sign in sign up
<<
Home , Matrix metalloproteinase, Metalloproteinase, MMP1, MMP3

ANTICANCER RESEARCH 24: 2021-2026 (2004)

Single Nucleotide Polymorphisms in MMP1 and MMP3 Promoters as Risk Factor in Head and Neck Squamous Cell Carcinoma

FRANCK ZINZINDOHOUÉ1, HÉLÈNE BLONS1, STÉPHANE HANS2, MARIE-ANNE LORIOT1, ANNE-MARIE HOULLIER1, DANIEL BRASNU2, OLLIVIER LACCOURREYE2, DAVID-ALEXANDRE TREGOUET3, ISABELLE STUCKER4 and PIERRE LAURENT-PUIG1,2

1U490 INSERM, Laboratoire de Toxicologie Moléculaire, 45 rue des Saints Pe`res, 75006 Paris; 2Pôle de cancérologie, Hôpital Europeen Georges Pompidou Assistance Publique-Hôpitaux de Paris, 75015 Paris; 3U525 INSERM, Genetic Epidemiology and Molecular of Cardiovascular Pathologies, 91 Bd de l’Ho§pital, 75634 Paris; 4U170 INSERM, Epidemiologic and Statistical Research on Environment and Health, 94807 Villejuif, France

Abstract. (MMP) 1 and 3 of head and neck squamous cell carcinoma but mainly when play an important role in initiating tumor growth and they were carried by the same haplotype. By comparison to the promoting cell spread. Since MMP1 and MMP3 transcription 1G-5A haplotype, the 2G-6A haplotype was associated with a levels can be modulated by polymorphism, we lower risk of head and neck squamous cell carcinoma (OR= investigated the impact of different genotypes on the occurrence 0.52 95%CI [0.34-0.80], p=0.003). of head and neck cancer in a Caucasian case control study. DNA was extracted from 126 male head and neck cancer Head and neck squamous cell carcinoma (HNSCC) is the patients and from 249 male hospitalized-based controls. sixth most common solid tumor worldwide, accounting for Genotyping was carried out using PCR multiplex allowing the 2% of all neoplasms in western countries and its incidence is co-amplification of MMP1-1607 bp and MMP3-1171 bp still rising parallel to tobacco consumption (1). Although polymorphisms. PCR products were separated on a capillary tobacco smoking and alcohol consumption are risk factors electrophoresis. The MMP1-2G and the MMP3-6A for HNSCC (2), only a small fraction of smokers or drinkers frequencies were significantly lower in cases than in controls. develop this disease, suggesting that there is a genetic In particular homozygous 2G/2G individuals were at lower risk susceptibility to HNSCC. Among the genes that may be of cancer than the 1G/1G carriers (OR= 0.37 95%CI [0.19- implicated in HNSCC susceptibility, xenobiotic metabolizing 0.71], p=0.003). MMP1 and MMP3 polymorphisms were in (XME) have been screened and genetic variants moderate linkage disequilibrium in cases and controls have been shown to slightly modify HNSCC risk (3, 4). The (D’=0.41 and D’=0.46). Haplotype frequencies distribution impact of genetic background on HNSCC risk cannot be derived from these 2 polymorphisms was significantly different restricted to XME and the identification of new candidate between cases and controls (p=0.01). The haplotype analysis genes remains and is of great interest in terms of prevention suggested an implication of both MMP1 and MMP3 (5-7). Matrix (MMPs) are a family of polymorphisms in the head and neck squamous cell carcinoma -dependent (8, 9) that are up-regulated susceptibility. Indeed, the presence of the MMP1-2G and in almost every type of human cancer. MMP expression is MMP3-6A seemed to be associated with decreased risk mediated by cancer cells or by surrounding stroma cells and over-expression is often related to poor prognosis (10, 11). Experimental models have shown that MMPs contribute to tumor progression, invasion and through Correspondence to: Pierre Laurent-Puig, Inserm U490 Laboratoire and cell spread activation (12). Recent studies de Toxicologie Moléculaire, Université René Descartes Paris V, have demonstrated that MMPs are involved in the early 45 rue des Saints-Pères, 75006 Paris, France. Fax: 33142862072, e- steps of cancer development and may, therefore, modulate mail: [email protected] cancer susceptibility. Indeed, the increased level of MMP, Key Words: MMP1, MMP3, head and neck cancer, case control due to promoter polymorphism, in normal stroma cells may study, haplotype. facilitate cell transformation and cancer growth (13). As an

