Université Bordeaux Segalen
Année 2011 Thèse N° 1852
THESE
pour le
DOCTORAT DE L’UNIVERSITE BORDEAUX 2
Mention: Sciences, Technologie, Santé
Option: Microbiologie
Présentée et soutenue publiquement le :
20 décembre 2011
par
Jam Nazeer AHMAD
né le 1 août 1979 au Rahim Yar Khan
Etude de l'expression de gènes impliqués dans les voies de défense et les mécanismes épigénétiques chez la tomate infectée par le phytoplasme du stolbur
………………………………………………………………………………………………….. Membres du Jury
Mme ADRIAN, M. Professeur à l’Université de Bourgogne Rapporteur Mr MANCEAU, C. Ingénieur de Recherches à l’INRA d’Angers Rapporteur Mme MARZACHI, C. Chercheur à l’Instituto di Virologia Vegetale à Turin Examinateur Mme CORIO-COSTET, M.F. Directeur à l’INRA de Bordeaux Examinateur Mr HERNOULD, M. Professeur à l’Université de Bordeaux Examinateur Mme EVEILLARD, S. Chargé de Recherches à l’INRA de Bordeaux Directeur de thèse
2
University of Bordeaux Segalen
Year 2011 Thesis N° 1852
THESIS
for
DOCTORATE OF UNIVERSITY BORDEAUX 2
Mention: Sciences, Technology, Health
Speciality: Microbiology
Presented and defended publicly:
20 December 2011
by
Jam Nazeer AHMAD
Born on 1 august 1979 in Rahim Yar Khan
Study of the Expression of Genes involved in Defense pathways and Epigenetic Mechanisms in tomato infected with Stolbur Phytoplasma
………………………………………………………………………………………………….. Jury Members
Mrs ADRIAN, M. Professeur à l’Université de Bourgogne Reporter Mr MANCEAU, C. Ingénieur de Recherches à l’INRA d’Angers Reporter Mrs MARZACHI, C. Chercheur à l’Instituto di Virologia Vegetale à Turin Examinater Mrs CORIO-COSTET, M.F. Directeur à l’INRA de Bordeaux Examinater Mr HERNOULD, M. Professeur à l’Université de Bordeaux Examinater Mrs EVEILLARD, S. Chargé de Recherches à l’INRA de Bordeaux Thesis Director
3
4
ACKNOWLEDGEMENTS
This work has been done under the direction of Madame Sandrine EVEILLARD in the mix unit of Fruit Biology and Pathology of the National institute of Agronomique Research and University of Bordeaux, directed by Thierry Candresse. I gratefully acknowledge the support of many people without whom I would not have completed the program.
I would like to pay thank to Mr Alain Blanchard who placed me with complete generosity in his laboratory. He helped me much and gave me always his valuable suggestions and courage during PhD. I pay thanks to Mr Michel Hernould to give me honour for presiding the jury. I am also thankful to Mr Charles Manceau and Mrs Marielle Adrian for being reporter, Mrs Cristina Marzachi, Mrs Marie-France Corio-Costet and Mr Michel Hernould for accepting as examinerr for this thesis and Mrs Sandrine Eveillard for becoming part of jury.
I wish to extend my profound gratitude to my supervisor Sandrine EVEILLARD for providing me with the opportunity to complete my PhD under her supervision. I am highly grateful for her great tolerance, advice, help and daily presence throughout my PhD program. She helped me and kept me active throughout my PhD. I really appreciate her untiring efforts in reading my manuscript to attain a professional standard.
I pay special thanks to Christophe Garcion, who helped me with the experiments and for providing the materials needed for experiment specially infected tomato samples from greenhouse.
I shall remain grateful to Joël Renaudin for his training assistance and constructive criticism of my work to bring the best out of me. Being the incharge of equipe Mollicute, he helped me much and gave me courage and useful suggestion to perform well during my experimentation. I am highly thankful for giving me suggestion for manuscript writing.
I am highly grateful to Pascal Salar for his great help for Nested PCR and computer programming. I am highly grateful to Jean luc Danet for his precious discussions and valuable informations about Nested PCR. I shall remain grateful to Michel Hernould and Philippe Gallusci for their support and their work on methylation of my work to bring the best out of me. I express my gratitude to Philippe Gallusci and Michel hernould for their great kindness during my Master 2.
I am highly grateful to MrsColette Saillard for her advices and gentleness and help during PhD. I am also highly grateful to Mr. Xavier Foissac for his precious discussions and valuable informations about phytoplasma and his help during PhD.
5
I am highly thankful to Mrs Jacqueline for giving me always sterile materials and her valuable advices and suggestions during my PhD. I am highly grateful to Evelyne for her help of documentation and her gentleness. I am also grateful to Isabelle for giving me help for good commands for material during whole period of my PhD.
I am highly thankful to Mrs Sybille Duret for her help during cloning and for giving information about lab work. I am highly grateful to Loure for her valuable discussion and her sense of humour. Special thanks to Pascal Sirand-Pugnet, Sylvie and Marie Pierre, Nathalie, Patricia Carle, Delphine, Guillaume, Carole and Anne for their gentleness.
I extend my appreciation to all my past and present laboratory colleagues, especially Fabien Labroussaa, Marc Breton and Claire Charenton for their assistance during the course of my program. I am highly thankful to Kaëlig and Denis for helping me much in green house by working with tomato plants.
I am highly thankful to my beloved brother Jam Rafiq Ahmad who always shared his PhD knowledge with me and always gave me his support and courage for the completion of this PhD program. Special thanks for the good attitude and gentleness of trainee (Marc, Cyrelys and Marina) for their sympathy. I am also highly grateful to all of my Pakistani friends in France withwhom I passed always good time.
I am highly indebted and thankful to HEC (Higher Education Commission of Pakistan) for providing me Scholarship for financial backing throughout my PhD program. Special thanks are extended to Institute National de la Recherche Agronomique (INRA), France, for the financial support from my advisors in completing my program.
These words are not enough to describe my admiration and appreciation for everyone’s help. Research indeed is a collaborative work. No one does it by oneself.
Finally, great appreciation to my beloved father, mother, brothers, sisters and loved ones in Pakistan for their continuous prayers and well wishes for me. I dedicate my humble effort of thesis to my beloved parents and all the poor humanity of this world. To God Almighty be the Glory.
Thanks Jam Nazeer AHMAD
6
List of Communications and Publications
Communications
The name of author who has presented is underlined
Jam Nazeer Ahmad , Sandrine Eveillard. 2011. Study of the Expression of Defense Related Protein Genes in Stolbur C and Stolbur PO phytoplasma-infected tomato. 2nd International Phytoplasmologist Working
Group Meeting. Neustadt/Weinstrasse, Germany. September 12-16, 2011 (Oral Communication)
Jam Nazeer Ahmad , Pascale Pracros, Christophe Garcion, Emeline Teyssier, Joel Renaudin, Michel
Hernould, Philippe Gallusci, Sandrine Eveillard . 2011. Epigenetic Control of stolbur phytoplasma-tomato plant interaction. COST Meeting, Neustadt/Weinstrasse, Germany. 12-16 September 2011. (Oral
Communication)
Jam Nazeer Ahmad , Christophe Garcion, Joel Renaudin, Sandrine Eveillard. 2010. Développement floral chez les tomates infectées par le phytoplasme du stolbur: implication de la méthylation de l’ADN dans l’expression des génes. 9ème Rencontre plantes-bactéries, pp. 50 Aussoi, France. 12-15 dec 2010 (Oral
Communication)
Jam Nazeer Ahmad , Pascale Pracros, Christophe Garcion, Emeline Teyssier, Joel Renaudin, Michel
Hernould, Philippe Gallusci, Sandrine Eveillard . 2009. Altération de la méthylation du gène SlDEF et dérégulation de l’expression de déméthylases dans les tomates infectées par le phytoplasme du stolbur.
In Société Francaise de Phytopathologie. P11. Lyon, France (Oral Communication)
Jam Nazeer Ahmad, Pascale Pracros, Christophe Garcion, Emeline Teyssier, Joel Renaudin, Michel
Hernould, Philippe Gallusci, Sandrine Eveillard. 2009. Altération de la méthylation du gène SlDEF et dérégulation de l’expression de déméthylases dans les tomates infectées par le phytoplasme du stolbur.
1er journées des doctorants du département SPE. Agrocampus Ouest- Rennes, France. 01-02 September 2009
(Oral Communication)
7
Jam Nazeer Ahmad , Christophe Garcion, Philippe Gallusci, Michel Hernould, Joel Renaudin, Sandrine
Eveillard. 2010. « Stolbur phytoplasma infected tomatoes: -Implication of DNA methylation in abnormal flower developpement -Implication of SA and JA defense pathways in the tomato response». 10 ème Journée scientifique de l'Ecole Doctorale Science de la Vie et de la Santé, Arcachon, France. 7 April 2010 (Poster)
Jam Nazeer Ahmad , Christophe Garcion, Joel Renaudin, Sandrine Eveillard. 2011. Stolbur phytoplasma- tomato interaction: defense gene expression in stolbur phytoplasma infected tomato. 11 ème Journée scientifique de l'Ecole Doctorale Science de la Vie et de la Santé. Arcachon, France. 7 April 2011 (Poster).
Articles
Jam Nazeer Ahmad , Sandrine Eveillard. 2011. Study of the Expression of Defense Related Protein Genes in Stolbur C and Stolbur PO phytoplasma-infected tomato. Bulletin of Insectology 64, S159-S160.
Jam Nazeer Ahmad , Pascale Pracros, Christophe Garcion, Emeline Teyssier, Joel Renaudin, Michel Hernould, Philippe Gallusci, Sandrine Eveillard, 2011. Stolbur phytoplasma infection affects DNA methylation process in tomato plants. Journal of Plant Pathology (accepted).
Two-Three publications are under preparation.
8
Table of Contents
9
Acknowledgements ...... 5
List of communications and publications ...... 7
Table of Contents ...... 9
General Introduction ...... 17
1. Mollicute ...... 19
2. Mollicute Classification...... 19
3. Phytopathogenic Mollicutes…………………………………………………………….…………...... 20
3.1. Spiroplasmas……………………………………………………………………...... …………..20
3.2. Phytoplasmas……………………………………………………………………..……...... …….22
3.2.1. Taxonomy and classification of Phytoplasmas…………………….…..……...……...23
3.2.2. Morphology and Ultrastructure of phytoplasmas………………………..…………....25
3.2.3. Phytoplasmas genome size and base composition………………………..…………..25
3.2.4. Distribution of Phytoplasmas……………………………………………..…………..26
3.2.5. Detection and identification of Phytoplasmas……………………………...…………27
3.2.6. Transmission and spread of Phytoplasmas……………………………..……………..29
3.2.7. Transmission cycle of Phytoplasmas in hosts………………………………..……….30
3.2.8. Phytoplasma infection disturbs plant developmental process ……………...... …...31
3.2.9. Phytoplasma effectors and Associated diseases……………………………...... …..32
3.2.10. Phytoplasma interfere with flower development…………………………...... …..34
3.2.11. Phytoplasma and other microbial effectors………………………………...... …..35
3.2.12. Plant Defense Response……………………………………………………...... …36
3.3.14. Stolbur Phytoplasmas……………………………………………..…………....……38
4. Objective of the thesis………………..………………………………………………………………….…43
Chapter I …………………………………………………………………………………………………...... 45
Implication of DNA methylation in SLDEF gene expression during flower development in stolbur phytoplasma-infected tomato
10
1. Introduction …………….……………………………………………………………………………...….47
1.1. Model of flower development…………………………………………………………...... …47
1.1.1. Flower development genes in Arabidopsis thaliana…………………………………...….47
1.1.2. Flower development genes in Solanum lycopersicum………………………………….....48
1.2. DNA Methylation……………….…………………………………………………...... 50
1.3. DNA Demethylation……………….……………………………………………...... 55
2-Results ...... 66
2.1. Material Chosen for the study………...... ……………………………………………...... 68
2.2. Up-regulation of Falsiflora ( FA ) in stolbur PO phytoplasma infected tomato……...... 68
2.2. Expression of SlDEF gene in stolbur C and PO phytoplasma infected tomato………...70
2.3. Effect of demethylation induced by 5-azacytidine treatment ………………………………….....73
2.3.1. Diseases symptoms observed in 5-azacytidine treated tomato…………...... 73
2.3.2. Up-regulation of SlDEF gene in 5-azacytidine treated tomato…………………...…..75
2.4. Differential expression of DNA Methyltransferase Genes…………………………………….....76
2.4.1. Expression of Methyltransferase genes in stolbur phytoplasma-infected tomato……76
2.4.1.1. Class I (METI) Methyltransferases……………...... 76
2.4.1.2. Class II (CMT) Chromomethylases…………………...... ……..78
2.4.1.3. Class III (DRM) Domain Rearranged Methyltransferases...... 80
2.5. Differential expression of DNA demethylase genes in stolbur infected tomato……...... 80
2.5.1. Expression of DNA demethylase genes in Stolbur PO phytoplasma-infected tomato….…81
2.5.1.1. Expression of DML 728 ……………………...... ………………83
2.5.1.2. Expression of DML 729 ………………………...... ……………..83
2.5.1.3. Expression of DML 325 ………...... …………………………...... 83
2.5.2. Expression of DNA demethylase genes in stolbur C phytoplasma-infected tomato...... 85
2.5.2.1. Expression of DML 728 ……………...... ………………………..85
11
2.5.2.2. Expression of DML 729 ……………...... ……………………….85
2.5.2.3. Expression of DML 325 …………………...... ……………………………………..85
2.6. DNA methylation status in stolbur phytoplasma-infected tomato……...... 86
2.6.1. Site specific determination of SlDEF methylation status by MSRE-PCR…...... 86
2.6.2. Region specific determination of SlDEF methylation status by Bisulfite Sequencing..…..89
2.6.3. Determination of methylation level by Southern Blotting…………...... ………...90
3. Discussion …………………..…………………………...... ……………………………………93
4. Conclusion and Perspectives …………………..…………………………...... 98
Chapter II ...... 100
Study of the Salicylic acid (SA), Ethylene (ET) and jasmonic acid (JA) dependent defence pathways gene expression in stolbur phytoplasma infected tomato
1. Introduction …………………………………………………...... ………………………….…..100
1.1. Plant-pathogen interaction…………………………...... ………………………………102
1.2. Mechanism of Defence……………………………...... ……………………………...103
1.3. Systemic Defenses………………...... ………………………………………………...105
1.3.1. Systemic Acquired Resistance (SAR)…………...... …...... ………………………....105
1.3.2. Induced Systemic Resistance (ISR)……………...... …………………………...106
1.4 Signalization……………………………………...……………………………………………..108
1.4.1. Perception and elicitors………………………………………………………….………..108
1.4.2. Signal transduction pathways……………………………………………………………..111
1.4.3. Salicylic acid signalling defense pathway……………………………...... ……111
1.4.5. Jasmonic acid signalling defense pathway…………………………...... ……….114
1.4.6. Ethylene signalling defense pathway……………………………...... ………….117
1.5 Defence genes expression…………………………………………………...... ………..118
1.5.1. Genes involved in cell wall modifications………………………...... …………………118
1.5.2. Genes involved in secondary metabolism……………………………………………...... 119
1.5.3. Genes for pathogenesis-related (PR) proteins…………………………...... …………...121
12
1.5.4. PR1 family of Pathogenesis-related Protein Genes………………………………………121
1.5.5. PR proteins involved in cell walls degradations…………………………………...... 124
1.5.6. PR proteins associated with membranes………………………………...... …………...125
1.5.7. Enzymatic and Enzyme-associated PR proteins…………………...... ………………...127
1.6. Cross-talk among defence pathways………………………………………...... ………………128
1.7. Counter defense strategies of Pathogens…………………………………...... ………………130
1.8. Tomato as model Plant ……………………………………………………...... ……………...131
1.9. Phytoplasma and defense pathways dependent genes expression……...... ……...132
2. Results ...... 135
2.1. Salicylic acid (SA) dependent defense genes expression in stolbur phytoplasma-infected tomato
...... 137
2.1.1. Salicylic acid (SA) biosynthesis genes expression in stolbur phytoplasma-infected tomato
………………………………………………………………………………………………………137
2.1.2. Expression of SA dependent PR genes…………...... ………………………………...139
2.1.2.1. Expression of Acidic pathogenesis related protein PR1gene (acidic PR1)...... 139
2.1.2.2. Expression of Acidic pathogenesis-related protein PR2 gene (acidic PR2 )...... 141
2.1.2.3. Expression of Pathogenesis-related protein PR5 gene (Thaumatin like PR5 )…….143
2.2. Jasmonic acid dependent defense genes expression in stolbur phytoplasma-infected tomato...... 145
2.2.1. Expression of Proteinase Inhibitor 2 gene ( PIN2 )…………………………………...145
2.2.2. Expression of basic pathogenesis related protein PR2 gene ( BGL2 ) ………………..145
2.3. Ethylene dependent defense genes expression in stolbur phytoplasma infected tomato...... 147
2.4. Developmental regulated defense gene expression (Defensin2 )…………...... ………………..149
2.5. Summary ………………………...... ………………………….150
3. Discussion …………………………………………………………………………………...... ……..151
3.1. Biosynthesis genes implicated in defense pathways are perturbed ……...... ……..….....152
3.1.1. Genes encoding of SA biosynthesis enzymes………………………………………..152
3.1.2. Genes encoding of JA biosynthesis enzymes...... 154
3.2. Pathogenesis related protein genes expression...... 155
13
3.3. Suggested Model of Cross-talk in stolbur phytoplasma-infected tomato…………...... 164
3.4. Suggested Counter defense strategies in stolbur phytoplasma-infected tomato……...... 166
4. Conclusion ………………………...... 168
5. Perspectives ………………………...... 169
Chapter III ...... 170
Effect of pre-activation of Salicylic acid (SA) or Jasmonic acid (JA) dependent defense pathways on disease development in stolbur PO-infected tomato
1. Introduction ………………………………………………………...... ………………………..…….171
2. Results ……………………………………………..……………………………...... ………….……176
2.1. Effect of pre-treatment with Benzothiadiazole (BTH)………………...... ……………....177
2.1.1. Symptoms observation……………………………………...... ……………….177
2.1.2. Stolbur PO phytoplasma detection………………………...... …………………..179
2.1.3. Expression of SA and JA dependent marker genes……...... ……………………..181
2.1.3.1. Expression of SA mediated pathogenesis-related marker gene PR1 …….….183
2.1.3.2. Expression of JA mediated marker gene PIN2 ……………………………...184
2.2. Effect of pre-treatment with MeJA (Activator of JA defense pathway)………………………186
2.2.1. Symptoms observation…………………………...... ……………..……186
2.2.2. Stolbur PO phytoplasma detection…………………………………………………..188
2.2.3. Expression of SA and JA dependent marker genes……………………...... 188
2.2.3.1. Expression of JA mediated marker gene PIN2 ………...... 188
2.2.3.2. Expression of SA mediated pathognesis-related marker gene PR1 ……..….191
2.3. Summary……..……………………………………………………………………………….191
2.4. SA /JA/ET mediated defense genes expression in stolbur PO phytoplasma-infected tomato at
two different time points……………………………………………………………………...192
2.5. SA /JA/ET mediated defense genes expression upon BTH and MeJA treatment in healthy
tomato………………………………………...... ……...... ………………………………..194
3. Discussion …………………………………………………...... …………………………….197
14
3.1. Effect of pre activation of SA and/or JA dependent defense pathways on the disease
development in stolbur PO phytoplasma-infected tomato...... 198
3.2. SA/JA/ET mediated defense genes expression in stolbur PO phytoplasma-infected tomato at
two different time points………...... ……………………………………………….....…….….201
3.3. SA/JA/ET mediated defense genes expression upon BTH and MeJA treatemnt in healthy
tomato…………...... ……...... ………………………………………...201
4. Conclusion………………………………………………………………………………………203
General Discussion and Perspectives ………...... ….....……………………………………………..205
MATERIAL AND METHODS ...... 214
1. Biological Material ………………...…………………………...... ………………………………..214
2. RNA extraction and related methods of analysis ……………………...... ……………....………215
2.1. RNA extraction………………………………………………...... ………………………216
2.2. RNA treatment with RNAse free DNase………………………...... …………………….216
2.3. Reverse-Transcription Polymerase Chain Reaction (RT-PCR)…………..…………………....219
2.3.1. Reverse Transcription…………………………………..…………………...219
2.3.2. Semi-quantitative RT-PCR…………………………….………………..…..219
2.3.3. Gel electrophoresis...... 221
2.3.4. Calculations and analysis for semi-quantitative RT-PCR...... 221
2.3.5. Real time RT-PCR…………………………………...... ……………….223
2.3.6. Calculations and analysis for real-time RT-PCR ……...... …………………223
3. DNA extraction and related methods of analysis ……………………………...... ………...….…..225
3.1. DNA Extraction………………………………………………...... …………………....225
3.2. Nested-PCR for stolbur phytoplasma detection ………...... ……………..…...225
3.3. Digestion of DNA with Restriction Enzymes…………………….………...... ………….…..228
4. Southern blot ……………….……………………………………………………………………………228
4.1. Gel Electrophoresis and DNA transfer to Membrane …………………………………...….228
4.2. Southern blot Hybridization and revelation………………...... ……………...... ….230
15
5. Bisulfite Treatment …………………………...... ……………...... ………………….231
6. Cloning of PCR products …………………………...... …………………...... ……...... 231
7. Methylation Specific Restriction Enzymes PCR (MSRE-PCR)…………………………………...... 232
ADDITIONAL DOCUMENTS OR ANNEX ...... 234
REFERENCES ...... 244
LIST OF ABBREVIATIONS...... 331
RESUME EN FRANCAIS ...... 335
16
General Introduction
17
Class Order Family Genus
Mycoplasma
Mycoplasmatales Mycoplasmataceae
Ureaplasma
Anaeroplasma
Anaeroplasmatales Anaeroplasmataceae
Asteroplasma
Mollicutes Haloplasmatales Haloplasmataceae Haloplasma
Mesoplasma
Entomoplasmataceae
Entomoplasmatales Entomoplasma
Spiroplasmataceae Spiroroplasma
Acholeplasma
Acholeplasmatales Acholeplasmataceae
Phytoplasma
Figure 1: Classification of the members of order of class mollicutes
18
General Introduction
1. Mollicutes
Mollicutes are a class of bacteria evolved from gram positive ancestors having low G + C contents by so-called regressive evolution (Weisburg et al ., 1989; Woese, 1987). The word "Mollicutes" is derived from the Latin mollis (meaning "soft" or "pliable"), and cutis (meaning "skin"). Indeed, Mollicutes are without cell walls, and are therefore unaffected by many common antibiotics such as penicillin or other beta- lactam that target cell wall synthesis.
Mollicutes are parasites of livings and some of them strictly require insect vectors to be transmitted.
Phytoplasmas and 3 spiroplasma spp. share similar habitats, these bacteria are only distantly related in the class Mollicutes. Various species are parasites of humans, animals, insects and plants, living on or in the host's cells. Individuals are very small, typically 0.2–0.3 m in size and have a very small genome size.
2. Mollicute Classification
The class mollicutes consists of 5 orders that have nearly 150 species (Figure 1).
The Mycoplasmatales (family, Mycoplasmataceae, genera, Mycoplasma and Ureaplasma ) having several members like M. pneumoniae , causal agent of atypical pneumonia and other respiratory disorders, and M genitalium which is believed to be involved in pelvic inflammatory diseases. Cholesterol is required for growth. A defining characteristic of the genus Ureaplasma is that they perform urea hydrolysis.
The Anaeroplasmatales (family, Anaeroplasmataceae, genera, Anaeroplasma and Asteroplasma ) are anaerobic bacteria isolated from the stomach of ruminants. The members of the genus Anaeroplasma needs cholesterol to live. Erysipelothrix rhusiopathiae cause infection in human skin diseases ‘erysipeloid’.
The Haloplasmatales are bacteria having single family Haloplasmataceae with a single genus
Haloplasma that contained Haloplasma Contractile , a halophilic, wall less-bacterium (Antunes et al ., 2008).
The Entomoplasmatales are a small order of mollicutes isolated from plants and arthropodes including family the Entomoplasmataceae having genera Mesoplasma and Entomoplasma . Spiroplasma is the most notably genus of family Spiroplasmataceae.
19
The Acholeplasmatales is an order containing only the family Acholeplasmataceae , comprising the genera Acholeplasma and Phytoplasma . Yet, Phytoplasma has candidatus status, because members still could not be cultured. Species in the order Acholeplasmatales can grow in a medium without cholesterol, unlike species in the order mycoplasmatales. Cholesterol is a sterol that is an important component of the cell membrane of mycoplasmas, whereas in acholeplasmas and in bacteria, it is in general absent.
Mollicutes have diverged at early stage of evolution to give rise to AAA (Asteroplasma,
Anaeroplasma, and Acholeplasma) and the SEM (Spiroplama, Entomoplasma and Mycoplasma). Both branches of mollicutes use different codons. AAA branch of mollicutes use UGA as stop codon whereas tryptophan is used as stop codon in SEM (Razin et al ., 1998).
3. Phytopathogenic Mollicutes
Most plant pathogenic bacteria colonize the apoplast of plant tissues, but phytopathogenic mollicutes
(spiroplasma and phytoplasma) (Figure 2) are restricted to the phloem sieve tubes where they are transmitted from plant to plant through phloem sap sucking insects (Purcell, 1983; Weintraub et al ., 2006).
Photo B. 1 µm Batailler
1 µm
Ca . phytoplasma Spiroplasma citri
Figure 2: Picture of stolbur phytoplasma and Spiroplasma citri in phloem sieve tube
3.1. Spiroplasmas
In the Mollicutes, the genus Spiroplasma consists of a group of motile helical prokaryotes that are associated primarily with arthropods, mainly insects (Gasparich et al ., 2004). Spiroplasma shares the simple
20 metabolism, parasitic lifestyle, fried-egg colony morphology and small genome of other Mollicutes , but has a distinctive helical morphology, unlike Mycoplasma .
Spiroplasmas are found either in the gut or hemolymph of insects, or in the phloem of plants.
Spiroplasmas are fastidious organisms, which require a rich culture medium. Typically they grow well at
30°C, but not at 37°C. A few species, notably Spiroplasma mirum , grow well at 37°C (human body temperature), and cause cataracts and neurological damage in suckling mice.
Three species, Spiroplasma citri (Saglio et al ., 1973), S. phoeniceum (Saillard et al ; 1987), S. kunkelii (Whitecomb et el ., 1986) are phytopathogenic. S. citri , the first plant pathogenic mollicute to be cultured and characterized (Saglio et al ., 1971, 1973) is an important pathogen which causes citrus stubborn disease in the Mediterranean area and in California (Calavan and Bové, 1989). They also cause as horseradish brittle root (Fletcher et al., 1981) and carrot purple leaf (Lee et al ., 2006) diseases in the United
States.
Spiroplasma citri induces symptoms such as leaf yellowings, stunting, wilting and even death to
Madagascar periwinkle that is the model or experimental host plant for that pathogen. Spiroplasma kunkelii is the causative agent of Corn Stunt Disease, and S. phoeniceum was cultivated in Syria in 1983 from
Madgascar periwinkle (Saillard et al ., 1987).
The Spiroplasmas reside within the phloem sieve tubes and are transmitted by phloem sap-feeding leafhopper in a persistant and propagative manner (Purcell, 1983; Fos et al , 1986). The leafhoppers
Circulifer haematoceps is the insect vector of Spiroplasma citri which transmit it in a circulative, persistent manner by insects of order Hemiptera (Cicadellidae) in Mediterranian area and the Near East (Fos et al .,
1986) and Circulifer tenellus (Baker) in United States (Liu et al ,. 1983).
Circulifer tenellus (Baker) was identified as the major vector of S. citri in California (Oldfield et al .,
1976), whereas in Turkey and Syria, C. haematoceps is regarded as the main vector of this pathogen (Bové et al, 1988).
In Iran, among the three species of leafhoppers, only C. haematoceps was capable of transmitting S. citri but the other two, Orosius albicinctus and Austroagallia sinuata , can acquire but were unable to
21 transmit S. citri from infected to healthy plants (Omaidi et al , 2011). Phytoplasma and Spiroplasma are phytopathogens have similar habitas and associated with insect vectors but they have different metabolic pathways. Many spiroplasma and mycoplasma species have been cultured in artificial medium but phytoplasma have not been cultured yet. Spiroplasma is also distinguishable from phytoplasma in that it displays helical morphology (Figure 2).
3.2. Phytoplasmas
Phytoplasmas are specialized bacteria that are obligate parasites of plant phloem tissue and insect vectors. Japanese scientists were the first to describe phytoplasma (mycoplasma-like organisms ‘MLOs’) responsible for plant ‘yellows’ diseases in 1967 (Doi et al ., 1967). Phytoplasmas were discovered in ultrathin sections of plant phloem tissue and named mycoplasma-like organisms (MLOs), because they physically resembled mycoplasma. The organisms were renamed phytoplasmas in 1994 at the 10th congress of the
International Organization of Mycoplasmology. They cannot be cultured in vitro in cell-free media.
Phytoplasmas are associated with plant diseases, and are known to responsible more than 600 diseases in several hundred plant species (Kirkpatrick, 1992; McCoy et al ., 1989). Phytoplasmas cause different symptoms and diseases in more than 700 plant species and bring about dramatic changes in plant development, including witches broom, dwarfism, proliferation, phyllody, virescence, sterility of flowers, bolting, purple tops (reddening of leaves and stem), generalized yellowing and phloem necrosis (Agrios,
1997; Christensen et al ., 2005; Hogenhout et al ., 2008).
They are characterized by their lack of a cell wall but plasma membrane is present, a pleiomorphic shape, a diameter of 0.1 to 0.8µm and a very small genome size (0.5-1.3 Mbp). They are the smallest among bacteria with low G+C contents (Christensen et al ., 2005; Hogenhout et al ., 2008).
The full genome sequence of 4 candidatus phytoplasmas were determined (Oshima et al ., 2004;
Kube et al ., 2008) and suggested that phytoplasma has lost many metabolic genes, suggesting that reductive evolution is a consequence of being an intracellular parasite.
Phytoplasmas need a vector to be transmitted from plant to plant, usually sap sucking insects. They have not been cultured so far and the mechanisms by which they cause diseases in plants are not understood.
22
3.2.1. Taxonomy and classification of Phytoplasmas
In 1992, the Subcommittee proposed the name Phytoplasma in place of the use of the term
MLO (Mycoplasma-Like Organism) for reference to the phytopathogenic mollicutes.In 2004, the genus name Phytoplasma was adopted and is currently at candidatus status which is used for bacteria that cannot be cultured. The taxonomy of phytoplasmas is complicated by the fact that it can not be cultured and thus methods normally used for classification of prokaryotes are not possible.
In the 1990’s, the first cloning of phytoplasma DNA was done (Kirkpatric et al ., 1987) and nucleic acid-based probes were applied to detect and differentiate phytoplasmas (Lee and Devis, 1988; Bonnet et al .,
1990; Harizon et al ., 1992; Prince et al ., 1993; Davis et al ., 2003). They provided the first evidences of genetic alterations in the phytoplasma DNA among strains derived from different hosts or from different geographical locations (Lee et al ., 1992; Bertaccini et al ., 1990b, 1993).
The first comprehensive phytoplasma classification scheme was based on restriction fragment length polymorphism (RFLP) analysis of polymerase chain reaction (PCR)-amplified 16S rDNA (Lee et al ., 1998).
RFLP provide a reliable means for the differentiation of a broad array of phytoplasmas and has become the most comprehensive and widely accepted phytoplasma classification system (Bertaccini and Duduk, 2009).
Phytoplasma are classified into different phylogenetic groups, subgroups and candidate species into the ‘Candidatus phytoplasma’ genus (Firrao et al ., 2007; Zhao et al ; 2009). Based on RFLP analyses, 34 phytoplasma strains were differentiated into 14 major groups (termed 16Sr groups) and 32 subgroups (Figure
3). Each group includes at least one Ca. Phytoplasma species, characterised by phytopathological, genetic and distinctive biological properties.
Figure 3 presents the main groups of phytoplasma based on restriction fragment length polymorphism analysis of 16S r DNA and ribosomal proteins (rp). Each group has subgroups and at least one candidatus phytoplasma species.
1-Aster Yellow group (16SrI) 2-Peanut witches’-broom group (16SrIII)
3-X-disease group (16SrIII) 4-Coconut lethal yellows group (16SrIV)
23
5-Elm yellows group (16SrV) 6-Clover proliferation group (16SrVI)
7-Ash yellows group (16SrVII) 8-Loofah witches’-broom group (16SrVIII)
9-Pigeon pea witches’-broom group (16SrIX) 10-Apple proliferation group (16SrX)
11-Rice yellow dwarf group (16SrXI) 12-Stolbur group (16SrXII)
13-Mexican periwinkle virescence group (16SrXIII) 14-Bermuda grass white leaf group
(16srXIV)
Figure 3: Representative species of main phytoplasma groups
24
3.2.2. Morphology and Ultrastructure of phytoplasmas
Phytoplasmas are mollicutes and have no cell walls but instead are bound by a tripple layered plasmic membrane. The cell membranes of all phytoplasmas studied so far usually contain a single immunodominant protein (of unknown function) that makes up the majority of the protein content of the cell membrane. Ultrathin section of phloem of yellows disease affected plants idicated the presence of mycoplasma like organisms that have resemblance to human and animal mycoplasmas (Doi et al., 1967), pleiomorphic in shape and with a size range similar to that of mycoplasma.
Indeed, they have an average diameter of 0.2-0.8 µm but they can also have a filamentous morphology and these filamentous bodies being especially predominant in plants during early stage of disease (Lee and Davis, 1992).
3.2.3. Phytoplasmas Genome size and base composition
Bermoda grass white leaf phytoplasma which has a genome size of only 530 Kbp, is one of the smallest known genomes of living organisms, while the larger phytoplasma genomes are around 1350 Kbp.
The low G+C contents which range between 23 mol % and 29 mol % (Kison et al ., 1994), supports the phylogenetic affiliation of phytoplasma with members of class Mollicutes (Razin et al., 1998).
The small genome size associated with phytoplasmas is because of reductive evolution from
Bacillus/Clostridium ancestors. It is considered that phytoplasma have lost 75% or more of their originals genes, and this is why they can no longer survive outside of insects or plant phloem, but despite their very small genomes, many predicted genes are present in multiple copies.
The genomes of four Ca. phytoplasmas have been sequenced: ‘ Ca. Phytoplasma asteris’ strain OY
(line OY-M) and AY-WB (Oshima et al ., 2004; Bai et al ., 2006), Ca. Phytoplasma australiense (Tranguyen et al., 2008) and ‘ Ca. Phytoplasma mali’ (Kube et al ., 2008).
Most of phytoplasma like Ca Phytoplasma asteris and Ca Phytoplasma australiense consist of circular chromosomes of 706-879 kbp (Oshima et al ., 2004; Bai et al ., 2006; Tran-Nguyen and Gibb, 2006) but Ca. P. Mali has a linear chromosome of 601kbp (Kube et al., 2008). Some phytoplasmas have extra-
25 chromosomal DNA such as plasmids. Two extra-chromosomal plasmids from tomato big bud phytoplasma
(TBB) and one from Ca phytoplasma australiense were discovered (Tran-Nguyen and Gibb, 2006).
Phytoplasma genome contains also large numbers of transposon genes and insertion sequences.
Unlike the rest of the Mollicutes, the triplet codon of UGA is used as stop codon in phytoplasmas, rather than coding for tryptophan.
3.2.4. Distribution of Phytoplasmas
Phytoplasmas can be found worldwide geographically, and they have been reported in at least 85 countries (McCoy et al ., 1989). Phytoplasmas do not have uniform geographic distribution (Lee et al ., 2000), many are restricted to one continent or to a specific geographical region. For example, most phytoplasma of the X-diseased group (16SrIII), the clover proliferation group (16SrVI), and ash yellows group (16SrVII) are restricted to the American continent.
The peanut witches-broom group (16SrII) and rice yellow dwarf group (16SrXI) of phytoplasmas are restricted to the South-east Asian region, and the apple proliferation group (16SrX) and stolbur subgroup
(16Sr XII-A) are limited to the European continent (Lee et al ., 1992).
Geographical separation of some phytoplasma to a particular region seems to correlate with the distribution of their insect vectors and host plants which are native to that particular region. For instance, maize bushy stunt phytoplasma [16SrI-B (rp-L)] is restricted to Central and South America and part of North
America. These regions correspond to the geographical range of the insect vectors Dalbulus madis and D. elimatus.
Micro- and macro-ecosystems on each continent can be changed through the introduction of foreign germplasms (e.g. weeds and cultivated crops) and/or insects or owing to a lack of conservation. Many phytoplasmas apparently have spread well beyond the regions where they originated, if similar vegetation and insect vectors existed in the new ecological niches.
Some phytoplasmas (e.g. aster yellows phytoplasma subgroup 16SrI-B) have become dispersed worldwide, whereas others have become isolated in new ecological niches and have evolved independently from parental strains.
26
3.2.5. Detection and identification of Phytoplasmas
In past decades, because of the inability to get pure cultures of any phytoplasma, their detection and identification were never accurate. The presence of characteristic symptoms in diseased plants and subsequent observation of mycoplasma like bodies in ultrathin sections of diseased plants were the main and important criteria used to diagnose diseases of possible phytoplasmal origin (Chen YD and Chen T A 1998;
Shiomi and Sugiura, 1984).
In some cases, the disappearance of diseases symptoms after antibiotic (i.e. tetracycline) treatment provided additional evidence to support the diagnosis (Doi et al ., 1967; Lee and Davis, 1992). For their identification, phytoplasma strains were differentiated by their biological properties, such as the similarity and difference in symptoms they induced in infected plants, their plant hosts, and their insect vectors.
In 1990’s, following the first cloning of the DNA of phytoplasma, nucleic acid-based probes were sythesized to detect and differentiate phytoplasmas (Kirkpatric et al ., 1987; Lee and Devis, 1988; Bertaccini et al ., 1990a; Bonnet et al ., 1990; Harison et al ., 1992; Prince et al ., 1993; Davis et al ., 2003). They provided the first evidences of genetic differences in the phytoplasma DNA among strains derived from different hosts or from different geographical locations (Lee et al ., 1992; Bertaccini et al., 1990b, 1993).
In last 20 years, the nucleic acid techniques based on polymerase chain reaction (PCR) are now routinely used and are adequate for the detection and identification of phytoplasmas. PCR detection of a wide array of phytoplasmas associated with plants and insects were allowed by developing the genomic sequence-specific oligonucleotides using generic or broad-spectrum primers designed based on 16S r DNA
(Ahrens et al ., 1992; Lee et al ., 1992; Namba et al ., 1993).
Now several universal and many phytoplasma group specific primers, based on the 16S ribosomal
RNA gene, have been designed for routine detection and identification of phytoplasmas. They allow the differentiation of phytoplasma strains at different taxonomic level (Lee et al ., 2010).
To enhance both sensitivity and specificity, Nested-PCR assays are designed which are indispensable for the amplification of phytoplasmas from samples in which usually low titters or inhibitors are present that
27 may interfere with PCR efficiency (Bertaccini et al ., 1992a; Gundersen et al ., 1994). By using a universal primer pair followed by PCR using a group specific primer pair, nested-PCR is capable of detection of dual or multiple phytoplasmas present in the infected tissues in case of mixed infection (Lee et al ., 1994).
Phytoplasmas’s identification can be done using Restriction Fragment Length Polymorphism (RFLP) analysis of PCR amplified 16S rRNA gene (Lee et al ., 1998). Lee et al . (1994) differentiate various phytoplasmas by their distinct RFLP patterns by using 17 restriction enzymes in RFLP analyses of 16S rDNA nested PCR. By comparing the patterns of known phytoplasmas, unknown phytoplasmas can be indentified without co-analyses of all reference representative phytoplasmas, as RFLP patterns characteristics of each phytoplasmas are conserved (Lee et al ., 1998; Wei et al ., 2008).
Using RFLP analyses, 34 phytoplasma strains were differentiated into 14 major groups (termed 16Sr groups) and 32 subgroups. RFLP analyses approach of PCR amplified 16S r DNA provides a simple, reliable and rapid means of differentiation and identification of known phytoplasmas.
Because the 16S r RNA gene is highly conderved, phytoplasmal 16S r RNA genes share similarities above 90% (Lee et al ., 2010). Thus, relative genetic distances among phytoplasma strains, assessed on the basis of 16S rRNA gene sequence similarities, may not fully reveal the genetic heterogeity of phytoplasmas, and genetically close but biologically distinct, strains may remain unresolved.
To faciltate the separation of such closely related strains and for finer differentiation, several less conserved, additional genetic markers such as ribosomal proteins (rp) genes, secY, tuf, groEL and 16S-23S rRNA intergenic spacer region sequences have been used as supplementary tools (Lee et al ., 1994, 2006,
2010; Martini et al ., 2007; Sachneider et al ., 1997; Smart et al ., 1996; Mitrovic et al ., 2011). Single nucleotide polymorphisms (SNPs) have also been exploited as molecular markers separating phytoplasma lineage (Jomantiene et al ., 2011).
RFLP analyses and rp gene sequences I combination provide finer subgroup delineation. The subgroups recognized by these methods were in agreement with the sub-cluster indentified by analysis of phytoplasma genomes through dot and Southern hybridizations using a number of cloned phytoplasma DNA probes (Lee et al ., 1992, 1998; Gundersen et al ., 1996; Martini et al ., 2007). A consensus for naming novel
28 phytoplasmas was reached and recommended by the IRPCM Phytoplasma/Spiroplasma Working Team-
Phytoplasma Taxonomy Group (IRPCM, 2004).
Accordingly ‘a Candidatus Phytoplasma’ species description should point to a single, unique 16S rRNA gene sequence (>1200 bp) and a strain can be reffered as novel ‘ Ca . phytoplasma’ species if its 16S rRNA gene sequence has <97.5% similarity to that of any previously described ‘Ca. phytoplasma species.
Many biologically or ecologically distinct phytoplasma strains unable to meet the requirement of
<97.5% sequence similarity because of high conserved 16S rRNA gene and can not be differentiated and classified. In this case, additional unique biological properties such as antibody specificity, host range and vector transmission specificity as well as other molecular criteria (gene) need to be included for speciation
(Schneider and Seemuller, 2004).
So, in conclusion, the detection of phytoplasma is very important for their identification in infected tissues. Real-time PCR, nested PCR, RFLP and microarray analysis, most of these have been based on 16S r
RNA gene sequences, have been developed for the detection of phytoplasma (Gundersen and Lee, 1996;
Hadidi et al., 2004; Hodgets et al ., 2007; Bertaccini, 2007; Tores et al ., 2005).
3.2.6. Transmission and spread of Phytoplasmas
Phloem sieve cells, where phytoplasmas are found, are live anucleate cells containing limited organelles, such as ribosome, small vacuoles and large plasmodesmata which connect to neighboring cells for nourishing. Adjacent sieve cells are connected by sieve plates that have small pores to transport sugars and other nutrients in plants. The phytoplasma infect the host by moving through the pores of sieve plates, thereby spreading throughout the plant’s vacular system.
Phytoplasmas can be spread from plant to plant by vegetative propagation through cuttings, storage tubers, rhizomes or bulbs (Lee and Davis, 1992). Phytoplasmas can also be spread via cuscuta dodder
(Carraro et al ., 1988) and through grafts but unlike viruses they can not be transmitted mechanically by inoculation with phytoplasma-containing sap from infected plants.
29
Phytoplasmas can also be spread or transmitted from plants to plants through sap-sucking insect vectors belonging to the different families of insect vectors such as Cicadellidea (leaf-hoppers), Fulgoridea
(plant-hoppers) and Psyllidea (jumping plant lice) (Banttari and Zeyea, 1979; Nielson, 1979; Grylls, 1979;
Tsai, 1979; Ploaie, 1981).
Insects attain phytoplasmas while feeding on phloem of infected plant. Phytoplasmas contain a major antigenic protein which makes up the majority of their cell surface proteins. The antigenic membrane protein of Ca. P. asteris , protein AMP, was shown to interact with the insect cell microfilament and to participate to insect vector specificity. It is believed to be the determining factor in phytoplasma-insect interaction (Suzuki et al ., 2006). Phytoplasmas may overwinter in insect vectors or perennial plants.
3.2.7. Transmission cycle of Phytoplasmas in hosts
Sap-sucking insects (plant hoppers, leafhoppers) become infected by phytoplasma in a process called acquisition feeding. Insect vectors receive phytoplasma from infected plant and once the phytoplasma entered into intestinal lumen of host insect, they invade and replicate at haemolymph site (Hogenhout et al .,
2008). Then bacteria infect other insect organs and tissues including salivary glands. Phytoplasma accumulate into the large vacuoles of salivary glands from where they get access to sieve cells during insect feeding in a process called as inoculation feeding (Nault, 1997).
The time lapse between acquisition and inoculation process is called latency period that depends upon the bacterium, insect species and temperature. Phloem feeding insect vectors belonging to specific group such as leaf hoppers, plant hoppers or psyllids with in the order Hemiptera transmit phytoplasma but other pholoem feeder like aphid are unable to transmit that show the specificity in acquisition and transmission. The longer the two organisms have coexisted and coevolved, the more likely the insect vector is to be benifited from the interaction (Nault, 1990).
So phytoplasma have two distinct kingdoms host range as Animalia and Plantae. They replicate in different organ and tissues of insects including plants where they reside only in phloem sieve tubes. The ability of these pathogens to invade and colonize in two dissimilar host environment and replicate intra-
30 cellularly is remarkable and implies the evolution of mechanism that enable the bacteria to modulate cellular process in their hosts.
3.2.8. Phytoplasma infection disturbs plant developmental process
Phytoplasmas infected plants exhibit a wide range of symptoms on vegetative and non vegetative parts. The common symptoms caused by phytoplasma disease include phyllody (development of floral parts into leafy structures), virescence (development of green flowers and loss of normal petal pigments), witches broom (proliferation of stem, branches and leaves), proliferation of axillary shoots, generalized stunting
(small flowers and leaves and shortened internodes), discoloration of leaves or shoots, leaf curling, bunchy appearance of growth at the ends of stem and generalized decline (dieback of shoots and unseasonal yellowing, pinkish or reddening of the leaves) (Lee et al ; 2000; Bertaccini, 2007).
Phytoplasmas affect the phloem function, impaire translocation of carbohydrates with subsequent effects on photosynthesis (Lepka et al ., 1999, Maust et al ., 2003). For example, photosystem II, is inhibited in many phytoplasmas infected plants (Bertamini et al ., 2004). Some other symptoms, such as the yellowing of leaves, are thought to be caused by the phytoplasma's presence in the phloem, affecting its function and changing the transport of carbohydrates (Muast et al ., 2003).
Often negative on plants, some symptoms were found positive like the production of more axillary shoots in poinsettia infected with OY phytoplasma which enables the production of poinsettia plants that have more than one flower (Lee et al ., 1997).
The mechanism of pathogenesis of phytoplasma is different from those of other gram negative phytopathogenic bacteria like Pseudomonas, Ralstonia, and Xanthomonas which inhibit in apoplast of infected plants and have developed type III secretion sysrem to secrete virulence factors. In contrast, phytoplasma live within the sieve cells and their virulence factors or effector proteins may simply be secreted through secA-dependent protein translocation system (Kakizava et al ., 2004).
Different phytoplasma effectors have been identified in recent years that modulate cellular process in plant development and probably also those involved in plant defense (Hogenhout and Loria, 2008; Bai et al.,
31
2009). The identification and functional characterization of the effectors of phytoplasma were facilated by whole genome sequence information of various phytoplasma genomes, the use of Arabidopsis thaliana in symptom development and effector function analysis (Hogenhout and Music, 2010).
3.2.9. Phytoplasma effectors and Associated Diseases
Plants have developed potent strategies to defend themselves against insect herbivory and pathogen invasion. These include physical barriers like cuticular wax and cell walls (Kosma et al ., 2010; Tooker et al .,
2010; Perez-Donoso et al ., 2010), and constitutive chemical defenses (Kaplan et al ., 2008). These defenses can be direct or indirect inducible defenses (Wu and Baldwin, 2010).
Herbivores and plant pathogens try to overcome these physical and biochemical defenses. Specific molecules or proteins, called effectors, are produced or secreted by plant pathogens for that purpose.
Different insects, nematodes and pathogenes use effectors to facilitate their colonization and multiplication in host. Effectors can be included as elicitors, cell wall degrading enzymes, toxins, phytohormone analogs, and other mollicutes that alter host plants (Hogenhout et al ., 2009).
Phytoplasma effectors could play different roles after releasing into host. Phytoplasma infection cause physiological and morphological changes in host plant which can have for consequence to attract insect host as it is generally supposed that effectors improve the pathogen fitness (Hogehout et al ., 2009). An increase in insect vector fitness would increase the pathogen fitness.
Phytoplasmas are biotroph and may increase the vegetative phase of host plant to live host for long time by reverting the flower development (phyllody). Another possibility is that phytoplasma interfere with fundamental process of plant development in order to reduce or alter the production of phytohormones such as jasmonic acid as it is involved in development as well as defense signaling.
Four phytoplasmas genome has been sequenced. These are Onion Yellows phytoplasma strain M
(OY-M; Candidatus Phytoplasma asteris) (Oshima et al ., 2004), Aster Yellows phytoplasma strainWitches’
Broom (AYWB; Ca. P. asteris) (Bai et al ., 2006), Australian Grapevine Yellows (AUSGY; Ca . P.
Australiense) (Tran-Nguyen et al ., 2008), and Apple Proliferation phytoplasma (AP; Ca. P. mali ) (Kube et
32 al ., 2008) . In genomes of these phytoplasmas, Sec-A secreted proteins are canditate effectors and likely to interact with host cell component upon secretion from phytoplasmal cell.
Recently, 56 candidate effectors proteins have been identified and named secreted AY-WB proteins
(SAPs) (Bai et al ., 2009), 7 out of 56 were encoded on four plasmids and 49 were found on chromosome
(Bai et al ., 2006). By similar approach, 45 in AY, 41 in Australian Grapevine Yellows (AUGSY), 13 in AP,
25 in maize bushy stunted phytoplasma (MBSP) candidate effectors have been indentified. MBSP, OY, and
AY-WB belong to group 16SrI and show that even closely species have different effector contents. Thus, phytoplasma with restricted plant host range may have fewer effectors than those with broad plant host range
(OY, AY-WB and AUSGY).
