DOCSLIB.ORG

FQA 8 − Using 9Front

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
FQA 8 − Using 9Front FQA 8 − Using 9front 9DAn =FFlEA@ ?onIEIJAnJlO, IEmFlA ?onLAnJEonI ?=n ?om>EnA Jo FHoLE@A FoMAHBKl HAIKlJI. 1n 2l=n ', conventions =HA FHABAHHA@ Jo rules. 6DEI IA?JEon ANFloHAI JDA 2l=n ' =FFHo=?D Jo=?JK=llOKIEnCJDA?omFKJAH. ­ ­ 8.1 − rc rc was a startup script from very early times in Unix, shortened, as Ken was wont to do, from runcom, the nearest thing CTSS had to a shellߞit could run up to six prespecified commands in background. The name runcom came to be applied to the scripts as well as to their interpreter. ߞ ,oKCM?1lHoO 6DA rc IDAll M=I MHEJJAn >O 6om ,KBB BoH 4AIA=H?D 7N1: L. 1J M=I l=JAH =@oFJA@ =I JDA IDAll BoH 2l=n '. 5omA oB EJI ?onLAnJEonI =HA KnKIK=l ?omF=HA@ MEJD oJDAH ?omm=n@ EnJAHFHAJAHI EnBlKAn?A@ >O JDA *oKHnA IDAll. )lJDoKCD EJI IOnJ=N m=O IAAm IJH=nCA =J BEHIJ, D=LA F=JEAn?A; rc M=I @AIECnA@ JDEI M=O on FKHFoIA. On?A EJI BAM, >KJ FoMAHBKl BA=JKHAI=HAEnJAHn=lEzA@, rc IEmFlOCAJIoKJoBJDAM=O. 4A=@: Rc − The Plan 9 Shell, rc(1) 8.1.1 − Prompts +HA=JEnC =n rc BKn?JEon MEJD JDA I=mA n=mA =I OoKH FHomFJ =lloMI OoK Jo A=IElO @oK>lA-?lE?k Jo IAlA?J =J JDA An@ oB = FHALEoKIlO JOFA@ lEnA =n@ JDAn send EJ KIEnC JDA moKIA >KJJon mAnK IAA JDA @EI?KIIEon oB rio mAnKI, >AloM. 6DEI ?=n >A KIA@ Jo =FFHoNEm=JA = BoHm oB ?omm=n@ DEIJoHO IAA =lIo JDA ?omm=n@I =n@ , MDE?D FHEnJ =n@ANA?KJAJDAFHALEoKI?omm=n@,HAIFA?JELAlO. )@@IomAJDEnClEkAJDEIJoOoKH $home/profile: fn term%{ $* } 1n rc JDA ; ?D=H=?JAH BoH?AI JDA An@ oB = lEnA =n@ EI JHA=JA@ =I = nooF MDAn EJ =FFA=HI =lonA, Io EJ EI =lIo FoIIE>lA Jo ?HA=JA = IEmFlA FHomFJ JD=J MoKl@ HAGKEHA no IFA?E=l FHomFJ BKn?JEon En oH@AH BoH JDA FHomFJ Jo >A ABBA?JELAlO ECnoHA@ MDAn IAlA?JEnC =n@ IAn@EnC: prompt=´; ´ O>LEoKIlO,JDAFHomFJ?=n>An=mA@DoMALAHJDAKIAHIAAIBEJ. 8.1.2 − /env Note: +onJAnJI oB JDA /env @EHA?JoHO =HA FHoLE@A@ >O JDA kAHnAl =n@ HAFHAIAnJ = IAF=­ H=JA =??oKnJEnC oB JDA IDAllߣI AnLEHonmAnJ; rc HA=@I /env onlO on IJ=HJKF, =n@ BlKIDAI/MHEJAI /env onlO>ABoHAANA?KJEnCFHoCH=mI. ­!