Downloaded a List of 1,000 Genes from RGD Using “Bone” As the Keyword in All Species and Used This Set to Decide If Candidate Genes Have Known Bone Association
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplementary Data
Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2). -
Supplemental Table S1
Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 -
By Submitted in Partial Satisfaction of the Requirements for Degree of in In
Developments of Two Imaging based Technologies for Cell Biology Researches by Xiaowei Yan DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biochemistry and Molecular Biology in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Ronald Vale Chair ______________________________________________________________________________Jonathan Weissman ______________________________________________________________________________Orion Weiner ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2021 By Xiaowei Yan ii DEDICATION Everything happens for the best. To my family, who supported me with all their love. iii ACKNOWLEDGEMENTS The greatest joy of my PhD has been joining UCSF, working and learning with such a fantastic group of scientists. I am extremely grateful for all the support and mentorship I received and would like to thank: My mentor, Ron Vale, who is such a great and generous person. Thank you for showing me that science is so much fun and thank you for always giving me the freedom in pursuing my interest. I am grateful for all the guidance from you and thank you for always supporting me whenever I needed. You are a person full of wisdom, and I have been learning so much from you and your attitude to science, science community and even life will continue inspire me. Thank you for being my mentor and thank you for being such a great mentor. Everyone else in Vale lab, past and present, for making our lab a sweet home. I would like to give my special thank to Marvin (Marvin Tanenbaum) and Nico (Nico Stuurman), two other mentors for me in the lab. I would like to thank them for helping me adapt to our lab, for all the valuable advice and for all the happiness during the time that we work together. -
Fkbp10 (NM 010221) Mouse Untagged Clone – MC201811 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201811 Fkbp10 (NM_010221) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Fkbp10 (NM_010221) Mouse Untagged Clone Tag: Tag Free Symbol: Fkbp10 Synonyms: AI325255; FKBP-10; FKBP-65; Fkbp-rs1; Fkbp1-rs; Fkbp6; FKBP65; Fkbprp Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Fkbp10 (NM_010221) Mouse Untagged Clone – MC201811 Fully Sequenced ORF: >BC029546 sequence for NM_010221 GTCCGCTCTCACTGCCGGCGTCCCTGGTCTGGGCACCATGTTCCTTGTGGGGTCCTCCAGCCACACCCTC CATCGGCTCCGCATACTGCCGTTGCTGTTGCTTCTACAGACCTTGGAGAGGGGACTGGGCCGTGCCAGCC CGGCCGGAGCCCCCTTGGAAGATGTGGTCATCGAGAGATACCACATCCCTCGGGCCTGTCCCCGAGAAGT GCAGATGGGGGATTTTGTGCGTTACCACTACAATGGCACTTTCGAAGACGGGAAAAAGTTTGACTCCAGC TATGACCGTAGCACCCTGGTGGCCATCGTTGTGGGCGTAGGCCGCCTCATCACCGGCATGGACCGGGGTC TCATGGGCATGTGTGTCAACGAGCGCCGCCGCCTCATTGTGCCTCCCCACCTGGGCTACGGCAGCATCGG TGTGGCGGGCCTCATCCCCCCTGATGCCACCCTCTATTTTGACGTGGTCCTGCTGGACGTGTGGAACAAA GCAGACACGGTGCAGTCAACTATCCTCCTGCGCCCTCCCTACTGCCCCCGAATGGTGCAGAACAGTGACT TTGTGCGCTATCACTACAATGGCACTCTGCTGGATGGCACTGCCTTTGACAACAGCTACAGTAGGGGAGG CACTTATGACACCTACATCGGCTCTGGTTGGCTGATCAAAGGCATGGACCAGGGGCTGCTGGGCATGTGC -
Rule Mining on Microrna Expression Profiles For
Faculty of Engineering and Information Technology University of Technology, Sydney Rule Mining on MicroRNA Expression Profiles for Human Disease Understanding A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Renhua Song July 2016 CERTIFICATE OF AUTHORSHIP/ORIGINALITY I certify that the work in this thesis has not previously been submitted for a degree nor has it been submitted as part of requirements for a degree except as fully acknowledged within the text. I also certify that the thesis has been written by me. Any help that I have received in my research work and the preparation of the thesis itself has been acknowledged. In addition, I certify that all information sources and literature used are indicated in the thesis. Signature of Candidate i Acknowledgments First, and foremost, I would like to express my gratitude to my chief supervisor, Assoc. Prof. Jinyan Li, and to my co-supervisors Assoc. Prof. Paul Kennedy and Assoc. Prof. Daniel Catchpoole. I am extremely grateful for all the advice and guidance so unselfishly given to me over the last three and half years by these three distinguished academics. This research would not have been possible without their high order supervision, support, assistance and leadership. The wonderful support and assistance provided by many people during this research is very much appreciated by me and my family. I am very grateful for the help that I received from all of these people but there are some special individuals that I must thank by name. A very sincere thank you is definitely owed to my loving husband Jing Liu, not only for his tremendous support during the last three and half years, but also his unfailing and often sorely tested patience. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
[CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors. -
Epigenetic Mechanisms of Lncrnas Binding to Protein in Carcinogenesis
cancers Review Epigenetic Mechanisms of LncRNAs Binding to Protein in Carcinogenesis Tae-Jin Shin, Kang-Hoon Lee and Je-Yoel Cho * Department of Biochemistry, BK21 Plus and Research Institute for Veterinary Science, School of Veterinary Medicine, Seoul National University, Seoul 08826, Korea; [email protected] (T.-J.S.); [email protected] (K.-H.L.) * Correspondence: [email protected]; Tel.: +82-02-800-1268 Received: 21 September 2020; Accepted: 9 October 2020; Published: 11 October 2020 Simple Summary: The functional analysis of lncRNA, which has recently been investigated in various fields of biological research, is critical to understanding the delicate control of cells and the occurrence of diseases. The interaction between proteins and lncRNA, which has been found to be a major mechanism, has been reported to play an important role in cancer development and progress. This review thus organized the lncRNAs and related proteins involved in the cancer process, from carcinogenesis to metastasis and resistance to chemotherapy, to better understand cancer and to further develop new treatments for it. This will provide a new perspective on clinical cancer diagnosis, prognosis, and treatment. Abstract: Epigenetic dysregulation is an important feature for cancer initiation and progression. Long non-coding RNAs (lncRNAs) are transcripts that stably present as RNA forms with no translated protein and have lengths larger than 200 nucleotides. LncRNA can epigenetically regulate either oncogenes or tumor suppressor genes. Nowadays, the combined research of lncRNA plus protein analysis is gaining more attention. LncRNA controls gene expression directly by binding to transcription factors of target genes and indirectly by complexing with other proteins to bind to target proteins and cause protein degradation, reduced protein stability, or interference with the binding of other proteins. -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
Expression Profiling of KLF4
Expression Profiling of KLF4 AJCR0000006 Supplemental Data Figure S1. Snapshot of enriched gene sets identified by GSEA in Klf4-null MEFs. Figure S2. Snapshot of enriched gene sets identified by GSEA in wild type MEFs. 98 Am J Cancer Res 2011;1(1):85-97 Table S1: Functional Annotation Clustering of Genes Up-Regulated in Klf4 -Null MEFs ILLUMINA_ID Gene Symbol Gene Name (Description) P -value Fold-Change Cell Cycle 8.00E-03 ILMN_1217331 Mcm6 MINICHROMOSOME MAINTENANCE DEFICIENT 6 40.36 ILMN_2723931 E2f6 E2F TRANSCRIPTION FACTOR 6 26.8 ILMN_2724570 Mapk12 MITOGEN-ACTIVATED PROTEIN KINASE 12 22.19 ILMN_1218470 Cdk2 CYCLIN-DEPENDENT KINASE 2 9.32 ILMN_1234909 Tipin TIMELESS INTERACTING PROTEIN 5.3 ILMN_1212692 Mapk13 SAPK/ERK/KINASE 4 4.96 ILMN_2666690 Cul7 CULLIN 7 2.23 ILMN_2681776 Mapk6 MITOGEN ACTIVATED PROTEIN KINASE 4 2.11 ILMN_2652909 Ddit3 DNA-DAMAGE INDUCIBLE TRANSCRIPT 3 2.07 ILMN_2742152 Gadd45a GROWTH ARREST AND DNA-DAMAGE-INDUCIBLE 45 ALPHA 1.92 ILMN_1212787 Pttg1 PITUITARY TUMOR-TRANSFORMING 1 1.8 ILMN_1216721 Cdk5 CYCLIN-DEPENDENT KINASE 5 1.78 ILMN_1227009 Gas2l1 GROWTH ARREST-SPECIFIC 2 LIKE 1 1.74 ILMN_2663009 Rassf5 RAS ASSOCIATION (RALGDS/AF-6) DOMAIN FAMILY 5 1.64 ILMN_1220454 Anapc13 ANAPHASE PROMOTING COMPLEX SUBUNIT 13 1.61 ILMN_1216213 Incenp INNER CENTROMERE PROTEIN 1.56 ILMN_1256301 Rcc2 REGULATOR OF CHROMOSOME CONDENSATION 2 1.53 Extracellular Matrix 5.80E-06 ILMN_2735184 Col18a1 PROCOLLAGEN, TYPE XVIII, ALPHA 1 51.5 ILMN_1223997 Crtap CARTILAGE ASSOCIATED PROTEIN 32.74 ILMN_2753809 Mmp3 MATRIX METALLOPEPTIDASE -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Mouse FKBP10 ORF Mammalian Expression Plasmid, N-His Tag
Mouse FKBP10 ORF mammalian expression plasmid, N-His tag Catalog Number: MG5A1953-NH General Information Plasmid Resuspension protocol Gene : FK506 binding protein 10 1. Centrifuge at 5,000×g for 5 min. Official Symbol : FKBP10 2. Carefully open the tube and add 100 l of sterile water to Synonym : Fkbp6; FKBP65; Fkbprp; FKBP-10; dissolve the DNA. FKBP-65; AI325255; Fkbp-rs1; Fkbp1-rs 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 1746bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_010221.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-SP-N-His Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature • PCR amplification for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY.