DOCSLIB.ORG

File Systems File Systems File Blocks Organization Hybrid Multi-Level

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
File Systems File Systems File Blocks Organization Hybrid Multi-Level File Systems n Implementing file system abstraction on top of raw disks n Issues: File Systems n How to find the blocks of data corresponding to a given file? n How to organize files? n How to enforce protection? Arvind Krishnamurthy n Performance issues: need to minimize the number of “non- Spring 2004 local” disk accesses n Try to keep related information together on the disk File Blocks Organization Hybrid Multi-level Indexing Scheme n Approaches: n Used in Unix 4.1 n Contiguous allocation n 13 Pointers in a header data n A file is stored on a contiguous set of blocks n 10 direct pointers n Prevents incremental growth and complicates allocation n 11: 1-level indirect n Linked list allocation data n 12: 2-level indirect 1 n A file header points to the first block of the file 2 . n 13: 3-level indirect . n Each block of the file points to the next block 11 . n 12 . data n If blocks are dispersed across disk è horrible performance for Pros & Cons 13 . both sequential access and random access n In favor of small files n Random access can be made faster by separating the next block n Can grow . data pointers from the data and storing it at a centralized place (FAT) n Limit is 16G (assuming 1K n Indexed files blocks) . n File header stores pointers to file blocks . data n Multi-level indexing required for large files Unix file header (I-node) Disk Layout Boot Super File descriptors File data blocks block block (i-node in Unix) n File headers (I-nodes) are identified by a number (I-number) n Can translate the I-number to a location on the disk n Headers are either located together as one group or spread across the disk in predetermined fashion n Superblock defines a file system n size of the file system n size of the file descriptor area n free list pointer, or pointer to bitmap n location of the file descriptor of the root directory n other meta-data such as permission and various times 1 Naming and directories Directory structure n Options n Approach 1: have a single directory for entire system. n Use index (ask users specify inode number). Easier for system, not n put directory at known location on disk as easy for users. n directory contains <name, index> pairs n Text name (need to map to index) n if one user uses a name, no one else can n Icon (need to map to index; or map to name then to index) n many older personal computers work this way. n Directories n Directory map name to file index (where to find file header) n Approach 2: have a single directory for each user n Directory is just a table of file name, file index pairs. n still clumsy. And ls on 10,000 files is a real pain n Each directory is stored as a file, containing a (name, index) pair. n Approach 3: hierarchical name spaces n Only OS permitted to modify directory n allow directory to map names to files or other dirs n file system forms a tree (or graph, if links allowed) n large name spaces tend to be hierarchical (ip addresses, domain names, scoping in programming languages, etc.) Hierarchical Unix / Naming afs bin cdrom dev sbin tmp n Used since CTSS (1960s) n Bootstrapping: Where do you start looking? n Unix picked up and used really nicely. awk chmod chown n Root directory n Directories stored on disk just like regular files n inode #2 on the system n n inode contains special flag bit set 0 and 1 used for other purposes n users can read just like any other file n Special names: <name, inode#> n only special programs can write n Root directory: “/” (bootstrap name system for users) <afs, 1021> n Current directory: “.” <tmp, 1020> n n file pointed to by the index may be Parent directory: “..” another directory <bin, 1022> <cdrom, 4123> n makes FS into hierarchical tree (what is needed to make a DAG?) <dev, 1001> <sbin, 1011> n Simple. Plus speeding up file ops = speeding up dir ops! Unix example: /a/b/c.c Announcements n Paper reviews due on Wednesday for: “.” Name space Physical organization n Fast File Systems a disk n Log structured file systems “..” 2 n Next assignment will be online by tomorrow b 3 Inode table “.” 4 5 ... <a,3> What inode holds file for c.c a? b? c.c? <c.c, 14> How many disk I/O’s to <b,5> access first byte of c.c? 2 Outline Creating synonyms: hard and soft links n Topics covered so far in file systems: n More than one dir entry can refer to a given file n Data blocks n Unix stores count of pointers (“hard links”) to inode n File headers n Directories foo bar n to make: “ln foo bar” creates a n File system superblocks synonym (‘bar’) for ‘foo’ ref = 2 n Soft links: ... n Remaining topics: n also point to a file (or dir), but object can be deleted from underneath n Hard and soft links it (or never even exist). n Permissions n normal file holds pointer to name, with special “sym link” bit set “baz” /bar n When the file system encounters a symbolic link it automatically translates it (if possible). Protection Access control n Goals: n Domain structure n Prevent accidental and maliciously destructive behavior n Access/usage rights associated with particular domain n Ensure fair resource usage n Example: user/kernel mode è two domains n Unix: each user is a domain; super-user domain; groups of users (and groups) n A key distinction to make: policy vs. mechanism n Type of access rights n Policy: what is to be done n For files: read/write/execute n Mechanism: how something is to be done n For directories: list/modify/delete n For access rights themselves n Owner (I have the right to change the access rights for some resource) n Copy (I have the right to give someone else a copy of an access right I have) n Control (I have the right to revoke someone else’s access rights) Access control matrix Access control lists vs. capability lists n Conceptually, we can think of the system enforcing access n Access control lists (ACL): keep lists of access for each controls based on a giant table that encodes all access domain with each object: rights held by each domain in the system File3: User A: rwx Group B: rw Example: ………… File1 File2 File3 Dir1 Dir2 … UserA rw r rwx lmd l … n Capability lists (CAP): keep lists of access rights for each GroupB r rw lm … object with each domain … … … … … … … User A: File1: rw File2: r ………… The access control matrix is the “policy” we want to enforce; Mechanisms: (1) access control lists n Which is better? (2) capability lists n ACLs allow easy changing of an object’s permissions n Capability lists allow easy changing of a domain’s permissions 3 A combined approach Data structures for a typical file system n Objects have ACLs Process Open file n Users have CAPs, called “groups” or “roles” control table File headers block (systemwide) (Metadata) File system info n ACLs can refer to users or groups File headers n Change permissions on an object by modifying its ACL Open Directories file . pointer . n Change broad user permissions via changes in group . array membership File data Appendix: Open a file Read a block n File name lookup and authenticate read( fd, userBuf, size ) n Copy the file descriptors into fd = open( FileName, access) PCB the in-memory data structure, Find open file if it is not in yet descriptor n Create an entry in the open Open PCB Allocate & link up read( fileDesc, userBuf, size ) file table (system wide) if data structures file there isn’t one table Logical ® phyiscal n Create an entry in PCB Open File name lookup n Link up the data structures file Metadata & authenticate read( device, phyBlock, size ) n Return a pointer to user table Get physical block to sysBuf Buffer copy to userBuf cache Metadata File system on disk Disk device driver Example: the open-read-close cycle Example: open-read-close (cont’d) 1. The process calls open (“DATA.test”, RD_ONLY) 1. The process calls open (“DATA.test”, RD_ONLY) 2. The kernel: 2. The kernel: n Get the current working directory of the process: n Get the current working directory of the process: Let’s say “/c/cs422/as/as3 n Call “namei” and get the inode for DATA.test; n Find an empty slot “fd” in the file descriptor table for the process; n Call “namei”: Get the inode for the root directory “/” n Put the pointer to the inode in the slot “fd”; n Set the initial file pointer value in the slot “fd” to 0; For (each component in the path) { n Return “fd”. can we open and read the directory file ? 3. The process calls read(fd, buffer, length); if no, open request failed, return error; if yes, read the blocks in the directory file; 4. The kernel: Based on the information from the I-node, read through the n From “fd” find the file pointer directory file n Based on the file system block size (let’s say 1 KB), find the blocks to find the inode for the next component; where the bytes (file_pointer, file_pointer+length) lies; } n Read the inode At the end of the loop, we have the inode for the file DATA.test 4 Example: open-read-close (cont’d) Example: the create-write-close cycle 4.