­ 8.2 − rio rio EI JDA 2l=n ' MEn@oM IOIJAm. MoHA =??KH=JAlO, rio mKlJEFlANAI EnFKJ @ALE?AI MEJD =n@ IAHLAI = BElA EnJAHB=?A Jo = IAHEAI oB HA?J=nClAI, EnIE@A JDA >oKn@=HEAI oB MDE?D =HA @H=Mn =n =H>EJH=HO =HH=nCAmAnJ oB FENAlI. +onJHollEnC JDA HA?J=nClAI EI moHA IJH=ECDJBoH­ M=H@, =n@ =J JDA I=mA JEmA moHA BlANE>lA, JD=n MD=J EI ?ommonlO ANFA?JA@ BHom moIJ MEn@oMm=n=CAHI. 4A=@: rio(1), rio(4) 6o ABBA?JELAlO KIA rio, OoK nAA@ = JDHAA >KJJon moKIA. 1B OoK onlO D=LA = JMo >KJJon moKIA OoK?=nAmKl=JAJDAmE@@lA>KJJon>ODol@EnC@oMnJDA shift kAOMDElIJFHAII­ EnCJDAHECDJ>KJJon. Note: *KJJon , , =n@ ! =HA KIA@ Jo HABAH Jo JDA lABJ, mE@@lA, =n@ HECDJ >KJJonI HAIFA?­ JELAlO. 8.2.1 − The Pop−up Menu 2HAIIEnC =n@ Dol@EnC @oMn moKIA >KJJon ! on JDA CH=O @AIkJoF oH on = IDAll MEn@oM MEllCELAOoK=mAnKMEJDJDABolloMEnCoFJEonI: New Resize Move Delete Hide 2HAIIEnC=n@Dol@EnC@oMnmoKIA>KJJon on=IDAllMEn@oMHAIKlJIEn=mAnK MEJD JDA ­"­ BolloMEnCoFJEonI: cut paste snarf plumb look send scroll 5AlA?J =n EJAm >O HAlA=IEnC JDA >KJJon oLAH JDA mAnK EJAm. 4Eo KIAI JDA I=mA >KJJon JD=J IJ=HJA@ =n =?JEon JDHoKCDoKJ JD=J oFAH=JEon. 1B OoK FHAII =noJDAH >KJJon @KHEnC JDA =?JEonJDAoFAH=JEonEI=>oHJA@=n@=nOEnJAHmA@E=JA?D=nCAI=HAHALAHIA@. -=?D mAnK =?JI =I = =?JEon LAH> IAlA?JoH MDE?D JDAn HAGKEHAI =n o>jA?J E.A. MEn@oM Jo >A FE?kA@ Jo En@E?=JA MDE?D MEn@oM JDA LAH> EI Jo =?J on. ) BKHJDAH moKIA =?JEon m=O JDAn>AHAGKEHA@. 8.2.2 − Window control +lE?kEnCon=MEn@oM>HEnCIEJJoJDABHonJ. ;oK ?=n @EHA?JlO ?D=nCA JDA ID=FA oB = MEn@oM >O ?lE?kEnC =n@ @H=CCEnC on JDA A@CA oH ?oHnAH oB JDA MEn@oM >oH@AH. MoKIA >KJJon oH MEll =lloM OoK Jo @H=C JDA A@CA oH ?oHnAHJo=nAMIEzA,=n@moKIA>KJJon!MEll=lloMOoKJomoLAJDAMEn@oM. 6DA moKIA >KJJon ! mAnK ?onJ=EnI = lEIJ oB =ll MEn@oMI JD=J =HA ?oHHAnJlO o>IJHK?JA@ >O [email protected]?JEnC=l=>AlJoFIJDAMEn@oM. 6DA FoF-KF mAnK HAmAm>AHI JDA l=IJ ?omm=n@ ?DoIAn, Io =I = IDoHJ?KJ OoK ?