Effector proteins, the 9kDa SAP11 of AY-WB and the <5 kDa TENGU of OY, were traced beyond the phloem. It shows that these can be transported through the pores of plasmodesmata, which size exlusion limit is of 67 kDa (Bai et al ., 2009; Hoshi et al ., 2009; Stadler et al ., 2005). SAP11 was detected in cell nuclei (Bai et al ., 2009) but TENGU was found at the tip of the stem and was not detected in nuclei (Hoshi et al ., 2009).
Naturally, AY Phytoplasma cause witches broom in infected plants. Transgenic Arabidopsis expressing SAP11 were made in order to find the role of this small protein. SAP11 was found to induce witches broom symptom in Arabidopsis (Sugio et al ., 2010). These plants have curly leaves and an increased number of axillary stem that resemble the witches broom symptoms exhibited by AY-WB infected plants. It has been shown that SAP11 destabilizes the TCP (TEOSINTE BRANCHED1, CYCLOIDEA,
PROLIFERATING CELL FACTOR1 and 2) transcription factors which is involved in JA synthesis and control the plant development (Martin-Trilo et al ., 2010).
The destabilisation of Class11 TCPs leads to a decreased synthesis of JA, a phytohormone that is involved in the defense response against the leafhopper Macrosteles quadrilineatu, the AY-WB insect vector
(Sugio et al ., 2010). It has been shown that survival and reproduction and fecundity of AY-WB leafhopper was increased when reared upon AY-WB infected phytoplasma and interestingly more progenies were produced by feeding on SAP11 expressing Arabidopsis (Kay et al ., 2007; Sugio et al ., 2010).
33
A similar work was done by Hoshi et al ., Who screened for OY effector proteins that induce such morphological changes (Hoshi et al ., 2009). Transient expression of OY- phytoplasma effector candidates in
Nicotiana bethamiana identified a gene that induces witches broom and dwarfism (Hoshi et al ., 2009). The identified protein was of 4.5 kDa in size which correspond to a gene named tengu as witches broom-like symptoms are called tengu-su in Japanese. Transgenic Arabidopsis lines that express TENGU show morphological alteration, including witches broom, dwarfism (short internodes), defects in phyllotaxis, and production of sterile flowers.
It has been shown by microarray that tengu expressing Arabidopsis lines revealed a downregulation of several auxin responsive genes and auxin eflux carrier genes. It is possible that tengu alters plant morphology by manipulating other molecular pathways including directly interfering with auxin biosynthetic and signalling pathways.
3.2.10. Phytoplasma interfere with flower development
The most dramatic symptoms in phytoplasma infected plants include alteration of flower morphology, such as sepal hypertrophy, virescence, phyllody, big bud symptoms and the production of inflorescence shoots from flowers (Bertaccini et al ., 2007).
Flowers development involved major 4 stages
1. transition from vegetative growth to reproductive growth
2. Establishment of floral meristem and its maintenance
3. Activation of floral organ identity genes and formation of sepals, petals, stamens and carpels
4. Termination of floral meristem
These stages have been shown to be altered in phytoplasma infected plants. First molecular insight into the flower malformation induced stolbur phytoplasma infection was provided by Pracros et al ., 2006. The stolbur phytoplasma infected tomato showed sepal hypertrophy, virescence, phyllody and big buds like symptoms.
Through semi-quantitative RT-PCR, It was demonstrated that tomato homologs WUSCHEL (WUS),
CLAVATA1 (CLAV1), APETALA3 (AP3), and AGAMUS (AG) were down regulated whereas
34 transcription factor LEAFY (LFY) was unchanged or slightly up-regulated (Pracros et al ., 2006). The authers suggested that phytoplasma infection may lead to the reduction of DNA methylation that leads to suppression of gene induction (Pracros et al., 2006).
It was also reported that homolog of WUS and some class B genes that regulate floral organ identity are down-regulated in OY phytoplasma infected petunia flowers (Himeno et al , 2010). Further, Cettul and firrao demonstrated that SEPALATA3 (SEP3) was down-regulated in Italian clover phyllody phytoplasma- infected Arabidopsis showing altered flowers (Cettul and Firrao, 2010). Recently, SAP54, an effector of AY-
WB, was shown to alter flower development when over expressed in Arabidopsis thaliana (MacLean et al .,
2011).
The Arabidopsis plants, infected by AY-WB phytoplasma, produce flowers with green petals with trichomes and sepal hypertrophy. The variety of developmental symptoms observed in phytoplasma-infected plants suggests that effector interferes with speciation of organ identity, and termination of floral meristem and floral meristem establishment. It is suggested that SAP54 may target MADS domain transcription factors.
It is yet not known at what level phytoplasmas interfere with flower development, because many flower development genes influence each others expression through a feed back loop mechanism. The effectors may induce pleitropic effects.
3.2.11. Phytoplasma and other microbial effectors
Phytoplasma effector SAP11 targets plant nuclei and destabilzes plant CIN-TCPs and causes morphological changes in the plant and suppress JA-mediated defense. Some other pathogens also secrete effectors that target cell nuclei but mode of action is distinct or unkown from that of phytoplasma.
An efftector, PopP2, is secreted by Ralstonia solanacearum , which may have virulence function
(Deslandes et al ., 2003) but in Ralstonia solanacearum resistant plants , PopP2 is an avirulent determinant and colocalize with corresponding resistance gene (R) in nuclei and prevents degradation of RRS1 (Tasset et al ., 2010).
35
Xanthomonas species produce TTSS transcription activator-like (TAL) effectors that target plant genes promoter for gene expression. For example, Xanthomonas oryzae tal effector , PthXo1 and AvrXa7 that seem to pump plant sugar transporter into apoplast and xylem where pathogen colonize.
In addition to pathogens, some insects and nematodes also secrete effectors, for example, Agrobacterium tumefaciens secrete effector to cause gall making by producing plant growth hormones auxin and cytokinins
(Zopan et al ., 2000).
White fly, an important insect, secrete BC1 of the Gemini virus tomato yellow leaf curl china virus which cause upward leaves curling. BC1 interference with MYB transcription factor and suppress the induction of some JA-responsive genes and promote the fitness of whitefly (Yang et al ., 2008).
3.2.12. Plant defense response
Plants are continuously attacked by a wide range of harmful pathogens and pests such as nematodes and insect herbivores, viruses, bacteria, fungi. Each of these potential attackers exploits highly specialized features to establish a parasitic relationship with its host plant.
Plant pathogens secrete diverse virulence factors to cause disease and infect the host plants severly
(Glazebrook et al ., 2005; Gohr and Robatzek, 2008; Nurnberger and kemmerling, 2009). Apart from pathogens, plants frequently are attacked by more than one herbivore species at the same time (Strauss,
1991; Vos et al ., 2001).
Phloem feeder insects like silver whitefly, aphid and chewing caterpillars establish direct access to amino acids and carbohydrates through the vascular tissue. They cause damage mechanically and by secreting chemicals from their herbivore saliva, mid gut fluids (Howe and Jander, 2008; Wu and Baldwin,
2009; Walling, 2000, 2009).
To defend themselves against all these different types of pathogens and herbivores, plants have an array of structural barriers and preformed antimicrobial metabolites to prevent or attenuate invasion by potential attackers.
36
Plants can perceive the duration, quality and quantity of these chemical and mechanical signals, and use “infestation- alert” cues to induce resistance that act directly to antagonize insect growth and development, and indirectly by synthesizing and releasing volatiles to attract natural enemies.
These defenses limit damage by the plant’s attacker and stimulate defenses to counter future attacks.
They also preserve vegetative growth and reproduction, yet minimize fitness costs to the plant (Koornneef and Pieterse, 2008; Dicke and Baldwin, 2010; Heil, 2010; Mooney et al., 2010).
These complex biochemical and physiological responses are often results in a local or systemic resistance (SR) to further challenge (De Vos et al ., 2006; De Vos and Jander, 2009). Plants defend themselves well during systemic acquired resistance (SAR) associated with hypersensitive response (HR).
Systemic acquired resistance is an enhanced level of basal resistance induced in the infected and non infected parts of whole plant. During hypersensitive response, sudden death of cell occurs around the infection sites that prevent the spread of disease from the infection sites.
Plants synthesise phytohormones and used as signalling molecules in defense response. They are essential for the regulation of plant growth, development, reproduction and survival. The importance of
Salicylic acid (SA), Ethylene (ET), Jasmonic acid (JA) and (phytohormnes) as primary signals in the regulation of the plant’s immune response against herbivore insects and pathogens is well established (Pozo et al , 2004; Van Loon et al ., 2006; Loake et al ., 2007; Howe et al ., 2004; Glazebrook, 2005; Walling, 2009).
Generally, Salicylic acid is part of defense responses against biotrophic pathogens, while JA is involved in defense responses against necrotrophic pathogens and insects (Beckers and Spoel, 2006).
Induction of pathogenesis-related proteins (PRs) is one of the best characters associated with defense pathways.
Pathogenesis related proteins are composed of 17 groups, most often associated with plant defense response. PR proteins are induced by various types of pathogens (viroids, viruses, bacteria, and fungi), by diverse environmental stresses, and by treatment with salicylic acid or ethylene and show diverse functions
(Van Loon, 1997; Van Loon et al ., 2006).
37
Lox2 expression and JA accumulation are reduced in the SAP11 transgenic Arabidopsis lines upon phytoplasma infection (Sugio et al., 2010). JA signaling pathway in Arabidopsis is involved in the plant defense response to AY-leafhoper herbivory and AY-WB SAP11 interferes with this defense response through destabilization of TCP that positively regulate JA synthesis. Thus SAP11 enhances the fitness of
AY-WB phytoplasma.
Two types of immunity systems have been described in plants against different pathogens. Pathogen associated molecular patterns (PAMPS) or MAPS are recognized by the pattern recognition recepters (PRRs) of broad host range which lead to PAMP trigered immunity (PTI). A Successful pathogen may employ and secrete virulence effectors that suppress PTI which result in compatible (suceptible) interaction.
When these virulence factors or effectors are recognized by plants, then results in incompatible interaction (resistant). There are many pathogens that have evolved effector to suppress PTI or ETI (Dodds and Rathjen, 2010). For instance, P. syringae strain DC3000, secrete effectors that suppress PTI or ETI or both indicating that suppression of both type of reaction helps to colonize the bacterial pathogens.
PAMPS include lipopolysacharides, peptidoglycans, and conserved domains of flagellin but phytoplasma have no such effectors because absence of outer cell wall. Phytoplasma have genes encoding cold shock proteins (CSP) and elongation factor Tu (EF-Tu) like PAMPS which can induce PTI in host. It is not clear that how plants respond to phytoplasma by their defense pathways.
3.2.13. Stolbur Phytoplasmas
Stolbur phytoplasma isolates belong to the subgroup 16Sr XII-A of the revised classification (Lee et al ., 1998) (Figure 2). Stolbur phytoplasma has a broad plant host range which affects many crops such as important solanaceous crops (tomato, potato and pepper) (Figure 4 A-C) Apiaceae (celery), grapevine
(Figure 4 B), sugar beet, strawberry (Figure 4 D), lavender, and maize (Lee et al ., 1998; Fos et al ,. 1992;
Garnier, 2000; Danet et al ; 2003; Langer and Maixner, 2004, Jovic et al ., 2007; Carraro et al ., 2008; Navratil et al ., 2009).
38
Insect vectors acquire stolbur phytoplasma by feeding on an infected plant. The phytoplasmas invade the midgut and then during incubation they propagate to other insect tissues that include the salivary glands from which they are transmitted through saliva to the plant phloem sap (Maillet and Gouranton, 1971).
A B
C D
Figure 4: Diseases caused by stolbur phytoplasma in different plants. A: stolbur of tomato B: Bois
Noir of grapes. C: stolbur of solanaceae. D: Marginal chlorosis of strawberry.
The stolbur phytoplasma also infects a number of dicotyledonous weeds, the most important of which are bindweeds ( Convolvulus arvense L. and Calystegia sepium L.) and stinging nettle (Urtica dioica
L.)
The known vectors of stolbur phytoplasma are the cixiid plant hoppers Hyalesthes obsoletus
Signoret, (Figure 5) (Fos et al ., 1992; Maixner, 1994; Sforza et al ., 1998; Gatineau et al ., 2001),
Pentastridius leporinus (L.) and Reptalus panzeri (Low). Like H. obsoletus P. leporinus (L.) and R. panzeri 39 are polyphagus with early stages of development occurring on grass. Bindweed and stinging nettle is the primary host of H. obsoletus.
Stolbur is quarantine diseases and have been shown to be spread from one region to other various sources and now it has been found in Asia region. The polyphagy of cixiid plant leafhopper Hyalesthes obsoletus (Figure 5) play a key role in the spread of stolbur (Fos et al ; 1992; Maixner, 1994, Sforza et al .,
1998). Hyalesthes obsoletus can transmit the phytoplasma to a wide range of wild plants, which can be found along the borders of vegetable plots or in or around vineyards (Marcone et al , 1997; Romanazzi et al ., 2009).
Photo B. Batailler Picture INRA
Ca. stolbur Phytoplasma Hyalesthes obsolestus
Figure 5: Insect vector of stolbur phytoplasma
In grapevines (Vitis vinifera L ), stolbur phytoplasma is the agent of grapevine yellows disease ‘Bois
Noir’ (BN) (Figure 4). Grapevine is itself a dead end host and does not contribute to the epidemiology of
Bois Noir. The association of stolbur phytoplasma diseases with different vectors, suggest key differences in disease etiology and epidemiology between monocot and dicot hosts.
There exist different isolates of stolbur which cause different symptoms. Their genome size varies from 860 kbp to 1350 kbp (Marcone et al , 1999) and has 83% of genes homologous to ‘ Ca. P. asteris ’ genes
(Cimerman et al , 2006). Stolbur phytoplasma infected plants showed dramatic developmental abnormalities but virulence factors of this phytoplasma have yet not been identified.
Stolbur phytoplasma infection has been reported to affect strongly floral morphology (Blattny,
1954; Valenta and Musil, 1961). When it was first reported on tobacco (Kostoff, 1933), the stolbur disease was named "female sterility" because infected plants showed flower malformations and failed to produce
40 seeds. The same disease reported on tomato in Australia was named “big buds” due to hypertrophy of flower buds (Hill, 1943).
In stolbur diseased plants, the most obvious examples of flower abnormalities are the development of green flowers and the loss of normal flower pigment (virescence), the development of floral organs into leafy structures (phyllody) and, in some cases, malformations of the stamens and carpels leading to plant sterility
(Cousin and Abadie, 1982).
Stolbur phytoplasma infection induces floral malformation in various plants including tomato
(Messiaen and Marrou, 1967; Valenta et al ., 1961). It is known that symptoms may differ in a host plant depending upon the stolbur phytoplasma isolate (Marchoux and Messiaen, 1967; Marchoux et al ., 1967).
Similar symptoms have been observed in periwinkle (Catharanthus roseus ) plants infected by the isolate PO of stolbur phytoplasma (Figure 6) (Jaraush et al ., 2001).
Healthy Periwinkle Infected Periwinkle
Figure 6: symptoms on Periwinkle caused by stolbur PO infection, top right (yellowness) and bottom right (phyllody) (Picture INRA)
41
In tomato, two different isolates of stolbur phytoplasma, named C and PO, induce different symptoms.
A B
Healthy (H)
C D
Stolbur C
E F
Stolbur PO
Figure 7: Phenotype of healthy and infected tomato Solanum lycopersicum var. Ailsa Craig . Healthy tomato (A-B) A: normal green leaves. B : normal flower with all floral organs. Stolbur C infected tomato (C-D) C: small yellow and dented leaves. C: small yellow green but nearly normal flowers. Stolbur PO infected tomato (E-F) E: Large yellow and crooked shaped leaves. F: Hypertrophied sepals, aborted petals and
42
The tomatoes infected by stolbur PO phytoplasmas show abnormal flower development such as hypertrophied sepals, sometime closed to big bud, and aborted petals and stamens development. The infected leaves are of regular size, crook-shaped and chlorotic. Symptoms are different in stolbur C phytoplasma infected tomato (Figure 7 A-F).
Indeed, in stolbur C infected tomato, leaves are small and indented, and flowers are nearly normal, leading to fruit. Evidence suggests that the Stolbur PO phytoplasma downregulates gene involved in petal formation ( AP3 and its orthologues) and genes involved in the maintenance apical meristem ( Wus and
CLV1 ). It has been shown that tomato flower abnormalities induced by stolbur PO phytoplasma infection are associated with changes of expression of floral development genes (Pracros et al ., 2006).
4. Objective of the Thesis
Our objectives were double:
First, we wanted to study the deregulation of the floral developmental genes which lead to the observed symptoms. Pracros showed that SlDEF, a gene involved in petal formation, was repressed, while its transcription factor FA was unchanged or slightly up-regulated.
This transcription factor could not be responsible for the SlDEF repression. As Methylation is known to be involved in the transcriptional silencing of genes we wanted to study if Stolbur phytoplasma infection affects
DNA methylation process in tomato flower buds.
In this purpose, we have studied
1. The expression of floral development gene Falsiflora FA (transcription factor) and SlDEF in stolbur
phytoplasma infected tomato by RT-PCR
2. The effect of demethylation through Azacitydine treatment on the expression of SlDEF and
symptoms on stolbur phytoplasma infected tomato.
3. The expression of enzymes involved in the process of methylation (Methyltransferase) and
demethylation (Demethylase).
43
4. The SlDEF DNA methylation status through MSRE-PCR, Southern Blotting and Bisulfite
sequencing.
The second objective was to study the defense related genes expression during stolbur phytoplasma infection. Indeed, Plant responds to infection by activating their defense pathways by the expression of defense genes. Stolbur phytoplasma-infected tomato show symptoms but nothing is known about the defense pathways.
In this purpose, we have studied
1. The Salicylic acid dependent defense pathway genes expression
2. The Jasmonic acid dependent defense pathway genes expression
3. The Ethylene dependent defense pathway genes expression
4. The effect of pre-activation of SA and JA dependent defense pathway on the development of disease
symptoms in stolbur PO phytoplasma infected tomato.
44
Chapter I Introduction
Implication of DNA methylation in SlDEF gene expression during
flower development in stolbur phytoplasma-infected tomato
45
Known ABC genes by class from Arabidopsis thaliana
A
Normal flower with sepals, petals, stamens and carpels development
C
B D
Mutant flower of classe B ( apetala3 ) sepals, carpels
E
Mutant flower of classe A gene ( apetala2 ) Mutant flower of Classe C gene (agamous) carpels ,stamens Sepals ,petals
Mutant flower of ABC (sepalata) class All whorls leaf like
Figure 8: Phenotype of Arabidopsis healthy and mutant flowers of known ABC class genes.
A: normal flower with all floral organs. B: Class A gene (apetala2) mutant flower without
sepals and petals development. C: Class B gene ( apetala3 ) mutant flower without petal and
stamens development. D: Class C gene ( agamous ) mutant flower without development of
carpels and stamens. E: ABC mutant flower with all whorls leaf like (Lohmann and Weigel,
2002).
46
1. Introduction
1.1. Model of flower development
In the last 10 years, data on the molecular and genetic mechanisms that underlie floral induction, floral patterning and floral organ identity have accumulated. The most detailed and comprehensive picture of the molecular mechanisms underlying flower development came from the studies performed on Arabidopsis .
The ABC model of flower development in angiosperms was formulated by Enrico Coen and Ellio
Meyerowitz in 1991. The accumulated knowledge served as a basis for works in other species and to show on the applicability of the floral patterning mechanisms to a wide range of plant species.
1.1.1. Flower development genes in Arabidopsis thaliana
From these studies unifying principles of flower development have been derived and the first, called the ABC model (Weigel and Meyerowitz, 1994; Yanofsky, 1995), postulate that three activities, A
(APetala1/APetala2 ), B ( APetala3/PIstillata ), and C ( AGamous ), specify floral organ identity in a combinatorial manner . This model is built on the observation of mutants with defects in floral organ development (Figure 8).
Figure 9 show that the expression of class A genes induces the development of sepals. The expression of class B genes together with class A genes induces the development of sepals. The expression of class B genes induces the development of stamens together with class C genes and the development of petals together with class A. The expression of class C genes induces the development of Carpels. The characterization of sepallata1, 2, 3 triple mutant in Arabidopsis has led to the formulation of the ABCE model (Figure 8), which consider the importance of class E genes for the development of the floral organs
(Krizek and Fletcher, 2005).
The second unifying principle involves the central role of the gene LEAFY ( LFY ) in specifying a meristem as floral (Weigel and Nilsson, 1995), in integrating the outputs of floral inductive pathways
(Blazquez and Weigel, 2000) and in activating the floral organ identity ABC genes (Weigel and Meyerowitz,
1993; Parcy et al ., 1998; Lenhard et al ., 2001; Lohmann et al ., 2001).
47
NAME : Arabidopsis (NAME) : Tomato
CLAVATA 1, 2, 3
Classe A : AP1/AP2 Classe B : AP3/PI Classe C: AG Classe D: STR/SHP1/SHP2 Classe E : SEP LEAFY WUSCHEL (FA)
A E A B E B C E C E
AP1/AP2 SEP AP1/AP2 AP3/PI SEP AP3/PI AG SEP AG SEP (TM29) (SlDEF) (TAG1) (TAG1)
Sepals Petals stamens Carpels
Figure 9: Flower development genes in Arabidopsis and tomato . Falsiflora (FA) or Leafy is
a transcription factor for respective target gene TM29 or Apetala1 and Apetala2 , SlDEFICIENS (SlDEF ) and TAG1 .
Generally, flower development can be divided into 4 steps that occur in a temporal sequence: (i) switch from vegetative to reproductive growth in response to both environmental and endogenous signals,
(ii) activation of a small group of meristem identity genes that specify floral identity (including LFY ), (iii) activation of floral organ identity genes (ABC model) by the meristem identity genes, of which LFY , and (iv) floral organ identity genes activating downstream ‘‘architect” genes that specify the tissues constituting the four floral organs (Figure 9).
1.1.2. Flower development genes in Lycopersicum esculentum
Interestingly, flower abnormalities observed in Stolbur phytoplasma infected tomato plants were reminiscent of homeotic-like modifications versus transformations described in Arabidopsis thaliana floral
48 organs mutants such as agamous and apetala 3 (Figure 8, 9) identity meristems mutants such as lfy and shoot apical meristem mutants as wuschel and clavata.
Orthologs of genes involved in the ABC model and orthologs of LFY are present in a wide range of flowering and non-flowering plant species (Frohlich and Parker, 2000; Gocal et al ., 2001), the Arabidopsis genetic regulation model of flower development was taken, as a reference, to analyze the expression pattern of tomato (Lycopersicon esculentum cv Ailsa Craig) floral development genes.
LeFLORICAULA (LeFLO), LeWUSCHEL (LeWUS), LeCLAVATA1 (LeCLV1), LePLENA
(LePLE), and LeDEFICIENS (LeDEF), homologs of Arabidopsis thaliana genes LFY , WUS , CLV1 , AG , and
AP3, respectively were studied. TM29 and TAG1 in tomato are homologues to AP1/AP2 and AG respectively in Arabidopsis (Figure 9).
In agreement with the morphological and anatomical changes, the expression of the key developmental genes controlling the floral development was found to be impaired by stolbur phytoplasma infection (Pracros et al ., 2006).
It has been shown that plant DNA methylation can be altered under biotic stress conditions. Tobacco mosaic virus infection induces hypomethylation of genomic regions such as pathogen-responsive
NtAlix1 gene, which becomes concomitantly activated (Wada et al ., 2004). Altered plant DNA methylation has been reported for the cotton – verticillium spp. pathosystem, but only at the biochemical level.
The Arabidopsis thaliana displays centrometric DNA hypomethylation upon infection by
Pseudomonas syringae (Pavet et al ., 2006). These observations support the idea that levels of DNA methylation change upon exposure to environmental stress, and that such change may globally regulate the expression of stress responsive genes.
In the literature, there are some evidences that the methylation could inhibit the gene expression
(Chan et al ., 2005). DNA methylation may be involved in the down-regulation of floral development genes.
49
For example, it has been suggested that, in Arabidopsis , APETALA3 down-regulation may result from their hypermethylation (Finnegan et al ., 1996).
In plants and animals, the cytosine methylation process is known to regulate expression of genes in an epigenetic manner. Genes can be down-regulated when the numbers of methylated cytosines are more abundant as compared with normal methylation status of gene (Jacobsen et al ., 2000). This phenomenon is called ‘hypermethylation’. Methylases and Demethylases are the enzymes that constitute the methylation pattern of the genomic DNA.
1.2. DNA methylation
DNA methylation is an epigenetic mark in plants, some fungi and most animals (Matzake et al .,
2005; Chan et al ., 2005). Methylation can occur through either DNA methylation or protein methylation contributing to epigenetic inheritance.
Approximately 2% to 8% of cytosines are methylated in mammals and up to 50% in higher plants but 5-methyl-Cytosine (5-meC) is undetectable in budding and fission yeasts, nematodes, or adult
Drosophila melanogaster (Doerfler, 1983). Cytosine methylation act an immune function in most bacterial species and protects the bacteria from bacteriophage infection by selectively degrading un-methylated foreign DNA using type 2 restriction-modification systems (Wilson, 1988).
DNA methylation down-regulate gene transcription in promoter elements directly by interfering with the binding of transcriptional activators and indirectly by favouring the formation of repressive chromatin by methyl DNA-binding proteins (Bird, 2002). In higher eukaryotes, DNA methylation is critical for a wide range of cellular functions such as genome stability and defense, imprinting, X chromosome inactivation, paramutation, tissue-specific gene regulation, carcinogenesis, and aging (Bird, 2002; Bender, 2004).
Cytosine methylation patterns are established and maintained by a conserved group of proteins called
DNA methyltransferases (MET) that catalyse transfert of a methyl group from S-adenosyl-L-methionine
(SAM) to the fifth position of cytosine bases in DNA yielding m 5C.
50
DNA methylation is a post replicative process. The methyl group is transferred from S-adenosyl- methionine to cytosines in DNA by DNA methyltransferase enzymes in a reaction that involves base flipping, whereby a cytosine base is swung completely out of the DNA helix into an extra helical position so that the enzyme can access and methylate the cytosine (Roberts and Cheng, 1998) (Figure 10).
Cytosine (C) 5 methyl-cytosine ( m5 C) S-adenosyl-methyl-methionine
DNA methyltransferases
Figure 10: DNA methylation caused by DNA Methyltransferases. S-adenosyl-methyl- methionine (SAM) is used as donor for CH3. DNA methyltransferase attach CH3 to carbon number 5 in DNA.
Both maintenance DNA methyltransferases and de novo DNA methyltransferases from mammals and plants have conserved methyltransferase catalytic domains in their C-terminal regions (Bestor, 2000; Chan et al .,
51
2005). Dnmt3 (DNA methyltransferase 3) and DRM2 (Domain Rearranged Methyltransferase 2) are the de novo DNA methyltransferases in mammals and plants, respectively (Bestor, 2000; Chan et al ., 20057).
The maintenance of CpG methylation is catalyzed by Dnmt1 in mammals and the Dnmt1 ortholog
MET1 in plants, that detect a hemi-methylated meCG/GC and methylate the unmodified C. Plants also contain non-CpG methylation; for example, In CpNpG context (N is A, T, or C) methylation is maintained by CMT3 (chromodomain methyltransferase 3), a plant-specific enzyme, whilst asymmetric CpNpN methylation cannot be maintained (it must occur de novo). CpNpN methylation is carried out mostly by
DRM2 and directed by 24-nt small interfering RNAs (siRNAs) (Chan et al ., 2005; Matzke and Birchler,
2005).
The level and pattern of 5-meC are determined by both DNA methylation and demethylation processes. For some genes, targeted or specific methylation by methyltransferases may be sufficient to create their methylation patterns, without the need for demethylases; for others, promiscuous methylation would need to be pruned by demethylases to generate the desired methylation pattern
DNA methyltransferase
There are currently three classes of DNA methyltransferases identified in Arabidopsis thaliana .
The MET1 Class of Methyltransferase : The first plant gene encoding a cytosine methyltransferase was isolated from Arabidopsis (Finnegan and Dennis, 1993). METI encodes a protein that is similar in structure to the mouse methyltransferase, Dnmt1. METI and Dnmt1 share 50% amino acid identity within the methyltransferase domains, but are less conserved in the amino-terminal domains which are 24% identical.
The Arabidopsis METI gene is a member of a small multigene family. METI is the predominant methyltransferase of this class based on transcription levels (Genger et al. , 1999. MET1 is expressed in vegetative and floral tissues, where the highest expression is in meristematic cells (Ronemus et al. , 1996).
METI homologues have now been identified in carrot, pea, tomato and maize . Two genes encoding proteins of the METI class have been sought in both carrot and maize. The two carrot genes are over 85%
52 resemblance, with the major difference being the presence of a repeated sequence of 171 bp, which is represented five times in one gene, but only once in the other (Bernacchia et al. , 1998).
The two genes show somewhat different expression patterns by in situ hybridization that suggest that these genes may have evolved different functions (Bernacchia et al. , 1998). The two METI -like genes in maize, identified by Southern hybridization, may be orthologous as maize is an ancient tetraploid (Olhoft,
1998). Although additional genes encoding METI-like proteins have been found in pea, only one gene has so far been identified. Thus, while it seems unlikely that Arabidopsis is unique in having such a large family of
METI -like genes, the data suggest that there may be fewer genes in other plant species.
In tomato, MET1 family of DNA methyltransferase have been indentified (Tessyier et al., 2008).
Alignment of the METI-like methyltransferases from plants and vertebrates points out some consistent differences between the plant and animal enzymes. The amino terminus of the mouse enzyme, Dnmt1, has three known functions and resemblance between the corresponding domains of METI and Dnmt1 suggests that this region of METI may have similar functions.
This domain directs the enzyme to the nucleus and targets the enzyme to the replication fork during
S phase of cycle (Leonhardt et al. , 1992; Liu et al. , 1998). The amino-terminal domain also causes the protein to discriminate between hemimethylated and unmethylated DNA, giving the enzyme a strong preference for a hemimethylated template (Bestor, 1992).
These functions strongly indicated that the main role of DNA methyltransferase 1(Dnmt1) and, by analogy, the main role of METI is restoring the parental pattern of cytosine methylation to the newly replicated daughter strands – maintenance methylation. So, it is suggested that MET1 family is involved in the maintenance of CpG methylation.
The Chromomethylases (CMT) family of Methyltransferase: A second class of methyltransferase was identified by Henikoff and Comai (1998) during searching the plant database for proteins containing chromodomain motifs (Paro and Hogness, 1991). A small gene family encoding chromomethylases (CMT family) with at least 3 members has been identified in Arabidopsis (Rose et al. , 1998; Genger et al. , 1999).
53
The sequence similarity between the METI and CMT family of enzymes ranges from 30% to 70% within these conserved motifs. The sequence identity for the conserved motifs within each family is higher, ranging from 65% to 100% (Genger et al. , 1999). The length of the amino-terminal domain in CMT proteins is variable and shows no similarity to that of the METI family, again suggesting a different role for these enzymes.
Transcripts of CMT1 were detected in both vegetative and floral tissues, although transcripts abundance was greater in flowers. This suggests that in ecotypes where the gene is not disrupted, CMT1 may have a role. The other two known members of the CMT family are also transcribed, but transcrips of CMT2 were more abundant than those of CMT3 or CMT1 (Genger et al. , 1999).
The CMT methyltransferases are widely spread throughout the plant kingdom with at least two genes in both Brassica and maize. In tomato, CMT class of Methyltransferase were identified and expression pattern was determined in tomato during fruit development (Tessyer et al., 2008). The two genes in Brassica appear to be homologues to CMT1 and CMT2, respectively, but in the polyploidy maize, the two known genes are probably orthologues, rather than different members of the CMT family (Rose et al. , 1998; Genger et al. , 1999).
Because to date no methyltransferases of class CMT have been identified in other kingdom except kingdoms of plant and may be unique to plants (Genger et al. , 1999). So, it is suggested that
Chromomethylases CMT family is involved in the maintenance of CpNpG methylation. Maintenance methylation activity is necessary to preserve DNA methylation after every cellular DNA replication cycle.
Enzymes from the Maintenance class recognize the methylation marks on the parental strand of DNA and transfers new methylation to the daughter strands after DNA replication.
The Domain Rearranged Methyltransferases (DRM) family: Plants possess another class of
DNA methylases, domain rearranged methylases (DRM). Genes of these enzymes have been found in
Arabidopsis , maize, and, possibly, in soya and tomato. The N-terminal regulatory region of DRM contains
54 ubiquitin-binding sequences, and this suggests a possibility of ubiquitination of these DNA methylases.
These proteins are most similar in functions with DNA methylases of the Dnmt3 family.
It is suggested that DRM can de novo methylate DNA in asymmetric sequences and maintain this modification of cytosine during inactivation of transposons and transgenic silencing (Cao et al ., 2000). Thus,
Domain Rearranged Methyltransferases DRM family create new methylation marks on the DNA. DRM2 is the only enzyme that has been considered as a de novo DNA methyltransferase. Plants are likely to have also other DNA methyltransferases. Unlike the situation in animals, decreased methylation of the plant genome is not lethal but causes anomalies in development and appearance of new phenotypes (Finnegan et al ., 1996).
1.3. DNA Demethylation
DNA demethylation is a process of removal of methyl group from nucleotide in DNA (Figure 11).
Figure 11: DNA demethylation caused by DNA Demethylase/ DNA glycosylase. DNA
demethylase remove CH3 from DNA. DNA methylase and DNA demethylase are necessary for the repression and activation of genes.
DNA demethylation might be passive or active. Passive process takes place in the absence of methylation of newly synthesized DNA strands by DNMT1 during several replication rounds (for example, upon 5-Azacytidine treatment) whereas active DNA demethylation occurs in the absence of DNA replication
55
(Kapoor et al ., 2005) which can also be used in vitro to remove methyl groups from DNA. The level and pattern of 5-meC are determined by both DNA methylation and demethylation processes.
Several evidences point out the importance of DNA demethylation in many cellular processes during development, defense, and disease. In plants, an important function of active DNA demethylation is to counteract the activities of the RNA-directed DNA methylation pathway to prevent the spreading of methylation from repetitive sequences to neighboring genes. Active DNA demethylation helped in genome regulation and plant development.
Demethylation is involved in prevention of transcriptional silencing of transgenes and endogenous genes . In plants, siRNAs of the 24-nt size class, generated from transgene or endogenous gene promoter, can trigger cytosine methylation and consequent transcriptional silencing of homologous DNA and the promoter is then silenced by RNA-directed DNA methylation (Baulcombe, 2004; Matzke et al ., 2007; Matzke and
Bircher, 2005).
For example, the ROS1 (repressor of silencing 1) gene, which encodes a 5-meC DNA glycosylase/demethylase, is required to maintain the expression of a transgene and its homologous endogenous gene (Gong et al ., 2002). The homologous genes are targets of RNA-directed DNA methylation and become heavily methylated and silenced transcriptionally in the absence of ROS1 activity.
ROS1 is needed to suppress the promoter methylation and silencing of a number of other endogenous genes (Zhu et al ., 2007). DML2 and DML3, two ROS1-like 5- meC DNA glycosylases, also prevent the hypermethylation of specific genomic loci in Arabidopsis vegetative tissues (Penterman et al .,
2007).
In Arabidopsis, the demethylase triple mutant ros1 dml2 dml 3and DNA methylation profiles of wild type plants indicated 179 loci with increased methylation showing that these loci are normally targeted for demethylation (Penterman et al ., 2007). Together, these studies provided evidence that active demethylation prevents the spreading of DNA methylation from repetitive sequences and thusly protects
56 genes from deleterious methylation. The results suggest that many plant genes may be under the dynamic control of DNA methylation and active demethylation.
Active DNA demethylation is also critical and activate the expression of the maternal allele of imprinted genes such as FWA (flowering wageningen ) (Kinoshita et al ., 2004), the polycomb group genes
MEA ( MEDEA ) (Gehring et al ., 2006) and FIS2 (fertilization independent seed 2 ) (Jullien et al ., 2006), and the C-terminal domain of poly (A)-binding protein MPC (maternally expressed PAB C-terminal) (Tiwari et al ., 2008) in Arabidopsis.
In Arabidopsis, the methylated inactive state is the default state for these imprinted plant genes, and demethylation and consequent expression take place only in the central cell of the female gametophyte and the endosperm where an active demethylase is expressed (Huh et al ., 2008). The endosperm is derived from the fertilized central cell and supports embryo growth. It is a terminally differentiated tissue, so the methylation status of the hypomethylated maternal allele does not need to be reset.
In the Arabidopsis, DNA demethylase mutant dme , the imprinted MEA and FWA genes are not demethylated and the genes remain silent in the endosperm, which results in impaired seed development
(Huh et al ., 2008). In maize, the polycomb group gene FIE1 (fertilization independent endosperm 1 ) is similarly imprinted (Hermon et al ., 2007). Only the maternal allele of FIE1 is expressed, and the expression is restricted to the endosperm, owing to active demethylation in this tissue.
Most transposons and other repetitive DNA sequences in plants are considered to be silent because of heavy DNA methylation, particularly at CpG sites. In the Arabidopsis ros1 mutants, some transposon or retrotransposon loci become more heavily methylated, especially at CpNpG and CpNpN sites (Zhu et al .,
2007). Recently, in the demethylase triple mutant ros1 dml2 dml3 of Arabidopsi, genome-wide methylation profiling identified transponsons among hundreds of loci that show hypermethylation and reduced expression (Lister et al ., 2008).
ROS1-like 5-meC DNA glycosylase/DNA demethylase in rice is important for maintaining the expression and promoting the transposition of the retrotransposon Tos17 (Guo-LiangWang, personal
57 communication). Other repetitive sequences and transposons that make up the major parts of large plant genomes, and play important roles in shaping genome structure and in evolution by promoting genetic variability through transposition (Bender, 2004, Feschotte et al ., 2002). The dynamic control of transposons by both methylation and active demethylation may keep the plant epigenome plastic so that the plant can respond efficiently to environmental challenges during adaptation.
DNA Demethylases are also implicated in the decondensation of 5S rDNA chromatin: In
Arabidopsis, 5S rDNA repeats within pericentromeric heterochromatin are silenced by siRNA-directed DNA methylation and chromatin compaction (Pikaard, 2006). In early seedling development, there is a decondensation of 5S rDNA chromatin (Douet et al., 2002). The decondensation is caused by ROS1- mediated active DNA demethylation. Shortly after, the 5S rDNA chromatin is recondensed through the Pol
IV-dependent RNA-directedDNA methylation pathway.
The brief decondensation of 5S rDNA chromatin caused by active DNA demethylation may be important in unlocking a fraction of 5S rDNA units so that they can respond to environmental changes
(Douet et al ., 2002). Demethylation was also shown to be involved in Plant responses to biotic and abiotic stresses , global DNA methylation is substantially reduced in Arabidopsis plants infected with the bacterial pathogen Pseudomonas syringae (Pavet et al ., 2006).
Indeed, there is a marked decrease at the 180-bp centromeric repeat and other loci following the pathogen attack. This change occurs in the absence of DNA replication, which suggests that it involves an active demethylation mechanism (Pavet et al ., 2006). In tobacco plants, DNA methylation is substantially and rapidly reduced in the coding region of a glycerophosphodiesterase like gene one hour after treatment with aluminium, NaCl, cold, or oxidative stress (Choi and Sano,
2007).
The reduced DNA methylation in the coding region correlates with stress induction of the glycerophosphodiesterase-like gene (Choi and Sano, 2007). Although the functional significance of gene
58 coding sequence methylation is unclear (Zhu, 2008), the correlation suggests that active DNA demethylation is involved in permitting the induction of the glycerophosphodiesterase-like gene by stress.
DNA Demethylases
Two forward-genetic screens in Arabidopsis independently led to the discovery of DNA glycosylases that suppress DNA methylation and activate gene expression. Studies of DNA glycosylase mutants provided strong genetic evidence that these enzymes are DNA demethylases. They were named
DEMETER, ROS1, DML1 and DML2. Genetic and biochemical studies demonstrated that two bifunctional
DNA glycosylase/lyases, ROS1 and Demeter, function as demethylases (Gong et al ., 2002; Agius et al.,
2006; Gehring et al., 2006; Morales-Ruiz et al., 2006). ROS1, DME, DML2, and DML3 can excise 5-meC from all sequence contexts (Penterman et al ., 2007).
ROS1: ROS1 can specifically recognize methylated DNA, its glycosylase activity removes the 5 methylcytosine base and its lyase activity nicks the DNA backbone at the abasic site by beta, gamma elimination mechanism (Agius et al ., 2006) (Figure 12). Then, an unmethylated cytosine nucleotide is added through the action of other enzymes in the DNA repair pathway (Kapoor et al ., 2005).
Figure 12: Diagram of ROS1-mediated DNA demethylation by a base excision repair pathway. Question marks indicate as yet unidentified enzymes in the pathway. ROS1 is a bifunctional DNA glycosylase/lyase that removes the 5-methylcytosine base and then cleaves the DNA backbone at the abasic site, resulting in a
59 gap that is then filled with an unmethylated cytosine nucleotide by as yet unknown DNA polymerase and ligase enzymes (Jian-Kang Zhu, 2009).
Loss-of-function mutations in ROS1 result in hypermethylation of some genes promoter (Gong et al ., 2002). For example, both the transgene RD29A promoter and the endogenous RD29A promoter from the ros1 mutants were heavily methylated in all sequence contexts. Whereas only a low level of methylation was found in the promoters from wild type plants which indicates that anti-silencing factors, later named ROS, exist in wild-type plants and that such factors are defective in the mutants (Kapoor et al ., 2005).
The fact that DNA glycosylases are plausible DNA demethylases and ROS1 has an important role of in suppressing DNA methylation in vivo which suggests that ROS1 is a DNA demethylase in Arabidopsis.
ROS1 is predicted to be a bifunctional DNA glycosylase/lyase (Gong et al ., 2002).
DEMETER: Demeter has mostly similar biochemical properties as ROS1, however its role is restricted to the female gametophyte where it is specifically expressed (Gehring et al ., 2006). DME was identified because loss-of-function mutations in this gene resulted in impaired endosperm and embryo development, and consequently in seed abortion (Choi et al ., 2002).
DME is preferentially expressed in the central cell and synergids of the female gametophyte (Choi et al ., 2002) when comparing with the widespread expression of ROS1 in all plant tissues examined (Gong et al ., 2002). DME is needed for the maternal allele-specific expression MEDEA (MEA ) in the central cell and endosperm. MEA , an imprinted gene, encodes a SET-domain polycomb group protein required for seed development (Grossniklaus et al ., 1998, Kiyosue et al ., 1999).
However, more recent work, has demonstrated that the maternal allele of MEA in the seed is hypomethylated relative to the nonexpressed paternal allele, and that DME is required for this maternal allele-specific hypomethylation of MEA (Gehring et al ., 2006).
The important role of DME in preventing the methylation of the MEA locus or of an unknown positive regulator of MEA is also consistent with the finding that mutations in the maintenance DNA methyltransferase MET1 suppress the effect of dme mutations (Xiao et al., 2003). Another imprinted gene,
60
FWA , also depend on DME for its maternal allele-specific expression in the endosperm (Kinoshita et al .,
2004). Unnlike imprinting in mammals, Imprinting of FWA and MEA in plants does not result from allele- specific de novo methylation (Li et al ., 1993), but rather from maternal gametophyte-specific gene activation by DME mediated DNA demethylation.
Regulation of DNA Demethylase Gene Expression: The level of DNA methylation of the genome seems to be strictly controlled, and therefore, the levels and activities of DNA demethylases as well as methyltransferases must be tightly regulated. The demethylase DME is expressed primarily in certain reproductive tissues of plants (Choi et al ., 2002). In contrast, the transcripts of ROS1 have been found in vegetative and reproductive tissues of plants (Gong et al ., 2002). Although the ROS1 protein accumulation pattern has not been examined and it may differs in different tissues and in response to environmental perturbations.
Interestingly, the transcriptional level of ROS1 appears to correlate with plant genome DNA methylation status. In the maintenance DNA methyltransferase mutant met1 , genome DNA methylation is drastically decreased (Lister et al ., 2006). ROS1 mRNA is virtually undetectable in met1 mutant plants
(Huettel et al ., 2006; Mathieu et al ., 2007).
Similarly, in the RdDM mutants nrpd1a , rdr2 , dcl3 , and drm2 , ROS1 mRNA level is also very low
(Huettel et al ., 2006; Mthieu et al ., 2007). In addition, the RdDM mutant drd1 , nrpd2a , nrpd1b , and ago6 also have reduced ROS1 transcript levels (Huettel et al ., 2006).
In these RdDM mutants, locus-specific DNA methylation is blocked, but the total level of genome
DNA methylation is not severely affected. These results suggested that ROS1 expression responds to the methylation levels of certain loci in the genome.
Presumably, DML2 and DML3 expression levels are also sensitive to DNA methylation but detection is weak. The identification of DNA demethylases has generated many new questions relevant to the mechanism of targeting demethylation to specific loci and the interplay between DNA demethylation and other epigenetic modifications (such as histone modifications, histone variants, and chromatin remodeling).
The known demethylases in Arabidopsis do not appear to function in global demethylation because ros1 , dme , or ros1 dml2 dml3 mutations affect the methylation status of only a relatively small number of
61 loci (up to several hundred) and do not substantially change the methylation level of the bulk genome DNA
(Gehring et al ., 2006; Lister et al ., 2006; Penterman et al ., 2007; Zhou et al ., 2007). The locus-specific effects of the demethylases suggest that there are mechanisms for targeting the demethylases.
Micro RNAs and small interfering RNAs (siRNAs) are sequence-specific guides for silencing of genes (Boulcombe, 2004; Carrington and Ambros, 2003; Matzke et al ., 2007; Sunkar et al ., 2007). De novo
DNA methylation in plants is guided by 24-nt siRNAs (Matzke et al ., 2007; Pikaard et al ., 2006). It appears that DNA demethylases and their regulators are not uniformly distributed in the nucleus.
Immunostaining showed that ROS1 and ROS3 are colocalized in discrete foci in the nucleoplasm
(Zheng et al ., 2008). These foci do not correspond to chromocenters where methylated DNA is most concentrated. The fraction of the ROS1 and ROS3 proteins are found in the nucleolus (Zheng et al ., 2008), which suggest that active DNA demethylation may be involved in the epigenetic regulation of rRNA genes and nucleolar dominance (Preuss and Pikaard, 2007).
Although it is possible that these sites are storage forms of the ROS proteins, it is also conceivable that DNA demethylases and their regulators are organized into active demethylation factories where specific methylated sequences are gathered for efficient demethylation. In plant mutants lacking ROS1 or related demethylases, the overall 5-meC levels are not affected, although specific loci are hypermethylated (Gong et al ., 2002, Lister et al ., 2008; Penterman et al ., 2007; Zhu et al ., 2007). Therefore, knowing where to look for methylation changes is important.
Regulation of Genes Expression by Azacytidine Treatment: Treatment of plant and animal cells with 5-azacytidine (5-azaC) results in demethylation of DNA directly by incorporation of an analogue of cytosine which can not be methylated, in place of cytosine during DNA replication (Jones et al ., 1984; Jones,
1985). Methyltransferases in the presence of azacytidine incorporate it into DNA during replication and into
RNA during transcription in the cell.
Azacytidine acts as potent inhibitor of methyltransferases and false substrate that lead to reduction of
DNA methylation indirectly inhibiting the methyltransferase enzyme (Bouchard and Momparler, 1983).
Demethylation of DNA by 5-azaC has been correlated with induction of transcription in a number of genes systems in plants and animals (Klaas et al ., 1989; Jones et al ., 1985). It can also be used in vitro to remove
62 methyl groups from DNA. This may weaken the effects of gene silencing mechanisms that occurred prior to the methylation.
Methylation process is therefore considered to secure the DNA in an inactive state while DNA
Demethylation process may reduce the stability of silencing signals confering relative gene activation
(Whitelaw and Garick, 2005).
The early-flowering phenotype, which includes reduced height at maturity and a reduction in the number of leaves produced on the main stem was the most striking effect induced by the 5-azaC treatment
(Fieldes and Amyot 1999; Fieldes and Harvey, 2004). Albeit, in total, 27% of the progeny of the plants grown from treated seeds displayed altered phenotypes in terms of flowering time and/or height, and much of this induced phenotypic variability was inherited into subsequent generations (Fieldes, 1994).
Treating seeds with 5-azaC show similar heritable effects that have also been reported for triticale
(Heslop- Harrison, 1990; Amado et al ., 1997), Brassica oleracea (King, 1995) and rice (Sano et al ., 1990). In rice, the treatment induced dwarfism and a concomitant reduced level of 5-methylcytosine (5mC) in the
DNA (Sano et al ., 1990), which was shown to be transmitted into the second generation after treatment.
Vyskot et al . (1995) have also demonstrated the meiotic transmission of hypomethylation induced by 5-azaC. The heritable effects of 5-azaC are thought to result from the demethylation of sites associated with loci that control developmental characteristics or phenotypic.
The demethylation is likely to be part of a generalised reduction level of genomic 5mC, which results from the incorporation of 5-azaC into the DNA and its inhibitory effects on DNA methyltransferases and the maintenance of methylation (Santi et al. , 1983; Jones, 1984).
It has also been recognised that epigenetic changes, such as alterations in DNA methylation status, are likely to be involved in regulating ontogenetic changes in gene expression in plants (Finnegan et al .,
1996; Richards, 1997). The direct effects of 5-azaC treatments on cell differentiation and gene expression have provided the information supporting this contention (LoSchiavo et al ., 1989; Burn et al ., 1993; Galaud et al ., 1993; Vyskot et al ., 1993; Chen and Pikaard, 1997; Tatra et al ., 2000; Horvath et al ., 2002; Santos and
Fevereiro, 2002).
63
Nevertheless, it is only recently have been described that definitive examples of epimutations (epi- alleles) results from changes in methylation status for plant genes that are developmentally regulated
(Hoekenga et al . 2000; Jacobsen et al ., 2000; Soppe et al .,2000; Stokes et al ., 2002).
In Arabidopsis, loss-of-function mutations (ddm1) at the decreased DNA methylation 1 (DDM1) locus (Vongs et al ., 1993), loss-of-function mutations (met1) at the DNA methyltransferase 1 gene (MET1)
(Kankel et al,. 2003), or antisense forms of MET1 (Ronemus et al ., 1996; Finnegan et al ., 1998; Genger et al ., 2003) have been used to produce lines with reduced levels of 5mC that display a range of heritable morphological defects and developmental changes.
Previous evidence suggested that plant DNA methylation can be altered under biotic stress conditions. It has also been reported that methylation has possible role of gene repression. SO, in previous study we have shown that tomato floral abnormalities induced by stolbur phytoplasma infection are associated with changes in the expression of flower development genes (Pracros et al ., 2006).
