Evolution of the Germline Actin Gene in Hypotrichous Ciliates: Multiple Nonscrambled Iess at Extremely Conserved Locations in Two Urostylids

The Journal of Published by the International Society of Eukaryotic Microbiology Protistologists

Journal of Eukaryotic Microbiology ISSN 1066-5234

ORIGINAL ARTICLE Evolution of the Germline Actin Gene in Hypotrichous Ciliates: Multiple Nonscrambled IESs at Extremely Conserved Locations in Two Urostylids

Tianbing Chena, Zhenzhen Yia, Jie Huangb & Xiaofeng Lina

a Laboratory of Protozoology, School of Life Science, South China Normal University, Guangzhou 510631, China b Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China

Keywords ABSTRACT Actin; ciliates; macronuclear; MDS; micronuclear. In hypotrichous ciliates, macronuclear chromosomes are gene-sized, and micronuclear genes contain short, noncoding internal eliminated segments (IESs) Correspondence as well as macronuclear-destined segments (MDSs). In the present study, we Z. Yi and X. Lin, Key Laboratory of Ecology characterized the complete macronuclear gene and two to three types of mi- and Environmental Science in Guangdong cronuclear actin genes of two urostylid species, i.e. Pseudokeronopsis rubra Higher Education, South China Normal and Uroleptopsis citrina. Our results show that (1) the gain/loss of IES happens University, Guangzhou 510631, China frequently in the subclass Hypotrichia (formerly Stichotrichia), and high frag- Telephone/Fax number: +86 (0) 20-8521- mentation of germline genes does not imply for gene scrambling; and (2) the 0644; micronuclear actin gene is scrambled in the order Sporadotrichida but non- e-mail: [email protected]; [email protected] scrambled in the orders Urostylida and Stichotrichida, indicating the independent evolution of MIC-actin gene patterns in different orders of hypotrichs; (3) Macronuclear (/Micronuclear) actin is abbre- locations of MDS–IES junctions of micronuclear actin gene in coding regions viated as MAC(/MIC)-actin. IESn-n +1repre- are conserved among closely related species. sent the IES between MDSn and MDSn +1.

Received: 7 November 2013; revised 16 June 2014; accepted July 8, 2014.

doi:10.1111/jeu.12158

CILIATES are unicellular eukaryotes characterized by the and Klobutcher 2002; Prescott 1994). Assembly of these presence of cilia and nuclear dimorphism. Each cell con- MDSs generates a MAC with up to 20,000,000 ampliﬁed tains two types of nuclei: a diploid germline micronucleus gene-sized chromosomes in the class Spirotrichea (Baird (MIC) which is transcriptionally inactive except during sex- and Klobutcher 1991; Prescott 1994). ual conjugation, and a somatic macronucleus (MAC) which Macronuclear-destined segments within some micronu- is the primary source of gene transcripts (Prescott 1994). clear genes are scrambled in comparison to their linear The development of a new MAC from a MIC involves a arrangement in the macronucleus. It is estimated that series of chromosomal rearrangements, including DNA approximately one-third of the genes in Hypotrichia sensu elimination, fragmentation, and ampliﬁcation (Jahn and Adl et al. (2012) (formerly Stichotrichia sensu Lynn 2008), Klobutcher 2002; Prescott 1994). These rearrangements a subclass of Spirotrichea, are scrambled (Cavalcanti et al. are extensive in three classes of ciliates: Armophorea, 2005). Among them, three genes have been extensively Phyllopharyngea, and Spirotrichea (the focus of this study). studied: actin I (Dalby and Prescott 2004; Greslin et al. Transposons and most intergenic spacer DNA, as well as 1989; Hogan et al. 2001; Mollenbeck€ et al. 2006), a-telo- intragenic spacer DNA, termed internal eliminated mere-binding protein (TEBP-a) (Mitcham et al. 1992; Pres- segments (IESs) are extensively eliminated from zygotic cott et al. 1998; Wong and Landweber 2006), and DNA chromosomes. In spirotrichous ciliates, the remaining polymerase a (DNA pol-a) (Chang et al. 2004, 2005; Hoff- DNA segments, called macronuclear-destined segments man and Prescott 1996, 1997; Landweber et al. 2000). (MDSs), occupy only 2–5% of the germline genome (Jahn However, conclusions about the evolution of these three

© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists 188 Journal of Eukaryotic Microbiology 2015, 62, 188–195 Chen et al. Evolution of the Micronuclear Actin Gene genes vary. For example, it is reported that higher num- citrina, the micronuclear segments 33–35, 34–35 (Fig. 1) bers of MDSs are present in species with scrambled mi- were amplified using the SiteFinding-PCR products as cronuclear actin I (Hogan et al. 2001) and TEBP-a (Wong templates. After obtaining the IES sequence, MIC-specific and Landweber 2006) than in species with nonscrambled primers and MAC-based primers were used to recover the genes. By contrast, extensive fragmentation does not full length of these genes (Fig. 1). PCR products were imply for scrambling of the DNA poly-a gene (Chang et al. cloned into the pMDTM18-T vector (Takara Biotechnology, 2005). Dalian, China). M13F and M13R sequencing primers and To get a better understanding about the evolutionary species-specific internal primers were used for sequencing history of micronuclear genes within hypotrichous ciliates, in the Guangzhou branch of Beijing Genomics Institute we determined macronuclear and micronuclear structures (BGI, Beijing, China). of the actin gene from Pseudokeronopsis rubra and Urol- eptopsis citrina, which represent a divergent group from Phylogenetic analyses previously studied species (Hogan et al. 2001) as defined by SSU rDNA trees (Huang et al. 2014; Yi and Song Due to the high ambiguity of the noncoding sequence 2011). We compared our results with previous studies regions, only the coding sequences of the MAC-actin gene and discussed the evolution of micronuclear actin (MIC- (Table S1), of which the micronuclear versions are avail- actin) gene in hypotrichs. able, were used in the phylogenetic analysis. A SSU rDNA tree was also constructed using sequences from GenBank (Table S1). Maximum likelihood analyses, employing the MATERIALS AND METHODS GTR (General Time Reversible) substitution model and 1,000 bootstrap replicates, were conducted via CIPRES Cell culture and DNA extraction Science Gateway (http://www.phylo.org/sub_sections/ The cultures of P. rubra and U. citrina in this study were portal) using RaxML-HPC v7.2.5 (Stamatakis et al. 2008). isolated from marine habitats in China and have been kept in culture since several years ago (described in Huang RESULTS et al. 2010; Yi et al. 2008). Several cells were picked and cultures were established in autoclaved seawater with rice MAC-actin gene grains. Subsequently, cells were collected in a 1-liter beaker by filtering through a 20-lm filter to remove large par- Three and two overlapping PCR products of the MAC- ticulate debris. Once cells settled at the bottom of the actin gene were obtained from P. rubra and U. citrina, beaker, the supernatant was discarded and fresh auto- respectively (P-mac and U-mac, Fig. 1). One to five clones claved seawater was added. These steps were repeated from each segment were sequenced to obtain consensus several times to wash the cells and reduce the number of sequences. These have been submitted to GenBank under bacteria. After the final wash and removal of the superna- the accession numbers: KJ439789 (P. rubra), KJ439788 tant, the ciliates were starved overnight to digest remain- (U. citrina). ing bacteria within cells and then pelleted by Comparing sequences from different cloning products, centrifugation at 2655 g for 3 min before DNA extraction. 13 and 35 segregating sites are detected in the MAC-actin Total genomic DNA of the two species was extracted genes of P. rubra and U. citrina, respectively. For P. rubra, using the DNeasy Blood & Tissue Kit (Qiagen, cat. no. one occurs in the 50 leader region, three in the 30 trailer 69506, Hilden, Germany). Micronuclear DNA was isolated region, and nine in the CDS region. Of these polymor- from genomic DNA by gel electrophoresis following the phisms, three are nonsynonymous. In U. citrina, three method described in Katz et al. (2003), and purified using nucleotide polymorphisms occur in the 50 leader region, the QIAEX II Gel Extraction kit (Qiagen, cat. no. 20021). one in the 30 trailer region, and 31 fall into the CDS region, with seven being nonsynonymous. The complete MAC- actin chromosomes (excluding the telomere repeats) are PCR and cloning 1,429 and 1,415 bp in P. rubra and U. citrina, respectively. Complete macronuclear actin I (MAC-actin) gene They both encode a putative actin protein of 376 amino sequences of P. rubra and U. citrina were determined by acids. Similar to other hypotrichous species, the 50 leader telomere suppression PCR following procedures estab- and 30 trailer are AT-rich in both species. lished by Chang et al. (2004). Conventional PCR aiming to amplify the complete sequences of micronuclear genes MIC-actin gene failed with gel isolated MIC-DNA or BAL-31 Nuclease (New England Biolabs, cat. no. M0213, Hitchin, UK)-treated Three patterns (P-mic-a, P-mic-b, and P-mic-c) of the MIC- MIC-DNA templates, and only macronuclear segments actin gene were observed in P. rubra in the present study. were obtained. We performed walking PCR (SiteFinding- P-mic-a was sequenced in full length by primers 21 and PCR) to amplify the MIC-actin segment 13-SFP3 (Fig. 1) of 25, located on the ends of the gene, while the other two P. rubra (Tan et al. 2005). We also designed MIC-specific patterns were only partially sequenced, likely due to the primers (Table 1) and paired them with MAC-based prim- long insertions of IESs (Fig. 1). Multiple clones (2–5) of ers to amplify the segments 21–22, 23–25 (Fig. 1). For U. each PCR segment were sequenced. The consensus

© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195 189 Evolution of the Micronuclear Actin Gene Chen et al.

Figure 1 Schematic representation of the MIC-actin and MAC-actin structures. MDSs are in blue and numbered, IESs of P-mic-a and U-mic-a are in yellow, IESs of P-mic-b and U-mic-b are in brown, P-mic-c is a recombinant of P-mic-a and P-mic-b, pointer sequences are in maroon. Black boxes represent telomeres, black dots mark the positions of start and stop codons. The IES between MDS3 and MDS 4 of P-mic-a is much shorter than that of P-mic-b and P-mic-c, and the absence sequences are labeled in white. P-mic-a, P-mic-b, P-mic-c: type a, b, c for micronuclear actin gene of Pseudokeronopsis rubra; U-mic-a, U-mic-b: type a, b for micronuclear actin gene of Uroleptopsis citrina; P-mac, U-mac: macronuclear actin gene of Pseudokeronopsis rubra and Uroleptopsis citrina, respectively. sequences have been deposited in the GenBank database In U. citrina, two patterns (U-mic-a, U-mic-b) of the MIC- under the accession numbers: KJ439783 (P-mic-a), actin gene have been determined by generating three and KJ439784 (P-mic-b), and KJ439785 (P-mic-c), respectively. two overlapping PCR products, respectively. The full P-mic-a consists of nine IESs and 10 MDSs in an orthodox lengths of these two patterns were ampliﬁed using prim- order (Fig. 1). Direct repeats (pointers) ranged from 2 to ers designed on both ends of the gene (31 and 35, Fig. 1). 7 bp at the junctions of an IES and its adjacent MDSs, Multiple clones (3–4) of each segment were sequenced to leaving one copy in the MAC chromosome (Fig. 1). The obtain consensus sequences, which have been deposited start codon (ATG) is present in MDS3 and the stop codon into GenBank under the accession numbers: KJ439786 (U- (TGA) appears in MDS9 (Fig. 1). Two of the nine IESs mic-a) and KJ439787 (U-mic-b). Both U-mic-a and U-mic-b (IES2-3 and IES7-8) are small in size and have a low AT con- are nonscrambled, consisting of six IESs and seven tent. The other seven IESs are AT-rich (52.80–75.13%) MDSs, with start codon (ATG) in MDS2 and stop codon (Table 2), which is consistent with earlier reported IESs in (TGA) in MDS6 (Fig. 1). The MDSs in the 50-UTRs and 30- other hypotrichous ciliates. The structure of P-mic-b is UTRs of the MAC-actin gene are 96.3–97.5% and 98.0– similar to that of P-mic-a (Fig. 1). IES1-2 is identical in P- 99.3% similar between U-mic-a and U-mic-b, respectively, mic-a and P-mic-b, while the lengths and sequences of while the MDSs in CDS are 96.6–98.2% similar (Table 4). the other four IESs vary between these two patterns. For All IESs of U-mic-a and U-mic-b are AT-rich (ranging from instance, IES3-4 of P-mic-a and P-mic-b is 121 and 202 bp 69.06% to 79.35%, Table 3), and divergent in both long, respectively (Table 2). We also obtained a third pat- lengths and sequences between these two patterns tern of the MIC-actin gene (P-mic-c), which might be gen- (Table 3). Pointers are 5–11 bp in U-mic-a and U-mic-b, erated by a recombination event that happened between and slight sequence variations are found among corre- P-mic-a and P-mic-b in the region of MDS3 (Fig. 1). How- sponding pairs of repeats (Table 3). Using U. citrina as a ever, we cannot exclude the possibility that P-mic-c is an reference, positions of corresponding MDS–IES junctions artifact of PCR-mediated recombination. By comparison, in P. rubra and U. grandis shift no more than four and six the 50-UTR of the MAC-actin gene (MDS1, MDS2, and 5 sites, respectively (Fig. 2). nt at the beginning of MDS3) is 97.7–98.9% similar between P-mic-a and P-mic-b. The sequence similarity of Phylogenetic analyses and evolution of MIC-actin CDS (MDS4, MDS5, and main part of MDS3) is 98.7– gene within Hypotrichia ciliates 99.7%. However, the average IES sequence similarity between P-mic-a and P-mic-b is much lower, only 82.5% In the ML tree based on the MAC-actin CDS nucleotide (Table 4). sequences (Fig. 3, left), hypotrichous species are divided

© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists 190 Journal of Eukaryotic Microbiology 2015, 62, 188–195 Chen et al. Evolution of the Micronuclear Actin Gene

Table 1. Primer sequences used in this study CDS, but the positions of Tetmemena, Uroleptus, and Uro- styla are different in two trees. Primer name Primer sequence 50?30 By mapping the MAC-actin structures on the phyloge- AP12 GTAATACGACTCACTATAGGGCACGCGTGGTCG netic tree, we found that all MIC-actin genes in the orders ACGGCCCGGGCTGGTCCCCAAAACCCCAAAA Urostylida and Stichotrichida are nonscrambled, while CCCCAAAA those in the order Sporadotrichida are scrambled. Genes AP1 GTAATACGACTCACTATAGGGC in the order Stichotrichida have the least number of IESs, AP2 ACTATAGGGCACGCGTGGT while those in the order Sporadotrichida possess the high- Siteﬁnder GACACGCTACTCCAACACACCACCTCGCACA est number of IESs. Although the gain/loss of IESs occurs GCGTCCTCAACCTGCAGGBHGCTC frequently even within the same order, the positions of SFP1 GACACGCTACTCCAACACACCA MDS–IES junctions are conserved especially in the CDS. SFP2 CTCCAACACACCACCTCGCACA The CDS within the order Urostylida contains six MDS– SFP3 CACCTCGCACAGCGTCCTCAA IES junction positions (U1–U6). The junction positions U1– 11 ATCCACATKSHGGCGAAGGT U4 are conserved in Pseudokeronopsis and Uroleptopsis. 12 ACCTTCGCCDSMATGTGGAT The CDS within the family Oxytrichidae (order Sporado- 13 AACTGGGAYGAYATGGARAAGAT trichida) has 11 MDS–IES junction positions (S1–S11). The 21 CCCGAGACGCAAGTTATTATTCC junction positions S1–S5 are conserved in at least two 22 GTCCCTGTCCCTACCCTCCCAAT species. The MAC-actin structures of all three populations 23 ATATGTCTTACAACCATCCACCTTC of Oxytricha trifallax are identical, while distinct orthologs 25 AGGGCGTCGTTCCCGGAAAAAGATAC 31 CCCCGATAGACGCTTGTTACTATTC are detected for two populations of Stylonychia lemnae. 32 AGAGAGGTGTGCTAAAGATTGA 33 GCAACTCCCTTGAGAAGAAGTATGA DISCUSSION 34 TATGAACTCCCAGACGGAAAGGT 35 CATGGTGCCAAAAGATACGAGTTTG Evolutionary scheme of germline patterns 36 GACCTTTCCGTCTGGGAGTTCA 37 GCAACTAACTTATAGATAACCTG The micronuclear actin gene is scrambled in all species of the order Sporadotrichida but not in the orders Urostylida and Stichotrichida (Fig. 3). The position of the MDS–IES into four clades. The fully supported clade of Uroleptopsis junction in MIC-actin CDS is conserved within an order and Pseudokeronopsis occupies the basal position, fol- (Fig. 3). This indicates that while MIC-actin patterns are lowed by Urostyla. Engelmanniella, a member of the order conserved within a given order/family. However, they Stichotrichida, forms a separate branch, followed by Uro- evolve independently among different orders/families. In leptus, which is sister to the oxytrichids, however, this addition, the scrambling pattern of the MIC-actin gene and relationship is not strongly supported (62%). The oxytri- the MDS–IES junction positions of Uroleptus pisces,a chid clade is fully supported, although the monophyly of genus with ambiguous taxonomic assignment but closely the genus Oxytricha is not validated. The topology of the related to the family Oxytrichidae (Berger 2006; Foissner SSU rDNA tree is mostly similar to that of the MAC-actin et al. 2004), is distinctively different to that of these oxytri-

Table 2. MIC-actin gene characteristics of MDSs, IESs, and pointer sequences of Pseudokeronopsis rubra