=n jKIJ FHAII =n@ HAlA=IA >KJJon ! MEJDoKJ moLEnC JDA moKIA >AJMAAn FHAIIEnC =n@ HAlA=IEnC JoIAlA?JJDAFHALEoKI?omm=n@=C=En. 1n =@@EJEon, rio IAHLAI = L=HEAJO oB BElAI BoH HA=@EnC, MHEJEnC, =n@ ?onJHollEnC MEn@oMI. 5omA oB JDAm =HA LEHJK=l LAHIEonI oB IOIJAm BElAI BoH @A=lEnC MEJD JDA @EIFl=O, kAO>o=H@, =n@moKIA; oJDAHI ?onJHol oFAH=JEonI oB JDA MEn@oM IOIJAm EJIAlB. 6DAIA BElAI, =I MAll =I JDA window(1) ?omm=n@, =lloM BoH ?onJHollEnC MEn@oMI FHoCH=mm=JE?=llO >O HA=@EnC =n@ MHEJEnC JANJ IJHEnCI. 6DKI IEmFlEBOEnC JDA =KJom=JA@ oFAnEnC =n@ Fl=?AmAnJ oB L=HE­ oKIMEn@oMIMEJDKIAHI?HEFJI. 4A=@: rio(4) 8.2.3 − Text in rio windows 6ANJ En = rio MEn@oM m=O >A BHAAlO m=nEFKl=JA@, A@EJA@, =lJAHA@, @AlAJA@ =n@/oH =?JA@ KFon KIEnC AEJDAH moKIA ?DoH@I oH JDA oFJEonI BHom JDA moKIA >KJJon mAnKI. .oH =n ­#­ AN=mFlA,IAAJDA@EI?KIIEonoBJDAKIAoB rc FHomFJI,=>oLA. 6DA IFA?E=l BElA /dev/text BoH JDA ?KHHAnJ MEn@oM, oH /mnt/wsys/n/text BoH MEn@oM n ?onJ=EnI =ll JANJ JD=J D=I =lHA=@O =FFA=HA@ En JDA MEn@oM. 6DA ?onJAnJI oB JDEI BElA m=O IAHLA =I = FHEmEJELA BoHm oB ?omm=n@ DEIJoHO =n@ m=O >A =?JA@ KFon KIEnCIJ=n@=H@?omm=n@lEnAJoolI,>KJ=HAloIJMDAnJDAMEn@oMEI?loIA@. 5AHEoKIlO,HA=@: rio(4) 8.2.4 − Scrolling *O @AB=KlJ, = rio MEn@oM MEll BEll KF MEJD JANJ =n@ JDAn >lo?k, o>LE=JEnC JDA nAA@ BoH = IAF=H=JAF=CAHFHoCH=mJDoKCDJDA p(1) F=CAHFHoCH=mIJEllIDEFIMEJDJDAIOIJAm. -n@lAIII?HollEnCm=O>AAn=>lA@>OIAlA?JEnC scroll BHomJDAmoKIA>KJJon mAnK. 6DA up oH down =HHoM kAOI =n@ pgup oH pgdwn kAOI m=O >A KIA@ Jo I?Holl KF oH @oMnEn?onIEIJAnJlOmA=IKHA@En?HAmAnJI. 0ol@EnC @oMn JDA shift kAO =n@ FHAIIEnC JDA KF oH @oMn =HHoM kAO MEll I?Holl = IEnClA lEnAEnJDAHAIFA?JELA@EHA?JEon. 'BHonJߣI rio IKFFoHJI moKIAMDAAl I?HollEnC. 6DA DAKHEIJE? AmFloOA@ EI HoKCDlO JDA I=mA =I JD=J oB ?lE?kEnC En JDA I?Holl>=H on JDA lABJ oB JDA MEn@oM: MDAn JDA moKIA FoEnJAH EI nA=H JDA JoF oB JDA MEn@oM JDA I?HollEnC En?HAmAnJ EI Im=ll, MDElA =I JDA moKIA FoEnJAH =FFHo=?DAI JDA >oJJom oB JDA MEn@oM JDA I?HollEnC En?HAmAnJ CHoMI FHo­ CHAIIELAlO l=HCAH. 2HAIAnJlO JDEI >AD=LEoH EI lEmEJA@ Jo rio, sam, =n@ mothra >KJ m=O l=JAH>AANJAn@A@JooJDAHFHoCH=mI. Note: 9DElA JDA >AD=LEoH oB JDA =HHoM =n@ F=CA kAOI EI B=EHlO ?onIEIJAnJ >AJMAAn FHo­ CH=mI,moKIAMDAAlI?HollEnCEInoJ.5oB=H, shift up oH down EIonlOIKFFoHJA@En rio MEn@oMI. 8.2.5 − Mouse Chording )lmoIJ =nOMDAHA ߞ sam(1), acme(1), window(1) ߞ OoK ?