Regarding the link between floral abnormalities and cytosine methylation, it has been suggested that, in Arabidopsis , APETALA3 down-regulation may result from their hypermethylation (Finnegan et al .,
1996). So, the objective of this chapter is to determine the possible role of epigenetic change in the down- regulation of SlDEF gene in stolbur phytoplasma-infected tomato.
Indeed, stolbur PO phytoplasma induced symptoms i.e. petals and stamen abortion are concomitant with SlDEF repression, repression which cannot be explained by the action its transcription factor FA because this one has no change in its expression or is slightly activated.
As methylation could be the mechanism by which SlDEF is repressed, its role was further studied.
For this purpose, SlDEF expression was monitored in 1mm, 3mm and 5mm flower buds and in leaves of stolbur phytoplasma infected tomato, showing the repression. Confirmation of the possible involvement of the methylation was brought by results obtained after 5-Azacytidine treatment.
64
Then, the expression of enzymes genes that are implied in methylation, i.e. methyltransferases and demethylases was measured and results show that indeed expression of these enzymes genes was down- regulated in stolbur PO phytoplasma infected tomato flower buds. The last part of this chapter deals with the methylation status of the DNA itself, more precisely on part of SlDEF sequence.
65
Chapter I
Results
Implication of DNA methylation in SlDEF gene expression during
flower development in stolbur phytoplasma-infected tomato
66
1mm Leaves 5mm 3mm
Stolbur PO
Stolbur C
Healthy
Figure.1A: Material chosen: leaves and flower buds from tomato ( Solanum lycopersicum var. Ailsa Craig). Flower buds of 1 mm, 3 mm, 5 mm and leaves of healthy and stolbur C and stolbur PO phytoplasma- infected tomato were chosen for this study.
1mm 3mm 5mm Flower buds Leaves H C PO H C PO H C PO H C PO
fU5 – rU3
H = Healthy tomato C= Stolbur C tomato PO = Stolbur PO tomato
Figure 1B: Detection of stolbur phytoplasma by Nested-PCR : DNA was extracted from 1mm, 3mm, 5mm flower buds and leaves of healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato. Nested PCR was done using universal primers pair (Gundersen and Lee, 1996) followed by primers pair fU5 and rU3.
67
Chapter 1
2. Results
Implication of DNA methylation in SLDEF Gene Expression during flower development in stolbur phytoplasma-infected tomato
2.1. Material chosen for the study
As we wanted to study the floral development gene SlDEF , Flower buds of 1mm, 3mm, and 5mm were chosen as biological materials. Leaves were also taken as control. Buds and leaves from healthy and equally infected tomato by two different isolates of stolbur phytoplasma, C and PO, were used for this study
(Figure 1A).
Figure.1A: Material chosen: leaves and flower buds from tomato ( Solanum lycopersicum var. Ailsa
Craig). Flower buds of 1 mm, 3 mm, 5 mm and leaves of healthy and stolbur C and stolbur PO phytoplasma-infected tomato were chosen for this study.
The stolbur infection of plants was verified by amplification with phytoplasma specific primers fU5-rU3. The absence of band signal in lane ‘’H’’ indicate that Stolbur-C and stolbur PO phytoplasma were not detected in flower buds of 1mm, 3mm and 5mm as well as in leaves of healthy tomato (Figure 1B).
A strong signal was detected in 1mm, 3mm and 5mm flower buds and leaves of stolbur C and stolbur
PO phytoplasma infected tomato indicating the infection of these samples (Figure 1B).
2.2. Up-regulation of Falsiflora (FA)
Falsiflora (FA) is the transcription factor of flower development gene SlDEF . We found that the level of mRNA expression of FA was unchanged or slightly up-regulated in 1mm flower buds of tomato infected by stolbur PO phytoplasma as compared to healthy ones (Figure 2)
68
1mm flower bud
H PO
FALSIFLORA (FA)
EF1 alpha
Figur e 2: Expression of floral development gene FA by RT -PCR on tomato RNA: Floral development gene FA expression in 1 mm flower bud. RNA extracted from 1mm flower buds of healthy (H) and stolbur PO (PO) phytoplasma-infected tomato. Upper Lane show expression of FA and lower lane for EF1 alpha as control.
Flower buds
1mm 3mm 5mm Leaves
H C PO H C PO H C PO H C PO
Sl DEFICIENS (SlDEF)
EF1 alpha
Figure 3A: Expression of SlDEF in stolbur phytoplasma-infected tomato through semi-quantitative RT-PCR: RT-PCR was done on total RNA extracted from 1mm, 3mm, 5mm flower buds and leave of Healthy (H), Stolbur-C (C) and Stolbur PO (PO) phytoplasma-infected tomato. The constitutive expression of EF1 alpha is shown as control gene.
69
2.2.1. Expression of SlDEF in Stolbur phytoplasma- infected tomato
In tomato, SlDEF is involved in the development of petals. Its expression was studied by semi quantitative RT-PCR using primers LeAP3 (F5-5’-GGTTGAGTAGTAATTTTCACC-3’) and
LeAP3 (R2- 5’-TTCATACTTCCACATGATC-3’) which are specific for SlDEF (Figure 3A). Clear bands were obtained for healthy tomato flower buds of 1mm, 3mm and 5mm showing the expression of SlDEF in these organs (Figure 3A).
Expression of SlDEF is specific to flowers so it was not detected in leaves of healthy and infected tomato as shown by the absence of bands in lanes corresponding to leaves (Figure 3A). No bands or very faint bands were obtained with mRNA extracted from flower buds of stolbur PO-infected tomato (Figure 3A) indicating that the expression of SlDEF was severely repressed in all sizes of flower buds as compared to healthy.
We quantified the intensity of each band and presented the result in the form of histogram which clearly showed the down-regulation of SlDEF gene expression. In 1mm, 3mm and 5 mm flower buds, the expression was 5 times, 4 times and 3 times lower in stolbur PO phytoplasma-infected tomato as compared to healthy control respectively (Figure 3B). EF1 alpha was used as control gene. These results confirmed the down-regulation of SlDEF mRNA in flower buds of 1 mm, 3 mm and 5 mm of tomato infected with stolbur
PO phytoplasma
The stolbur C phytoplasma induces leaves symptoms in tomato but the development of flowers with formation of petals was nearly normal. Expression of SlDEF was not found to be changed, or only slightly up-regulated in stolbur C infected tomato flower buds as compared to healthy ones. This could be relied to the nearly normal flower development in stolbur-C phytoplasma infected tomato.
Indeed, clear bands of amplifications were found in stolbur C phytoplasma-infected tomato. The intensity of each band of SlDEF mRNA was quantified and results were presented in the histogram in Figure
3B. We did not found any significant difference in the expression level of SlDEF gene in 1 mm, 3 mm and 5 mm flower buds of stolbur C phytoplasma infected tomato as compared to healthy controls (Figure 3B).
70
The repression of SlDEF gene in PO- infected tomato do not seem to be due to its transcription factor Falsiflora (FA) as it is slightly up-regulated. The repression should come from another mechanism. In this purpose, we wanted to determine if methylation, a mechanism which could induce gene repression, was involved in the down-regulation of SlDEF . In a first attempt, tomato seeds were treated with 5-Azacytidine (5-Aza-C), an analog of cytidine, which can not be methylated.
71
Healthy Stol-C Stol-PO
SLDEF
1200 1000 800 600 400 200
0
-200 Relative gene expression 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
Figure 3B: Histogram showing the SlDEF gene expression in stolbur phytoplasma-
infected tomato through semi-quantitative RT-PCR : Expression of SlDEF in 1mm, 3mm, 5mm flower buds and leaves of healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-
infected tomato (from left to right). Green bar for healthy control tomato, yellow bar for stolbur C phytoplasma-infected tomato, pink bar for stolbur PO phytoplasma-infected tomato (n=3)
Figure.4: symptoms on tomato treated with 10µM 5-azacytidine
-AZA and Stolbur PO phytoplasma-infected tomato Healthy non treated Tomato
Figure 4A: Normal development of flower Figure 4B: yellows with abnormal development of flower
10 µM AZA and Stolbur PO phytoplasma-infected tomato
Figure 4C: yellows with normal development of flower
72
2.3. Effect of demethylation induced by 5-azacytidine treatment in stolbur phytoplasma infected tomato
Azacytidine treatment is used to reduce the level of methylation in tomato. So we treated tomato seeds with 10µM, or 50µM of 5-Azacytidine (5-Aza-C) in order to cause demethylation. Two months old seedlings were infected with stolbur C or stolbur PO phytoplasma by grafting. Apparition of disease symptoms were observed on leaves and flower buds and SlDEF gene expression was also studied.
2.3.1. Diseases symptoms observed in 5-azacytidine treated tomato
In non treated healthy, stolbur C and stolbur PO phytoplasma infected tomato, we observed regular symptoms, i.e. yellowing on leaves but nearly normal development of flowers in stolbur C tomato and severe yellowing on leaves and abnormal development of flowers in PO infected tomato. In batches of treated healthy or not treated healthy tomato, no stolbur symptoms were seen on leaves and flowers as expected
(Figure 4A).
2.3.2. Effect of demethylation induced by 5-azacytidine treatment in stolbur phytoplasma infected
In the case of stolbur PO, untreated plants, did not show symptoms up to 12 days post grafting
(Figure 4B). In contrast, respectively 5 and 7 out of the 10 plants treated with Aza-C (10 and 50 µM, respectively) were symptomatic (Figure 4C).
All 10 stolbur PO-infected plants treated with 50 µM Aza-C showed leaf yellowing at 27 days post grafting while 39 days were required for having all 10 untreated plants symptomatic. A similar delay in symptom production was also observed in the case of stolbur C-infected plants.
Knowing that the number of flower bunches is strongly reduced in stolbur PO-infected tomato, we studied the effect of Aza-C treatment on the number of bunches in both healthy and stolbur phytoplasma-infected tomato (Figure 5).
73
Healthy Stol-C Stol-PO
Effect of 5-azacytidine
7
6
5
4
3
2
1 Number of bunches per plant (mean) plant per bunches of Number 0 - azacytidine 10 µM azacytidine
Figure 5: Effect of azacytidine on tomato flowers bunches: Green bars indicate healthy tomato light yellow show stlolbur C infected tomato, pink bar show stolbur PO infected tomato.
Flower buds
1mm 3mm 5mm Leaves
H C PO H C PO H C PO H C PO Sl DEFICIENS (SlDEF)
EF1 alpha
Figure 6: Expression of SlDEF in 5 -aza C treated tomato: Semi-quantitative RT-PCR using SlDEF gene specific primer. Total RNA extracted from 1mm, 3mm, 5mm flower buds and leaves of healthy (H), stolbur-C (C), and stolbur-PO (PO) phytoplasma-infected tomato. Constitutive expression of EF1 alpha was used as control gene. SlDEF was equally expressed in 1mm, 3mm, 5mm flower buds of 10 µM azacytidine treated healthy and stolbur C and stolbur PO phytoplasma- infected tomato.
74
In healthy plants, the Aza-C treatment (50 µM) had a limited effect as the average number of bunches per plant was 4 as compared to 5.5 in the untreated plants. On the contrary, in stolbur PO- infected plants the average number of bunches increased from 1 to 4 upon Aza-C treatment (Figure
5).
Interestingly, when treated with Aza-C, healthy, stolbur C-, and stolbur PO-infected plants had identical numbers of bunches, suggesting that DNA demethylation might somehow circumvent the effect of stolbur infection.
In contrast, Aza-C treatment had little effect on flower formation. Stolbur PO-infected tomato plants are characterized by flowers with hypertrophied sepals and aborted petals and stamens.
Similar phenotypes were observed on Aza-C treated plants, irrespective to the concentration used.
However, in contrast to untreated plants, approximately 2 % of flowers in these Aza-C treated plants harbored nearly apparently normal flowers that were never observed in untreated, stolbur PO-infected plants
(Figure 4C).
Although the Aza-C treated, stolbur PO-diseased plants possessed a limited number of normal flower buds, these results clearly show that Aza-C treatment (i.e. DNA demethylation) did interfere with the plant response to stolbur phytoplasma infection and partially counteract the deregulation of floral development.
2.3.3. Up-regulation of SlDEF in 5-azacytidine treated-stolbur phytoplasma infected tomato
Through RT-PCR, we found that SlDEF gene was nearly equally expressed in 1mm, 3mm and 5mm flower buds of 5-aza-C treated healthy and 5-aza-C treated-infected tomato.
The intensity of bands signals of mRNA of SlDEF gene were same in 1mm, 3mm and 5mm flower buds of 5-aza-C treated healthy and 5-aza-C treated stolbur C or stolbur PO phytoplasma- infected tomato (Figure 6).
75
In leaves of 5-aza-C treated healthy and 5-aza-C treated stolbur C or stolbur PO-infected tomato, the expression level of mRNA was not detected confirming that expression of SlDEF is restricted only to the flowers (Figure 6). EF1 alpha as control gene was found to be equally amplified in flower buds and leaves of healthy and infected tomato (Figure 6).
These results suggested that the repression of SlDEF gene in abnormal floral buds of stolbur-PO phytoplasma-infected tomato and restoration of its expression in 5-azacytidine-treated tomato is atleast partially due to the epigenetic phenomenon of DNA methylation. So, it is further suggested that methylation status of SlDEF gene is involved in the control of its expression in stolbur PO phytoplasma infected tomato.
2.4. Differential expression of DNA Methyltransferase genes in stolbur phytoplasma-infected tomato
In order to determine if the possible SlDEF methylation was correlated to the expression of genes involved in cytosine methylation, we decided to conduct a gene expression study of genes involved in the process of methylation which is carried out through enzymes called DNA Methyltransferases. There are mainly 3 known classes of DNA Methytransferases:
ClassI is represented by methylases which are involved in the maintenance of CpG methylation.
ClassII is represented by Chromomethylases which are specific to plants and are involved in maintenance of
CpNpG methylation. Class III is represented by Domain Rearranged Methylases which do de novo methylation.
We determined the expression level of 7 DNA Methyltransferase genes from class I ( MET1 ), class II
(CMT2, CMT3 and CMT4 ) and class III ( DRM5, DRM7 and DRM8 ) by semi-quantitative RT-PCR in flower buds and leaves of healthy and stolbur C or stolbur PO phytoplasma infected tomato.
2.4.1. Expression of Methyltransferase genes in stolbur phytoplasma-infected tomato
2.4.1.1. Class I (MET1) Methyltransferases
Expression of MET1 class was determined by RT-PCR in flower buds and leaves of tomato infected.
76
Flower buds
1 mm 3 mm 5 mm Leaves
H C PO H C PO H C PO H C PO Classe I: MET1 SlMET 1 SlCMT 2 SlCMT 3 Classe II: CMT SlCMT 4
SlDRM 5
Classe III: DRM SlDRM 7 SlDRM 8
EF1 alpha
Figure 7: Expression of methylases genes in stolbur phytoplasma -infected tomato: Semi- quantitative RT-PCR using methylases genes specific primers. Total RNA extracted from 1mm, 3mm, 5mm flower buds and leaves of healthy (H), Stolbur-C phytoplasma (C), and
Stolbur-PO phytoplasma-infected (PO) tomato. EF1 alpha was used as control gene (n=3).
1 mm Flower buds 3 mm Flower buds 5 mm Flower buds Leaves Genes H C PO H C PO H C PO H C PO SlMET1 1 1.00±SE0.05 0.97±SE0.08 1 1.02±SE0.02 1.10±SE0.25 1 0.82±SE0.11 0.94±SE0.04 1 1.49±SE0.68 0.98±SE0.52 SlCMT2 1 1.88±SE0.54 0.11±SE0.03 1 1.21±SE0.10 0.22±SE0.14 1 0.68±SE0.17 0.09±SE0.05 1 1.92±SE0.57 0.13±SE0.10 SlCMT3 1 1.27±SE0.08 0.26±SE0.11 1 1.38±SE0.50 0.57±SE0.22 1 0.72±SE0.18 0.38±SE0.02 1 1.30±SE0.29 0.17±SE0.10 SlCMT4 1 1.73±SE0.27 0.45±SE0.20 1 1.34±SE0.64 0.53±SE0.17 1 0.98±SE0.57 0.56±SE0.23 1 2.21±SE0.68 0.09±SE0.06 SlDRM5 1 1.28±SE0.21 0.87±SE0.20 1 0.84±SE0.18 0.66±SE0.02 1 0.69±SE0.22 0.76±SE0.14 1 2.05±SE1.50 0.44±SE0.27
SlDRM7 1 1.59±SE0.39 3.71±SE1.52 1 1.39±SE0.16 1.93±SE1.10 1 1.11±SE0.10 1.92±SE0.40 1 1.05±SE0.14 0.10±SE0.01 SlDRM8 1 3.63±SE0.97 1.77±SE0.88 1 2.10±SE0.52 1.23±SE0.17 1 1.51±SE0.81 0.62±SE0.47 1 2.79±SE0.52 0.66±SE0.05
Table1: Ratio of the expression values of DNA methylase genes through semi-quantitative RT-PCR : Relative gene expression as compared to healthy tomato. Gene repression< 1 < Gene activation. Healthy (H), stolbur C (C), stolbur PO (PO) phytoplasma-infected tomato in 1mm, 3mm, 5mm flower buds and leaves respectively. Each value represent the average of 3 biological replicates (n=3) with ± SE (Standard Error).
77
Clear bands signals of MET1 genes of nearly equal intensity was obtained.(Figure 7-SlMET1 -bands signals in lane C) for 1 mm, 3mm, 5 mm flower buds and leaves of healthy or stolbur phytoplasma infected tomato. This is confirmed by semi q-RT-PCR as shown by the RGE or average expression values which are nearly equal to 1 (Table 1). Indeed, RGE for MET1 was of 1.00± SE0.05 in 1 mm flower bud, 1.02±SE0.02 in 3mm flower bud, 0.82±SE0.11 in 5mm fllower buds and 1.49±SE0.68 in leaves of stolbur C infected tomato as compared to the value 1 of healthy control (Figure 7-SlMET1 - C). Results are similar for stolbur
PO infected tomato (Figure 7-SlMET1 - PO).
2.4.1.2. Class II (CMT) Chromomethylases
The enzymes of class II are specific to plants and are called Chromomethylases. The expression of 3 chromomethylases ( CMT2, CMT3, CMT4 ) was determined in flower buds of 1mm, 3mm and 5mm and in leaves of stolbur C phytoplasmas-infected tomato. The clear bands signals of each of 3 chromomethylases
(CMT2, CMT3, CMT4 ) indicated their expression in flower buds of 1mm, 3mm and 5mm and in leaves of stolbur-C phytoplasmas infected tomato (Figure 7).
After quantification of bands intensities, we noticed that SlCMT were globally up-regulated in stolbur C infected tomato. For example, in 1mm flower buds, RGE was of 1.88±SE0.54 for SlCMT 2 , 1.27±SE0.08 for
SlCMT3 and 1.73±SE0.27 for SlCMT4 (Table1).
On the contrary, they were clearly down regulated in stolbur PO infected tomato, whatever the bud size. We found a detection of very faint signal bands of all the Class II enzymes ( SlCMT2, SlCMT3,
SlCMT4 ) in 1mm, 3mm and 5mm flower buds and leaves of stolbur PO phytoplasma infected tomato (Figure
7- CMT2, CMT3, CMT4 bands in PO).
For SlCMT2, we measured transcriptional expression value 0.11±SE0.03 in 1mm, 0.22±SE0.14 in
3mm, 0.09±SE0.05 in 5mm flower buds and 0.13±SE0.10 times in leaves. SlCMT3 was repressed as
0.26±SE0.11 times in 1mm, 0.57±SE0.22 in 3mm, 0.38±SE0.02 in 5mm flower buds and 0.17±SE0.10 times in leaves. Simillar to others SlCMTs, SlCMT4 was down-regulated as 0.45±SE0.20 fold in 1mm,
0.53±SE0.17 in 3mm, 0.56±SE0.23 in 5 mm flower buds and 0.09±SE0.06 in leaves (Table 1).
78
Healthy Stol-C Stol-PO
MET1
2000
1500
1000
500
0 Relativegene expression 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
CMT3
25000
20000 15000 10000 5000
Relative gene expression gene Relative 0 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
DRM5
4000
3000
2000
1000
Relativegene expression 0 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
Figure 8 : Expression of MET1, CMT3 and DRM5 in stol-C and stol-PO phytoplasma infected tomato through semi-quantutative RT-PCR : Relative expression of Methylases in
1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, yellow bar for stolbur C phytoplasma infected tomato, pink bar for stolbur PO phytoplasma-infected tomato.
Expression was normalized by Elongation factor 1 (EF1alpha) as control gene (n=3).
79
2.4.1.3. Class III (DRM) domain rearranged methyltransferases
Concerning the DRM, expression of SlDRM 5 was slightly down-regulated in stolbur PO-infected plants but was not in stolbur C-infected ones. On the contrary, expressions of SlDRM 7 and SlDRM 8 were significantlty affected by stolbur phytoplasma infection. Whereas SlDRM 7 was up-regulated in stolbur PO- but not in stolbur C-infected plants, SlDRM 8 was found to be over-expressed in stolbur C- but not in stolbur
PO-infected plants.
In conclusion, our results showed the differential expression pattern of DNA Methyltransferases in flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato. The transcription level of the mRNA of class 1 Metyltransferase ( MET1 ) was not significantly changed in both stolbur C and stolbur
PO phytoplasma-infected tomato. CMTs of class II are significantly repressed in flower buds and leaves of stolbur PO phytoplasmas.
DRMs of class III have different expression pattern as DRM7 and DRM8 were found to be up- regulated in PO infected tomato flower buds but repressed in infected leaves. The infection by stolbur phytoplasma shows the perturbation of Methylases genes expression. So, it was suggested that stolbur phytoplasma interfere in the process of methylation. Then we decided to study the expression pattern of
DNA demethylases in stolbur phytoplasma infected tomato.
2.5. Expression of DNA demethylase genes in stolbur phytoplasma-infected tomato
In Arabidopsis, four demethylase genes are already known i.e DEMETER , ROS , DML2 and DML3 .
Three orthologs were found in a tomato databank SGN (SOL Genomic Network, http://www.solgenomic.net): SGN-U319729, SGN-U319728, and SGN-U324525. They were named
DML728, DML729 and DML325.
Two of them have identity with ROS and the third one with DEMETER . DML729 has 93% identity with Nicotiana tabacum NtROS1 mRNA for repressor of silencing 1. DML728 has 91% identity with
Nicotiana tabacum NtROS2b mRNA for repressor of silencing2b and DML325 has 71% identity with a part
80 of DEMETER protein from Arabidopsis thaliana. Primers were designed to amplify fragments of these genes and the efficiency of each primer was determined (cf mat met).
The expression level of the 3 DNA demethylases ( DML728, DML729 and DML325 ) was studied using RNA extracted from 1mm, 3mm and 5mm flower buds and leaves of stolbur-C and PO infected tomato through semi quantitative RT-PCR and Real time RT-PCR. Three biological replicates were done and average expression values calculated for semi-quantitative RT-PCR and real time RT-PCR of each DML are indicated in their respective tables.
2.5.1. Expression of DNA demethylase in stolbur- PO phytoplasmas infected tomato
2.5.1.1. Expression of DML728
We determined the expression level of DNA demethylase ( DML728 ) in flower buds and leaves of through semi-quantitative RT-PCR. Signals obtained for DML728 in 1mm, 3mm, 5mm flower buds and leaves of stolbur PO phytoplasma infected tomato were faint as compared to healthy control (Figure 9-
DML728 -Lane PO).
According to average values of gene expression calculated from the gels, the transcription level of
DML728 was reduced 0.55±SE0.03 times in 1mm, 0.50±SE0.03 in 3mm, 0.58±SE0.17 in 5mm flower buds and 0.03±SE0.02 times in leaves of PO infected tomato as compared to healthy control (Table 2-DML728 -
PO).
Through real time RT-PCR, transcript accumulation of DML728 was also found to be down- regulated 0.41±SE 0.09 times in 1mm, 0.20±SE 0.04 in 3mm, 0.16±SE 0.001 in 5mm flower buds and
0.003±SE 0.04 in leaves of stolbur-PO phytoplasma tomato.
The significant down regulation of DML728 in 1mm, 3mm, 5mm flower buds and leaves of PO infec ted tomato has been shown in histogram (Figure 10-DML728 -bar PO) through real time RT-PCR.
81
1mm flower bud 3mm flower bud 5mm flower bud Leaves
H C PO H C PO H C PO H C PO
Dml 728
Dml 729
Dml 325
EF1alpha
Figure 9: Expression of DNA demethylases (DML 728, DML 729 and DML 325) genes in stolbur phytoplasma-infected tomato: Semi-quantitative RT-PCR using demethylases genes specific primers. Total RNA extracted from 1mm, 3mm, 5mm flower buds and leaves of healthy (H), stolbur-C (C), Stolbur-PO (PO) phytoplasma-infected tomato. EF1 alpha was used as control gene (n=3).
1 mm Flower buds 3 mm Flower buds 5 mm Flower buds Leaves Genes H C PO H C PO H C PO H C PO
DML729 1 1.64±SE0.10 0.80±SE0.02 1 1.21±SE0.18 0.33±SE0.10 1 0.98±SE0.16 0.48±SE0.15 1 1.32±SE0.27 0.06±SE0.01
DML728 1 1.72±SE0.38 0.55±SE0.03 1 1.48±SE0.01 0.50±SE0.03 1 1.41±SE0.28 0.58±SE0.17 1 1.76±SE0.52 0.03±SE0.02
DML325 1 1.95±SE0.15 0.96±SE0.40 1 1.36±SE0.01 0.67±SE0.13 1 1.10±SE0.73 0.21±SE0.02 1 0.90±SE0.53 0.10±SE0.10
Table 2: Table showing the ratio of expression values of DNA demethylase genes through semi- quantitative RT-PCR: Relative gene expression as compared to healthy tomato. Gene repression < 1 < Gene activation. Healthy (H), Stolbur C (C), Stolbur PO (PO) phytoplasma-infected tomato in 1mm, 3mm, 5mm flower buds and leaves respectively. Each value represent the average of 3 biological replicates (n=3) with ± SE (Standard Error).
82
2.5.1.2. Expression of DML729
Like DML728 , no clear bands of DML729 were observed in 1mm, 3mm, 5mm flower buds and leaves of infected PO infected tomato as compared to healthy (Figure 9-DML729 -Lane PO). After measuring the bands intensity, we found that DML729 was down-regulated 0.80±SE0.02 times in 1mm, 0.33±SE0.10 in
3mm, 0.48±SE0.15 in 5mm flower buds and 0.06±SE0.01 in PO infected leaves (Table 2-DML729 -PO).
Expression level of DNA demethylase ( DML729 ) was also measured through real time RT-PCR.
The transcriptional level of DML729 was 0.77±SE 0.10 in 1mm, 0.34±SE 0.07 in 3mm, 0.29±SE 0.015 in
5mm flower buds and 0.003±SE 0.001 times in leaves of PO infected tomato. DML729 was significantly down regulated in 1mm, 3mm, 5mm flower buds and leaves of PO infected tomato as compared to control shown by histogram (Figure 10-DML729 -bar PO).
2.5.1.3. Expression of DML325
A faint band of DML325 was observed in 1mm, 3mm, 5mm flower buds and leaves of PO infected tomato comparing to healthy (Figure 9-DML325 -Lane PO). Expression ratio of DNA demethylase DML325 was 0.96±SE0.40 in 1mm, 0.67±SE0.13 in 3mm, 0.21±SE0.02 in 5mm flower buds and 0.10±SE0.10 in leaves of stolbur-PO phytoplasma infected tomato through semi-quantitative RT-PCR (Table 2-DML325 -
PO).
Transcription accumulation of DML 325 was also determined through real time RT-PCR. DML325 was found to be down-regulated as 0.68±SE 0.23 times in 1mm, 0.36±SE 0.033 in 3mm, 0.28±SE 0.06 in
5mm flower buds and 0.005±SE 0.002 in leaves of PO infected tomato.
One representative histogram (Figure 10-DML325 -bar PO) of DML325 shows a significant down- regulation in 1mm, 3mm, 5mm flower buds and leaves of PO infected tomato as compared to healthy control
83
Healthy Stol-C Stol-PO
DML 728
3 2,5 2 1,5 1 0,5 Relativefoldexpression 0 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
DML 729
2,5 2 1,5 1 0,5 0 Relativefoldexpression 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
DML 325
2
1,5
1
0,5 Relativefoldexpression 0 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
Figure 10 : Representative histograms of expression of DNA demethylase: DME728, DME 729 and DME 325 in stol-C and stol-PO phytoplasma infected tomato by real time RT-PCR: Relative expression of DNA demethylases in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato,yellow bar for stolbur C phytoplasma infected tomato, pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene (n=3).
84
2.5.2. Expression of DNA demethylase genes in Stolbur- C phytoplasmas infected tomato
2.5.2.1. Expression of DML728
A clear band of DML728 was observed in 1mm, 3mm, 5mm flower buds and leaves of stolbur C phytoplasma infected tomato (Figure 9-DML728 -Lane C). After quantification, DML728 was found to be up- regulated as 1.72±SE0.38 times in 1mm, 1.48±SE0.01 in 3mm, 1.41±SE0.28 in 5mm and 1.76±SE0.52 in leaves (Table 2-DML728-C).
These results are confirmed by real-time RT-PCR as transcription level of DML728 was increased by 1.15±SE 0.14 times in 1mm, 1.38±SE 0.07 in 3mm, 1.52±SE 0.027 in 5mm flower buds and 2.32±SE
0.20 in leaves of stolbur-C phytoplasma tomato. Histogram (Figure 10-DML728 -bar C) for DML728 indicated the up-regulation in 1mm, 3mm, 5mm flower buds and leaves of infected tomato as compared to healthy control.
2.5.2.2. Expression of DML729
Through semi-quantitative RT-PCR, clear bands were obtained for DML729 gene in 1mm, 3mm,
5mm flower buds and leaves of stolbur C phytoplasma-infected tomato as compared to healthy one (Figure
9-DML729 -Lane C). We found 1.64±SE0.10 time fold change in 1mm, 1.21±SE0.18 in 3mm, 0.98±SE0.16 in 5mm flower buds and 1.32±SE0.27 times in leaves of stolbur C phytoplasma infected tomato as compared to control (Table 2-DML729 -C).
Through real time RT-PCR, transcript accumulation of DML729 was also found to be increased as
1.99±SE 0.006 in 1mm, 1.13±SE 0.07 in 3mm, 1.33±SE 0.14 in 5mm flower buds and 1.78±SE 0.16 in leaves of stolbur-C phytoplasma infected tomato as shown in histogram (Figure 10-DML729 -bar C).
2.5.2.3. Expression of DML325
Clear bands signals can be observed in 1mm, 3mm, 5mm flower buds and leaves of stolbur C phytoplasma infected tomato through semi-quantitative RT-PCR (Figure 9-DML325 -Lane C). Expression of DML325 was
85
1.95±SE0.15 in 1mm, 1.36±SE0.01 in 3mm, 1.10±SE0.73 in 5mm flower buds and 0.90±SE0.53 times in leaves of stolbur C infected tomato as compared to control (Table 2-DML325 -C).
Transcript accumulation of DML325 was found to be increased 1.72±2E 0.069 times in 1mm, 1.16±SE 0.04 in 3mm, 1.31±SE 0.08 in 5mm flower buds and 1.15±SE 0.02 in leaves of stolbur-C phytoplasma-infected tomato through real time RT-PCR as showing by the histogram (Figure 10-DML325 -bar C). Our results show the down-regulation of Demethylase genes ( DMLs ) in flower buds with severe repression in leaves of stolbur PO phytoplasma infected tomato.
Transcriptional expression level was found to be slightly up regulated in flower buds and leaves of stolbur C phytoplasma-infected tomato. The down-regulation of all DMLs in stolbur PO phytoplasma-infected tomato was in accordance to the hypothesis of involvement of methylation in the repression of SlDEF gene.
2.6. DNA methylation status in stolbur phytoplasma-infected tomato
2.6.1. Site specific determination of SlDEF methylation status by MSRE-PCR
Methylation status of SlDEF was determined using Methylation Sensitive Restriction
Enzymes Polymerase Chain Reaction (MSRE-PCR). Then SlDEF sequence was used to design primers for MSRE-PCR. Two CGATC sites were found at the beginning of SlDEF gene, one in the second intron and one in the second exon (Figure 11).
Transcription initiation site
1 2 TGA ATG ron ron Int Int n6 AB tro 3’ 5’ In E E E x xo x o n2 on n1 7
CGATC sites for position A and B Figure 11: Organization of SlDEF gene introns
exons 86
untranslated regions
9 5 1 AATCAAAGCT TCGACATAAT TTTCATAACC ATTCTCCTAA CTCCTAA T C C 1 0 0 1 TTTTTAATGA AGTGTAAATG GGCCTTTTTC ACAATATTTT CGTAATT G T C 1 0 5 1 A A T AATTTAG AAAGAAAATT AATAACTCAC GATAAGAGTG TTATCAGTAC 1 1 0 1 TTCTCTCGAA TATAAA TGCT GTTGGGTGAC AAGTGACTGA TAACTGAGAC 1 1 5 1 GTTGTGATGG TAGGGA CAAC TACAACAAGT GACAATTGAT TGATTCTTAA 1201 ATTACTTTTA TCAAATTCTG CAATCACCTT TCATTGTTTT G GCATCCCTT 1251 TCCATTTTTA GTAACTCCAT CTTTCTAAGA CTCTTCTCCT C CTCCAATAT 1301 CTTATCACAA TCAAAATAAC AAAAAACATA GAAAAATAAA T CAAAATTGC 1351 ACAATAAAAG TTAACTTGAC CTTCTAGGGT TTGAGTATTC A AGATCTCAA 1401 AAAAAAAAAA AAGAAGAAGA AGTT A T G GCT CGTGGTAAGA TCCAGATCAA 1 4 5 1 GAAAATAGAA AACCAAACAA ATAGACAAGT GACTTATTCA AAGA GAAGAA 1 5 0 1 ATGGGCTATT CAAG AAGGCT AATGAACTTA CTGTTCTTTG TGATGCTAAA 1 5 5 1 GTTTCAATTG TTATGATTTC TAGTACTGGA AAACTTCATG AGTTTAT A A G A 1 6 0 1 TCCCTCTATC ACG TAAGTAA ACAAACTTTA TTTTATTTTT ATTATTTTCA 1 6 5 1 AAATTTTTGT GTTTGTTTTA ATTATTTTGA TGTTGTTTAT GTTTTGT T T A 1 7 0 1 GGACCA AACA ATTGTT CGATC TGTACCAGA AGACTATTGG AGTTGATA T T 1 7 5 1 TGGACTACTC ACTATGAG GT TT TCATGTCT TTAATTTCTT CCTTCTAA G A 1801 TCTTTAACTT TCCCCC TTTT TTTTGGTTAA ATTGTGTAAC AAATTCATCT B 1 8 5 1 TAAAAAGTGC TTTTTATATT TGTTTTTGGA AT C G A T C ACA CTTTCTATTT 1 9 0 1 ATTTGGTTAT ATTTTCAACA TGCCCTTTAC GGTTAGATTT AATTCTT T T T 1 9 5 1 TATGTAAAGATTCTTGAAATAACGGC TAA…………………
Figure 11: Organizatio n of SlDEF gene : Two identified sites A and B with CGATC sequences in the regulatory region of SlDEF gene. Mbo I and Sau3 AI recognize these sites. Methylation specific primers are situated on both sides of these sites. A: Axon 2 region of regulatory sequence with nucleotide (red) and (green) where primer was designed on each side of CGATC sequence. B: Intron 2 region of regulatory sequence with nucleotide (green) where primer was designed on each side of CGATC sequence.
Two restriction enzymes were used. Mbo I which is insensitive to methylation cut the CGATC sequences and Sau 3AI which is sensitive to methylation and do not cut the CGATC sequence if cytosines are methylated. The DNA extracted from flower buds of healthy and infected tomato was digested with each restriction enzyme. Then DNA was amplified by PCR using the primers pairs (Fme2-
GAAGAAATGGGCTATTCAAG, Rme2- ACCTCATAGTGAGTAGTCC, and Fme3-
GATCTTTAACTTTCCCCCTT, Rme3- CCGTTATTTCAAGAATCTTTAC) situated on each side of the restriction site.
87
This experiment has been repeated 3 times by using different biological sample. No or very faint amplified band were observed with DNA digested with Mbo I that digestion was efficient (Figure 12- Non- dig- lane H and PO). The DNA digested with Sau3 AI and then amplified by PCR showed bands faint amplification as compared to the well amplified bands with non digested DNA (Figure 12- Sau3 AI- lane H and PO).
1mm Flower bud 3mm Flower bud
H PO H PO Non-dig
Mbo 1
Sau 3A1
Figure 12: Methylation level determined by MSRE-PCR in stolbur PO infected tomato by using enzymes Mbo I and Sau3 AI (GATC) on position A on SlDEF gene: MSRE-PCR was done on DNA extracted from healthy and stolbur PO infected tomato. Amplification was done on DNA extracted and digested by Mbo I and Sau 3AI. Non-digested DNA was used as control.
These observations suggest that CGATC sites were slightly methylated in healthy and stolbur phytoplasma infected tomato.
A relatively brighter band was observed with DNA restricted with Sau3 AI in stolbur PO -infected tomato as compared to healthy tomato (Figure 12- Sau3 AI- lane PO). It suggested that CGATC site is more methylated in stolbur PO phytoplasma-infected tomato as compared to healthy tomato.
This result seems to be in favour of SlDEF methylation in PO infected tomato and support our hypothesis that SlDEF repression is due to methylation. However in the third replicate, no clear-cut differences between DNAs from healthy, stolbur C- and stolbur PO-infected flower buds were detected.
88
2.6.2. Region specific determination of SlDEF methylation status by bisulphite sequencing
Methylation status of the TATA box region of SlDEF promoter was determined by bisufite sequencing. Bisulfite treatments convert unmethylated cytosines to thymine (T) or uracyl (U) while methylated cytosine (C) remains unchanged. Specific primers were designed for bisulfite sequencing from
SlDEF gene sequence to determine its methylation.
After convertion of DNA extracted from flower buds and leaves of healthy, stolbur C and stolbur PO infected tomato through bisulfite treatment, PCR and Nested-PCR were conducted and amplified PCR products were sequenced.
The first region was situated from the ATG to 504bp and the second region was situated from 650 bp before to the TATA box. Six clones from the healthy tomato and 12 clones from the stolbur PO infected tomato were used to determine the methylation status of first region. For the second region, we used 51 clones from healthy tomato and 46 clones from stolbur PO infected tomato from 3 different tomato samples.
After analysis, we noticed that the methylation was fluctuant along the studied sequence in two zones, with positions more methylated than others (Figure 13 histogram). In figure 13, the results are presented as the percentage of methylated cytosine residue at each cytosine position of the sequenced region for both heathy (green) and stolburPO-infected (pink) flower buds.
The figure clearly shows that methylated cytosine were not randomly distributed but instead grouped within two regions with very frequently methylated positions (positions 494 534, 613, 648-672, and 675-679 for examples).
However although variations of the cytosine methylation level was detected at several positions (for examples 534 and 613) for the stolbur PO-infected material, these variations proved to be inconsistent.
Indeed, independent experiments repeatedly yielded different results, suggesting that the methylation status of the SlDEF regulatory region might not be significantly affected by the stolbur phytoplasma infection or that variations could not be detected in our experimental conditions
89
Percentage of methylated cytocine in SlDEF promoter
A
Healthy tomato
PO infected tomato
B
Healthy tomato
PO infected tomato
Figure 13: Percentage of methylated cytosine in SlDEF promoter in two different experiments A and B . Green bars show the proportion of methylated cytosine in healthy tomato as compared to the pink bars representing the proportion of methylated cytosine in stolbur PO phytoplasma -infected tomato buds.
2.6.3. Determination of methylation level by southern blotting
The methylation status was estimated with 5S rDNA probe using DNA extracted from 1mm, 3mm,
5mm and leaves of stolbur-C and stolbur-PO phytoplasma-infected tomato through southern blotting by using methylation sensitive restriction enzymes, Msp I and HpaII . MspI is inhibited when first C of CCGG sequence was methylated, while HpaII is inhibited when the first or second C was methylated.
As shown in figure 8A, DNA digested with HpaII did not show a ladder of bands formations either in healthy or infected tomato (Figure 14- HpaII - lane H, C and PO). This uncomplete digestion with HpaII
90 restriction enzyme indicated that the tomato DNA was globally methylated (Figure 14- HpaII - lane H, C and
PO).
.
1mm flower buds 3mm flower buds 5mm flower buds Leaves
MspI HpaII MspI HpaII MspI HpaII MspI HpaII H C PO H C PO H C PO H C PO H C PO H C PO H C PO H C PO
Figure 14: Methylation level at a specific locus determined by Southern blotting in stolbur C and PO infected tomato by using enzymes MspI and HpaII (CCGG) and a 5S r DNA probe: The DNA extracted from 1mm, 3mm, 5mm flower buds and leaves of healthy (H), stolbur C (C) or stolbur PO (PO) infected tomato and digested with restriction enzymes MspI and HpaII . Hybridization was done with a 5S rDNA probe.
91
A ladder of band was found with DNA digested with MspI from healthy and infected tomato (Figure
14- MspI ). No significant difference of hybridization pattern was observed in 3mm and 5mm flower buds of infected tomato as compared to healthy controls (Figure 14- MspI ) suggesting that the global DNA methylation level do not seem to be different
In conclusion, although a repression of gene expression implicated in methylation and demethylation was observed in stolbur PO-infected tomato, which seemed to indicate an absence of demethylation in stolbur PO infected tomato, this could not be shown on SlDEF sequence. SlDEF repression can not be connected thus firmly with its promoter methylation.
92
Chapter I
Discussion
Implication of DNA methylation in SlDEF gene expression during
flower development in stolbur phytoplasma-infected tomato
93
3. Discussion and Conclusion
Stolbur C and stolbur PO induce different symptoms in tomato flower buds and leaves. Tomato infected by stolbur PO phytoplasma show abnormal development of flowers, hypertrophied sepals, aborted development of petals and stamens, and large chlorotic and deformed leaves. The same symptoms were not observed in tomato infected by stolbur C phytoplasma. Flower development is nearly normal but leaves are very small, chlorotic and jagged.
It is known that symptoms may differ in a host plant depending upon the stolbur phytoplasma isolate
(Marchoux and Messiaen, 1967; Marchoux et al ., 1967). Similar symptoms have been observed in periwinkle ( Catharanthus roseus ) plants infected by the isolate PO of stolbur phytoplasma (Jaraush et al .,
2001).
These methylation patterns across the genome can change with both the developmental state and the environmental conditions .It has been shown that there is significant decrease of the total 5mC content (30%) during pericarp development stage of tomato fruit development which also represent the tissue specific variation in DNA methylation during tomato fruit development (Teyssier et al ., 2008).
In contrast, there is general view that methylation increases during plant development (Finnegan et al., 1998). The difference of symptoms between these two isolate of phytoplasma could be related to the different genome size of both phytoplasma. The genome size of stolbur PO phytoplasma is about 850 kbp whereas 1280 kbp is for stolbur C isolate.
We have shown that floral development Falsiflora ( FA ) and SlDEF genes were deregulated in stolbur phytoplasma infected tomato inducing floral malformation. The repression of SlDEF in stolbur PO phytoplasma infected tomato is probably at the origin of the abnormal development of flowers with aborted petals and stamen. Stolbur C phytoplasma infected tomatoes have small but normal development of flowers and the expression of SlDEF is normal. These differences in symptomatology imply that Stolbur C and stolbur PO phytoplasma have different ways of actions.
94
Other phytoplasma such as Aster Yellows phytoplasma, Onion yellows phytoplasma and the
Japanese Hydrangea Phyllody phytoplasma (JHP) induced floral malformations like phyllody. In hydrangea,
JHP was found to suppress the genes of ABC class and induce homeotic conversion of sepals and pistils to leaves in florets, and triggered the formation of bracts on pedicel.
Expression level of floral development genes HmAP3, HmTM6, HmP1 and HmAG, were changed in JHP phytoplasma infected tomato suggesting that this phytoplasma can regulate the expression of floral organ morphogenesis.
We have shown that SlDEF was down-regulated while its transcription factor FA was unchanged or slightly up regulated in stolbur PO phytoplasma-infected tomato. So, the repression of SlDEF gene can not be explained merely by the action of its transcription factor FA. Methylation is a mechanism known to be involved in gene repression and it is possible that stolbur PO phytoplasma infection affect the methylation status of SlDEF .
Indeed, in plants, genome stability and gene expression was controlled by maintaining the cytosine methylation at CG and non-CG residues. Plants have developed a mechanism to modulate their gene expression in response to environmental stimuli and biotic and abiotic stress (Zhou et al ., 2007).
Environmental stimuli, such as water stress and salinity can cause demethylation at coding region of certain genes and activate their expression (Choi and Sano, 2007).
In Z. mays , ZmM11 that encodes part of a coding region of a putative protein and part of a retrotransposon-like sequence was transcribed and hypermethylated at both CpG and CpNpG sites during a 4 to 8°C chilling treatment. By contrast, changes in heterochromatin CpNpG methylation occurred in response to osmotic stress and were reversisble in tobacco cell culture.
Environmental stimuli such as aluminum, heavy metals, water stress can also cause an increase or decrease in cytosine methylation throughout the genome and at specific loci. These demethylations can involve flower development. For example, oil palms show an abnormal flower development, called mantled.
Analysis of leaf genomic DNA has revealed demethylation in severely mantled palms (20.6% versus 22.2%).
95
Evidence for a direct relationship in oil palm between hypomethylation of genomic DNA of the ‘mantled’ somaclonal variant phenotype is still yet to be obtained.
Methylation perturbations were also observed in biotic stress as shown by the centromeric demethylation in Arabidopsis infected with Pseudomonas syringae (Pavet, 2006) and by the hypomethylation in tobacco after infection with tobacco mosaic virus (Wada et al ., 2004).
It was hypothesized that methylation was involved in the tomato response to stolbur PO infection.
This was supported by the results obtained with Aza-C treated tomato. Indeed 2% normal flowers were obtained on aza-C treated tomato infected with stolbur phytoplasma.
Moreover, in these flowers, SlDEF expression was not repressed. It is known that Aza-C resulted in demethylation, as observed for the progeny silenced plants with 5-Aza-C treatment that resulted in demethylation of Ubi1 promoter and reactivation of gene expression, demonstrating a functional relationship for methylation in gene silencing (Kumpatla et al ., 1997, 1998). Aza-C treatment usually resulted in about
30% of demethylation.
Our results show that in stolbur PO phytoplasma infection, besides floral development genes which are differently perturbed, some methylase and demethylase genes are perturbed. The repression of the gene expression was only observed in stolbur PO infected tomato.
This is in accordance with the hypothesis of SlDEF methylation. Methylases don’t ‘over’ methylated the gene (Their expression is repressed). But an absence of demethylation because of the repression of the demethylase genes could induce the fact that SlDEF remains methylated and its expression is repressed.
DNA methylation status was studied in stolbur PO-infected tomato. However, results didn’t show any remarkable difference of DNA methylation between healthy or stolbur phytoplasma-infected tomato.
Such results have been also observed in tobacco leaves treated with aluminium where global DNA methylation was just slightly reduced upon aluminium treatment (Choi and Sano, 2007). However other
96 results indicate that other treatment like drought, salt and cold tended to reduce the overall methylation levels in leaves and roots (Wang et al ., 2010).
Methylation observed at specific loci may change in response to external stresses and this is closely related to the activation of stress-responsive genes NtAlix (Wada et al ., 2004). So, the specific methylation of SlDEF was then studied by MSRE-PCR and bisulfite sequencing. MSRE-PCR was targeting two
Sau3AI/MboI restriction sites. It has also been shown in literature that gene can be repressed even if promoter was not methylated perhaps same is the case with SlDEF .
The results did not allow to rely the repression of SlDEF with its methylation, although methylase and demethylase genes were repressed. If involved, methylation may target another transcription factor gene. We showed that azacitidine treated tomato developed early flowers and
SlDEF that was repressed possibly due to methylation in PO infected tomato, was activated, consistent with the previous findings. For example, the work of Klass et al. and Jones et al. indicated that demethylation of DNA caused by Azacitidine treatment induces the expression of inactivated genes (Klass et al ., 1989; Jones et al ., 1985; Whitelaw and Garick, 2005).
Our results were also in agreement with others previous findings that early flowering time, altered phenotype and reduced plant height and overall reduction in 5m C level in DNA and activation of developmental regulated silent genes are the striking effects caused by aza-C treatment in different plants
(Fields and Harvey, 2004; Fields, 1990; Sano et al ., 1990).
It has been demonstrated that in Arabidopsis methyltransferase mutant plants (Like met1 ), showed reduced level of 5 mC and displayed a range of heritable morphological defects and developmental changes
(Kankel et al ., 2003; Finnegan et al ., 1998; Genger et al ., 2003). Our results also showed that in stolbur PO phytoplasma-infected tomato display morphological symptoms on flower buds and leaves and
Chromomethylase (CMT) calss of methyltransferase have been down-regulated.
97
Although, expression of MET1 class was not changed but down-regulation of CMTs class, specific to plant may cause morphological defect. It has been shown that Class 3 methyltrnsferase (DRM) can methylate the DNA at CG, CNG or CNN context, here, 2 out of 3 DRMs studied have been up-regulated in
PO infected-tomato showing that possible targeting methylation on some specific loci. The expression of
Methyltransferase and Demethylase can be used to determine the methylation status of plant.
Our results showed that Demethylase genes have been repressed globally in PO infected tomato showing the possible hypomethylation caused by phytoplasma-infection. It has been shown in several literatures that in methylase mutants, the expression of demethylase gene ( ROS1 ), were also repressed causing the reduced level of methylation.
The repression level of Demethylase can not affect the overall methylation level because they target specific loci. Our results are in consistent as Demethylases were down-regulated indicating that some specific loci have been still methylated in inactivated methylated genes.
In Arabidopsis , 5S rDNA repeats within pericentromeric heterochromatin are silenced by siRNA- directed DNA methylation and chromatin compaction (Pikaard, 2006). Our results by southern blotting on
5S r DNA showed little methylated level in stolbur PO infected tomato flower buds as little faint bands was observed.
Our results of bisufite sequencing showed a fluctuant level of Methylation along the SlDEF gene sequence which was not strictly observed in promoter region but it has also been shown that Gene can be trancriptionally silenced even in the absence of methylated promoter.
