DOCSLIB.ORG

The Genomic Search Engine Toolkit

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Genomic Search Engine Toolkit GENESTATION: THE GENOMIC SEARCH ENGINE TOOLKIT By Mara Kim Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University In partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY In Biological Sciences October 31, 2018 Approved: Douglas K. Abbot, Ph.D. Antonis Rokas, Ph.D. Ge Zhang, M.D., Ph.D. John A. Capra, Ph.D. Thomas A. Lasko, M.D., Ph.D. Copyright © 2018 by Mara Kim All Rights Reserved ii DEDICATION To my mother, who showed me the wonders of art. To my father, who taught me the beauty of science. To my sisters that made me who I am. To Andrea, who inspires me to be my best. I love you. iii ACKNOWLEDGEMENTS This work was supported by Vanderbilt University, the Gisela Mosig Travel Fund, and the March of Dimes Ohio Collaborative. I would like to thank my collaborators Kris McGary, Antonis Rokas, Patrick Abbot, Ken Petren, Tony Capra, Lou Muglia, Scott Williams, Sashank Nutakki, Jibril Hirbo, Haley Eidem, Julie Phillips, Rohit Venkat, and Brian Cooper. I would also like to recognize Abigail Lind, David Rinker, Jen Wisecaver, Corinne Simonti, and Ling Chen for their help in developing ideas and techniques for this work. I would like to thank Katherine Friedman and Steve Baskauf for their mentorship during my time as both an undergraduate and graduate student at Vanderbilt, as well as Alicia Goostree, Leslie Maxwell, Angela Titus, Christopher Patterson, and LaDonna Smith for their patience and assistance with the logistics of graduate school. I am grateful to my committee, Patrick Abbot, Tony Capra, Tom Lasko, Ge Zhang, and Antonis Rokas, for the chance to do this work and pushing me to accomplish as much as possible. Their ideas and criticism were instrumental in ensuring the vision behind the project became a reality. Finally, I would like to thank my advisor, Antonis Rokas, a fantastic scientist and teacher, for taking me in as an undergraduate researcher. He always believed in me and encouraged me in all my efforts. Without his mentorship and support, this work would not have been possible. iv TABLE OF CONTENTS ACKNOWLEDGEMENTS................................................................................................iv LIST OF TABLES...........................................................................................................viii LIST OF FIGURES..........................................................................................................ix CHAPTER...............................................................................................................1 I. Introduction..........................................................................................................1 A BRIEF HISTORY OF GENOMICS...................................................................1 GEneSTATION...................................................................................................5 THE GENOMIC SEARCH ENGINE....................................................................6 SynTHy and GeneViewer...................................................................................6 REFERENCES...................................................................................................7 II. GEneSTATION 1.0: a synthetic resource of diverse evolutionary and functional genomic data for studying the evolution of pregnancy-associated tissues and phenotypes.........................................................................................................11 ABSTRACT......................................................................................................12 INTRODUCTION..............................................................................................12 DATA SOURCES AND DATA ORGANIZATION................................................15 DATA PRESENTATION....................................................................................17 SYNTHESIS AND ANALYSIS...........................................................................25 DATA ACCESS.................................................................................................26 SUMMARY AND FUTURE PERSPECTIVES...................................................26 MATERIALS AND METHODS..........................................................................27 ACKNOWLEDGEMENTS.................................................................................30 FUNDING.........................................................................................................30 REFERENCES.................................................................................................31 