=n KIA JDA BolloMEnC moKIA?DoH@I: mb1 ߞ 5AlA?JJANJ. mb1 double click ߞ 5AlA?J MoH@ Kn@AH ?KHIoH, oH =J JDA An@/IJ=HJ oB = lEnA, IAlA?J JDAMDolAlEnA. )BJAHIAlA?JEnCMEJD mb1 =n@MDElAIJEllDol@EnC mb1 @oMnJDAIA?DoH@I=lIo MoHk MEJD JANJ IAlA?JA@ >O @oK>lA-?lE?kEnC, JDA @oK>lA-?lE?k ANF=nIEon D=FFAnI MDAn JDAIA?on@ ?lE?kIJ=HJI,noJMDAnEJAn@I: mb2 ߞ +KJJANJ. mb3 ߞ 2=IJAJANJ?=n>AHALAHJA@>O?lE?kEnC mb2 EmmA@E=JAlO=BJAHM=H@I. ­$­ 6oIn=HB?oFO,?lE?k mb2 EmmA@E=JAlOBolloMA@>O mb3. 8.2.6 − Keyboard Shortcuts )lmoIJ =nOMDAHA ߞ sam(1), acme(1), window(1) ߞ OoK ?=n KIA JDA BolloMEnC IDoHJ?KJI: Ctrl−u ߞ ,AlAJABHom?KHIoHJoIJ=HJoBlEnA. Ctrl−w ߞ ,AlAJAMoH@>ABoHAJDA?KHIoH. Ctrl−h ߞ ,AlAJA?D=H=?JAH>ABoHAJDA?KHIoH. Ctrl−a ߞ MoLA?KHIoHJoIJ=HJoBJDAlEnA. Ctrl−e ߞ MoLA?KHIoHJoAn@oBJDAlEnA. Ctrl−b ߞ MoLA?KHIoHJoJDAFoIEJEonEmmA@E=JAlO=BJAHJDAFHomFJ.rio onlO 4A=@:7N1:KAO>o=H@*En@EnCI 1n= rio(1) MEn@oM,I?HollKFoH@oMnonAlEnA>ODol@EnC shift =n@ FHAIIEnC JDA KF oH@oMn=HHoM. ­%­ 8.2.7 − Color scheme rio lookIlEkAJDEI: rioߣI ?oloH I?DAmA m=O >A mo@EBEA@ >O A@EJEnC JDA .? ?onBECKH=JEon BElAI =n@ HA- ?omFElEnC: Note: 5omAonAMEllmo?kOoKBoH@oEnCJDEI. 5AA:DJJF://Fl=n'.IJ=nlAOlEA>AH.?om/HEo,DJJFI://BJHL.IA/" ­&­ 4o>2EkA,HEoߣI=KJDoH,M=I=lllEkA: JDA ?lA=n =FFA=H=n?A oB JDA I?HAAn ?omAI moIJlO BHom l=zEnAII, >KJ JDA ?oloH I?DAmA EI o>LEoKIlO @AlE>AH=JA. JDA EnJAnJ M=I Jo >KEl@ on =n o>IAHL=JEon >O A@M=H@ JKBJA JD=J JDA DKm=n IOIJAm lEkAI n=JKHA =n@ n=JKHA EI BKll oB F=lA ?ol­ oHI, Io IomAJDEnC OoKߣHA CoEnC Jo look =J =ll @=O mECDJ >AIJ IAHLA EB EJ MAHA =lIo En HAl=NEnC ID=@AI. HAnAA BHAn?D DAlFA@ mA MEJD JDA IFA?EBE?I oB JDA ?oloH I?DAmA IDAߣI = FHoBAIIEon=l EllKIJH=JoH =n@ mO ?oloH LEIEon EI IKIFA?J, on?A Eߣ@ BECKHA@ oKJ DoM E M=nJA@ EJ Jo look.
