing 25 mM Tris-HCl (pH 8.3),

192 mM glycine, and 20% methanol using electrophoretic transfer cells (Bio-Rad) at

lOOV for 1.5 hours at 4OC. Additionai protein binding sites on the membrane were blocked with 5% defatted milk in TBST (10 mM Tris base (pH 7-4). 150 mM NaCl, and

0.1 % Tween 20) (Sigma). The membranes were then incubateci with the primary antibody

for either RHAMM (antibody-1 or -2), ras, erk or CD44 (ali diluted at 1: 10or 1 pghl

in 1% defatted milk in TBST) for 2 hours at room temperature and washed three times at

15 minute intervals with 1% defatted miik in TBST. Immunodetection was performed

using secondary antibodies conjugated to HRP (diluted 1:Sûûû (1 pg/mi) in 1% defatted

milk in TBST for 1 hour at room temperature followed by three washes with TBST.

Blotting was visualized by the enhanced chemiluminescence (ECL) Western blotting

detection system (Arnersham Phannacia Biotech, Piscataway, NI) according to the

manufacturer's instructions. Quantification of optical densities of the reactive protein

bands was performed on a Bio-Rad Video Densitometer. The specificity of the anti-

RHAMM antibody was confirmed by probing blots with either non-immune rabbit IgG,

or anti-RHAMM antibody-2 pre-incu bated with RHAMM fusion protein as stated above.

To account for variations in loading, padlel SDS gels were carried out with the

experiments and equd amounts of the protein were separated on these gels. These other

gels were then stained with Coomassie blue dye in order to confirm equal loaciing. The

densitometric results were presented as mean of three experiments + standard deviations.

Immunoprecipitation analyses were performed using 400 pg of protein from each ce11 lysate mixed with 5 pg of either anti-RHAMM antibody-2, anti-CD44, antierkl,

anti-rabbi t IgG (for polycIona1 an tibodiesj, or anti-mouse IgG antibodies (for monoclonal

antibodies). After 12 hours of incubation at 4°C on a rotator, 25 pl of a 50% suspension of protein MG-Sepharose beads (Gibco BRL) was added to each tube and the samples

were mixed end-over-end for another 4 hours at 4 OC. The beads were pelleted by brief centrifugation at 7000 g and washed three times with cold 0.5% Triton-X-100/PBS.

Bound proteins were released from the beads by boiling in 25 @ of 2X Laedi buffer for 5 minutes. Protein samples were subjected to 12% SDS-PAGEand imrnunoblotted in

Western assay as described above.

II. 4. Time-Lapse Cinemicmgraphy

To quanti@ the effect of blocking CD44 (Herrera-Gay01 and Jothy, 1999) and

RHAMM (Hall et al., 1995; Pilarski et al., 1999) antibodies, cell lines expressing different levels of RHAMM were seeded on T-25 flasks (Costar, Cambridge, MA) at 16 cells. Cells were incubated with either anti-RHAMM antibody (Antibody-2, 30 pghl), anti-CD44 antibody (Hemes3,30 pg/ml), or mixture of anti-RHAMM (Antibody-2,30 pg/rnl) and anti-CD44 antibodies (Hermes3, 30 pg/rnl) for 30 min prior to filming. As a control, a mixture of mouse and rabbit IgG (30 pg/ml each) was used. Cell locomotion was monitored for a period of 6 hours using a X10 modulation objective (Zeiss,

Germany) attached to a Zeiss Axiovert LOO inverted microscope equipped with Hoffman

Modulation contrat optical filters (Greenvale, NY) and a 37 OC heated stage. Ce11 images were captured with a CCD video camera module attached to a Hamamatsu CCD camera controller. Motility was assessed using Northem Exposure 2.9 image anaiysis software

(Empix Imaging, Mississauga, Ontario). Nuclear displacement of 20-30 cells were measured and data were subjected to statistical analysis (see below). Each expriment was repeated at least three times. To test the involvement of the MAP kinase pathway in the motility of these cells, PD098059 (2-[2'-amioo-3'-methoxyphenyl]-oxanaphthalen4 one]) compound, which inhibits MEKl (Dario et al., 1995), was purchased from Calbiochem Biosciences (Mississauga, Ontario). A stock concentration (50 mM) of this compound was prepared in DMSO and frozen at -70 OC. The cells were incubated with the MEK inhibitor at 50 pM in complete culture medium 30 minutes before the beginning of motility filming. DMSO alone was used as a control. The results of motility analyses were expressed as means (Wour) means + standard deviations, unless otherwise indicated. Statisticaily significant (@.OS) differences between means were assessed by the unpaireci Student's t-test method, performed using Micosoft Excel '97 software.

II. 5. Flow Cytometry (FACS)

Cells were grown to 50% subconfluence on 100 mm culture plates in growth media, 12 hours after subculturing, and rinsed in cazc-free Hank's Buffered Saline

Solution (HBSS)/20 mM HEPES, pH 7.3. Cells were harvested with non-enzymatic

HBS S-based ce11 dissociation solution (S igrna) and suspended in cold

1O%FCS/HBS S/HEPES (FACS buffer). The viability of released cells was established to be between 85% and 95%, by Tsrpan blue exclusion. An aliquot of 2 x 1o6 cells was incubated with primary antibodies-1, -2 or -3 (1: 100, 1 pg/pl) in a total volume of 200 pl of FACS buffer for 30 minutes on ice, and washed three times in cold FACS buffer.

Rabbit IgG was used as a negative control for each ce11 line. Fluorescein isothiocyanate

(FiTc)-conjugated goat anti-rabbit IgG (1:300 dilution, Sigma) in FACS buffer was then added and incubated for 30 minutes in the dark on ice- The cells were washed again and exarnined with a flow cytometer supplied by the Hospital for Sick children, Toronto, using FACS Calibur with Cell Quest acquisition and analysis software (Becton Dickinson, Lincoln Park. No. Viable ceiis were gated based on forward and side scatter to eliminate dead aggregates and debris, and then the distribution of fluorescence intensity was cdculated. Rabbit IgG was used as control ate 1: 100 of 1 pl /ml dilution.

II. 6. Immunofluoreseence Staining

Cells were plated at 50% confluence on sterile glas coverslips in 35 mm tissue culture plates for 12 heurs, Culture medium was then aspirateci, and attached cell monolayers were rinsed in PBS then fixed in a solution of 2 to 4% paraformaldehyde/PBS for 10 minutes. Cells were then washed three times for 5 minutes each in IxPBS, then non-specificity binding sites were blocked with 3% BSNPBS for I hour at room temperature. Monolayers were washed three times with PBS, then were incubated with a 1: 100 dilution of anti-RHAMM (Ab-2) (1 pg/pi), antierk (1 pg/pi), anti-CD44 (1 pg/pl), and anti-ras (1 pglpl) antibodies in 1% BSA for 1 hour at room temperature. The cells were washed and incubated with 1:300 dilution of secondary antibody in 1% BSA labeled with FITC or TRïTC (trisrhodamine isothyiocyanate).

Following another three washes, the cover slips containing the cells were mounted ont0 glas slides and examined using a Leica TCS 4D laser scanning confocal microscope equipped with Scanware 5.0 software. CHAPTER III

RESULTS III. 1. AntibocUes SpeciBcaiïy Detect RHAMM

In Western blot anaiysis, antibodies-2 and -3 were used to probe 5 pg of murine

RHAMM(A1-5 : exons one to five deleted) recombinant protein (without GST), prepareâ from a mouse RHAMM cDNA (Entwistle et al., 1995; Hohann et al., 1998). These antibodies were prepared against sequences that are entirely conserved between mouse and hurnan RHAMM. GST done was prepared as a control. Antibodies recognized the

73 kDâ -(Al-5) as weU as a 53 kDa proteolytic fragment of murine RHAMM recombinant protein (Fig. III. 1A. and B.). Antibodies did not detect GST alone (Fig.

III. 1C.). Non-immune cabbit IgG also did not detect recombinant RHAMM protein and was used as negative control (Fig. m. 1B.).

III. 2. Cell Surface RHAMM Expression Varies with The on the

Surface of Human Breast Cancer Cells

Two human breast cancer ce11 lines, MDA-MB-231 and MCF-7 which differ in their tumorigenicity and aggressiveness (Thompson et al., 1992; Bae et al., 1993;

Sommer et al., 1994) were andyzed for ce11 surface RHAhfM. MDA-MB-23 1 ceils, derived from an estrogen receptor-negative, vimentin-positive human breast adenocarcinornas are invasive and metastatic in nude rnice (Thompson et al., 1992).

These cells have been reported to produce high levels of hyaluronan (Heldin et al., 1996) and to expresses high levels of CD44 (Culty et al., 1994; Ponta et al., 1995). Ce11 surface

RHAMM was detected using FACS analysis at 2, 12-17 and 24 hours following celi plating (Fig. III. 2A-D.). Using anti-RHAMM antibodies-1, -2 and -3, MDA-MB-23 1 cells severally express 2-3 fold higher levels of ce11 surface RHAMM than the MCF-7 cells, but the exact arnount and ciifferences in expression Vary with time after plating when cells are maintaineci at 50% subconfluence. (Fig. III. 2A-Do). In terms of differential expression, at 2 hours after cells plating, ce11 surface RHAMM was 2-fold higher on MDA-MB-231 cells than on MCF-7 celis (Fig. III, 2A.) and this increased to

Cfold higher at 12 hours after ce11 plating (Fig. III. 2B.) but dropped to 2-fold higher than MCF-7 cens at 17 (Fig. III. 2C.) and 24 (Fig. III. 2D.) hours. In absolute times, using a semilog scale, ceil surface RHAMM expression for both cell Lines was high at 2 hours, low at 12 hours and high again at 17 and 24 hours after cell plating (Fig. III. 2E.).

The presence of two FACS peaks for MDA-MB-231 cells suggests that at 12 hours after piating most cells expressed very low levels of RHAMM but a subset of cells expressed high levels of this protein (Fig. III. 2B.).

III. 3. Breast Cancer Ceh Express Several RHAMM Isoforms

Western blot analyses were conducted using anti-RHAMM antibodies as shown in Fig. m. 1. Using Ab-2, three RHAMM proteins were detected in MDA-MB-231 and

MCF-7 cells; 85 kDa, 63 kDa and 43 kDa proteins were detected. Ab-1 detected one

RHAMM protein of 85 kDa in both the MDA-MB-23 1 and MCF-7 cells. The specificity of antibody-2 was confirmed by cornpetition with murine recombinant RHAMM(A1-S), which blocks Ab-2 detected proteins (Fig. III. 3C.). MDA-MB-23 1 cells expressed 3.8- fold higher levels of the 85 kDa protein and 3.5-fold higher levels of the 63 kDa protein than MCF-7 cells but the sarne amount of the 43 kDa protein was expressed in both ce11 lines, as shown by densitometric analysis (Fig. III. 3.). III. 4. RHAMM Overexprrssion is Associated with the PFesence of

Mutant Active ras

RHAMM expression has previousiy been associated with the presence of mutant

active H-ras in murine fibroblasts (Turley et al., 1993; Haii et al., 1995). with H-ras overexpression in primary breast mmor biopsies (Wang et al., 1998) and with activation and expression of erk kinase (Zhang et al., 1998). We therefore examined the effect of transfecting the proto-oncogene ras or mutant active ras in immortalized hmnan bfeast epithelial cells on RHAMM expression (Soule et al., 1992). Antibody- 1 detected an 85 kDa RHAMM protein in MCF-1OA cells transfected with empty vector (Fig. m. 4A.), whereas Ab-2 detected 43 kDa and 63 kDa proteins in these cells (Fig. III. 4B.). The overexpression of either ras protooncogene or mutant active ras was associated with

increased expression of the 85 and 63 kDa proteins (Fig. III. 4A. and B.) and a down- regdation of 43 kDa (Fig. m. 4B.). The overexpression of ras in these cells was confirmed by Western immunoblotting (Fig. III. 5.). The specificity of the RHAMM Ab-

2 was confirmed by its ability to recognize the murine RHAMM-GST fusion protein (Al-

5) on Westem blots (Fig. II. 1A. and B.) and by its ability to be blocked by excess murine RHAMM-GST fusion protein (Al-5) (Fig. m. K.).A 120 kDa non-specific protein was not blocked by excess fusion protein. These results were quantified using densitometry (Fig. III. 4D.). IIL 5. REIAMM Overexpression in MDA-MB-231, MCF-7, or MCF-

10A Ceiis Correlates with the Overexpression of ras, Presence of Active

erk, and with High Leveis of CD44

Western and densitometric anaiysis showed a 3-fold and 2.7-fold enhanced level of ras protein and active erkl protein, respectively in MDA-MB-231 ce11 compared to

MCF-7 ce11 lines (Fig. III. S.). This is consistent with the presence of ras mutation in

MDA-MB-231 cells (Gilhooly and Rose, 1999) and the absence of mutation of ras in

MCF-7 cells (Bos, 1988). Interestingly active erk2 protein expression was the same in the two ce11 lines (Fig. III. 5.). Since it has been reported that the HA receptor CD44 plays a role in the aggressive phenotype of MDA-MB-231 ce11 line (Culty et al., 1994),

CD44 expression was determined. Expression of CD44s, corresponding to the 85 kDa isoform, was 8-fold higher in MDA-MB-231 cells than in MCF-7 cells, as quantified by densitornetry (Fig. III. 5.).

MCF- IOA celis transfected with mutant active ras exhibited a six-fold induction in the expression of CD44s corresponding to the 85 kDa isoform (Fig. III. 6.).

Furthemore, a three-fold increase in the levels of active erkl and erk2 expression was correlated with ras-transfection, confiming the downstream position of erk in the ras-

MAP kinase pathway (Fig. m. 6.).

III. 6. REAMM Co-distributes with erk and CD44 in Breast Cancer

Cells

MDA-MB-231 cells exhibited intense staining for RHAMM in the nuciei and perinuclear regions and diffuse staining in ce11 ruffies (Fig. III. 7A.), whereas weak RHAMM staining was seen in the perinuclear regions of MCF-7 cells w~g.IIL 7B.).

Erk CO-distributedwith RHAMM in the nuclei and perinuclear regions of MDA-MB-231 cells (Fig. III. 7A.). Treatment of MDA-MB-23 i with the PD098059, a MEK inhibitor, led to the impairment of nuclear colocalization of RHAMM and erk (Fig. III. 7C.) compared to DMSO-treated cells which were used as a negative control @ig. m. 7D.).

CD44 expression was concentrated on the membrane and in the perinuclear regions of

MDA-MB-23 1 cells. RHAMM and CD44 CO-distributedin non-penneabilized celis at the tips of ce11 processes and to a smaii extent in the perinuclear regions (Fig. III. 7E.).

Permeabilizing cells with 0.1 % Triton-X following fixation enhanceci visuaiization of the perinuclear CO-localizationof intracellular RHAMM and CD44 in MDA-MB-23 1 cells, but abolished staining for RHAMM in the cell processes (Fig. III. 7F.). Furthemore, staining for CD44 or RHAMM observed in MCF-7 cells was weak in either non- permeabilized (Fig. III. 76.) or permeabilized cells (Fig. III. 78.).Rabbit and mouse

IgG were used as negative controis (Fig. III. 7L).

Intense staining and CO-localizationof RHAMM and erk was observed in the nuclei and ruffles of MCF-1OA ceils transfected with mutant active ras (Fig. III. SA.), compared to the weak staining and absence of CO-Iocalization in either cells overexpressing the ras proto-oncogene or cells transfeçted with empty vector alone (Fig. III.

8B.). Very faint staining of RHAMM and erk was present in the cells transfected with empty vector (Fig. III. SC.). MCF-IOA mutant active ras-transfected cells were then treated with PDû98059 (Fig. III. %D.),which debilitated the CO-localizationof RHAMM and erk in the nuclei of these cells as compared to the DMSO-treated ceils (Fig. III. SE.) used as control. IgG was used as a negative control (Fig. III. 8F.). In these ceUs and in contrast to MDA-MB-231 cells, RHAMM and CD44 co-

Iocalized at the points of ceIl-to-celi contact (Fig. III. SR). Permeabilizatioa of ceils

revealed a CO-localizationof CD44 and RHAMM in the pe~uclearregions of these celis

(Fig. III. 86). Cells that were transfected with normal &ras (Fi~gs. III. 8H. ami 1.) or

transfected with empty vector (Figs. III. SJ. and K.) did not show a CO-locaiization of

RHAMM and CD14. IgG was used as negaiive control (Fig. III. SL.).

Furthemore, CD44 was found to be in close proximity to ras when co-

irnrnunostaining of ras and CD44 was performed (Fig. III. 9.). In MDA-MB-23l (Fig.

III. 9A.) and MCF-IOA-NeoT2 (Fig. III. 9B.) cells, c-H-ras CO-localized with CD44 close to the cell membrane compared to no CO-localizationseen in MCF-7 (Flg. III. 9C.) and MCF-LOA-Neo cells (Fig. m. 9D.). IgG was used as negative control (Fig. III. 9E.).

III. 7. RaAMM Co-bnunoprecipitates with erk and CD44 in MDA-

MB-231,MCF-7, and in ras-transfected Breast Epithelial Cells

The ability of RHAMM antibodies to CO-immunoprecipitate components of the

MAP kinase cascade was assessed (Fig. III. 9.). Erkl CO-immunoprecipitatedwith anti-

RHAMM antibody-2 in both the MDA-MB-231 and MCF-IOA cells transfected with mutant active ras, whereas lower amounts of erk were CO-immunoprecipitated with

RHAMM in MCF-7 cells and in MCF-IOA-Neo cells, respectively (Fig. III. 9A.). Erk-2

CO-immunoprecipitatedwith RHAMNI only in the MDA-MB-23 1 cells w~g.m. 9A.). A

63 kDa RHAMM was CO-immunoprecipitated with an antierk antibody. Only MDA- MB-23 1 cells and MCFIOA-NeoT2 ceils showed intense staining of RHAMM foilowing

imrnunoprecipitation by erk antibody (Fig. III. 9A.).

RHAMM also CO-imrnunoprecipitated with CD44. Two isoforms of CD44 (86 kDa and 1 16 kDa) were CO-immunoprecipitatedwith anti-RHAMM antibody-2 in MDA-

MB-23 1 cells and in MCF-IOA cells transfected with mutant active ras (Fig*III. 9B. and

Cm).However, CO-imrnunoprecipitationwas not observed in MCF-7 or MCF-1OA ceils transfected with vector only. To merconfii this CO-association, an anti-CD44 antibody was used to co-immunoprecipitated RHAMM and this antibody co- immunoprecipitated an 85 kDa and a 63 kDa RHAMM isoforms in both M'DA-MB-23l and MCF-7 cells mg. m. 9D.). The same anti-CD44 antibody CO-imrnunoprecipitated

RHAMM in MCF-1OA cells. In ras-transformed breast epithelial cells (MCF-1OA-

NeoT2), both 85 kDa and 63 kDa RHAMM isoforms were detected, but only the 85 kDa isoform was detected in cells transfected with an empty. In al1 experiments, rabbit IgG and mouse IgG were used as negative controls for mock imrnunoprecipitation (Fig. III.