III. GEneSTATION 2.0: the integrative encyclopedia of evolutionary and functional data of human coding and non-coding elements for the study of pregnancy- associated diseases...........................................................................................35 ABSTRACT......................................................................................................35 INTRODUCTION..............................................................................................35 DATA SOURCES AND ORGANIZATION..........................................................37 v DATA PRESENTATION....................................................................................38 SYNTHESIS AND ANALYSIS...........................................................................41 SUMMARY.......................................................................................................41 MATERIALS AND METHODS..........................................................................41 REFERENCES.................................................................................................42 IV. The Genomic Search Engine.............................................................................46 ABSTRACT......................................................................................................46 INTRODUCTION..............................................................................................46 METHODS.......................................................................................................50 DESIGN...........................................................................................................50 PERFORMANCE.............................................................................................54 CONCLUSIONS...............................................................................................56 REFERENCES.................................................................................................57 V. SynTHy: Synthesis and Testing of Hypotheses..................................................59 BACKGROUND................................................................................................59 IMPLEMENTATION..........................................................................................61 RESULTS AND DISCUSSION..........................................................................61 CONCLUSION.................................................................................................62 REFERENCES.................................................................................................62 VI. GeneViewer: Integrative visualisation of the holistic gene..................................64 BACKGROUND................................................................................................64 IMPLEMENTATION..........................................................................................64 RESULTS AND DISCUSSION..........................................................................65 CONCLUSIONS...............................................................................................66 REFERENCES.................................................................................................67 VII. Conclusion.........................................................................................................68 REFERENCES.................................................................................................71 APPENDIX............................................................................................................73 I. Genome Feature Object: Representing Genomic Features in JSON document stores.................................................................................................................73 Introduction......................................................................................................73 vi Mapping...........................................................................................................73 Indexing............................................................................................................78 II. Genestation Command Line Interface................................................................83 Synopsis...........................................................................................................83 Commands.......................................................................................................83 III. Genomic Data Descriptor JSON........................................................................85 INTRODUCTION..............................................................................................85 GENOMIC METADATA KEYS..........................................................................85 GENOMIC DATA KEYS....................................................................................85 vii LIST OF TABLES Time to count the features on human