Load more

Recommended publications
  • File Systems and Disk Layout I/O: the Big Picture
    File Systems and Disk Layout I/O: The Big Picture Processor interrupts Cache Memory Bus I/O Bridge Main I/O Bus Memory Disk Graphics Network Controller Controller Interface Disk Disk Graphics Network 1 Rotational Media Track Sector Arm Cylinder Platter Head Access time = seek time + rotational delay + transfer time seek time = 5-15 milliseconds to move the disk arm and settle on a cylinder rotational delay = 8 milliseconds for full rotation at 7200 RPM: average delay = 4 ms transfer time = 1 millisecond for an 8KB block at 8 MB/s Bandwidth utilization is less than 50% for any noncontiguous access at a block grain. Disks and Drivers Disk hardware and driver software provide basic facilities for nonvolatile secondary storage (block devices). 1. OS views the block devices as a collection of volumes. A logical volume may be a partition ofasinglediskora concatenation of multiple physical disks (e.g., RAID). 2. OS accesses each volume as an array of fixed-size sectors. Identify sector (or block) by unique (volumeID, sector ID). Read/write operations DMA data to/from physical memory. 3. Device interrupts OS on I/O completion. ISR wakes up process, updates internal records, etc. 2 Using Disk Storage Typical operating systems use disks in three different ways: 1. System calls allow user programs to access a “raw” disk. Unix: special device file identifies volume directly. Any process that can open thedevicefilecanreadorwriteany specific sector in the disk volume. 2. OS uses disk as backing storage for virtual memory. OS manages volume transparently as an “overflow area” for VM contents that do not “fit” in physical memory.
    [Show full text]
  • Dealing with Document Size Limits
    Dealing with Document Size Limits Introduction The Electronic Case Filing system will not accept PDF documents larger than ten megabytes (MB). If the document size is less than 10 MB, it can be filed electronically just as it is. If it is larger than 10 MB, it will need to be divided into two or more documents, with each document being less than 10 MB. Word Processing Documents Documents created with a word processing program (such as WordPerfect or Microsoft Word) and correctly converted to PDF will generally be smaller than a scanned document. Because of variances in software, usage, and content, it is difficult to estimate the number of pages that would constitute 10 MB. (Note: See “Verifying File Size” below and for larger documents, see “Splitting PDF Documents into Multiple Documents” below.) Scanned Documents Although the judges’ Filing Preferences indicate a preference for conversion of documents rather than scanning, it will be necessary to scan some documents for filing, e.g., evidentiary attachments must be scanned. Here are some things to remember: • Documents scanned to PDF are generally much larger than those converted through a word processor. • While embedded fonts may be necessary for special situations, e.g., trademark, they will increase the file size. • If graphs or color photos are included, just a few pages can easily exceed the 10 MB limit. Here are some guidelines: • The court’s standard scanner resolution is 300 dots per inch (DPI). Avoid using higher resolutions as this will create much larger file sizes. • Normally, the output should be set to black and white.
    [Show full text]
  • Ext4 File System and Crash Consistency
    1 Ext4 file system and crash consistency Changwoo Min 2 Summary of last lectures • Tools: building, exploring, and debugging Linux kernel • Core kernel infrastructure • Process management & scheduling • Interrupt & interrupt handler • Kernel synchronization • Memory management • Virtual file system • Page cache and page fault 3 Today: ext4 file system and crash consistency • File system in Linux kernel • Design considerations of a file system • History of file system • On-disk structure of Ext4 • File operations • Crash consistency 4 File system in Linux kernel User space application (ex: cp) User-space Syscalls: open, read, write, etc. Kernel-space VFS: Virtual File System Filesystems ext4 FAT32 JFFS2 Block layer Hardware Embedded Hard disk USB drive flash 5 What is a file system fundamentally? int main(int argc, char *argv[]) { int fd; char buffer[4096]; struct stat_buf; DIR *dir; struct dirent *entry; /* 1. Path name -> inode mapping */ fd = open("/home/lkp/hello.c" , O_RDONLY); /* 2. File offset -> disk block address mapping */ pread(fd, buffer, sizeof(buffer), 0); /* 3. File meta data operation */ fstat(fd, &stat_buf); printf("file size = %d\n", stat_buf.st_size); /* 4. Directory operation */ dir = opendir("/home"); entry = readdir(dir); printf("dir = %s\n", entry->d_name); return 0; } 6 Why do we care EXT4 file system? • Most widely-deployed file system • Default file system of major Linux distributions • File system used in Google data center • Default file system of Android kernel • Follows the traditional file system design 7 History of file system design 8 UFS (Unix File System) • The original UNIX file system • Design by Dennis Ritche and Ken Thompson (1974) • The first Linux file system (ext) and Minix FS has a similar layout 9 UFS (Unix File System) • Performance problem of UFS (and the first Linux file system) • Especially, long seek time between an inode and data block 10 FFS (Fast File System) • The file system of BSD UNIX • Designed by Marshall Kirk McKusick, et al.