0250-7005/2004 $2.00+.40 2021 ANTICANCER RESEARCH 24: 2021-2026 (2004)

Table I. Characteristics of the study subjects included in the analysis.

n age Pack-years Tumor location n % Diagnosis n %

Cases 126 57.6 ± 0.9 40 ±1.8 Hypopharynx 36 28% Endolarynx 27 21% Oropharynx 49 40% Oral cavity 14 11%

Controls 249 59.2 ± 0.6 22.8 ±1.5 Nervous system 59 24% Circulatory disease 54 22% Musculo-skeletal disease 24 10% Skin disease 29 12% Poisoning 40 16% Other 23 9% Missing 20 8%

example, overexpression of MMP3 in the of MMP1 or MMP3 as risk factors for cancer is still matter results in spontaneous mouse breast cancer (14, 15) of debate. On the one hand the MMP3-5A allele appears to Moreover recent studies have suggested that single be a risk for breast cancer, while, on the other hand, the nucleotide polymorphism (SNP) in the promoter region of MMP1-2G allele appears to be a risk for colon, ovarian, both MMP1 and MMP3 genes could be associated with an endometrial and cancer. We investigated the respective increased risk of lung (16), endometrial (17), ovarian (18) role and the interaction between these two polymorphisms colon (19, 20), breast (21) and renal cancers (22). in a HNSCC case control study. MMP1 (-1), is capable of cleaving the triple helical fibrillar of (I, II, III, VII, VIII, X), aggregan Patients and Methods and serpins. The MMP1 gene polymorphism tested in case control studies arises from insertion (allele 2G) or deletion The original study population included 162 patients (141 males and (allele 1G) of a guanine nucleotide at position –1607bp. 21 females; mean age 58.8±10 years) with a histologically-confirmed HNSCC diagnosis (25). Briefly, they were recruited prospectively This guanine creates the sequence 5’-GGA-3’ which is a from 1996 to 1999 at the department of Otorhinolaryngology and core recognition sequence of the for the Ets Maxillofacial Surgery of Laennec University Hospital (Paris,France); family transcription factors. The presence of the 2G leads only new cases with first primary tumors were included. Patients with to an increased transcriptional activity as shown in a previous history of other cancer were excluded. A previous case- melanoma cells (23). control study had recruited 310 hospital-based cancer-free patients MMP3 (Stromelysine-1) is capable of cleaving the triple (26). All were male subjects hospitalized for different disorders helical fibrillar of collagen (IV, V, IX, X), , , except cancer (Table I). All study subjects were interviewed using a standard , and E-cadherin. MMP3 is activated by questionnaire for their demographic characteristics, previous family MMP1. The SNP in the promoter region of the MMP3 gene history of cancer and smoking habits. Blood samples were obtained arises from the insertion or deletion of an adenine at after written informed consent and approval by the ethics position –1171 bp in a polymorphic track of committee. Blood samples were taken after HNSCC diagnosis was resulting in a 5 adenosines allele (5A) or a 6 adenosines histologically confirmed, before the initiation of any chemo- or allele (6A). In vitro assays showed that the 5A allele had a 2- radiotherapy. DNA was isolated from the lymphocytes using fold higher promoter activity than the 6A allele in standard techniques (25). Since all controls were male, we only retained the 141 male cases in this study. Among them, samples fibroblasts and vascular smooth muscle cells (24). from 5 patients were damaged, no more DNA was available from 6 These two MMPs gene map to the 11q22 MMP cluster subjects and, due to technical problems, the genotype data could region of 400 kb which contains 7 other MMPS. The –1607 not be achieved for 4 more study subjects. Finally genotype data MMP1 and –1171 MMP3 polymorphisms are distant from 50 were available for 126 cases and 249 controls. Table I displays the kb. They were found in linkage disequilibrium in a Japanese clinical characteristics of the genotyped cases and controls. colorectal cancer case-control study (19). It is noteworthy MMP1 and MMP3 genotyping. Multiplex PCR was performed that the haplotypes 2G-6A and 1G-5A are more frequently allowing co-amplification of MMP1 and MMP3 fragments using the found than expected, leading to a preferred association of following primers: 6FAM-CCCTCTTGAACTCACATGTTATG the higher and the lower transcriptional activity for both and ACTTTCCTCCCCTTATGGATTCC for MMP1 and TCCT MMP1 and MMP3 genes. Furthermore, the respective roles CATATCAATGTGGCCAAA and 6FAM-CGGCACCTGGCC