Load more

Recommended publications
  • Sequence Alignment/Map) Is a Text Format for Storing Sequence Alignment Data in a Series of Tab Delimited ASCII Columns
    NGS FILE FORMATS SEQUENCE FILE FORMATS FASTA FORMAT FASTA Single sequence example: >HWI-ST398_0092:1:1:5372:2486#0/1 TTTTTCGTTCTTTTCATGTACCGCTTTTTGTTCGGTTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGAT ACGTAGCAGCAGCATCAGTACGACTACGACGACTAGCACATGCGACGATCGATGCTAGCTGACTATCGATG Multiple sequence example: >Sequence Name 1 TTTTTCGTTCTTTTCATGTACCGCTTTTTGTTCGGTTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGAT ACGTAGCAGCAGCATCAGTACGACTACGACGACTAGCACATGCGACGATCGATGCTAGCTGACTATCGATG >Sequence Name 2 ACGTAGACACGACTAGCATCAGCTACGCATCGATCAGCATCGACTAGCATCACACATCGATCAGCATCACGACTAGCAT AGCATCGACTACACTACGACTACGATCCACGTACGACTAGCATGCTAGCGCTAGCTAGCTAGCTAGTCGATCGATGAGT AGCTAGCTAGCTAGC >Sequence Name 3 ACTCAGCATGCATCAGCATCGACTACGACTACGACATCGACTAGCATCAGCAT SEQUENCE FILE FORMATS FASTQ FORMAT FASTQ Text based format for storing sequence data and corresponding quality scores for each base. To enable a one-one correspondence between the base sequence and the quality score the score is stored as a single one letter/number code using an offset of the standard ASCII code. Quality scores range from 0 to 40 and represent a log10 score for the probability of being wrong. E.g. score of 30 => 1:1000 chance of error SEQUENCE FILE FORMATS FASTQ FORMAT FASTQ Each fastq file contain multiple entries and each entry consists of 4 lines: 1. header line beginning with “@“ and sequence name 2. sequence line 3. header line beginning with “+” which can have the name but rarely does 4. quality score line SEQUENCE FILE FORMATS FASTQ FORMAT FASTQ @HWI-ST398_0092:6:73:5372:2486#0/1 TTTTTCGTTCTTTTCATGTACCGCTTTTTGTTCGGTTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGAT
    [Show full text]
  • In Silico Analysis of Single Nucleotide Polymorphisms
    Central JSM Bioinformatics, Genomics and Proteomics Original Research *Corresponding author Anfal Ibrahim Bahereldeen, Department of medical laboratory sciences, Sudan University of Science and In silico analysis of Single Technology, Khartoum, Sudan; Tel: 249916060120; Email: [email protected] Submitted: 14 October 2019 Nucleotide Polymorphisms Accepted: 23 January 2020 Published: 27 January 2020 (SNPs) in Human HFE Gene ISSN: 2576-1102 Copyright coding region © 2020 Bahereldeen AI, et ail. OPEN ACCESS Anfal Ibrahim Bahereldeen1*, Reel Gamal Alfadil2, Hala Mohammed Ali2, Randa Musa Nasser2, Nada Tagelsir Eisa2, Keywords Wesal Hassan Mahmoud2, and Shaymaa Mohammedazeem • In silico • HFE gene, Polyphen-2 2 Osman • I mutant 1Department of Medical laboratory sciences, Sudan University of science and • Project hope Technology, Sudan 2Department of Medical laboratory sciences, Al-Neelain University, Sudan Abstract Background: HFE gene is a HLA class1-like molecule, expressed in the different cells and tissues, mutations on this gene reported to cause about 80-90% of Hereditary haemochromatosis (HHC) and it is increasing the risk of different diseases. In this study; we aimed to analysis the SNPs in HFE gene by using different computational methods. Methodology: We obtained HFE gene nsSNPs from dbSNP/NCBI database, Deleterious nsSNPs predicted by different bioinformatics servers including; SIFT, polyphen-2, I-mutant and SNPs & GO servers. Protein structure analysis done by using Project hope and RaptorX tools then visualized by Chimera software and function, interaction and network of HFE gene analysis done by Gene MANIA program. Results: SIFT and Polyphen-2 servers predicted 75 deleterious nsSNPs and nine polymorphisms from them predicted as highly damaging and disease associated.
    [Show full text]
  • Biological Databases