Load more

Recommended publications
  • MOAT004 1 Eprint Cs.DC/0306067 Computing in High Energy and Nuclear Physics, 24-28 March 2003, La Jolla, California Resources
    Computing in High Energy and Nuclear Physics, 24-28 March 2003, La Jolla, California The AliEn system, status and perspectives P. Buncic Institut für Kernphysik, August-Euler-Str. 6, D-60486 Frankfurt, Germany and CERN, 1211, Geneva 23, Switzerland A. J. Peters, P.Saiz CERN, 1211, Geneva 23, Switzerland In preparation of the experiment at CERN's Large Hadron Collider (LHC), the ALICE collaboration has developed AliEn, a production environment that implements several components of the Grid paradigm needed to simulate, reconstruct and analyse data in a distributed way. Thanks to AliEn, the computing resources of a Virtual Organization can be seen and used as a single entity – any available node can execute jobs and access distributed datasets in a fully transparent way, wherever in the world a file or node might be. The system is built aroun d Open Source components, uses the Web Services model and standard network protocols to implement the computing platform that is currently being used to produce and analyse Monte Carlo data at over 30 sites on four continents. Several other HEP experiments as well as medical projects (EU MammoGRID, INFN GP -CALMA) have expressed their interest in AliEn or some components of it. As progress is made in the definition of Grid standards and interoperability, our aim is to interface AliEn to emerging products from both Europe and the US. In particular, it is our intention to make AliEn services compatible with the Open Grid Services Architecture (OGSA). The aim of this paper is to present the current AliEn architecture and outline its future developments in the light of emerging standards.
    [Show full text]
  • A Large-Scale Study of File-System Contents
    A Large-Scale Study of File-System Contents John R. Douceur and William J. Bolosky Microsoft Research Redmond, WA 98052 {johndo, bolosky}@microsoft.com ABSTRACT sizes are fairly consistent across file systems, but file lifetimes and file-name extensions vary with the job function of the user. We We collect and analyze a snapshot of data from 10,568 file also found that file-name extension is a good predictor of file size systems of 4801 Windows personal computers in a commercial but a poor predictor of file age or lifetime, that most large files are environment. The file systems contain 140 million files totaling composed of records sized in powers of two, and that file systems 10.5 TB of data. We develop analytical approximations for are only half full on average. distributions of file size, file age, file functional lifetime, directory File-system designers require usage data to test hypotheses [8, size, and directory depth, and we compare them to previously 10], to drive simulations [6, 15, 17, 29], to validate benchmarks derived distributions. We find that file and directory sizes are [33], and to stimulate insights that inspire new features [22]. File- fairly consistent across file systems, but file lifetimes vary widely system access requirements have been quantified by a number of and are significantly affected by the job function of the user. empirical studies of dynamic trace data [e.g. 1, 3, 7, 8, 10, 14, 23, Larger files tend to be composed of blocks sized in powers of two, 24, 26]. However, the details of applications’ and users’ storage which noticeably affects their size distribution.