Length of Pointer sequence between Length of IESs between IESs AT IES Identity between MDS n MDS n MDS n and (n + 1) MDS n and (n + 1) content (%) type a and type b (%)

1 62 TA 68.85 100 2 41 ATTGT a: 17 a: 35.29 66.6 b: 20 b: 40.00 3 a: 164 a: GAGTACA a: 121 a: 71.07 50 b: 163 b: GAGTAC b: 202 b: 72.28 4 a: 249 ATC a: 335 a: 70.15 96.6 b: 250 b: 336 b: 70.83 5 222 CAGG a: 125 a: 52.80 89.3 b: 123 b: 55.28 6 97 GARCTGC 189 75.13 7 132 GCG 14 14.29 8 138 ATTGYCT 279 74.91 9 160 TGAAT 128 68.75 10 164

Length of MDS and IES includes one copy of pointer sequences. Nucleotide differences between types are listed separately. a: P-mic-a; b: P-mic- b. P-mic-c is a recombinant and not shown.

© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195 191 Evolution of the Micronuclear Actin Gene Chen et al.

Table 3. MIC-actin gene characteristics of MDSs, IESs, and pointer sequences of U. citrina

Length Pointer sequence between Length of IESs between IESs AT IES identity between MDS n of MDS n MDS n and (n + 1) MDS n and (n + 1) content (%) type a and type b (%)

1 99 a: YTGTTT 104 a: 72.12 53.5 b: TTGTTT b: 71.15 2 a: 165 a: GATGAGTACAT a: 411 a: 75.91 65 b: 166 b: GAGTACATT b: 423 b: 78.01 3 a: 249 a: AYCCA a: 139 a: 69.06 36.4 b: 248 b: ATCCA b: 197 b: 72.59 4 313 GTATGAA a: 276 a: 79.35 60.6 b: 218 b: 77.52 5 138 GCGAT a: 178 a: 70.22 64.7 b: 171 b: 69.59 6 298 a: GAATT a: 138 a: 77.54 64.8 b: GRATT b: 147 b: 76.19 7 153

Length of MDS and IES includes one copy of pointer sequences. Nucleotide differences between types are listed separately. a: U-mic-a; b: U- mic-b.

Figure 2 Comparison of the locations of MIC-actin MDS, pointer, and IES in three hypotrichous species. IES sequences and most MDS sequences are not shown due to limited space, and lengths of each IES and MDS are listed in Tables 2 and 3. MDS, pointer, and IES are in red, green, and blue colors, respectively. Conserved pointer sequences between two species are underlined. P-mic-a: type a for micronuclear actin gene of Pseudokeronopsis rubra; U-mic-a: type a for micronuclear actin gene of Uroleptopsis citrina; U. grand: Urostyla grandis. chids (Dalby and Prescott 2004) (Fig. 3). Our results do hypotrichous germline may have evolved independently in not support the previous conclusion that the scrambling different orders/families. Because only two/three urostylid pattern of MIC-actin is conserved within the subclass Hyp- and one/none stichotrich MIC genes have been examined otrichia (Hogan et al. 2001). Moreover, in the subclass (Fig. 3, Chang et al. 2005; Wong and Landweber 2006), Hypotrichia, all reported scrambled micronuclear TEBP-a the evolutionary patterns suggested here should be veri- (Mitcham et al. 1992; Prescott et al. 1998; Wong and ﬁed by examining the MIC genes of more species in Landweber 2006) and DNA pol-a genes (Chang et al. these groups. More MIC gene patterns of orders Urostyl- 2004, 2005; Hoffman and Prescott 1996, 1997; Landwe- ida and Stichotrichia are suggested to be investigated in ber et al. 2000) are in the order Sporadotrichida, while future studies. those two genes in Urostylida are nonscrambled. Further- The numbers and positions of IESs of actin gene varied more, for the micronuclear TEBP-a (Chang et al. 2005; even within a given order/family (Fig. 3), indicating that Wong and Landweber 2006) and DNA pol-a (Chang et al. IESs are unstable elements that are inserted and removed 2005) genes, only few MDS–IES junctions at conserved continually (DuBois and Prescott 1997). The total numbers locations are detected in both nonscrambled (order Uro- of MDSs are 3–10 and 7–16 in the order Urostylida (non- stylida) and scrambled (order Sporadotrichida) species. scrambled) and Sporadotrichida (scrambled), respectively Therefore, we propose that all micronuclear genes of the (Fig. 3). It is clear that extensive fragmentation of the

© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists 192 Journal of Eukaryotic Microbiology 2015, 62, 188–195 Chen et al. Evolution of the Micronuclear Actin Gene

Figure 3 MAC actin ML tree constructed using all three nucleotide positions in the CDS (left), and corresponding SSU rDNA tree (right). Sche- matic illustration of the MIC-actin structures and pointer distribution of all 14 hypotrichs is shown. Species classiﬁcation follows modiﬁed systems of Lynn (2008) and Adl et al. (2012). MDSs are numbered, and the scrambled and inverted ones are underlined and in red, respectively. Positions of start and stop codons are marked by black dots. Conserved locations of the MDS–IES junctions are in pink rectangles (U1–U4), and U5–U6 are nonconserved locations in Urostylida. S1–S5 indicates the conserved locations of the MDS–IES junctions in Sporadotrichida, and S6–S10 are nonconserved locations.

MIC-actin gene does not imply for scrambling. This is con- ing that the order Sporadotrichida (scrambled) undergoes sistent with previous report that the micronuclear DNA more frequent IESs insertion and deletion events. Consid- pol-a gene of some earlier diverging hypotrichous species ering that the order Urostylida (nonscrambled) occupies a is not scrambled, but either highly or moderately frag- basal position in the Hypotrichia, it might mean that fre- mented (Chang et al. 2005). By contrast, Hogan et al. quent IESs insertion and deletion is a recent event, and it (2001) proposed that continuous addition of IESs produces produces scrambled MIC-actin genes. MIC-actin genes with scrambled MDSs, and Wong and Landweber (2006) arrived at the same conclusion for the Epigenetic effects on genome evolution micronuclear TEBP-a gene. As two more species with nonscrambled MIC-actin genes (P. rubra and U. citrina) are Previous studies have found that UTRs of actin genes observed in this study, the viewpoint that the addition of have a much higher rate of nucleotide substitution when IESs produces MIC-actin genes with scrambled MDSs compared to that of CDSs, both at the interspecies and in- seems to be an artifact of the low sampling of nonscram- terpopulation levels (Croft et al. 2003; Dalby and Prescott bled taxa. 2004; Katz and Kovner 2010; Mollenbeck€ et al. 2006). This As revealed in previous investigation (Wong and Land- is because that nucleotide diversity is much higher in CDS weber 2006), IESs can vastly differ in their sizes and than UTRs due to gene selection pressure. By contrast, sequences across species in both scrambled and non- MDS sequence differences in CDS and UTR are similar scrambled species (Tables 2, 3). It is difﬁcult to infer evo- among different actin gene copies within populations of P. lutionary patterns using IESs sequences. However, rubra or U. citrina (Table 4), or within the same individual positions of MDS–IES junctions are conserved and could of Sterkiella nova or O. trifallax (DuBois and Prescott provide some evolutionary information (Fig. 3). We found 1997), although both IES sequences and length positions of MDS–IES junctions between nonscrambled divergences are detected between different copies of urostylid species are more tightly conserved than those germline genes (Tables 3, 4; Dalby and Prescott 2004). among scrambled sporadotrichid species (Fig. 3), indicat- We hypothesize that the proposed macronuclear

© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195 193 Evolution of the Micronuclear Actin Gene Chen et al.