2022 Zinzindohoué et al: MMP1, MMP3 and Head and Neck Cancer Risk

Table II. Distribution of MMP1 and MMP3 genotypes and risk estimates. Results

Controls HNSCC Genotype distribution of the MMP3 polymorphism was n % n % OR (95%CI) consistent with HW equilibrium in cases and controls. The Crude Adjusted1 MMP3-6A allele frequency significantly differed between cases and controls (0.43 vs 0.52 p=0.03). Homozygous 6A/6A MMP3 individuals were at lower risk of HNSCC than 5A/5A carriers (OR=0.46 95%CI [0.24 – 0.89], p=0.022) (Table II). The 5A/5A 60 24.1% 36 28.8% 1.0 1.0 (Ref) (Ref) association failed to reach significance after adjusting for age 6A/5A 121 48.6% 70 56% 1.0 0.9 and smoking (OR=0.53 95%CI [0.26 – 1.1], p=0.086). When (0.6-1.6) (0.5-1.6) patients were grouped according to tumor location, the OR 6A/6A 68 27.3% 19 15.2% 0.5 0.5 observed were smaller than one. However the number of (0.2-0.9) (0.2-1.1) subjects in each location was small and almost all these MMP1 relationships were non significant (Table III). Genotype distribution of the MMP1 polymorphism was 1G/1G 57 22.9% 41 32.8% 1.0 1.0 consistent with HW equilibrium in both populations. The (Ref) (Ref) MMP1-2G allele frequency was significantly lower in cases 1G/2G 126 50.6% 66 52.8% 0.7 0.7 than in controls (0.40 vs 0.52 p=0.004). Homozygous 2G/2G (0.4-1.1) (0.4-1.2) 2G/2G 66 26.5% 18 14.4% 0.4 0.3 individuals were at lower risk of HNSCC than 1G/1G carriers (0.2-0.7) (0.1-0.6) (OR=0.37 95%CI [0.19 – 0.71], p=0.003) (Table ππ). Adjusting for age and smoking did not modify the result (OR=0.31 1 : age and pack-year 95%CI [0.15 – 0.65], p=0.002). The number of pack-years smoked was not significantly related to either MMP1 or MMP3 polymorphisms in controls or cases. The analysis of the OR by TAAAGAC for MMP3. Briefly, 40 ng of genomic DNA were HNSCC location subtypes showed results very close to those amplified by 0.5 U of HotStarTaqì polymerase (Qiagen, Les Ulis, obtained for the whole HNSCC group (Table III). France), 200mM dNTPs, 2mM MgCl2 and 300nM of each primers MMP1 and MMP3 polymorphisms were in linkage R on a GeneAmp PCR system 9700 (Applied Biosystems, disequilibrium in cases and controls (D'=0.41 and D’= 0.46, Courtaboeuf, France). Thirty-five cycles of PCR were run at an -4 annealing temperature of 58ÆC after activation at 95ÆC for p<10 , respectively), leading to the 4 common haplotypes 15 min. Amplified fragments are separated, after dilution, on an ABI (Table IV). Haplotype frequency distribution was significantly 2 310 genetic analyzer (Applied Biosystems). Analyses of MMP1 and different between cases and controls (¯ =11.2 with 3 df, MMP3 genotypes were performed using genotyper software (Applied p=0.011) (Table IV). The 2G-6A haplotype was less frequent Biosystems). The genotype of MMP1 was characterized by the in cases (0.26) than in controls (0.39) and was associated with insertion or the deletion of a guanine at position -1607 (- a lower cancer risk by comparison to the 1G-5A haplotype 1607del/insG) which defined two alleles, 1G or 2G, of 167 and 168 (OR=0.52 95%CI [0.34-0.80] p=0.003). No other haplotypes bp, respectively. For the MMP3 gene, the deletion or the insertion of an adenine at position -1171 (-1171del/insA) defined two alleles, seemed to be associated with the risk of HNSCC. Since the 5A or 6A of 126 and 127 bp, respectively. MMP1-2G allele was carried by both the 5A and the 6A allele Standard statistical analyses were performed using STATA of the MMP3 polymorphism, we further investigated whether Version 7.0 software (College Station, TX, USA). Allele frequencies its effect was homogeneous according to these two haplotypic were estimated by gene-counting. Departure from Hardy-Weinberg backgrounds. When carried by the 5A allele, the 2G allele was (HW) equilibrium was tested using a ¯2 with 1 degree of freedom. associated with an OR of 0.89 (95%CI [0.50-1.57], p=0.69) Association between cancer risk and polymorphisms was expressed while, when carried by the 6A allele, the OR was 0.41 (95%CI in terms of genotype odds ratio (OR) using logistic regression. Pairwise linkage disequilibrium (LD) between MMP1 and [0.21-0.84], p=0.015). However, the test of homogeneity of 2 MMP3 promoter polymorphisms was estimated by a log-linear these two ORs did not reach significance (¯ =1.84 with 1 df, model (27) and the extent of disequilibrium was expressed in terms p=0.17) leading to a common MMP1 2G allelic OR of 0.68 of D’, which is the ratio of the unstandardized coefficient to its (95%CI [0.48-0.97], p=0.033). Under this model, the MMP3- maximal/minimal value. In order to take into account the LD 6A allele was not associated with HNSCC risk (OR=0.83 between MMP1 and MMP3 polymorphisms, a recently developed 95%CI [0.58-1.18], p=0.31). maximum-likelihood method for haplotype-based association analysis was used (28). This method allows one to simultaneously estimate haplotype frequencies as well as covariate-adjusted Discussion haplotype OR by comparison with a reference haplotype. In these analyses, the most frequent haplotype was taken as the reference In this study, we investigated the influence of MMP1 and haplotype. Haplotype analyses were adjusted for age and smoking. MMP3 functional promoter polymorphisms on HNSCC risk.

2023 ANTICANCER RESEARCH 24: 2021-2026 (2004)

Table III. Distribution of MMP1 and MMP3 genotypes and risk estimates according to tumor locations.

Hypopharynx Oropharynx Endolarynx Oral cavity n % OR (95%CI) n %OR (95%CI) n % OR (95%CI) n % OR (95%CI) Crude Adjusted1 Crude Adjusted1 Crude Adjusted1 Crude Adjusted1

MMP3

5A/5A 15 42 1.0 1.0 13 27 1.0 1.0 415 1.0 1.0 429 1.0 1.0 (ref) (ref) (ref) (ref) (ref) (ref) (ref) (ref) 5A/6A 17 47 0.6 0.5 28 58 1.1 1.2 17 63 2.1 2 857 1 0.9 (0.3-1.2) (0.2-1.2) (0.5-2.2) (0.6-2.7) (0.7-6.5) (0.6-6.6) (0.3-3.4) (0.2-3.2) 6A/6A 4 11 0.2 0.3 715 0.5 0.6 622 1.3 1.5 214 0.4 0.2 (0.1-0.7) (0.1-0.9) (0.2-1.2) (0.2-1.7) (0.3-5) (0.4-6.1) (0.1-2.5) (0 -2)

MMP1

1G/1G 14 39 1.0 1.0 15 31 1.0 1.0 726 1.0 1.0 643 1.0 1.0 (ref) (ref) (ref) (ref) (ref) (ref) (ref) (ref) 1G/2G 17 47 0.5 0.5 25 51 0.7 0.8 17 63 1.1 0.9 750 0.5 0.4 (0.2-1.2) (0.2-1.1) (0.4-1.5) (0.4-1.7) (0.4-2.8) (0.3-2.3) (0.2-1.6) (0.1-1.4) 2G/2G 5 14 0.3 0.2 918 0.5 0.5 311 0.4 0.2 17 0.1 * (0.1-0.9) (0.1-0.8) (0.2-1.3) (0.2-1.3) (0.1-1.5) (0.1-1.1) (0-1.2)

1 : age and pack-year ; *unestimable

Table IV. Association between MMP1 and MMP3 haplotypes with head risk to breast cancer for the 5A/5A genotype (21). Our results and neck cancer risk (N=375). are opposite to those previously described. In our series, concerning MMP1, 2G/2G genotype is linked to a low cancer Haplotypes Haplotype Haplotype Haplotypic p value frequency frequency ORs risk and, for MMP3, haplotypic analyses suggested that its in controls in cases [95% CI] influence on cancer risk was due to the existence of a linkage disequilibrium with MMP1. These findings were not 1G-5A 0.35 0.42 reference influenced significantly by tobacco consumption or age which 1G-6A 0.13 0.17 1.25 p=0.47 are risk factors for HNSCC. The linkage disequilibrium [0.67 –2.34] 2G-5A 0.13 0.15 0.89 p=0.69 observed in the present series was weaker than observed in a [0.50 – 1.57] Japanese population (19) (i.e D’=0.80). This could explain an 2G-6A 0.39 0.26 0.52 p=0.003 OR under the threshold of significance in patients with MMP3 [0.34 – 0.80] 6A/6A genotype when adjusted for age and smoking habits. We evaluated possible bias due to our control group: (i) frequencies of the different MMP1 and MMP3 genotypes in our hospital-based control population are close to those found The existence of a linkage disequilibrium between both in other Caucasian control populations (16, 21, 29). (ii) Both polymorphisms made us consider the question both for genotypic distributions of MMP1 and MMP3 polymorphisms individual genotypes and for haplotypes. are in agreement with the Hardy-Weinberg equilibrium. (iii) Although this work is the first case control study analyzing Our control population included 22% of subjects suffering the association between MMP1 and MMP3 promoter from a circulatory disease. Since several epidemiological polymorphisms and HNSCC risk, seven previous studies have studies displayed a positive association between MMP1 and/or been published on the subject in other tumor types (16-22). MMP3 genotypes and different non cancerous diseases, All together, five studies have shown an elevated risk of including cardiovascular diseases (29-34), we excluded one by cancer associated with the 2G/2G MMP1 genotype (16, 18-20, one from the statistical analysis each of the six types of disease 22). Three studies have also considered MMP3 polymorphism constituting the control group. The results remained in their analyses (19-21). Two studies (19, 20) demonstrated unchanged (data not shown). Therefore our results were not an increased risk of cancer for the 6A/6A genotype (although related to an overrepresentation of the 2G/2G genotype in one was non significant) while the other found an elevated one of our control diseases. Concerning our case group, since

2024 Zinzindohoué et al: MMP1, MMP3 and Head and Neck Cancer Risk it has been suggested that overexpression of MMP1 is a References prognostic factor of tumors, we studied the distribution of the different genotypes according to the stage of the tumors. We 1 Sankaranarayanan R, Masuyer E, Swaminathan R, Ferlay J and did not observe any difference (data not shown). Finally to Whelan S: Head and neck cancer: a global perspective on rule out classification errors from our MMP1 and MMP3 epidemiology and prognosis. Anticancer Res 18: 4779-86, 1998. 2 Khuri FR, Lippman SM, Spitz MR, Lotan R and Hong WK: genotyping methods, first we genotyped MMP1 on a subset of Molecular epidemiology and retinoid chemoprevention of head 20 controls with another published method (16). We and neck cancer. J Natl Cancer Inst 89: 199-211, 1997. reproduced individually the same genotyping results. Second, 3 Zavras AI, Wu T, Laskaris G, Wang YF, Cartsos V, Segas J, we validated our MMP3 genotyping method by characterizing Lefantzis D, Joshipura K, Douglass CW and Diehl SR: the 23 CEPH individuals, for whom the MMP3 genotype is Interaction between a single nucleotide polymorphism in the available in the NCIBI SNP database. We found identical alcohol dehydrogenase 3 gene, alcohol consumption and oral genotyping data. cancer risk. Int J Cancer 97: 526-30, 2002. One of the previous case control cancer studies found 4 Geisler SA and Olshan AF: GSTM1, GSTT1, and the risk of squamous cell carcinoma of the head and neck: a mini-HuGE that the MMP3 5A allele frequency was higher in the breast review. Am J Epidemiol 154: 95-105, 2001. cancer group than in control. Although, a linkage 5 Zheng Y, Shen H, Sturgis EM, Wang LE, Shete S, Spitz MR disequilibrium was evidenced between the MMP1 1G and and Wei Q: Haplotypes of two variants in p16 (CDKN2/MTS- MMP3 5A alleles, they failed to demonstrate a higher 1/INK4a) exon 3 and risk of squamous cell carcinoma of the frequency of the 1G allele in breast cancer patients as head and neck: a case-control study. Cancer Epidemiol compared to controls. This result was probably due to the Biomarkers Prev 11: 640-5, 2002. small number of patients included in this study. However, 6 Sturgis EM, Castillo EJ, Li L, Zheng R, Eicher SA, Clayman GL, Strom SS, Spitz MR and Wei Q: Polymorphisms of DNA their results and ours suggest that the MMP1 and MMP3 repair gene XRCC1 in squamous cell carcinoma of the head allele at risk could change according to tumor cell types. and neck. Carcinogenesis 20: 2125-9, 1999. Wyatt et al. (35) recently discussed the functional role of 7 Sturgis EM, Zheng R, Li L, Castillo EJ, Eicher SA, Chen M, MMP1 polymorphism (-1607del/insG). They showed that Strom SS, Spitz MR and Wei Q: XPD/ERCC2 polymorphisms the 2G allele did not significantly affect mean MMP1 and risk of head and neck cancer: a case-control analysis. mRNA expression in normal fibroblasts, contrary to that Carcinogenesis 21: 2219-23, 2000. observed in melanomas (23). Furthermore, there are a few 8 Ye S: Polymorphism in gene promoters: implication in regulation of and cases in which increased expression of specific MMPs susceptibility of various diseases. Matrix Biol 19: 623-9, 2000. reflects a favorable prognosis, suggesting that MMPs are 9 Vihinen P and Kahari VM: Matrix metalloproteinases in necessary for generating proapoptotic factors or for cancer: prognostic markers and therapeutic targets. Int J stimulating immune response (36). Cancer 99: 157-66, 2002. Our haplotypic analysis suggested that the protective 10 Franchi A, Santucci M, Masini E, Sardi I, Paglierani M and effect of the 2G allele on HNSCC risk was higher when it Gallo O: Expression of matrix metalloproteinase 1, matrix was associated with the 6A allele (OR=0.41) rather than metalloproteinase 2, and matrix metalloproteinase 9 in carcinoma of the head and neck. Cancer 95: 1902-10, 2002. the 5A allele (OR=0.89). Even though the test for 11 Monvoisin A, Bisson C, Si-Tayeb K, Balabaud C, Desmouliere interaction failed to reach significance, this analysis suggests A and Rosenbaum J: Involvement of matrix metalloproteinase that both polymorphisms could be implicated in the type-3 in hepatocyte growth factor-induced invasion of human occurrence of HNSCC with more complex interaction than hepatocellular carcinoma cells. Int J Cancer 97: 157-62, 2002. that described initially. 12 Nelson AR, Fingleton B, Rothenberg ML and Matrisian LM: In summary, the current study documented that for SNP Matrix metalloproteinases: biologic activity and clinical in the promoter region of both MMP1 (-1607bp del/insG) implications. J Clin Oncol 18: 1135-49, 2000. 13 Coussens LM and Werb Z: Matrix metalloproteinases and the and MMP3 (–1171bp del/insA) genes on 11q22, the development of cancer. Chem Biol 3: 895-904, 1996. homozygous 2G and 6A allele was associated with a lower 14 Sternlicht MD, Lochter A, Sympson CJ, Huey B, Rougier JP, Gray risk of HNSCC. Haplotype analysis showed that the 2G-6A JW, Pinkel D, Bissell MJ and Werb Z: The stromal proteinase haplotype was at lower risk of HNSCC. These results MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell 98: suggest that, according to tumor types, the effect of MMP1 137-46, 1999. and MMP3 polymorphisms on cancer risk could be 15 Ha HY, Moon HB, Nam MS, Lee JW, Ryoo ZY, Lee TH, Lee different. KK, So BJ, Sato H, Seiki M and Yu DY: Overexpression of membrane-type matrix metalloproteinase-1 gene induces mammary gland abnormalities and adenocarcinoma in Acknowledgements transgenic mice. Cancer Res 61: 984-90, 2001. 16 Zhu Y, Spitz MR, Lei L, Mills GB and Wu X: A single nucleotide La Région Ile de France, La Ligue Nationale de Lutte Contre le polymorphism in the matrix metalloproteinase-1 promoter Cancer, France. enhances lung cancer susceptibility. Cancer Res 61: 7825-9, 2001.