    [Show full text]
  • Acme: a User Interface for Programmers Rob Pike [email protected]−Labs.Com
    Acme: A User Interface for Programmers Rob Pike [email protected]−labs.com ABSTRACT A hybrid of window system, shell, and editor, Acme gives text-oriented applications a clean, expressive, and consistent style of interaction. Tradi­ tional window systems support interactive client programs and offer libraries of pre-defined operations such as pop-up menus and buttons to promote a consistent user interface among the clients. Acme instead pro­ vides its clients with a fixed user interface and simple conventions to encourage its uniform use. Clients access the facilities of Acme through a file system interface; Acme is in part a file server that exports device-like files that may be manipulated to access and control the contents of its win­ dows. Written in a concurrent programming language, Acme is structured as a set of communicating processes that neatly subdivide the various aspects of its tasks: display management, input, file server, and so on. Acme attaches distinct functions to the three mouse buttons: the left selects text; the middle executes textual commands; and the right com­ bines context search and file opening functions to integrate the various applications and files in the system. Acme works well enough to have developed a community that uses it exclusively. Although Acme discourages the traditional style of interaction based on typescript windowsߞteletypesߞits users find Acmeߣs other ser­ vices render typescripts obsolete. History and motivation The usual typescript style of interaction with Unix and its relatives is an old one. The typescriptߞan intermingling of textual commands and their outputߞoriginates with the scrolls of paper on teletypes.
    [Show full text]
  • File System Design Approaches
    File System Design Approaches Dr. Brijender Kahanwal Department of Computer Science & Engineering Galaxy Global Group of Institutions Dinarpur, Ambala, Haryana, INDIA [email protected] Abstract—In this article, the file system development design The experience with file system development is limited approaches are discussed. The selection of the file system so the research served to identify the different techniques design approach is done according to the needs of the that can be used. The variety of file systems encountered developers what are the needed requirements and show what an active area of research file system specifications for the new design. It allowed us to identify development is. The file systems researched fell into one of where our proposal fitted in with relation to current and past file system development. Our experience with file system the following four categories: development is limited so the research served to identify the 1. The file system is developed in user space and runs as a different techniques that can be used. The variety of file user process. systems encountered show what an active area of research file 2. The file system is developed in the user space using system development is. The file systems may be from one of the FUSE (File system in USEr space) kernel module and two fundamental categories. In one category, the file system is runs as a user process. developed in user space and runs as a user process. Another 3. The file system is developed in the kernel and runs as a file system may be developed in the kernel space and runs as a privileged process.
    [Show full text]
  • Tiny Tools Gerard J
    Tiny Tools Gerard J. Holzmann Jet Propulsion Laboratory, California Institute of Technology Many programmers like the convenience of integrated development environments (IDEs) when developing code. The best examples are Microsoft’s Visual Studio for Windows and Eclipse for Unix-like systems, which have both been around for many years. You get all the features you need to build and debug software, and lots of other things that you will probably never realize are also there. You can use all these features without having to know very much about what goes on behind the screen. And there’s the rub. If you’re like me, you want to know precisely what goes on behind the screen, and you want to be able to control every bit of it. The IDEs can sometimes feel as if they are taking over every last corner of your computer, leaving you wondering how much bigger your machine would have to be to make things run a little more smoothly. So what follows is for those of us who don’t use IDEs. It’s for the bare metal programmers, who prefer to write code using their own screen editor, and who do everything else with command-line tools. There are no real conveniences that you need to give up to work this way, but what you gain is a better understanding your development environment, and the control to change, extend, or improve it whenever you find better ways to do things. Bare Metal Programming Many developers who write embedded software work in precisely this way.