    Biological Databases Biology Is A Data Science ● Hundreds of thousand of species ● Million of articles in scientific literature ● Genetic Information ○ Gene names ○ Phenotype of mutants ○ Location of genes/mutations on chromosomes ○ Linkage (relationships between genes) 2 Data and Metadata ● Data are “concrete” objects ○ e.g. number, tweet, nucleotide sequence ● Metadata describes properties of data ○ e.g. object is a number, each tweet has an author ● Database structure may contain metadata ○ Type of object (integer, float, string, etc) ○ Size of object (strings at most 4 characters long) ○ Relationships between data (chromosomes have zero or more genes) 3 What is a Database? ● A data collection that needs to be : ○ Organized ○ Searchable ○ Up-to-date ● Challenge: ○ change “meaningless” data into useful, accessible information 4 A spreadsheet can be a Database ● Rectangular data ● Structured ● No metadata ● Search tools: ○ Excel ○ grep ○ python/R 5 A filesystem can be a Database ● Hierarchical data ● Some metadata ○ File, symlink, etc ● Unstructured ● Search tools: ○ ls ○ find ○ locate 6 Organization and Types of Databases ● Every database has tools that: ○ Store ○ Extract ○ Modify ● Flat file databases (flat DBMS) ○ Simple, restrictive, table ● Hierarchical databases ○ Simple, restrictive, tables ● Relational databases (RDBMS) ○ Complex, versatile, tables ● Object-oriented databases (ODBMS) ● Data warehouses and distributed databases ● Unstructured databases (object store DBs) 7 Where do the data come from ? 8 Types of Biological Data
    [Show full text]
  • Alternate-Locus Aware Variant Calling in Whole Genome Sequencing Marten Jäger1,2, Max Schubach1, Tomasz Zemojtel1,Knutreinert3, Deanna M
    Jäger et al. Genome Medicine (2016) 8:130 DOI 10.1186/s13073-016-0383-z RESEARCH Open Access Alternate-locus aware variant calling in whole genome sequencing Marten Jäger1,2, Max Schubach1, Tomasz Zemojtel1,KnutReinert3, Deanna M. Church4 and Peter N. Robinson1,2,3,5,6* Abstract Background: The last two human genome assemblies have extended the previous linear golden-path paradigm of the human genome to a graph-like model to better represent regions with a high degree of structural variability. The new model offers opportunities to improve the technical validity of variant calling in whole-genome sequencing (WGS). Methods: We developed an algorithm that analyzes the patterns of variant calls in the 178 structurally variable regions of the GRCh38 genome assembly, and infers whether a given sample is most likely to contain sequences from the primary assembly, an alternate locus, or their heterozygous combination at each of these 178 regions. We investigate 121 in-house WGS datasets that have been aligned to the GRCh37 and GRCh38 assemblies. Results: We show that stretches of sequences that are largely but not entirely identical between the primary assembly and an alternate locus can result in multiple variant calls against regions of the primary assembly. In WGS analysis, this results in characteristic and recognizable patterns of variant calls at positions that we term alignable scaffold-discrepant positions (ASDPs). In 121 in-house genomes, on average 51.8 ± 3.8 of the 178 regions were found to correspond best to an alternate locus rather than the primary assembly sequence, and filtering these genomes with our algorithm led to the identification of 7863 variant calls per genome that colocalized with ASDPs.
    [Show full text]
  • Galaxy Platform for NGS Data Analyses
    Galaxy Platform For NGS Data Analyses Weihong Yan [email protected] Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 § UCLA galaxy and user account § Galaxy web interface and management § Tools for NGS analyses and their application § Data formats § Build/share workflow and history § Q and A ü Day 2 § Galaxy Tools for RNA-seq analysis § Galaxy Tools for ChIP-seq analysis § Galaxy Tools for annotation. § Q and A *** Published datasets/results will be used in the tutorial UCLA Galaxy http://galaxy.hoffman2.idre.ucla.edu ü Hardware – Headnode (1) 96Gb memory, 12 core – Computing nodes (8) 48Gb memory, 12 core – Storage 100 Tb disk space ü Galaxy Resource Management － Hoffman2 grid engine Default: 1 core/job bowtie, bwa, tophat, cuffdiff, cufflinks, gatk programs: 4 core/job UCLA Galaxy http://galaxy.hoffman2.idre.ucla.edu ü galaxy login account: login: your email associated with ucla ü Disk quota: 1 Tb/user Galaxy Account Management Installed tools Launch analysis and view result History of execu7on and results Raw Reads *_qseq.txt, *.fastq Upload to Galaxy File transfer protocol (ftp) deMultiplex Barcode splitter, deMultiplex workflow fastqc, compute quality statistics, Quality Assessment draw quality score boxplot, draw nuclotides distribution Process Reads Trim sequences, sickle, scythe Alignment to bwa, bowtie, bowtie2, tophat Reference Format Conversion Text manipulation toolkit, BEDTools, SAM Results (sam/bam) Tools, java genomics toolkit, picard toolkit Downstream Analyses BS-Seeker2, cufflinks, cuffdiff, macs, macs2, GATK, CEAS Visualization Genome browser, IGV Repositories of Galaxy Tools https://toolshed.g2.bx.psu.edu ü History panel contains all datasets that are uploaded and results derived from certain analyses ü A history can be organized, annotated, and managed as a project ü History is sharable.