9A-Dm).

III. 8. RHAMM and CD44 are Required for the Locomotion of MDA-

MB-231 Cells and Ce& Transfected with Mutant Active ras

The locomotion of MDA-MB-231 cells was significantly higher than the locomotion of MCF-7 cells; 60.2 IG.27 Cun/hour versus 13.39H.84 Crm/tiour (p<0.00 1).

Anti-RHAMM antibody-2 significantly inhibited the locomotion of MDA-MB-23 1 cells

(pc0.005) (Fig. III. 10A.) but had only minor effects on MCF-7 cells that were not statistically significant. Anti-CD44 antibody signif~cantlydecreased the motility of MBA-MD-23 1 cells to the same level as anti-RHAMM antibodies (W.03). To assess if the effects of anti-CD44 and anti-RHAMM antibodies were additive, anti-CD44 and

RHAMM antibodies were mixed and their combined effect on motility of MDA-MB-231 cells was assessed. Mixing antibodies did not fbrther inhibit MDA-MB-23 1 ceIl motility

(Fig. III. 10A.).

Because erk has been impiicated in breast cancer cell motïiity (Zeigler et al., 1999;

Xing and Imagawa, 1999), and MDA-MB-23 1 ceiis express high levels of this kinase, and since RHAMM and CD44 have both been reported to regdate erk kinase activity

(Hofmann et al., 1993; Zhang et al., l998), the effect of inhibiting this kinase on MDA-

M.-231 ce11 motility was examined. A MEK inhibitor, PD98059, most strongly blocked

MDA-M.-231 cell motility (pd.001) relative to the effects of antibodies (Fig. III.

10B.).

The three MCF- 1OA-denved ce11 lines also exhibited significantly different rates of random ce11 motility, with Iocomotion king significantly higher in cells transfected with mutant active H-ras (37.68k3.87 Crm/hr) (pd.ûû1) (Fig. m. 10C.). Anti-RHAMM antibodies strongly blocked the locomotion of mutant active ras-transforrned ce11 lines

(2.5 fold, p

RHAMM and anti-CM antibodies, however, did not further inhibit ce11 motility relative to each antibody alone (Fig. m. 10C.). The MEK inhibitor (PDû98059)also significantly decreased ce11 motility to a level similar to that observed with the anti-RHAMM antibody

(Fig. III. 10D.). SECTION III. 9 Fig. m. 1. Confirmation of the specificities of RHAMM antibodies-2 and -3 by immunoblot

analysis. Murine RHAMM(A1-5) recombinant protein (5 mg) was electrophoresed on a

10% SDS gel, transferred to nitrocellulose, and probed with antibodies-2 and -3, which detected 73 kDa protein bands correlating to RHAMM(A1-5) and 53 kDa proteolysis product respectively (A and B). GST alone and non-immune rabbit IgG were used as controls (B and C).

Fig. III. 2.

Detection of RHAMM expression on the surface of MDA-MB-23 1 and MCF-7 cells by

FACS analysis. FACS analysis was performed using anti-RHAMM antibodies-1 and -2

following 2, 12, 17, and 24 houa of subculturing (A-D). Anti-RHAMM antibody-3

replaced antibody-1 at the 12 hour time point (B). Plotting results of the percentage of

gated cells on a log immunofluorescence intensity from mean of two experiments +

standard deviations, revealed that ce11 surfice RHAMM was approximately 2-3-fold

higher on MDA-MB-231 cells compared to MCF-7cells using anti-RHAMM antibodies

specific to different regions of the RHAMM protein (E). CeIl surface RHAMM expression was most heterogeneous, shown by two single FACS peaks, at 12 hours after

subculturing of both ce11 lines (B). IgG was used as a negative control.

Fig. m. 3.

Western immunoblot analyses of RHAMM expression in MDA-MB-23 1 and MCF-7 cells. Anti-RHAMM antibody- 1, which detects only standard form of RHAMM (A), and

antibody-2, which detects both RHAMMs and isoforms of RHAMM (B), were used in the anaiyses. Three major RHAMM protein bands of 85 kDa, 63 kDa and 43 kDa, were detected in these cells. The specificity of the anti-RHAMM antibodies were shown by cornpetition studies using RHAMM fusion protein preincubated with anti-RHAMM antibody-2 (C). Densitometry analysis was used to quantify the amounts of the different

RHAMM isofonns expressed in these ce11 iines and the resufts are presented as mean of three experiments + standard deviations @).

Fig. III. 4.

Western immunoblot analyses of RHAMM expression in ras-transfected MCF-IOA cells.

Antibody-1 detected greater amounts of an 85 kDa RHAMM protein in MCF-1OA cells transfected with either the ras protooncogene (NeoN) or mutant active ras (Neo-2T) (A).

Antibody-2 detected 85 kDa and 63 kDa, and 43 kDa proteins in similar experiments (B).

As a control, the anti-RHAMM antibody-2 was cornpeted out with excess RHAMM-GST fusion protein, and was then used to probe the blots (C). The densitometry graph shows the quantity of RHAMM protein presented as mean of keexperiments + standard deviations in the three MCF- 1OA ceii lines (ID). MCF-1 OA-protooncogen ris *<"

MCF-1OA-vcctor alone

MCF1OA-protoonwgen ras

MCI;-1OA-mutant active ras

MCF-1 OA-vector a lone

MCF-10A-protoo~~ogenras

MC F-1OA-mutant active nu Fie. III. 5.

Western immunoblot analyses of active erk, H-ras, and CD44 expression in MDA-MB-

23 1 and MCF-7 ceus. Monoclonal antibodies against ras, CD44 and phosphorylated erk were used for probing the blots. Densitometric andysis presented as mean of three experiments + standard deviations showed enhanced protein levels of ras, CD44, and active erkl in MDA-MB-23 1 celis compared to MCF-7cells.

Fig. III. 6.

Western immunoblot analyses of active erk, H-ras, and CD44 expression in ras- transfected MCF- IOA cells* Monoclonal antibodies against ras, CD44 and phosphorylated erk were used for probing the blots . In MCF-1OA cells, levels of active erk, and CD44, expression correlateci with the levels of ras expression, Shown by the densitometry analysis which is presented as mean of three experiments 2 standard deviations, active erkl and CD44 levels were highest in celis transfected with mutant active ras. ERK- 1- IEI ERK- 2- Fig. 1'.7.

Confocal microscopie analysis of RHAMM, erk and CD44 expression in MDA-MB-23 1

and MCF-7 cells. Antibody-2 and antierk monoclonal antibodies were used for

RHAMM (green color) and erk (mi color) staining. RHAMM and erk displayed intense

nuclear staining in MDA-MB-231 ceils (A) but diffuse and subtle perinuclear staining in

MCF-7 cells (B). Nuclear CO-distribution of erkl and RHAMM (yeliow color) was detected only in the MDA-MB-23 lcells (A). When MDA-MB-23 1 ceils were treated with PD098059, a MEK inhibitor, nuclear CO-locaiizationof RHAMM and erk was not seen (C) compared to DMASO treated cells (D). When ceUs were fixed with 2% paraformaldehyde, RHAMM (green color) and CD44 (detected by Herrnes 3; red color ) were CO-distributed on the vesicles close to the ce11 membrane and ceil processes of

MDA-MB-23 1 cells (E). Upon treatment of celis with 48 paraformaldehyde and 0.1 %

Triton-X, intracellular RHAMM and CD44 CO-locaiization was observed in the perinuclear regions of MDA-MB-23 1 cells O.However, CD44 or RHAMM staining in

MCF-7 celIs was week in either non-permeabilized (G) or permeabilized cells (8).

Rabbit and mouse IgG were used as negative controls (1). The line bar indicates 25 mm; the arrows point to CO-localizationof RHAMM either with CD44 or erk.

Fig. HI, 8.

Confocal microscopie andysis of RHAMM, erk and CD44 expression in ras-transfected

MCF- 1OA cells. Immunofluorescence staining using both antibody-2 against RHAMM

(green color) and anti-erk antibody (rd color), showed intense nuclear staining of MCF-

10A-NeoT2 cells (A), compared to less intense, perinuclear staining of MCF-IOA-NeoN cells (B) and to the faint staining of MCF-1OA-Neo ceUs (C).The nuclear CO-distribution of RHAMM and erk was not seen in the MCF-1OA cells transfected with mutant active ras following treatrnent of the cells with MEK inhibitor, PDû98059, @) compared to

DMSO treated cells (E). IgG was used as a control(F). The CO-distribution of CD44 and

RHAMM (yellow color) was seen at points of cell-to-cell contact when MCF-1OA-

NeoT2 ceUs were fmed with 2% paraformddehyde (G), but was present in the perinuclear regions of cells treated with 4% parafomaldehyde and O. 1% Triton-X (H).

The latter staining pattern was not observed in MCF-1OA-transfected with normal ras 0 and .J) or in MCF- 1OA-transfected with empty vector (K and L), used as controls, which were sirnilarly treated with 2% parafomaldehyde (Iand K) or 4% paraformaldehyde and

0.1% Triton-X (J and L). The line bar indicates 25 mm; the arrows point to colocalization of RHAMM either with CD44 or erk.

Fig. m. 9.

Confocal rnicroscopic analysis of CD44 and ras expression in breast cancer ce11 lines and

in ras-transfected breast epithelial cells. Antibodies specific to CD44 (red color) and ras

(green color) were used. CD44 CO-localization(yellow color) was present with ras in

MDA-MB-23 1 (A) and MCF-1OA-NeoT2 celis (B), in contrast to the more faint and non- overlapping staining for ras and CD44 in MCF-7 (C) and MCF-1OA-Neo cells @) used as controls. IgG was used as a control in these experïments (E).

Fig. III. 10.

Co-immunoprecipitation of RHAMM, erk, and CD44 Antibody-2, anti-erk, and Herrnes3 were used against RHGMM, erk, and CD44, respectively, for both immunoprecipitation

(IP) and probing (TB) of the blots. The anti-RfiGMM antibody co-immunoprecipitated erk, and the anti-erk antibody co-immunoprecipitated the 63 kDa RHAMM isoform, to greater extents in the MDA-MB-231 ceiis than in the MCF-7 cells (A). More co- immunoprecipitation of RHAMM and erk oçcurred in the MCF-1OA-NeoT2 (ceus transfected with mutant active ras) than in MCF-IOA-NeoN (cells transfected with normal ras). Antibody-2 CO-immunoprecipitated116 kDa and 85 kDa CD44 isofoms only in MDA-MB-23 1 cells and in cells transfected with mutant active ras (B and C).

Anti-CD44 antibody CO-immunoprecipitatedboth the 85 kDa and 63 kDa RHAMM isoforms found in greater abundance in MDA-MB-23 1 cells and MCFlOA-NeoT2 than in the MCF-7 and MCFlOA-Neo control ce11 Lines @). In al1 expenrnents, MOCK was used as negative control, where rabbit IgG, or mouse IgG was used instead of anti-RHAMM, anti-erk or anti-CD44 B IP: RHAIMM, Ab-2 - IB: CD44 2 Z S 4 kDi iZ Y 5! 120 -c 874 64 - 53 4

Fig. III. Il.

Time-lapse cinemicrography of MDA-MB-23 1 cells and ras-transfected MCF-1 OA cells.

MDA-MB-231 locomotion at (60.21627 Cun/hour) was significantly blocked by treatment with anti-RHAMM antibody-2 or anti-CD44 (Hermes3) antibody, but mùring of these antibodies did not show an additive effect on their motility (A). PD098059 compound, a MEK inhibitor, also decreased MDA-MB-231ce11 motility compareci to cells treated oniy with the diluent, DMSO (B). The random locomotion of MCF-ZOA-

Neo-2T cells was decreased upon treatment with anti-RHAMM antibody-2 or anti-CD44 antibody, and mixing of these antibodies did not show an additive effect (C). Treatment of MCF- IOA-Neo-2T cells with the PDû98059 compound decreased their motility to similar levels as did the anti-RHAMM antibody @). Results shown are from triplicate experiments. Asterisks indicate that differences in mean locomotion between treatment with specific antibody and treatment with IgG control were statisticaily significant at p<0.05. Ab ('s), antibody or antibodies. MCF-10A mutant active ras trdected CHAPTER IV

DISCUSSION Whereas the signal transduction pathways involved in ceii cycle regdation have been well studied, those coordinathg ce11 motility have only recently received attention.

Cell surface receptors, such as integrins and growth factor receptors including the protein tyrosine kinase src and the serindthreonine kinase ERK, have been shown to play roles in ce11 motility and invasion (Patel et al., 1998; Zeigler et al., 1999). Recently, a novel group of extracellular matrix receptors belonging to a class of hyaluronan binding proteins called the hyaladherins have also been implicated in tumor ce11 motility (Kohda et al., 1996). Two of these hyaladhenns, RHAMM and CD44, have been studied in the context of human cancer (Wang et al., 1998; Pilarski et al., 1998; Herrera-Gayol and

Jothy, 1999). The purpose of this study was to examine the contribution of these hyaladherins to the motïlity of breast cancer ceil lines which had been previously characterized with respect to their invasiveness in nude mice (Thompson et al., 1992).

Specifically, we demonstrated relationships arnongst RHAMM and CD44 expression, overexpression/mutation of ras proto-oncogene, and activation of the ras/MAP kinase pathway, to breast cancer cdmotility.

IV.1 Ras and raderk Signaling Cascade in Breast Cancer Development

Breast cancer is a complex and heterogeneous disease that is the most common world-wide cause of malignancy in women (Fisher et al., 1997). Although experimental studies suggest that aberrant ras function can promote the malignant progression of human breast epithelial cells, the occurrence of mutant ras gens in breast tumors is infrequent (5%). The infrequent occurrence of activating ras mutations in breast carcinomas indicates that any aberrant function of the proteins on the ras signaling pathway, which contributes to breast cancer progression, occurs via another de-regulating mechanism. Constitutive activation of ras signaling pathways may occur by at least nuo

mechanisms. Fit, overexpression of other componeats, both upstreaxn (e.g.

overexpression and upregulation of HEIU/neu/erbBZ receptor tyrosine kinase) (Shackney

et al., 1998; Ross et al., 1999), ancilor downstream (e-g. erk) (Sivaraman et al., 1997;

Wang et al., 1998; Salh et al., 1999) of ras may occur. Second, deregulaîed function of

regulatory proteins for ras or of other GTPases such as ho, which are essential for ras

transformation, may promote signahg through ras (Mangues et al., 1998). Therefore,

chronic activation of the ras signaling pathway by aiternate means is aiso involved in

breast carcinomas.

The three human ras proto-oncogenes encode four closely related 21 kDa

proteins, designated H-ras, K-ras, N-ras, and m-ras, whose activities are controiled by

guanine nucleotide binding (Boume et al., 1990a; Boguski and McCormick, 1993;

Matsumoto et al., 1997). Ras proteins are responsible for regulating the flow of

information that is triggered by diverse extracellular signals impinging upon a variety of ce11 surface receptors (Lewis et aL, 1998). The relay of signds from these receptors via ras proteins ultimately controls the activities of nucIear transcription factors which induce the expression of key genes regulating ce11 growth and differentiation (Kyriakis et al.,

1999) (Fig. Ne 1.). Ras proteins shuttle between active GTP-ùound "on" states and

inactive GDP-bound "off" states by means of a regulated GTP/GDP cycle that is controlied by at least two types of regulatory nucleotide exchange factors (Bourne et al.,

1990a; Boguski and McCormick, 1993) which serve to promote the formation of active ras-GTP. Oncogenic ras proteins persist chronicaily in the GTP-bound state, thus leading to the constinitive activation of downstream growth regulatory signals (Fig. IV.1.). Figo IV. 1. b mgdates a cascade of kinases. A linear pathway where ras fûnctions downstream of receptor tyrosine kinases (RTK)and upstream of a cascade of se~e/threo~ne kinases (Ra.6MEOER.K) provides a complete Iink between the ceIl surface and the nucleus. Activated erk proteins also phosphorylate and thereby activate transcription factors such as Elk-1. Activated erks also phosphorylate substrates in the cytoplasm, including the Mnk kinase, and thus contribute to translation initiation of mRNAs with sauctured 5'- untranslatecl regions. (Ciark adDer, 1994)

PTK receptors, such as HERUneu (Tari et al., 1999) and c-MET (Hiscox and

Jiang, 1999), promote mitogenic responses in breast cancer cells and these receptors regulate cellular functions that are involved in the acquisition of an invasive phenotype such as modulation of cellular attachments, proteolysis of extracellular matrix, and directional migration. For instance, in the case of c-MET receptor, mature, biologically active hepatocyte growth factor, aiso known as scatter factor (HGFISF) elicits its response by binding to the Met tyrosine kinase receptor at the ceil surface (Bottaro et al.,

199 1; Naldini et al., 199 1). Subsequent activation of numerous signaling pathways then results in the reguiation of a wide range of biological activities of tumor ceUs including stimulation of motility, migration, growth, angiogenesis and invasion (Hiscox and Jiang,

1999). One of the pathways involved in the tumorigenic activity of mutant c-Met molecules has been shown to occur through the raJMAP kinase pathway in mouse metastatic mammary carcinoma ceils (Jeffers et al., 1998).

Overexpression and amplification of HER2 oncogene, another PTK receptor, bas been found to correlate with poor survivai of breast tumors (Peles et al., 1993; Vargas-

Roig et al., 1999). In addition, HERuneu oncogene is also associated with high tumorigenicity and the metastatic phenotype of both breast and ovarian carcinoma ce11 lines (Berchuck et al., 1990). Cells expressing high levels of CD44 and pl85- bind hyaluronic acid with high affinity (Zhu et al., 1996). Furthemore, mammary tumors initiated by HEWneu have high levels of active ErkIMAP kinase and their anchorage independent growth is strongly inhibited by PD098059 (Amundsdottir et al., 1998).

In addition, RTK have been reported to induce a number of extracellular matrix- degrading proteases including MMP-9 via activation of MAPK pathway (McCawley et al., 1998; Reddy et al., 1999). MMPs are a family of stnicturally related enzymes that together cm degrade al1 components of the extracelIular matrix and are known to be important in tumor ce11 invasion (Stelter-Stevenson et al., 1993). Recentiy, it has been shown that the invasive breast tumor cells express high levels of MMP-9 (Reddy et al.,

1999; Yu and Stamenkovic, 1999) whicb associates with ce11 surface receptors such as

CD44 to degrade collagen type N leading to tumor ce11 invasion and metastasis

(Bourguignon et al., 1998a; Yu and Stamenkovic, 1999). A possible mechanism by which sustained activation of MAPK could result in MMP-9 induction is through regulation of essential transcription factors such as c-Fos. Expression of this immediate- early gene is dependent on MAPK activation, and furthemore, phosphorylation of c-Fos by MAPK enhances its activity leading to transcription activity and AP-1 dependent expression of the MMP-9 gene, and breast tumor celi motility and invasion (Hayashi et

al., 1999; McCawley et al., 1999; Mira et al., 1999).

IV. 2. CD44 and RBAMM, Co-receptors that Mediate Tumor CeU

Moolity through the RPs/MAP Kinase Pathway

The hyaluronan receptors, CD44 and RHAMM, have been impiicated in breast

tumor growth and metastasis by mechanisms that riemain pooriy understood (Wanget al.,

1998; Herrera-Gayol and Jothy, 1999), but severai observations suggest their

involvement in the ras/ MAPK signaling pathway. These are: 1) RHAMM expression correlates with erk and ras in human breast tumor biopsies (Wang et al., 1998); 2)

RHAMM is an erk binding protein in murine fibroblasts (Zhang et al., 1998; 1999); 3)

RHAMM regulates signaling through ras in munne fibroblasts (Hall et al., 1995); 4)

CD44 expression is regulated by ras (Hofmann et al., 1993); and 5) CD44 associates with

HEWneu, which is up-regulated in the activated ras pathway in breast cancer cells

(Bourguignon et al-, 1997; Kaiish et al., 1999).

CD44 mediates adhesion and migration of a variety of ce11 types upon hyaluronan substrats (Thomas et al., 1992; Faassen et al., 1993; Goebeler et al., 1996;

Okada et al., 1996; Trochon et al., 1996; Knudson, 1998). This receptor is required for breast tumor ce11 invasion through other rnatrix components (Knudson, 1998; Herrera-

Gay01 and Jothy, 1999). This latter ability may be related to interactions between CD44, or its modified variant forms, and receptors for growth factors or integrins such as

HEWneu andor c-met that collectively control signaiing pathways regulating ce11 motilityhvasion (F3ourguignon et al., 1998b; Pais et al., 1998; Katagiri et al., 1999' van der Voort et al., 1999). In addition to the outer domains of CD44 that act as an adhesion receptor for HA (Aruffo et al., 1990) and CO-receptor for HER2/neu (Zhu et al., 1996)' the cytoplasmic domain of CD44 is linked to the actin cytoskeleton via ERM proteins

(Nearne et al., 1995) (Fig. 1. 4.). Possibly these interactions localize CD44 to invadopodia and it's association with MMP-9 (Bourguignon et al., 1998a; Yu and

Stamenkovic, 1999), a collagenase that is regulaîed by the rasmiLAP kinase pathway and has been impiicated in cell motility and invasion (Okada et al,, 1997; Llorens et al,, 1998;

Maeda et al., 1998; Hayashi et al., 1999; McCawley et al., 1999; Mira et al., 1999)' and may contribute to the requirernent for CD44 in ce11 invasion.

EWAMM is a hyaladherin required for ce11 motility and invasion of a variety of ce11 types. Ce11 surface RHAMM has been shown to be required for invasion of human breast cancer cells through matrigel in vitro (C. Wang, personal communication) and for motility of malignant B cells (Gares et al., 1998; Pilarski et al., 1999). Cell surface and in tracelMar forms of RHAMM are required for signaling motility through mutant active ras in fibrobiasts (Hall et al., 1995; Zhang et al., 1998) for promoting ceil motility following injury (savani et al., 1995a, 199%) and in response to growth factors such as

TGF-P (Samuel et al., 1993). The appearance of RHAMM expression early after celi plating within ce11 IamelIae (Zhang et al., 1998) and the role of RHAMM in neurite extension (Nagy et al., 1998) suggest that RHAMM is involved in ce11 extension and formation of larnellae dunng the motïie cycle. RHAMM is, like CD44, also present within invadopodia (Harrison and Turley; 1999) and regulates AP-1 activation (Cheung et al., 1999) as well as expression and release of MMP-9 (Zhang et al., 1999). The highly invasive and metastatic celi line, MDA-MB-231, was chosen for this study based on previously published data describing its aggressive biological behavior

(Thompson et al., 1992; Bae et al., 1993; Sommers et al., 1994). Like MCF-7 cells,

MDA-MB-23 1 cells were derived from a mammary epithelial breast carcinoma, but unlike MCF-7 cells, MDA-MB-231 cells express mutant K-ras and activated H-ras.

Moreover, MDA-MB-23 1 cells are estrogen receptor-negative. vimentin-positive, and are invasive and metastatic in nude mice. This ceil line is able to synthesize hyaluronan

(Heldin et al., 1996) and expresses high levels of surface CD44 protein (Culty et al.,

1994; Ponta et al., 1995) (Table W. 2.). MCF-1OA cells are immortalized, estrogen receptor negative breast epithelial cells derived from human fibrocytic mamrnary tissue

(Soule et al., 1990) and were transfected with either ras oncogene (Mm-IOA-NeoN) or proto-oncogene (MCF-IOA-NeoT2) as stated in Basolo et al. (1991). Unlike the MCF-

10A-Neo or the MCF-IOA-NeoN cells, the MCF-IOA-NeoT2 cells exhibit anchorage- independent growth, are estrogen negative cells, and are invasive in vitro and tumorigenic in nude mice. Therefore, these highly tumongenic human breast epithelial ce11 lines were selected as they exempli@ the behavior of a clinicaily aggressive human tumor (Table

IV. 2.).

It was demonstrated here that human breast cancer ce11 lines express RHAMM at the ce11 surface and intracellularly, and that the levels of RHAMM expression correlate to the previously determined invasive and metastatic phenotypes of these cells in nude rnice

(Thompson et al., 1992). In contrast to the results obtained by Assmann et al. (1998), who reported exclusively intrace1luIa.r RHAMM localization, we found RHAMM Table 2 Characteristics of human breast epithelial cell lines

2 Cell Line TT' ~otility HA' E: vin5 BCCA~ E-cad7 811 ~4)hs-mut'' H-ras" ~-m" fin lnv. M&

' Tl' tumor type, AC, adcnocarcinoma (7'hompson et al., 1992) 2~an&mce11 motility measund by using a computerized timelapse image anilyois system ()rm/hr). 3 HA production in culturc (pL/10~cells) MCF-lOAT2 cells are capmble of binding and iipPLe of hyaluronan (Giunciuglio et al., 1995). 4 Estrogen recepior slatus: MDA-ME-23 1& MCF-7(Thompson et al, 1992); MCF-1OA (Pilat et al,, 19%) 5 lntermediate filament potein vimentin MDA-MB-23 l& MCF-7 (Thompson et al, 1992) 6 lnvasive activity in Boyden chamber chernoinvasion assay: MDA-MB-23 l& MCF-7 (Thompson et al, 1992); MCF4OA (Giunciglio et al., 1995) 7 Ecadherin/uvomorulin expression: MDA-MB-23 1& MCF-7 (Sommers et al, 1994); MCF- 1OA (Zhong et al,, 1997), 31 integrin expression (fm Sommen et al, 1994). 9 P4 integrin expression (from Sommers et al, 1994). 'O ras poto-oncogen mutation (Bos, 1988) "H-ras 1.2 kb niRNA genc ampüfication relative to normal 18 1 cells: MDA-MB-23 l& MCF-7 (Zajchowski et al., 1988); MCPIOA (Soule ct (il.(1 990) '2~-ras1.2 kb mRNA gene amplification relative to normai 18 1 alls (Zpjchowski et al., 1988). 13 Tumorigenesis, local invasion and metastasis in athymic nude mouse (Ncr nidnu): MDA-MB-23 1Eé MCF-7( Thompson et al, 1992); MCF-IOA (Giunciuglio et al., 1995). expression on the surface of both MDA-MB-23 1 and MCF-7 cells using FACS malysis;

MDA-MB-23 1 cells were shown to express the highest Ievel of ce11 surface RHAMM.

These results are consistent with the previous fmdings indicating that ce11 surface

RHAMM appears to be less dynamic over time and more constitutively expresseci with malignanc y (Crainie et al., 1999) and in ras-transformed murine fibroblasts (Zhang et al.,

1998, Cheung et al., 1999). The apparent discrepancy between our results and those of

Assmann and coworkers may have been due to one or to a combinaîion of several factors.

For instance, the MDA-MB-468 cells used by Assmann et al. (1998) have a similar mutational background as MCF-7 cells, are not invasive or metastatic in nude mice, and do not harbor a ras mutation (Thompson et al., 1992). Consistent with their finding, we detected low levels of RHAMM on the surface of MCF-7 cells. Furthermore, the transient nature of RHAMM expression, which occurs soon after plating but maximdy before confluency of murine fibroblast cells (Zhang et al., 1998, Cheung et al., 1999), requires that cornparisons between studies be made over time after ceil plating.

Differences in the rnethods used for FACS analyses for detecting ce11 surface RHAMM may also have contributed to the difierent findings. In contrast to Assmann et al. (1998), we did not treat the cells with paraformaldehyde andor sodium azide before antibody treatment. Furthemore, because trypsinization of cells before FACS analysis leads to loss of RHAMM from the ce11 surface, we have used a proprietary dissociation reagent that contains no trypsin. Throughout al1 of Our experiments presented here, we used cells at 50% confluency; the degree of confiuency at which cells were studied by Assmann et al. ( 1998) was not clearly defined. Furthermore, whereas we present data of ce11 surface

RKAMM expression utilizing three different anti-RHAMM antibodies specific for different regions of RHAMM protein, detection of cytoplasmic and nuclear RHAMM by

Assmann et al. (1998) was performed using a single anti-RHAMM antibody directed against an epitope found in the interior of the RHAMM protein. Possible masking of this interna1 epitope due to the secondary structure of RHAMM might prevent its detection.

Both RHAMM and CD44 have been reported to coordinate motility of various ce11 types (Nagy et al., 1998; Herrera-Gayol and Jothy, 1999; Pilarski et al., 1999). The results of the present study are the first to show that although both RHAMM and CD44 coordinate the motility of ras-transfected and cancerous breast epithelial cells, they do not appear to exert additive effects. For instance, both RHAMM and CD44 antibodies significantl y blocked the motility of MDA-MB-23 1 cells and Mm-1 OA cells transfected with mutant active ras. However, combination of the two antibodies did not further decrease the motility these ceus. Coordination is suggested by: 1) the non-additive effect of the antibodies on ce11 motility; and 2) CO-association of receptors in ce11 processes.

RHAMM and/or CD44 are obviously not the only ce11 surface receptors responsible for the motility of these celis, as other receptors such as urokinase plasminogen activator receptor (uPAR), which is also regulated by erk kinase (Nguyen et al., 1998) take part in enhanced ce11 motility (Andreasen et al., 1997). Results presented here indicate that the motility of breast cancer cells and ras-transfod cells is significantly reduced upon treatment with a MEK inhibitor, suggesting the direct involvement of the erk kinase pathway in the motility of breast cancer ceils consistent with previous studies of the role of erk in motility of other cells (KIemke et al., 1997; Reszka et al., 1997). The concentration of PD08059 used in this study (5Op.M) is equal to that reported to completely inhibit MEKl in vitro (Alessi et al., 1995). Previous studies suggest that PD098059 interferes with growth factor-induced erk activation and MMP-9 expression,

suggesting that receptor tyrosine kinase-mediated MMP-9 induction requires a MEKI-

dependent pathway (Gum et al., 1997; McCawley et al., 1999). In one mode1 system where cells displayed constitutive activation of MAPK, the accompanying up-regdation

of MMP-9 expression was dependent upon AP-1 response element sites within the MMP-

9 promotor (Qui and Green, 1992; Himelstein et al., 1997). Furthemore, recent observations indicate that CD44 serves to anchor MMP-9 on the celi surface (Yu and

Starnenkovic, 1999), and disruption of the function of ce11 surface RHAMM by antibody blocking inhibits MMP-9 activity (Zhang et al., 1999). Interestingly, both the invasive

MDA-MB-23 1 cells and mutant active ras-transfected MCF-IOA cells studied here have previously ken shown to express high levels of MMP-9on the ce11 surface, as compared

to their non-invasive counterparts, MCF-7 and MCF-LOA-Neo (Toth et al., 1997;

Bourguignon er al., 1998a, 1998b). Ce11 surface expression of MMP-9 would ultimately lead to the degradation of type TV collagen and therefore to the ability of hlmor cells to invade and metastasize. From these findings, it seems reasonable to propose that

RKAMM and CD44 play synergistic roles in controiling MMP releaselfunction mediating Nmor ce11 motility and invasion (Fig. W.2.). The precise role of RHAMM in such a signaling cascade, however, remains to be determined, IV. 3. RHAMM and CD44 Expression are Linked to ras Overexpdon and erk Activation in Breast Cancer Ceb and Bre~stEpithelial Cek

Transfected with Mutant Active ras

In this study, RHAMM and CD44 expression correlated with over~xpressionof ras and activation of erk in MDA-MB-231human breast cancer cells and in MCF-1OA cells transfected with mutant active ras. Although a correlation of active erk to CD44 is novel, the findings that RHAMM overexpression, a regutator of ras (Hal1 et aL, 1995) and erk signahg (Mohapatra et al., 1996; Zhang et al., 1998), significantly correlated to active erkl was consistent with recent studies by Wang et al. (1998) indicating that erk expression by itself was not significantly associated with poor prognosis of breast cancer, but overexpression of both RHAMM and erk were indicative of lymph node metastasis and high tumor grade. Moreover, the expression of both the 85 kDa and 63 kDa isoforms of RHAMM was up-regulated with ras overexpression both in the MDA-MB-23 1 ceiis and in the mutant active ras transfected MCF-1OA cells, whereas the 43 kDa RHAMM was not correlated with ras overexpression. Recent studies of the RHAMM promotor region indicated the presence of an AP-1 transcription factor binding site (Assmann et al.,

1998). In addition, RHAMM is required for activation of erk kinase cascades and AP-1 through PDGF activity (Zhang et al. 1998; Cheung et al., 1999). Hence, the correlation between RHAMM overexpression and the presence of overexpressed or mutant active ras in the two groups of ce11 lines studied here is consistent with a previous report from Our laboratory noting this same correlation in breast cancer biopsies (Wang et al.. 1998). and

E2HAMM overexpression has often (Hall et al., 1995) but not always (Hofmann et al.,

1998) been linked to mutant active ras expressed in munne fibroblasts. Previous data indicated the involvement of CD44 in the raslerk sigaaling and in human breast cancer development. For example, an AP-1 transcription factor binding site has been identified in the CD44 gene prornoter that is activated by c-H-ras activation in rat embryonic fibroblasts and results in the expression of CD44 isofom as weli as in increased expression of CD44 mRNAs (Hofmann et al., 1993). Our results indicate that it is the standard forrn of CD44 correlating to a reported molecular weight of 85 kDa

(Bourguignon et ai., 1998a) that is overexpressed both in MDA-MB-231ceils and in

MCF-1OA cells transfected with mutant active ras. This CD44 isofonn has been shown to bind to p 185- (Bourguignon et al., 1998b) . Collectively, these results suggest that an interplay occurs between signals generated from ce11 surface RHAMM and CD44s variant, and those signals regulated by intracellular RHAMM forrns and CD44 domains, ail of which involve growth factor receptor mediated ras/MAP kinase activation and hence have impact upon tumor ceil motility (Fig. N. 2.).

IV. 4. REKAMM Co-associates with erk in MDA--1231 Ceh and

MCF-1OA Cek Transfected wïth Mutant Active ras

Aithough expression of both the 85 kDa and the 63 kDa RHAMM isoform were up-regulated with ras overexpression both in the MDA-MB-231 cefls and in the mutant active ras-transfected MCF-1OA cells, CO-immunoprecipitationresults showed that erk was bound by the smaller (63 kDa) RHAMM isoform and not by the standard (85 kDa)

RHAMM isoform. The 63 kDa RHAMM isoform was not detectable in MCF-7 cells, but when an increased amount of total protein was used for CO-irnrnunoprecipitation,this isoform was CO-immunoprecipitatedwith erk in MCF-7 cells and also to a smaller extent in MCF-1OA cells transfected with empty vector only. However, the de- of co- association of erk and RHAMM depended on the mutational background of the cells used, where more RHAMM associated with erk in the MDA-MB-23 1 cells and MCF-

10A cells transfected with mutant active ras. Furthermore, confocal analyses were indicative of CO-associationof RHAMM and erk in the nucleus of MDA-MB-23 1 cells and MCF- 1OA cells transfected with mutant active ras. Interestingly, treatment of these cells with the MEK inhibitor, PDû9û859, abolished the ;tccumulation of both RHAMM and erk in the nucleus and instead the CO-localizationwas seen in the perinuclear regions of these cells. Recent studies by Brunet et al. (1999) indicated that nuclear translocation of erk is required for growth factor-induced gene expression and ce11 cycie entry by Ek- dependent gene transcription which leads to DNA replication in response to growth factors. McCawley et al. (1999) has show that sustained activation of the mitogen- activated protein kinase pathway is required for expression of MMP-9 through AP-1 regulated genes. In addition, Balmanno and Cook (1999) suggested that sustained activation and translocation of erk into the nucleus is essential for neurite growth factcr

(NGF)-induced neuronal differentiation of PC12 (pheochromocytoma) cells.

Furthermore, nuclear erk is known to bind AP-1 sites to increase the transcription activity of growth-related genes, the expression of which leads to ce11 motility and invasion

(Karin, 1995; Seger and Krebs, 1995, Zhou et al., 1998). Other workers in my laboratory have previously shown that RHAMM is required for ce11 cycle progression through the

G2/M transition (Mohapatra et al., 1996), and ongoing studies suggest that active erk associates w ith intracellular RHAMM in the rnitotic spindles of ras-transformed human breast cancer ceils (R. Harrison, persona1 communication). Recently, Huileman and

colleagues ( 1999) showed that p42/p44 MAPK nuclear translocation and retention

requires both MAPK activation and neosynthesis of nuclear anchonng proteins which are expressed transiently. It could be speculated that RHAMM may facilitate erk entry into

the nucleus and it may not ody play a crucial role in sustainhg nuclear erk activity

leading ultimately to ce11 motility which may not require transcription of genes (Kiemke

et al., 1997; Hoshino, 1999), but it may dso take part in ceil division and hence may act

as an oncogene (Hdl et al., 1995).

IV. S. RHAMM Co-Associates with CD44 in Breast Cancer Ceils and

Breast Epitheliai CeUs Transfected with Mutant Active Ras

RHAiMM CO-immunoprecipitatedwith two CD44 isoforms - an 85 kDa isoform which represents the standard form of CD44 and a 1 16 kDa isoform which likely represents the CD44v10 isoform. Both of these CD44 isoforms have been shown to be expressed in MDA-MB-23 1 cells (Culty et al., 1994) and are associated with increased tumorigenicity and invasiveness of breast cancer cells (Bourguignon et al., 1998a, 1998b;

Kalish et al., 1999). Likewise, the CO-immunoprecipitationof two RHAMM isoforms (85 kDa and 63 kDa) seems to be associated with the mutational background of breast epithelial cells, since only the 85 kDa RHAMM isoform was CO-irnmunoprecipitatedin normal MCF-1OA cells whereas both RHAMM isofonns CO-immunoprecipitated with

CD44 in both the MDA-MB-23 1 cells and MCF-IOA cells overexpressing ras.