    [Show full text]
  • Latency-Aware, Inline Data Deduplication for Primary Storage
    iDedup: Latency-aware, inline data deduplication for primary storage Kiran Srinivasan, Tim Bisson, Garth Goodson, Kaladhar Voruganti NetApp, Inc. fskiran, tbisson, goodson, [email protected] Abstract systems exist that deduplicate inline with client requests for latency sensitive primary workloads. All prior dedu- Deduplication technologies are increasingly being de- plication work focuses on either: i) throughput sensitive ployed to reduce cost and increase space-efficiency in archival and backup systems [8, 9, 15, 21, 26, 39, 41]; corporate data centers. However, prior research has not or ii) latency sensitive primary systems that deduplicate applied deduplication techniques inline to the request data offline during idle time [1, 11, 16]; or iii) file sys- path for latency sensitive, primary workloads. This is tems with inline deduplication, but agnostic to perfor- primarily due to the extra latency these techniques intro- mance [3, 36]. This paper introduces two novel insights duce. Inherently, deduplicating data on disk causes frag- that enable latency-aware, inline, primary deduplication. mentation that increases seeks for subsequent sequential Many primary storage workloads (e.g., email, user di- reads of the same data, thus, increasing latency. In addi- rectories, databases) are currently unable to leverage the tion, deduplicating data requires extra disk IOs to access benefits of deduplication, due to the associated latency on-disk deduplication metadata. In this paper, we pro- costs. Since offline deduplication systems impact la-
    [Show full text]
  • Release 0.5.0 Will Mcgugan
    PyFilesystem Documentation Release 0.5.0 Will McGugan Aug 09, 2017 Contents 1 Guide 3 1.1 Introduction...............................................3 1.2 Getting Started..............................................4 1.3 Concepts.................................................5 1.4 Opening Filesystems...........................................7 1.5 Filesystem Interface...........................................7 1.6 Filesystems................................................9 1.7 3rd-Party Filesystems.......................................... 10 1.8 Exposing FS objects........................................... 10 1.9 Utility Modules.............................................. 11 1.10 Command Line Applications....................................... 11 1.11 A Guide For Filesystem Implementers.................................. 14 1.12 Release Notes.............................................. 16 2 Code Documentation 17 2.1 fs.appdirfs................................................ 17 2.2 fs.base.................................................. 18 2.3 fs.browsewin............................................... 30 2.4 fs.contrib................................................. 30 2.5 fs.errors.................................................. 32 2.6 fs.expose................................................. 34 2.7 fs.filelike................................................. 40 2.8 fs.ftpfs.................................................. 42 2.9 fs.httpfs.................................................. 43 2.10 fs.memoryfs..............................................
    [Show full text]
  • On the Performance Variation in Modern Storage Stacks
    On the Performance Variation in Modern Storage Stacks Zhen Cao1, Vasily Tarasov2, Hari Prasath Raman1, Dean Hildebrand2, and Erez Zadok1 1Stony Brook University and 2IBM Research—Almaden Appears in the proceedings of the 15th USENIX Conference on File and Storage Technologies (FAST’17) Abstract tions on different machines have to compete for heavily shared resources, such as network switches [9]. Ensuring stable performance for storage stacks is im- In this paper we focus on characterizing and analyz- portant, especially with the growth in popularity of ing performance variations arising from benchmarking hosted services where customers expect QoS guaran- a typical modern storage stack that consists of a file tees. The same requirement arises from benchmarking system, a block layer, and storage hardware. Storage settings as well. One would expect that repeated, care- stacks have been proven to be a critical contributor to fully controlled experiments might yield nearly identi- performance variation [18, 33, 40]. Furthermore, among cal performance results—but we found otherwise. We all system components, the storage stack is the corner- therefore undertook a study to characterize the amount stone of data-intensive applications, which become in- of variability in benchmarking modern storage stacks. In creasingly more important in the big data era [8, 21]. this paper we report on the techniques used and the re- Although our main focus here is reporting and analyz- sults of this study. We conducted many experiments us- ing the variations in benchmarking processes, we believe ing several popular workloads, file systems, and storage that our observations pave the way for understanding sta- devices—and varied many parameters across the entire bility issues in production systems.