Table 4. Sequence similarity (%) of different MDS and IES regions in Heiss, A., Hoppenrath, M., Lara, E., Gall, L., Lynn, D. H., Mcm- MIC-actin gene anus, H., Mitchell, E., Mozley-Stanridge, S. E., Parfrey, L., Paw- loski, J., Rueckert, S., Shadwick, L., Schoch, C. L., Smirnov, A. MIC-actin gene IES & Spiegel, F. 2012. The revised classification of eukaryotes. J. 0 0 correspond to 5 UTR CDS 3 UTR (average) Eukaryot. Microbiol., 59:429–493. Baird, S. E. & Klobutcher, L. A. 1991. Differential DNA amplifica- Pseudokeronopsis 97.7–98.9 98.7–99.7 – 82.5 tion and copy number control in the hypotrichous ciliate Eupl- rubra otes crassus. J. Protozool., 38:136–140. – – – Uroleptopsis citrina 96.3 97.5 96.6 98.2 98.0 99.3 61.2 Berger, H. 2006. Monograph of the Urostyloidea (Ciliophora, Hypotricha). Monogr. Biol., 85:1–1303. RNA-mediated mechanism in O. trifallax (Nowacki et al. Cavalcanti, A. R. O., Clarke, T. H. & Landweber, L. F. 2005. 2008) could explain why CDS and UTR are similar among MDS_IES_DB: a database of macronuclear and micronuclear – different actin gene copies within populations or individu- genes in spirotrichous ciliates. Nucleic Acids Res., 33:D396 als. Conjugation between individuals of a given population D398. Chang, W. J., Stover, N. A., Addis, V. M. & Landweber, L. F. could result in the two genomes communicating through 2004. A micronuclear locus containing three protein-coding RNA templates (Nowacki et al. 2008). Micronuclear genes remains linked during macronuclear development in the sequence variation in both UTR and CDS would affect spirotrichous ciliate Holosticha. Protist, 155:245–255. their matching with RNA templates from the old macronu- Chang, W. J., Bryson, P. D., Liang, H., Shin, M. K. & Landweber, cleus during sexual conjugation, restricting the variation L. F. 2005. The evolutionary origin of a complex scrambled rate at a similarly low level. Therefore, the sequence diver- gene. Proc. Natl Acad. Sci. U. S. A., 102:15149–15154. gence of the UTR is not much higher than that of the Croft, K. E., Dalby, A. B., Hogan, D. J., Orr, K. E., Hewitt, E. A., CDS within a population/individual. On the other hand, bar- Africa, R. J., DuBois, M. L. & Prescott, D. M. 2003. Macronu- riers of genetic exchange between different populations clear molecules encoding actins in spirotrichs. J. Mol. Evol., – (geographic or reproductive isolation) result in a faster evo- 56:341 350. Dalby, A. B. & Prescott, D. M. 2004. The scrambled actin I gene lutionary rate in the noncoding MDS regions, but lower in Uroleptus pisces. Chromosoma, 112:247–254. sequence variations in CDS at interspecific and interpopu- DuBois, M. L. & Prescott, D. M. 1997. Volatility of internal elimi- lation levels due to different selective pressures. nated segments in germ line genes of hypotrichous ciliates. Mol. Cell. Biol., 17:326–337. Foissner, W., Moon-van der Staay, S., van der Staay, G., CONCLUSION Hackstein, J., Krautgartner, W. & Berger, H. 2004. Reconciling In summary, we can draw the following conclusions: (1) classical and molecular phylogenies in the stichotrichines the gain or loss of IES is frequent in the subclass Hypotri- (Ciliophora, Spirotrichea), including new sequences from some – chia (formerly Stichotrichia), and extensive fragmentation rare species. Eur. J. Protistol., 4:265 281. of MIC genes does not always accompany gene scram- Greslin, A. F., Prescott, D. M., Oka, Y., Loukin, S. H. & Chappell, J. C. 1989. Reordering of nine exons is necessary to form a bling; (2) although the MIC-actin gene is scrambled in spe- functional actin gene in Oxytricha nova. Proc. Natl Acad. Sci. cies of the order Sporadotrichida, it is nonscrambled in USA, 86:6264–6268. Urostylida and Stichotrichida, which suggests that the Hoffman, D. C. & Prescott, D. M. 1996. The germline gene encod- MIC-actin gene patterns of hypotrichs may be the result ing DNA polymerase a in the hypotrichous ciliate Oxytricha nova of an independent evolutionary event in different orders; is extremely scrambled. Nucleic Acids Res., 24:3337–3340. (3) the positions of MDS–IES junctions are largely con- Hoffman, D. C. & Prescott, D. M. 1997. Phylogenetic relation- served within orders/families. ships among hypotrichous ciliates determined with the macronuclear gene encoding the large, catalytic subunit of DNA polymerase alpha. J. Mol. Evol., 45:301–310. ACKNOWLEDGMENTS Hogan, D. J., Hewitt, E. A., Orr, K. E., Prescott, D. M. & Muller, K. M. 2001. Evolution of IESs and scrambling in the actin I This work was supported by the Natural Science Founda- gene in hypotrichous ciliates. Proc. Natl Acad. Sci. USA, tion of China (project no. 31030059, 41006098, 31222050, 98:15101–15106. 31172041). Many thanks are due to Dr. Laura Katz, Smith Huang, J., Chen, Z., Song, W. & Berger, H. 2014. Three-gene College, for her protocol on micronuclear DNA extraction, based phylogeny of the Urostyloidea (Protista, Ciliophora, Hypo- and Dr. Rebecca A. Zufall, University of Houston, for her tricha), with notes on classification of some core taxa. Mol. constructive suggestions on the Manuscript. And we also Phylogenet. Evol., 70:337–347. thank Dr. Michaela Struder-Kypke,€ University of Guelph, Huang, J., Yi, Z., Al-Farraj, S. A. & Song, W. 2010. Phylogenetic Canada, and Dr. Eleni Gentekaki, Dalhousie University, positions and taxonomic assignments of the systematically con- Canada, who improved the English; and two anonymous troversial genera, Spirotrachelostyla, Uroleptopsis and Tunico- reviewers and the editor, who give us a lot of constructive thrix (Protozoa, Ciliophora, Stichotrichia) based on small subunit rRNA gene sequences. Syst. Biodiv., 8:409–416. suggestions. Jahn, C. L. & Klobutcher, L. A. 2002. Genome remodeling in ciliated protozoa. Annu. Rev. Microbiol., 56:489–520. LITERATURE CITED Katz, L. A. & Kovner, A. M. 2010. Alternative processing of scrambled genes generates protein diversity in the ciliate Chil- Adl, S. M., Simpson, A. R., Lane, C. E., Lukes, J., Bass, D., odonella uncinata. J. Zool. Exp., 314:480–488. Bowser, S., Brown, M. W., Burki, F., Dunthorn, M., Hampl, V.,

© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists 194 Journal of Eukaryotic Microbiology 2015, 62, 188–195 Chen et al. Evolution of the Micronuclear Actin Gene

Katz, L. A., Lasek-Nesselquist, E. & Snoeyenbos-West, O. L. Tan, G., Gao, Y., Shi, M., Zhang, X., He, S., Chen, Z. & An, C. 2003. Structure of the micronuclear alpha-tubulin gene in the 2005. SiteFinding-PCR: a simple and efficient PCR method for phyllopharyngean ciliate Chilodonella uncinata: implications for chromosome walking. Nucleic Acids Res., 33:e122. the evolution of chromosomal processing. Gene, 315:15–19. Wong, L. C. & Landweber, L. F. 2006. Evolution of programmed Landweber, L. F., Kuo, T.-C. & Curtis, E. A. 2000. Evolution and DNA rearrangements in a scrambled gene. Mol. Biol. Evol., assembly of an extremely scrambled gene. Proc. Natl Acad. 23:756–763. Sci. USA, 97:3298–3303. Yi, Z., Chen, Z., Warren, A., Roberts, D., Al-Rasheid, K., Miao, M., Lynn, D. H. 2008. The Ciliated Protozoa: Characterization, Classifi- Gao, S., Shao, C. & Song, W. 2008. Molecular phylogeny of cation, and Guide to the Literature, 3rd edn. Springer, Dordrecht. Pseudokeronopsis (Protozoa, Ciliophora, Urostylida), with recon- Mitcham, J. L., Lynn, A. J. & Prescott, D. M. 1992. Analysis of a sideration of three closely related species at inter- and intra- scrambled gene: the gene encoding alpha-telomere-binding pro- specific levels inferred from the small subunit ribosomal RNA tein in Oxytricha nova. Genes Dev., 6:788–800. gene and the ITS1-5.8S-ITS2 region sequences. J. Zool., Mollenbeck,€ M., Cavalcanti, A. R. O., Jonsson,€ F., Lipps, H. J. & 275:268–275. Landweber, L. F. 2006. Interconversion of germline-limited and Yi, Z. & Song, W. 2011. Evolution of the order Urostylida (Proto- somatic DNA in a scrambled gene. J. Mol. Evol., 63:69–73. zoa, Ciliophora): new hypotheses based on multi-gene informa- Nowacki, M., Vijayan, V., Zhou, Y., Schotanus, K., Doak, T. G. & tion and identification of localized incongruence. PLoS ONE,6: Landweber, L. F. 2008. RNA-mediated epigenetic programming e17471. of a genome-rearrangement pathway. Nature, 451:153–158. Prescott, D. M. 1994. The DNA of ciliated protozoa. Microbiol. Rev., 58:233–267. SUPPORTING INFORMATION Prescott, J. D., DuBois, M. L. & Prescott, D. M. 1998. Evolution Additional Supporting Information may be found in the of the scrambled germline gene encoding alpha-telomere bind- online version of this article: ing protein in three hypotrichous ciliates. Chromosoma, 107:293–303. Table S1. GenBank accession numbers of phylogenetic Stamatakis, A., Hoover, P. & Rougemont, J. 2008. A rapid boot- trees. Newly published sequences in the present paper strap algorithm for the RAxML web servers. Syst. Biol., are in bold. 57:758–771.