2025 ANTICANCER RESEARCH 24: 2021-2026 (2004)

17 Nishioka Y, Kobayashi K, Sagae S, Ishioka S, Nishikawa A, 28 Tregouet DA, Barbaux S, Escolano S, Tahri N, Golmard JL, Matsushima M, Kanamori Y, Minaguchi T, Nakamura Y, Tiret L and Cambien F: Specific haplotypes of the P-selectin Tokino T and Kudo R: A single nucleotide polymorphism in gene are associated with . Hum Mol Genet the matrix metalloproteinase-1 promoter in endometrial 11: 2015-23, 2002. carcinomas. Jpn J Cancer Res 91: 612-5, 2000. 29 Satsangi J, Chapman RW, Haldar N, Donaldson P, Mitchell S, 18 Kanamori Y, Matsushima M, Minaguchi T, Kobayashi K, Sagae Simmons J, Norris S, Marshall SE, Bell JI, Jewell DP and S, Kudo R, Terakawa N and Nakamura Y: Correlation between Welsh KI: A functional polymorphism of the stromelysin gene expression of the matrix metalloproteinase-1 gene in ovarian (MMP-3) influences susceptibility to primary sclerosing cancers and an insertion/deletion polymorphism in its promoter cholangitis. Gastroenterology 121: 124-30, 2001. region. Cancer Res 59: 4225-7, 1999. 30 Lamblin N, Bauters C, Hermant X, Lablanche JM, Helbecque 19 Hinoda Y, Okayama N, Takano N, Fujimura K, Suehiro Y, N and Amouyel P: Polymorphisms in the promoter regions of Hamanaka Y, Hazama S, Kitamura Y, Kamatani N and Oka M: MMP-2, MMP-3, MMP-9 and MMP-12 genes as determinants Association of functional polymorphisms of matrix of aneurysmal coronary artery disease. J Am Coll Cardiol 40: metalloproteinase (MMP)-1 and MMP-3 genes with colorectal 43-8, 2002. cancer. Int J Cancer 102: 526-9, 2002. 31 Fujimoto T, Parry S, Urbanek M, Sammel M, Macones G, 20 Ghilardi G, Biondi ML, Mangoni J, Leviti S, DeMonti M, Kuivaniemi H, Romero R and Strauss JF 3rd: A single Guagnellini E and Scorza R: Matrix metalloproteinase-1 nucleotide polymorphism in the matrix metalloproteinase-1 promoter polymorphism 1G/2G is correlated with colorectal (MMP-1) promoter influences amnion cell MMP-1 expression cancer invasiveness. Clin Cancer Res 7: 2344-6, 2001. and risk for preterm premature rupture of the fetal membranes. 21 Ghilardi G, Biondi ML, Caputo M, Leviti S, DeMonti M, J Biol Chem 277: 6296-302, 2002. Guagnellini E and Scorza R: A single nucleotide polymorphism 32 Ghilardi G, Biondi ML, DeMonti M, Bernini M, Turri O, in the matrix metalloproteinase-3 promoter enhances breast Massaro F, Guagnellini E and Scorza R: Independent risk cancer susceptibility. Clin Cancer Res 8: 3820-3, 