Interestingly, onIy in the MDA-MB-231 cells was the 48 kDa RHAMM isoform co-

immunoprecipitated with CD44 The level of co-imrnunoprecipitation of RHAMM with CD44 was higher in invasive MDA-MB-231 ceils and MCF-1OA cells transfected with mutant active ras as compared to MCF-7 ceUs or MCF-1OA celis transfected with empty vector. This could have been due to higher expression of both RHAMM isoforms in these cells, as shown by Western andysis, and hence more RHAMM is able to interact with

CD44 The results of immunostaining for RHAMM and CD44 in MDA-MB-231 cells indicated tbat most RHAMM and CD44 CO-association occurred in the perinuclear regions of these cells, although some immunostaining was also detected in the cellular processes and in the vesicies found close to the ce11 membrane. However, treatment with

0.1% Triton-X ablated staining for RHAMM in the cellular processes and under these conditions, we were able to observe the RHAMM and CD44 immunostaining onIy in the perinuclear regions only. Other laboratories have shown that RHAMM and CD44 are found in close association in the endocytic vesicles of astrocytoma cells, and that this association is required for HA uptake (J. Rutka, personal communication). Our results show that RHAMM and CD44 interact in the MDA-MB-23 1 cefls and MCF- 1OA cells, both of which bear ras mutations. Hence, the interaction of CD44 and RHAMM appears to predoniinate when ras is overexpressed. Although the exact regions of RHAMM interacting with CD44 and the role of this interaction remains to be investigated, this association couId add to the invasive phenotype of breast cancer cells.

IV. 6. A Model of HA and its Receptors in Werk Sipaiing and Breast

Cancer Development

Considerable data suggest that the raderk signaling pathway is involved in breast cancer progression. HA and its receptors RHAMM and CD44 regulate this signaling cascade and are Wcely implicated in breast cancer development. Although CD44 hyaluronan interactions have been show to activate AP-1, little is known about how this signal is transmitted. It is emerging that CD44 may exert its effect on AP-1-regulated genes by acting as a co-receptor for growth fxtor receptors such as c-Met or HEWneu

(Bourguignon et al., 1998b; van der Voort et al., 1999) to enhance activation of the erk kinase cascade, thereby indirectly promoting MMP-9 expression. CD44 may aiso affect

MMP-9 activity by enhancing expression of MMP-2. which is able to activate pro-MMP-

9 (Takahashi et al., 1999) Recently, two groups demonstrated that CD44 associates with

MMP-9 at the site of invadopodia (Bourguignon et al., 1998b; Yu and Stamenkovic,

1999) and this association is required for the maintenance of invadopodia, the ability of

MW-9 to degrade collagen type N, and the ability of tumor cells to invade in vitro. The ability of CD44 to bind to HA may also act to corral growth factor receptors within larnellae tips where invadopodia or podosomes occur (Yu and Starnenkovic, 1999), permitting local regulation of signaling pathways such as erk kinase which cm aiso contribute to rnotility independent of gene transcription (Klernke et al., 1997).

Both the ce11 surface and intracelluIar forms of RHAMM act on the src-ras-erkl kinase cascade (Hail et al., 1994; HaiI et al., 1995; Zhang et al., 1998). Ce11 surface

RHAMM, like CD44 participates in the binding of hyaluronan to the cell surface

(Entwistle et al., 1996; Hofmann et al., 1998) in many but not on aU ce11 types. This interaction appears to activate src, resulting in modification of the actin cytoskeleton

(Hall et al., 1996; Cheung et al., 1999). Ce11 surface RHAMM, which is not an integral membrane protein, may achieve this effect by its association with caveoli (Piiarski et al.,

1999) andor its association with growth factor receptors such as PDGF (Zhang et al., 1998). Since ce11 swface RHAMM is usually transientiy expresseci, its role in the motile cycle may be to initiate it rather than to sustain it. As mentioned earlier, RHAMM exists as several isofomis, and RHAMM(AI -5) is transiendy expresseci even in ras-transformed cells (Zhang et al., 1999). When constitutively overexpressed, RHAMM(A1-5) activates erk 1 kinase, activates AP-1, and enhances expression of MMP-9. Interestingly,

RHAMM(A1-5) is present within podosomes where it CO-localizes with both erkl and

MEKl (Harrison and Turley, 1999)- Activation of erk kinases have, in partidar, been linked to cell motility and invasion (Klemke et al., 1997; Herrera, 1998; Jeffers et al.,

1998; Tanimura et al., 1998). Since the erk kinase cascade clearly reguiates MMP-9 expression via AP-I activation in breast cancer cells (Tremble et al., 1995; Gum et al.,

1997; McCawley et al., 1999) part of the effect of hyaluronan on ce11 motility and on invasion is likely mediated, in part, by this collagenase. The ce11 surface isoform of

RHAMM which appears to be labile is a peripheral protein, unlike CD44, which has a transmembrane domain (Lesley et al., 1993). Therefore, for signaling events to occur,

RHAMM may associate with a docking protein, such as CD44 (Welsh et al., 1995) (Fig.

IV. 2.), andor perform a smcnual hinction, such as by changing the conformation of transmembrane proteins in a manner that modifies their signaling profile, For example, it has recently been shown that ce11 surface RHAMM modifies the ability of PDGF receptor to phosphorylate proteins on tyrosine (Zhang et al., 1998). Since both CD44 and

RHAMM have previously been shown to regulate ras activity, and since CD44 is involved in invadopodia formation and gelatinase B release (Bourguignon et al., 1998b), interaction between RHAMM and CD44 may enable the transmission of an extracelluiar signal regulating cell motility. In summary, the hyaladherins CD44 and RHAMM regulate signaling pathways to

control ce11 motility and invasion. One key pathway that is involved in this regdation is

the raserk kinase cascade that has previously been show to resuit in enhanced expression of MMP-9. CD44 and RHAMM might co-ordinate signaling through this

pathway to regulate expression of the collagenase, to regulate the formation of sites of

MMP release, invadopodia or podosomes, and to control activity of MMP-9 at these sites

of release. These propeaies are proposed to be responsible, io part, for the role of these

hyaiadherins in tumor progression.

Fig. IV. 2. A Mode1 of HA and its Receptors in the raslerk Signaüng Pathway IV. 7. Future Studies

While data obtained fiom the M-Sc. project descnbed in this thesis provide some

insight into the roles that RHAMM and CD44 may play in human breast cancer

development, other questions are raised as weil. There is as yet no direct evidence

indicating that RHAMM is an oncogene in human cells, although RHAMM

overexpression has been shown to transfonn murine fibroblasts (Hall et al., 1995).

Changes of cell locomotion, invasion, turnongenicity, and metastasis as weii as CD44

expression could be examined in human breast cancer cells following: i) transfection of

RHAMM cDNA and overexpression of RHAMM protein; ü) down-regdation of

RHAMM using antisense strategies; or iii) blockade of RHAMM function using mutant

RHAMM (Hail et al., 1995). Furthermore, it would be very usefid to determine whether

specific RHAMM antibodies or peptides, fusion protein, or antisense oligonucleotides could affect breast cancer cell growth and dissemination in an animal model. This study will provide the basis for future use of RHAMM as a specific therapeutic target in human breast cancer.

Although the findings in this thesis indicate that the level of RHAMM and CD44 protein expression correlate to breast cancer ce11 invasiveness phenotype, future studies could be directed towards the study of the regdation of RHAMM and CD44 expression at the transcriptional and translational levels. Furthemore, in munne fibroblast cells, the shorter isoforrn of RHAMM (RHAMM(A1-5)) is an oncogene (Hall et al., 1995). Since a

63kDa isoform is upregulated in both MDA-MB-23 1 cells and in MCF-1OA cells transfected with mutant active ras, elucidation of the role of this isoform in invasion and metastasis is necessary. Cell surface RHAMM expression is correlateci with the aggressive pbenotype of

breast cancer cells. However, more studies could be performed to identifi the isoforms

that are expressed on the ceii surface as compared to intracellularly, or to determine if the

isoforms differ in their affinities toward CD44 and erk binding. Moreover, the molecular

switch that leads to constitutive expression of cell surface RHAMM in cancerous cells as

compared to its transient nature in non-cancerous cells has yet to be discovefed.

Although results presented in this thesis demonstrates that interaction of RHAMM

and CD44 occurs in vitro, further investigation is needed to determine the domains and/

or regions of each molecule responsible for this interaction or if other intermediates such

as erk are required to faditate this interaction. For example, what are the CD44 isoforms

that bind RHAMM? Does RHAMM bind directly to CD44? Does RHAMM bind to

MMP-9? In addition, although we now know that these HA receptors interact primarily

when ras is constitutively active, it will be usehl to study the exact role of these proteins

in the raderk pathway by using other inhibitors of intermediaries in the pathway. Two

such inhibitors which have recently become available are ras-specific inhibitor (famesyl transferase inhibitor- 1) and erk inhibitor (PD 184352) compound. inhibition studies using these reagents could provide more information on the roles of RHAMM and CD44 in this pathway and could lead to novel therapeutic approaches.

Another gap in Our understanding is the role of RHAMM in the nucleus of ras- overexpressing cells. Initial studies in this area are suggestive of the role of RHAMM in

spindle organization during mitosis in the ras-transformeci breast epithelial cells (R.

Harrison, personal communication) and the role of RKAMM in nuclear HA uptake (L.

Collis, personal communication) in breast cancer ceils. Future studies could therefore be directed toward deteminhg whether nuclear HA lm aiization is dependent upon nuclear

RHAMM and its interaction with nuclear erk, CHAPTER V

REFERENCES Abetamam, V, Kem, HP. and Elsasser, H.P. (1996). Differential expression of the hyaluronan receptors CD44 and RHAMM in human pancreatic cancer cells. Ch Cancer Res. 2, 1607-1618.

Albino, A., GAF, J., Kitten, G.T., Kleinman, HK, Martin, GR., Veillette, A. and Lippman, ME. (1986). 17pestradiol regulates and v-Ha-ras transfection constitutively enhances MCF-7 breast cancer cell interactions with basement membrane. Proc. Nat2 Acad. Sci. U.S.A.83,8 182-8 186.

Alessi, D.R., Cuenda, A., Cohen, P., Dudley, D.T. and Saltiel, A.R. (1995). PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J. Biol. Chem. 270,27489-27494.

Amundadottir, L.T. and Leder, P. (1998). Signal transduction pathways activated and required for mammary carcinogenesis in response to specific oncogenes. Oncogene 16, 737-746.

Ancireasen, P.A., Kjoller, L., Christenesen, L. and Duffy, M.J. (1997). The urokinase- type plasminogen activator system in cancer metastasis: a review. Int. Cancer 72, 1-22.

Angello, J-C., Danielson, K.G., Anderson, LW. and Hosick, H.L. (1982). Glycosarninoglycan synthesis by subpopulations of epithelial cells from a mammary adenocarcinoma Cancer Res. 42,2207-22 10.

Araki, S., Kikuchi, A., Hata, Y., Isomura, M. and Takai, Y. (1990). Regulation of reversible binding of smg p25A, a ras p21-like GTP-binding protein, to synaptic plasma membranes and vesicles by its specific regdatory protein, GDP dissociation inhibitor. J. Biol. Chem. 265, l3OO7- 13015.

Aruffo, A., Stamenkovic, L, Melnick, M., Underhiil, C.B. and Seed, B. (1990). CD44 is the principal cell surface receptor for hyaluronate. CeLZ 61,1303- 1313.

Assmann, V., Marshall, J.F., Fieber, C., Hofmann, M. and Hart, I.R. (1998). The human hyaluronan receptor RHAMM is expressed as an intracellular protein in breast cancer. J. Cell Sci. lll,l68S- 1694.

Auvinen, P.K., Parkkinen, JJ., Johansson, R.T., Agren, U.M., Tammi, R.H., Eskelinen, M.J. and Kosma, V.M. (1997). Expression of hyaluronan in benign and malignant breast lesions. Int. J. Cancer 74,477-48 1.

Ayroldi, E., Cannarile, L., Migliorati, G., Bartoli, A., Nicoletti, 1. and Riccardi, C. (1995). CD44 (Pgp-1) inhibits CD3 and dexamethasone-induced apoptosis. BIood 86,2672-2678.

Bae, S.N., Arand, G., km,H., Pavasant, P., Torri, J., Frandsen, T.L. and Thompson, E.W. (1993). Molecular and cellular analysis of basement membrane invasion by human breast cancer cells in matrigel-based in vitro assays. Breast Cancer Res. Treat, 24, 241- 255.

Bajorath, J., Greenfield, B., Munro, SB., Day, A.J. and Aniffo, A. (1998). Identification of CD44 residues important for hyaluronan binding and delineation of the binding site. J. Biol. Chem. 273,338-343.

Balmanno, K. and Cook, J.S. (1999). Sustained MAP kinase activation is required for the expression of cyclin D 1, p2 1 and a subset of AP-1 proteins in CCL39 ce&. Oncogene 18, 3085-3097.

Bartolazzi, A., Nocks, A., Aruffo, A., Spring, F. and Starnenkovic, 1. (1996). Glycosylation of CD44 is implicated in CD44mediated ceil adhesion to hyaluronan. J. Cell Biol. 132,1199-1208.

Basolo, F., Elliott, J., Tait, L., Chen, X.Q., Maloney, t., Russo, LH., Pauley, R., Momiki, S., Caarnano, J., Klein-Szanto, AJ-P., Koszaika, M. and Russo, J. (1991). Mol. Carcinogen- 4,2535.

Ben-Levy, R., Paterson, H.F., Marshall, C.J. and Yardmen, Y. (1994). A single autophosphorylation site confers oncogenicity to the NeuErbB-2 receptor and enables coupling to the MAP kinase pathway. EMBO J. 13,3302-33 1 1.

Bennett, K.L., Modrell, B., Greenfield, B., Bartolazzi, A., Stamenkovic, L, Peach, R., Jackson, D.G., Spring, F. and Amffo, A. (1995). Regulation of CD44J. binding to hyaluronan by glycosylation of variably spliced exons. J. Ce11 Biol. 138, 1623-1633.

Berchuck, A., Rodriguez, G., Kamel, A., Soper, J.T., Clarke-Pearson, D.L. and Bast, R.C. ( 1990). Expression of epidermal growth factor receptor and HER-Uneu in normal and neoplastic cewix, vulva, and vagina Obsret. Gynecol. 76,38 1-78 1.

Bertrand, P., Girard, N., Delpech, B., Duval, C., d'Anjou, J. and Dauce, J.P. (1992). Hyaluronan (hyaluronic acid) and hyaluronectin in the extracellular maûix of human breast carcinomas: cornparison between invasive and non-invasive areas. Znt. J. Cancer 52, 1-6.

Bertrand, P., Girard, N., Duval, C., D'Anjou, J., Chauzy, C., Menard, J.F. and Deplech, B. (1997). Increased hyaluronidase levels in breast tumor metastases. Int. Cancer 73, 327-33 1.

Boguski, M.S. and McConnick, F. (1993). Proteins regulating ras and its relatives. Nature 366,643-654.

Bos, J.L. (1988). Ras oncogenes in human cancer: a review. Cancer Res. 49,4682-4689. Bottaro, D.P., Rubin, J.S. and Faktto, DL. (1991). Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product Science 258,802-ûû4.

Boudreau, N., Turley, E. and Rabinovitch, M. (1991). Fibronectin, hyaluronan and a hyaluronan binding protein contribute to increased ductus arteriosus smooth muscle cell migration. Dev. Bol. 143,235-247.

Bourguignon, L.Y., Lokeshwar, VB., Chen, X. and Kemclc, W.G. (1993). Hyaluronic acid-induced lymphocyte signal transduction and HA receptor (GPWCD44)- cytosketeton interaction. J. Inununol. 15,6634-6644.

Bourguignon, L.Y.W.,Gunja-Smith, Z., Iida, N., Zhu, H.B., Young, LJ-T., Muller, WJ. and Cardiff, RD. (1 998a). CD44v(3,8-10) is involved in cytoskeleton-meâiated tumor ce11 migration and matrix metalloproteinase (MMP-9) associated in metastatic breast cancer cells. J. Cell Physiol. 176,206-215.

Bourguignon, L-Y-W-, Zhu, D. and Zhu, H. (1998b). CD44 isofomi-cytoske~eton interaction in oncogenic signaling and tumor progression. Front. Biosci. 3, D637-D649.

Bourguignon, L.Y.W., Zhu, He,Chu, A., Iida, N., Zhang, L. and Hung, M.C. (1997). interaction between the adhesion receptor, CD44,and the oncogene product, pl85HER2, promotes human ovarian tumor ce11 activation. J. Biol. Chem. 272,279 13-279 18.

Bourne, H.R., Sanders, D.A. and McCormick, F. (1990). The GTPase superfamiiy: conserved structure and molecular mechanism. Nature 349, 1 17- 126.

Boyd, J., Takahashi, H., Waggoner, SE., Jones, L.A., Hajek, R.A., Wharton, J.T., Liu, F.S., Fujino, T., Barrett, J-C. and McLachlan, I.A. (1996). Molecular genetic analysis of clear ce11 adenocarcinornas of the vagina and cervix associated and unassociated with dieth yls tilbestrol exposure in utero. Cancer 77,507-5 13.

Brunet, A., Roux, D., Lenormand, P., Dowd, S., Keyse, S. and Pouyssegur, J. (1999). Nuclear translocation of p24/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. EMBO J. 18,664-674.

Catterall, J.B., Gardner, M.J. and Turner, G.A. (1995). Hyaluronic acid, ce11 adhesion, and metastasis. Cancer J. 8, 1320- 1324.

Cheung, W.F., Cruz, T.F. and Turley, E.A. (1999). Receptor for hyaluronan-mediated motility @HAMM), a hyaladherin that regulates ce11 responses to growth factors. Biochem. Soc. Tm.27, 135-142.

Chang, C.Y.M., Harrison, R-, Li, A-, Yang, X., McCarthy, J.B. and Turley, E.A. (1997). Fibronectin-RHAMM interactions regulate ce11 motility. FASEB J. A1095, 1397. Clark, G.J. and Der, CJ. (1994). Oacogenic activation of ras proteins. In: GZPases in Biology I., Dickey, B.F. and Birnbaumer. L. (eds.), Berlin: Spnnger Verlag, pp. 2590- 2598.

Classen, S.D., Eirman, W., Wolf, H., KOPP, R. and Wilmans, W. (1995). CD44 variant in semm of breast cancer patients: a prognostic factor for clinical progression? Proc. Am. Assoc. Cancer Res. 36,209.

Collis, L., Hall, C., Lange, L., Ziebeii, M., Prestwich, R. and Turley, E.A. (1998). Rapid hyaluronan uptake is associated with enhanced motility: implications for an intracelluiar mode of action. FEBS Let?. 440,444449.

Crainie, M., Blech, AR.. Mant, MJ. and Pilarski, LM. (1999). Overexpression of the receptor for hyaluronan media& motility (RHAMM) characterizes the malignant clone in multiple myeloma: identification of three distinct RHAMM variants. Blood 93, 1984- 1696.

Culty, M., Nguyen, H.A. and Underhill, C.B. (1994). The hyalwonan receptor (C'DM) participates in the uptake and degradation of hyaluronan. J. Cell Biol. 116.1055- 1062.

Dalchau, R., Kirldey, J. and Fabre, J.W- (1980). Monoclonal antibody to a human Ieukocyte-specific membrane glycoprotein probably homologous to the leukocyte- cornmon (L-C)antigen of the rat. Eur. J. Immunol. 10,737-744.

Dasgupta, A., Takahashi, K., Cutler, M. and Tanabe, K.K. ( 1996). O-hked glycosylation modifies CD44 adhesion to hyaluronate in colon carcinoma cells. Biochem Biophys. Res. Commun. 227, 110- 1 17.

Delpech, B., Girard, NeTBertrand, P., Courel, M.N., Chauzy, C. and Delpech A. (1997). Hyaluronan: fundamental pnnciples and applications in cancer. J. Intern. Med 242, 41- 48.

Dickson, R.B. and Lippman, M.E. (1997). Cancer of the breast. In: Cancer. Pniiciples & Practice of Oncology. B.T.J. DeVita, S. Hellman and S.A. Rosenberg, (eds.), Philadelphia: Lippincott-Raven, pp. 1541- 1557.

Dudley, D.T.,Pang, L., Decker, SJ., Bridges, A.J. and Saltiel, AR. (1995). A synthetic inhibitor of the rnitogen-activated protein kinase cascade. Pmc. Nat1 Ac& Sci. U.S.A. 92, 7686-7689.

Duesbery, N. and Vande Woude, G.F. (1999). Anthrax lethal factor causes proteolytic inactivation of MAP-kinase-kinase. Lert. Appl. Mcrobiol- (in press).

El-Ashry, D. and Lippman, M.E. (1994)- Moleculas bioiogy of breast carcinoma Wodd J. Surg. 18, 12-20. Entwistle J., Hall, C.L. and Turley, E.A. (1996). HA ceceptors: regulators of sigaaüng to the cytoskeleton. 'Cell Biochem. 61,569-577. Entwistle, J., Zhang, S., Yang, B., Wong, C., Li, Q., Hall, CL, A.j., Mowat, M., Greenberg, A.H. and Turley, E.A. (1995). Charactenzation of the murine gene encoding the hyaluronan receptor RHAMM. Gene 163,233-238.

Faassen, A.E., Mooradian, D-L., Tranquille, R-T., Dickinson, RB., Letomeau, P.C., Oegema, T.R. and McCarthy, J.B. (1993). Ce11 surface CD44-related chondroitin sulfate proteoglycan is required for transforming growth factor-beta-stimulated mouse melanoma ce11 motility and invasive behavior on type 1collagen J. Cell Sci. 105,501-51 1.

Fearon, E.R. and Vogelstein, B. (1990) A genetic mode1 for colorectal tumorigenesis. Cell61,759-767.

Fearon, E.R., Cho, K.R., Nigro, LM.,Kern, S.E., Simons, LW., Ruppert, J.M., Hamilton, SR., Preisinger, A.C., Thomas, G. and Kuizler, ICW. (1990). Identification of a chromosome 18q gene that is altered in colorectal cancers. Science 24,749-756.

Fidler, I.J. (1978). Tumor heterogeneity and the biology of cancer invasion and metastasis. Cancer Res. 9, 265 1-2660.

Fieber, C., Plug, R., Sleeman, J., Dail, P., Ponta, H. and Hohann, M. (1999). Characterîsation of the murine gene encoding the intracellular hyaluronan receptor IHABP(RHAMM). Gene 226,4 1-50.

Fisher, B., Osborne, C.K., Margolese, R.G. and Bloorner, WB. (1997). Neoplasms of the breast. In: Cancer Medicine. J.W.J. Pine (ed.), Baltimore: WilIiams & Wilkins, pp. 2349- 2429.

Folkman, 1. (1997). Angiogenesis and angiogenesis inhibition: an overview. EXS. 79, 1- 8.

Funaro, A., Spagnoti, G.C., Momo, M., Knapp, W. and Malavasi, F. (1994). Stimulation of T cells via CD44 requires leukocyte-function-associated antigen interactions and interleukin-2 production. Hum. Immunol. 40,267-278.

Galandrini, R., Albi, N., Tripodi, G., Zarçone, D., Terenzi, A., Moretta, A., Grossi, C.E. and Velardi, A. (1993). Antibodies to CD44 trigger effector functions of human T ce11 clones. J. Zmmunol. 150,4225-4235.

Galandrini, R., Piccoli, M., Frati, L. and Santoni, A. (1996). Tyrosine kinase-dependent activation of human NK ce11 functions upon triggenng through CD44 receptor. Eur. J. Zmmunol. 26,2807-28 1 1. Gares, S.L., Giannakopoulos, N., MacNeil, D-, Faull, R.J. and Pilarski, LM- (1998). During human thymic development, beta 1 integrins regulate adhesion, motility, and the ouicorne of RHAMMmyaluronan engagement. J. Leukoc. Biol. 64,78 1-790.

Ghaffari, S., Dougherty, G.J., Lansdorp, P-M., Eaves, A.C. and Eaves, CJ. (1995)- Differentiation-associateci changes in CD44 isoform expression during normal hematopoiesis and their alteration in chronic myeloid leukernia. Blood 86,2976-2985.

Gilhooly, E.M. and Rose, D.P. (1999). The association between a mutated ras gene and cyclooxygenase-2 expression in human breast cancer ce11 lines. Int. J' Oncol. 15, 267- 270.

Goebeler, M., Kaufmann, D., Srocker, EB. and Klein, C.E. (1996). Migration of highly aggressive melanoma ceils on hyaluronk acid is associated with functional changes, increased turnover and shedding of CD44 receptors. J. Ceil Sci. 109, 1957-1964.

Goldstein, L.A., Zhou, D.F., Picker, L.J., Minty, CS., Bargatze, RI., Ding, W.and Butcher, E.C. (1989). Human lymphocyte homing receptor, the hermes antigen, is relatai to cartilage proteoglycan core and link proteins. Cell56, 1063-1072.

Grammatikakis, N., Grammatikakis, A., Yoneda, M., Banerjee, S.D. and Toole, B-P- (1995). A novel glycosaminoglycan-binding protein is the vertebrate homologue of the ce11 cycle control protein, cdc37. J. Bid Chem 270, 16 198- 16205.

Gunthert, U., Hohann, M.,Rudy, W., Reber, S., Zoller, M., Haubmann, I., Matzku, S., Wenzel, A., Ponta, H. and Herrlich, P. (1995). A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Ce11 65, 13-24.

Gum, R., Wang, H., Lengyel, E., Juarez, J. and Boyd, D. (1997). Regulation of 92 kDa type N collagenase expression by the jun amino terminal kinase- and the extracellular signal regulated kinasedependent signaling cascades. Oncogene 14, 148 1- 1493.

Guo, YJ., Ma, J., Wang, J., Che, X., Narula, J., Bigby, M., Wu, M. and Sy, M.S. (1994)- Inhibition of human melanoma growth and metastasis in vivo by anti-CD44 monoclonal antibody. Cancer Res. 54, 156 1- 1565.

Hall, CL., Wang, C., Lange, L.A. and Turley, E.A. (1994). Hyaluronan and the hyaluronan receptor RHAMM promote focal adhesion turnover and transient tyrosine kinase activity. J. Cell Biol. 126,575-588.

Hall, CL.,Yang, B., Yang, X., Zhang, S., Turley, M., Samuel, S., Lange, L.A., Wang, C., Curpen, G.D., Savani, R.C., Greenberg, A.H. and Turley, E.A. (1995)- Overexpression of the hyaluronan receptor RHAMM is transforming and is also required for H-ras transformation. Cell82, 19-26. Hardwick, C., Hoare, K., Owens, R, Hohn, H.P., Hook, M., Moore, D., Cripps, V., Austen, L., Nance, DM. and Turley, E.A. (1992). Molecular clonhg of a novel hyaluronan receptor that mediates tumor ce11 motility. J. Ce11 BioL 117, 1343-1350.

Harrison, R. and Tudey, E.A. (1999). http:// www.giycoforum.gr.jp/ science/ hyaluronanl HA1 l/ HA1 1E.html

Hart, I.R., Birch, M. and Marshall, J.F. (199 1). Ce11 adhesion receptor expression during melanoma progression and metastasis. Cancer Met. Rev. 10, 1 15-128.

Hayashi, M., Schelienberg, R.R., Tsang, S. and Roberts, C.R. (1999). Matrix metalloproteinase-9 in myeloid cells: Implications for allergic inflammation. Znt. Arch. Allergy Immunol. 118,429432,

Heldin, P. and Pertoft, H. (1993). Synthesis and assembly of the hyaluronancontaining coats around normal human mesothelial cells. Exp. Cell Res. 208,422429.

Herrera, R. (1998) Modulation of hepatocyte growth factor-induced scattering of Hi29 colon carcinoma ceils. Involvement of the MAPK pathway. J. Cell Sci. 11, 1039- 1ON.

Herrera-Gayol, A. and Jothy, S. (1999b). Adhesion proteins in the biology of breast cancer: contribution of CD44 Exp. Mol. Pathol. 66,149- 156.

Himelstein, B.P., Lee, E.J., Sato, H., Seiki, M. and Muschel, R.J. (1997). Transcriptional activation of the matrix metalloproteinase-9 gene in an H-ras and v-myc transformed rat embryo ce11 line. Oncogene 14,1995- 1998.

Hirao, M., Sato, N., Kondo, T., Yonemura, S., Monden, M., Sasaki, T., Takai, Y. and Tsukita, S. (1996). Regulation mechanism of ERM (ezrin/radixin/moesin) proteidplasma membrane association: possible involvement of phosphatidylinositol turnover and Rho- dependent signaiing pathway. J. Cell Biol. 135,3741.

Hiscox, S. and Jiang, W.G. (1999). Association of the HGFISF receptor, c-met, with the cell-surface adhesion molecule, E-cadherin, and catenins in huma. tumor cells. Biochem. Biophys. Res. Commun. 261,4û64 1 1.

Hofmann, M., Fieber, C., Assmann, V., Gottlicher, M., Sleeman, J., Plug, R., Howells, N., von Stein, O., Ponta, H. and Herrlich, P. (1998). Identification of IHABP, a 95 kDa intracellular hyduronate binding protein. J. Ce11 Sci. 111, 1673- 1684.

Hoshino, R. (1999). Constitutive activation of the 41143-kDa mitogen-activated protein kinase signaling pathway in human tumors. Oncogene 18,813-822.

Hotchin, N.A. and Hall, A. (1996). Regulation of the actin cytoskeleton, integrins and ce11 growth by the Rho famiiy of small GTPases. Cancer Surv. 27,3 1 1-322. Hua, Q., Knudson, C.B. and Knudson, W. (1993). Intemalization of hyaluronan by chondrocytes occurs via receptor-mediated endocytosis. Ce11 Sci., 106,365-375.

Hulleman, E., Bijvelt, J.J., Verkleij, AJ., Vemps, C.T- and Bmnstra, J. (1999). Nuclear translocation of mitogen-activated protein kinase p42MAPK during the ongoing ceU cycle. J. Cell Physiol. 180,325-333.

Hyman, R., Lesley, I. and Schulte, R (1991). Somatic cell mutants distinguish CD44 expression and hyaluronic acid binding. Immunogenetics 33,392-395.

Ilangumaran, S., Briol, A. and Hoessli, D.C. (1998). CD44 selectively associates with active Src farnily protein tyrosine kinases Lck and Fyn in glycosphîngolipid-rkh plasma membrane domains of human perïpheral blood lymphocytes. Blood 91,3901-3908.

Itano, N., Sawai, T., Miyaishi, 0. and Kirnata, K. (1999). Relationship between hyaluronan production and metastatic potential of mouse mammary carcinoma cells. Cancer Res. 59,2499-2504-

Jalkanen, S. and Jalkanen, M- (1992). Lymphocyte CD44 binds the COOH-terminal heparin-binding domain of fibronectin. J. Cell Biol. 116,817-825.

Jarnd, H.H., Cano-Gauci, D.F., Buick, R.N. and Filmus, J. (1994). Activated ras and src induce CD44 overexpression in rat intestinal epitheiial cells. Oncogene 9,4 17-423-

Jeffers, M., Fiscella, M., Webb, C.P., Anver, M., Koochekpour, S. and Vande Woude, D.F. (1998). The mutationaliy activated Met receptor mediates motility and metastasis. Proc- Nat2 Acad. Sci. U.S.A. 95, 1441 7- 14422.

Kalish, E-D., Iida, N., Moffat, F.L. and Bourguignon, L-Y-W. (1999). A new CD44v3- containing isoform is involved in tumor ce11 growth and migration during human breast carcinoma progression. Front. Biosci. 4, 1-8.

Kantor, J.D. and Zetter, B.R. (1996). Cell motility in breast cancer. Cancer Treat Res. 83,303-323.

Katagiri, Y.U., Sleeman, J., Fujii, H., Herrlich, P-,Hotta, H., Tanaka, K., Chikuma, S., Yagita, H-,Okumura, K., Murakami, M., Saiki, I., Chambers, A.F. and Uede, T. (1999). CD44 variants but not CD44 cooperate with beta 1-containhg integrins to permit cells to bind to osteopontin independently of arginine-glycine-aspartic acid, thereby stimulating ce11 motility and chemotaxist Cancer Res. 59,2 19-226,

Karin, M. (1995). The regulation of AP-1 activity by mitogen-activated protein kinases. J. Biol. Chem. 270, 16483-16486. Kimura, Y., Rutherford S.L., Miyata, Y-, Yahara, I., Freeman, S.C., Yue, L., Morimoto, R.L and Lindquist, S. (1997). Cdc37 is a molecular chaperone with specific hinctions in signal transduction. Genes Dev. 11, 1775- 1785.

Klemke, R.L., Cai, S., Giannini, A.L., Gaiiagher, PJ., de Lanerolle, P. and Cheresh, DA, (1 997). Regulation of ce11 motility by mitogen-activated protein kinase. J. Ce11 Biol. 137, 48 1-492.

Knudson, W. (1996). Turnor-associated hyaluronan. Providïng an extraceilular matrix that facilitates invasion. Am. J. Pathol. 148, 1721- 1726.

Knudson, W. (1998). The role of CD44 as a ceil surface hyaiuronan receptor during tumor invasion of comective tissue. Front- Biosci. 3, D604-D615.

Kogerman, P., Sy, M.S. and Culp, L.A. (1996). CD44 protein levels and its biological activity are regulated in Balbk 3T3 fibroblasts by serum factors and by transformation with the ras but not with the sis oncogene. J. Cell Physiol. 169,341-349.

Kohda, D., Morton, C.J., Parker, A.A., Hatnda, H., Inagaki, F.M., Campbell, ID. and Day, A.J. (1996). Solution structure of the link module: a hyalwonan-binding domain involved in extracellular rnatrix stability and ce11 migration. Celi 86,767-775.

Koop, S., Schmidt, E.E., MacDonald, E.C., Moms, V.L., Khokha, R., Grattan, M., Leone, J., Chambers, A.F. and Groom, A.C. (1996). Independence of metastatic ability and extravasation: metastatic ras-transformed and control fibroblasts extravasate equally well. Proc. Nat1 Acad. Sci. USA.93, 1 1080-1 1084,

Kyriakis, J.M. (1999). Making the connection: coupling of stress-activated ERK/MAPK (extracellular-signal-~gulatedkinasehitogen-activated protein lunase) core signaiing modules to extracelIular stimuli and biological responses. Biochem. Soc. Symp. 64,2948.

Laurent, TC.and Fraser, J.R.E. (1992). Hyaluronan. FASEB J. 6,2397-2404.

Lesley J., Hyman, R. and Kincade, P-W. (1993). CD44 and its interaction with extracellular rnatrix. Adv. Immunol. 54271-335.

Levine, M.D., Liotta, L.A. and Stracke, M.L. (1995). Stimulation and regdation of tumor ce11 motility in invasion and metastasis. E.X.S. 74, 157-179.

Lewis, T.S., Shapiro, P.S. and Ahn, N.G. (1998). Signal transduction through MAP kinase cascades. Adv. Cancer Res. 74,49- 139.

Liotta, L.A. (1986). Tumor invasion and metastases - role of the extracellular matrix: Rhodes Memorial Award lechue. Cancer Res. 46, 1-7.

Llorens, A., Rodrigo, L, Lopez-Barcons, L., Gonzaiez-Garrigues, M., Lozano, E., Vinyals, A., Guintanilla, M., Cano, A. and Fabra, A. (1998). Dom-regulation of E- cadherin in mouse skin carcinoma ceils enhances a migratory and invasive phenotype linked to matrix metailoproteinase-9 gelaîinase expression. Lab. Invest. 78, 1 131 - 1142. Lokeshw ar, V.B. and Bourguignon, L.Y. (1 99 1). Post-translationaiJ. protein modiftcation and expression of ankyrUi-binding site(s) in GP85 (PgpllCD44) and its biosynthetic precursors dwiag T-lymphoma membrane biosynthesis. Biol. Chem. 266, 17983- 17989.

Maeda, M., Vaniandingham, B.D., Ye, H., Lu, P.C. and Amr, D.T. (1998). Immunoconfocal localization of gelatinase B expresseci by migrating intrastromal epithelial ceLls &r deep annular excimer keratectomy. Curr. Eye Res. 8,836-843.

Mackay, CR., Maddox, J.F., Wijffels, G.L., Mackay, I.R. and Walker, 1.D. (1988). Characterization of a 95,000 molecule on sheep leukocytes homologous to murine Pgp-1 and human CD44 Iinmunology 65,93-99.

Mackay, CR., Terpe, H.J., Stauder, R., Marston, W.L., Stark, H. and Gunthert, U. (1994). Expression and modulation of CD44 variant isoforms in humans, J. Cell Biol. 124,7142.

Madan, A.K., Yu, K., Dhurandhar, N., Cullinane, C., Pang, Y., Beech, DJ. (1999). Association of hyaluronidase and breast adenocarcinoma invasiveness. Oncol. Rep. 6, 607-609.

Mangues, R., Corral, T., Lu, S., Synimans, WJ?., Liu, L. and Pellicer, A. (1998). NF1 inactivation cwperates with N-ras in in vivo lyrnphogenesis activating Erk by a mechanism independent of its Ras-GTPase accelerating activity . Oncogene 17 1,705-7 16.

Masellis-Smith, A., Belch, A.R., Mant, M.J., Turley, E.A. and Pilarski, L.M. (1996). Hyaluronan-dependent motility of B cells and leukemic plasma cells in blood, but not of bone marrow plasma cells, in ultiple myeloma: alternate use of receptor for hyaluronan- mediated motility (RHAMM) and CD44 BIood 87, 1891- 1899.

Mareel, M.M., Van Roy, F.M. and Bracke, M.E. (1993) How and when do tumor cells metastasize? Crit. Rev. Oncog. 4, 559-594.

Matsumoto, K., Asano, T. and Endo, T. (1997). Novel small GTPase M-Ras participates in reorganization of actin cytoskeleton. Oncogene 15,2409-2417.

McCawley, J.L., Wattenberg, E-V. and Hudson, L.G. (1999). Sustained activation of mitogen-activated protein kinase pathway: a mechanism underlying receptor tyrosine kinase specificity for matrix metalloproteinase-9 induction and ce11 migration. J. Biol. Chem. 274,4347-4353. Mira, E., Manes, S., LacalIe, R.A., Marquez, G. and Martinez, AC. (1999)- Insulin-Like growth factor 1-triggered ce11 migration and invasion are mediatecl by matrix metalloproteinase-9. Endocrinology 140, 1657-1664.