    [Show full text]
  • Semiconductor Memories
    Semiconductor Memories Prof. MacDonald Types of Memories! l" Volatile Memories –" require power supply to retain information –" dynamic memories l" use charge to store information and require refreshing –" static memories l" use feedback (latch) to store information – no refresh required l" Non-Volatile Memories –" ROM (Mask) –" EEPROM –" FLASH – NAND or NOR –" MRAM Memory Hierarchy! 100pS RF 100’s of bytes L1 1nS SRAM 10’s of Kbytes 10nS L2 100’s of Kbytes SRAM L3 100’s of 100nS DRAM Mbytes 1us Disks / Flash Gbytes Memory Hierarchy! l" Large memories are slow l" Fast memories are small l" Memory hierarchy gives us illusion of large memory space with speed of small memory. –" temporal locality –" spatial locality Register Files ! l" Fastest and most robust memory array l" Largest bit cell size l" Basically an array of large latches l" No sense amps – bits provide full rail data out l" Often multi-ported (i.e. 8 read ports, 2 write ports) l" Often used with ALUs in the CPU as source/destination l" Typically less than 10,000 bits –" 32 32-bit fixed point registers –" 32 60-bit floating point registers SRAM! l" Same process as logic so often combined on one die l" Smaller bit cell than register file – more dense but slower l" Uses sense amp to detect small bit cell output l" Fastest for reads and writes after register file l" Large per bit area costs –" six transistors (single port), eight transistors (dual port) l" L1 and L2 Cache on CPU is always SRAM l" On-chip Buffers – (Ethernet buffer, LCD buffer) l" Typical sizes 16k by 32 Static Memory
    [Show full text]
  • How UNIX Organizes and Accesses Files on Disk Why File Systems
    UNIX File Systems How UNIX Organizes and Accesses Files on Disk Why File Systems • File system is a service which supports an abstract representation of the secondary storage to the OS • A file system organizes data logically for random access by the OS. • A virtual file system provides the interface between the data representation by the kernel to the user process and the data presentation to the kernel in memory. The file and directory system cache. • Because of the performance disparity between disk and CPU/memory, file system performance is the paramount issue for any OS Main memory vs. Secondary storage • Small (MB/GB) Large (GB/TB) • Expensive Cheap -2 -3 • Fast (10-6/10-7 sec) Slow (10 /10 sec) • Volatile Persistent Cannot be directly accessed • Directly accessible by CPU by CPU – Interface: (virtual) memory – Data should be first address brought into the main memory Secondary storage (disk) • A number of disks directly attached to the computer • Network attached disks accessible through a fast network - Storage Area Network (SAN) • Simple disks (IDE, SATA) have a described disk geometry. Sector size is the minimum read/write unit of data (usually 512Bytes) – Access: (#surface, #track, #sector) • Smart disks (SCSI, SAN, NAS) hide the internal disk layout using a controller type function – Access: (#sector) • Moving arm assembly (Seek) is expensive – Sequential access is x100 times faster than the random access Internal disk structure • Disk structure User Process Accessing Data • Given the file name. Get to the file’s FCB using the file system catalog (Open, Close, Set_Attribute) • The catalog maps a file name to the FCB – Checks permissions • file_handle=open(file_name): – search the catalog and bring FCB into the memory – UNIX: in-memory FCB: in-core i-node • Use the FCB to get to the desired offset within the file data: (CREATE, DELETE, SEEK, TRUNCATE) • close(file_handle): release FCB from memory Catalog Organization (Directories) • In UNIX, special files (not special device files) called directories contain information about other files.