4. Conclusion
1. There is abnormal floral developmet such as hypertrophy sepals and aborted petal and stamens
development.
2. Expression of floral developmet genes were deregulated (transcription factor Falsiflora (FA) was little
activated but SlDEF was repressed.
98
3. Expression of SlDEF was restored (not repressed) upon Azacitydine treatment and PO infected tomato
with some normal development of flowers (2%).
4. Expression of plant specific DNA Methylase (CMT) and DNA demethylase (DML 325, DML 728
and DML 729) were repressed.
5. We observed fluctuation of methylation status along the sequeces of SlDEF gene studied.
The methylation seems to interfere in the expression of SlDEF gene but its repression regarding to its
methylated promoter was not clearly established through Bisulfite Sequencing.
5. Perspectives
1. First verified the conditions of experiments and then determine the methylation status of all the
regulatory region of SlDEF gene.
2. Determine the global methylation level through HPLC
3. Verify the role of DNA demethylases in the expression of floral development genes.
99
Chapter II
Introduction
Study of the Salicylic acid (SA), Ethylene (ET) and Jasmonic acid (JA)
Dependent Defense Gene Expression in Stolbur Phytoplasma-Infected
Tomato
100
Fig ure 1-Schematic representation of systemically induced immune responses. Systemic acquired resistance (SAR) is typically activated in healthy systemic tissues of locally infected plants. Upon pathogen infection, a mobile signal travels through the vascular system to activate defense responses in distal tissues. Salicylic acid (SA) is an essential signal molecule for the onset of SAR, as it is required for the activation of a large set of genes that encode pathogenesis-related proteins (PRs) with antimicrobial properties. Induced systemic resistance (ISR) is typically activated upon colonization of plant roots by beneficial microorganisms. Like SAR, a longdistance signal travels through the vascular system to activate systemic immunity in above-ground plant parts. ISR is commonly regulated by jasmonic acid (JA)- and ethylene (ET)-dependent signaling pathways and is typically not associated with the direct activation of PR genes. Instead, ISR-expressing plants are primed for accelerated JA- and ET-dependent gene expression, which becomes evident only after pathogen attack. Both SAR and ISR are effective against a broad spectrum of virulent plant pathogens (Pieterse et al., 2009)
101
1. Introduction
1.1. Plant-pathogen Interaction
Interaction between plant and pathogen involves the exchange of information. First, the pathogen is able to recognize the plant by factors carried by the host (Thordal-Christensen, 2003), and then it change its metabolism to provide favourable conditions for the pathogenicity (Alfano and Collmer 2004; Chang et al .,
2004). Meanwhile, plants have evolved mechanisms to identify patterns associated with pathogens (PAMPs), to strengthen the existing defenses and to develop other potent defense mechanisms (Gomez-Gomez and
Boller 2002). These defense mechanisms may be constitutive or induced after contact with an appropriate agent (Figure 1). There are three types of plant / pathogen interaction:
Non host interaction: Most of the interactions between plant and pathogens are non host interaction in which a potentially pathogenic microorganism is unable to enter or reproduce, and plant is not affected by the infection. Thus non host resistance is defined as kind of immunity by the whole plant against all genetic variants of a pathogen (Heath, 2000). It may depend on multiple mechanisms that are mechanical barriers, constitutive and induced reactions (Heath, 2000; Nürnberger et al ., 2004). This type of immunity may be limited in time but very common in nature and not yet well known in comparison with specific resistance.
Incompatible host interaction: In incompatible interaction, there is resistance against a specific pathogen although the plant is host for that pathogen. Race specific recognition of the microorganism is the result of genetic incompatibility between plant and pathogen. This type of immunity is triggered by direct recognition or indirectly between the protein of resistance gene (R) of plant and a virulence protein (Avr) of a specific pathogen (Flor, 1971; Keen, 1990).
In this interaction, pathogen loses its ability to grow and multiply and plant often produces a hypersensitive response (HR) (Agrios, 2005), where rapid death of plant cells occur surrounding the site to stop further spread of infection (Pontier et al ., 1998). This type of resistance is called localized acquired resistance (Fritig et al ., 1998) which often triggers non-specific resistance through out the plant called systemic acquired resistance (SAR) which gives protection against infections caused by a broad spectrum of pathogens (Sticher et al ., 1997; Van Loon, 1997 ; Fritig et al ., 1998).
102
Compatible host interaction: The compatible interaction occurs between a susceptible host or moderate tolerant and a virulent pathogen. There is no involvement of specific gene products of both partners in these interactions (R gene of plant and Avr of pathogen) and so there is no specific recognition of a pathogen that may colonize the plant (Agrios, 2005). However plant can activate certain defense mechanism, induced by certain compounds called MAMP (Microbe-Associated Molecular Patterns) produced by microorganisms and thus limits the growth of certain pathogens (partial resistance). Defense responses (also called basal defenses) that are induced in this interaction affect the sensitivity of the host and most are correlated with quantitative resistance.
1.2. Mechanism of Defence
Basal defence: The preformed physical barriers of the plant (such as the cuticle of leaves) prevent the entry of the pathogen in the tissues of the plant. Pathogen may enter through natural openings (stomata and hydathodes, injuries) and persist in apoplastic space. However, the low pH, the degradative enzymes or the antimicrobial compounds produced by the plant are another barrier that pathogens must overcome.
Phenols, phenolic glycosides, unsaturated lactones, sulfur compounds, saponins, cyanogenic glycosides and glucosinolates are constituent compounds of plants that also have antifungal activity (Mansfield, 1983;
Osbourn, 1996).
Plants use these physical barriers and chemical compounds to limit the invasion of pathogenes.
However, microorganisms have developed mechanisms that enable them to overcome or inactivate preformed defenses and degrade the wall surrounding the cell (Gohr and Robatzek, 2008). Many pathogens establish intimate physical contact with cells of the host plant.
Nematodes and aphids can feed by inserting direct stylus in cell cytoplasm. Some bacteria produce a secretion system Type III (Type III Secretion System: TTSS) that form a molecular syringe penetrating and injecting molecules called effectors into the cytoplasm of the host cells (Gohr and Robatzek, 2008,
McDowell and Simon, 2008). For example the protein coronatine which is secreted by the bacteria
Pseudomonas syringae in the tomato and Arabidopsis, suppress the plant defense response (Kunkel and
Chen, 2005). Some fungi and oomycetes like Phytophthora infestans can penetrate the epidermal cells forming appressoria, and these structures allow the penetration of hyphae through the plant cell wall by internal osmotic pressure.
103
Subsequently, structures called haustoria feeder can be formed, surrounded by the plasma membrane of the plant (Gohr and Robatzek, 2008; Jones and Dangl, 2006). Some other microorganisms like fungal pathogens do not use specialized structure to enter the plant cell; instead they secrete degrading enzymes like pectinolytic enzymes, cellulases, xylanases or proteases. All these structures and mechanisms can overcome the plant defenses and contribute to the preformed virulence of the pathogen.
Induced defence: Plants and herbivores have co-evolved together for 350 million years. Plants have evolved many defence mechanisms against insect herbivory. Such defences can be broadly classified into
Basal defences, inducible defences (Karban and Baldwin, 1997). Both types are achieved through similar means but differ in that basal defences are present before a herbivore attacks, while induced defences are activated only when attacks occur (Chen, 2008; Dicke et al., 2003; Gatehouse, 2002). In addition to constitutive defences, initiation of specific defence responses to herbivory is an important strategy for plant persistence and survival (Karban and Baldwin, 1997).
Plants have systems of recognition and induced defense responses that are triggered immediately after the first exposure to foreign molecules. They are reinforced by prolonged interaction with pathogens
(Gohr and Robatzek, 2008). Plants have no immune systems such as animals, but have an innate immunity to recognize potential pathogens and induce defense responses that will stop or slow down the growth of the pathogen (Jones and Dangl, 2006).
In the model described by Jones and Dangl in 2006, the first level of defense is triggered by the perception of Microbe-Associated Molecular Patterns (MAMP). It can be flagelline and bacterial elongation factor EF-Tu, fragments of chitin or fungal glucan, molecules that are only present in microorganisms but absent in plants, and which play an important role in microbial life (Bolton, 2009).
However, during evolution, pathogens have developed mechanisms that suppress the resistance triggered by MAMP through proteins called effectors. So the second level of innate immunity is reached when plant has developed the ability to recognize effectors directly or indirectly, by resistance proteins (R).
There has again activation of the defense, in response to the recognition of the effectors, which allows the plant to resist to the aggression (Chisholm et al., 2006, de Wit, 2007). This form of resistance is often associated with hypersensitive response (HR).
104
1.3. Systemic Defenses
Defense implemented by plants is not limited only to local responses. Plants are also able to deploy systemic defenses, in other words, generalized to all tissues.
1.3.1. Systemic Acquired Resistance (SAR)
This resistance is enhanced as a result of an initial infection by an avirulent pathogen. This resistance has been demonstrated for the first time by Ross who found that following an initial infection of tobacco plants by TMV (Tobacco Mosaic Virus), a second infection caused less damage at the whole plant (Ross,
1961). In cucumber for instance, it was observed that after the first inoculation with a pathogen, the plants were protected until flowering (Madamanchi and Kuc, 1991). Plants seem to be able to memorize the impact of the first infection to protect themselve against a second infection.
Generally, this type of resistance is accompanied by the accumulation of salicylic acid (SA) and protein related to pathogenicity (PR: Pathogenesis-Related Proteins). It can be induced after a local hypersensitive response (HR), may be associated with the production of reactive species of oxygen (ROS) and sometimes to the synthesis of phytoalexins (Sticher et al ., 1997; Durrant and Dong, 2004). When the plant is in a healthy environment, these defenses are not activated; it is the arrival of a stimulus that will trigger the latent defense mechanisms. The time required for the establishment of the SAR and the level of protection depends on the plant and the type of organism used for the initial inoculation (Sticher et al ., 1997).
It was found that the SAR happened after 30 minutes to several hours after the initial infection and results in resistance at a subsequent infection in a large number of potential pathogens as different as viruses, bacteria or fungi (Klarzynski and Fritig, 2001). After establishing, SAR can remain for several weeks and give protection to plants (Madamanchi and Kuc 1991, Hammerschmidt and Kuc 1995). This is the time necessary for the simultaneous accumulation of PR proteins and salicylic acid in whole plant (Cameron et al. , 1994; Uknes et al. 1992; Ward et al ., 1991).
The SAR can be triggered by exposing the plants to avirulent microorganisms, non-virulent or artificially with chemicals such as salicylic acid, acid 2,6-dichloro-isonicotinic (INA) or acid benzol (1,2,3) thiadiazole-7- arbothioic s-methyl ester (BTH) (Sticher et al ., 1997). A HR is often seen locally, but is not absolutely necessary. The SAR is associated with an accumulation of proteins defense of the group of PR proteins dependent on salicylic acid.
105
1.3.2. Induced Systemic Resistance (ISR)
ISR resistance is induced by the contact of plant roots with bacteria beneficial, Plant Growth
Promoting rhizobacteria (PGPR), especially of the genus Pseudomonas and Bacillus. The plant defense is prepared for future attacks and reacts more quickly.
It is not dependent of salicylic acid but requires ethylene and jasmonate (Pieterse et al ., 1998). The
ISR is phenotypically similar to SAR. However, it seems that pathways of induction of SAR and ISR are different, as will be explained far, even though both are based on the transmission of a signal leading to activation of a set of defense mechanisms.
The mechanisms developed by plants provide protection against a broad spectrum of pathogens not only fungal, bacterial and viral, but also certain diseases caused by insects and nematodes (Sticher et al .,
1997; Van Loon et al ., 1998; Ramamoorthy et al ., 2001, Durrant and Dong, 2004). This resistance is driven by certain non-pathogenic rhizobacteria (PGPR) such as trichoderma sp . As noted above, these rhizobacteria are capable of reducing a disease through the stimulation of inducible defense mechanisms in plants (Van
Loon et al ., 1998).
Treatment of roots by PGPR produced protective effects on other parts of the plant without inducing migration of bacteria through the vascular system of the plant or through the tissues (Ramamoorthy et al.,
2001; Bent, 2005). The proof that PGPR strains is an inducer of ISR and reduce the disease is achieved by guaranteeing a spatial separation of the pathogen and the PGPR inducing agent of resistance.
PGPR bacteria can be inoculated on the roots and the pathogen on the surface leaf of the plant or roots can be separated into two groups (Van Peer et al ., 1991; Zhou and Paulitz, 1994, Bakker et al ., 2007).
Efficient root colonization by PGPR is essential for optimal expression of the activity of biocontrol and ISR
(Bloemberg and Lugtenberg, 2001). Population of bacteria on the roots must reach a threshold level sufficient to trigger the phenomenon. For instance, In Pseudomonas, it must be at least 10 5 cells per gram of roots and the resistance mechanisms attain its maximum efficiency 4 to 5 days after (Raaijmakers et al .,
1995).
106
Plant defense response
Infection
Effectors (pathogene) + Receptors (plant)
Signal Cascade
Biosynthesis
phytohormones
Transcription Factors
Pathogenesis-related Proteines (PRs )
Figure 2: Schematic representation of signalisation and defense response
107
1.4. Signalization
When plants are attacked by a pathogen, they activate a defense response of multiple components.
This activation is triggered by the perception of elicitor molecules and mediated by molecular mechanisms signalling. The presence of the pathogenic effector proteins or exogenous (from the parasite) or endogenous elicitors (produced in degradation of host cell wall) are recognized (Glazebrook, 2001). Recognition of these molecules leads to activation of a signalling network complex. This implies in particular a selective increase in the permeability of the plasma membrane leading to flux of Ca + +, H +, K + and Cl- (McDowell and
Dangl, 2000).
For example, in response to flagelline, a protein from the bacterial flagel, there is a rapid alkalinisation (Felix et al., 1999). Reactive oxygen species (ROS) are also produced, such as superoxide, hydrogen peroxide (H2O2) and hydroxyl radical through the NADPH oxidase localized in the plasma membrane and / or peroxidases localized in the apoplastic membrane (Somssich and Hahlbrock, 1998).
These transitory initials are partially pre-requisite for late stage of a complete signal transduction that involves the phytohormones ethylene, jasmonate and salicylic acid that trigger the defense response
(Legendre et al., 1992; Glazebrook, 2001).
1.4.1. Perception and Elicitors
Signal transduction involves molecular recognition and physical interaction between specific receptors of the plant ad elicitor. This perception induces an intracellular signal transduction cascade responsible at the end of the implementation of effective defenses (Figure 2) (Nürnberger, 2001). Originally, the term "elicitor" was used for molecules capable of inducing production of phytoalexins. They are classified in two categories. General elicitors on one hand, which are able to trigger defense responses in host and non-host plants, and race-specific elicitors on the other, which induce defense responses only in specific cultivars (Nürnberger, 2001).
In addition, elicitors may also be classified according to their origin. They may be exogenous (From fungi, bacteria, viruses and herbivores) and endogenous (released in planta by the attack of the pathogen). Some
108 abiotic molecules (such as metal ions and inorganic compounds), can induce defenses in plants and are also called elicitors. Best described elicitors in the literature are those from bacteria and fungi. They may be of protein, carbohydrate or lipid. The general elicitor stimulates defense response in different species of plant.
The MAMP such as the flagelin, fragments of chitin or fungal glucans are part of this group. One of the first studied elicitor was flagellin. The Characterization of the responses to flagelin was the key to understand the immunity of the host plant (Asai et al ., 2002; Felix et al ., 1999). Indeed, only Flagelines from certain Gram-negative bacteria have an elicitor activity.
Those of specialized microorganisms such as Rhizobium, Agrobacterium meliloti or A. tumefaciens have none (Felix et al ., 1999). Studies have shown that flageline from Pseudomonas syringae causes ethylene production in tomato cell cultures (Felix et al ., 1999), but also callose deposition and activation of defense genes in Arabidopsis (Gómez-Gómez et al ., 1999).
Membrane receptors for multiple MAMP have been characterized and cloned (Zipfel, 2009). For example, MAMPS are recognized by plasma membrane localized pattern recognition receptors (PRRs).
PRRs have two domains, extracellular leucine-rich repeat (LRR) domain and cytoplasmic serine/threonine kinase domain which are able to recognize MAMPS.
The race-specific elicitor is the product of avirulence gene (Avr) present in a particular race of a pathogen. It will induce resistance only in a host plant that has the corresponding resistance gene
(Hammond-Kosack and Jones, 1997). Elicitors or avirulence determinants can be recognized directly or indirectly by the plant receptors or by R proteins of cytoplasm, or they can be localized in the plasma membrane before inducing signaling pathways. Among the fungal elicitors, the fungus Cladosporium fulvum secretes many proteins rich in cysteine in the apoplast of tomato leaves (Ludere et al ., 2002).
Several elicitor genes have been cloned and were identified as avirulence genes. The Transfer of these genes, for example the gene Avr9, in a virulent strain, confers avirulence, making the interaction incompatible in plants containing the corresponding resistance gene CF9 (Van den Ackerveken et al ., 1992).
In general, the elicitors activate signaling pathways that induce the corresponding change of conformation of the receptor.
109
Salicylic acid (SA ) C6H4(OH)CO2H
colorless crystalline organic acid
widely used in phytohormone organic synthesis
photosynthesis transpiration ion uptake and transport Changes leaf anatomy and plant growth Plant defense chloroplast development structure
Endogenous signal, mediating in plant defense, against pathogens
induce the production of 'pathogenesis-related proteins
It is involved in the systemic acquired resistance [SAR] in which a pathogenic attack on older leaves causes the development of resistance in younger leaves
Figure 3A : Schematic representation of functions of SA in plants development and defense.
Salicylic acid dependent Defense Pathway (SA)
Main characteristics
Biotrophic/ Hyperdensitive R-gene mediated Systemic acquired synergistic/antagonistic interaction necrotrophic response(HR) resistance resistance (SAR) with otherpathways pathogen
SA regulated defense gene expression PR1,PR2,PR5, PR7, PR10, PAL, ICS, Pathogen recognition CHS2
Marker genes X SA JA ET
PR1 PR2 PR5 NPR1 WRKY
PR2 PDF1.2 PR1,PR2,PR5
Figure 3B: Schematic representation of main characteristic of SA defense pathways.
110
1.4.2. Signal transduction pathways
Plant hormones such as salicylic acid (SA), ethylene (ET) and jasmonic acid (JA) have been shown to play an important role in the regulation of signal transduction pathways (Figure 3A and B). Signal transduction is the result of a very complex network of regulation and connection between the different channels. SA takes the major role in the defense activation against biotrophic pathogens, while JA and ET are preferentially associated with defense against necrotrophic pathogens (Kunkel and Brooks, 2002, Turner et al ., 2002;
Glazebrook, 2005; van Loon et al ., 2006).
Communications nodes, also named "cross-talk", between the signaling pathway mediated by SA, JA or ET and other hormone such as auxin, hydrogen abscisic, cytokinins, gibberellins and brassinosteroids have been reported in different plants (Chen et al ., 2005). The term "cross-talk" is reserved for communication between two independent linear signals that are activated simultaneously in the same cell.
Therefore, the components of two signaling pathways must be expressed in the same cellular compartment
(Noselli and Perrimon, 2000). The "cross-talk" aids the plant to minimize energy costs and produces a signaling network flexible allowing it to adjust its defense response to the invaders encountered (Reymond and Farmer, 1998; Pieterse et al ., 2001; Kunkel and Brooks, 2002).
1.4.3. Salicylic acid signalling defense pathway
Salicylic acid (SA) is phytohormone and is found in plants with roles in plant growth and development, photosynthesis, transpiration, ion uptake and transport. SA also induces specific changes in leaf anatomy and chloroplast structure. SA is involved in endogenous signaling, mediating in plant defense against pathogens (Hayat and Ahmad, 2007).
It plays a role in the resistance to pathogens by inducing the production of pathogenesis-related proteins. It is involved in the systemic acquired resistance (SAR) in which a pathogenic attack on one part of the plant induces resistance in other parts. SA-dependent signalling seems to be crucial for resistance against biotrophic/ necrotrophic pathogens (Glazebrook, 2005; Loake and Grant, 2007) (Figure 3 A and B).
Salicylic acid (SA) is synthesized in plants in response to the attack of different pathogens and is a key element for the establishment of local resistance and SAR (Loake and Grant, 2007). Salicylic acid is biosynthesized from the amino acid phenylalanine. PAL is a key enzyme which is involved in the
111 biosynthesis of the SA, which has been shown to play an important role in plant resistance (Mauch-Mani and
Salusarenko, 1996).
SA is synthesized from phenylalanine via PAL pathway in the resistance of Arabidopsis to
Peronospora parasitica (Mauch-Mani and Slusarenko, 1996), virus-inoculated tobacco (Yalpani et al.,
1993), in potato (Coquoz et al., 1998), in tobacco (Ribnicky et al ., 1998). In Arabidopsis thaliana it can also be synthesized via a phenylalanine-independent pathway. For example, Similar to bacteria, plants can also synthesise SA from isochorismate (IC) via ICS pathway , AtICS1, a gene/ enzyme is required for pathogen- induced SA biosynthesis (Wildermuth et al ., 2001).
Salicylic acid (SA) is a master regulatory molecule that accumulates to significant levels following pathogen recognition, is implicated in the promotion of HR, and is also necessary for SAR inductions
(Yalpani et al ., 1991; Hammond-Kosack and Jones, 1996) and an association with the induction of pathogenesis-related (PR) genes and proteins (Durrant and Dong, 2004). Following exposure to pathogens,
SA levels enhances substantially at the site of infection (locally) and to a lesser extent, in uninfected
(systemic) tissues (Ryals et al ., 1996; Yalpani et al ., 1991).
SA accumulation is necessary for SAR, as plants unable to accumulate SA, either through transgenic expression of a bacterial salicylate hydroxylase ( NahG ) gene that metabolizes SA to catechol (Delaney et al .,
1994; Gafney et al ., 1993; Lawton et al ., 1995) or loss-of-function mutations that prevent SA biosynthesis
(Nawrath et al ., 1999) are compromised in SAR. SA also modulates cell death associated with hypersensitive response, activation of lipid peroxidation and generation of free radicals (Dempsey et al ., 1999; Shah and
Klessig, 1999).
An elevation in the endogenous level of SA or exogenous application of SA or its synthetic analog benzothiadiazole S-methyl ester (BTH) or INA results in a selective and concerted activation/activation of a plethora of genes (SAR genes) encoding proteins related to defense against pathogens (viruses, bacteria, oomycetes and fungi) in dicotyledonous plants (Ryals et al ., 1996; Shah and Klessig, 1999) and monocots
(Morris et al ., 1998; Gorlach et al ., 1996; Ward et al ., 1991).
112
Jasmonate (JAs) Group of plant hormones Regulate growth and development It includes
also converted to Jasmonic acid JA Methyl jasmonate MeJA
Growth Leaf Senesence Cancer Control seed inhibition abscision Wounding produces treatment germination Biotic and abiotic stress
Plant defense against Plant defense Insect attack JA act as signalling compound
induce Phytoalexin
That inhibit digestion ability of insect Component of SAR
Figure 4A: Schematic representation of functions of JA in plants development and defense.
Jasmonic acid Dependent pathwayJA
Main characteristics
necrotrophic Induced Systemic acquired synergistic/antagonistic interaction Chewing insects Wound induciable pathogen resistance (ISR) or SAR genes with otherpathways
JA regulated defense gene expression
PIN2, LoxD, Basic PR2 (BGL2, GluB)
SA JA ET Marker genes JA defensevs JA/ET defense WRKY
Transcription factor PIN2 GluB LoxD JAMY ERF1 PR1,PR2,PR5 PDF1.2 C
JR1 THI2.1 VSP PDF1.2 CHI
Figure 4B: Schematic representation of JA dependent defense pathways.
113
A major subset of these proteins is known as pathogenesis-related (PR) proteins, which comprises several families of proteins (Cutt and Klessig, 1992). Different families of PR proteins like PR1, PR2, PR5 etc are regulated by SA mediated signalling pathways.
The initial expression of PR genes takes place in dying tissues that are in direct contact with the pathogen and are thus developing HR. Later on, expression of PR genes is induced in the distal tissues during the course of SAR induction. PR proteins genes can be used as known marker to study the salicylic acid (SA)-mediated responses (Block et al., 2005; Tornero et al., 1997; Van kan et al ., 1992). SA interacts synergistically and antagonistically with other defense pathways. For example, SA and JA/ET defense pathways are mutually antagonistic (Glazebrook, 2005, Lorenzo and Solano, 2005).
1.4.5. Jasmonic acid signalling defense pathways
During the past 20 years, a class of phytohormones derived from the metabolism of membrane fatty acids, collectively known as jasmonates, has attracted considerable attention. Jasmonic acid (JA), methyl jasmonate (MeJA), 12-oxophytodienoic acid (12-OPDA), JA conjugated to some amino acids such as leucine (JA-leucine) and isoleucine. Jasmonic acid (JA) is derived from the fatty acid linolenic acid. It is a member of the jasmonate class of plant hormones.
The major function of JA and its various metabolites is regulating plant responses to abiotic and biotic stresses as well as plant growth and development (Delker, 2006). JA is involved in several aspects of the biology of the plant as growth inhibition, senescence, leaf abscission, pollen development, flower development, seed germination, and defense against injury, ozone, insects and pathogens (Figure 4 A and B)
(Turner et al ., 2002). JA is also responsible for tuber formation in potatoes, yams, and onions.
Jasmonate biosynthesis and signaling pathways have been extensively studied, mainly in dicots such as Arabidopsis (Arabidopsis thaliana ) and tomato ( Solanum lycopersicum ), and to a lesser extent in some monocots (Kazan and Manners, 2008). JA is biosynthesized from linolenic acid by the octadecanoid pathway. The general route of JA biosynthesis starts from linoleic acid which is oxidized by lipoxygenase.
The LOX enzyme is known to fulfill an important role at the beginning of the jasmonate synthesis cascade. JA biosynthesis involves enzymes such as lipase, lipoxygenase (LOX), allene oxide synthase (AOS) and allene oxide cyclase (AOC) (Schaller, 2001). Jasmonic acid is also converted to a variety of derivatives including esters such as methyl jasmonate. The term jasmonate includes biologically active intermediate
114 track biosynthesis of jasmonic acid (eg OPDA) and derivatives biologically active like methyl jasmonate
(MeJA) volatile. In Arabidopsis thaliana , AtLOX2 has been directly linked to the biosynthesis of jasmonic acid (Bell et al ., 1995). In tomato, LoxD is involved in JA biosynthesis through octadecanoid pathways.
It is known that jasmonates have a central role in the regulation of the biosynthesis of several secondary metabolites, including terpenoids, alcaloids, phenylpropanoids, and antioxidants. The constitutive activation of the jasmonate-signaling pathway causes enhanced production of secondary metabolites in tomato plants.
These compounds are widely present in plants and affect various physiological processes (Creelman and Mullet., 1997). It has an important role in response to wounding of plants and systemic acquired resistance SAR or ISR. JA-dependent resistance appears to be more effective against necrotrophic pathogens, insects and other herbivores (Kessler and Baldwin, 2002; Glazebrook, 2005; Beckers and Spoel, 2006).
When plants are attacked by insects, they respond by releasing JA, which activates the expression of protease inhibitors, among many other anti-herbivore defense compounds. These protease inhibitors prevent proteolytic activity of the insects' digestive proteases, thereby stopping them from acquiring the needed nitrogen in the protein for their own growth. In 1992, Farmer and Ryan suggested that jasmonates have a function in the defense response because they observed a causal relationship between injuries caused by herbivorous insects, formation of JA and induction of proteases inhibitors gene.
The first detailed studies describing the involvement of JA in wound-induced signaling and insect damage were made on Solanaceae. The discovery of wound-induced proteinases expressed in tomato (Green and Ryan, 1972) and potato (Sanchez-Serrano et al ., 1986), along with the findings that expression of the corresponding genes was induced by exogenous JA treatment, were crucial for the establishment of a first study model for signaling triggered by wounds in plants (Farmer et al ., 1998; Farmer and Ryan, 1992).
MeJA has been considered an important candidate for an airborne signal molecule mediating intra- and interplant communications, modulating plant defense responses (Demole et al ., 1962; Creelman and
Mullet, 1995; Seo et al ., 2001; Wasternack, 2007) and regulating plant reproductive processes (von Malek et al. , 2002).
In tomato, exogenous treatment with MeJA induces transcripts of different wound inducible genes such as lipoxygenase D ( LoxD ) and proteinase inhibitors ( PIN2 ).
115
Ethylene ET Plant hormone that regulate
Plant defense against Fruit ripening Abscission of leaves Flower opening pathogen
Ethylene acts physiologically as a hormone in plants. It exists as a gas and acts at trace levels .
ET biosynthesis in plants
Its biosynthesis starts from methionine with 1-aminocyclopropane-1-carboxylic acid (ACC) as a key intermediate,ACC synthase is inhibited by abscisic acid. amino acid methionine Ethylene ET
Met Adenosyltransferase Ethylene Forming Enzyme (EFE ACC synthase (ACS 1-aminocyclopropane-1- S-adenosyl-L-methionine carboxylic-acid (ACC (SAM
Figure 5A: Schematic representation of function of ET in plants development and defense.
Ethylene dependent Defense Pathway (ET)
Main characteristics
SA and ET defense pathways are regulated together in tomato mostly by activating SA/ET mediated genes
ET regulated defense gene expression
PR1b, PR4, PR7b and Pti4, TSR transcrition factors
Marker genes
PR1b PR4 PR7b
Figure 5B: Schematic representation of main characteristic of ET defense pathways.
116
Some pathogenesis-related proteins genes like basic PR2 or GluB are also regulated by JA signaling pathway. JA dependent defense pathway was measured by JA mediated marker gene like proteinase inhibitor
2 (Pin2) (Findatsef et al ., 1999; Penacortes et al ., 1995; Bowles, 1998).
Plant defenses against pathogens and insects are regulated differentially by cross-communicating signal transduction pathways in which salicylic acid and jasmonic acid play key roles (Spoel et al. , 2003). The SA and JA signalling pathways are mutually antagonistic (Kunkel and Brooks, 2002)
1.4.6. Ethylene Signaling Defense pathway
Ethylene (ET) is a gaseous plant hormone involved in plant growth and development. It has a role in several aspects of the life cycle of the plant, as flower development, seed germination, development of root hairs on roots and fruit ripening (Ecker, 1995). Ethylene is a regulator of plant responses following abiotic stress (injury, hypoxia, ozone, drought, low temperatures) and biotic stress (attack by a pathogen) (Wang et al. , 2002; Mattoo and Suttle, 1991; Abeles et al ., 1992).
The precursor of ET involved in biotic stress resistance, during its biosynthesis is the S-adenosyl methionine transformed into 1-1-aminocyclopropane carboxylic acid (ACC) by ACC synthase (Figure 5 A and B). ACC is then converted by the action of ACC oxidase to ethylene, CO2 and cyanide. It has been demonstrated that Gene expression of ACC synthase and ACC oxidase were induced in plants after inoculation with pathogens (van Loon et al ., 2006).
The role of ethylene in plant defense may be different depending on the pathogenic agent and the plant species. ET-mediated responses may be involved in PGPR–plant interactions due to the role of ET regulated pathways in expression of ISR (Van Loon et al ., 2006). In response to a necrotrophic pathogen, ethylene in triggering defense responses may inhibit the development of symptoms. However, it could increase cell death caused by biotrophic pathogens (Van loon et al ; 2006).
For example, the Arabidopsis thaliana mutant ethylene-insensitive 2 (ein2) showed an increased sensitivity to Botrytis cinerea (Thomma et al ., 1999) and Erwinia carotovora (Norman-Setterblad et al .,
2000) while it displays a better resistance against Pseudomonas syringae pv. tomato or Xanthomonas campestris pv. campestris (Bent et al ., 1992).
117
The role of ethylene as a regulator in the defense is not yet fully understood, but it has been shown that this hormone preferentially induces the basics PR protein. In tomato, basic beta- 1,3-glucanase (GluB) proteins with vacuolar location ( Van Kan et al ., 1995) and induced strongly after MeJA and ET treatments
(Chao et al .,1999). Activation of ET mediated responses can be followed using the basic PR-1 marker gene
(Block et al ., 2005; Tornero et al ., 1997; Van kan et al ., 1992; Van Loon et al., 2006).
There is cross-talk between ET signaling pathways, particularly with auxin whose effects are often mediated by ET, but also with ABA, cytokinins, gibberellins and brassinosteroids. ET act cooperatively with
JA in the activation of response to pathogens and antagonistically in response to wounding (Lorenzo and
Solano, 2005). In tomato, ET can have mutual interaction with SA defense pathways.
1.5. Defence genes expression
The plant defense system detect pathogen and alerts a battery of signalling cascades by activating defense pathways by the expression of genes involved in defense pathways. The reprogramming of trancription takes place which results in a multifaceted defence response against pathogen invasion (Caplan et al ., 2008). Hundreds of genes are up or down-regulated during infection, some of which are specific which target the particular pathogens and encode the defence proteins which can be categorized into three different functional groups. One group is included the proteins which are involved in cell wall modifications, other group is involved in secondary metabolism and lastly, pathogenesis-related (PR) proteins (Stintzi et al .,
1993). These proteins mostly constitute the defense system of plants.
1.5.1. Genes involved in cell wall modifications
The plant restricts the spreading or infection of pathogens directly during their invasion by different types of structural modifications of their cell walls which have long been associated with plant defence. Then strengthening of plant cell walls takes place against microbial enzymes that degrade cell walls directly or indirectly. Hydroxyproline-rich glycoproteins (HRGPs) accumulation, lignification and suberinization, or callose deposition takes place in case of non vascular pathogen attack but in the case of vascular pathogen infections, vessel occluding gels and tylosis happened. There is limited understanding of genetic regulation of these processes.
For example, sortly after infection of tomato with a pathogen, there is a fast oxidative cross linking of the hydroxyproline-rich glycoproteins (HRGP) extensin (Brownleader et al ., 1995) that results in an
118 increase levels of extensin proteins in the primary cell walls of surrounding tissues which suggest that the tomato cell wall plays active roles during defence, serving as a rich source of defence polypeptide signals rather than playing a passive role (Narváez-Vásquez et al ., 2005).
The tomato defends vascular pathogen infection by producing extensins proteins or expressing extensins inducing genes which may also play a special role in defense stratigies. It has long been known that pectinaceous gels block the pathogen colonization to the upper reaches of stem and leaves which are formed in xylem vessels of plants infected with Fusarium oxysporum , are an important defence strategy used by host plant against this pathoge (Vander Molen et al. 1977, 1982).
In infected tomato lignin and suberin are formed during different step that is a characteristic of plant cell walls undergoing pathogen attack. These are used as structural barriers and in the last step their biosynthesis is catalyzed by gene TPX1. The expression was restricted to cells undergoing lignin and suberin synthesis and the same stresses that induce lignin and suberin synthesis cause alterations in the gene expression patterns of TPX1 mRNA and protein (Quiroga et al ., 2000).
Suberin is secreted by vascular parenchyma cells in tomato plants infected by the fungal pathogen
Verticillium albo-atrum . The suberin form vessel coating material that blocks colonization of the vascular system and contribute to resistance as well as wilting syndrome by blocking water flow to surrounding tissues contributing (Robb et al ., 1991). The expression of the suberin-specific anionic peroxidase gene was found to be up-regulated in the xylem parenchyma cells of resistant plants as compared to susceptible tomato that confirm an active role in defence (Robb et al ., 1991). Some of the genes encoding for cell wall modification are also induced by ethylene (Alexander and Grierson, 2002).
1.5.2. Genes involved in secondary metabolism
If a pathogen gets access into host plant by overcomming first defense stratigy then 2nd defense system is activated. The host plant activates internal system by expressing a group of plant defence genes encoding proteins that are involved to regulate secondary metabolism products. These terms refer to pathways that provide extra biochemical resources to help the plant respond to changing developmental or environmental requirements but may not be necessary for basic survival.
Secondary metabolites such as phenolic compounds and phytoalexins as well as compounds involved in HR are important to defence. Secondary metabolites fall into three categories in a general sense:
119 phenylpropanoids, alkaloids and terpenoids are important compounds involved secondary metabolites.
Shikimates are also often included in these compounds. Both phenylpropanoid and shikimate pathways play important roles in healthy plants (i.e. differentiation) but secondary metabolites are also very important which are required for defence.
The three aromatic amino acids phenylalanine, tyrosine and tryptophan are derivatives of the shikimate pathway which share first seven enzymatic steps in their biosynthesis. Most of the genes for the enzymes involved in shikimate pathway have been documented in tomato. For example, genes encoding for the enzymes catalyzing four steps within the shikimate pathway were shown to be dramatically induced by fungal elicitors in one the study involved in tomato (Görlach et al ., 1995).
Shikimate kinase accumulates more rapidly than the others among these fours which suggest a central role for this enzyme. In barley, chorismate synthase (CS), together with anthranilate synthase (AS) and chorismate mutase (CM), have been shown to mediate branch points downstream of the shikimate pathway which result in biosynthesis of aromatic amino acid (Hu et al ., 2009) and up-regulation of the genes encoding these three proteins. They contribute to the resistance against the penetration of the powdery mildew causative agent Blumeria graminis f. sp. hordei (Hu et al ., 2009).
The direct products of the shikimate pathway including phenylalanine and tyrosine which play important roles in plant defence by producing the phytohormones involved in plant defense system. In particular, the phenylalanine ammonia lyase (PAL) enzyme acts on the substrate such as phenylalanine (or tyrosine). The PAL enzyme is very important for plant defence involved in the biosynthesis pathway of SA and is one of the most studied enzymes in all secondary metabolisms (Buchanan et al ., 2000).
Phenylalanine ammonia lyase (PAL) initiates biochemical pathways leading to the formation of the important signalling molecule, salicylic acid (SA), a signalling molecule associated with SA defense pathway which gives resistance against biotrophic pathogens as well as many important propanoids with key roles in plant resistance. The accumulation of phenylpropanoid compounds during pathogen defence requires up-regulation of genes in both the shikimate and phenylpropanoid pathways, suggested by the work done with elicitor-treated tomato tissue culture cells (Görlach et al ., 1995). Isochorismate Synthase (ICS) is another enzymes involved in the synthesis of SA during infection in host plant.
120
1.5.3. Genes for pathogenesis-related (PR) proteins
Final group of defence genes include those coding for PR proteins genes induced upon biotic and abiotic stress and provide resistance against various types of pathogens. These PR proteins which collectively constitute the majority of soluble protein and induce during the plant defence response.
Pathogenesis-related proteins (PRs) are defined as plant proteins that are induced in pathological or related situations. The term PRs was coined in 1986.
Although some of them are associated in plant defence, they have not been identified because of their antimicrobial activity, but only because of their accumulation in infected plants (van Loon, 1997). PRs synthesis can also be developmentally controlled in an organ-specific manner in healthy plants, besides being induced by pathogens (van Loon et al ., 2006).
PR protein genes are induced by various types of pathogens such as viroids, viruses, bacteria, and fungi but also against insects, herbivores and nematode worms, by diverse environmental stresses, and by treatment with salicylic acid or ethylene (Van Loon, 1997; Van Loon et al ., 2006; Edreva, 2005; Elvira et al .,
2008). When it was shown that the genes coding for various PR proteins such as beta-1,3-glucanases, chitinase and osmotin were induced substantially in incompatible interactions between Pto resistance gene of tomato and Pseudomonas syringae pv. tomato with the avrPto gene, the relationship between resistance and induction of PR protein genes was first demonstrated in this pathosystem (Jia and Martin, 1999). Pto gene binds to Pti 4/5/6 (transcription factors) which in turn bind to PR boxes in the promoter regions of genes of various PR proteins, leading to upregulated gene expression.
Pathogenesis related proteins are composed of 17 groups, most often associated with plant defense response. Although most of them are induced by stress, biotic or abiotic, they show diverse functions (van
Loon et al ., 2006). In tomato, among 17 families of PR proteins, some families do not have representative members from tomato yet .Table 1 shows representative PR proteins families in tomato.
1.5.4. PR1 family of Pathogenesis-Related Proteins Genes
The PR1 family of proteins is probably the most extensively studied, whose antifungal nature was first reported more than a decade ago (Niderman et al ., 1995). Antifungal activity was suggested by some of the scientists during different pathosystems. Yet, the actual function of these proteins remains a mystery.
Different functions have been suggested:
121
Table1 – Recognized Families of Pathogenesis Related Proteins (PRs) in tomato
Family Properties Target Pathogen References
PR-1 Antifungal Fungal pathogen Camacho-Henriquez and Sänger, 1984 van Kan et al ., 1992 Niderman et al ., 1995 Granell et al ., 1987 Tornero et al ., 1994
PR-2 Endo-beta-1,3-glucanase Glucans Real et al ., 2004 De Wit et al ., 1986 Granell et al ., 1987 Fischer et al ., 1989 Domingo et al ., 1994
PR-3 Endochitinase Fungal chitin Granell et al ., 1987 Fischer et al ., 1989 Garcia Breijo et al ., 1990
PR-4 Endochitinase Fungal chitin De Wit et al ., 1986
PR-5 Thaumatin-like Fungal hyphal growth Woloshuk et al ., 1991 and spore germination King et al ., 1988 Rodrigo et al ., 1991
PR-6 Proteinase inhibitor Insects and De Wit et al ., 1986; Abuqamar et al ., 2008 Microbial proteins
PR-7 Endopeptidase Pathogenic proteins and peptides Vera and Conejero, 1988 Fischer et al ., 1989 Krüger et al ., 2002
PR-9 Peroxidase/peroxidase-like Pathogenic reactive Vera et al ., 1993 oxygen intermediates Botella et al ., 1994 Yoshida et al ., 2003
PR-10 Ribonuclease RNA viruses Constabel et al ., 1993
PR-12 Defensin Microbial cell membranes van den Heuvel et al ., 2001
PR-13 Thionin Cytotoxic Chan et al ., 2005
PR-14 Nonspecific lipid Bacterial and fungal Trevino and transfer proteins pathogens O’Connell, 1998 Lee et al., 2006
PR-15 Oxalate oxidase Zhou et al ., 2008; Zhou et al ., 2009
16 and 17 families of PR proteins have not yet been identified in tomato
122
For example, for PR1 protein prevents virus diffusion, restrict fungal invasion or protect the plant against environmental stress (Antinow and White, 1986; Benhamou et al ., 1991; Cutt et al ., 1989; Eyal et al ., 1992).
The induction of PR proteins is generally pathogen and host specific that point to the need to examine the relationship in each different host pathogen interaction (Van Loon et al ., 2006). The PR1 family is widely spread in plants which suggest that these proteins share an evolutionary origin and possess activity essential to the functioning and surviving of living organisms (Van Loon, 2001). The PR1 family accounts for 1-2 percent of leaf protein during induced states as it is considered the most abundant induced. In tomato plants inoculated with Cladosprium fulvum , PR1 protein is accumulated a major inducible protein in both incompatible and compatible interactions (De Wit and Bakker, 1980).
In radish (Hoffland et al., 1995) and Arabidopsis (Pieterse et al ., 1996) infected with rhizobacteria and in tomatoes infected with Phytophthora capsici (Hong and Hwang, 2002 ), PR1 proteins play accessory roles but appear not to be necessary to resistance. In these three pathosystems, through immunogold labeling
PR1 proteins have been shown to be accumulated over oomycete cell walls and at the host-oomycete cell wall interface, although levels were enhanced in incompatible interactions as compared to incompatible interaction (Hong and Hwang, 2002).
Within the families, PR proteins can possess isoforms according to their isoelectric points. These can be regulated differentially and have separate cellular localization (Memelink et al., 1990; Stinzi et al ., 1993).
Normally, acidic PR proteins are localised in apoplast and basic PRs are found mainly in vacuoles.
Few acidic isoforms of PR1 show antimicrobial activity and they are most commonly targeted to the intercellular space localization (Buchel et al ., 1999; Van Loon et al ., 1997). In tomato, acidic PR1 and basic
PR1 proteins have been found which have been shown to be accumulated upon infection of pathogen (van
Kan et al ., 1992).
Tomato PR1b1 (basic PR1 ) gene was expressed in the leaves of transgenic tobacco exhibiting a hypersensitive response (HR) after infection with tobacco mosaic virus (TMV) (but not in non-inoculated leaves) and is induced by both SA and ET treatment (Tornero et al ., 1997).
Induction of salicylic acid (SA)-mediated responses or systemic acquired resistance (SAR) can be followed using the expression level of the acidic PR1 gene which is also known as marker gene for salicylic acid dependent defense responses in tomato (Block et al ., 2006; Tornero et al ., 1997; Van kan et al ., 1992).
123
1.5.5. PR proteins involved in cell wall degradation
There are some specific families of PR proteins which are involved in cell wall degradation of pathogen such as the PR proteins of class I, II, and III endo-beta-1,3-glucanases. Some times, these are referred to as glucanase (endo-beta-1,3-gluconase). They were first identified from tobacco, although, PR2 proteins have since been discovered in many other plants. The PR protein genes encoding glucanase enzymes have been shown to be regulated by sugars in a SA-independent pathway (Thibaud et al ., 2004).
Joosten and De Wit (1989) showed that beta-1,3-glucanases could be identified in both apoplastic fluids and homogenates of leaves following the infection of tomato with Cladosporium fulvum (Cooke).
Additionally, in the apoplastic fluids during incompatible interactions than in their compatible counterparts, the enzymatic activity of these PR protein genes increased much more rapidly which indicate a central role of PR2 proteins in plant defence, possibly in the degradation of hyphal cell walls. Many PR2 proteins have been isolated from tomato showing glucanase activities and have been shown to have antifungal properties (Domingo et al ., 1994; Real et al ., 2004) and have also been shown to be induced co- ordinately during plant defence (Domingo et al ., 1994; Real et al ., 2004). In tomato infested by Helicoverpa armigera , the trancripts of basic β -1,3-glucanase ( BGL2 ) was enhanced (Peng et al ., 2004). Some pathogens can suppress the expression of PR2 proteins genes as counter defense.
The PR-3 gene family has endochitinases activity and is composed of class I, II, IV, V, VI, and VII.
In tomato, endochitinases were identified in both cells and apoplastic fluids and have been isolated after infection with Cladosporium (Joosten and De Wit, 1989). Certain tomato chitinase genes are also induced more rapidly during incompatible compared with compatible interactions (Danhash et al ., 1993), again showing the importance of these genes and proteins in plant defence respone against different pathogens.
Expression of chitinases seems to be temporally and spatially regulated (Yeboah et al ., 1998).
Immunocytological studies demonstrated that PR3 proteins accumulate earlier in incompatible interactions than compatible and concentrated in the host-fungal cell wall contacts (Benhamou et al ., 1990).
The PR4 gene family possess endochitinase activity such as antifungal win -like proteins. Although
PR4 proteins actually do not contain the chitin-binding hevein domains but these genes have homology with the C-terminal domain of the prohevein protein (Linthorst et al ., 1991). The PR4 protein gene, P2 , was
124 originally isolated from phage DNA libraries of tomato infected with Cladosporium fulvum (Linthorst et al .,
1991).
More recently, to enhance resistance to both non-chitinous and chitinous fungi, PR4 gene overexpression in tomato was demonstrated indicating that chitin-binding is not necessary for PR4 antifungal activity as was considered by the absence of the hevein domains (Lee et al ., 2003). As suggested for other
PR4 proteins such as tomato PR-P2 and tobacco PR4 proteins, mostly, PR4 proteins are localized and accumulated in apoplastic space (Linhorst et al ., 1991). PR4 protein genes have been induced in intercellular space during incompatible viral interaction (Elvira et al ., 2008).
1.5.6. PR proteins associated with membranes
The PR proteins of PR5 gene family interacts with membrane and encodes antifungal, thaumatin-like proteins, including osmotin, NP24 and P23 , all of which have been reported in tomato (Jia and Martin, 1999;
Pressey, 1997, Robb et al ., 2009). These proteins were named as thaumatin-like because of homology to the sweet tasting protein found in the West African shrub Thaumatococcus daniellii . Enhanced levels of thaumatin like proteins seem to have antimicrobial effects on hyphal growth and sporulation (Vigers et al .,
1991). However, the molecular mechanisms that are involved in the antifungal activity remain somewhat obscure.
PR5 proteins disrupt the lipid bilayer and create trans-membrane pores and generally exert their antifungal activity through a very fast and dramatic increase in the permeability of the pathogen’s plasma membrane therefore some of them are also called permatin (Vigers et al ., 1991). Osmotin, another PR5 protein, interfere the signal transduction pathway with pathogen to enhance fungal cell susceptibility.
Osmotin which has long been associated with hyphal lysis is one of the best studied PR5 proteins
(Hong et al ., 2004). Current molecular evidence indicated that osmotin first binds to mannoproteins of the fungal wall where susceptibility or resistance to osmotin is determined. NP24 may also act in a same fashion.
In tomato infected by the vascular wilt fungus Fusarium oxysporum, PR5 proteins have been isolated
(Rep et al ., 2002). In another vascular pathogen, the expression of P23 and NP24 has also been found to be increased in tomatoes infected by Verticillium dahliae (Robb et al ., 2009). P23 proteins were first purified and isolated from the leaves of tomato inoculated with exocortis viroid (Rodrigo et al ., 1991). Further studies have strengthened the evidence that these PR5 proteins are involved in tomato resistance against different
125 pathogens in different crops. But results demonstrating the increase expression of NP24 protein during fruit ripening also suggest a role for some PR5 proteins in this phenomenon lead to the resistance and fruit ripening indicating a functional overlap of molecular pathways (Pressey, 1997). Castroverd, (2010) has worked and described some PRs proteins in verticillium-tomato pathosystem.
Defensins are a group of proteins of PR12 gene family. The prominent examples of PR12 are the snakin antimicrobial peptides (Segura et al ., 1999; Sels et al ., 2008). The expression of AT2, a defensin gene, was first identified in cells of the shoot apex and developing flowers of tomato (Brandstädter et al ., 1996) but since then these have been observed in many other tissues of plants (van den Heuvel et al ., 2001; Thomma et al ., 2002).
The tomato defensin (DEF2) was also shown to have functions in both flower development and foliar resistance against Botritis cinerea (Stotz et al ., 2009). Various physiological roles have been suggested and described for these proteins, including disrupting microbial membranes or acting as ligands during signal transduction (Thomma et al ., 2003).
The PR13 gene family encodes thionins that are peptides family each containing 45 to 48 amino acids, including a number of cysteine residues that can form disulfide bonds. Although, the exact mechanism of action remains controversial but these PR13 proteins target plasma membrane structure and are toxic to a wide range of bacteria and fungi (Stec, 2006).