Mohapatra, S., Yang, X., Wright, J.A., Turley, E.A. and Greenberg, A.H. (1996). Soluble hyaluronan receptor RHAMM induces mitotic arrest by suppressing cdc-2 and cyclin B 1 expression. J. Exp. Med 183, 1663-1668.

Mulder, W.M., Stem, PL., Stukart, M.J.,de Windt, E., Butzelaar, R.M., Meijer, S., Ader, H.J., Claessen, A.M., Vermorken, J.B., Meijer, CJ., Wagstaff, J., Scheper, RJ., Bloemena, E. (1997). Low intercellular adhesion molecule 1 and high 5T4 expression on tumor cells correlate with reduced disease-free swvival in colorectd carcinoma patients. Clin. Cancer Res. 3, 1923- 1930.

Nagy, J-L, Hacking, J ., Frankenstein, UN. and Turley, E.A. (1998). Requirement of the hyaluronan receptor RHAMM in neunte extension and motility as demonstrated in pnmary neurons and neuronal ce11 lines. J. Neurosci. 86,24 1-255.

Nddini, L., Weidner, K. M. and Vigna, E. (1991). Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10,2867-2878.

Naor, D., Slonov, R-V. and Ish-Shalom, D. (1997). CD44 structure, fimction, and association with the rnalignant process. Adv. Cancer Res. Tl,% 1-3 19.

Naujokas, M.F., Morin, M., Anderson, M.S., Peterson, M. and Miiler, J. (1993). The chondroitin sulfate form of invariant chain can enhance stimuIation of T ceil responses through interaction with CD44 Ceil 74,257-268.

Neame, S.J., Uff, CR., Sheikh, H., Wheatley, SC. and Isacke, C.M. (1995). CD44 exhibits a ce11 type dependent interaction with triton X-100 insoluble, lipid rich, plasma membrane domains. 'CeIl Sci. 1M,3127-3 135. Nguyen, H.D., Hussaini, M. and Gonias, L. (1998). Binding of urokinase-type plasminogen activator to its receptor in MCF-7 cells activates extracellular signal- reguIated kinase 1 and 2 which is required for increased cellular motility. 3. Biol. Chem. 273,8502-8507.

Nishio, K. ( 1999). Mitogen-activated protein kinase antisense oligonucleotide inhibits the growth of human lung cancer celis. Int. J. Oncol. 14,461-469.

Okada, H., Yoshida, J., Sokabe, M.,Wakabayashi, T. and Hagiwara, M. (1996). Suppression of CD44 expression decreases migration and invasion of human gtioma celis. Int. J. Cancer 66,255-260.

Qui, M.S. and Green, S.H. (1992). PC12 ceii neuronai differentiation is associated with prolonged p2 1ras activity and consequent prolonged ERK activity. Neuron. 9,705-7 17.

Radotra, B., McCormick D. and Crockard, A. (1994). CD44 plays a dein adhesive interactions between giioma ceiis and extracellular matrix components. Neuropathol. Appl. Neurobiol. 20,39945.

Reddy, K.B., Kmeger, J.S., Kondapaka, SB. and Digiio, C.A. (1999). Mitogen-activaîed protein kinase (MAPK) regulates the expression of progelatinase B (MMP-9) in breast epithelial cells. Int. Cancer 82,268-273.

Reszka, A.A., Bulinski, C., Krebs, E.G. and Fischer, E.H. ( 1997). Mitogen-activated protein kinasdextraceiiuiar signaling-regulated kinase 2 regdates cytoskeletai organization and chernotaxis via catalytic and microtubule-specific interactions. Mol. Cell Biol. 8, 1219- 1232.

Roos, E. ( 1991). Adhesion moleculcs in lymphoma metastasis. Cancer Met. Rev. 10,33- 48.

Ropponen, K., Tamrni, M., Parkkinen, J., Eskelinen, M., Tammi, R., Lipponen, P., Agen, U., Alhava, E. and Kosma, VM. (1998) Tumor cell-associated hyalwonan as an unfavorable propostic factor in colorectal cancer. Cancer Res. 58,342-347.

Ross, J.S. and Fletcher, I.A. (1999). HER-Uneu (c-erb-B2) gene and protein in breast cancer. Am J. Clin. Pathol. 112, S53-S67.

Salh, B. (1999). DifferentiaI cyclin-dependent kinase expression and activation in human colon cancer. Anticmcer Res. 19,741-748.

Samuel, S.K., Hurta, R.A.R., Spearman, M.A., Wright, I.A., Turley, E.A. and Greenberg, A.H. (1993). TGF-pl stimulation of ce11 locomotion utilizes the hyaluronan receptor RHAMM and hyaluronan. J. Cell Biol. 123,749-758.

Savani, R.C., Khalil, N. and Turley, E.A. (1995a). Hyaluronan receptor antagonists alter skin inflammation and fibrosis follow ing injury. Proc. West. Phamcol Soc. 38, 1 3 1- 136.

Savani, R.C., Wang, C., Yang, B., Zhang, S., Kinsella, M., Wight, T.N.,Stem, R., Nance, D.M. and Turley, E.A. (1995b). Migration of bovine aortic smooth muscle cells folhwing wounding injury. The role of hyaiuronan and RHAMM. J. Clin. Invest. 95, 1158-1 168.

Scott, J.E. (1989). Secondary structures in hyalwonan solutions: chernical and biologicai implications. In: The Biology of Hyaluronan, Ciba Foundotion Symposium 143. D. Evered and J. Whelan (eds.), Chichester, England: Wiley, pp. 6- 15. Scott, JE. ( 1992). Supramolecular organization of extraceilular rnatrix glycosaminoglycans, in vitro and in the tissues. FASEB J. 6,263902645.

Screaton, G.R., Beil, M.V., Jackson, DG.,Cornelis, F.B., Gerth, U. and Beil, J.L (1992). Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 altematively spliced exons. Proc. Nat1 Acad. Sci. U.S.A. 89, 12160-12 164.

Seger, R. and Krebs, E.G. (1995). The MAPK signaling cascade. FASEB J. 9,726-735.

Shackney, S.E., Poliice, A.A., Smith, C.A., Janocko, L.E., Sweeney, L., Brown, KA., Singh, S.G., Gu, L., Yakulis, R. and Lucke, J.F. (1998). Intraceiiular CO-expressionof epidermal growth factor receptor, Her-Uneu, and p2lras in human breast cancers: evidence for the existence of distinctive patterns of genetic evolution that are cornmon to tumors from different patients. Clin Cancer Res. 4,9 13-928.

Sherman, L., Sleeman, J., Herrlich, P. and Ponta, H. (1994). Hyaluronate receptors: key p 1ayers in growth, differentiation, migration and tumor progression. Cum. Opin. Cell Biol. 6,726-733.

S ivararnan, V.S ., Wang, H., Nuovo, G.J. and Malbon, C.C. (1997). Hyperexpression of mitogen-activated protein kinase in human breast cancer. J. Clin. Invest. 99, 1478-1483.

Sleeman, J.P., Kondo, K., Moll, J., Ponta, H. and Herrlich, P. (1997). Variant exons v6 and v? together expand the repertoire of glycosaminoglycans bound by CD44 J. Biol. Chem. 272,3 1837-3 1844.

Sneath, R.J. and Mangharn, D.C. (1998).The normal structure and function of CD44 and its role in neoplasia. Moi. Pathol. 51, 191-200.

Somrners, C.L., Byers, S.W., Thompson, E.W., Tom, J.A. and Gelmann, E.P. (1994). Differentiation state and invasiveness of human breast cancer ce11 lines. Breast Cancer Res. Treat. 31,325-335.

Sommer, F., Huber, M., Rollinghoff, M. and Lohoff, M. (1995). CD44 plays a co- stimulatory role in murine T ce11 activation: ligation of CD44 selectively co-stimulates IL-2 production, but not proliferation in TCR-stimulated murine Th1 cells. Int. lmmunol. 7, 1779- 1786.

Soule, H.D., Maloney, T.M., Wolman, S.R., Peterson, W.D.J., Brenz, R., McGrath, C.M., Pauley, R.J., Jones, R.F. and Brooks, S.C. (1990). Isolation and characterization of a spontaneously immortalized human breast epitheliai ce11 line, MCF-IO. Cancer. Res. 50, 6075-6086.

Spandidos, D.A. (1987). Oncogene activation in malignant transformation: a study of H- ras in human breast cancer. Anticancer Res. 7,99 1-996. Stamenkovic, L, Amiot, M., Pesando, J. and Seed, B. (1989). A lymphocyte molecule implicated in lymph node homing is a member of the cartilage link protein family. Ce11 56, 1057-1062,

Staurder, R., Eisterer, W., Thaler, J. and Gunthert, U. (1995)- CD44 variant isofonns in non-Hodgkin's lymphoma: a new independent prognostic factor. Bloud 85,2885-2899.

Stelter-Stevenson, W.G.9 Aznovoorian, S. and Liotta, L.A (1993). Tumor ceU interactions with the extracellular matrix during invasion and metastasis. Annu. Rev. Cell BioL 9, 541- 573.

Sukumar, S., Carney, W.P. and Barbaci, M. (1988). Independent molecular pathways in initiation and loss of hormone responsiveness of breast carcinomas. Science 240, 524- 526.

Sy, M.S., Guo, Y.J. and Stamenkovic, 1, (199 1). Distinct effects of two CD44 isoforms on tumor growth in vivo. Exp. Med. 174,859-866.

Taher, T.E., Smit, L., GrifTioen, A.W., Schilder, TE., Borst, J. and Pals, S.T. (1996). Signaiing through CD44 is mediated by tyrosine kinases. Association with p561ck in T lymphocytes. J. Biol. Chern. 271,2863-2867.

Takahashi, K., Et09 Ho and Tanabe, K-K, (1999). Involvement of CD44 in matrix metalloproteinase regulation in hurnan melanoma cells. Inf- J. Cancer 80,387-395.

Takai, Y., Sasaki, T., Tanaka, K. and Nakanishi, H. (1995). Rho as a regulator of the cytoskeleton- Trends Biochem. Sci. 20,227-23 1.

Takaishi, K., Kikuchi, A., Kuroda, S., Kotani, K., Sasaki, T. and Takaî, Y. (1993). Involvement of rho p21 and its inhibitory GDP/GTP exchange protein (rho GDI) in cet1 motility. Mol. Cell Biol. 13,72-79.

Tarnmi, R., Agen, U.M., Tuhkanen, A.L. and Tammi, M. (1994). Hyduronan metabolism in skin- Prog. Histochem. Cytochern. 29, 1-8 1.

Tarnmi, R., Ripellino, J.A., Margolis, R.U. and Ta-, M- (1988). Localization of epidermal hyduronic acid using the hyduronate binding region of cartilage proteoglycan as a specific probe. J. Invest. Dennatol. 90,4 12-4 14.

Tanabe, K-K-, Nishi, T. and Saya, H. (1993). Novel variants of CD44 arising fiorn alternative splicing: changes in the CD44 alternative splicing pattern of MCF-7 breast carcinoma cells treated with hyaluronidase. Mol. Carcinog. 7,212-220.

Tanimura, S., Chatani, Y., Hoshino, R., Sato, M-, Wastanabe, S., Kataoaka, T., Nakamura, T. and Kohno, M. (1998). Activation of the 41/43 kDa mitogen-activated protein kinase signaling pathway is required for hepatocyte growth factor-induced ce11 scattering. Oncogene 17,57-65.

Tari, AM., Hung, M.C., Li, K. and Lopez-Berestein, G. (1999). Growth inhibition of breast cancer celis by Grb2 down-regulation is correlated with inactivation of mitogen- activated protein kinase in EGFR, but not in ErbB2, çells. Oncogene 18, 1325- 1332.

Teder, P., Bergh, J. and Heldin, P. (1995). Functiond hyaluronan receptors are expressed on a squarnous ceii lung carcinoma ce11 line but not on other lung carcinoma ce11 lines. Cancer Res. 55,3908-39 14.

Thomas, L., Byers, H.R., Vink, J. and Stamenkovic, L (1992). WHregulates tumor ceIl migration on hyduronate-coated substrate. J. Ce11 Biol. 118,971-977.

Thompson, E.W., Paik, S., Brumer, N., Sommers, CL.,Zugrnaier, G., Clarke, R., Shima, T.B., Tom, J., Donhue, S., Lippman, ME., Martin, G.R. and Dickson, R.B. (1993). Association of increased basement membrane invasiveness with absence of estrogen receptor and expression of vimentin in human breast cancer ceIl lines. J. Ce11 Physiol. 150,534-544.

Tolg, C., Hof'mann, M., Herrlich, P. and Ponta, H. (1993). Splicing choice from ten variant exons establishes CD44 variability. Nucleic Acidr Res. 21, 1225- 1229.

Tool, B.P. (1990). Hyaluronan and its binding proteins, the hyaladherins. Curr. Opin. Ce11 Biol. 2, 839-844.

Toole, B.P. (1997). Hyaluronan in morphogenesis. J. Intern. Med 242,3540.

Torre, E.A. and Fulco, R.A. (1993). Tumor-associated urokinase-type plasminogen activator: significance in breast cancer. Eur. J. Gynaec. Oncol. 17,315-3 18.

Toth, M., Gervasi, D.C. and Fridman, R. (1997). Phorbol ester-induced ce11 surface association of matrix metalloproteinase-9 in human MCFlOA breast epithelial cells. Cancer Res. 57,3 159-3 167.

Toyama, S.N., Sorimachi, H., Tobita, Y., Kitarnura, F., Yagita, H., Suzuki, K. and Miyasaka, M.A. (1995). novel ligand for CD44 is sergiycin, a hematopoietic ce11 iineage- specific proteoglycan. Possible involvement in lyrnphoid ce11 adherence and activation. J. Biol. Chem. 270,7437-7444.

Tremble, P., Damsky, C.H. and Werb, 2. (1995). Components of the nuclear signaling cascade that regdate collagenase gene expression in response to integrin-derived signals. J. Cell. Biol. 129, 1707-1720. Trochon, V., Mabilat, C., Bertrand. P., Legrand, Y., Smadja-Joffe, F., Soria, C., Delpech, B. and Lu, H. (1996). Evidence of involvement of CD44 in endothelid cell proliferation, migration and angiogenesis in vitro. Zn?. J. Cancer 66,664-668.

Tsukita, S., Oishi, K, Sato, N., Sagara, J., Kawai, A. and Tsukita, S. (1994). ERM family members as molecular Wers between the ceil surface glycoprotein CD44 and actin- based cytoskeletons. J. Cell Biol. 126,39 1-40 1.

Turley, EA. (1982). Purification of a hyduronate-binding protein fraction that modifies ce11 social behavior. Biochem Biophys. Res. Commun. 108, 1016-1024.

Turley, E.A .(1992). Hyaluronan and ce11 locomotion. Cancer Metm. Rev. 11,21-30.

Turley, E.A., Austen, L., Vandeligt, K. and Clary, C. (1991). Hyaluronan and a ceil- associated hyaluronan binding protein regulate the locomotion of ras-transfo& cells. J. Cell Biol. 112, 1041-1047.

Turley, E.A., Hossain, M.Z., Sorokan, T., Jordan, L.M. and Nagy, 1.1 (1994). Astrocyte and microglial motility in vitro is functionaiiy dependent on the hyaluronan receptor RHAMM. Glia 12,68-80.

Underhill, C.B., Green, S.J., Comoglio, P.M. and Tarone, G. (1987). The hyaluronate receptor is identicai to a glycoprotein of Mr 85,000 (gp85) as shown by a monoclonal antibody that interferes with binding activity. J. BioL Chern. 262, 13 142- 13 146.

Vaheri, A., Carpen, O., Heiska, L., Helander, T.S., Jaaskelauien, J., Majander, N.P., Sainio, M., Timonen, T. and Tumnen, 0. (1997). The ezrin protein family: membrane- cytoskeleton interactions and disease associations. Cum Opin. Cell Biol. 9,659-666. van der Voort, R., Taher, T.E., Wielenga, V.J., Spaargaren, M., Prevo, R., Smit, L., David, G., Hartmann, G., Gherardi, E. and Pals, S.T. (1999). Heparan sulfate-modified CD44 promotes hepatocyte growth factorkatter factor-induced signal transduction t hrough the recep tor tyrosine kinase c-Met. J. Biol. Chem. 274,6499-6506.

Vargas-Roig, L.M., Gago, FE, Tello, O., Martin de Civetta, M.T. and Ciocca, D.R, (1999). c-erbB-2 (HER-Uneu) protein and dmg resistance in breast cancer patients treated with induction chemotherapy. Znt. J. Cancer 84, 129- 134.

Victor, R., Chauzy, C., Girard, N., Gioanni, J., d'Anjou, J-, Stora De Novion, H. and Delpech, B. (1999). Human breast-cancer metastasis formation in a nude-mouse model: studies of hyaluronidase, hyaluronan and hyaluronan-binding sites in metastatic cells. Int. J. Cancer 82,7743.

Vogelstein, B., Fearon, E.R., Hamilton, S.R., Kem, S.E., Preisinger, A.C., Leppert, M., Nakamura, Y., White, R., Smits, A.M. and Bos, J.L. (1988). Genetic alterations during colorectal-tumor development. N. Engl. J. Med. 19,525-532. Walker, R.A., Jones, J.L., Chappeil, C., Walsh, T. and Shaw, J.A. (1997). Molecular pathology of breast cancer and application to clinical management Breast Cancer Res. Treat. 16,527.

Wang, C., Entwistle, J., Hou, G., Li, Q. and Turley, E.A. (1996). The charactenzation of a human RHAMM cDNA: conservation of the byaluronan-binding domains. Gene 174, 299-306.

Wang, C., Thor, A.D., Moore, D., Zhao, Y., Kerschmann, R., Stem, R., Watson, PH.and Turley, E.A. (1998). The overexpression of RHAMM, a hyaluronan-binding protein that regulates ras signaling, correlates with overexpression of mitogen-activated protein kinase and is a signifiant parameter in breast cancer progression. Clin Cancer Res. 4, 567-576.

Washington, K., Gottfried, M.R. and Telen, MJ. (1994). Expression of the ce11 adhesion molecule CD44 in gastric adenocarcinornas. Hum. Pathol. 25, 1043-1049.

Wayner, E.A. and Carter, W.G. (1987). Identification of multiple ceil adhesion receptors for collagen and fibronectin in human fibrosarcoma ceils possessing unique alpha and common beta subunits. 3. Ce11 Biol. 1û5, 1873-1884.

Webb, C.P., Van Aelst, L., Wigler, M.H. and Vande Woude G.F. (1998). Signaling pathways in ras-mediated tumongenicity and metastasis. Proc. Nat2 Acad. Sci. U.S.A. 95, 8773-8778.

Webb, D.S.A., Shimizu, Y., Van Seventer, G.A., Shaw, S. and Gerrard, T.L. (1990). LFA-3, CD44 and CD&: Physiological triggers of human monocyte TNF and IL-1 release. Science 249, 1295- 1297.