    [Show full text]
  • Filesystems HOWTO Filesystems HOWTO Table of Contents Filesystems HOWTO
    Filesystems HOWTO Filesystems HOWTO Table of Contents Filesystems HOWTO..........................................................................................................................................1 Martin Hinner < [email protected]>, http://martin.hinner.info............................................................1 1. Introduction..........................................................................................................................................1 2. Volumes...............................................................................................................................................1 3. DOS FAT 12/16/32, VFAT.................................................................................................................2 4. High Performance FileSystem (HPFS)................................................................................................2 5. New Technology FileSystem (NTFS).................................................................................................2 6. Extended filesystems (Ext, Ext2, Ext3)...............................................................................................2 7. Macintosh Hierarchical Filesystem − HFS..........................................................................................3 8. ISO 9660 − CD−ROM filesystem.......................................................................................................3 9. Other filesystems.................................................................................................................................3
    [Show full text]
  • Knowledge Management Enviroments for High Throughput Biology
    Knowledge Management Enviroments for High Throughput Biology Abhey Shah A Thesis submitted for the degree of MPhil Biology Department University of York September 2007 Abstract With the growing complexity and scale of data sets in computational biology and chemoin- formatics, there is a need for novel knowledge processing tools and platforms. This thesis describes a newly developed knowledge processing platform that is different in its emphasis on architecture, flexibility, builtin facilities for datamining and easy cross platform usage. There exist thousands of bioinformatics and chemoinformatics databases, that are stored in many different forms with different access methods, this is a reflection of the range of data structures that make up complex biological and chemical data. Starting from a theoretical ba- sis, FCA (Formal Concept Analysis) an applied branch of lattice theory, is used in this thesis to develop a file system that automatically structures itself by it’s contents. The procedure of extracting concepts from data sets is examined. The system also finds appropriate labels for the discovered concepts by extracting data from ontological databases. A novel method for scaling non-binary data for use with the system is developed. Finally the future of integrative systems biology is discussed in the context of efficiently closed causal systems. Contents 1 Motivations and goals of the thesis 11 1.1 Conceptual frameworks . 11 1.2 Biological foundations . 12 1.2.1 Gene expression data . 13 1.2.2 Ontology . 14 1.3 Knowledge based computational environments . 15 1.3.1 Interfaces . 16 1.3.2 Databases and the character of biological data .
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • Computerized Patient Record System (CPRS) Setup Guide
    Computerized Patient Record System (CPRS) Setup Guide June 2021 Department of Veterans Affairs Health Data Systems Computerized Patient Record System Product Line Revision History Project Technical Date Patch Page Change Manager Writer 6/17/2021 OR*3*0*547 30 Added row to GUI Parameters SHRPE SHRPE Menu Options for OTH: GUI Add/Edit Local Message for OTH Button. Added Subsection for GUI 37-38 Add/Edit Local Message for OTH Button 10/16/2019 OR*3.0*397 All Added Revision dated REDACTED REDACTED 3/25/2019 (see below). Checked for 508 Compliance. Removed extra space between some pages. Removed extra Table of Contents from Pharmacy Packages section (G). 07/31/2019 OR*3.0*510 88 Added two NOTE: REDACTED REDACTED 3/25/2019 OR*3.0*397 21 Added ORSUPPLY Key REDACTED REDACTED 08/20/2018 XU*8.0*679 28 Added note regarding Electronic REDACTED REDACTED Signature Block restrictions. 03/30/2011 OR*3.0*272 5, 77, Changed references from REDACTED REDACTED 79, Duplicate Drug Class to 81, Duplicate Drug Therapy. 82, 93, 01/25/2007 OR*3.0*245 123 – Added information about the REDACTED REDACTED 125 new option, ORCM QUICK ORDERS BY USER 11/27/06 OR*3.0*242 182 Added information about the REDACTED REDACTED new way to edit items for the Nature of Order file. 12/30/04 36 Added new information about REDACTED REDACTED document templates. Computerized Patient Record System (CPRS) ii June 2021 Setup Guide Project Technical Date Patch Page Change Manager Writer 10/14/98 138 Added information about ORMTIME 10/15/98 14 Added explanation of global journaling 10/20/98
    [Show full text]