It has also been shown that PR1 is not responsible for resistance of Nicotiana attenuata against P. syringae pv tomato but PR13 (Rayapuram et al ., 2008) suggesting that PR1 may be a marker for resistance but has no antimicrobial function. In tomato, Thionin genes have been identified and expression has been linked with the development of pistil but no clear defence function has been observed yet (Milligan and
Gasser, 1995). The Arabidopsis THI2.1 gene in tomato showed enhanced resistance to both bacterial and
Fusarium wilt through a systemic suppression of bacterial or fungal multiplication (Chan et al ., 2005).
The PR-14 family of proteins is composed of non-specific lipid transfer proteins (ns-LTPs). They are encoded by the members of large multi gene family that differ in primary amino acid sequence, expression and proposed functions (Blein et al ., 2002). Different patterns of gene expression have been observed in a drought-tolerant tomato variety indicating that sequence similarity among ns-LTPs genes does not necessarily mean functional redundancy (Trevino and O'Connell, 1998).
126
It has been demonstrated recently that RNAi silencing of ns-LTP genes in tomato decreases its allergenicity, also suggesting a role for the proteins in tomato defence (Le et al ., 2006). Further, mutation of a gene encoding an apoplastic ns-LTP compromises the systemic acquired response (SAR) in Arabidopsis thaliana challenged by the bacterial pathogen P. syringae . However,in general, the relationship between PR-
14 proteins and defence remains unclear.
1.5.7. Enzymatic and Enzyme-associated PR proteins
The PR6 gene family have wound-inducible proteinase inhibitors (PIs) that provide primary defence against phytophagous insects herbivory. The tomato inhibitor I is an example induced upon insect attack
(Johnson et al ., 1990). When proteinase inhibitor gene expression is reduced after infection with B. cinerea, the Susceptibility is apparently increased in tomato (Abuqamar et al ., 2008). Because of their role in plant defence, transgenic tomato plants overexpressing plant proteinase inhibitors were shown to have multiple insect resistances (Abdeen et al ., 2005). Expression of the tomato proteinase inhibitors I ( PIN1 ) and II
(PIN2 ) genes were monitored to investigate the role of the methyl-JA–dependent pathway, which is induced by wounding and chewing insects (Graham et al. , 1985).
A multitude of proteases from diverse plants are up-regulated during infection by pathogens, suggesting a potential role in plant defense (Tornero et al ., 1997; Avrova et al ., 1999, 2004; Liu et al ., 2001;
Guevara et al ., 2002; Zhao et al ., 2003; Tian et al ., 2004). The PR7 gene family encoding endoproteases, like the tomato protein P69, which was extracted from the citrus exocortis viroids infected leaves (Vera and
Conejero, 1988). The relationship between R-genes and PR7 proteins is still being deciphered; one step towards this is the finding that the secreted papain-like cysteine endoproteinase Rcr3 (of the PR7 family) is required for the functioning of the tomato Cf-2 resistance protein gene (R-genes) (Krüger et al ., 2002).
Recently, even in the absence of pathogen, the PR7 ( 69A ) genes were shown to be induced in tomato plants by suppressive compost, induction may be related to the microflora of soil (Kavroulakis et al ., 2006).
Among the 6 indentified P69 , the expression of P69B and P69C occurred during infection with
Pseudomonas syringae and was upregulated by salicylic acid (Jordá et al ., 1999).
PR10 proteins have enzymatic activities in plant secondary metabolisms, and roles in abiotic stresses, have been reported to have various functions ranging from antimicrobial activity, in vitro ribonuclease
127 activity (Liu and Ekramoddoullah, 2006). Therefore, PR10 proteins may play important roles in plant defense against pathogen attack.
The PR10 gene family encodes ribonucleases related proteins. PR10 proteins are believed to be major defence related proteins against plant RNA viruses (Pinto and Ricardo, 1995). However, in tomato infected with cucumber mosaic virus, despite the induction of PR10 transcripts, the plants still underwent systemic necrosis and accumulation of the PR10 protein correlated with leaf epinasty and other symptoms
(Xu et al ., 2003). This suggests that PR10 proteins may have pleiotropic effect during compatible and incompatible interactions (Xu et al ., 2003).
1.6. Cross-talk among defence pathways
Another mechanism used in plants to further improve defense responses is based on the cross-talk between different hormonal signalling defense pathways, influencing not only processes related to growth and development, but also adaptation to biotic and abiotic stresses (Kazan and Manners, 2008). In nature, the primary defense response induced by the host plant is influenced by simultaneous or subsequent invasion by multiple aggressors and beneficials (Stout et al., 2006; Poelman et al ., 2008). The activation of plant defense mechanisms is associated with ecological fitness costs (Walter and Heil, 2007).
Crosstalk between phytohormonal signalling defense pathways provides the plant with a powerful regulatory potential and may allow the plant to fine its defense response to the invaders encountered
(Reymond and Farmer, 1998; Pieterse and Dicke, 2007; Kunkel and Brooks, 2002; Bostock, 2005).
These SA, JA and ET mediated defense pathways are then interconnected and can act antagonistically or synergistically (Mur et al ., 2006). The convergence of these defense pathways at key signalling nodes Non expressor of PR1 and WRKY transcription factor (NPR1, WRKY70) may enable prioritization of the signalling pathways allowing deployment of the most effective local and systemic defenses against the attackers (Koornneef and Pieterse, 2008).
It is known that, Coranatine (COR), in JA signalling, induces the expression of JA mediated genes but suppresses the SA dependent defense genes. Similarly, early work in tomato and Arabidopsis indicated that SA and its acetylated derivative aspirin are strong antagonists of the JA signaling pathway (Doherty et al ., 1988). On the other hand, JA and ET signalling pathways can act synergistically (Pennincks et al., 1998).
128
The genomics era provided a wealth of new opportunities to investigate how the SA, JA and ET signaling defense pathways are interconnected in the induced defense signaling network (Katagiri, 2004).
In response to infection by the hemibiotrophic bacterial pathogen Pseudomonas syringae, whole genome expression profiling of a large set of Arabidopsis mutants affected in SA, JA or ET signalling
(Glazebrook et al ., 2003) confirmed that there is extensive crosstalk between the SA, JA and ET response pathways and paved the way to model the network topology of the plant’s immune response (Katagiri,
2004).
One of the best studied examples of defense-related signal crosstalk is the antagonistic interaction between the SA and JA response pathways. Many cases of trade-offs between SA-dependent resistance against biotrophic pathogens and JA-dependent defense resistance against necrotrophic pathogens and insect herbivory have been documented (Stout et al ., 2006; Poelman et al ., 2008; Van der Putton et al ., 2001;
Reymond and Farmer, 1998; Pieterse and Dicke, 2007; Bostock, 2005).
For example, induction of the SA pathway in Arabidopsis by the biotrophic oomycete pathogen
Hyaloperonospora arabidopsidis strongly down-regulated JA-mediated defenses that were activated upon feeding by caterpillars of the small cabbage white Pieris rapae (Koorneef et al ., 2008). Similarly, Activation of the SA pathway by P. syringae suppressed JA signaling pathway and rendered infected leaves more susceptible to the necrotrophic fungus Alternaria brassicicola (Spoel et al ., 2007).
Although many reports describe an antagonistic interaction between SA- and JA-dependent signalling, synergistic interactions have also been reported as well (Schenk et al ., 2000; Mur et al ., 2006;
Van wees et al ., 2000). For example in Arabidopsis , treatment with low concentrations of JA and SA resulted in a synergistic interaction on the JA- and SA-responsive genes PDF1.2 and PR-1, respectively.
However, at higher concentrations the effects were antagonistic which demonstrate that the outcome of the
SA-JA interaction is dependent on the relative concentration of each hormone (Mur et al ., 2006).
Koornneef et al . (2008) demonstrated that timing and sequence of initiation of SA and JA signalling are also important for the outcome of the SA-JA signaling interaction. Hence, the kinetics of the biosynthesis of phytohormone and signalling during the interaction of a plant with its attackers could be highly decisive in the final outcome of the defense response to the attacker encountered. Additionally, phytohormones can be readily modified into derivatives with altered biological activity, which adds yet another layer of regulation.
129
Ethylene (ET) has been demonstrated to be an important modulator of the plant’s defense response to pathogen and insect attack (Van Loon et al ., 2006; Von Dahl et al ., 2007). It was concluded that ET is essential for the onset of SA-dependent SAR that is triggered upon infection by tobacco mosaic virus, for instance, from a study with ET-insensitive tobacco plants (Tetr), (Verberne et al ., 2003).
Moreover, ET was shown to enhance the response of Arabidopsis to SA signalling that result in a potentiated expression of the SA-responsive marker gene PR-1 (Lawton et al ., 1994; Devos et al ., 2006).
This synergistic effect of ET on SA-induced PR1 expression was blocked in the ET-insensitive mutant ein2
(Devos et al ., 2006) indicating that the modulation of the SA pathway by ET is EIN2 dependent and thus functions through the ET signalling defense pathway.
Further evidence for SA-ET crosstalk came from the network topology study of Glazebrook et al .
(2005) in which the global expression profiles of P. syringae –infected Arabidopsis wild-type and signalling- defective mutant plants were analyzed. This study demonstrated the extensive crosstalk between the SA and
ET signalling pathways, as evidenced by the fact that the expression of many SA-responsive genes was significantly affected in the ein2 mutant background.
In addition, these defense signalling pathways communicate with other hormones such as abscisic acid (ABA), auxin, gibberellic acid, and brassinosteroid signaling pathways to coordinate the magnitude and quality of the defense response activated (López et al ., 2008; Spoel and Dong, 2008). There are accumulating evidences for additional defense-signaling pathways that are modulated after herbivore attack; however the identities of these pathways have yet to be revealed (Glazebrook, 2005; De Vos et al ., 2006; De
Vos and Jander, 2009; Bhattarai et al ., 2010).
1.7. Counter defense strategies of Pathogens
Plants and plant pathogens have coevolved various defense and counterdefense strategies in their arms race for survival and growth (Stahl and Bishop, 2000). For example, plants use the PR proteins b-1,3- endoglucanases to damage pathogen cell walls, either rendering the pathogen more susceptible to other plant defense responses or releasing oligosaccharide elicitors that activate plant defenses response (Rose et al .,
2002). The oomycete pathogen Phytophthora sojae has evolved a counterdefense mechanism to overcome the activity of b-1, 3-endoglucanases. P. sojae secretes glucanase inhibitor proteins (GIPs) that suppress the activity of a soybean ( Glycine max ) beta-1,3-endoglucanase (Rose et al ., 2002).
130
An analogous plant enzyme-pathogen inhibitor coevolution appears to involve plant proteases and pathogen protease inhibitors (Tian et al ., 2004, 2005; Rooney et al., 2005). It concerns that a diverse family of Kazal-like extracellular Ser protease inhibitors with at least 35 members described in five plant pathogenic oomycetes: P. infestans, P. sojae, Phytophthora ramorum, Phytophthora brassicae , and the downy mildew
Plasmopara halstedii (Tian et al ., 2004).
In tomato infected with P. infestans , two Kazal-like Ser protease inhibitors, EPI1 and EPI10 were found to bind and inhibit the PR P69B subtilisin-like Ser protease of the tomato host plant (Tian et al., 2004,
2005). Inhibition of P69B by two structurally different protease inhibitors of P. infestans suggests that EPI1 and EPI10 function in counter defense manners (Tian et al ., 2004, 2005).
1.8. Tomato as a model plant
Tomato has been used a model plant to investigate and to make a good study on its cytology and biochemistry, as well as more targeted and specific molecular biological research (Pedley and Martin, 2003;
Rivas and Thomas, 2005). Still, the molecular mechanisms of resistance, tolerance or susceptibility in tomato remain controversial, as indicated by its interaction with the fungus Verticillium (Fradin and Thomma, 2006;
Robb, 2007). This originate from the fact that these studies have focused either on on the activated PR genes
(and their role in plant immunity) or the R genes (and their role in pathogen recognition). But the difficulty is compounded by the fact that signalling pathways are non-linear and overlapping with signalling cascades for other biological phenomena such as abiotic stress, senescence and differentiation, not normally associated with defence.
To study the molecular mechanisms governing host-pathogen interactions, in many ways tomato is a good model plant. The tomato plant is diploid (n=12) and has well-characterized genetic map and is amenable to most biotechnological manipulations including plant transformation and gene silencing (Niven and Jones, 1986; Liu et al ., 2002; Cortina and Culianez-Macia, 2004). With the advancement of functional tools for the characterization of individual genes and proteins and also the extensive availability of genome- and proteome-wide methodologies, a clearer molecular picture of tomato-pathogen interactions is being developed slowly.
Two-dimensional (2-D) protein analysis followed by mass spectrometry (Robb et al., 2009) and the availability of various tools like tomato microarrays (Moore et al. , 2005) have facilitaed wide global analyses
131 of both the mRNA (transcriptome) and protein (proteome) populations during many tomato-pathogen interactions (Rep et al. , 2002; Robb et al. , 2007; Robb et al. , 2009; Jiang et al ., 2009).
The data generated by the researchere sometimes overwhelms their interpretation but the current challenge for scientists is to integrate them, providing a more holistic view of plant defence and development. Now tomato plant is mostly used by the researcher to conduct genetic study, defense and development to understand the molecular mechanism underlying the phenomenon.
1.9. Phytoplasma and defense pathways dependent genes expression
In recent years, it has become evident that the inducible plant defense response to microbial pathogens, probably insect herbivores and nematodes, is a multilayered process that consists of at least two phases (Nishimura and Dangl, 2010).
Phase 1 is initiated with the recognition of microbial or pathogen associated molecular patterns
(MAMPs or PAMPs) by the plant pattern recognition receptors (PRRs) and results in PAMP-triggered immunity (PTI). PAMPs and MAMPS are defined as conserved epitopes within essential molecules that are recognized by a broad range of hosts (Schwessinger and Zipfel, 2008). A successful pathogen may secrete virulence proteins (effectors) that suppress PTI and results in a compatible interaction or effector-triggered susceptibility (ETS), unless plants recognize these effectors and trigger phase 2 of the plant defense response.
Then after, phase 2 is triggered upon recognition of the pathogen effectors or their activities by plant disease R genes which results in effector-triggered immunity (ETI). Many bacterial effectors have been shown to interfere with host immune responses such as PTI and ETI (Dodds and Rathjen, 2010). For example, a systematic characterization of the effectors of P. syringae strain DC3000 revealed that the majority of the effectors suppress either PTI or ETI or both, indicating that suppression of both types of host defense reactions is a key for successful bacterial colonization (Gau et al ., 2009). Therefore, it is relevant to ask whether phytoplasma effectors interfere in defense response and suppress PTI/ETI induced by host organisms.
Pathogen associated mollecular patterns (PAMPs) of gram-negative bacterial pathogens mostly include lipopolysaccharides, peptidoglycans, and a conserved domain of flagellin (flg22), which are generally located on the exterior of the bacterial cells. These PAMPs are recognized by numbers of plants
132
(Schwessinger and Zipfel, 2008; Zipfel and Felix, 2005). PAMPs also include intracellular proteins, such as cold shock proteins (CSPs) and the translation elongation factor Tu (EF-Tu) which can be recognized by different hosts.
The conserved domains of CSP (csp15) and EF-Tu (elf18) are recognized by Solanaceae and
Brassicaceae , respectively, and PTI is triggered (Felix and Boller, 2003; Kunze et al ., 2004; Zipfel et al .,
2006). Because phytoplasmas have no outer cell wall and no flagella, and hence lack the peptidoglycans and flg22 PAMPs. However, phytoplasmas have genes encoding cold shocks proteins (CSPs) and the elongation factor Tu (EF-Tu) and these gene products may induce PTI.
All the plant pattern recognition receptors (PRRs) identified to date seem to receive the ligands in the extracellular space, whereas R-mediated ETI can be triggered by extracellular and intracellular effectors
(Bent and Mackey; 2008). But it is unclear whether sieve cells induce PTI/ETI. Because the phytoplasmas are intracellular and reside within the sieve cell cytoplasm, the bacteria may be hidden from the plant detection systems, hence the absence of PTI/ETI may results. Phytoplasmas may avoid from their detection by a plant host via an absence of both PAMPs and recognizable (avirulent) effectors or by secreting effectors that suppress PTI/ETI and/or by virtue of residence within non responsive phloem sieve cells.
Recently, it has been shown that Phytoplasmas secrete membrane-associated proteins, such as Amp, and effectors, such as SAP11 and TENGU, that are released into the host cells of plants and insects to target host cell molecules. A functional Sec-dependent translocation pathway present in phytoplasma that enables these pathogens to secrete their effectors. In case of phytoplasma infection, expression of lypoxigenase 2
(Lox2) and the accumulation of JA are reduced in the SAP11 transgenic Arabidopsis lines (Sugio et al .,
2010).
JA signaling pathway in Arabidopsis is implicated in the plant defense response to the herbivory of
AY-leafhoper and SAP11 of AY-WB interferes with this defense response through destabilization of TCP that positively regulate JA synthesis. Thus SAP11 effectors have been shown to modulate the production of phytohormones such as JA that regulate plant defense responses against their insect vectors by altering the signalling pathways.
In tomato, two isolates of stolbur C and PO phytoplasma induce different symptoms. Stolbur PO infected tomato show abnormal flower development with large chlorotic leaves. Such symptoms can not be
133 observed in stolbur C infected tomato but nearly normal flower development with small chlorotic leaves.
Stolbur phytoplasma have not been sequenced and no effectors have been identified. We don’t know whether they modulate/alter the defense pathways to stimulate colonization in infected tissues. As phytoplasma interfere with phytohormones which play important role in plant defense and development.
Here, for the first time, we studied the expression of SA/JA/ET dependent defense pathways genes in stolbur C and stolbur PO phytoplasma-infected tomato flower buds and leaves. We studied the expression of near about 21 defense related Genes including pathogenesis related proteins and SA and JA biosynthesis genes and ET mediated transcription factors to know how stolbur phytoplasma alter defense pathways by altering the expression pattern of these genes.
134
Chapter II
Results
Study of the Salicylic acid (SA), Ethylene (ET) and Jasmonic acid (JA)
Dependent Defense Gene Expression in Stolbur Phytoplasma-Infected
Tomato
135
1mm Flower buds 3mm Flower buds 5 m m Flower leaves
GenesH C PO H C PO H C PO H C PO PAL 1 1.44 ±SE 0.19 0.78 ±SE 0.16 1 1.23 ±SE 0.16 1.29 ±SE 0.045 1 2.31 ±SE 0.60 2.56 ±SE 0.10 1 1.6 ±SE 0.03 0.05 ±SE 0.005 ICS 1 0.37 ±SE 0.06 0.31 ±SE 0.09 1 0.60 ±SE 0.09 0.85 ±SE 0.10 1 0.49 ±SE 0.10 1.36 ±SE 0.10 1 0.71 ±SE 0.16 2.05 ±SE 0.32
CHS2 1 0.41 ±SE 0.08 8.23 ±SE 0.05 1 0.83 ±SE 0.15 2.65 ±SE 0.51 1 0.67 ±SE 0.12 2.65 ±SE 0.11 1 0.29 ±SE 0.01 6.55 ±SE 0.46 acidic PR1 1 8.92 ±SE 1.29 24.73 ±SE 4.99 1 19.57 ±SE 0.34 35.05 ±SE 5.03 1 33.10 ±SE 6.44 6.94 ±SE 0.30 1 4.43 ±SE 0.31 21.46 ±SE 3.66 basic PR1 1 33.86 ±SE 8.05 98.09 ±SE 4.46 1 56.79 ±SE 9.59 127.20 ±SE 9.62 1 85.35 ±SE 4.84 74.58 ±SE 8.95 1 9.92 ±SE 2.19 37.19 ±SE 3.32 acidic PR2 1 7.75 ±SE 0.53 14.92 ±SE 4.61 1 3.89 ±SE 0.33 6.60 ±SE 1.45 1 8.57 ±SE 0.47 13.70 ±SE 3.35 1 3.5 ±SE 0.68 5.44 ±SE 0.29 PR5 1 8.98 ±SE 1.28 4.57 ±SE 0.96 1 5.33 ±SE 0.15 2.73 ±SE 0.38 1 9.42 ±SE0.27 2.085 ±SE 0.20 1 5.04 ±SE 1.92 18.43 ±SE 2.78
PR10 1 3.17 ±SE 0.81 6.11 ±SE 0.37 1 2.20 ±SE 0.65 2.85 ±SE 0.56 1 3.19 ±SE 0.084 4.14 ±SE 0.58 1 1.84 ±SE 0.27 11.94 ±SE 1.63 LoxD 1 1.44 ±SE 0.37 1.79 ±SE 0.90 1 1.18 ±SE 0.16 1.46 ±SE 0.06 1 1.16 ±SE 0.05 2.00 ±SE 0.21 1 1.72 ±SE 0.08 0.15 ±SE 0.003 Pin2 1 2.75 ±SE 0.42 0.71 ±SE 0.07 1 1.82 ±SE 0.05 0.11 ±SE 0.01 1 2.73 ±SE 0.57 0.13 ±SE 0.002 1 1.98 ±SE 0.15 0.67 ±SE 0.20 BGL2 1 2.90 ±SE 0.74 0.30 ±SE 0.11 1 1.82 ±SE 0.13 0.76 ±SE 0.01 1 5.84 ±SE 0.42 0.34 ±SE 0.08 1 5.21 ±SE 0.29 0.74 ±SE 0.04 Pti4 1 2.09 ±SE 0.04 5.79 ±SE 0.77 1 1.56 ±SE 0.04 2.34 ±SE 0.75 1 1.98 ±SE 0.86 1.99 ±SE 0.26 1 1.51 ±SE 0.28 4.64 ±SE 1.36
TSR 1 1.89 ±SE 0.15 1.22 ±SE 0.07 1 2.56 ±SE 1.10 3.13 ±SE 0.56 1 2.10 ±SE 0.08 4.05 ±SE 0.74 1 1.68 ±SE 0.10 1.51 ±SE 0.10 PR7(69B) 1 6.93 ±SE 0.48 4.60 ±SE 0.38 1 6.96 ±SE 0.25 7.04 ±SE 0.41 1 6.63 ±SE 0.60 13.27 ±SE 0.23 1 2.7 ±SE 0.02 5.35 ±SE 0.21 PR7(69A) 1 1.57 ±SE 0.14 1.56 ±SE 0.28 1 1.62 ±SE 0.14 1.41 ±SE 0.42 1 1.51 ±SE 0.10 1.45 ±SE 0.35 1 1.62 ±SE 0.23 0.08 ±SE 0.01
Table 1- Defense Gene Expression in stolbur C and PO Phytoplasma infected tomato through real time RT-PCR : healthy tomato (H), Stolbur C phytoplasma (C), stolbur PO phytoplasma(PO) infected tomato. Phenylalanine ammonia lyase (PAL); Isochorismate synthase (ICS); Acidic pathogenesis-related protein1 (acidic PR1); Basic pathogenesis-related protein1 (basic PR1); Acidic pathogenesis-related protein2 (acidic PR2); Pathogenesis-related protein 5 (Thaumatin-Like) (PR5); Pathogenesis-related protein 10 (PR10); Lipoxygenase D (LoxD); Proteinase inhibitor 2 (Pin2); Beta- 1,3-glucanase (BGL2); Ethylene Responsive transcription factors (Pti4 and TSR); Isoform of pathogenesis-related protein 7; PR7 (69A) and PR7 (69B). Average value of relative gene expression (RGE) of each gene with ± standard error (n=3). RGE >1 Gene activation (Pink); RGE <1 Gene repression (blue). Transcriptional expression was normalized with reference gene EF1 alpha.
136
Chapter II
2. Results
The plants respond to pathogens and activate defense pathways by expressing their defense related genes. In order to study defense pathways in stolbur C and stolbur PO phytoplasma-infected tomato, expression of different defense related genes implicated in these defense pathways, including PR proteins, biosynthesis and transcription factors genes were evaluated.
For each gene, expression was studied by real time RT-PCR and semi-quantitative RT-PCR using
RNA extracted from 3 biological samples. The average expression of each gene was shown by tables1 or histograms. For each gene, EF1 alpha was used as control gene. Here, some important results have been described but the figures of others have been included in Annex or (Additional documents) of the thesis. The results of all the genes studied have been shown in table1.
2.1. Salicylic acid (SA) dependent defense genes expression in stolbur phytoplasma-infected tomato
2.1.1. Salicylic acid (SA) biosynthesis genes expression in stolbur phytoplasma infected tomato
PAL is a key enzyme which is involved in the biosynthesis of the defense signal molecule SA, which has been shown to play an important role in plant resistance (Mauch-Mani and Salusarenko, 1996). The expression of PAL gene was studied in tomato leaves and flower buds of tomato infected with stolbur-C and
PO phytoplasma.
In stolbur C phytoplasma-infected tomato, transcriptional level of PAL was globally enhanced.
Indeed, by real time RT-PCR, we found that expression was 1.77 folds higher in 1mm flower buds, 1.23 folds in 3mm flower buds, 2.3 folds in 5mm flower buds and 2.75 folds higher in leaves as compared to healthy ones (Figure 1A).
These results were confirmed by semi-quantitative RT-PCR as clear band signal can be observed in leaves of stolbur C phytoplasma infected tomato (Figure 1B).
137
Healthy Stol-C Stol-PO
PAL
3,5 3 2,5 2 1,5 1 0,5
Relative fold Relative expression 0 1mm Flow er bud 3mm Flow er bud 5mm Flower bud Leaves
ICS
2,5
2
1,5
1 0,5
Relative fold expression Relative 0
1mm Flower bud 3mm Flower bud 5mm Flow er bud Leaves
Figure 1A: Expression of PAL and ICS genes by real time RT-PCR: Relative expression of phenyl alanine ammonia lyase ( PAL ) and Isochorismate Synthase ( ICS ) in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma- infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1< Gene activation (n=3).
H C PO PAL
ICS
EF1 alpha
Figure 1B: Expression of phenyl alanine ammonia lyase ( PAL ) and Isochorismate Synthase ( ICS ) genes by semi-quantitative RT-PCR in leaves of Healthy (H) stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). The constitutively expressed Elongation factors 1 (EF1alpha) as control gene.
138
In stolbur PO phytoplasma-infected tomato and in opposition to stolbur C tomato, expression of PAL was repressed in 1mm flower bud and leaves. However it was enhanced 1.29 folds in 3mm flower buds and
2.56 folds in 5 mm flower buds, like in stolbur C infected tomato. The repression of PAL was confirmed by semi-quantitative RT-PCR in leaves of stolbur PO tomato (Figure 1B).
Results showed that SA biosynthesis pathway via PAL was perturbed in stolbur infected leaves. The gene was activated in stolbur C but down-regulated in stolbur PO phytoplasma-infected leaves. The results of the other genes involved in SA biosynthesis pathways are listed in table 1.
We have observed that Isochorismate Synthase gene ( ICS ) was not activated in stolbur C but up- regulated in stolbur PO tomato. Another biosynthesis enzyme gene chalcone synthase ( CHS ), similar to ICS , was not expressed in stolbur C but induced in stolbur PO phytoplasma-infected tomato.
Expression of CHS2 was shown in histogram (Figure 2 in Annex). Control gene Elongation Factor
1 alpha (EF1) was amplified egually in flowere buds and leaves of healthy and stolbur phytoplasma infected tomato as shown by histogram (Figure 1 for EF1 alpha as control gene).
2.1.2. Expression of SA dependent PR genes
2.1.2.1. Expression of acidic pathogenesis related protein PR1 gene (acidic PR1)
Induction of salicylic acid (SA)-mediated responses or SAR can be followed using the expression level of the acidic PR1 gene which is also known marker gene for salicylic acid dependent defense responses in tomato (Block et al ., 2006; Tornero et al ., 1997; Van kan et al ., 1992).
In stolbur C phytoplasma-infected tomato, expression of acidic PR1 was up-regulated. Indeed, by real time RT-PCR, relative gene expression was 8.92 in 1mm, 19.57 in 3mm, 33.10 in 5mm flower buds and
4.43 in leaves (Figure 2A).
139
Healthy Stol-C Stol-PO
acidic PR1
50 40
30
20 10
Relative foldRelative expression 0
1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
acidic PR2
25 20
15
10
5
Relative foldRelative expression 0
1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
Figure 2A: Expression of acidic PR1 and acidic PR2 genes by real time RT-PCR: Relative expression of acidic pathogenesis-related protein 1 ( PR1a ) and acidic pathogenesis-related protein 2 ( PR2a ) genes in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato,yellow bar for stolbur C phytoplasma-infected tomato, pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1< Gene activation (n=3).
.
140
Similar to stolbur C tomato, in stolbur PO phytoplasma-infected tomato, transcription level of acidic
PR1 transcripts was also enhanced. Indeed, through real time RT-PCR, relative gene expression was 24.78 in
1mm flower buds, 35.05 in 3mm, 31.94 in 5mm flower buds and 21.46 in leaves (Figure 2A).
The expression in stolbur phytoplasma-infected tomato leaves and flower buds was significantly higher as compared to control which indicated that SA mediated defense pathway was activated.
2.1.2.2. Expression of acidic pathogenesis-related protein PR2 gene (acidic PR2)
In tomato, acidic PR2 or acidic beta- 1,3-glucanase ( GluA ) genes encodes apoplastic proteins induced upon 1 mM SA application and is considered as SA responsive marker gene (Van Kan, et al ., 1995).
In stolbur C and PO phytoplasma-infected tomato, transcripts expression level of acidic PR2 transcripts was up-regulated. Indeed, by real time RT-PCR, RGE in 1mm, 3mm, 5mm of flowers buds and leaves was 7.75, 3.89, 8.57 and 3.5 respectively in stolbur C-infected tomato as compared to relative control
1 (Figure 2A). By comparison, relative gene expression was 14.92 in 1mm, 6.60 in 3mm 13.70 in 5mm flower buds and 5.44 in leaves of stolbur PO-infected tomato.
Acidic PR2 expression was also studied by semi qRT-PCR and showed band signals brighter stolbur infected leaves than in healthy ones (Figure 2B).
These results indicated that expression of acidic PR2 gene was enhanced in both stolbur C and stolbur PO phytoplasma-infected-tomato suggesting that SA mediated pathway was present as basal defense against stolbur phytoplasma.
141
H C PO
acidic PR2
EF1 alpha
Figure 2B: Expression of pathogenesis related protein gene acidic PR2 gene in leaves through semi-quantitative RT-PCR in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1
(EF1alpha) as control gene.
Healthy Stol-C Stol-PO
PR5
25 20
15
10
5
Relative fold expression 0
1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
Figure 3A: Expression of PR5 gene through real time RT-PCR: Relative expression of PR5 gene (Thaumatin-like) in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, yellow bar for stolbur C phytoplasma infected tomato, pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation
H C PO
PR5
EF1 alpha
Figure 3B: Expression of pathogenesis related PR5 gene (Thaumatin-like) in leaves through semi-quantitative RT-PCR in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene.
142
2.1.2.3. Expression of Pathogenesis-related protein PR5 gene (Thaumatin like PR5)
The family of PR5 plays diverse functions and roles in development, and protection against bacterial, and fungal pathogens (Campos et al ., 2002; Piggott et al ., 2004).
For example, In Arabidopsis, tobacco and tomato, PR5 is involved in SAR along with PR-1
(unknown function), and PR-2 ( β-1-3 glucanase) these three genes have been extensively used as markers for the onset of SAR (Durant and Dong, 2004).
Transcripts expression level of PR5 was up-regulated in stolbur C phytoplasma-infected tomato.
Indeed, by real time RT-PCR, RGE of PR5 was of 8.98 in 1mm, 5.33 in 3mm, 9.42 in 5mm flower buds and
5.04 in leaves (Figure 3A). Expression of PR5 was confirmed through Semi qRT-PCR in different samples which is indicated by well amplified band signal of PR5 (Figure 3B).
In stolbur PO phytoplasma-infected tomato, accumulation of PR5 transcripts was also enhanced but to a lesser extent than in stolbur C-infected tomato buds (Figure 3A). Like for stolbur C phytoplasma, a well amplified signal band for PR5 was observed in stolbur PO phytoplasma infected leaves through Semi q RT-
PCR (Figure 3B).
The results suggested that PR5 was activated in both stolbur phytoplasma infected tomato. The higher PR5 gene expression activation was shown in Stolbur PO infected tomato leaves.
Some other SA mediated pathogenesis related protein genes like PR7 (69B) and PR10 were activated both in stolbur C and stolbur PO phytoplasma-infected tomato. The relative gene expression values of these pathogenesis related proteins in flower buds and leaves of stolbur C and PO infected tomato have been shown in Table1. (Figure 3 for PR10 , 9 for PR7 (69B) are shown in Annex).
143
Healthy Stol-C Stol-PO
Pin2
3,5
3 2,5 2 1,5 1 0,5
Relative fold expression Relative 0
1mm Flow er bud 3mm Flow er bud 5mm Flow er bud Leaves
BGL2
7 6 5 4
3 2 1 Relative fold Relative expression 0 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves
Figure 5A : Expression of proteinase inhibitor ( PIN2 ) and basic PR2 ( BGL2 ) genes by real time RT-PCR: Relative expression of PIN2 (upper) and BGL2 (lower) in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1< Gene activation (n=3).
H C PO H C PO Pin2 BGL2
EF1 alpha EF1 alpha
Figure 5B: Expression of PIN2 and BGL2 genes through semi-quantitative RT- PCR: Expresion of Pin2 (left) or BGL2 (right) in leaves of Healthy (H) stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomat. Elongation factors 1 (EF1alpha) as control gene.
144
2.2. Jasmonic acid dependent defense genes expression in stolbur phytoplasma-infected tomato
Plant defense against microbial pathogens involves several signalling pathways. JA is central to successful defense responses against insects and other herbivores (Glazebrook 2001, Hammond- Kosack and
Parker 2003, Glazebrook 2005, Kim et al., 2008).
Real-time quantitative polymerase chain reaction (qPCR) was used to follow the expression several genes (Table 1) which are involved in JA pathway, and production of JA-inducible serine proteinase inhibitors.
2.2.1. Expression of Proteinase Inhibitor 2 gene ( PIN2 )
Transcripts of the JA- and wound-inducible PIN2 (Heitz et al ., 1997) were detected in both incompatible and compatible interactions while aphid feed on tomato (Martinez de Ilarduya et al ., 2003). The expression level of a proteinase inhibitor gene, PIN2, can be utilized to measure induction of wound-inducible jasmonic acid
(JA) signalling (Bowles, 1998; Fidantsef et al ., 1999; Penacortes et al ., 1995)
In stolbur C phytoplasma-infected tomato, transcription expression level of PIN2 was up-regulated.
Indeed, by real time RT-PCR, relative gene expression of Pin2 was 2.75 in 1mm flower bud, 1.82 in 3mm flower buds, 2.73 in 5 mm flower buds and 1.98 in leaves of (Figure 5A). Semi qRT-PCR was conducted for
PIN2 , and a brighter band was obtained in Stolbur C infected tomato leaves as compared to healthy ones
(Figure 5B).
In stolbur PO phytoplasma-infected tomato, level of transcripts expression was globally down- regulated. Indeed, by real time RT-PCR, relative gene expression of PIN2 gene was 0.71 in 1mm, 0.11 in
3mm, 0.13 in 5mm flower buds and 0.12 in leaves. The down-regulation of PIN2 was confirmed as very faint signal band was obtained in stolbur PO infected leaves (Figure 5B).
These results suggested that PIN2 gene was differentially regulated in stolbur C and stolbur PO infected tomato as it was found activated and repressed respectively. This indicated that JA mediated defense pathway was active only in stolbur C tomato.
2.2.2. Expression of basic pathogenesis related protein PR2 gene (BGL2)
Identified PR2 proteins include β-1,3-glucanase. They may help to degrade fungal cell wall in addition to their involvement in normal plant development such as seed germination, growth, and flower development (Ye et al ., 1990).