    [Show full text]
  • File Systems
    File Systems Profs. Bracy and Van Renesse based on slides by Prof. Sirer Storing Information • Applications could store information in the process address space • Why is this a bad idea? – Size is limited to size of virtual address space – The data is lost when the application terminates • Even when computer doesn’t crash! – Multiple process might want to access the same data File Systems • 3 criteria for long-term information storage: 1. Able to store very large amount of information 2. Information must survive the processes using it 3. Provide concurrent access to multiple processes • Solution: – Store information on disks in units called files – Files are persistent, only owner can delete it – Files are managed by the OS File Systems: How the OS manages files! File Naming • Motivation: Files abstract information stored on disk – You do not need to remember block, sector, … – We have human readable names • How does it work? – Process creates a file, and gives it a name • Other processes can access the file by that name – Naming conventions are OS dependent • Usually names as long as 255 characters is allowed • Windows names not case sensitive, UNIX family is File Extensions • Name divided into 2 parts: Name+Extension • On UNIX, extensions are not enforced by OS – Some applications might insist upon them • Think: .c, .h, .o, .s, etc. for C compiler • Windows attaches meaning to extensions – Tries to associate applications to file extensions File Access • Sequential access – read all bytes/records from the beginning – particularly convenient for magnetic tape • Random access – bytes/records read in any order – essential for database systems File Attributes • File-specific info maintained by the OS – File size, modification date, creation time, etc.
    [Show full text]
  • EEPROM Emulation
    ...the world's most energy friendly microcontrollers EEPROM Emulation AN0019 - Application Note Introduction This application note demonstrates a way to use the flash memory of the EFM32 to emulate single variable rewritable EEPROM memory through software. The example API provided enables reading and writing of single variables to non-volatile flash memory. The erase-rewrite algorithm distributes page erases and thereby doing wear leveling. This application note includes: • This PDF document • Source files (zip) • Example C-code • Multiple IDE projects 2013-09-16 - an0019_Rev1.09 1 www.silabs.com ...the world's most energy friendly microcontrollers 1 General Theory 1.1 EEPROM and Flash Based Memory EEPROM stands for Electrically Erasable Programmable Read-Only Memory and is a type of non- volatile memory that is byte erasable and therefore often used to store small amounts of data that must be saved when power is removed. The EFM32 microcontrollers do not include an embedded EEPROM module for byte erasable non-volatile storage, but all EFM32s do provide flash memory for non-volatile data storage. The main difference between flash memory and EEPROM is the erasable unit size. Flash memory is block-erasable which means that bytes cannot be erased individually, instead a block consisting of several bytes need to be erased at the same time. Through software however, it is possible to emulate individually erasable rewritable byte memory using block-erasable flash memory. To provide EEPROM functionality for the EFM32s in an application, there are at least two options available. The first one is to include an external EEPROM module when designing the hardware layout of the application.
    [Show full text]
  • If You Have Attempted to Upload Your Files and You Receive an Error Or
    If you have attempted to upload your files and you receive an error or they simply will not upload to EDJOIN, your files are probably either in an inappropriate format, or too large. Please ensure that your document meets the appropriate format and size requirements below. Acceptable format: .PDF Size limit: Each file must not exceed 1 MB (megabyte) or 1024 KB File Name: The file name must contain less than 50 characters including spaces. If the file name contains more than 50 characters or any special characters, you may have trouble attaching your documents and/or the district you are applying to may have trouble viewing them. Please make sure your document title only contains letters and numbers. If the document is multiple pages, you may need to scan multiple sections of the document to maintain the 1MB file size allowance. Saving Your Documents to .PDF Format: If Using A PC: Microsoft Word 2007 or later allows you to save a document as .PDF on a PC 1. Open the document from where you have it saved in your computer. 2. Once the document opens in Microsoft Word, go to the File menu at the top left of your Microsoft Word window and click on Save as. 3. Note where you will be saving the document, go to the bottom of the window and select PDF (*.pdf) in the Save as type box. 4. Save and close. If Using A Mac: Using the print dialog box allows you to save just about any document to .PDF format from a Mac 1.