2002. factor for moderate to severe internal carotid artery stenosis: 22 Hirata H, Naito K, Yoshihiro S, Matsuyama H, Suehiro Y and T786C mutation of the endothelial nitric oxide synthase gene. Hinoda Y: A single nucleotide polymorphism in the matrix Clin Chem 48: 989-93, 2002. metalloproteinase-1 promoter is associated with conventional 33 Yamada Y, Izawa H, Ichihara S, Takatsu F, Ishihara H, renal cell carcinoma. Int J Cancer 106: 372-4, 2003. Hirayama H, Sone T, Tanaka M and Yokota M: Prediction of 23 Rutter JL, Mitchell TI, Buttice G, Meyers J, Gusella JF, the risk of myocardial infarction from polymorphisms in Ozelius LJ and Brinckerhoff CE: A single nucleotide candidate genes. N Engl J Med 347: 1916-23, 2002. polymorphism in the matrix metalloproteinase-1 promoter 34 Terashima M, Akita H, Kanazawa K, Inoue N, Yamada S, Ito creates an Ets binding site and augments transcription. Cancer K, Matsuda Y, Takai E, Iwai C, Kurogane H, Yoshida Y and Res 58: 5321-5, 1998. Yokoyama M: Stromelysin promoter 5A/6A polymorphism is 24 Ye S, Eriksson P, Hamsten A, Kurkinen M, Humphries SE and associated with acute myocardial infarction. Circulation 99: Henney AM: Progression of coronary is 2717-9, 1999. associated with a common genetic variant of the human 35 Wyatt CA, Coon CI, Gibson JJ and Brinckerhoff CE: Potential stromelysin-1 promoter which results in reduced gene for the 2G single nucleotide polymorphism in the promoter of expression. J Biol Chem 271: 13055-60, 1996. matrix metalloproteinase to enhance gene expression in normal 25 Cabelguenne A, Loriot MA, Stucker I, Blons H, Koum-Besson stromal cells. Cancer Res 62: 7200-2, 2002. E, Brasnu D, Beaune P, Laccourreye O, Laurent-Puig P and De 36 Egeblad M and Werb Z: New functions for the matrix Waziers I: Glutathione-associated enzymes in head and neck metalloproteinases in cancer progression. Nat Rev Cancer 2: squamous cell carcinoma and response to cisplatin-based 161-74, 2002. neoadjuvant chemotherapy. Int J Cancer 93: 725-30, 2001. 26 Stucker I, de Waziers I, Cenee S, Bignon J, Depierre A, Milleron B, Beaune P and Hemon D: GSTM1, smoking and lung cancer: a case-control study. Int J Epidemiol 28: 829-35, 1999. 27 Tiret L, Amouyel P, Rakotovao R, Cambien F and Ducimetiere Received January 5, 2004 P: Testing for association between disease and linked marker loci: Revised March 8, 2004 a log-linear-model analysis. Am J Hum Genet 48: 926-34, 1991. Accepted April 15, 2004

2026