    [Show full text]
  • Biocuration Experts on the Impact of Duplication and Other Data Quality Issues in Biological Databases
    Genomics Proteomics Bioinformatics 18 (2020) 91–103 Genomics Proteomics Bioinformatics www.elsevier.com/locate/gpb www.sciencedirect.com PERSPECTIVE Quality Matters: Biocuration Experts on the Impact of Duplication and Other Data Quality Issues in Biological Databases Qingyu Chen 1,*, Ramona Britto 2, Ivan Erill 3, Constance J. Jeffery 4, Arthur Liberzon 5, Michele Magrane 2, Jun-ichi Onami 6,7, Marc Robinson-Rechavi 8,9, Jana Sponarova 10, Justin Zobel 1,*, Karin Verspoor 1,* 1 School of Computing and Information Systems, University of Melbourne, Melbourne, VIC 3010, Australia 2 European Molecular Biology Laboratory, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Cambridge CB10 1SD, UK 3 Department of Biological Sciences, University of Maryland, Baltimore, MD 21250, USA 4 Department of Biological Sciences, University of Illinois at Chicago, Chicago, IL 60607, USA 5 Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA 6 Japan Science and Technology Agency, National Bioscience Database Center, Tokyo 102-8666, Japan 7 National Institute of Health Sciences, Tokyo 158-8501, Japan 8 Swiss Institute of Bioinformatics, CH-1015 Lausanne, Switzerland 9 Department of Ecology and Evolution, University of Lausanne, CH-1015 Lausanne, Switzerland 10 Nebion AG, 8048 Zurich, Switzerland Received 8 December 2017; revised 24 October 2018; accepted 14 December 2018 Available online 9 July 2020 Handled by Zhang Zhang Introduction assembled, annotated, and ultimately submitted to primary nucleotide databases such as GenBank [2], European Nucleo- tide Archive (ENA) [3], and DNA Data Bank of Japan Biological databases represent an extraordinary collective vol- (DDBJ) [4] (collectively known as the International Nucleotide ume of work.
    [Show full text]
  • Bioinformatics: a Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D
    BIOINFORMATICS A Practical Guide to the Analysis of Genes and Proteins SECOND EDITION Andreas D. Baxevanis Genome Technology Branch National Human Genome Research Institute National Institutes of Health Bethesda, Maryland USA B. F. Francis Ouellette Centre for Molecular Medicine and Therapeutics Children’s and Women’s Health Centre of British Columbia University of British Columbia Vancouver, British Columbia Canada A JOHN WILEY & SONS, INC., PUBLICATION New York • Chichester • Weinheim • Brisbane • Singapore • Toronto BIOINFORMATICS SECOND EDITION METHODS OF BIOCHEMICAL ANALYSIS Volume 43 BIOINFORMATICS A Practical Guide to the Analysis of Genes and Proteins SECOND EDITION Andreas D. Baxevanis Genome Technology Branch National Human Genome Research Institute National Institutes of Health Bethesda, Maryland USA B. F. Francis Ouellette Centre for Molecular Medicine and Therapeutics Children’s and Women’s Health Centre of British Columbia University of British Columbia Vancouver, British Columbia Canada A JOHN WILEY & SONS, INC., PUBLICATION New York • Chichester • Weinheim • Brisbane • Singapore • Toronto Designations used by companies to distinguish their products are often claimed as trademarks. In all instances where John Wiley & Sons, Inc., is aware of a claim, the product names appear in initial capital or ALL CAPITAL LETTERS. Readers, however, should contact the appropriate companies for more complete information regarding trademarks and registration. Copyright ᭧ 2001 by John Wiley & Sons, Inc. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic or mechanical, including uploading, downloading, printing, decompiling, recording or otherwise, except as permitted under Sections 107 or 108 of the 1976 United States Copyright Act, without the prior written permission of the Publisher.