145
Healthy Stol-C Stol-PO
basic PR1
150
100
50
0 Relative fold Relative expression
1mm Flow er bud 3mm Flower bud 5mm Flow e Leaves
Figure 6A : Expression of basic PR1 gene in flower buds and leaves through real time RT-PCR: Relative expression of basic pathogenesis related protein PR1 gene (basic PR1) in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 H C PO basic PR1 EF1 alpha Figure 6B: Expression of basic PR1 gene through semi-quantitative RT-PCR: Expression of basic PR1 (PR1b) gene on gel in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. 146 In tomato, basic PR2 or β-1,3-glucanase ( GluB ) genes encodes proteins with vacuolar location ( Van Kan et al ., 1995) which are induced strongly after MeJA and ET treatments. They are considered as MeJA dependent marker gene (Chao et al ., 1999). In stolbur C phytoplasma-infected tomato, expression of BGL2 gene (basic PR2) was up-regulated. Indeed, by real time RT-PCR, RGE of BGL2 was 2.90 in 1mm, 1.82 in 3mm, 5.84 in 5mm flower buds and 6.5 in leaves (Figure 5A). Elevated expression level of basic PR2 genes (basic PR2 , GluB and BGL2 ) in stolbur C phytoplasma-infected tomato leaves was confirmed by semi qRT-PCR as a brighter band was observed as compared to healthy plants (Figure 5B) (Figure 5 in Annex). Contrarily to stolbur C, transcripts expression level of BGL2 messenger RNA was globally down- regulated in stolbur PO-infected tomato. Indeed, by real time RT-PCR, relative gene expression level for BGL2 is comprised between 0.30 and 0.79 (Figure 5A). This down-regulation of basic PR2 protein genes was also confirmed in leaves infected by stolbur PO phytoplasma by semi-quantitative RT-PCR (Figure 5B). The results suggested that basic PR2 protein genes were activated in stolbur C phytoplasma-infected tomato leaves and flower buds whereas they were down-regulated in stolbur PO tomato. JA mediated defense pathway seems to be active in stolbur C infected tomato but not in stolbur PO infected tomato. The expression of JA biosynthesis gene LoxD was studied and found to be activated in stolbur C phytoplasma infected tomato but repressed in stolbur PO phytoplasma-infected tomato leaves (Table1) and (Figure 4 in Annex or additional documents). 2.3. Ethylene dependent defense genes expression in stolbur phytoplasma-infected tomato Ethylene (ET) is thought to enhance and stimulates defense responses, that’s why we study the expression of ET dependent defense genes in stolbur infected tomato. Ehylene mediated responses may be associated in induced systemic resistance (Van Loon et al ., 2006). Activation of ET responses can be followed using the basic PR1 marker gene (Figure 6A) (Block et al ., 2005; Tornero et al ., 1997; Van kan et al ., 1992; Van Loon et al ., 2006). Basic PR1 can also be used as marker gene in SA mediated defense pathway but acidic PR1 is usually preferred as it was exposed in part II- 2. 147 1mm Flower buds 3mm Flower buds 5mm Flower buds H C PO H C PO H C PO Defensin2 EF1 alpha Figure 7A : Expression of DEF2 through semi-quantitative RT-PCR: Trannscripts expression of pathogenesis related protein PR12 gene (DEF2 ) in 1mm, 3mm, 5mm flower buds of stolbur C and stolbur PO phytoplasma- infected tomato (from left to right). Healthy tomato (H), stolbur C-infected tomato (C), stolbur PO-infected tomato (PO) H C PO Defensin2 EF1 alpha Figure 7B : Transcripts expression of DEF2 through semi-quantitative RT-PCR Expression of Defensin 2 gene (DEF2 ) in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. Expression of basic PR1 gene was studied in stolbur C and PO phytoplasma-infected tomato and was found to be highly up-regulated. Indeed, by real time RT-PCR, relative gene expression of basic PR1 was comprised between 33.86 and 127.20 in stolbur infected tomato buds, and between 9.92 and 37.19 for stolbur infected leaves (Figure 6A). Elevated expression level of basic-PR1 was confirmed by semi-quantitative RT-PCR by the presence of well amplified band signal in stolbur C and PO phytoplasma-infected tomato (Figure 6 B). Our results suggested that SA/ET mediated defense pathway was activated in stolbur C and stolbur PO 148 phytoplasma infected tomato as indicated by the activation of basic PR1 (and acidic PR1) which is considered as SA/ET dependent marker gene. The expression of some other ET mediated defense genes like PR4 , PR7 (69B) have been studied. We found that both pathogenesis-related protein genes was activated in flower buds and leaves of stolbur C and PO phytoplasma-infected tomato (Table 1). The genes of ET responsive transcription factors (TSR and Pti4) which regulate ET mediated genes, were also activated in stolbur C and PO phytoplasma-infected tomato (Table1 for TSR , Pti4 , PR4 , PR7B and Figure 6, 7 and 8, 9 respectively are shown in additional documents). Another PR protein gene, PR7 (69A) was found to be activated in stolbur C but repressed in stolbur PO phytoplasma-infected tomato leave (Figure 10 in additional documents or Annex). 2.4. Developmental regulated Defense Gene Expression ( Defensin 2 ) Plant defensins are small, highly stable, cysteine-rich peptides that constitute a part of the innate immune system primarily directed against fungal pathogens. Based on recent studies, some plant defensins are not merely toxic to microbes but also have roles in regulating plant growth and development. In stolbur C phytoplasma-infected tomato, expression level of defensin 2 ( DEF2 ) gene was globally not changed. Indeed, by semi-qRT-PCR, we obtained the bands of nearly equal intensity in 1mm, 3mm and 5 mm flower buds as compared to bands obtained in healthy tomato (Figure 7A). In healthy and stolbur C phytoplasma-infected leaves, DEF2 was not expressed as the absence of bands showing its expression only restricted to flower buds (Figure 7B). Unlike in stolbur C phytoplasma-infected tomato buds, the transcripts expression level of defensin 2 (DEF2 ) was down-regulated in 1mm, 3mm and 5mm flower buds infected by stolbur PO phytoplasma by RT-PCR. Faint bands to DEF2 were observed in 1mm, 3mm and 5mm flower buds of PO phytoplasma- infected tomato as compared to bands obtained in healthy tomato (Figure 7A). Like stolbur C phytoplasma- infected leaves, no band was observed in stolbur PO infected leaves, showing its expression was restricted to flower buds (Figure 7B). These results suggested that the expression of defensin 2 gene was not changed in stolbur C phytoplasma infected-tomato flower buds and that stolbur PO inhibited the expression of defensin 2 gene. 149 2.5. Summary After studying the defense genes expression in stolbur C and stolbur PO phytoplasma-infected tomato, the results are as follow. In stolbur C phytoplasma-infected tomato, phenylalanine ammonia lyase (PAL ) which acts upstream of SA biosynthesis and is implicated in defense pathways, was activated. But other SA biosynthesis enzymes genes, isochorismate synthase ( ICS ) and, chalcone synthase 2 ( CHS2 ), were not activated. All the SA mediated and down-stream acting pathogenesis-related proteins genes, PR1a, PR1b, PR2a, PR5, PR7 (69B) and PR10 were activated suggesting that Salicylic acid (SA) dependent defense pathway was present in stolbur C phytoplasma-infected tomato. Ethylene (ET) dependent defense pathway genes, like ET responsive transcription factors, TSR and Pti4 , and ET mediated marker gene PR1b, PR4, PR7 ( 69B ) protein genes were activated. Lipoxygenase D (LoxD ) which is involved in jasmonic acid (JA) biosynthesis and JA dependent marker genes such as proteinase inhibitor 2 and basic pathogenesis-related proteins PR2 (basic PR2 , BGL2 , and GluB ) were activated suggesting that JA dependent defense pathway was also present in stolbur C phytoplasma-infected tomato. In stolbur PO phytoplasma-infected tomato, expression of PAL was down-regulated while ICS and CHS2 were up-regulated along with the activation of SA mediated Pathogenesis-related proteins gene ( PR1a, PR1b, PR2a, PR5, PR7 (69B) and PR10 ) suggesting that SA dependent defense pathway was activated. Like SA defense pathway, ET dependent defense pathway was also activated because ET responsive transcription factors ( TSR and Pti4 ) and PR genes ( PR1b, PR4, PR7 (69B)) were up-regulated in stolbur PO phytoplasma- infected tomato. However, unlike stolbur C phytoplasma-infected tomato, JA dependent defense pathway was not activated because JA biosynthesis enzyme gene, LoxD with JA dependent marker genes, proteinase inhibitor 2 and basic PR2 (basic PR2, BGL2 , and GluB ) were severly down-regulated. 150 Chapter II Discussion Study of the Salicylic acid (SA), Ethylene (ET) and Jasmonic acid (JA) Dependent Defense Gene Expression in Stolbur Phytoplasma-Infected Tomato 151 3. Discussion We have studied the transcriptional expression of defense genes involved in SA, ET and JA dependent defense pathway in stolbur C and stolbur PO phytoplasma-infected tomato. These defenses related genes have been shown to be expressed in different plants against different pathogens. The expression of each gene was discussed here separately by comparing their expression in response to different pathogens. 3.1. Biosynthesis Genes Implicated in Defense Pathways are perturbed 3.1.1. Genes encoding SA biosynthesis enzymes Phenylalanine ammonia-lyase ( PAL ) acts in an upstream component of SA biosynthetic pathway, which has been shown to play an important role in plant defense and development (Mauch- Mani and Salusarenko, 1996). An increase in PAL transcript level has been correlated with wounding, aphid feeding and pathogen infection (Lee et al ., 1994; Moran and Thomson, 2001). Indeed several genes in the phenylpropanoid biosynthetic pathway of which PAL , are differentially expressed and response to various biotic and abiotic stresses (Weisshaar and Jenkins, 1998). Previous studies showed that plants synthesize SA from phenylalanine via PAL pathway in Arabidopsis plants resistant to Peronospora parasitica (Mauch-Mani and Slusarenko, 1996), TMV virus-inoculated tobacco (Yalpani et al., 1993), and potato (Coquoz et al ., 1998; Ribnicky et al ., 1998; Leon et al ., 1995). Little is known about PAL expression after biotic stress in tomato plants (Gorlach et al ., 1995). Although we did not measure the SA level in infected plants, up-regulation of PAL gene and activation of SA dependent defense genes in stolbur C phytoplasma-infected tomato indicated that SA was synthesized via PAL . Our results are also consitent with the previous findings which showed induction of PAL on insect herbivory or pathogen infection. For example, in tomato chewed by caterpillar , Helicoverpa armigera, the expression of PAL was highly induced and synthesis of SA was also observed (Peng et al ., 2004). David et al . (2010) showed that mRNA level of PAL was enhanced in tomato on white fly feeding. In contrast, susceptible tomato with fungus strain verticilium showed substantial suppression level of PAL m RNA. It has been suggested that pathogens can suppress the expression of PAL in diseased plants (Lee et al ., 1991; Lee et al ., 2006). 152 Consistent with these results, in our current study, PAL was found to be repressed in stolbur PO-infected leaves. Differential expression of PAL , as compared to healthy tomato, may be associated to stolbur phytoplasma, C and PO, and possibly to the different virulence factors altering the expression of PAL . Jun Tao et al. (2011) suggested that in Euphorbia poinsettia , EpPAL might play an important role in the anthocyanin biosynthetic pathway of poinsettia bracts. It has been shown that the colour of plant organ, such as fruit, leaf and flower originates from a blend of chlorophyll, carotenoids and flavonoids (Kim et al ., 2003, 2006). Flavonoids have many bioactivities like anti-cancer, anti-inflammation and anti-atherosclerosis and act as antioxidants and pathogen protectants (Harborne and Williams, 2000; Arai et al ., 2000; Havsteen, 2002). In our current study, PAL was induced in flower buds of both stolbur C and stolbur PO infected tomato showing that PAL is involved in basal defense against phytoplasma. However, it is known that PAL can be also associated with the production of phenylpropanoid metabolites such as chlorophyll, carotenoids, and flavonoids and anthocyanin contents. Our results showed that SA biosynthesis could be done via PAL in stolbur C-infected tomato leaves, but not in stolbur PO-infected leaves However, SA could still be produced when this pathway was inhibited through another biosynthetic pathway (Mauch-Mani and Slusarenko, 1996; Coquoz et al ., 1998). Indeed, like bacteria, Plants can also produce SA from isochorismate (IC) via ICS pathway. We have shown that in stolbur PO-infected tomato, Isochorismate synthase gene ( ICS ) was up- regulated. So biosynthesis of SA signalling molecule can take place via ICS pathways. In A. thaliana , the pathogen-induced accumulation of SA requires isochorismate synthase (AtICS1) (Wildermuth et al ., 2001). Strawn et al . (2007) have also demonstrated that plastid localized AtICS1 is required for the pathogen- induced accumulation of SA which is produced from isochorismate (IC). Our results are consistent with previous work showing that SA could still be produced when PAL pathway was inhibited (Mauch-Mani and Slusarenko, 1996; Coquoz et al ., 1998). We have shown that Chalcone synthase gene was down-regulated in stolbur C phytoplasma-infected tomato and up-regulated in stolbur PO phytoplasma infected tomato. Chalcone synthases belong to the family of polyketide synthase enzymes associated with the production of chalcones mainly found in plants as natural defense mechanisms and for the production of pigments. Phenylalanine ammonia-lyase (PAL) and 153 chalcone synthase (CHS) are two key enzymes involved in phenylpropanoid biosynthesis (Smith and Banks, 1986). Infection of petunia (Petunia hybrida) plants with tobacco rattle virus (TRV) containing a chalcone synthase fragment resulted in silencing of anthocyanin production in infected flowers (Chen et al ., 2004) Our results suggested that CHS gene was activated in Stolbur-PO-infected tomato leaves and flower buds, but not in stolbur C phytoplasma-infected tomato. On the other hand, PAL has an increased level of expression in stolbur C-infected tomato but reduced expression was found in PO-infected tomato. As CHS is involved in synthesis of anthocyanin (pigment of flowers). We can suggest that the repression of CHS2 gene can have an effect on pigmentation of stolbur C phytoplasma-infected tomato petals. On the other hand, activation of CHS in stolbur PO could be related to the production of purple colour at severe infection in stolbur PO-infected tomato leaves. 3.1.2. Genes encoding of JA biosynthesis Enzyme JA biosynthesis takes place when plants are infected by pathogens or wounded by insect herbivory (Graham et al ., 1985; O’Donnell et al., 1996; Diaz et al., 2002). We have studied the expression of LoxD which is involved in JA biosynthesis and defense mechanism. Lox enzyme is known to fulfil an important role at the beginning of the jasmonate synthesis cascade (Hause et al., 2000). Indeed, Transgenic Nicotiana attenuata plants expressing the Lox3 gene in the antisense orientation had decreased accumulation of damage-induced JA, by then reducing resistance to herbivory. Similar to PIN1 and PIN2, LoxD mRNAs accumulate in response to wounding, chewing insects, and JA (Heitz et al ., 1997). Transcripts of PIN2, and LoxD (Heitz et al ., 1997) were detected in both incompatible and compatible interactions while aphid feed on tomato (Martinez de Ilarduya et al ., 2003). Lox mRNAs were induced in susceptible tomato by potato aphid (Fidantsef et al ., 1999). Similarly, induction of Lox2 transcript levels by the green peach aphid has been observed in Arabidopsis (Moran and Thompson, 2001). In our current study, we have found an elevated expression of LoxD in stolbur C-infected tomato and a reduced expression in stolbur PO-infected tomato. It suggested an activation of JA mediated defense pathway via LoxD in stolbur C infected tomato leaves, and a down regulation of JA defense pathway in PO infected tomato leaves through the repression of LoxD . 154 This difference of LoxD expression in stolbur C and stolbur PO infected tomato can be associated to different virulence effectors, yet unknown. Recently, 56 candidate effectors proteins named secreted AY-WB proteins (SAPs) have been identified from Ayster Yellows Phytoplasma (Bai et al ., 2009). SAP11 effectors were detected in the nuclei beyond the phloem showing that these proteins have been transported from phloem to nuclei (Bai et al ., 2009). SAP11 was found to induce witches broom symptom in Arabidopsis (Sugio et al ., 2010). These plants have curly leaves and an increased number of axillary stem that resemble the witches broom symptoms exhibited by AY-WB infected plants. It has been shown that SAP11 destabilizes the TCP (Teosinte branched1, Cycloidea, Proliferating Cell Factor 1 and 2) transcription factors which control plant development (Martin-Trilo et al ., 2010) leading to a decreased synthesis of JA, a phytohormone involved in development and defense. SAP11 suppressed the expression of Lox enzyme and down-regulated the JA defense pathway. Our results are in agreement with these findings because stolbur PO phytoplasma infection induces floral malformation like sepals hypertrophy, aborted petal and stamen development and large chlorotic, crooked shaped leaves. Stolbur PO phytoplasma also suppress the expression of LoxD and down-regulated the JA defense pathways. So, it is hypothesis that stolbur PO phytoplasma may produce such effector proteins that suppress the expression of JA mediated defense genes. On other hand, stolbur C phytoplasma did not induce symptoms like stolbur PO and may have different virulence effectors. This is supported by the fact that different effectors contents have been identified even from closely related phytplasma strains (Bai et al ., 2009). Stolbur C and stolbur PO have different genome size and induce different symptom: they may have different effectors to interfere the plant developmental and defense process. 3.2. Pathogenesis Related Proteins Genes Expression Many pathogenesis related proteins have been shown to be induced upon biotic stress such as pathogen infection. We have studied the expression of pathogenesis related proteins in stolbur C and stolbur PO phytoplasma-infected tomato and our results support previous works done on PRs. In our current study, expression of acidic PR1 was enhanced in both stolbur C and stolbur PO phytoplasma infected tomato. 155 Acidic PR1 has been shown to be expressed in different plants against different pathogens: In rice, it has been shown that infection with Magnaporthe grisea highly induced the transient expression of acidic PR1 in the incompatible interaction as compared to the compatible interaction (Jwa et al ., 2001; Schweizer et al ., 1997). In our case, higher induction of acidic PR1 was found in susceptible tomato infected by stolbur phytoplasma as any resistance against these phytoplasmas could be found. Alexander et al . (1993) demonstrated that transgenic tobacco plants expressing high levels of protein acidic PRl and basic PR1 exhibited significantly reduced disease symptoms caused by infection with two oomycete pathogens, Peronospora tabacina and Phytophthora parasitica var nicotianae. However, no resistance was found against viruses in transgenic tobacco plants expressing PRla and PRlb (Cutt et al ., 1989; Linthorst et al ., 1989). During infection of tomato with TMV, PR1a1 gene (acidic PR1), an isoform of acidic PR1 , is strongly induced upon tobaco mosaic virus (TMV) infection and Salicylic acid (SA) treatment (Tornero et al ., 1994). The accumulation of PR1 (also known as P4 or acidic PR1) with antifungal activity (Niderman et al., 1995) was accumulated in response to aphid feeding on tomato during compatible and incompatible interaction (Martinez de Ilarduya et al ., 2003). The transcript level of acidic PR1 and basic PR1 was enhanced in tomato infected by bacterial pathogen Pseudomonas syringae DC 300 pv tomato (Herman et al ., 2008). Our results of acidic PR1 expression support the findings of above mentioned work because acidic PR1 has been shown to be induced in tomato infected by stolbur C and stolbur PO phytoplasma. Basic PR1 expression was highly enhanced in stolbur C and stolbur PO phytoplasma-infected tomato. Previous work showed that like acidic PR1, basic PR1 protein exhibit strong inhibitory activity against the late blight fungal pathogen of potato, Phytophthora infestans (Niderman et al ., 1995). In our study, basic PR1 gene was highly expressed in stolbur C and stolbur PO phytoplasma-infected tomato supporting the previous findings. In flower buds of infected tomato, expression of acidic PR1 and basic PR1 was highly enhanced, which shows its involvement in the defense. We suggest that acidic PR1 and basic PR1 are involved in basal defense activated by SA/ET mediated defense pathway against stolbur C and PO phytoplasma. 156 Our results showed the activation of acidic PR2 gene in stolbur C and PO-infected tomato. In tomato, acidic PR2 or acidic β- 1,3-glucanase ( GluA ) encodes apoplastic proteins induced upon 1 mM SA application and are considered as SA responsive marker genes (Van Kan et al ., 1995). It exists Variants of acidic- β -1,3-glucanases ( PR-2a, PR-2b, PR-2c and PR-2d ) which have been shown to be induced during SAR in N.tabacum (Van Loon and Strien, 1999 ). Increases in levels of chitinases and β -1,3-glucanases have been reported in resistant but not susceptible barley upon infestation with the birdcherry-oat aphid Rhopalosiphum padi L. and in both resistant and susceptible sorghum exposed to the greenbug Schizaphis graminum Rondani (Forslund et al ., 2000; Krishnaveni et al ., 1999). In contrast, Chao et al . (1999) and David et al. (2010) found that in tomato, GluA was not induced upon white fly feeding. Our results indicated that the mRNA of GluA accumulated in stolbur C and stolbur PO phytoplasma-infected tomato. It suggested that SA mediated defense pathways existed in stolbur C and stolbur PO phytoplasma-infected tomato. Lotan et al., 1989 have shown that, in addition to their pathogen-related induction in leaves, at least three classes of these proteins (PR1, PR2 and PR3) are present in healthy tobacco flowers, irrespective of microbial attack or other stress. Expression of a β-1,3-glucanase in floral organs may interfere with microsporogenesis. The expression of acidic PR in flower buds and leaves supported the idea of the PR involvement in defense and development. It has also been shown that β-1,3-glucanase may help to degrade fungal cell wall in addition to its involvement in normal plant development such as seed germination, growth, and flower development (Ye et al ., 1990). We have also studied the expression of Thaumatin-like Pathogenesis related Protein PR5 gene which showed enhanced expression in stolbur C and PO-infected tomato. Expression of PR5 genes can be triggered by plant pathogens or abiotic factors such as wounding and exogenously supplied SA and methyl jasmonate (Merkouropoulos et al ., 2003; Shanmugam et al ., 2005). PR5 was systemically induced in response to ISR inducing microorganism Trichoderma humatum 328 colonization of tomato roots and provided a significant degree of protection against bacterial spot of 157 tomato and its pathogen Xanthomonas euvesicatoria (Alphano et al ., 2007). However, although PR5 was activated in stolbur infected tomato, protection has not been observed againts the two stolbur isolates used. PR5 has also been shown to be induced in tomato grown on suppressive compost, where induction is likely to be related to soil pathogens (Kavroulakis et al., 2006). This is consistent with the fact that constitutive expression of genes encoding PR is one of the strategies proposed to obtain a broad and durable level of resistance against different phytopathogenic fungi (Veronese et al ., 1999). Indeed, Over-expression of PR5 proteins in transgenic plants have generally resulted in enhancing disease resistance in some plant species. For example, potato osmotin enhances resistance to potato late blight pathogen Phytophthora infestans (Liu et al ., 1994). The rice Thaumatin like protein-D34 enhances resistance to the sheath blight pathogen, Rhizoctonia solani and Fusarium graminearum (Datta et al ., 1999; Chen et al ., 1999; Mackintosh et al ., 2007). Also, Constitutive expression of Vitis vinifera PR5 (TLP), VVTL-1 plays an important role in grape resistance to anthracnose (Jayasankar et al ., 2003) and transgenic grapes expressing VVTL-1 exhibit sustained resistance to several fungal pathogens such as Uncinula necator and Botrytis cinerea (Dhekney et al ., 2010). Prunus domestica Pathogenesis-Related Protein-5 activates the defense response pathway and increases the resistance to fungal infection in Arabidopsis transgenic plant against Alternaria brassicicola (El-kereamy et al ., 2011). Higher accumulation of Osmotin-like PR5 in the resistant cultivars suggested that they were related to the defense mechanism against P. infestans (El-komy et al ., 2010). Our results showed that PR5 expression was higher in stolbur-C and stolbur -PO infected tomato but no resistance was observed. Our results also support the findings that many PR10 genes were up regulated when plants were exposed to biotic stresses, such as viruses (Xu et al ., 2003), bacteria (Robert et al ., 2001) or fungi (Jwa et al ., 2001). It has been demonstrated that some PR10 proteins possess antimicrobial activities in vitro against bacteria, fungi and viruses, such as Ocatin (Flores et al ., 2002), SsPR10 (Liu et al ., 2006) and CaPR10 (Park et al ., 2004). The constitutive accumulation of PR10 proteins has been detected during plant growth and development in plant flower organ, pollen grain, fruits seeds, roots, stem and leaves . All these studies point out PR10 as a very useful gene for crop improvement. 158 With very minimal information available on its expression, we decided to study its transcription in stolbur C and stolbur PO phytoplasma-infected tomato. The results suggested that PR10 was activated in both stolbur phytoplasma infected tomato leaves and flower buds. Transcript levels of the intracellular basic β -1,3-glucanase ( GluB ), which accumulates in response to Methyl Jasmonate and Ethylene signal molecules (Chao et al. , 1999; van Kan et al ., 1995) were also investigated. In tomato infected by stolbur C phytoplasma, GluB was activated, consistent with the fact that in tomato infested by Helicoverpa armigera , GluB trancripts was enhanced (Peng et al ., 2004). Also, the RNA transcripts of GluB were increased in tomato infested with whitefly. These proteins have attracted considerable interest because of their possible causal role in resistance suggested by their high induction during induced local and systemic resistance. A prominent induction of chitinase and β -1,3-glucanase gene expression in the leaves of plants challenged by a pathogen has been reported for plants growing on compost-amended mixtures, with suppressive activity (Zhang et al ., 1998). In contrast, expression of GluB was significantly lower in Stolbur PO-infected tomato leaves and flower buds as compared to control, which indicated that JA mediated defense pathway was repressed in stolbur -PO infected tomato. The repression of GluB in stolbur PO infected tomato can be related to the repression of a soybean (Glycine max) beta-1,3-endoglucanase during Phytophthora sojae infection which secretes a glucanase inhibitor proteins that suppress the activity of this PR protein (Rose et al ., 2002). Also, Phytoplasma effector protein SAP11 was involved in the down-regulation of JA mediated defense pathway (Bai et al ., 2009). The expression level of the proteinase inhibitor 2 (PIN2), can be used to measure induction of wound-inducible jasmonic acid (JA) signalling (Bowles, 1998; Fidantsef et al ., 1999; Penacortes et al ., 1995). This JA dependent marker gene, proteinase inhibitor 2 ( PIN2) was also up-regulated in stolbur C infected tomato and down-regulated in stolbur PO infected tomato. It is known that expression of the tomato proteinase inhibitors I ( PIN1 ) and II ( PIN2) genes were induced by wounding and chewing (Graham et al., 1985ab; O’Donnell et al., 1996; Diaz et al., 2002; Heitz et al ., 1997). Indeed, Transcripts of the JA and wound-inducible PIN2 (Heitz et al ., 1997) were detected in both incompatible and compatible interactions while aphid feed on tomato (Martinez de Ilarduya et al ., 159 2003). Capsicum annuum showed hypersensitive response to TMV infection by over-expressing several defense-related transcripts including proteinase inhibitors (PIs) (Shin et al ., 2001). In potato, a classic example of plant–insect interactions is the production of potato type I inhibitor (PIN1) and type II inhibitor (PIN2) serine PIs by solanaceous plants responding to damage by lepidopteran larvae (Green et al ., 1972). Serine proteinase inhibitors (PIs) are abundant in plant tissues such as seeds, tubers and flowers that require high protection from insects, and show several fold higher accumulation in leaves upon damage/chewing (Ryan, 1990). Besides plant-insect interactions, PIN2 was also involved in plant-bacteria interaction. For example, the transcript of PIN2 was enhanced in tomato infected by bacterial pathogen Pst DC 300 pv tomato (Herman et al ., 2008). This is consistent with our study where PIN2 was activated in stolbur C phytoplasma- infected tomato leaves and flower buds. However, the expression in stolbur PO-infected tomato leaves and flower buds was significantly lower as compared to control, indicating the difference of response against these two isolates. In tomatoes ( Solanum lycopersicum Mill.), caterpillars and aphids induced different plant responses. Similarly, stolbur C and stolbur PO also induced different induction concerning proteinase inhibitors expression. Indeed, stolbur C phytoplasma induces PIN2 via JA pathway, like the beet armyworm, Spodoptera exigua (Hübner) induced the production of a variety of plant defenses including PIs (Broadway et al ., 1986) via the JA-signaling pathway (Thaler et al ., 2002). We have also shown that PR4 was activated in both stolbur C and PO phytoplasma-infected tomato consistent with the fact that PR4 protein is induced by pathogen attack, (Gu et al ., 2002; Ruperti et al ., 2002). It has been shown for example that PR4 was induced in intercellular space during incompatible viral interaction (Elvira et al., 2008). In C. chinense , PR4 is induced during both the compatible (PMMoV-I infection) and the incompatible (PMMoV-S infection) interactions. It was highly associated with HR induction and to a lesser extent with the compatible interaction, but only in the later stages of infection (Guevara-Morato et al ., 2010). Expression of PR4 was also found in tomato flower bud which is in agreement with the fact that PR4 polypeptides are endochitinases present in pedicels, sepals, anthers, and ovaries of tobacco flowers (Lotan et al ., 1989). 160 PR4 proteins were recently found in the extra floral nectar of Acacia, where their presence was described as protecting the extrafloral nectar from fungal infestation (Gonzalez-Teuber et al ., 2009). Expression of PR4 in stolbur C and stolbur PO phytoplasma infected tomato leaves and flower buds suggested that ET dependent defense pathway was active. PR4 is indeed considered as a marker gene of ET mediated pathway. We have also showed that PR7 , more precisely the gene for the subtilisin-like Ser protease P69B, was activated in stolbur C and PO-infected tomato, has long been tied to plant defense (Tornero et al ., 1997; Zhao et al ., 2003; Tian et al ., 2004). P69B is known to be induced by multiple plant pathogens, including the oomycete Phytophthora infestans , citrus exocortis viroid, and the bacterium Pseudomonas syringae (Tornero et al ., 1997; Zhao et al., 2003; Tian et al ., 2004). In marked contrast, another gene member of the PR69 family like PR7 , ie P69A , was inhibited in stolbur PO phytoplasma-infected tomato but induced upon stolbur C infection. During the course of both compatible and an incompatible interaction with Pseudomonas syringae or upon treatment with SA, P69A gene was shown to be expressed constitutively in tomato plants, but P69B and P69C , do not show constitutive expression but are notably induced by infection (Jorda´ et al ., 1999; Jorda´ and Vera., 2000). This suggests that both, P69B and P69C , may play roles as active defense weapons against the attacking pathogens. Although the expression of P69A , P69D , P69E , and P69F is not induced over basal levels during pathogenesis, it cannot be excluded that these genes are implicated in pathogenesis by acting as an early line of defense, as proposed for other constitutively expressed PR genes (Samac and Shah, 1991; Tornero et al ., 1997b). Our results indicate that ET and SA mediated defense pathways are active in stolbur C and in stolbur PO susceptible tomato, but the other isoform of PR7 (69A) was found to be repressed in PO-infected tomato. This inhibition may be related as counter defense strategie of stolbur PO phytoplasma. Our results showed that ET responsive transcription factors were activated in stolbur C and PO- infected tomato. In tomato, ET responsive transcription factors, Pti4 and TSR, regulate the expression of ET mediated genes through GCC box (or without GCC) present mostly in the promoter region of PR proteins. 161 Transcription factor Pti4 in Arabidopsis activated the expression of salicylic acid-regulated genes such as PR1 and PR2 . Arabidopsis plants expressing Pti4 displayed increased resistance to the fungal pathogen Erysiphe orontii and increased tolerance to the bacterial pathogen Pseudomonase syringae pv tomato (Yong-Qiang Gu et al ., 2002). The results of transcription factor genes expression indicated that both ET dependent transcription factors TSR and Pti4 genes were activated in stolbur C and stolbur PO phytoplasma infected tomato suggesting that ET mediated genes were regulated by these transcription factors. Based on recent studies, some plant defensins are not merely toxic to microbes but also has roles in regulating plant growth and development. DEF2 from certain plants appeared to be active as antifungal peptide (Osborn et al ., 1995; Terasse et al ., 1995). 162 Stolbur PO Stolbur C Effectors? Effectors? Biosynthesis Enzymes Biosynthesis Enzymes CHS2 PAL ICS ? LoxD CHS2 PAL ICS ? LoxD SA Ethylene JA SA Ethylene JA Transcription factors Transcription factors ? TSR Pti4 ? ? TSRPti4 ? Defense Genes Expression Defense Genes Expression PR1a PR1b PIN2 PR1a PR1b PIN2 PR1b PR2a PR2b PR1b PR2a PR2b PR2a PR4 Bgl2 PR2a PR4 Bgl2 PR5 PR5 PR5 PR5 PR7b PR7b PR7b PR7b PR10 PR10 PR10 PR10 PR7a PR7a PR7a PR7a DEF2 DEF2 DEF2 DEF2 Figure 9 - : Proposed Model /Cross talk showing relative gene expression of defense related genes in flower buds and leaves through real time RT-PCR: Not tested gene (white box); Expression not changed (yellow box); Expression down-regulated (blue box); Epression up-regulated (pink box). healthy tomato (H), Stolbur C phytoplasma (C), stolbur PO phytoplasma(PO) infected tomato. Phenylalanine ammonia lyase (PAL); Isochorismate synthase (ICS); Acidic pathogenesis-related protein1 (acidic PR1); Basic pathogenesis-related protein1 (basic PR1); Acidic pathogenesis-related protein2 (acidic PR2); Pathogenesis-related protein 5 (Thaumatin-Like) (PR5); Pathogenesis-related protein 10 (PR10); Lipoxygenase D (LoxD); Proteinase inhibitor 2 (Pin2); Beta- 1,3-glucanase (BGL2); Ethylene Responsive transcription factors (Pti4 and TSR); Isoform of pathogenesis-related protein 7; PR7 (69A) and PR7 (69B); Defensin 2 (DEF2). 163 Tomato defensin ( DEF2 ) is closely similar to DEF1 . Over expression of DEF2 alter the growth of various organs like flower but enhance foliar resistance to fungal pathogen Botrytis cinerea in tomato plants (Henrik et al., 2009). DEF2 was expressed only in tomato flower buds but not in leaves indicating its involvement in floral organ synthesis. In Tomato infected by stolbur C phytoplasma, expression of DEF2 was not changed but it was repressed in stolbur PO-infected tomato. 3.3. Suggested Model of Cross-talk in stolbur phytoplasma-infected tomato Synergistic or antagonistic interactions of different defense pathways, based on the cost of fitness, have been observed in plants against particular pathogen or insect. Plants respond to pathogen attack by activating multiple defense mechanisms to protect them selves from infection. Our study on the defense gene expression in stolbur phytoplasma-tomato interactions clearly show this type of cross talk of defense pathways mediated by different phytohormones (Figure 9). Results suggested a cross-talk of defense pathways in stolbur-C phytoplasma infected tomato. Indeed, SA mediated defense and biosynthesis genes have been shown to be activated. The pathogenesis related protein genes like PR1a, PR1b, PR2a, PR5 , considered as marker genes in SA dependent defense pathways, and were used to measure the SA mediated pathway. Transcriptional activation of SA mediated genes indicated clearly that this pathway is activated against stolbur-C phytoplasma infection. Moreover, Increased expression of wound inducible and JA mediated genes LoxD, PIN2 and PR2b (GluB ) showed the activation of JA pathway in these tomato. In addition, ET mediated expression of PR1b, PR4, PR7 also indicated the involvement of this defense pathway. This study, suggested a synergistic interaction of SA, JA and ET dependent defense pathways. This has been already described for different pathogens and insects. During compatible and incompatible aphid-tomato interaction, SA, JA mediated defense pathway is suggested (Martinez de Ilarduya et al ., 2003). SA- and JA-dependent synergistic interactions have been described in Arabidopsis (Mur et al ., 2006; Van wees et al ., 2000). For example, treatment with low concentrations of jasmonic acid (JA) and salicylic acid (SA) resulted in a synergistic effect on the JA- and SA-dependent genes but at higher concentrations the effects were antagonistic which showed that the outcome of the SA-JA interaction is dependent on the relative concentration of each hormone (Mur et al ., 2006). 164 The temporal and spatial distribution can impact on the outcome of SA and JA interaction (Truman et al. , 2007). Phytoplasma also alter the concentration of phytohormones (JA synthesis) by interfering in the process of their biosynthesis (Bai et al ., 2009). Here, we suggested that stolbur C phytoplasma maintain the lower concentration of JA and SA by activating JA and SA responsive genes. First time, we suggested a SA, JA, ET synergistic Cross-talk model during the stolbur-C phytoplasma-tomato interaction, as shown in Here for the Figure 9. Mutual antagonisms between the SA and JA defense pathways has been well documented and estabilished (Glazebrook et al . 2003; Spoel et al ., 2003; Thaler et al ., 2002; Thomma et al . 2001). In nature, SA and JA synergistic and antagonistic interaction have been observed against different pathogen and insects. Here, we observed SA and JA antagonistic interaction in stolbur-PO infected tomato. SA dependent marker gene ( PR1a, PR1b, PR2a, PR5 ) are activated as well as ET mediated genes but JA dependent marker genes (like PIN2, PR2b, loxD ) are repressed. SA and JA antagonistic interaction have already been observed in insect-plant interaction and plant-pathogen interaction. For example, silver white fly induces SA defense pathway but suppresses JA pathway in Arabidopsis. Aphid and Silverleaf whitefly (SLWF; Bemisia tabaci type B; Bemisia argentifolii ) are obligate phloem feeding insects. Transcriptome analysis after SLWF feeding in Arabidopsis ecotype Columbia has implicated that the SA-dependent pathway is induced, while the JA-dependent pathway shows no alteration or is repressed (Kempema et al ., 2007). SLWFs enhance their success on Arabidopsis plants by failing to activate JA-regulated defense response. It is hypothesized that SLWFs try to evade the JA pathway activation. Because SLWFs cause little tissue damage (intracellular punctures) until they establish feeding sites at minor veins of the phloem (Cohen et al ., 1996; Walling, 2000). SLWFs could also prevent the activation of JA defens pathways by secreting inhibitors that directly or indirectly antagonize JA-signaling pathway activation or suppression. In Arabidopsis, SLWF nymphs feeding activate SA-regulated defenses and suppress JA-regulated defenses (Zarate et al ., 2007). One of the best studied examples of defense-related signal crosstalk is the antagonistic interaction between the SA and JA dependent defense pathways. Many cases of cross-talk between SA-dependent resistance against biotrophic pathogens and JA-dependent defense against necrotrophic pathogens and insect 165 herbivory have been documented and well estabilshed against different insects and pathogens (Stout et al ., 2006; Poelman et al ., 2008; Reymond and Farmer, 1998; Pieterse and Dicke, 2007; Bostock, 2005). For example, activation of the SA defense pathway in Arabidopsis by the biotrophic oomycete pathogen Hyaloperonospora arabidopsidis strongly suppressed JA-mediated defenses that were activated upon feeding by caterpillars of the small cabbage white Pieris rapae (Koorneef et al ., 2008). Induction of the SA defense pathway by P. syringae similarly suppressed JA signaling and leaving infected leaves more susceptible to the necrotrophic fungus Alternaria brassicicola (Spoel et al ., 2007). Here, results suggested that stolbur-PO phytoplasma infection has the same influence as it enhances SA mediated pathway but represses JA pathway. Stolbur PO phytoplasmas are phloem restricted pathogens so the activation of SA/ET and suppression of JA pathway may be related as defense observed in silver whitefly feeding and other pathogens which suppress JA pathways but activate SA pathways for their benefits. Moreover, SAP11 effectors from Aster Yellows phytoplasma have been identified to repress the JA synthesis thereby repressing the JA dependent defense pathway (Bai et al ., 2009). Our results of JA repression in stolbur PO phytoplasma are in agreement with the above findings. Figure 9 showed suggested cross talk model in PO infected tomato. 3.4. Suggested Counter defense strategies in stolbur phytoplasma-infected tomato Pathogens have evolved complex mechanisms to evade from plant defense responses and cause disease in susceptible host plants (Abramovitch and Martin 2005; Espinosa et al., 2003; Jakobek et al ., 1993; Uppalapati et al ., 2005). For example, plants use the PR proteins beta-1,3-endoglucanases to damage pathogen cell walls, either rendering the pathogen more susceptible to other plant defense responses or secreting oligosaccharide elicitors that activate plant defenses (Rose et al ., 2002). The oomycete pathogen Phytophthora sojae has evolved a counterdefense mechanism to overcome the action of b-1,3-endoglucanases . P. syringae pv. tomato DC3000, which causes bacterial speck disease of tomato. A. thaliana , and Brassica spp. secrete a plethora of virulence factors and effector proteins to 166 suppress plant defense responses and promote disease physiology (Abramovitch and Martin 2005; Kunkel and Chen, 2005; Mudget et al., 2005). In P. infestans , water-soluble glucans have been reported which suppress host defenses in a plant cultivar-specific manner (Sanchez et al ., 1992; Andreu et al ., 1998). Nevertheless, the molecular basis of suppression of host defenses by Phytophthora remains poorly understood (Kamoun, 2003). It is tempting to speculate that unique classes of suppressor genes have been recruited to facilitate in infection and counteract host defenses during the evolution of pathogenesis. Ton et al . (2002) indicated that basal resistance in Arabidopsis against X. campestris pv. armoraciae is through a combination of SA-, JA-, and ethylene-dependent defenses. The expression patterns associated with compatible (susceptible plant) and incompatible (resistant plant) plant-microbe interaction can be strikingly similar, but the amplitude of expression and speed are often greater during R-gene dependent resistance response than compatible interaction (Nimchuk et al ., 2003). Attenuation of SA-dependent defence responses in host plants such as suppression of expression of PR genes has been reported for certain plant pathogens. For example, susceptibility of tomato to PstDC3000 is associated with repression of PR genes in Arabidopsis (Kloek et al ., 2001) and in tomato (Zhao et al ., 2003). Recently, it has been reported that a different member PR7 gene family like P69A, P69B, may be inhibited in the leaves of tomato by the extracellular protease inhibitor EPI1 from Phytophthora infestans as counter defence mechanism from this biotrophic pathogen, leading to colonization of the host apoplast (Tian et al ., 2004). In stolbur PO-infected tomato interaction, we suggest such type of strategy as basic PR2 ( GluB ), PIN2, PR7 (69A ) have been down regulated. Other Plant pathogen have been shown to suppress these genes as counter defense, like P. sojae which secretes glucanase inhibitor proteins that suppress the activity of a soybean (Glycine max) beta-1,3-endoglucanase (Rose et al ., 2002) and P infestans which suppress PR7 by secreting EPI type proteinase inhibitor as counter defense. A diverse family of Kazal-like extracellular Ser protease inhibitors with at least 35 members has been identified and described in five plant pathogenic oomycetes: P. infestans, P. sojae, Phytophthora ramorum, Phytophthora brassicae, and the downy mildew Plasmopara halstedii (Tian et al., 2004). In P. 167 infestans , two Kazal-like inhibitors, EPI1 and EPI10, among a total of 14, were found to bind and inhibit the PR P69B subtilisin-like Ser protease of the tomato host plant (Tian et al., 2004, 2005). It was demonstrated that coronatine, a phytotoxin from bacterial pathogen P. syringae in susceptible tomato, activate JA defense pathway but suppresses the SA regulated pathway (Uppalapati et al ., 2007). Despite the importance of extracellular proteases in plant defense, some protease inhibitor has been reported from microbial plant pathogens. Yet, virulence factors are not known in stolbur phytoplasma. Recently, some virulence effectors SAP11 proteins (Bai et al ., 2009) and TENGU (a virulence factor for proliferation and dwarfism) have been identified in Ca. Phytoplasma asteris. Perhaps both stolbur C and stolbur PO phytoplasma use distinct type of virulence factors to cause disease in plants, therefore, causing the differential expression of defense and biosynthesis related genes in tomato. 3.5. Conclussion 1. All SA, ET and JA dependent defense genes tested were activated in stolbur C phytoplasma- infected tomato. PAL was activated in stolbur C but ICS and CHS2 were down-regulated. It suggected that a mutual synergistic interaction of SA, ET and JA mediated defense pathway existed in stolbur C phytoplasma-infected tomato. 2. SA and ET dependent defense genes were found to be activated but JA dependent defense genes were down-regulated in stolbur PO phytoplasma-infected tomato. Expression of ICS and CHS2 was enhanced but PAL was found to be down regulated in PO infected tomato. It suggested that a mutual synergistic interaction of SA/ET existed as well as an antagonistic interaction with JA mediated defense pathway. 3. The expression of all above mentioned genes was studied following infection of susceptible tomato by two different isolates of stolbur phytoplasmas, i.e. C and PO. The results of gene expression in leaves and in flower buds showed the same expression pattern in both organs. The expression of defense and pathogenesis related genes in flower buds seem to be associated with basal defense against pathogens and development of floral organs. 168 3.5. Perspectives 1. Because phytoplasma infection seem to interfere with SA or JA defense pathways but we don’t know that stolbur phytoplasma may interfere in SA or JA synthesis so it is important to determine the level of these phytohormones by HPLC in stolbur phytoplasma infected tomato. 2. Generally, acidic PR accumulates in apoplast and basic PRs accumulate in vacuoles against different pathogens which secreted their effectors through TSSR system. But stolbur phytoplasma have no TSSR system and reside in phloem tubes of plant cell, so, PRs proteins accumulation and their localisation must be detected in infected tomato. 3. We must study the expression of transcription factors and some defense genes which interact and regulated the cross-talk of defense pathways. 4. As SA defense pathway was activated in both C and PO tomato but JA was repressed in stolbur PO tomato only, hence the effect of pre-activation of SA or JA defense pathways must be studied in infected tomato. 169 Chapter III Introduction Effect of Pre-Activation of Salicylic Acid (SA) or Jasmonic Acid (JA) Dependent Defense Pathways on the Disease Development in Stolbur PO-Infected Tomato 170 1. Introduction Tomato infected by stolbur PO phytoplasma show severe disease symptoms on leaves and flower buds. We have shown that defense pathways are activated in stolbur C and stolbur PO phytoplasma-infected tomato. However the effect of pre-activation of these pathways on the development of disease symptoms caused by stolbur PO phytoplasma is not known. Salicylic acid (SA) and jasmonic acid (JA) are well known to regulate both basal and R gene- dependent defense responses against pathogens and insects (Glazebrook, 2001, Hammond- Kosack and Parker 2003; Glazebrook, 2005; Kim et al. , 2008). SA-mediated signalling seems to be crucial for resistance against biotrophic pathogens (Glazebrook, 2005; Loake and Grant, 2007). In contrast, JA-dependent resistance appeared to be more effective against necrotrophic pathogens, insects and other herbivores (Kessler and Baldwin 2002; Glazebrook, 2005; Beckers and Spoel, 2006). An elevation in the endogenous level of Salicylic Acid (SA) or exogenous application of SA or its synthetic analogues, BTH or INA, results in a selective and concerted activation of a plethora of genes by activating the Systemic Acquired Resistance (SAR) (Ward et al ., 1991; Lawton et al ., 1993). Benzothiadiazole (BTH) has been shown to act like SA in Arabidopsis (Lawton et al ., 1996). The BTH is marketed under the name Bion ® as a stimulator protection of plants. A major subset of SAR genes are proteins known as pathogenesis-related (PR) proteins, which comprises several families (Cutt and Klessig, 1992). This SAR is a systemic, durable, and wide-spectrum resistance induced by pathogens or some chemical products. SAR is induced in uninfected parts of a plant following localized exposure to pathogens that cause some form of cell death at the site of infection, such as the hypersensitive response (HR) associated with R-gene-mediated resistance or disease induced necrosis (Durrant and Dong, 2004; Ryals et al ., 1996). SAR has been reported in several monocot and dicot plant species and is effective against a wide range of viruses, bacteria, oomycetes, and fungi (Kuc, 1982; Sticher, 1997). However, SAR is not effective against all pathogens and the spectrum of resistance varies between plant species and type of pathogens (Hammerschmidt, 1995). Characteristic features of SAR include the requirement for the phenolic signalling molecule salicylic acid (SA) and an association with the induction of pathogenesis-related (PR) genes and proteins (Durrant and Dong, 2004). Following exposure to pathogens, SA levels increase substantially at the 171 site of infection (locally) and to a lesser extent, in uninfected tissues (systemic) (Ryals et al ., 1996; Yalpani et al ., 1991). SA accumulation is necessary for SAR induction, as plants unable to accumulate or synthesis SA, either through transgenic expression of a bacterial salicylate hydroxylase ( NahG ) gene which metabolizes SA to catechol (Delaney et al ., 1994; Gafney et al ., 1993; Lawton et al ., 1995) or loss-of- function mutations that prevent SA biosynthesis (Nawrath et al ., 1999) are compromised in SAR. Plant activators, compounds that control disease without directly impacting the pathogen, could be useful tools for crop protection. For example, the Acibenzolar-S-methyl (ASM) is a commercially available activator derived from BTH, the functional analogue of salicylic acid known to stimulate the production of plant defense-related compounds and to induce systemic acquired resistance (SAR) (Fidantsef et al ., 1999; Kuc, 2001). ASM activates defense responses in a wide range of plants, potentially providing broad- spectrum protection (Oostendorp et al ., 2001). Within 2 h of application, ASM can be detected in tomato leaves of both treated and distant from the application site (Scarponi et al ., 2001). One previous study demonstrated the molecular effects of plant activators in the field and found that BTH-treated tomatoes exhibited enhanced levels of P4 mRNA expression 5 days after application, though not significantly different from the untreated control (Thaler et al ., 1999). BTH and SA induce the expression of the same set of SAR mediated genes (PRs) and confer resistance to the same species. BTH was found to be effective at reducing downy mildew caused by Peronospora parasitica in B. oleracea (Godard et al ., 1999; Jensen et al ., 1998; Ziadi et al ., 2001) and to provide some control of damping-off caused by Rhizoctonia solani in B. napus (Jensen et al ., 1998). BTH treatment on B. oleracea seedlings activated β-1,3 glucanase activity and PR-2 protein accumulation, but had no effect on chitinase activity or on the levels of PR-1, PR-3, and PR-5 (Ziadi et al ., 2001; Friedrrich et al ., 1996). Treatment of B. napus plants with the SAR-inducing BTH significantly increased resistance against virulent strains P. syringae pv. Maculicola of the bacterial pathogen and the fungal pathogen Leptosphaeria maculans. Expression of BnPR-1 and BnPR2 was found in BTH leaves and are considered SAR maker gene in B. napus (Potlakayala et al ., 2006). Treatment of BTH also led to the enhancement of β-1,3- glucanase (PR-2) enzymatic activity and protein levels in B. oleracea seedlings, before and after infection with P. parasitica (Ziadi et al ., 2001). 