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • A Hybrid Swapping Scheme Based on Per-Process Reclaim for Performance Improvement of Android Smartphones (August 2018)
    Received August 19, 2018, accepted September 14, 2018, date of publication October 1, 2018, date of current version October 25, 2018. Digital Object Identifier 10.1109/ACCESS.2018.2872794 A Hybrid Swapping Scheme Based On Per-Process Reclaim for Performance Improvement of Android Smartphones (August 2018) JUNYEONG HAN 1, SUNGEUN KIM1, SUNGYOUNG LEE1, JAEHWAN LEE2, AND SUNG JO KIM2 1LG Electronics, Seoul 07336, South Korea 2School of Software, Chung-Ang University, Seoul 06974, South Korea Corresponding author: Sung Jo Kim ([email protected]) This work was supported in part by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education under Grant 2016R1D1A1B03931004 and in part by the Chung-Ang University Research Scholarship Grants in 2015. ABSTRACT As a way to increase the actual main memory capacity of Android smartphones, most of them make use of zRAM swapping, but it has limitation in increasing its capacity since it utilizes main memory. Unfortunately, they cannot use secondary storage as a swap space due to the long response time and wear-out problem. In this paper, we propose a hybrid swapping scheme based on per-process reclaim that supports both secondary-storage swapping and zRAM swapping. It attempts to swap out all the pages in the working set of a process to a zRAM swap space rather than killing the process selected by a low-memory killer, and to swap out the least recently used pages into a secondary storage swap space. The main reason being is that frequently swap- in/out pages use the zRAM swap space while less frequently swap-in/out pages use the secondary storage swap space, in order to reduce the page operation cost.
    [Show full text]
  • AN-1471 Application Note
    AN-1471 APPLICATION NOTE One Technology Way • P. O. Box 9106 • Norwood, MA 02062-9106, U.S.A. • Tel: 781.329.4700 • Fax: 781.461.3113 • www.analog.com ADuCM4050 Flash EEPROM Emulation by Pranit Jadhav and Rafael Lajara INTRODUCTION provides assurance that the flash initialization function works as Nonvolatile data storage is a necessity in many embedded expected. An ECC check is enabled for the entire user space in systems. Data, such as boot up configuration, calibration constants, the flash memory of the ADuCM4050. If ECC errors are reported and network related information, is normally stored on an during any read operation, the ECC engine automatically corrects electronically erasable programmable read only memory 1-bit errors and only reports on detection of 2-bit errors. When a (EEPROM) device. The advantage of using the EEPROM to store read occurs on the flash, appropriate flags are set in the status this data is that a single byte on an EEPROM device can be register of the ADuCM4050. If interrupts are generated, the source rewritten or updated without affecting the contents in the other address of the ECC error causing an interrupt is available in the locations. FLCC0_ECC_ADDR register for the interrupt service routine (ISR) to read. The ADuCM4050 is an ultra low power microcontroller unit (MCU) with integrated flash memory. The ADuCM4050 includes Emulation of the EEPROM on the integrated flash memory 512 kB of embedded flash memory with a 72-bit wide data bus reduces the bill of material (BOM) cost by omitting the EEPROM that provides two 32-bits words of data and one corresponding in the design.
    [Show full text]
  • File System Layout
    File Systems Main Points • File layout • Directory layout • Reliability/durability Named Data in a File System index !le name directory !le number structure storage o"set o"set block Last Time: File System Design Constraints • For small files: – Small blocks for storage efficiency – Files used together should be stored together • For large files: – ConCguous allocaon for sequenCal access – Efficient lookup for random access • May not know at file creaon – Whether file will become small or large File System Design Opons FAT FFS NTFS Index Linked list Tree Tree structure (fixed, asym) (dynamic) granularity block block extent free space FAT array Bitmap Bitmap allocaon (fixed (file) locaon) Locality defragmentaon Block groups Extents + reserve Best fit space defrag MicrosoS File Allocaon Table (FAT) • Linked list index structure – Simple, easy to implement – SCll widely used (e.g., thumb drives) • File table: – Linear map of all blocks on disk – Each file a linked list of blocks FAT MFT Data Blocks 0 1 2 3 !le 9 block 3 4 5 6 7 8 9 !le 9 block 0 10 !le 9 block 1 11 !le 9 block 2 12 !le 12 block 0 13 14 15 16 !le 12 block 1 17 18 !le 9 block 4 19 20 FAT • Pros: – Easy to find free block – Easy to append to a file – Easy to delete a file • Cons: – Small file access is slow – Random access is very slow – Fragmentaon • File blocks for a given file may be scaered • Files in the same directory may be scaered • Problem becomes worse as disk fills Berkeley UNIX FFS (Fast File System) • inode table – Analogous to FAT table • inode – Metadata • File owner, access permissions,
    [Show full text]