    [Show full text]
  • Will a Biological Database Be Different from a Biological Journal? Philip Bourne
    Perspectives Will a Biological Database Be Different from a Biological Journal? Philip Bourne he differences, or otherwise, between biological checked for format compliance and reviewed internally by databases and journals is an important question to experienced annotators. There are even parallel T consider as we ponder the future dissemination and presubmission steps in journals and databases. For example, impact of science. If databases and journals remain discrete, potential authors in PLoS Computational Biology may make our methods of assimilating information will change presubmission inquiries to confirm the suitability of their relatively little in the years to come. On the other hand, if paper, and depositors to the PDB may run their entries databases and journals become more integrated, the way we against a validation server to determine whether the data are do science could change significantly. As both Editor-in-Chief in compliance, prior to having the same tests run by a PDB of PLoS Computational Biology and Codirector of the Protein annotator. Data Bank (PDB), one of the oldest and widely used data Once registered with the corresponding online submission resources in molecular biology, the question is particularly system, a journal manuscript receives a permanent pertinent. Here, I give my perspective on what could and, I manuscript number, while a database entry receives a unique believe, should happen in the future. identifier. Subsequent revisions can be mapped to these My vision is that a traditional biological journal will respective numbers, so that both journals and databases can become just one part of various biological data resources as provide an accurate audit trail of journal manuscripts and the scientific knowledge in published papers is stored and database entries, respectively.
    [Show full text]
  • COMBINED STUDY on DIGITAL SEQUENCE INFORMATION in PUBLIC and PRIVATE DATABASES and TRACEABILITY Note by the Executive Secretary 1
    CBD Distr. GENERAL CBD/DSI/AHTEG/2020/1/4 31 January 2020 ENGLISH ONLY AD HOC TECHNICAL EXPERT GROUP ON DIGITAL SEQUENCE INFORMATION ON GENETIC RESOURCES Montreal, Canada, 17-20 March 2020 COMBINED STUDY ON DIGITAL SEQUENCE INFORMATION IN PUBLIC AND PRIVATE DATABASES AND TRACEABILITY Note by the Executive Secretary 1. At its fourteenth meeting, the Conference of the Parties to the Convention on Biological Diversity requested the Executive Secretary “to commission a peer-reviewed study on ongoing developments in the field of traceability of digital information, including how traceability is addressed by databases, and how these could inform discussions on digital sequence information on genetic resources” (decision 14/20, para. 11 (c)), and “to commission a peer-reviewed study on public and, to the extent possible, private databases of digital sequence information on genetic resources, including the terms and conditions on which access is granted or controlled, the biological scope and the size of the databases, numbers of accessions and their origin, governing policies, and the providers and users of the digital sequence information on genetic resources and encourages the owners of private databases to provide the necessary information;” (decision 14/20, para. (d)). 2. Accordingly, and with financial support from Norway and the European Union, the Executive Secretary commissioned a research team to carry out the studies in a combined manner, taking into account the conceptual linkages between the two studies, and also partly for practical reasons. 3. A draft of the combined study was made available online for peer review from 22 October to 22 November 2019.1 The comments received in response have been made available online.2 The research team revised the study in the light of the comments received and prepared, in consultation with the Secretariat, the final version as presented herein.
    [Show full text]
  • Protein-Protein Interactions Prediction Based on Iterative Clique Extension with Gene Ontology Filtering
    Hindawi Publishing Corporation e Scientific World Journal Volume 2014, Article ID 523634, 6 pages http://dx.doi.org/10.1155/2014/523634 Research Article Protein-Protein Interactions Prediction Based on Iterative Clique Extension with Gene Ontology Filtering Lei Yang and Xianglong Tang School of Computer Science and Technology, Harbin Institute of Technology, Mailbox 352, 92 West Dazhi Street, Nan Gang District, Harbin 150001, China Correspondence should be addressed to Lei Yang; [email protected] Received 24 August 2013; Accepted 5 November 2013; Published 22 January 2014 Academic Editors: C. Angelini and Y. Lai Copyright © 2014 L. Yang and X. Tang. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Cliques (maximal complete subnets) in protein-protein interaction (PPI) network are an important resource used to analyze protein complexes and functional modules. Clique-based methods of predicting PPI complement the data defection from biological experiments. However, clique-based predicting methods only depend on the topology of network. The false-positive and false- negative interactions in a network usually interfere with prediction. Therefore, we propose a method combining clique-based method of prediction and gene ontology (GO) annotations to overcome the shortcoming and improve the accuracy of predictions. According to different GO correcting rules, we generate two predicted interaction sets which guarantee the quality and quantity of predicted protein interactions. The proposed method is applied to the PPI network from the Database of Interacting Proteins (DIP) and most of the predicted interactions are verified by another biological database, BioGRID.