172 SAR required an induction time of almost 2 days to 2 weeks to be fully established in plants upon infection (Sticher et al ., 2001). Since neither BTH nor its metabolites appear to have antifungal activities therefore it is not believed that the better performance of BTH is due to direct growth inhibition of the virulent pathogens, (Friedrich et al ., 1996). The wide spectrum of action of SAR contrasts with the resistance against specific pathogen strains provided by major resistance genes used in developed cultivars and, therefore, it can be less susceptible to resistance breakdown (Moraes, 1998). Induced resistance is considered as an important biocontrol tool in the production of organic vegetables (Sequeira, 1983). PR1 is often used as a reliable molecular marker for SA dependent systemic acquired resistance (SAR). However, all the PR genes are not SA marker. Indeed PR5 is also induced but is not recognized SAR marker gene. Expression of BnPR-5 was not traced in any of the leaves infected with P. syringae pv. maculicola 1848B as well as on BTH treatment and so is not considered SAR maker gene in B. napus (Potlakayala et al., 2006). Constitutive expression of genes encoding pathogenesis proteins (PRs) is one of the good strategies proposed to obtain a broad and durable level of resistance against various phytopathogenic fungi (Veronese et al ., 1999). Over-expression of PR5 gene in transgenic plants have generally resulted in enhancing disease resistance in some plant species, even if it is not considered as SA marker gene. In tomato, SA induces pathogenesis-related protein genes such as PR1 (P4 ), PR1 (P6 ) and PR7. PR-1 protein belongs to a small multigenic family. Both PR1 (P4 ) induction and PR1 (P6 ) induction are used as a molecular marker for the activation of the SA mediated signalling defense pathway (Jordá et al ., 1999, Spletzer and Enyedi 1999; Sobzak et al ., 2005, Hase et al ., 2008). PR7 encodes a subtilisin- like protease (Zhao et al ., 2003). Jasmonates (JA) dependent resistance is considered more effective against necrotrophic pathogens, insects and other herbivores (Kessler and Baldwin, 2002; Glazebrook, 2005; Beckers and Spoel, 2006). JA are involved in crucial processes related to plant development and survival, including direct and indirect defense responses, secondary metabolism, reproductive process, senescence, and fruit development (Seo et al ., 2001; Arimura et al ., 2005; Wasternack, 2007). MeJA is believed to be the active form of jasmonic acid (JA) under specific physiological conditions (Seo et al ., 2001; Delker et al ., 2006). 173 Exogenous treatment with MeJA induces three different wound-induced genes such as proteins inhibitors, PIN1, PIN2, and LoxD . It is known that jasmonates have a central role in the regulation of the biosynthesis of several secondary metabolites, including terpenoids, alcaloids, phenylpropanoids, and antioxidants. The constitutive activation of the JA-signalling pathway causes enhanced production of secondary metabolites in tomato plants. MeJA has been considered an important candidate for an airborne signal molecule mediating intra- and inter-plant communications, modulating plant defense responses (Demole et al ., 1962; Creelman and Mullet, 1995; Seo et al ., 2001; Wasternack, 2007) and involved in plant reproductive processes (von Malek et al., 2002). In tomato, PR1a is not induced by MeJA application but in rice PR1a gene was specifically induced by JA in a light- and dose-dependent manner (Schweizer et al ., 1997; Agrawal et al ., 2000) and a JA inhibitor prevented induction of PR1a-like proteins (Schweizer et al ., 1997). Rice transgenic plants constitutively expressing the Allen Oxide Synthase (AOS) enzyme, which is an extremely important enzyme in the JA biosynthetic pathway, showed increased resistance to attack by pathogenic fungi and a robust induction of pathogen-related genes, such as PR1a , PR3 and PR5 (Mei et al., 2006). In rice related studies, JA treatment induces the expression of PR1a and PR10 in tissue- and developmental stage-specific manner (Rakwal et al ., 2000). Proteinase inhibitors (PIs) are a potential component of gene stacks for the protection of important agricultural crops against insect damage. Plants have developed both physical and molecular strategies to limit consumption by insect pests while attracting insect pollinators. A classic example of plant–insect interactions is the production of potato type I inhibitor (pin I) and type II inhibitor (pin II) serine PIs by solanaceous plants responding to damage by lepidopteran larvae (Green et al ., 1972). Proteinase inhibitors (PIs) in reproductive tissues are expressed constitutively at high levels (Atkinson et al ., 1993), whereas expression is relatively low in leaves until the leaves are damaged by chewing insects (Graham et al ., 1985). Expression of the tomato proteinase inhibitors I ( PIN1 ) and II ( PIN2 ) genes were monitored to investigate the role of the methyl jasmonate (MeJA) mediated defense pathway, which is induced by wounding and chewing insects (Graham et al ., 1985ab). It is known that RNAs of PIN2 was accumulated during compatible and incompatible interaction in response to aphid feeding on tomato (Martinez de Ilarduya et al ., 2003). Furthermore, wounded plants synthesis volatile signals that attract 174 parasitic and predatory insects and induce PI production in neighboring, nonwounded plants to arm themselves before insect invasion occurs (Kessler and Baldwin, 2002). When plant PIs bind to the digestive proteinases of insects, they interfere with the digestion of proteins, leading to developmental delays and increased mortality. Proteinase inhibitor 1 and 2 target the digestive serine proteinases trypsin and chymotrypsin, the major enzymes involved in protein digestion in the gut of lepidopteran larvae (Applebaum et al ., 1985). Very little is known about the importance of SA- and JA-mediated signalling in phytoplasma-tomato interaction. It is not yet clear whether the signal transduction pathways and defense strategies triggered by stolbur PO phytoplasma during infection are the same as those observed in the resistance against foliar pathogens like P. syringae or phloem feeding insects like aphid and whitefly. To determine whether pre-activation or stimulation of SA-signaling pathway or JA signalling pathway would attenuate disease symptoms, the SA analogue BTH was used to activate the SA defense pathway, and Methyl Jasmonic Acid was used to activate the JA defense pathway in tomato. The activation of these different pathways was verified and tomato plants were infected by stolbur PO phytoplasma by grafting. The symptoms evolution was noted for each plant. The objective of this study was to investigate the role of SAR or SA mediated defense pathway activated by the treatment of BTH on stolbur phytoplasma infection. Because SAR is considered effective against broad range of insects and pathogens but very little is known about its effeectiveness against phytoplasma. Recently, Only 3 reports have been shown by researchers regarding the impact of BTH treatment on the phytoplasma transmission, multiplcation and disease symptoms appearance on grapevine, arabodopsis and daisy plants against different group of phytoplasma (Bressan and Purcell, 2005; Romanazii et al ., 2009; Amelio et al ., 2010). Here for the first time, we are studying the effect of BTH and MeJA trearment that cause SAR or ISR in tomato infected by stolbur phytoplasma. We demonstrated the effect of BTH or MeJA on the diseases symptoms appearances and multiplication of stolbur phytoplasma in association of disease symptoms. 175 Chapter III Results Effect of Pre-Activation of Salicylic Acid (SA) or Jasmonic Acid (JA) Dependent Defense Pathways on the Disease Development in Stolbur PO-Infected Tomato 176 2.1 . Effect of pre-treatment with Benzothiadiazole (BTH) (Activator of SA defense pathway) Concentrations between 0.1 mM to 10 mM of BTH were efficient at inducing PR genes and diminishing pathogen development of fungal and some bacterial pathogen in tomato (Görlach et al ., 1996). In our current study, 1 mM concentration of BTH was used to induce the activation of SA dependent defense pathway as this concentration was selected as optimal by Sanz-Alférez et al . for different plants against fungal and bacterial pathogens (Sanz-Alférez et al ., 2008). The efficiency of the treatment was verified anyway. Tomatoes were treated by spraying with BTH and after 3 days, they were grafted with a healthy or a stolbur PO phytoplasma infected scion. Observation of symptoms was done according to Foissac et al ., 1997c and stolbur phytoplasma was detected by Nested- PCR. The expressions of SA and JA dependent marker genes were studied to confirm the activation of SA or JA defense pathways. 2.1.1. Symptoms observation Stolbur PO phytoplasma-infected tomato plants have chlorotic leaves and abnormal development of flowers with hypertrophied sepals and aborted petals, along with retarded growth at severe infection. Disease symptoms starts to appears on young top leaves and then spreads from tops towards the down leaves of sides branches, situated below the tops. On infected leaves, yellowness starts from leaf margins and increases rapidly towards the midrib of leaves. The tips and sides of symptomatic leaves curved downwards and leaf necrosis can be observed at severe infection. Three types of treatment were tested: no treatment, water treatment and BTH treatment. For each type of treatment, tomatoes were grafted either with healthy or stolbur PO infected scion. Symptoms were noted at 4 time points, i.e. 14 days, 21 days, 28 days and 32 days after grafting. Results have been recorded in table 1. Concerning the controls, non-treated healthy, water-treated healthy and BTH-treated healthy tomatoes do not show any symptoms (-) at any time points i.e. after 14, 21, 28, and 38 days after grafting as expected (Table 1). After 14 days of infection, disease symptoms started to appear on young leaves of stolbur 177 N° of days after PO transmission Plant N° 14 21 28 35 1 - - - - Non-treated Healthy 2 - - - - 1 - - - - H2O treated Healthy 2 - - - - 1 - - - - BTH treated Healthy 2 - - - - 3 - - - - 1 + ++ ++ ++++ 2 + + ++ +++ Non treated PO-infected 3 + ++ +++ ++++ 4 + ++ +++ ++++ 5 + ++ +++ ++++ 1 + + ++ ++++ 2 + ++ ++ +++ 3 + ++ ++ +++ 4 + ++ +++ ++++ 5 + ++ +++ ++++ H2O treated-PO infected 6 + ++ +++ ++++ 7 + ++ ++ +++ 8 + ++ +++ ++++ 9 + ++ +++ ++++ 10 + + ++ ++++ 1 - + ++ ++++ 2 + + ++ ++++ 3 - + ++ ++++ 4 - + ++ +++ BTH treated-PO infected 5 - + ++ ++++ 6 + + +++ ++++ 7 - + ++ +++ 8 - + ++ ++++ 9 + + +++ ++++ 10 - + ++ ++++ Table 1: Symptoms observation in BTH treated stolbur-PO phytoplasma-infected tomato, Symptom scale as: -, no symptoms; +, marginal chlorosis/yellows on young leaves; ++, young leaves asymmetric and Chlorosis starts to appear towards interveins; +++, general yellows and retarded growth ; ++++, lethal necrosis/necrotic spots ; +++++, dead 178 PO infected tomatoes. We observed nearly the same intensity of symptoms of marginal chlorosis (+) on all non-treated PO-infected tomato (1-5), and all water treated PO-infected tomatoes (1-10). At the same time, only 3 out of 10 BTH treated PO-infected tomatoes, were symptomatic with marginal chlorosis (+) (tomato n°2, 6 and 9) and the other 7 BTH treated PO-infected tomatoes (tomato n°1, 3, 4, 5, 7 and 10) were without symptoms (-) (Table 1). After 21 days of PO transmission, the disease symptoms increased and all the PO-infected tomatoes were symptomatic. However, the intensity varied following the treatment. Indeed, non treated-PO infected and water treated-PO infected tomato have a disease scale of ++, while all BTH treated PO-infected tomatoes showed a marginal chlorosis of scale + (Table l). After 28 days of PO transmission, the intensity of disease symptoms was nearly the same for all kind of tomato. For example, non treated PO-infected tomatoes were symptomatic +++ (except tomato N° 1 and 2 with symptom scale ++). For water treated PO-infected tomatoes, tomato N° 1, 2, 3 and 7 were symptomatic with ++ and the others have +++. In case of BTH treated PO-infected tomato, all tomato except N° 6 and N°9 (+++) have disease symptom scale ++. After 32 days of PO transmission, the intensity of disease symptoms were further increased and disease symptoms scales were found to be the same for each non treated PO-infected or treated PO-infected tomato, varying between +++ and ++++ as shown in table 1. The results of symptom observations show that after 14 days of stolbur PO phytoplasma transmission, 30 % of tomatoes were symptomatic in case of BTH treatment PO-infected tomato while 100% of non treated PO- infected and water treated PO-infected tomatoes were symptomatic. However after 21, 28 and 32 days of PO transmission, all non treated-PO infected and treated PO-infected tomatoes were symptomatic. 2.1.2. Stolbur PO phytoplasma detection Along with the disease symptoms observation, the infection by stolbur PO phytoplasma was followed by nested-PCR. The DNA was extracted from leaves of healthy and stolbur PO phytoplasma- infected tomato samples taken after 14 and 21 days of PO transmission. The healthy and PO-infected tomato plants were tested for the presence of stolbur PO phytoplasma by Nested-PCR using two universal primers pair R16mF2/ R16R2 and R16F2n/R16R2 designed by Gundersen and Lee (1996). 179 14 days after PO transmission H PO A 1 2 1 2 3 4 5 Non treated tomato 1.5 kb H PO B 1 2 3 1 2 3 4 5 6 7 8 9 10 BTH treated tomato 1.5 kb H PO C 1 2 1 2 3 4 5 6 7 8 9 10 H2O treated tomato 1.5 kb 21 days after PO transmission H PO D 1 2 1 2 3 4 5 Non treated tomato 1.5 kb H PO E 1 2 3 1 2 3 4 5 6 7 8 9 10 BTH treated tomato 1.5 kb H PO 1 2 1 2 3 4 5 6 7 8 9 10 F 1.5 kb H2O treated tomato Figure 1 : Detection of stolbur PO phytoplasma by universal primer pair (Gundersen and Lee, 1996): A-C detection after 14 days, D-F after 21 days of PO transmission. A-lanes 1-2 not treated healthy with no detection, lanes 1-5 not treated PO-infected with detection. B-lanes 1-3 BTH treated healthy with no detection, lanes 1-10 BTH treated PO-infected with detection. C-1-2 H2O treated healthy with no detection, lanes 1-10 H2O treated PO-infected with detection. D-lanes 1-2 not treated healthy with no detection, lanes 1-5 not treated PO-infected with detection. E-lanes 1-3 BTH treated healthy with no detection, lanes 1-10 BTH treated PO-infected with detection. F-1-2 H2O treated healthy with no detection, lanes 1-10 H2O treated PO-infected with detection. (0.5 µg DNA was used for each sample in Nested-PCR). 180 Stolbur PO phytoplasma was not detected in any of the samples of non treated-healthy, water treated healthy and BTH treated-healthy tomato from samples taken after 14 days and 21 days as the absence of bands signal (Figure 1). A fragment of about 1.5 kb was amplified from the template DNA extracted for all non-treated- PO infected tomato samples taken after 14 days of PO transmission of which one weakly (lane 3) (Figure 1, A. Lanes 1-5 PO-infected). Similarly, a well amplified fragment of about 1.5 kb was observed for all water-treated-PO infected tomato samples taken after 14 days of PO transmission (Figure 1, C. Lanes 1-10 PO-infected). Very faint bands of amplified DNA were obtained for all BTH treated PO-infected tomatoes in accordance with the absence of disease symptoms observed in BTH treated tomato in samples taken after 14 days of PO transmission (Figure 1, B. Lanes, 1-10 BTH PO-infected). After 21 days of PO transmission, well amplified fragments of 1.5 kb with high intensity signals were observed in all non treated PO-infected tomato (Figure 1, D. Lanes, 1-5 PO-infected) and in all water treated-PO infected tomatoes (1-10) (Figure 1, F. Lanes 1-10 PO-infected). As compared to PO amplified fragments observed after 14 days in BTH treated PO-infected tomato, well amplified fragments were obtained in all (1-10) BTH treated PO-infected tomato of samples taken after 21 days of PO-transmission (Figure 1, E. Lanes 1-10 PO-infected). However, this intensity was somewhat lower than in non-treated or water-treated tomato. We noticed also that generally, the intensity of amplified fragments were higher in tomato showing stronger disease symptoms as observed in non treated PO-infected and water treated PO-infected and BTH treated PO infected tomato. Result showed that all PO infected tomato whatever the treatment were found to be positive for the presence of stolbur PO phytoplasma and that they show similar symptoms. 2.1.3. Expression of SA and JA dependent marker genes PR1 is a dominant group of PRs and is commonly used as a marker for systemic acquired resistance (SAR) which function downstream in the SA pathway (Yalpani et al. , 1993, 1994). Acidic PR1 gene is activated by compounds such as benzothiadiazole (BTH) and in response to abiotic and biotic stress (Durrant and Dong, 2004; Friedrich et al ., 1996). Thus the induction of salicylic acid (SA)-mediated responses or SAR can be followed using the expression level of the acidic PR1 gene as a marker (Block et al ., 2005; Tornero et al ., 1997; Van Kan et al ., 1992). 181 14 dpi 21 dpi 14 dpi 21 dpi Plant N° PR1 PR1 Pin2 Pin2 Non-treated Healthy control (H) 1 1 1 1 1 0.90±SE 0.30 0.74±SE 0.28 0.95±SE 0.10 1.01±SE 0.09 H2O treated Healthy 2 1.12±SE 0.10 0.54±SE 0.08 0.78±SE 0.25 1.13±SE 0.09 1 66.45±SE 9.80 91.27±SE 23.37 0.72±SE 0.08 0.23±SE 0.03 BTH treated Healthy 2 93.83±SE 5.31 51.61±SE 10.28 0.20±SE 0.04 0.05±SE 0.03 3 55.64±SE 11.13 64.12±SE 9.71 0.51±SE 0.05 0.22±SE 0.05 control (H) 1 1 1 1 1 6.94±SE 1.88 25.50±SE 1.59 0.76±SE 0.08 0.68±SE 0.02 2 7.63±SE 1.60 43.13±SE 2.90 0.58±SE 0.16 0.14±SE 0.08 Non treated PO-infected 3 3.73±SE 0.91 31.73±SE 2.53 0.87±SE 0.06 0.48±SE 0.12 4 7.20±SE 0.95 26.06±SE 3.98 0.67±SE 0.18 0.26±SE 0.06 5 5.35±SE 0.90 46.71±SE 1.55 0.82±SE 0.10 0.16±SE 0.14 control (PO) 1 1 1 1 1 0.62±SE 0.078 0.20±SE 0.043 1.25±SE 0.12 0.63±SE 0.022 2 0.59±SE 0.001 1.50±SE 0.39 0.98±SE0.15 0.12±SE 0.020 3 0.59±SE 0.11 0.74±SE 0.29 1.18±SE 0.26 1.73±SE 0.22 4 1.14±SE 0.076 0.64±SE 0.043 0.46+SE 0.14 1.21±SE 0.18 H2O treated-PO infected 5 1.53±SE 0.10 0.12±SE 0.052 0.55±SE 0.15 0.35±SE 0.085 6 1.9±SE 0.08 0.86±SE 0.034 0.49±SE 0.13 1.65±SE 0.44 7 1.85±SE 0.54 0.18±SE 0.017 0.98±SE0.28 0.72±SE 0.08 8 0.58±SE 0.16 1.65±SE 0.16 1.26±SE 0.20 0.70±SE 0.096 9 2.33±SE 0.094 0.54±SE 0.080 0.50±SE 0.08 1.47±SE 0.014 10 1.21±SE 0.15 1.45±SE 0.33 0.66±SE 0.13 0.27±SE 0.036 control (PO) 1 1 1 1 1 71.10±SE 3.61 16.45±SE 3.60 0.21±SE 0.023 0.78±SE 0.020 2 23.01±SE 8.28 13.60±SE 4.001 0.13±SE 0.034 0.57±SE 0.075 3 46.45±SE 9.80 12.48±SE 4.76 0.65±SE 0.18 0.68±SE 0.04 4 97.87±SE 11.18 22.31±SE 6.80 0.34±SE 0.007 0.07±SE 0.005 BTH treated-PO infected 5 81.09±SE 15.22 15.77±SE 3.057 0.24±SE 0.019 0.12±SE 0.008 6 73.83±SE 5.31 21.07±SE 4.68 0.49±SE 0.002 0.01±SE 0.001 7 82.37±SE 13.61 50.24±SE 10.01 0.54±SE 0.14 0.29±SE 0.038 8 59.41±SE 1.94 40.29±SE 7.01 0.09±SE 0.024 0.22±SE 0.003 9 55.65±SE 11.14 34.13±SE 8.16 0.69±SE 0.16 0.09±SE 0.004 10 71.27±SE 10.94 24.98±SE 4.28 0.19±SE 0.002 0.66±SE 0.040 Table 2 : Relative transcriptional expression of two signalling marker genes acidic pathogenesis related PR 1 (PR1) and proteinase inhibitor 2 (Pin2) in BTH (1mM) treated tomato. Expression was determined after 14 days (14 dpi) and 21 days (21 dpi) of PO transmission. Real time RT- PCR was performed. EF1 alpha was used as standard control gene. ± SE represents the standard error bar of mean (n=2). 182 2.1.3.1. Expression of SA mediated pathognesis-related marker gene PR1 . The transcriptional expression of SA dependent marker gene acidic PR1 was studied through real time RT-PCR using RNA extracted from non treated PO-infected, water treated PO-infected, and BTH treated PO-infected tomatoes samples. The expression was studied at two different time points, after 14 days and 21 days of PO transmission. After 14 days of PO transmission, all non treated PO-infected tomatoes (1-5) show expression ranging from 3 to 7 folds with average of 6.17 ± 0.72 which was enhanced after 21 days of PO infection, between 25 and 46 folds with average of 34.62 ± 4.37 depending upon the PO infection respectively as compared to healthy tomato (Table 2-non treated-PO infected) showing that stolbur infection naturally activated PR1 expression as shown in chapter II. To determine whether BTH activate SAR or work in treated tomato, expression of SA marker gene was studied in healthy treated and non-treated plants. Transcriptional level of PR1 was 55folds to 93 folds superior with an average of 71.97 ± 11.37 at 17 days after BTH treatment, and 51 to 91 folds superior with an average of 69.97 ± 11.70 at 25 days after BTH treatment as compared to non treated healthy plants (Table 2-BTH treated Healthy) suggesting that BTH activated SA mediated pathway. In case of BTH treated PO-infected tomato, after 14 days of PO transmission, transcriptional level of PR1 was 23 folds to 97 folds superior with an average of 66.20 ± 6.67 in BTH treated PO-infected tomato as compared to control (Table 2-BTH treated-PO infected). This could be correlated to the absence of symptoms as compared to non treated PO-infected or H2O treated PO-infected tomato. But after 21 days of PO transmission, transcriptional level of PR1 was found to be 12 to 50 folds higher with an average of 25.63 ± 4.31. The induced level of PR1 expression by BTH was also lower as compared to level observed after 14 days of PO transmission (Table 2-BTH treated-PO). In all 10 water treated PO-infected tomato, the level of PR1 expression was between 0.58 and 2.33 with an average 1.13 ± 0.19 after 14 days of PO transmission as compared to non treated PO-infected tomato (Table 2-H2O treated-PO). After 21 days of PO transmission, nearly the same ratios, 0.12 to 1.65 with average of 0.91 ± 0.17, were found in water treated PO-infected tomato as compared to non treated PO- infected tomato suggesting that non treated PO-infected and water treated PO-infected have no significant difference of PR1 expression after 14 days and 21 days of PO transmission (Table 2-H2O treated-PO). 183 This suggests that BTH activated the SA defense pathway even 2 and 3 weeks after treatment. The results further suggested that BTH treatment activate the SA dependent defense pathway by enhancing the expression of SA marker gene PR1 . The elevated level of PR1 expression and SA activation have a relative negative effect on disease symptom development and even multiplication of phytoplasma as weaker amplification of PO phytoplasma DNA was obtained by nested PCR. 2.1.3.2. Expression of JA mediated marker gene PIN2 Pin2 is considered as JA mediated wound inducible marker gene and is up-regulated at MeJA treatment but severely down-regulated upon BTH treatment. We determined the accumulation of Pin2 transcripts in BTH treated tomato in samples taken after 14 days, 21 days of infection. In non treated PO infected tomato, PIN2 has a Relative Gene Expression (RGE) comprised between 0.58 and 0.87 with an average of 0.74 ± 0.05 after 14 days of PO transmission. The repression was also observed after 21 days of PO infection as the observed RGE was between 0.14 and 0.68 with average 0.34 ± 0.10 as compared to healthy control (Table 2-non treated PO) suggesting that JA marker gene PIN2 was down-regulated in PO infected tomato as expected and confirmed in chapter II. Expression of PIN2 was down-regulated (RGE of 0.20 to 0.72) with an average of 0.48 ± 0.15 in BTH treated-healthy tomato after 17 days of BTH treatment and a similar down-regulation (RGE of 0.05 to 0.22) with an average of 0.17 ± 0.05 was observed after 21 days of BTH treatment (Table 2-BTH treated healthy) as compared to non treated-healthy plants suggesting that BTH application down-regulated JA defense pathway as was expected. Transcription level of PIN2 was down-regulated from 0.09 to 0.69 with an average of 0.35 ± 0.06 in BTH treated PO-infected after 14 days of PO transmission (Table 2-BTH treated PO). Similarly, the transcriptional level of PIN2 was found to be down-regulated between 0.005-0.78 with an average of 0.39 ± 0.11 after 21 days of PO transmission (Table 2-BTH-PO), suggesting that in BTH treatment down-regulate JA mediated defense pathway. After 14 days of PO transmission, in the case of H2O treated PO-infected tomato, transcriptional level of PIN2 fluctuated between 0.49 to 1.25 with an average of 0.81 ± 0.10 which was found 0.12-1.73 with an average of 0.85 ± 0.15 after 21 days of PO transmission (Table 2-H2Otreated PO). 184 N° of days after PO transmission Plant N° 14 21 28 32 Non-treated Healthy 1 - - - - 2 - - - - etOH treated Healthy 1 - - - - 2 - - - - MeJA treated Healthy 1 - - - - 2 - - - - 3 - - - - 1 + ++ ++ +++ Non treated PO-infected 2 + + ++ +++ 3 + ++ +++ ++++ 4 + ++ +++ ++++ 5 + ++ +++ ++++ 1 - + ++ ++++ 2 + + ++ +++ 3 + ++ ++ +++ 4 + ++ +++ ++++ etOH treated-PO infected 5 + + +++ ++++ 6 + ++ +++ ++++ 7 + ++ ++ +++ 8 + ++ +++ ++++ 9 + ++ +++ ++++ 10 - + +++ ++++ 1 + ++ +++ +++ 2 + ++ +++ +++ 3 + ++ +++ +++ MeJA treated-PO infected 4 + ++ +++ +++ 5 + ++ +++ +++ 6 + ++ +++ ++++ 7 + ++ ++ +++ 8 + ++ +++ +++ 9 + ++ +++ +++ 10 + ++ +++ +++ Table 3: Symptoms observation in MeJA treated stolbur-PO phytoplasma-infected tomato, Symptom scale as: -, no symptoms; +, marginal chlorosis/yellows on young leaves; ++, young leaves asymmetric and Chlorosis starts to appear towards interveins; +++, general yellows and retarded growth ; ++++, lethal necrosis/necrotic spots ; +++++, dead 185 2.2. Effect of pre-treatment of MeJA (Activator of JA defense pathway) 2.2.1. Symptoms observation Three treatments were applied to the tomatoes: no treatment, spray with ethanol (the solution in which MeJA was resuspended) and spray with MeJA. After 3 days, infection was done by grafting with stolbur PO phytoplasma infected scion and symptoms of disease development were noted after 14 days, 21 days, 28 days and 32 days of PO transmission. As for BTH treatment, disease symptoms have been recorded and are shown in table 3. No disease symptom was observed on healthy tomato, treated or not with ethanol or MeJA. 14 days, 21 days, 28 days and 32 days after grafting (Table 3-non-treated and treated healthy tomato). 14 days after grafting, nearly the same intensity of marginal chlorosis (+) was observed on all 5 non- treated PO-infected tomato. Similarly, All 10 ethanol treated PO-infected tomatoes except tomato N° 1 and tomato N° 10 were also observed symptomatic with marginal chlorosis (+). At the same time, all 10 MeJA treated PO-infected tomatoes were observed as symptomatic with marginal chlorosis (+) (Table 3). After 21 days of PO transmission, the disease symptoms increased and all the PO-infected tomatoes were symptomatic whatever the treatment applied. For example, non treated-PO infected tomato was asymmetric and chlorotic with a scale of ++ except tomato N°2 which has disease scale of +; all 10 ethanol treated-PO infected tomato has a scale of ++ except tomato N°1, 2, 5 and 10 which have disease scale of (+); and All 10 MeJA treated PO-infected tomatoes showed asymmetric and chlorotic leaves as shown by disease symptom scale of ++ (Table 3). 28 days after grafting, the intensity of disease symptoms was enhanced and disease symptoms scales recorded were comprised between scales ++ and +++. The situation was similar after 32 days of grafting with scales from +++ to ++++. The results of symptom observations showed that after 14 days, nearly all tomatoes grafted with stolbur PO infected scion were found to be symptomatic in the case of non treated and treated tomato and after 21, 28 and 32 days of PO transmission, all PO-infected tomatoes were symptomatic with severe diseases symptom. This suggested that MeJA treatment have no effect on disease symptoms development. 186 14 days after PO transmission H PO A 1 2 1 2 3 4 5 1.5 kb Non treated tomato H PO B 1 2 3 1 2 3 4 5 6 7 8 9 10 MeJA treated tomato 1.5 kb H PO 1 2 1 2 3 4 5 6 7 8 9 10 C 1.5 kb Ethanol treated tomato 21 days after PO transmission PO H D 1 2 1 2 3 4 5 Non treated tomato 1.5 kb H PO E 1 2 3 1 2 3 4 5 6 7 8 9 10 MeJA treated tomato 1.5 kb H PO F 1 2 3 1 2 3 4 5 6 7 8 9 10 Ethanol treated tomato 1.5 kb Fig ure 2 : Detection of stolbur PO phytoplasma through nested PCR by universal primer pair (Gundersen and Lee, 1996): A-C detection after 14 days, D-F after 21 days of PO transmission. A- lanes 1-2 not treated healthy with no detection, lanes 1-5 not treated PO-infected with detection. B- lanes 1-3 MeJA treated healthy with no detection, lanes 1-10 MeJA treated PO-infected with detection. C-1-2 etOH treated healthy with no detection, lanes 1-10 etOH treated PO-infected with detection. D-lanes 1-2 not treated healthy with no detection, lanes 1-5 not treated PO-infected with detection. E-lanes 1-3 MeJA treated healthy with no detection, lanes 1-10 MeJA treated PO-infected with detection. F-1-2 etOH treated healthy with no detection, lanes 1-10 etOH treated PO-infected with detection. 0.5 µg DNA was used for each sample. 187 2.2.2. Stolbur PO phytoplasma detection The infection by stolbur PO phytoplasma was followed by PCR after the observation of diseases symptoms. Tomato samples were taken after 14 and 21 days of grafting. The healthy and PO-infected tomato plants were tested for the presence of stolbur PO phytoplasma by Nested-PCR using two universal primers pair R16mF2/ R16R2 and R16F2n/R16R2 designed by Gundersen and Lee (1996). Stolbur PO phytoplasma was not detected in all samples taken 14 days and 21 days after grafting of healthy tomato, either non treated or treated with ethanol or MeJA (Figure 2-Healthy lanes). A fragment of about 1.5 kb was amplified from the template DNA extracted from all non-treated-PO infected tomato samples taken 14 days after grafting except N° 3 which has faint signal (Figure 2, A. Lanes 1-5 PO- infected). Well amplified fragments of about 1.5 kb were observed in all ethanol-treated-PO infected tomato samples (1-10) except tomato N°1 and 10 which showed a weak amplified fragments taken after 14 days of PO transmission (Figure 2, C. Lanes 1-10 PO-infected). Tomato N° 1 and 10 show very little or no clear development of symptoms in accordance with the weak fragment amplification (Figure 2, C. Lanes 1and 10 PO-infected). DNA fragments were also amplified from all 10 MeJA treated PO-infected tomatoes from samples taken after 14 days of PO transmission (Figure 2, B. Lanes 1-10 PO-infected). After 21 days of PO transmission, well amplified fragments of 1.5 kb with high intensity signals were obtained in all treated or not PO-infected tomato (Figure 2, D. Lanes 1-5 PO-infected). The result indicated that all PO infected tomato including those treated with MeJA were found to be positive for the presence of stolbur PO phytoplasma whereas fragments were not amplified from DNA extracted from healthy tomato. 2.2.3. Expression of SA and JA dependent marker genes 2.2.3.1 Expression of JA mediated marker gene PIN2 PIN2 is considered as JA mediated wound inducible marker gene and is up-regulated at MeJA treatment but is severely down-regulated upon BTH treatment. The accumulation of JA marker gene PIN2 was studied in non treated PO-infected, ethanol treated PO-infected and MeJA treated PO-infected and healthy tomato in samples taken after 14 days, 21 days of PO transmission through real time RT-PCR. 188 In non treated PO infected tomato, PIN2 has a RGE comprised between 0.58 and 0.87 with an average of 0.74 ± 0.05 after 14 days of PO transmission and was also down-regulated after 21 days of PO infection as the observed RGE was comprised between 0.14 and 0.68 with an average of 0.34 ± 0.10 as compared to healthy control (Table 4-non treated PO). This suggested that JA marker gene PIN2 was down- regulated in PO infected tomato as expected and confirmed in chapter II. Expression of PIN2 was up-regulated (RGE of 5.77 to 6.19) with an average of (6.01 ± 0.12) in 1-3 MeJA treated-healthy tomato after 14 days of treatment (Table 4, MeJA healthy). After 21 days of MeJA treatment, expression of PIN2 was also activated but RGE was 2.18 to 2.22 with an average of 2.19 ± 0.02 (Table 4, MeJA healthy) as compared to non treated-healthy plants. This suggested that MeJA application up-regulated JA defense pathway as was expected. Transcription level of PIN2 was up-regulated between 2.05 fold to 5.85 fold with an average expression of 3.32 ± 0.35 in MeJA treated PO-infected tomato numbered from 1-10 after 14 days of PO transmission (Table 4-MeJA-PO). After 21 days of PO transmission, expression of PIN2 was found to be down-regulated as the observed RGE was of 0.07 to 3.18 with an average of 0.83 ± 0.31 in tomato numbered from 1 to 10 (Table 4-MeJA-PO). This suggested that PO-infection repress the expression of PIN2 indicating a down regulation of the JA defense pathways as indicated after 21 days of PO infection, even with a treatment of MeJA. In etOH (ethanol) treated-PO tomato, transcriptional level of PIN2 was comprised between 0.16 and 1.34 with an average expression of 0.79 ± 0.12 after 14 days which was fluctuant between 0.03 to 1.09 with an average fold of 0.88 ± 0.10 after 21 days of treatment as compared to control suggesting that PIN2 expression was not changed significantly in Ethanol treated PO-infected tomato (Table 4-etOH-PO). These results suggested that MeJA treatment down-regulate the expression of PR1 which is considered the SA marker gene indicating a repression of the SA mediated defense pathway. Whereas, it activated the expression of PIN2 which is considered JA marker gene indicating an activation of the JA mediated defense pathway. These results further suggest that MeJA treatment have no much impact on the disease development as all MeJA treated PO-infected tomato were symptomatic with high amplification of stolbur PO phytoplasma fragment. 189 In our experimental conditions, treatment with BTH and MeJA showed activation of SA and JA defense pathway respectively up to 21 days but it was noticed that the effect of MeJA treatment was no long lasting as observed by BTH treatment. . 14 dpi 21 dpi 14 dpi 21 dpi Plant N° PR1 PR1 Pin2 Pin2 Non-treated Healthy control (H) 1 1 1 1 1 0.76±SE 0.17 1.10±SE 0.60 1.19±SE 0.32 1.18±SE 0.28 H2OetOH treated treated Healthy Healthy 2 0.85±SE 0.40 0.69±SE 0.33 1.08±SE 0.30 0.78±SE 0.08 1 0.01±SE 0.001 0.20±SE 0.09 6.07±SE 0.50 2.22±SE 0.89 BTHMeJA treated treated Healthy Healthy 2 0.04±SE 0.02 0.22±SE 0.04 6.19±SE 0.94 2.18±SE 0.72 3 0.05±SE 0.01 0.38±SE 0.18 5.77±SE 0.96 2.18±SE 0.02 control (H) 1 1 1 1 1 6.94±SE 1.88 25.50±SE 1.59 0.76±SE 0.08 0.68±SE 0.02 2 7.63±SE 1.60 43.13±SE 2.90 0.58±SE 0.16 0.14±SE 0.08 Non treated PO-infected 3 3.73±SE 0.91 31.73±SE 2.53 0.87±SE 0.06 0.48±SE 0.12 4 7.20±SE 0.95 26.06±SE 3.98 0.67±SE 0.18 0.26±SE 0.06 5 5.35±SE 0.90 46.71±SE 1.55 0.82±SE 0.10 0.16±SE 0.14 control (PO) 1 1 1 1 1 0.38±SE 0.054 0.15±SE 0.025 0.55±SE 0.17 1.03±SE 0.25 2 1.07±SE 0.09 1.24±SE 0.34 0.34±SE 0.15 0.52±SE 0.08 3 0.66±SE 0.11 0.26±SE 0.087 0.22±SE 0.089 0.94±SE 0.04 4 0.90±SE 0.33 1.42±SE 0.53 0.59±SE 0.22 0.58±SE 0.05 H2OetOH treated-PO treated-PO infected infected 5 2.86±SE 0.41 0.88±SE 0.44 0.35±SE 0.06 1.09±SE 0.11 6 1.34±SE 0.43 0.53±SE 0.22 0.94±SE 0.11 0.99±SE 0.10 7 2.96±SE 0.52 0.44±SE 0.10 0.16±SE0.005 0.57±SE 0.22 8 1.98±SE 0.24 0.49±SE 0.26 0.50±SE 0.30 0.038±SE 0.01 9 1.53±SE 0.25 1.20±SE 0.50 0.22±SE 0.002 0.41±SE 0.08 10 1.02±SE 0.20 1.26±SE 0.061 1.34±SE 0.091 0.46±SE 0.01 control (PO) 1 1 1 1 1 0.024±SE 0.0013 0.587±SE 0.392 2.68±SE 0.45 0.07±SE 0.002 2 0.014±SE 0.007 0.311±SE 0.211 3.26±SE 0.33 0.11±SE 0.01 3 0.043±SE 0.112 5.53±SE 2.01 2.95±SE 0.40 0.084±SE 0.011 4 0.018±SE 0.002 2.72±SE 0.73 3.24±SE 0.14 0.077±SE 0.003 BTHMeJA treated-PO treated-PO infected infected 5 0.153±SE 0.003 1.34±SE 0.295 2.21±SE 0.26 0.87±SE 0.018 6 0.30±SE 0.007 2.93±SE 0.79 2.054±SE 0.13 1.20±SE 0.15 7 0.070±SE 0.014 0.99±SE 0.23 5.85±SE0.92 0.436±SE 0.014 8 0.21±SE 0.076 2.85±SE 1.074 2.76±SE 0.41 0.53±SE 0.025 9 0.083±SE 0.024 0.89±SE 0.319 3.89±SE 0.33 2.32±SE 0.104 10 0.014±SE 0.001 0.22±SE 0.19 4.42±SE 0.37 1.78±SE 0.30 Table 4 : Relative transcriptional expression of two signalling marker genes acidic pathogenesis related PR 1 (PR1) and proteinase inhibitor 2 (Pin2) in MeJA (0.1mM) treated tomato. Expression was determined after 14 days (14 dpi) and 21 days (21 dpi) of PO transmission. Real time RT- PCR was performed. EF1 alpha was used as standard control gene. ± SE represents the standard error bar of mean (n=2). 190 2.2.3.2. Expression of SA mediated pathognesis-related marker gene PR1 SA dependent marker gene, acidic PR1 , was used to study the SA mediated defense pathway in MeJA treated tomato. SA mediated marker gene PR1 was induced upon BTH treatment but have much lower transcriptional expression upon MeJA treatment. Here, we studied the expression of PR1 in all treated and non treated infected tomato at 2 time points. After 14 days of PO transmission, all non treated PO-infected tomatoes (1-5) showed an RGE ranging from 3 to 7 with an average of 6.17 ± 0.72, and it was comprised between 25 and 46 with an average of 34.62 ± 4.37 after 21 days of PO infection as compared to healthy tomato (Table 4-non treated-PO infected). This showed that stolbur infection naturally activated PR1 expression as shown in chapter II. In samples taken after 14 days of PO transmission, MeJA treated-healthy tomato plants showed reduced transcript expression, 0.01 and 0.05 folds with an average of 0.04 ± 0.02. Twenty-one days after PO transmission, the expression of PR1 was also down-regulated between 0.22 and 0.38 fold with an average of 0.27 ± 0.05 fold as compared to non treated healthy control, suggesting that MeJA treatment down-regulated the expression of PR1 (Table 4-MeJA healthy). After 14 days of PO infection, transcriptional expression of PR1 was down-regulated with a RGE comprised between 0.01 and 0.2 with an average of 0.09 ± 0.03 in MeJA treated PO-infected tomato as compared to control (Table 4). Twenty-one days after infection, transcription of PR1 was fluctued between 0.22 and 2.85 with an average of 1.83 ± 0.52 as compared to control (Table 4- MeJA PO-infected). Relative Gene Expression of PR1 in all ethanol treated PO-infected tomato was comprised between 0.38 and 2.96 with an average of 1.32 ± 0.15 as compared to control (Table 4-etOH-PO). After 21 days, expression was found to be 0.15 and 1.42 with an average of 0.83 ± 0.10 (Table 4-etOH-PO) as compared to control. These results suggested that non treated-PO-infected and ethanol-treated-PO-infected tomato have no difference in SA defense pathways activation. These results suggested that MeJA treatment repress the activation of SA dependent defense pathway as indicated by the down-regulation of PR1 which is considered as SA dependent marker. 2.3. Summary 1- In tomato, BTH treatment activate the SA dependent defense pathway, as shown by the up- regulation of the transcriptional expression of SA marker gene acidic PR1 . It represses the JA 191 mediated defense pathway as shown by the down-regulation of the transcriptional expression of JA marker gene PIN2 . 2- In tomato, pre-activation of SA dependent defense pathways by application of BTH little modify the evolution of diseases symptoms caused by stolbur PO phytoplasma. Only 30% of BTH treated PO- infected tomato were found symptomatic after 2 weeks of PO-transmission as compared to the 100% for non treated tomato. But after 3 weeks, 100% tomatoes were symptomatic. 3- BTH treatment seems to have an effect on the multiplication of the stolbur PO phytoplasma because weaker amplified detection signals were observed in BTH treated PO-infected tomato. 4- In tomato, MeJA treatment activate JA dependent defense pathway and repress SA dependent defense pathway as indicated by the activation of JA marker gene PIN2 and the repression of SA marker gene PR1 . 5- Pre-activation of JA defense pathway did not contribute to modify the evolution of the disease or to have any effect on the multiplication of stolbur PO phytoplasma. 2.4. SA/JA/ET mediated Defense Genes Expression in stolbur PO phytoplasma-infected tomato at two different time points. In chapter II, the transcriptional expression level of defense Genes was determined in stolbur C and PO phytoplasma-infected tomato flower buds and leaves. Here, we studied the expression of defense genes in stolbur PO phytoplasma-infected tomato at two different time points, after 14 days (when symptoms started to appear on PO transmitted plants) and after 21 days. The expression level was estimated by real time RT-PCR. The average Relative Genes Expression of each Gene from 6 PO infected tomato was shown in table 5. After 14 days of PO transmission, symptoms just appear on leaves and transcripts level of acidic PR1 was accumulated by 5.28±SE 1.32 folds and was further up-regulated by 31.68±SE folds after 21 days of PO infection (Table 5). Like acidic PR1 , level of basic PR1 transcript was 7.66±SE folds higher and further enhanced by 78.73±SE 10.47 after 21 days of infection as compared to control (Table 5). 192 Acidic PR2 transcription level was 5.35±SE 0.89 higher in stolbur PO-infected leaves after 14 days and 22.54±SE higher 21 days after infection. In contrast, basic isoform of PR2 protein genes like GluB and BGL2 were down-regulated particularly in leaves after 21 days of PO transmission as shown in table 5. activated repressed Not changed SA or JA Control stolbur PO stolbur PO Genes dependent (H) (14 dpi) (21 dpi) genes acidic PR1 SA 1 5.28±SE 1.32 31.68±SE 6.33 basic PR1 SA 1 7.66±SE 1.11 78.73±SE 10.47 acidic PR2 SA 1 5.35±SE 0.89 22.54±SE 4.34 GluA SA 1 3.52±SE 0.63 19.37±SE 3.28 PR5 SA 1 4.18±SE 1.12 43.17±SE 7.72 PR7 (69B) SA 1 6.01±SE 1.47 31.73±SE 2.53 PR10 SA 1 2.90±SE 0.46 6.48±SE 0.70 PAL SA 1 1.49±SE 0.19 0.68±SE 0.17 ICS SA 1 0.96±SE 0.21 1.82±SE 0.19 basic PR2 JA 1 0.94±SE 0.08 0.45±SE 0.21 GluB JA 1 0.59±SE 0.11 0.37±SE 0.04 BGL2 JA 1 0.94±SE 0.08 0.70±SE 0.18 PIN2 JA 1 0.77±SE 0.16 0.46±SE 0.13 LoxD JA 1 0.66±SE 0.29 0.57±SE 0.35 PR7 (69A) 1 0.96±SE 0.21 0.81±SE 0.06 CHS2 1 1.87±SE 0.14 4.83±SE 1.07 Table 5: Summary of Defense Gene Expression in stolbol PO infected tomato leaves at 2 time points (14 and 21 days of PO inoculation by real time RT-PCR. healthy tomato (H); stolbur PO (PO) phytoplasma-infected tomato; acidic PR1-Acidic pathogenesis-related protein1; basic PR1-Basic pathogenesis-related protein1; acidic PR2-Acidic pathogenesis-related protein2, GluA-acidic beta 1,3-glucanase; basic PR2, GluB and BGL2- Beta- 1,3-glucanase (basic PR2) PR5-pathogenesis-related protein (Thaumatin-Like); PR10-pathogenesis-related protein 10; LoxD- lipoxygenase D; Pin2- Proteinase inhibitor 2; PR7 (69B)- Isoform of pathogenesis-related protein 7; PR7 (69A)- Isoform of pathogenesis-related protein; PAL-phenylalanine ammonia lyase; ICS-Isochorismate synthase; (n= 6 mean ± SE )-Average value with ± standard error. RGE>1 Gene activation. (Pink), RGE<1 Gene repression (yellow). Like PR1 , other studied genes showed an up-regulation by real time RT-PCR: PR5, PR7B (69B), PR10 , and CHS2 . On the other side, two genes showed a down-regulation: PR2 and PIN2 (Table5). ICS RGE was 193 0.73±SE 0.26 after 14 days and increased at 1.82±SE 0.19 after 21 days of PO infection. In an opposite way, the transcriptional level of PAL was of 1.49±SE 0.19 at 14 days and of 0.68±SE 0.17 after 21 days. These results suggested that the expression of defense genes were consistent with those described in chapterII. We showed that SA responsive genes expression was enhanced after 21 days of PO infection as compared to the expression observed after 14 days. In a similar way, it was found that the down-regulation was higher 21 days after infection than 14 days after. 2.5. SA /JA/ET mediated Defense Genes Expression upon BTH and MeJA treatment in healthy tomato We have studied the expression of SA/JA/ET dependent defence genes in stolbur Phytoplasma- infected tomato. We have shown that SA responsive genes Like acidic PR1 , basic PR1 , acidic PR2 , or GluA , PR5, PR7 (69B) and PR10 were activated in both stolbur C and PO infected tomato but JA mediated wound inducible genes such as loxD, PIN2 and GluB or BGL2 or basic PR2 were up-regulated in stolbur C but down-regulated in stolbur PO-infected tomato. Here, we studied the expression of SA and JA regulated defense genes in BTH and MeJA treated tomato to determine their expression pattern in treated tomato. BTH is well known to induce SA mediated defense genes expression and MeJA used to activate JA regulated defense genes. The expressions of all defense genes have been shown in Table 6. Through real time RT-PCR, the transcriptional level of acidic PR1 was determined in BTH treated leaves of tomato 17 days after treatment and was found to be highly induced (56.23±SE 10.20) but in MeJA treated tomato, expression was down-regulated (0.25±SE 0.02) as compared to non treated, as was expected. Acidic PR1 is considered as SA dependent marker gene in tomato and it has been also induced upon BTH treatment but repressed/ or not activated in MeJA treated tomato (Table 6). As expected, for basic PR1 and acidic PR2 genes transcription levels were the same as the acidic PR1 . Several other genes were activated by BTH treatment: acidic PR1 , basic PR1 , PR5, PR7 (69B), ICS and PAL . It was found that basic PR2s were not activated upon BTH treatment but induced in MeJA treated tomato. 194 Indeed, expression of basic PR2 was 1.41±SE 0.44 but enhanced (7.99±SE 0.64) in MeJA treated tomato. The same pattern was observed for GluB and BGL2 . Several genes were up-regulated by MeJA treatment like PR2b, PR5, PIN2, ICS and PAL . activated repressed Not changed SA or JA Control Genes BTH MeJA Dependent genes (H) acidic PR1 SA 1 56.23±SE 10.20 0.25±SE 0.02 basic PR1 SA 1 77.05±SE 11.85 0.29±SE 0.15 acidic PR2 SA 1 26.97±SE 6.70 0.02±SE 0.001 GluA SA 1 23.9±SE 6.70 0.05±SE 0.02 PR10 SA 1 1.13±SE 0.032 0.53±SE 0.13 PR7 (69B) SA 1 14.50±SE 3.98 1.50±SE 0.61 PAL SA 1 1.58±SE 0.25 1.85±SE 0.13 PR5 SA 1 25.22±SE 5.36 1.99±SE 0.67 ICS SA 1 2.78±SE 0.60 basic PR2 JA 1 1.41±SE 0.44 7.99±SE 0.64 GluB JA 1 1.16±SE 0.40 3.88±SE 0.31 BGL2 JA 1 0.87±SE 0.35 3.50±SE 0.66 PIN2 JA 1 0.018±SE 0.002 8.06±SE 0.09 LoxD JA 1 0.043±SE 0.003 1.37±SE 0.21 PR7 (69A) 1 0.70±SE 0.20 1.10±SE 0.15 CHS2 1 0.90±SE 0.14 Table 6: Summary of Defense Gene Expression in BTH (1mM) and MeJA (0.1mM) treated (17 days after treatment) healthy tomato by real time RT-PCR: healthy tomato (H); Benzothiadiazole (BTH); Methyl jasmonic acid (MeJA); acidic PR1-Acidic pathogenesis-related protein1; basic PR1-Basic pathogenesis-related protein1; acidic PR2-Acidic pathogenesis-related protein2, GluA-acidic beta 1,3-glucanase; basic PR2, GluB and BGL2- Beta- 1,3-glucanase (basic PR2) PR5-pathogenesis-related protein (Thaumatin-Like); PR10-pathogenesis-related protein 10; LoxD- lipoxygenase D; Pin2- Proteinase inhibitor 2; PR7 (69B)- Isoform of pathogenesis-related protein 7; PR7 (69A)- Isoform of pathogenesis-related protein; PAL-phenylalanine ammonia lyase; ICS-Isochorismate synthase; CHS2-chalcone synthase2; (n= 6 mean ± SE )-Average value with ± standard error. RGE >1 Gene activation (Pink), RGE<1 Gene repression (blue) and not changed significantly (yellow). Some genes have a particular behaviour, like CHS and PR7 ( 69A ) which expression level is stable whatever treatment is applied. 195 The RGE of PR10 is unchanged after BTH treatment but down-regulated after MeJA treatment, and the opposite is observed for LoxD (down-regulation after BTH treatment and unchanged level after MeJA treatment). Our results were in agreement with the fact that BTH activated the SA regulated genes and MeJA activated the JA regulated genes. Our results were also consistent with previous work as discussed under 196 Chapter III Discussion Effect of Pre-activation of Salicylic Acid (SA) or Jasmonic Acid (JA) Dependent Defense Pathways on the Disease Development in Stolbur PO-Infected Tomato 197 3. Discussion 3.1. Effect of pre activation of SA and/or JA dependent defense pathways on the disease development in stolbur PO phytoplasma-infected tomato In tomato, stolbur PO phytoplasma induce floral malformation and large chlorotic crooked leaves. It has been shown in chapter II that tomato infected by stolbur PO phytoplasma activate Salicylic acid (SA) mediated defense pathway as a basal defense but repress the jasmonic acid (JA) mediated defense pathway. SA and JA mediated signalling are well known to cause resistance against different pathogens and insects. Salicylic acid (SA) is a phytohormone best known for its role in plant defense. It is synthesized in response to viral, bacterial and fungal pathogens (Dempsy et al ., 1999) and is responsible for the large scale transcriptional induction of defense-related genes (e.g. Pathogenesis-related PR1 ) and the establishment of local and systemic acquired resistance (SAR) responses (Dempsy et al ., 1999; Durrant and Dong, 2004). SA phytohormone is implicated in the promotion of Hypersensitive Response (HR), and is also necessary for SAR induction (Yalpani et al ., 1991; Hammond-Kosack and Jones, 1996). Systemic acquired resistance (SAR) is an induced disease-resistance state that is achieved in uninfected parts of a plant following localized exposure to pathogens that cause some form of cell death at the site of infection, such as the hypersensitive response (HR) associated with R-gene-mediated resistance or disease induced necrosis (Durrant and Dong, 2004; Ryals et al ., 1996). SAR has been reported in several dicot and monocot species and is effective against a broad range of viruses, bacteria, oomycetes, and fungi (Kuc, 1982; Sticher, 1997). Concentration of SA from 0.5 mM to 9 mM significantly induced SA-dependent genes expression (Peng et al ., 2004). It has been shown that BTH and SA act in the same way in Arabidopsis and both cause SAR (Lawton et al ., 1996). Potlakayala (2007) demonstrated that single application of 178 µM BTH on B. napus enhances the resistance against virulent strain of bacterial pathogen P. syringae and fungal pathogen L. Maculans, and that SA dependent marker gene like PR1 was also highly activated. Arabidopsis plants grown in soils drenched with 0. 3 mM BTH were found to be more resistant to foliar diseases caused by P. syringae pv. tomato DC3000 (Pst) and exhibited a significant reduction in disease symptoms (Hossain et al ., 2007). Scarponi et al . (2001) also demonstrated that application of BTH 198 on tomato control effectively P. syringae pv. tomato DC3000. BTH treatment on tomato has also been shown to be effective against bacterial pathogen when applied alone or with PGPR by reducing the severity of diseases symptoms (Herman et al., 2008). Our results showed that BTH treatment of tomato was not totally effective against stolbur PO phytoplasma infection as symptoms appeared and phytoplasma multiplied in treated plants. However, our results are in complete agreement with Herman et al ., 2008 in case of acidic PR1 activation and PIN2 repression after BTH application. Herman showed that BTH treatment activate SA mediated defense pathway as SA marker gene acidic PR1 was activated, and repress JA wound-inducible defense pathway as JA marker gene PIN2 was repressed, as what was observed here. Recently, It has been demonstrated that SAR induced by BTH treatment (2.4 mM) on daisy plants reduces the multiplication of Chrysanthemum yellows phytoplasma and consequently low intensity of disease symptom developmet for few weeks (Amelio et al ., 2010). Bressan and Purcell (2005) have shown that X disease phytoplasma transmission to Arabidopsis is reduced by its isect vector ( Colladonus montanus ) significantly upon BTH treatment under controled conditions. Romanzzi et al . (2009) also noticed high recovery rate from Bois noir phytoplasma (stolbur phytoplasma or Ca. phytoplasma solani ) in grapevine treated with BTH. We have also demonstrated that SAR induced by BTH is effective in delaying the development of diseases symptoms and multiplication of stolbur phytoplasma for just few weeks. But in our case little effect of SAR on stolbur phytoplasma is because of snigle application of BTH treatment instead of more application and difference of BTH concentration used (Amelio et al ., 2010; Romanazzi et al ., 2009, Bressan and Pourcell, 2005). We suggest that less severity of symptoms is related to lower multiplication of stolbur phytoplasma is due to the SAR but by the direct effect of BTH. We have also found that SA and ET mediated responses increased during the compatible interaction between tomato and stolbur PO phytoplasma, which is in complete agreement with previous studies done on tomato-bacterial pathogen interaction (Block et al ., 2005; Van Loon et al., 2006; Zhao et al ., 2003). It was also shown that P. Syringae production of coronatin, a JA mimic and phytotoxic, was correlated with the induction of wound-responsive genes in susceptible tomato (Strasser et al ., 2002; Zhao et 199 al ., 2005). In our case, we have shown on the contrary, that stolbur PO phytoplasma inhibits the expression of wound-inducible proteinase inhibitor PIN2. Aster yellow phytoplasma (AY-WB) have been shown to secrete a virulence factor protein SAP11 which inhibits the synthesis of JA by repressing JA mediated defense pathway (Bai et al ., 2009). Our results showed a repression of JA defense pathway in tomato infected by stolbur PO phytoplasma. Although no virulence factors have been indentified in stolbur PO phytoplasma, it cannot be excluded that PO can secrete “SAP11 like” effectors that interfere with JA signalling. In Arabidopsis, 100 µM MeJA was found to activate JA responsive genes pin2 but repress SA responsive genes like PR1 showing the antagonistic interaction between SA and JA defense pathway. Our results of MeJA treatment are in agreement with above findings and showed activation of PIN2 and repression of PR1 . It has been shown that rice transgenic plants expressing an enzyme involved in JA biosynthesis pathway, elevated the expression of some pathogenesis related genes causing increased resistance against pathogenic fungi (Mei et al ., 2006). In other related studies in rice, JA treatment induced developmental stage specific and tissues specific expression of some defense related genes (Rakwal et al ., 2000) but however, exogenous application of JA did not confer resistance against pathogens (Schweizer et el ., 1997). In our study, MeJA treatment activated the JA pathway but did not confer any resistance against stolbur phytoplasma-infection. Görlach et al . (1996) demonstrated that concentrations between 0.1 mM to 10 mM of BTH were effective at inducing PR genes and diminishing pathogen development in different plants. In our study 1 mM concentration of BTH was used to induce the activation of SA dependent defense pathway. Our results show that BTH-induced SAR was accompanied by strong systemic induction of PR genes responsive to the SA pathway. Challenge inoculation of BTH-treated plants did not result in further stimulation of SA-inducible PR genes, indicating that BTH activates these genes by itself (Kohler et al ., 2002). In conclusion, our results show that pre-activation of SA signalling pathway in tomato has a limited effects on PO infection. The observation that the SAR effect is only partially dependent on SA is a reasonable basis to argue that multiple pathways are involved, although it does not specify what the other pathway(s) might be. 200 Activation of SA- and JA- inducible genes in plants treated with BTH or MeJA also implies that not only SA, but other signals as well, may play an important role in inducing resistance. This may be explained by the fact that these microorganisms produce multiple pathogen-associated molecular patterns (PAMPs), each of which is recognized by different receptors and activates different pathways . In both cases, basal defense and pre-activation of defense pathways did not give any resistance against stolbur phytoplasma because diseases symptoms were the same in susceptible and pre-activated tomato. It can be concluded that plant activators such as BTH and MeJA are not effective against stolbur disease in tomato. 