Weber, G.F., Ashkar, S. and Glimcher, M.J. (1996) Cantor If. Receptor-ligand interaction between CD44 and osteopontin (Eta-1). Science 271,509-5 12.

Weiss, J.M., Renkl, AC., Ahrens, T., Moll, J., Mai, RH., Denfeld, R.W., Schopf, E., Ponta, H., Herrlich, P. and S irnon, J.C. ( 1994). Activation-dependent modulation of hyaluronate-receptor expression and of hyaluronate-avidity by human monocytes. J. Invest. Dermatol. 111,227-232.

Welsh, CF., Zhu, D. and Bourguignon, L.Y. (1995). Interaction of CD44 variant isoforms with hyaluronic acid and the cytoskeleton in human prostate cancer cells. J. Cell Physiol. 164,605-612.

West, D.C. and Kumar, S. (1985). Angiogenesis induced by degradation products of hyaluronic acid. Science 228, 1324- 1326. Xing, C. and Imagawa, W. (1999). Altered MAP kinase (ERK1,2) regdation in primary cultures of mamrnary tumor celis: elevated basal activity and sustained response to EGF. Carcinogenesis 201,201-208.

Yang, G., Yang, B.L., Savani, R.C. and Turley, E.A. (1994). Identification of a common hyaluronan binding motif in the hyaluronan binding proteins RHUM, CD44 and iidc protein- EMBO J. 13,286-294.

Yu, Q. and Stamenkovic, 1. (1999). Localization of ma& metalloproteiaase 9 to the ce11 surface provides a mechanism for CD44-mediated tumor invasion. Genes Dev. 13,3548.

Zeigler, M.E., Chi, Y., Schmidt, T. and Varani, J. (1999). Role of ERK and JNK pathways in regulating ce11 motility and matrix metdoproteinase 9 production in growth factor-stimulated human epidermal keratinocytes. 'CeCZ Physiol. 180,271-284. Zhang, S., Chang, M.C.,Zylka, D., Turley, S., Harrison, R. and Turley, E.A. (1998). The hyaiuronan receptor RHAMM regulates extracellular-regulated kinase. J. Biol. Chem. 273, 11342- 1 1348.

Zhang, S., Ziebeil, M., Cheung, W.F., Lu, J., Haddad, A., Litchfield, D., Ahn, N. G., Cniz-, T.T., Prestwich, GD. arid Turley, E.A. (1999). Intracellular RKAMM is an erkl binding protein and removal of its N-terminai sequence is required or activation of erkl. (submitted)

Zheng, Z., Katoh, S., He, Q., Oritani, K-,Miyake, K., Lesley, J., Hyman, R., Hamik, A., Parkhouse, R.M. and Fm, AG. (1995). Monoclonal antibodies to CD44 and their influence on h y aluronan recognition. J. Ce11 Biol. 130,485495.

Zhou, J.N., Ljungdahl, S., Shoshan, M.C., Swedenborg, J. and Linder, S. (1998). Activation of tissue-factor gene expression in breast carcinoma cells by stimulation of the Ru-erk signaling pathway. Mol. Carcinog. 4,234-243.

Zhu, D. and Bourguignon, L. (1996). Overexpression of CD44 in plSS(neu)-transfected NM3T3 cells promotes an up-regulation of hyaluronic acid-mediated membrane- cytoskeleton interaction and ce11 adhesion. Oncogene 12,2309-23 14. CHAPTER VI

APPENDIX

The Drosophila RHAMM Homologue BACKGROUND RHAMM is a hyaluronan binding protein which was originally purificd from locomoting murine 3T3 fibroblasts (Hartwick ct al., 1992) and chick embryo heut fibroblasts (Entwhistlt et al., 1995). This 60 kDa protein was found to be an HA binding component of a soluble protein cornplex. RHAMM functions as a motility mxptor for KA in numemus cdtypes. including fibroblasts (Savani cc ai, 1993). rmootb muscle œIis (Savani a 4.. 1993). macfopbages (Sunuel et ai.. 1992). T lymphocytes flurley et al.. 1991). spennat~~ytesflurky et ai.. 1992) ami neumns (Tudey et J., 1992). as vell as mrligiunt ccilr such as m-tmmf" fibrioblasa

(Turley et al.. 1991). multiple rnyclomi B celis fluriey et d.. 1991). aad kcrrt cricinomi aîi

as restenosis and tumor progressicm (Wmg et d.. 1998).

StnicWy. RHAMM is enooded by a single gene loca

5q33.2qter and on mouse chromosome 11. Ibe murine gcne is composed of 18 exons. 9 of which have btcn shown to bc altanatively splicccl, and contains two putative uiitidon codons.

Ieading to the synthesis of 52.2 lcDa and 46.7 kDa prodicted gene products. mpectively (Yang et al.. 1992). Five murine RHAMM isofomis exist (Yang et al.. 1993). Pt kast O- of which transientiy appm a< the ceil nnfaœ whtttas most are found intraccilulady mg. 1). The soif- form appcais to be glyeosylphosphuidyinositol-iinkcd and insecteci in the outer luRei of the plasma membrane (unpublished data). RHAMM has two splife sites kwccn exons 3 and 4 which generate the iniracellular RHAMM variants 2, 3 and 4. Another intracellular isoform,

RHAMMvI. is the most commonly expressed variant in normal murine cells and differs from

RHAMMv3 and RHAMMv4 in that it lacks exon 4 (Hardwick et al.. 1992) (Fig. 1). Other variants of RHMM have been shown to be released into the tissue culture medium as soluble proteins of 72. 68. 58 and 52 kDa. but these isofoms have not yet knwell characteri&

(Entwistle et al., 1995).

The ended proteins arc rich in glutamic acid. lysine. glutamine and leucine (Entwistk et al., 1995) and have nine potentiai sites of N-g1ycosylation. five of which am concentratcd within a motif near the amino tenninus consisting of a stretcb of 21 ruidues repeated five tims.

With respect to sccondary structure. RHAMM proteins appmr to be largely a-helicrl. In addition to aitemative spficing, pod-tmaslationai modificatilioar may &O contni ta cbe gawdo(t Oc numemus tissue and species spdc RXAMM procàol.

RHAMM 7two B(X7)B motifs. wbert B may be eikaginiae a lysine and X is any non-acidic Muno acid. ùoth of wbich conmite qdlyto the ability of thir tû bind hyalumnic acid (Yang et al.. 1994). Positioncd betwœn &O rids Ml411 in aie carboxyl terminus of RHAMM, each of thetwo 10 amino acid domains consists of two rets of two basic amino si& spaceû sevea ruidues ~pahCiustering of basic amino acids withiii a at eilher end of the motif enhances hyaimnic acid binding dvity. while the occurrence of ridic residues betwten the basic amino acids teduces binding (Yang et al., 1993). In addition to

hyaluronic aci& these dornaias also bind to heparin but not to chondroitin sulphatc or dermaiin

sulfate. A leucine Ppper motif has ben identifieci in exon 3 of ihc RHAMM gent, which may

mediate its dimerization either with itself or othet binding partners (unpublishd data).

The human RHAMM cDNA. isolated from a breast cDNA library using the murinc

RHAMMv2 as a probe. is 2175 nucleotides in length and encodes a 725 amino acid. 84 kDa

polypeptide (Wong et al.. 1996) (Fig. 2). The overall homology between the overlapping open reading frames of murine and human RHAMM cDNAs is 85% . However. the hyaluronic rid binding motifs (B(x7)E) arc 10040 conservai between human. rat, and mouse sequences (Fig.2).

RHAMM AND CELL MOTIUlV

RHAMM expression has bcen reported to occur transiently at the surfeof locomoting cells. particularly on extcnding lvnellac of fibpoblasts. but is mon okn pteseat inttpctIlularly within these same ceiis flurley et al., 1989; Hardwick et ai., 1992; Piluski et ai.. 1994,

Mohapanr et al, 1996) md within tiima cek (Wang a d. 1998). Oveoupersioa of

RHAMMv4, dting in Uiaused expression of both at the cdd' rnd h the cytoplasm, has ken shom to indue tnnJformation and CO pmmotc both Mdom al1 Hty and invasion in vivo (HiII et ai.. 1995) and in vitro (Wong et ai., mmuScrip in mon).

RHAMM is a tightly rcgulated protein whose expiession is coordinatcd with the lwmothg capacity of celis - as ceIl locomotion decreases, extracellular levels of RHAMM p-in decline

(TurIey et al., 1991). Fwthermorc, RHAMM expression is rcgulwd by fadon thai effect aU locomotion, including wounding (Savani et aL.1993). TGF-p stimulation (Sunuel et al., 1992) and ras oncogene expression (Hall et al., 1995). However, the mechanisms by which RHAMM ngulates ccll motility and invasion ut still under investigation. Severai lhes of evidcnce suggest that hyaluronic acid mediatcd RHAMM signaling in H-ras transfod fibroblasts induces a rapid, transient protein tyrosine kinase phosphorylation, notably of a kinase that has pnviously been implicated in regulating ce11 motility and focal adhesion turnover - focal adhesion kinase (p 125 FAK)(Hall et al.. 1994). h has been shown that an anti-RHAMM antibody. used al a low concentration. is able to elicit proiein tyrosine phosphorylation, and that tyrosine kinase inhibitors block motility induced either by the anti-RHAMM antibody or by hyaiuronic acid (Hail et al., f 994). Furthemore. cetls in \\-hich RHAMM is ablated by antisense expression exhibit luge. stable focal adhesions (Hall et al.. 1994). and expression of a dominant

negative suppressor mutant of RHAMM (Le. one in which the hyaluronic acid binding domains

an mutated) pnvents the above signding events. =verts ras-induced transfomation. and rcsults

in cells with low motility rates (Hall et al.. 1994). Consistent with thest rtsults, RHAMM

directed motility has ken show to k dependent on src (Hail et al.. 1995). which is a membrane

associated, non-reoeptor pcotein tyrosine kinase involved in cytoskeletal organitation, dl adhesion and motility. In c-H-ras ûadonned murine fibrosacc~mCC~. REïAbM .ad rrr wae

found to ~prscipitictrnd

Momver, hyaluronic ridrad RHAMM mediued motiüty in thcse ~u-truisfbœdails was

blocked by anti-src anti'bodies. and a dominant ncgative sn: wu shown to inhibit RHAMM

mediated motility (HA et J.. 1996). nieJe results suggest that sr^ rts of RHAMM

io signal ce11 motility (HiU et al.. 19%; Piang et al.. 1998).

More rccent data dso suggest oüier possible mechaohms by wbich RHAMM may

mediaie ce11 motility. Chang et ai. (1998) bas iacentiy demonrtnted th* RHAMM is transitnîly organuod in to padosomc-like structures in ceIl processes. which have previcusly becn show to be involved in cc11 invasion (ïurley et ai.. 1994; Nakahm et ai.. 19%. 1997;Pelh.m et ai.. 1997;

Rabinovitz.1997). Several additional observations suggest thaî both ceil sudacc RHAMM

isoforms and RHAMMv4 are dso involved in regulating extracellular regulated kinase (ERK)

activity (Zhang et al.. 1998). Phosphorylation of ERIC by upstream kinases MEK and raf (Cobbs

et al.. 1995). the latter of which is activated by ras (Daunet al.. 1994). bas been shown to

contribute to ce11 proliferation and motility (Boudewijn et al. 1995; Marshall et al.. 1995).

Hyaluronic acid has also ken shown to activate ERK activity following response to injury

(Savani et al.. manuscript in preparation). ERK activation by growth factors such as PDGF. as well as cytoplasmic regdators such as mutant active ras. is mediated by RHAMMv4. which has shown to form a complex with ERK and MEK. The functional significance of this complex

formation is however not yet clear.

RATlONALE AND HYPOTHESIS FOR THE STUDY

To date, studies of RHAMM function, including its involvement in signai transduction, have been performed in mammalian ce11 systems. While essential for understanding the complexity of signaling pathways, such systerns do not offer the advantagcs compubd to simpler mode1 organisms such as Drosophila mehnogosicr whoa genetics. molecular biology, and development biology arc nlatively well understood Morcover. the signal transduction pathway

linking ras to ce11 motility has ban extensively investigaîed in this organism.

Given the importance of RHAMM in ce11 motility and the high evolutionary conservation of hyaiuronan, we hypothesized that a homologous protein exists in simplet organisrns such as

Drusuphila which may be like marnrndian RHAMM involved in signaling motility. We also propose that the role of the putative Drosophila RHAMM homologue in signal transduction will be more easily studied in this organism, the genome for which may soon to bc compleicly sequenceà, and for which the phenotype effects of mutations in several thousand genes have

already been describeci. In addition. the well-characterized biology, short life cycle, and relative ease of handling make Drosophifn an ideal experimeotal mode! for the study of RHAMM

function. To canying out this study. several reagents will be required. some of which we already

possess and others we do not yet possess. Our laboratory has generated antibodies that recognize

RHAMM and cross-react with Drnsophila proteins. Drosopliiln RHAMM cDNA, which will be required for RT-PCR analysis. howevcr. has no[ yel been obtained. This projecl is designcd 10 fulfill both short and long-term goals as sumrnarized below.

RESEARCH OBJECTIVES

Short Term Goals

Prelirninary studies employing Western immunoblotting and immunocytochemical

techniques. using both monoclonal and pol yclonal an tibodics against RHAMM and

including cornpetition shidies. demonstraied the pCGSena of immunortaicrivt spcies of

RHAMM in Drosophih tissues .

Southem immunoblot aaadyses have benperfonned on Drosophih genomic DNA using

murine RHAMMV4 as a probe. The mlts suggested the presence of a RHAMM

homologue-

RT-PCR analyses have been perfomied on Drosopfilu cDNA using degencrate primes

directeci against conserved sequences of murine RHAMM. These pcÏmen amplifiai som

potential RHAMM homologue DNA sequences. However. southern blot analysis did not

show any cross reactivity with RHAMMv4 cDNA.

Two cDNA libraries (adult and embryonic) from Drosophih have been scrcened using the

RHAMMV4 and RHAMMv2 cDNAs as probes. However. no Positive clones were

detected.

Hornology searches of rnurine RHAMM have been done using BLAST software and

others. No significant homology was found between segments of rnurine RHAMM and

Drosophiln genes present in the GenBank. Long Term Goals

In collaboration with Dr. H. Lipshitz in the Department of Genetics at the Hospital for

Sick Children. Drosophih RHAMM cDNA will be used to localize the sequence to a particulv chromosome in that organism. facilitating the structural characterization of the RHAMM gene.

Studies of RHAMM function in Drosophila. particularly related to its involvement in signal transduction, will include the analysis of the phenotypic effects of targeted dismption of the

RHAMM gene.

MATERIALS AND METHODS

Western and Dot Blot Analysis

Dot blots and Western analysis were perfonned with monoclonal and pofyclonal antibodies raid against munne RHAMM in order to test the sensitivity and cross mactivity of this immunoreagents against Drosophila total protein lysatts. for theu powitial use iu

Drosophila cDNA library scrccning. The adult and embryonic nies were frozen in Iiquid

nitrogen followed by their pulverization with a manual pestle. The cells were lysed with ice coid

modified RIPA lysis buffer (25 mM NaCI. ImM EDTA) containing the prokinase inhibitors

leupeptin (1 pdrnl). phtnylrne&ylsulfonyl~uo~de(PMSF, 2 rnMj. pepstatin A (1 Wml).

aprotinin (0.2 pg/ml) and 3.6dicholoroisocoum~n(200 pM) (al1 hmSigma). Lysetes wen

centrifuged at 13,000 rpm for 20 min at 4OC after incubating on ice for 20 min. Protein

concentrations of the supematants were detennined using the DC protein assay (Bio-Rad). The

required amount of total protein from each lysate were either blotted directly ont0 nitrocellulose

filters (for dot blotting) or loaded ont0 108 SDS gels together with prestained molecular weight

standards (Sigma) (for Western blotting). After transferring proteins from the gels onto

n~trocellulosemembranes (Bio-Rad) in buffer contnining 25 itiM Tris-HCI (pH 8.3). 192 mM glycine, 20% methanol. using electrophoretic transfer cells (Bio-Rad) at 100 V for f hr at 4.c. additional protein binding sites on the membranes werc blocked with 5% defattcd milk in TBST

(10 mM Tris base (pH 7.4). 150 mM NaCl. with 0.1% Twcen 20. di from Sigma). Doc bia membranes were treated similady. The membranes were then ùiarbated with the primary antibody for RHAMM ovemight at 4'C while shalcing. nie polyclonal antibodics used fa

Western bloaing wcre R3.6 and Ex4, both of which wae taiscd in nbbits rad ured at 0.16 pg/ml anci 0.2 CLg/ml conœntrations. nspsctivcly, in 1% defatted müi: in TBST. Fadot blottïng, the monocionai antiôoâics were 3T3-5 rnd 3T3-9. ôoth of WWwe~e ured 5.8 p#d conantrations in 1% defooed milk in TBST. Afk wuhing 3 tim~dwitb TBST. tbe membranes were incubated with horserdish pcmxi~jugatcdgoat anti-&bit IgG (0.2 Wml) for 1 hour at room temperature (RT) and washed with TBST. Blotting was visualized by tk enhanccd cherniluminescence Western blotting daection systcm (Amersbarn) accordhg to the manufacturer's instructions. The quantification of optical densitics of the re~ultnntbands was performad on the Bio-Rad Mode1 620 VibDensitometer and analyzcd using the 1-D rnaiyst II software. The specificity of the antibody binding was confiinaed by pmbing the blots witb R3.6

(O. 16 Wd) and Ex4 (0.20 @ni) pre-incubrted for 2 hr with IWfold exce~sRHAMM furion pmtein (murine RHAMMv4 cDNA linkcd to giutathionc S-msfe- (GST)-RHAMM fusion protein. C3 cells (ras-transfonnad murine fibmblasts) were uscd as positive control to detcct

RHAMM. These cells were grown in growth media (GibcoBRL) and were harvested at 5&6û% confluency. After washing with ice cold PBS. the cells were lysed with modified RIPA lysis

buffer as above. ~mrnunohietochemistry

Formalin-fixcd. paraffincmbeddd adult nies were cut into 4 pm sections and mounted on polylysinecoaied slicks for assessing RHAMM expression. Following deparaffinkation with xylene. the scxtions wcn rchydrated in gradcd alcohol (100% ethano1 for 10 min. 95% ethaml for 5 min, 70% chan015 min. and XI% ethimol for 5 min). Afiu washing two times with PBS. the endogenous pcroxidue dvitywps blockd for 30 min at RT with a 3% Hasolution. Tbe sections werc thcn washed in PBS. adthe MWIS~C&C mtibody bladiag was blochi at 37.C fa

30 min using an aiiquot of 200 pl per slide of 1:10 dilution of maise senua in PBS. Inaibrtion with an anti-RHAMM mo~~:lonalantîbody (3 Wml of 3T3-5)was pcrformd in PBS at 40C overnight. PolycIonal antibodies (Ex4 and R3.6) werit used at 4 Wml conceotntions in PBS.

Aftcr 2 washes in 1- anâ lxPBST for 10 min ah.incubation with rabôit-aati-mousc &G conjugaied to HRP (2 CLg/ml in PBS) was pedornied at RT for 2 hr. Followiag washcs with

PBST and 0.05 M Tris @H 7.2-7.4) for 5 min each the sections were exposcd to chn,mogen

(3.3'-diaminobMzidine (Dm)5 mgml in 0.05 M Tris (pH 7.2-7.4) for 7-12 mis and tbe cola change to brown (280 pl PBS + 20 pl DAB) was monitored Counterstaining with hematoxyün for 1 min was then followd by a wash in running dH20 for 5 min. 'Lbe SCÇtio~ls wm deyhdrated and mounting for visualization using a microscope

Cloning and DNA Sequencing

Library Screening. Iwo separate Drosophila cDNA libraries were screened. One library was from adult flics (Novagen), and the other was from embryonic cDNA (embryos between 0-24 hr old) (kindly provided by Dr. H. Lipshitz). Both murine 1.9 kb RHAMMv4 and 900 bp

RHAMMv2 cDNA were used as probes. Total RNA was extracted from adult nies and embryos using TRIZOL nagent

(GibcoBRL). Approximately 100 mg nies were pulverid in liquid nitrogen with a manual pestle, rhen treated with 1 ml TREOL reagent. The homogenizcd samples werr incubate. for 5

min at RT to permit the complete dissociation of nuclboprotein complexes. Chloroform (0.2 ml)

was addd to the mixtures. which wcrc shakcn vigorousiy by band for 15 s then incubrited for 3

min on ice. The samplu wae ccnaifugcd at 120g for 15 min r 4OC; the RNA was ex-

in the aqutous pbrre, prscipiwed using 05 mi of isopmpyl dohd. and obuined by

centrifugation at 12.000 g for 10 min at 4.C. Thc pellets wae washd with 1 ml of 70% aicohol.

drid at RT, and dissolved in DEPC-trea!ad water. This total RiUA was d for RT-PCR and

Northern blot anaiysis foUowing its quantification b.sed on its 0% AS a pitiw c01ltrol. the

LR21 (RHAMMv4-Cransfacted) œil lint was usai, the RNA of which was extmztd using

TRIZXlL but with the following modifications: LR21 cells which were &romon a mcmofaycr in

cornpletc media (Gibco BRL) to 50-6046 confiu«ice wem washed with icecold PBS and

lysed diroctly with TRlUlL without homogenization. 'Ihe cernainder of the m(hd was

followed as describai above.

RT-PCR. RT-PCR of ihe totai RNA wu performod exactly as instmcted by a kit (Clontech).

Bnefly. 1 pg RNA was rtvtrse ~scribcdusing a 13-mer oligo dT pprimet and 100 uni& of

MMLV reverse transcriptase at 42OC for 60 min. The total 20 pl rcaction volume was diluicd to

100 pl by adding 80 pi of sterile dHIO. 5 fl of the diluted cDNA template was used in each 50

pl PCR reaction dong with thermostable Taq polymerase and degenerate primers designcd

against different regions of murine RHAMM (Table 1). The PCR cycling parameters consisted

of an initial denaturation a< 94OC for 4 min. denaturation at 94OC for I min. annealing at series of

temperatures and extension for 1 min 72°C. for 40 cycles, and then a final extension of 10 min at 72°C. The PCR products were electrophoresed on an 0.8% agarose gel in IxTBE and denahmd

in 2.5 N NaOH for 20 min at RT with gentie agitation. The products on the gel werc thcn

vansfemd to nitrocellulose in 25N NaOH ovemight and probed with [32p]dCTP labelai 1.9 Kb

Wv4starting at various strcngencies from low to high.

Sourhem anulysir (mbhs) Gcnomic DNA wrs extraccd from following species: hum

mouse, Dosophila, Xclulpus. Z&ra fi&. E.coli. and C.e&g

/8 j chlorofom isoamyl-abho1 was donc at RT for 1 hr with gentle rotation. The DNA was / precipitatcd with 3 M Na-acetate and two volumes of iœ-ld cthuiol. mined gatly. rad

spooned out of the mixture. Mtcr washing the DNA twiœ with 70% alcd101 a RT and do-g

it to airdry. it was usp pend ad in lxTE buffer and quantificd on the bais of its obsorbrnce at I i 260 nm. 'Ihc extractcd genomic DNA was digestcd at 37OC ovemight in 10-20 pg amounts witb ! ! the enzymes EcoRI, B@. and Sad pl 2 unitslpg of DNA. The digests werc then loided ont0 a

0.8% agarose gel and allowcd to run overnight dong with plpsMd conml contlining

RHAMMv4 cDNA at 800 pg dilution. The gel was first denaturd with 0.25 N HCl for exactly

14 min, and then wiih 2.5 N WHfor 20 min at RT using gentle agitation, transferrcd using

Hybridization Solution (Siratagene) at 68OC. washed at bah low and high stnngencies. and

final1 y autoradiographed. RESULTS SUMMARY AND DISCUSSION

Dot Blot and Westem Analyses

A) In Western analysis. murine anti-RHAMM polyclonal antibcxiies (R3.6 and Ex4) nised

against specific amino acids in exon 9 and exon 4 showcd cross reactivity with seved

proteins in Dlosophilo lysattes (Figs. 3A and 4A). Cornpetition studis in which these

antibodiu wcrc prciacubwd with exccss RHAMM hision minbefat pmbmg the

membranes dut the intemitics of mmy O€ tbe bands wac reduced

after blocking of the antibodies wiai the fiision protein (3B and 4B). B) Dot blots pcrfdon DrosopNh lysates pmbed witb moweld rntibodies a@st

murine RHAMM showed that .II antibodies displaycd dvitywben 1.66 pg of 1-

protein WPI uscû, as show in Figs. 5B. Dccrcasing the Jysatc protein antent to 0.008 pg

resulted in reduccd nrtivity @g. 5B.D). Used as a positive control. RHAMMv4

showed a similar trend to that in Drosophile lysatc. and no apparent cross dvitywas

seen using mouse IgG as a negative contml (Fig. SA and C).

C) In order to determine the molecular weight of the RHAMM-ükê proteins dcteacd by the

monoclonal antibodies in Drosophiîà lysate. additional Westem analyses werc

performed. Although all antibodiu rcacted with mouse total lysatc (Fig. 6). ody two

(3T3-5 and 3T3-9) reacted with Drosophila total proiein, hvcaling bands betwcen 39

kDa and 52 kDa markers mg. 7A and B). The specificity of the rcactivity of 3T3-S and

3T3-9 with the DrosophiIo proteins were confirmeci by incubating the antibodies with

excess fusion protein, showing that the bands were partialiy blocked (Fig. 7C and D).

O) In summary, bah monoclonal and polyclonal antibodies cross reacted with potentially

RHAMM-Iike proieins in Drosophila indicaring a band between 52 and 39KDa. and cornpetition for binding of boih antibodies to lysate components was inhibitcd by

RHAMM fusion protein. lmmunostaining Analyses

Pdn sections papami from adult fliu wuc subjectcd to immunohistochernistry with a monoclonal and two pdycloiul antibodiu. rcvuling immunorcactivity in scverd tissues, including cye. brain. ovaries, and hmMouse IgG wuuxd as a negaiive contml in pl- of the primary antibody (figures wiîi be sboM in the dg).

Dot Blot and Southem Blot Analyses

Since the above cesults suggested that a RHAMM-lïke protein is prcseiit in Dmo- totai genomic DNA of DrosopM& wrr andm fa the preseaa of a RHAMM iikc ga~iuhg a

Southem blot assay.

A) Fit. dot blots wcre prfofmcd using genomic DNA hmDrosophila at wocentrations

of 10 pg and 2û pg, and pmM with RHAMMv4 cDNA. This CDNA. as weU as moüsê

genornic DNA and humin genomic DNA werc uscd as positive controls w1g.8).Tbe blot

was washed at stringencies varying from low to high. nit positive signal wrr seen .fw

washing up to 60°C with lxSSC + O. 1% SDS.

B) Southem analyses werc perfod using pnomic DNA fmDrosopirik and otha

specics in order to detcct the prrsence of RHAMM homologues. As soen in Figs.9 and

10. RHAMM-Iike gents are present in Drosophila Xenopus, and C. elegans at low

stringencies up to 5S°C. These results were then confinneci by a xcond set of Southem

analyses (Fig. II) using Drosophita and C. elegans genomic DNAs. by which a number

of bands were aetectable in Drosophila and C. elegans DNA ai low stringency washes up

[O 55°C. In siil of the Southern analyses perfornied. RHAMMv4 cDNA and mouse genomic DNA were uscd as positive controls (Fig. 12). To detst the prercnce of

RHAMM homologues in species closely related to humans. and to optimize conditions

for Southem anaiysis of cross-reactive spccics. eukaryotic zoo bloaing was pcfiod.

As the results suggcst in Figs. 13 and 14, RHAMM-like genes werc dettctable in rat, dog,

rabbit. as well as in chicken ai diffcrent stringencies. Human RHAMM was dctectablt rit

low stringuicy washes, iduding up to 2xSSC + O. 1% SDS at 55T.

C) Noahua .nalyses WC= @Ozmdd on totai DrosoprUh RNA to deikt RHAMM merugc.

1have not yct bzen suocessful with this proadure.

Dl Furthcr RT-PCR milyses wcrc pcrfonncd uring degencntc the rrgi011s

of RHAMM coasaved bttwcm humans and mice @ig.lS). lne PCR ccactioa wis

optimizcd with respect to annding temperature, magnesium conantratiotls, and numk

of moncycles (Figs.16 and 17). nie many bands amplificd wuc &en probed with

RHAMMv4 cDNA (Fig. 18). No positive bands wendetectabk

E) cDNA libraries €rom both the adult and embryod wem scrwned using both RHAMMv4

and RHAMMv2 probes. No positive clones were detected.

FUTURE WORK

Short Term Studies

Northem analyses. RT-PCR, and library scncning need to k repcaicd beforc muningful

conclusions can be drawn.

Repeating the immunostaining procedure on the embryonic Drosophila tissue sections to

examine ihe expression levels of the RHAMM-like protein in particular tissues. since the

Western analyses using polyclonal ûntibodies revenled differences in expression. Blocking of

irnmunoreactivity in these sections with RHAMM fusion protein will also be performed. In the event that library screening is unsuccessful. genomic DNA bands seen on Southem

analyses of Drosophila lysates probed with RHAMMv4 will be eluted from the gel, cloncd

into a suitable vector, and sequenccd-

Long TmStudks

noduction of the Drosophilu knockout rnight enhance wr biowkdge of the role of

RHAMM in siniplcc otgrnisms. lhese studics caild be towuds the shidy of rrr

signai tnnsduction paîh

Study the role of RHAMM homologue in siguüag pathways sinœ thû pthway is wcIi

established in the Drojophila CF.

Fig.2 Homology Cornparison of Human and Murine RHAMM cDNA

hn 1363 QA~kCt(lCSCM~ATMllGeEn~~tcn~ II II I111111 11 11111111111 1 Il111 1 II 11111111111111 IIIIIIII 1 Mu(* il23 ~t~~~TCl't~

)bui* llH~~~tPk#OCPI(IIIOC

HUVA 15da 111111 III 111111 I IIIIII n#uc lwBF# b 1-

IhmIn 1lMfuowmmrA II- 11111111111 II- 111 nGwr 1498 raCamarATA4- 718 N..Y.i--i_..-m 1111111~1111l11 11 IlIIII 111111111 III 11111111111111111111111 11111111 Iluui 1813 m- ~iu111111111l11 11111 -1 II )buie lm luAwaattatlPlU~- ., A

rn 101 mm--- I III II 1111 111111111 lllil 111111111 11111 1 111 11 111111 II nPurm 1798OCMOGO(n~~-ker

lb~1073 CIA hmn 1100 -mçAtWotcrmcmn h I II 111111111111111 III 1 I 1 lm I(ow 1HBMllCnoROMPMIA~~~~

II I I I norvr 2023 mAt~~mormicr-.--~".--*-- Fig.3 Western Blot Analysis of Drosophila Total Protein using Anti-Mouse RHAMM Rabbit Polyclonal Antibody kDa 1 2 3 4 5 6

Exon4 Antibody

.. .

Exon4 Antibody Preincubated with RHAMMv4 Fusion Protein Fig. 4 Western Blot Analysis of Drosophila Total Protein using Another Anti-Mouse RHAMM Rabbit Polyclonal Antibody Fig. 5 Dot Blot Analyses Using Anti-Murine-RHAMM Monoclonal Antibodies

Concentration of RHAMMV4 fusion protein(pg) A B Concentration of Drosophila total protein((ig)

Anti- RHAMM 3T3-3 m rn rn mm Anti- RHAMM monoclonal 3T3-5 monoclonal 3'313-5 antibodies oniibodies 3T3-6 m mm rn m 3T3-7

Fig. 7 Western Blot Analysis of Orosophila Total Protein using Anti-RHAMM MonocIoni Antibody Preincubated with RHAMM Fusion Protein

C3 Dros

3T3-5 333-5 t RHAMMV4 Fusion Protein

D B C3 Dros C3 Dros

3T3-9 + RHAMMV4 Fusion Protein

Fig. 10 Southern Blot, of Genomic DNA of Eukaryotic Species Restricted with EcoR1 and Bg111, Probed with RHAMMv4 cDNA Low Stringency High Stringency (washed twice with 2xSSCi-û. IZSDS for 2Ornin at 42°C) (washed twice with 2xSSCtû.l%SDSfor 2Omin at 55°C)

Lanes: 1 mouse 2 human 3 Dtosophilu 4 Xenopus 5 C. elegans Fig. 11 Genomic DNA of Eukaryotic Species Restricted with Different Endonucleases

Lane I hHindIII marker Lanes 2-4 Mouse Lanes 5-7 Drosophila Lanes 8- 10 C. elegans Al1 cut with EcoRI, BgliI and Sad respective Fig. 12 Southern Blot, of Genomic DNA of Eukaryotic Species Restricted with Different Endonucleases, Probed with RHAMMv4 Low Stringency High Stringency (washed twice with 2xSSC+O. 1%SDS for 20min at 42OC) (washed twice with 2xSSCM. 1BSDS for 20min at SS°C)

Lanes 1-3 mouse genomic DNA cut Lanes 4-6 Drosophila genomic DNA cut Lanes 7-9 C. elegms genomic DNA cut with EcoR1, BglII, and Sac1 respectively with EcoR1, BglII, and Sac1 respectively with EcoRI, BgM, and Sad nspectively Fig. 13 EcoR1-Restricted Genomic DWA of Eukaryotic Species

h HindIII

4 pg genomic DNA Lane 1. Human Lane 2. Monkey Lane 3. Rat Lane 4. Mouse Lane 5. hg Lane6. Cow Lane 7. Rabbit Lane 8, Chicken Lane 9. Yeast Fig. 14 Eukaryotic Zoo Blot Probed with RHAMMv4 cDNA

Low Stringency High Stringency (washed twice with LxSSC+O.l%SDSfor 20min at 55°C) (washed twice with IxSSCtû. l%SDS for 20min at 60°C) 12345 6789 12345 6789

4 pg genomic DNA of : Lane 1. Human Lane 6. Cow Lane 2. Monkey Lane 7. Rabbi t Lane 3, Rat Lane 8. Chicken Lane 4. Mouse Lane 9. Yeast Lane 5. Dog Fig. 15 Position of Degenerate Primers on Murine RHAMM cDNA and their Homology to Human RHAMM cDNA

Human 5 ' ATAGAGAAAGAAAAGATTGAT ' I , i/Il/ . II I [~rimer#l] Mouse 16 8 ATHGARAARGARAARATTGAT 18 8

Human S'ATAGAGAAAGAAAAGATTGAT 31 i IIIII: [~rimer#î] Mouse 16 8 ATHGARAARGARAARATMGAT 188

Human 5 1 AAAGAAAAGATTGATGAAAAA 3 1 IIIlIIhi/ [~rimer#31 Mouse 174 AARGARAARATHGAYGARAAA lgq

Human 5 1 AAACAAAAAATCAAGCATGTT 3 t

III , I/l// [Primertl] Mouse 16 6 6 AARCARAARATHAARCAYGTT 16 87 Human 5'CTAAGCTTGGAGTTGATGAA.A 3 1 III 11 Ili/ I III / [Primer# 51 Mouse 9CTAAGCCTGGAATTGATGAAA30

Human 5'AGAAACAAAAGAGAAACAAAGATGAGG 31 /il1! 1 !IlII IIIH Il II/ [Primer# 61 H= (AtCtT) Mouse 3 4 AGAAATAAGAGAGAGACAAAGATGAGG 5 9 Y= (CtT) R= (A+G) Human 51 GATGAAAATAGCCAACTCAAATCG 3 ' M= (A+C) lilll~~l~ilillI!Illlll/ [Primer#71 Mouse 1700 GATGAAAATAGCCAACTCAAATCG 1725 Fig. 16 RT-PCR of Drosophila cDNA using RHAMMv4 Degenerate Primers

Annealing Temperatures (OC)

Marker 42 44 46 48 50 52 54 56

S'Adapter primer & 3' degenerate primer#l S'Adapter primer & 5'Adapter primer & 3' degenerate pfimem 3' degenerate primedl6 A

Fig. 18 RT-PCR of Orosophila cDNA using RHAMMv4 Degenerate Primers

Lanes: 5ml of sample sample annealing temp.*c 1-3 from A 52,54,56 respectively 4-5 from B 56,70 respectively 6-8 from E 56,64,70 9-1 1 from D 56,64,70 12-13 from F 5 137 14- 15 fromC 56,6û 15-17 fromG 57,s 1 18; 80pg of RHAMMv4 plasmid 19; 80pg of RHAMMv4 plasmid Fig. 19 lmmunostaining of Drosophila Eye with Anti-Mouse RHAMM Rabbit Polyclonal Anti body

R3.6 Antibody R3.6 Antibody Preincubated Mouse IgG Control with RHAMM peptide Fig. 20 lmmunostaining of Drosophila Head with AntCMouse RHAMM Monoclonal Anti body

3T3-5 Antibody H&E Staining

Fig. 22 Southern Blot, of Genomic DNA of Eukaryotic Species Restricted with EcoR1 and Bglll, Probed with RHAMMv4

Low Stringency High Stringency (washed twice with 2xSSC+O. l%SDS at 42OC) (washed twice with 2xSSCtû. l%SDS at 50°C)

Lanes: 1 mouse 2 human

5 C elegnns Fig. 23 Southern Blot, of Genomic DNA of Eukaryotic Species Restricted with Different Endonucleases, Probed with RHAMMv4

Low Stringency Hlgh Stringency (washed twice with 2xSSC+O, l%SDS for 20min at 42OC) (washed twice with ZxSSC-tû. 1 %SDS for 20min at 50°C) kb~ 123 4 56 78 9 12 3 45 6 789

Lanes 1-3 mouse genomic DNA cut Lanes 4-6 Drosophila genomic DNA cut Lanes 7-9 C. elegans genomic DNA cut with EcoRI, BglII, and Sac1 respectively with EcoRI, BgllI, and Sac1 respectivoly with EcoRI, BgIII, and Sac1 respectively