    [Show full text]
  • Genomics in the UK an Industry Study for the Office of Life Sciences
    Genomics in the UK An industry study for the Office of Life Sciences September 2015 Contents Foreword 1 Executive summary 2 Part 1. Developments in genomics 4 Part 2. The trends driving growth 8 Part 3. UK competitive position 18 Glossary of terms 28 Deloitte contacts 30 Footnotes 24 Foreword Welcome to the Monitor Deloitte report on Genomics. This is one of a series of reports reflecting work commissioned by Office of Life Sciences in March 2015 on key healthcare and life science industry segments in the UK. Genomics is the study of the complete set of DNA within an individual. Knowledge of individuals’ genetic make-up can help understand their predisposition toward certain genetic diseases, inform the best course of treatment and contribute to precision medicine. These advanced applications of genomics have only recently become a possibility due to the exponential decline in the cost of genome sequencing, large scale public sector and pharmaceutical investment and promise to change the way healthcare is delivered and patient lives and life expectancy improved. This report analyses trends in human genomics and the UK market position based, discussions with industry and public sector stakeholders literature review and our work in the sector. It focusses on the United Kingdom but in the context of the global market and draws on examples from other countries. The report considers the challenges to growth, barriers to adoption, shifting dynamics and how the emergent industry is developing. The intention is to provoke discussion and offer readers an overview of the industry challenges and dynamics in the UK.
    [Show full text]
  • Genomic Databases and Softwares: in Pursuit of Biological Relevance
    s in que Bio ni lo h g c y e T & d M Kaushik et al., Adv Tech Biol Med 2016, 4:3 e e c Advanced Techniques in d n i c a i v DOI: 10.4172/2379-1764.1000185 n d e A ISSN: 2379-1764 Biology & Medicine MiniResearch Review Article OpenOpen Access Access Genomic Databases and Softwares: In Pursuit of Biological Relevance through Bioinformatics Mahima Kaushik1,2*, Swati Mahendru2, Mohan Kumar2, Swati Chaudhary2 and Shrikant Kukreti2* 1Cluster Innovation Centre, University of Delhi, Delhi, India 2Nucleic Acids Research Laboratory, Department of Chemistry, University of Delhi, Delhi, India Abstract With the completion of human genome project, a plethora of information had been available for exploring various unanswered questions related to cell and molecular biology. Bioinformatics has been instrumental in unravelling the genetic, phenotypic, structural and functional aspects of the whole genome by using this information. Genomics and proteomics have become one of the most relevant fields after the advancements in computational analysis, interpretation, and modelling software. It can not only quite categorically describe the position of nucleotides and amino acids throughout genomes and proteomes respectively, but it also helps in performing the phylogenetic analysis, search for associated transcription factors, multiple sequence alignments, and many other relevant explorations/hunts. The advances in the knowledge of genetics acquired from molecular biology and bioinformatics are applied and point towards potential therapeutic strategies such as genome editing. This review has an aim of discussing some of the bioinformatics databases and software, which has been utilized for exploring the position of a DNA sequence, any associated single nucleotide polymorphism (SNP) related to a disease, on or nearby situated transcription factor binding sites followed by multiple sequence alignment of this sequence with other organisms.
    [Show full text]