3.2. SA /JA/ET mediated Defense Genes Expression in stolbur PO phytoplasma-infected tomato at two different time points. This part have been discussed in chapter 2 with defense genes expression 3.3. SA /JA/ET mediated Defense Genes Expression upon BTH and MeJA treatment in healthy tomato. In tomato, David et al. showed that mRNA level of PAL was not found to be induced with 0.25 mM SA treatment but up-regulated at 100 µM MeJA (David et al ., 2010). In Arabidopsis, pre-treatment with 100 µM BTH cause strong PAL gene activation (Kohler et al ., 2002). This is in agreement with our results. In Arabidopsis, PR1 is not induced by MeJA but up-regulated only by Salicylic acid (SA) or its analogues BTH or INA (Durrant and Dong, 2004). In tobacco, PR1 is not only induced by SA but also by the combination of ethylene (ET) and MeJA (Xu et al ., 1994). Acidic PR1 was highly induced upon SA or functional analogues of SA (BTH, ASM or INA) application which cause systelic acquired resistance (SAR) against different pathogens or insects. Acidic PR1 is also activated in response to abiotic and biotic stress (Durrant and Dong, 2004; Friedrich et al ., 1996). Our results showed an induced expression of acidic PR1 upon BTH treatment that is consistent with these results. Moreover, field experiment of Herman et al ., 2008 showed that SA marker gene acidic PR1 was highly induced upon ASM application in three different tomato cultivars after 7 days of treatment. ASM is a 201 commercially available activator derived from BTH and it activates defense response against wide range of plants giving protection (Oostendorp et al., 2001). Some studies have found raised expression levels of the tomato gene P4 (a marker for SAR) 4 days after BTH application in the greenhouse (Fidantsef et al ., 1999). PR1 is also induced on exogenous treatment with methyl jasmonate (MeJA), ethylene (ET), and salicylic acid (SA) signal molecules (Chao et al ., 1999; van Kan et al ., 1995). So, in the expression point of view, our results are consistent with work done on the expression of acidic PR1 as we found it activated upon BTH treatment. Another isoform PR1b1 (basic PR1 ) is strongly induced upon pathogen TMV, SA and ET treatment (Tornero et al., 1994; Tornero et al ., 1997). Plant activators such as BTH and ASM also induced the transcriptional expression of basic PR1 in tomato grown in the fields (Herman et al ., 2008). In tomato, it was shown that PR1 was highly induced upon 0.25 mM SA and ethylene but not strongly enhanced upon 100 µM MeJA as compared to SA and ET (Chao et al., 1999; David et al , 2010). Basic PR1 is considered marker gene in ET and SA mediated defense pathways. We have also shown that BTH treatment enhances the expression of basic PR1 but that MeJA treatment down regulate its expression. Our results are in consistent with those who have shown induced expression of basic PR1 against pathogens and phytohormones like SA. Our study showed an enhanced expression level of acidic PR2 in BTH treated tomato as well as upon phytoplasma infection. This is in agreement with the fact that in tomato, acidic β-1,3-glucanase or GluA was slightly induced upon 100 mM SA and strongly enhanced upon ethylene (Van Kan et al ., 1995; Chao et al ., 1999; David et al , 2010). Our results showed that basic PR2s were not highly activated in BTH treated tomato but expression was found to be enhanced upon MeJA treatment consistent with earlier work. Indeed, transcript levels of the intracellular basic β -1,3-glucanase ( GluB ) accumulates in response to Methyl Jasmonate and Ethylene signal molecules (Chao et al ., 1999; van Kan et al. , 1995). For example, the RNA transcripts level of basic β -1,3-glucanase ( GluB) was increased in tomato infested with whitefly and upon the treatment of MeJA and ethylene but not upon the application of SA (Chao et al ., 1999; David et al ., 2010). PR5 was induced highly upon BTH treatment in our current study that is in complete agreement with under given work done on PR5 expression. In Arabidopsis, PR5 is induced by SA or INA but in tobacco, 202 PR5 is regulated by SA, MeJA, ET, ABA and other phythormones (Xu et al ., 994; Singh et al ., 1989; Stinzi et al ., 1991). Expression of PR5 genes can be triggered by plant pathogens or abiotic factors such as wounding and exogenously supplied SA and methyl jasmonate (Merkouropoulos et al ., 2003). In Arabidopsis, tobacco and tomato, PR5 is considered SA dependent marker gene and so is induced upon BTH treatment (Durrant and Dong, 2004). The transcript level of PIN2 was not increased in tomato treated with BTH or ASM (Herman et al ., 2008). Proteinase inhibitor (PIN) genes are linked to wounding through JA and ET signalling (O’Donnell et al. 1996; Diaz et al. 2002). Similar to Pin2, LoxD RNAs accumulate in response to wounding, chewing insects, and JA (Heitz et al ., 1997). Our results are in consistent with findings that PIN2 was up-regulated upon MeJA treatment and considered as JA marker gene. In our case, it was up-regulated at MeJA treatment but down regulated in stolbur PO as well as upon BTH treatment. The P69A gene was shown to be expressed constitutively. In marked contrast, two other genes members of the P69 family, namely P69B , do not show constitutive expression but are notably induced in tomato plants upon treatment with salicylic acid (SA) (Jorda´ et al ., 1999; Jorda´ and Vera, 2000). We also observed the same pattern of PR7 expression by BTH treatment agreeing with earlier findings. The transcription of PR10 is induced by several stimuli such as methyl jasmonate (MeJA), salicylic acid (SA), in different plant species (Agrawal et al ., 2001; Liu et al ., 2006). Here, we showed that PR10 expression was unchanged after BTH treatment and down-regulated or not changed by MeJA treatment. In conclusion, our results confirmed the previous findings that SA regulated genes are activated by BTH and that JA responsive Genes are activated by MeJA treatment. The endogenous signalling molecules salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) play major roles in the activation of defense responses to microbial pathogens (Dong, 1998; Glazebrook, 2005; Thomma et al ., 2001). The roles of SA-, JA-, and ET-mediated signalling pathways vary in different plant–pathogen interactions (Kunkel and Brooks 2002; Lund et al ., 1998; O’Donnell et al. 2003; Thomma et al. , 2001). 4. Conclusion In BTH treated tomato 1. The genes implicated in SA dependent defense pathways were activated 2. The genes implicated in JA dependent defense pathways were repressed 203 3. 30% tomatos were symptomatic upon BTH treatment after 14 days of PO infection as compared to non BTH treated and PO infected tomato. 4. The detection stolbur PO phytolasma was faible in BTH treated and PO infected tomato only after 14 days of infection. 5. After 21 days of PO infection, 100% tomato, treated or non treated were symptomatic with strong PO detection. The pre-activation of SA defense pathways (SAR) through BTH little modify the evolution of disease and multiplication of stolbur phytplasma. In MeJA treated tomato 1. The genes implicated in JA dependent defense pathways were activated 2. The genes implicated in SA dependent defense pathways were repressed 3. 100% tomatos were symptomatic upon MeJA treatment after all days of PO infection. 4. The detection stolbur PO phytolasma was strong in MeJA treated and PO infected tomato. The pre-activation of JA defense pathways through MeJA have no influence on phytoplasma multiplication and disease symptoms appearance. 204 General Discussion and Perspectives 205 General Discussion and Perspectives Phytoplasmas are bacteria without cell walls, non cultivated in vitro , which reside within host cells of plant and insect vectors. Phytoplasmas cause numerous plant diseases in many plant species worldwide. In the host plant, phytoplasmas are restricted to phloem tissue in which they multiply. They are naturally transmitted by sap-sucking insects belonging to the families Cicadellidae (leafhoppers) and Fulgoridae (planthoppers) in which they multiply. Phytoplasmas of the stolbur group are vectored by polyphagous planthopper ( Hyalesthes obsoletus ). They induced severe symptoms resulting in crop loss due to the restricted growth, decline and death, but also abnormalities or abortion of flowers and fruits. In tomato, two different isolates of stolbur phytoplasma, named C and PO, which belong to 16 Sr XII-A group, induce different symptoms. The tomatoes infected by stolbur PO phytoplasmas show abnormal flower development such as hypertrophied sepals, sometime closed to big bud, and aborted petals and stamens development. The infected leaves are of larger size, crook-shaped and chlorotic. The same symptoms can not be observed in stolbur C phytoplasma-infected tomato. It has been shown that tomato flower abnormalities induced by stolbur PO phytoplasma infection are associated with changes of expression of floral development genes (Pracros et al ., 2006). We have shown that floral development gene SlDEF was down- regulated in stolbur PO phytoplasma infected tomato in accordance with abnormal floral development. In the litterature, there are evidences that methylation could inhibit gene expression (Chan et al ., 2005). Genes can be down-regulated when the numbers of methylated cytosines are more abundant as compared with normal methylation status of gene (Jacobsen et al ., 2000). DNA methylation may be involved in the down-regulation of floral development genes. 206 For example, it has been suggested that, in Arabidopsis , APETALA3 down-regulation may result from their hypermethylation (Finnegan et al ., 1996). This phenomenon is called ‘’hypermethylation’’. Methylases and Demethylases are the enzymes which determine the methylation pattern of the genomic DNA. To understand the molecular processes associated with flower abnormalities and the implication of methylation in the deregulation of flower development genes, it was important to study the expression of floral development genes. Our result showed a repression of SlDEF gene in PO phytoplasma-infected tomato which has abnormal flowers, whereas transcripts of SlDEF were up-regulated in the nearly normal flowers obtained in Azacytidine treated tomato. Azacytidine treatment decreases the methylation level and activates the expression of methylated silenced gene. This result supports our hypothesis that the repression of SlDEF could be due to methylation. Further, deregulation of genes involved in the process of methylation (methylases) specifically the repression of chromomethylases (CMT) and activation of some domain rearranged methyltranferase (DRM) such as DRM7 and DRM8 leaded us to think about the involvement of methylation. The down-regulation of demethylases strengthens our hypothesis that phytoplasma PO infection could inhibit demethylation process by maintaining genome wise in hypermethylation status in PO phytoplasma-infected tomato. Results obtained with Methylation Sensitive Restriction Enzymes PCR (MSRE-PCR) and Southern Blotting indicated involvement of global methylation but the results of bisulfite sequencing regarding to SlDEF gene promoter methylation did not clearly support the hypothesis that repression of SlDEF gene was due to its promoter methylation. If the methylation is involved in SlDEF repression, the specific loci were not found along the studied sequences. It has indeed been shown that gene can be repressed without its promoter methylation. 207 Methylation level can be changed with developmental stage and biotic and abiotic stresses. Here, we cannot exclude that repression of SlDEF gene could be due to specific targeted locus or some other factors. In fact, the floral development genes expression is overlapped and is regulated by feed loop mechanisms. So, it is possible that repression of SlDEF gene could be linked to other floral developmental genes or some other factors. Moreover, recently, phytoplasma effector such as Tengu which cause morphological changes, produce sterile flowers and down-regulate some phytohormones responsive gene, have been identified from OY-phytoplasma. Phytoplasma effectors, proteins SAP54, interfere with flower development and produce green petals when overexpressed in Arabidopsis, showing their significance in the induction of disease symptom. SAP11 effector proteins, identitified from AY-WB phytoplasma, interfere in developmental process and down-regulate the synthesis of JA which is an important phytohormone involved in development and defense. So, as future perspective, to determine well the association of abnormal floral development and possible molecular mechanism in stolbur phytoplasma-infected tomato, it is important to study the regulation and epigenetic mechanism of some other floral development genes. The identification of possible effectors from stolbur phytoplasma, which still have not been identified, is also important. We have to determine the global methylation level of stolbur phytplasma infected tomato by HPLC. It is also important to determine the methylation status of all the regulatory region of SlDEF gene through bisulfite sequencing after verifying the necessary conditions of the experiment. The role of DNA demethylases have to be verified in transgenic plants regarding to the expression of floral developmental genes. To defend themselves, plants employ different strategies to cope with potential attackers. They synthesized different phytohormones that are essential for the regulation of plant growth, development, reproduction and survival and used as signalling molecules in defense response. Salicylic acid (SA), Jasmonic acid (JA) and Ethylene (ET) (phytohormnes) are considered primary signals and important defense pathways in the regulation of the plant’s immune response against herbivore insects and pathogen. 208 Upon infection, plants activate SA, JA or ET dependent defense pathways by their defense genes expression. Induction of pathogenesis-related proteins (PRs) is one of the best characters associated with defense pathways. Different mollecular markers can be used to study the defense pathways. Some evidences indicate that phytoplasmas can alter the levels of various phytohormones. The striking alterations in plant morphology and development caused by phytoplasma suggest that these pathogens change the balance of regulatory signals within infected plants. Little is known about the pathogenicity of phytoplasmas and defense pathways. Genes Stol-C Stol-PO BTH MeJA acidic PR1 + + + - basic PR1 + + + - acidic PR2 + + + - GluA + + + - basic PR2 + - o + GluB + - o + BGL2 + - o + PR4 + + PR5 + + + + PR7 (69A) + - o o PR7 (69B) + + + o PR10 + + + - PR12 + + PAL + - + + ICS + + + CHS2 - + o Pin2 + - - + LoxD + - - + TSR + + Pti4 + + not changed (o) ; <1 down-regulated (-); >1 up-regulated (+) Defense pathways dependent defense genes expression was studied in stolbur C and stolbur PO phytoplasma-infected tomato by semi-quantitative RT-PCR and Real time RT-PCR. We studied the expression SA, ET or JA regulated defense genes including some transcription factors and genes involved in their biosynthesis pathways. Our results showed clearly that defense genes were expressed differentially (Table) by activating different defense pathways in Stolbur C and stolbur PO phytoplasma- infected tomato. 209 In stolbur C phytoplasma-infected tomato, phenylalanine ammonia lyase (PAL) which acts upstream of SA biosynthesis and is implicated in defense pathways was activated but it was down-regulated in stolbur PO infected tomato. It has been shown that SA biosynthesis can also takes place through other pathways such as isochorismate synthase (ICS) which was actived in PO tomato. Our results are consistent with previous findings that PAL can be induced upon BTH or MeJA application. All the SA mediated and down-stream acting pathogenesis-related proteins genes, PR1a, PR1b, PR2a, GluA PR5, PR7 (69B) and PR10 were activated upon stolbur C and stolbur PO infection and BTH treatment. Our results support the previous findings that SA regulated genes are activated not only during compatible and incompatible interaction but also upon SA/BTH treatment but not upon JA/MeJA applications because mostly SA/JA defense pathways have an antagonistic interactions. Ethylene (ET) responsive transcription factors, TSR and Pti4, and some pathogenesis-related genes PR1b, PR4, PR7 (69B) genes were activated in both stolbur C and PO phytoplasma-infected tomato. Lipoxygenase D (LoxD) which is involved in jasmonic acid (JA) biosynthesis and JA dependent marker genes such as proteinase inhibitor 2 and basic pathogenesis-related proteins PR2 (basic PR2, BGL2, and GluB) were activated only in stolbur C but not in stolbur PO phytoplasma infected tomato suggesting that JA dependent defense pathway was active in stolbur C but not in stolbur PO-infected tomato. Similarly, All JA regulated genes were induced upon MeJA treatment but not upon BTH treatment. The differential expression of defense genes in stolbur C and PO phytoplasma suggested that these phytoplasma may have different effectors that interfere defense signalling. Recently, it has been shown that phytoplasmas have a functional Sec-dependent translocation pathway that enables these pathogens to secrete membrane-associated proteins, such as Amp, and effectors, such as SAP11 and TENGU, that are released into the host cells of plants and insects to target host cell molecules. In case of Aster Yellows phytoplasma infection, Lox2 expression and JA accumulation are reduced in the SAP11 transgenic Arabidopsis lines. Thus SAP11 effectors have been shown to alter signalling pathways and modulate the production of phytohormones such as JA that regulate plant defense responses against their insect vectors. Stolbur C and stolbur PO phytoplasma have different genome sizes such as 1280 and 860 kbp respectively, but have not been sequenced yet. Only a few sequences are available and no effectors have 210 been identified so far. It is suggested from our results that stolbur PO phytoplasma which induced the repression of the JA defense pathway may have similar effectors as Aster Yellows phytoplasma. Moreover, in stolbur phytoplasma-infected tomato, the study of the expression of different pathogenesis-related protein genes with different activities such as antifungal, glucanase, chitinase, proteinase and ribonuclease, may provide us useful informations about the nature of effector/ proteins secreted or components of stolbur phytoplasma as they are much different from other plant pathogens. Very first time, we studied the expression of PR genes and obtained valuable results. Further, we have to detect the localisation and accumulation of PR protein in infected tomato. We have to study the expression of some other transcription factors and defense genes implicated to regulate the defense pathways. The expression of pathogenesis-related proteins genes in floral buds also showed us organ specific induction along with defense. Some PR proteins genes have been shown to be induced in an organ specific manner and involved in developmental process. Our results showed that genes of PR1 family were highly up-regulated in floral buds of infected tomato, as it was highly expressed in sepals of tobacco flowers. PR2 family such as Beta 1,3 glucanase (BGL2) was found to be highly induced in petals of tobacco flower consistent with the expression of BGL2 in stolbur C phytoplasma-infected tomato which showed flowers with complete petals,and consistent with the fact that BGL2 was not induced in stobur PO tomato which show aborted petal development. Our results also suggested that like other plant pahogens, stolbur phytoplasma use counter defense mechanism by interfering defense pathways to be successfully established within host cells. Stolbur PO phytoplasma repressed JA defense pathways as shown by the down-regulation of loxD, Pin2 and basic pathogenesis-related proteins genes. In many susceptible plants, counter defense strategies implied by different pathogens are well documented and involved the secretion of effectors by pathogens to overcome the defense induced by host plants. We have shown that defense related genes depending the different defense pathways have been activated or down-regulated or not changed. We have demonstrated that SA/ET mediated defense pathways were activated in stolbur PO but JA alongwith SA/ET pathways were activated in stolbur C infected tomato. The activation or repression of defense pathways may be due to interference in the synthesis of phytohormones SA, JA or ET because of the effectors secreted by these two isolates of stolbur phytoplasma 211 C and PO. So, Because phytoplasma infection seem to interfere with SA or JA defense pathways but we don’t know that stolbur phytoplasma may interfere in SA or JA synthesis so it is important to determine the level of these phytohormones by HPLC in stolbur phytoplasma infected tomato. Generally, acidic PR accumulates in apoplast and basic PRs accumulate in vacuoles against different pathogens which secreted their effectors through TSSR system. But stolbur phytoplasma have no TSSR system and reside in phloem tubes of plant cell, so, PRs proteins accumulation and their localisation must be detected in infected tomato. We must study the expression of transcription factors and some defense genes which interact and regulated the cross-talk of defense pathways. As SA defense pathway was activated in both C and PO tomato but JA was repressed in stolbur PO tomato only, hence the effect of pre-activation of SA or JA defense pathways or induction of SAR or ISR must be studied in infected tomato. Pre-activation of SA and JA defense pathways have been shown to be effective against different bacterial pathogens. However it was not yet clear whether the signal transduction pathways and defense strategies triggered by stolbur PO phytoplasma during infection are the same as those observed in the resistance against other pathogens or phloem feeding insects. Very little is known about the importance of SA- and JA-mediated signalling in phytoplasma-tomato interaction. We determined whether pre-activation/stimulation of SA-signaling pathway or JA signalling pathway would restore disease symptoms. The SA analog, benzo (1, 2, 3) thiadiazole-7-carbothioic acid S- methyl ester (BTH) and Methyl Jasmonic Acid were used to activate their regulated defense pathways. BTH treatment activate the SA dependent defense pathway as shown by the up-regulation of the transcriptional expression of SA marker gene acidic PR1 but repress the JA mediated defense pathway as shown by the down-regulation of the transcriptional expression of JA marker gene PIN2. Pre-activation of SA dependent defense pathways by application of BTH little modify the evolution of diseases symptoms caused by stolbur PO phytoplasma. The detection stolbur phytoplasma was followed by Nested-PCR. All the infected samples were found positive for phytoplasma presence. BTH treatment 212 seems to have an effect on the stolbur PO phytoplasma multiplication because week amplified DNA fragments of stolbur PO phytoplasma were observed in BTH treated PO-infected tomato as compared to non treated. MeJA treatment activate JA dependent defense pathway and repress SA dependent defense pathway. Indeed, JA marker gene PIN2 was activated but SA marker gene PR1 was repressed. Pre-activation of JA defense pathway did not contribute to modify the evolution of disease or to have any effect on the multiplication of stolbur PO phytoplasma. Pre activation of SA or JA defense pathways did not change, or slightly, the development of the disease. Use of plant activators like BTH or MeJA cannot thus serve as track to study the mechanisms of defense of tomatoes towards the infection by the stolbur phytoplasma but it is important to quantify the stolbur PO phytoplasma through real time PCR on BTH treated tomato as BTH treated tomato showed inhibition in the multiplication of stolbur PO. So, stolbur phytoplasma is important pathogen and there are many secrets left to expolre it in future and challenging work including their culturing, sequencing, and identifying their virulence factors and mechanism of pathogenecity and interference in physiological process is continued by the scientists in all over the world. 213 Materials and Methods 214 Material and Methods 1. Biological material The stolbur phytoplasma isolates C (Stol-C) and PO (Stol-PO) belongs to the 16S rDNA XII-A phylogenetic sub-group. It was initially introduced into periwinkle plants ( Catharanthus roseus ) through insect ( Hyalesthes obsoletus ) transmission (Jarausch et al ., 2001). Stol-PO was maintained in periwinkle plants by successive grafting in an insect-proof greenhouse. The stolbur PO phytoplasma was transferred from periwinkle to tomato plants by the method of Valenta et al. (1961) using dodder ( Cuscuta campestris ), a phloem sap-feeding parasitic plant, and was further propagated in tomato by side-grafting. Tomato ( Solanum lycopersicum L. cv. Ailsa Craig) plants (Meissner et al. 1997) were germinated and grown for a week in moist vermiculite and maintained in the greenhouse at 27°C during the day and at 20°C during the night. The plantlets were transferred in containers with sand (20%) and organic matter (80%). For the experiments, two-month-old tomatoes were inoculated with stolbur phytoplasma isolates C and PO by side-grafting at two alternate positions on main stem by using scions each of 3cm. Control plants were grafted with healthy scions. Disease symptoms were scored relative to control using a 0 or (-) (i.e no symptoms) to 5 or (+++++) (i.e dead plant) scale (Busch and Smith, 1981; Foissac et al., 1997c; Shittu et el., 2009). Briefly, diseases symptoms scales are described as: healthy tomatoes are noted -, young leaves with marginal yellows are noted +, young leaves asymmetric and other leaves developing yellows are noted ++, general yellowness with retarded growth are noted +++, tomato with lethal necrosis appearance are noted ++++, and dead plants are noted +++++. Infection of plants by the stolbur phytoplasma was followed by Nested-PCR using primers R16mF2 / R16mR1 and R16 F2n/ R16R2 (Gunderson and Lee, 1996) on flower buds of 1 mm, 3 mm, 5 mm and leaves. 215 To induce DNA hypomethylation, tomatoes were cultivated from seeds on MS medium (Murashige and Skoog, 1962) supplemented with 10 or 50 µM of 5-azacytidine. After 4 weeks of culture, plants were cultivated in greenhouse. In case of Benzothiadiazole (BTH) and Jasmonic acid (JA) treatment experiments, batches of tomatoes were first sprayed with BTH (1mM) and Jasmonic acid (0.1mM) separately. After 2 days, all treated and non treated tomatoes were side-grafted with scions from healthy and Stol- PO infected tomato. Symptoms were noted and leaves were collected at various time points i.e 14 days (apparition of symptoms), 21 days and 28 days after grafting. Immediately after being picked, all samples were covered with ice and conserved at -80°C. 2. RNA extraction and related methods of analysis 2.1. RNA Extraction Total RNA from 0.2 g to 0.5 g of flower buds and leaves of healthy and infected tomato plants was isolated by TriZol LS-Reagent® Method (Invitrogen- Carlsbad, MI, USA). Briefly, 0.2 g of frozen, young flower buds and 0.2 g to 0.5 g of leaves of healthy and stolbur phytoplasma infected tomato was ground in liquid nitrogen. The powder was mixed well with 1mL of TriZol LS-Reagent® (Invitrogen- Carlsbad, MI, USA). After 15 min at room temperature, the mixture was centrifuged at 14000 rpm for 10 min at 4°C. The supernatant (1mL) was emulsified with 0.3 mL of chloroform for 15 min at room temperature. The nucleic acids of the supernatant were precipitated by adding 0.5ml of cold isopropanol for 2h at 20°C. Then centrifugation was done at 14000 rpm for 30min at 4°C. Supernatant was poured out and pellets were washed with 70% ethanol. The nucleic acids were resuspended in 15 µL sterile deionised water. 2.2. RNA Treatment with RNase- Free DNase. RNAs (8 µg to 12 µg) from flower buds and leaves were treated with 5 units of RQ1 RNase- Free DNase (Promega, Madison, WI, USA) at 37°C for 1h in the presence of 5µL RQI DNase 10X reaction buffer (Promega, Madison, WI, USA) in a final volume of 50µL . After incubation, 50 µL of H2O and 100 µL of phenol saturated in TRIS were added and each tube was vortexed for 30 seconds. 216 Centrifugation was carried out at 14000 rmp for 5 min and supernatant (nearly equal to 100 µL) was transferred into other 1.5 mL tube by discarding the lower phase. Then, 100 µl of chloroform/isoamilique alcohol (v/v 24/1) were added and each tube was vortexed for 30 sec. Centrifugation was done at 14000 rpm for 5 min and supernatant (nearly equal to l00µL) were transferred into other 1.5ml tubes. Then, 1/10th of volume of 3M potassium acetate (10µL) and 2.5 times volume of 95% cold absolute ethanol (250 µL) were added and tubes were put at -80 °C for 2h. Centrifugation was done at 14000 rpm for 15 min at 4°C and supernatant were poured out. The pellets were washed with 70% cold ethanol (500µL) by centrifuging at 14000 rpm for 5 min. Finally, RNA pellets were resuspended in 10 to 15 µL sterile deionised H2O and conserved at -20°C. RNA/DNA concentration measurement The nucleic acid concentration was measured by spectrophotometry. An aliquot of sample was diluted in water (1/80 th or 1/100 th ) and its absorbance was measured at 260 nm using a UV spectrophotometer. The following formula was used to determine the RNA concentration. C (µg/ml) = A260nm *40*dilution factor. DNA concentration was determined using the following formula C (µg/ml) = A260nm *50*dilution factor. The concentration of nucleic acid was also measured directly by a Nanodrop 217 Table 1-Composition of RT Master Mix RT Mix components Initial concentration Final Preparation for 1 concentration Reaction (30 µL) or quantity Buffer FS (Invitrogen) 5X 1X 6.00 µL DTT 0,1 M 2 mM 0.60 µL RNaseOut 40 U/µL 24 Units 0.60 µL dNTP Mix 5 mM 250 µM 1.50 µL Oligo dT18 100 µ£M 1.6 µM 0.50 µL Reverse Transcriptase 200 U/µL 400 Units 2.00 µL H2O up to 30 µL RNA 1 µg 1.00 µL Composition of buffer 1X of Reverse Transcriptase: 50 mM Tris-HCL, pH 8.3; 75 mM KCl; 3 mM MgCl2 Table 2- Composition of PCR Master Mix PCR Mix components Initial concentration Final Preparation for 1 concentration reaction (25 µL) or quantity Buffer 10X 1X 2.50 µL MgCl2 25 mM 4 mM 4.00 µL dNTP Mix 5 mM 200 µM 1.00 µL Forward Primer 10 µM 0.1 µM 0.25 µL Reverse Primer 10 µM 0.1 µM 0.25 µL Taq DNA polymerase 5 U/µL 2 Units 0,4 µL H2O up to 24 µL DNA (cDNA) 1.00 µL Composition of buffer 1X of Taq DNA polymerase: 20 mM Tris-HCL, pH 8.4; 50 mM KCl 218 2.3. Reverse Transcription Polymerase Chain Reaction RT-PCR 2.3.1. Reverse Transcription Complementary DNA (cDNA) was synthesized from 1µg RNA extracted from flower buds and leaves of healthy, Stol-C and Stol-PO phytoplasma infected tomato by using 400 units of Superscript® II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) in a 30 µL final reaction according to the manufacturer’s protocol. Briefly, 18.8 µL volumes containing 1µg RNA template and 0.5 µL of 100 µM gene-specific reverse primers (sequence on tab 3) or Oligo-dT18 primer were incubated at 65°C for 5 minutes to allow the denaturation and chilled immediately on ice for 3 minutes. Chilling was done to quench the RNA and to prevent the renaturation. Then the volume was completed to 30µl with the MIX to obtain a solution containing 400 units of Superscript® II Reverse Transcriptase, 2 mM DTT (Invitrogen, Carlsbad, CA, USA), 250 µM Deoxyribonucleoside Triphosphate (dNTPs), 24 units of RNase Out TM (Invitrogen, Carlsbad, CA, USA), 1X first strand reaction buffer (Invitrogen, Carlsbad, CA, USA) and sterile deionised H2O were added to a final volume of 30 µL (Table 1). Complemetary DNA synthesis (cDNA) was allowed to occur at 42°C for 1 hour. The reaction was inactivated by heating at 80°C for 5 minutes and RT reaction mixture was used as template for PCR amplification experiments. To ensure that all signals came from the cDNA and not from contaminating DNA, a negative RT control (no addition of reverse transcriptase) was also used as template for PCR. 2.3.2. Semi-quantitative RT-PCR The 30 µL final volume of PCR mixture was prepared to contain the following components: Thermophillic DNA 1X Mg free buffer (Promega, Madison, WI, USA), 4 mM Magnesium Chloride (Promega, Madison, WI, USA), 200 µM Deoxyribonucleotide triphosphate (dNTPs), 0.1 µM of each Oligonucleotide Primer, 1 µL pure or 1/10 th diluted cDNA and 2 Units of Taq DNA polymerase (Promega, Madison, WI, USA), (Table N°2). PCR amplification was performed in a programmable Mastercycler gradient (Eppendorf) or iCycler (Bio-Rad) using a variable number of reaction cycles depending on the targeted gene 219 Table 3: Primers used for RT-PCR in tomato Name Accession Forward Primer sequence 5’- 3’ Reverse Primer sequence 5’- 3’ Length Tm number bp °C/ N° of cycles Floral developmental Genes (Pracros et al., 2006) FA(Falsiflora ) AF197936 CGCGGACACATTTTGTCC CTTTGTCTCTCGCTTATTCC 602 60 /40 SlDEF TC116723 GGTTGAGTAGTAATTTTCACC TTCATACTTCCACATGATC 140 50/ 28 DNA Methyltransferase (Pracros et al., 2006) SlMET1 AJ002140 ATTGGCGTGACCTTGAAG CTGTGCTTGTGCAAGATG 295 54/34 SlCMT2 SGN- GAATTGTAATGAAGTGTCAC AATGTTACATGGAATTGAATG 264 54/34 U320922 SlCMT3 SGN- GACGAATCTCTAGATAAGG GAAATAAGCTTTGCATATAAG 313 54/35 U314390 SlCMT4 SGN- GATTCTCAGTCTGGTTCC CAGACAATGGGTCATCAG 325 54/34 U345626 SlDRM5 EU344815 AAGACATGTTTCCAAATGGG CGCCACATGAATCTATCAG 246 54/33 SlDRM7 TC161581 TGGAAGTAACAGGGTGAC ACAATGAGAAGTTCAGCAG 287 54/34 SlDRM8 SGN- ATTCATGCAGGAGCCTTG GTCTCAGAATTGATGCCG 520 54/38 U325992 DNA Demethylase Dml 325 SGN- ACTTCC TCGATAGACTGGTG CAG GAAGTGGTTGGAGAGG 248 55/34 U324525 Dml 728 SGN- TCTGGAACTGTACC GGTGAGTGAAATTTTCCCT 246 55/34 U319728 Dml 729 SGN- TTCTGGAATTGTACCCTGTG GTTGATTGAAGTTCTGGAA 248 55/34 U319729 Reference Gene (Teyssier et al. , 2008) Ef1 α X53043 GGTTAAGATGATTCCCACC CCAGTTGGGTCCTTCTTG 148 54/34 220 The PCR cycles consisted of a 45 sec denaturation step at 94°C, 45 sec annealing step at variable annealing temperatures and 45 sec elongation step at 72°C. Forward and Reverse primers sequences are listed in Table N°3. 2.3.3. Gel electrophoresis: After PCR, 8 l of the amplicons were analyzed on 1.2% or 1.5% DNA grade agarose gel by electrophoresis in 1X TAE ( Tris HCL 40 mM; EDTA 10 mM; Sodium acetate 2 mM; acetic acid pH=7.8). Gels were run on Bio-Rad Mini-Sub Cells or Bio-Rad Wide Mini-Sub Cells at 50 to 100V. Gels were then stained in solution of ethidium bromide (2µg/mL) for 4 minutes and destained with distilled water for 15 minutes. Seventy five nanograms of 1 kb ladder molecular weight marker (Promega) were used as a size standard. Gels were visualized under UV light using complete image acquisition system (Sony, Vilbert Lourmont, UK). The DNA band intensities were quantified using Bio-Rad Fluor- S TM MultiImager System and Quantity One software (Bio-Rad, CA, USA). For the RT-PCR, the intensity ratio between the bands of targeted gene and control gene (EF1 alpha) was correlated. For statistical reliability, three technical replicates of the RT-PCR reactions were done independently. 2.3.4. Calculations and analysis for semi-quantitative RT-PCR All semi-quantitative RT-PCR reactions were carried out with elongation factor 1 alpha (EF1 alpha) as control gene by which the expression of the other genes was normalized. The expression units for the genes investigated were divided by the expression units of the reference gene EF1 alpha. Three to four biological RT-PCR replicates were performed to ensure accuracy, precision and reproducibility of results. The means of the expression values of gene of interest were tested to determine if they were statistically significant or not (Students test with p<0.05). The presence of statistical significance in expression values signified differential expression of that particular gene (either up-regulated or down-regulated). 221 Table 4-Composition of qRT-PCR Master Mix qPCR Mix components Initial Final Preparation for 1 concentration concentration Reaction (25µL) QPCR SYBR Green Mix 2X 1X 12.5 µL 2X (Thermo Scientific) Forward Primer 10 µM 0.7 µM 1.75 µL Reverse Primer 10 µM 0.7 µM 1.75 µL H2O 8.00 µL DNA (cDNA) 1.00 µL PCR conditions for qRT-PCR in SYBR Green number of cycle temperature time cycles cycle 1 1 step 1 95°C 15 min cycle 2 45 step 1 95°C 20 sec step 2 52 to 56°C 40 sec step 3 72°C 40 sec data collection and real-time analysis enabled cycle 3 1 step 1 72°C 3 min cycle 4 1 step 1 95°C 30 sec cycle 5 80 step 1 60°C +0,5°C 10 sec Melt curve data collectioneach and analysis10 sec enabled cycle 6 1 step 1 72°C 10 min 222 2.3.5. Real-time RT-PCR Real-time RT-PCR was performed on Light Cycler 480 II (Roche) or Bio-Rad iCycler system. The master mix for each PCR run was prepared with Absolute Blue qPCR SYBR Green Fluorescein Mix (Thermo Fisher Scientific, ABgene, UK) according to the manufacturer’s protocol. Absolute Blue SYBR Green Fluor 1X, 0.7 µM of each PCR primer (Forward and Reverse) and pure or 1/10 th diluted cDNA were used in 25 µL final reaction (Table 4). The following thermal cycling programme was as followed: Enzyme activation at 95C° for 15 min for 1 cycle, denaturation temperature at 95°C for 20 seconds, annealing temperature according to Tm (56°C or 52°C) of tested gene primers for 40 seconds, extension temperature at 72°C for 40 seconds, for 45 cycles (Table N°4). The threshold cycles were calculated by plotting normalized fluorescence in relation to cycle number. After amplification, a melt curve temperature was generated: 95°C for 30 seconds for 1 cycle, starting temperature at 60°C for 10 seconds for 1 cycle, Melting step 60 °C for 10 seconds with increasing of 0.5 °C every cycle for 80 cycles and final cycle of 72°C for 10 min. Three biological replicates were done for each sample. The respective target genes and their nucleotide sequences (forward and reverse primers) have been indicated in Table 3. 2.3.6. Calculations and analysis for Real Time RT-PCR The results of Real time RT-PCR were expressed as Ct (cycle threshold) values that corresponded to the cycle at which the fluorescence of the SYBR Green dye reached above the threshold or background fluorescence value. In quantifying relative gene expression, the following formula determining the Relative Gene Expression (RGE) was used: Efficiency (of primers for target gene) (Ct control-Ct infected) RGE = Efficiency (of primers for control gene) (Ct control-Ct infected) Where the primer efficiency was determined automatically by the real-time PCR software by using pure, 1/10, 1/100, 1/1000, 1/10000 dilutions of cDNA. Students test were also used. 223 Table 3 continuation – Primers used for RT-PCR in tomato Accession Name Forward Primer sequence 5’- 3’ Reverse Primer sequence 5’- 3’ Reference number Pathogenesis-related Proteins Genes PR1a GAGGGCAGCCGTGCAA CACATTTTTCCACCAACACATTG Herman et al., 2007 AJ01152 PR1b GGTCGGGCACGTTGCA GATCCAGTTGCCTACAGGACATA Herman et a.l, 2007 0 PR2a M80604 TATAGCCGTTGGAAACGAAG TGATACTTTGGCCTCTGGTC Van Kan et el. , 1992 GluA M80604 GGTCTCAACCGCGACATATT CACAAGGGCATCGAAAAGAT Aimé et a.l , 2008 PR2b M80608 CAACTTGCCATCACATTCTG CCAAAATGCTTCTCAAGCTC Van Kan et e.l , 1992 GluB M80608 TCTTGCCCCATTTCAAGTTC TGCACGTGTATCCCTCAAAA Aimé et al., 2008 BGL2 M80680 CACCAACATTCACATAACAGAGGC CAG GGC TGATTTCATTACCAAC J. Peng et al., 2004 PR4 U01880 CTAGCGGACCAGGGGAGAGC ACGCGATCAATGGCCGAAACAAG Gu et el., 2002 F. Fiocchetti et el , PR5 M29279 CCCCAACAAAACCTAGTGGA ACCAGGGCAAGTAAATGTGC 2006 PIN2 TGATGCCAAGGCTTGTACTAGAGA AGCGGACTTCCTTCTGAACGT Herman et el. , 2008 PR7(69A) Y17275 AACTGCAGAACAAGTGAAGG AACGTGATTGTAGCAACAGG PR7(69B) CAGCAGTCGGCCATGTAGCCAATGTT GGGAGATGGTGGTGCTGGAAGC Tian et el., 2004 PR10 AGGAGGTACGCTTCGATGGCCT CACATTTTTCCACCAACACATTG PR12 GACCATGGCTCGTTCCATTT CAAAGAGCACCATTGCCAAGA Henrik et al. , 2009 Biosynthesis Enzymes Genes PAL AJ01152 TTCAAGGCTACTCTGGC CAAGCCATTGTGGAGAT J. Peng et al., 2004 0 ICS TCGCCGGCATTCATTGGAAACA AAAGCCCGTGCATCTTCTGT Uppalapati et al. , 2007 CHS2 X55195 GGCCGGCGATTCTAGATCA TTTCGGGCTTTAGGCTCAGTT Schijlen et al., 2007 LoxD U37840 CATTCTTGGTCATCTCAATGG GTGACAACACGTTTGGATCG IIarduya et al. , 2008 ET transcription Factors Pti4 U89255 GGATCAACAGTTACCACCG CGGTGTTTCAGCCGCCGGA Gu et el., 2002 TSR ACCGGCGAAGGAGAAGTCGT GCGCCACTACAGGGGAGCAA Zhang et e.l, 2004 Reference Gene/Control Gene Ef1 α X53043 GGTTAAGATGATTCCCACC CCAGTTGGGTCCTTCTTG Teyssier et al. , 2008 224 3. DNA extraction and related methods of analysis 3.1. DNA extraction The genomic DNA from 0.2 to 0.5 g of flower buds and leaves were extracted by modified CTAB method (Murray and Thomson, 1980). Briefly, 0.2g of flower buds and 0.3 to 0.5g leaves of tomato was ground in 3 mL containing 2% cetyltrimethylammoniumbromide (CTAB); NaCl 1.4 M; EDTA 20 mM; Tris- HCl 100 mM, p H 8) with 0.2% v/v beta-mercaptoethanol mixture in plastic sachet was ground with Grinder (Bioreba AQ, homex6, Switzerland). All liquid were transferred into 2 ml tubes by disposable pipette and put in water bath at 65°C for 30 min. Centrifugation was done at 3000 rpm for 5 min and supernatant (nearly 1mL) was treated with 10 µL of DNase free RNase (10mg/mL) at 37°C for 1 hour. One mL of chloroform/isoamylique alcohol (24/1 v/v) was added into each tube and centrifugation was done at 14000rpm for 5 min. The supernatant was taken into other 1.5 mL tubes and kept at -20°C for 1h after adding 0.9 mL of cold isopropanol. Centrifugation was performed at 14000 rpm for 30 min at 15°C.The supernatant was poured out and DNA pellets were washed with 70% ethanol (500µl) by centrifuging at 14000 rpm for 5 min. The dried pellet was resuspended in 20 µL of sterile deionised H2O and conserved at -20°C. 3.2. Nested-PCR for Stolbur Phytoplasma detection Stol-C and Stol-PO phytoplasmas were detected in DNA extracted from flower buds and leaves of healthy and infected tomato by Nested-PCR following the protocol of Gunderson and Lee 1996. First, PCR1 was performed in 40 µL final reaction by using R16mF2 (F: 5’- CATGCAAGTCGAACGGA-3’) as forward primer and R16R2 (F: 5’- CTTAACCCCAATCATCGAC-3’) as reverse primer in Master Mix containing 0.5 µg DNA, 1X Thermophilic DNA Mg free buffer (Promega, Madison, WI, USA), 2 mM Magnesium Chloride (Promega, Madison, WI, USA), 200 µM 225 Deoxyribonucleotide triphosphate (dNTPs), 0.2 µM of each Primer, and 2 Units of Taq DNA polymerase (Promega, Madison, WI, USA), (Table 5). PCR conditions and number of cycles are indicated in table N°5. One µL of 40 times diluted product of PCR1 was used for Nested PCR using primers R16F2n (F: 5’- GAAACGACTGCTAAGACTGG-3’) and R16R2 (F: 5’-TGACGGGCGGTGTGTACAAACCCCG-3’) as forward and reverse primers repectively with same master mix components as in PCR1. 226 Table 5-Composition of PCR Master Mix for PCR1 PCR1 Mix Initial Final Preparation for 1 components concentration concentration Reaction (40 µL) or quantity Buffer Promega 10X 1 X 4.00 µL MgCl2 25 mM 2 mM 3.20 µL dNTP Mix 5 mM 200 µM 1.60 µL Forward Primer 100 µM 0.2 µM 0.20 µL Reverse Primer 100 µM 0.2 µM 0.20 µL Taq DNA 5 U/µL 2 Units 0.20 µL polymerase H2O up to 39.00 µL DNA 0.5 µg 1.00 µL PCR1 Conditions Time number of cycles 94°C 4 min 1 94°C 1 min 55°C 1 min 20 72°C 1 min 30 sec 72°C 7 min 1 Table 5 continued- Composition of Master Mix for Nested- PCR (PCR2) Nested-PCR Mix Initial concentration Final Preparation for 1 components concentration Reaction (40µL) or quantity Buffer 10X 1X 4.00 µL MgCl2 25 mM 2mM 3.20 µL dNTP Mix 5 mM 200 µM 1.60 µL Forward Primer 100 µM 0.2 µM 0.20 µL Reverse Primer 100 µM 0.2 µM 0.20 µL Taq DNA polymerase 5 U/µL 2 Units 0.20 µL H2O up to 39.00 µL DNA (Product PCR1) 1.00 µL Nested PCR Time Conditions number of cycles 94°C 4 min 1 94°C 1 min 60°C 1 min 35 72°C 1 min 30 sec 72°C 7 min 1 227 Master Mix components and PCR conditions are shown in table N°5. Then, 8 µL of amplified Nested PCR product were run on a 1.5 % agarose gel electrophoresis in 1X TAE stained with ethidium bromide and visualized under UV light (cf Mat and Met II.3.3). 3.3. Digestion of DNA with Restriction Enzymes The restriction enzymes recognize and cut the DNA on specific sequences. Hpa II and Msp I are methylation sensitive restriction enzymes that recognize CCGG sequence. Msp I does not cut if C1 is methylated while Hpa II does not cut if C1 or C2 is methylated in the CCGG sequence. Mbo I and Sau 3I recognize CGATC sequence. Mbo I is methylation insensitive and cut CGATC sequence if DNA is methylated or not. Sau 3I is methylation sensitive and does not cut the CGATC sequence if C is methylated. For Southern-blotting, 15 µg of DNA extracted from flower buds and leaves of stol-C and stol-PO infected tomato were digested with 5 units of MspI or Hpa II restriction enzymes in a 100 µL final reaction for 4 hours or overnight. After precipitation, digested DNA was resuspended in 15 µL H2O. For MSRE- PCR, 1 µg of DNA was digested with 2x5 unis of Mbo I and Sau 3AI in a 100 µL final volume, following the manufacturers instructions. After precipitation, digested DNA was resuspended in 10 µL H2O. 4. Southern-blot 4.1. Gel Electrophoresis and DNA transfer Agarose gel (1.4%) were prepared in 1X TAE buffer (40 mM Tris-acetate, 1 mM EDTA) and 15µL of digested DNA were loaded along with 2 µl of blue loading dye on to the gel for migration at 75 V for 2 hours in 1X TAE buffer. After migration, gel was stained in ethidium bromide bath (2µg/mL) for 1 min and visualized under UV light. DNA was transferred from gel onto Hybond-XL membrane (Amersham) with Vacuum Blotter (Appligene) using 0.4 M NaOH at 40 mbar for 40 minutes After DNA migration, the membrane was dipped into 2X SSC and conserved at 4°C. Gel was stained again in ethidium bromide and visualized under UV for verification of complete DNA transfer. 228 Table 6- Composition of 20X SSC Final concentration Quantity SSC 20X 5X 125 mL N-laurylsarcosine 0,10% 0,5 g SDS 20% 0,02% 1 mL Formamide 50% 250 mL Blocking Reagent (Roche) 1,50% 7,5 g H2O up to 500 mL Table 7- Composition of Hybridization buffer final concentration quantity NaCl 3 M 350,60 g Sodium Citrate 0,3 M 176,1 g H O up to 2 L 2 229 4.2. Southern Blot Hybridization and revelation Pre-hybridization and hybridization were performed at 42°C following standard protocols (Sambrook et al., 1989) with probes corresponding to the tomato 5S rDNA. Briefly, the extra pores of membrane were blocked in pre-hybridization by incubating the membrane at 42°C for 2 h in the presence of 10 ml of hybridization buffer (Table 6) containing 500 µg of denatured Salmon fish sperm DNA. After pre-hybridization, the pre-hybridization mixture was poured out and other 10 mL of hybridization buffer containing 5 µL DIG labeled probe and 500 µg of denatured Salmon fish sperm DNA were added and incubated overnight at 42°C. The unnecessary probes were removed by washing the membrane for 30 min at room temperature with 2X SSC/0.5% SDS then with 1X SSC/0.1% SDS (Table 7). For the revelation of the signal, the membrane was dipped in solution1 (Tris 100 mM pH 7.5, NaCl 150 mM) and solution 2 (1% blocking reagent in solution 1) to block the proteins by incubating at room temperature for 30 min. The detection was done with 1 µL of 1/10 000 diluted anti-DIG antibody contained in 10 ml of solution2 by incubating at room temperature for 30 min on agitator. The washings were done by incubating 2 times 15 min in solution1. For revelation, the membrane was incubated in oven at 37°C for 5 min after spreading 5 µL of a solution containing solution3 (Tris 100 mM pH 9.5, 100 mM NaCl) containing 1/100 diluted CDP-star (Roche) (Table 8). After 5 min, membrane was taken out and briefly dipped into water. Finally, membrane was placed in a plastic cover, and exposed to Kodak- film. 230 Table 8- SLDEF methylation specific primers used in bisulfite experiments number Name of cycles primers sequences cycles 94°C/45sec- 52°C/45sec- 72 PCR 1 30 °C/50 sec F20 5: F:TAGTTAATTAGAGAGTATTTG-3’ R22 R: 5’-ATCTTAAATACTCAAACCCTA -3 Nested 94°C/45sec- 52°C/45sec- 72 PCR 1 30 °C/50 sec F21 F: 5’-AAGTTACGATGTAGATTATA R23 R: 5’-TTATCCCTACCATCACAAC-3’ 95°C/5min - 94°C/1min- PCR 2 35 50°C/45sec- 72 °C/1min EF F: 5-AAGTTTAGTTTAGTGTAATG -3’ ER R: 5’-TTCACATCCTTTCTTCCT -3’ Nested 95°C/5min - 94°C/45sec- PCR 2 35 52°C/45sec- 72 °C/50 sec IF2 F: 5’-ATAATTATAATAAGTGATAATT-3’ IR3 R: 5’-TTAATTAAATAAAATTCCTAAT-3’ 5. Bisulfite Treatment Bisulphite treatment converts C (cytosine) to T (Thymine) or U (Uracil) except if C is methylated. This technique is used to determine the individual methylation status of each base in DNA. Bisulphite treatment of DNA extracted from flower buds of healthy and stolbur-PO tomato was done using Epitec Bisulphite Kit (Qiagen) following the manufacturer recommendation protocol. For each sample, 1 µL aliquot of the total bisulphite-treated material was used for PCR1 reaction followed by a second PCR. The amplified products were cloned and sequenced with the same primers used for PCR. The experiment was repeated 2 times. Sequences of primers pairs and their PCR conditions are shown in table 8. 6. Cloning of PCR products PCR products were cloned in the pGEM-T EASY (Promega) plasmid following the manufacturer recommendations. Electroporation of bacteria was done using a Bio-Rad Gene Pulser II. Bacteria were prepared for electroporation to maximize the transformation efficiency for different bacterial species. 231 Suspension of competent E.Coli -DH10B cells (40 µL) and 2 µL of Ligation mixture were transferred to 2 mm path-length cuvette. The parameters of electroporation were as follows: 200 Ohms, 25 µFarad, 2.5 kV. Then, 1 mL of sterile LB medium was added to the cuvette (10% tryptone, 5% yeast extract, 10% NaCl). Bacteria were incubated for 45 min at 37°C at 120 rpm under Orbital agitation. On solid LB-agar plate (LB and 15% agar), 40 µl of each IPTG and XGAL (23:1) were applied and 100 to 200µL incubation Suspension were spread evenly onto LB-agar plate containing 50 mg/ml ampiciline and incubated at 37 °C in oven overnight. Colonies of bacteria were cultured into a tube containing 3 mL (LB + ampicilline) at 37°C at 120 rpm overnight. Isolation and purification of plasmid was done by using miniprep (Promega kit) following the manufacturer recommendations. Five µL of the extracted plasmid DNA were digested with Eco R1 enzyme in the presence of Eco R1 buffer and incubated at 37 °C for 30 minutes. The analyses on 1% agarose gel allow the verification of the insert size. Thus, plasmids were sent for sequencing. 7. Methylation Specific Restriction Enzymes PCR (MSRE-PCR) Methylation specific restriction enzymes were used to determine the site specific methylation status of genes. Mbo I and Sau 3I are two restriction enzymes which recognize CGATC sequence in DNA. Mbo I is methylation insensitive and Sau 3I is methylation sensitive. PCR was done with primers Fme2 as forward and Rme2 as reverse, situated on each side of the restriction site on SlDEF gene. PCR amplicons were analyzed on 2 % agarose gel. The obtention of a signal indicate that Sau 3AI did not cut, meaning that the C was methylated at this position. One µL of DNA digestion was performed with 2 times 5 units of Mbo I or 2 times 5 units of Sau 3AI at 37°C for 2 times 4 hours in final volume of 100 µL. Control samples were treated in the same way but with 10 units of inactivated enzyme (Pre incubation at 65°C for 20min). 232 Methylation specific PCR was performed using digested DNA samples and primers Fme2 and Rme2 designed in Sl DEF gene, near the 5’ UTR-end and containing one CGATC site. Taq DNA polymerase was from Promega and used at 2 units per reaction. Programme for PCR was (30 cycles: 94°C, 45 s; Tm 56°C, 45 s; 72°C, 45 s). Finally, 8 µL of PCR product were loaded onto 2% agarose gel electrophoresis in 1X TAE and visualized after ethidium bromide staining (cf Mat Met II.3.3). 233 (Annex) Additional documents 234 Chapter II-Results- Annex-Figures Healthy Stol-C Stol-PO EFI alpha 17,8 17,7 17,6 17,5 Relative nuber of threshold cycles (Ct) 17,4 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves Figure 1A: Relative expression of control gene EF1 alpha (Ct) through real time RT PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato (n=3) 1mm 3 mm 5 mm flower buds Leaves H C PO H C PO H C PO H C PO EF1 alpha EF1 alpha 40000 30000 20000 expression 10000 Relative geneRelative 0 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves Figure 1B: Expression of EF1 in leaves through semi-quantitative RT-PCR in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). 235 Healthy Stol-C Stol-PO CHS2 10 8 6 4 2 Relative fold Relative expression 0 1mm Flow er bud 3mm Flow er bud 5mm Flow er bud Leaves Figure 2A: Relative expression of Chalcone synthase 2 (CHS2) through real time RT-PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation (n=3) Healthy Stol-C Stol-PO PR10 16 14 12 10 8 6 4 2 Relative foldRelative expression 0 1mm Flow er bud 3mm Flow er bud 5mm Flow er bud Leaves Figure 3A: Relative expression of pathogenesis related protein PR10 (PR10) through real time RT-PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation (n=3) 236 H C PO PR10 EF1 alpha Figure 3B: Expression of PR10 in stolbur infected leaves through semi-quantitative RT-PCR in leaves of Healthy (H) stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. Healthy Stol-C Stol-PO LoxD 2,5 2 1,5 1 0,5 Relative fold Relative expression 0 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves Figure 4A: Relative expression of Lipoxygenase D (LoxD) through real time RT- PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation (n=3) 237 H C PO LoxD EF1 alpha Figure 4B-Expression of Lypoxigenase D (LoxD) in stolbur C (C) and stolbur PO (PO) phytoplasma infected leaves through semi-quantitative RT- PCR. EF1 used as control gene. H C PO BGL2 basic PR2 GluB EF1 alpha Figure 5B: Expression of basic pathogenesis related proteins 2 (BGL2 upper, basic PR2, GluB) through semi-quantitative RT-PCR in leaves of Healthy (H) stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. 238 Healthy Stol-C Stol-PO TSR 6 5 4 3 2 1 Relative fold Relative expression 0 1mm Flow er bud 3mm Flower bud 5mm Flower bud Leaves Figure 6A: Relative expression of Ethylene responsive transcription factor (TSR) through real time RT-PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma- infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation (n=3) H C PO TSR EF1 alpha Figure 6B: Expression of TSR (Ethylene responsive factor) through semi-quantitative RT-PCR in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. 239 Figure 7A: Histogram showing relative gene expression of Pti4 in flower buds and leaves Healthy Stol-C Stol-PO Pti4 7 6 5 4 3 2 1 fold Relative expression 0 1mm Flow er bud 3mm Flower bud 5mm Flower bud Leaves Figure 7A: Relative expression of Ethylene responsive transcription factor (Pti4) through real time RT-PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation (n=3) H C PO Pti4 EF1 alpha Figure 7B: Expression of Pti4 (Ethylene responsive factor) through semi- quantitative RT-PCR in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. 240 1mm flowerbuds 3mm flowerbuds 5mm flowerbuds H C PO H C PO H C PO PR4 EF1 alpha Figure 8A: Relative expression of pathogenesis related protein PR4 through semi- quantitative RT-PCR in 1mm, 3mm, 5mm flower buds of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Healthy tomato (H), stolbur C- infected tomato (C), stolbur PO-infected tomato (PO). The constitutively expressed Elongation factor 1 (EF1alpha) as control gene. H C PO PR4 EF1 alpha Figure 8B: Relative expression of pathogenesis related protein PR4 through semi-quantitative RT-PCR in leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Healthy tomato (H), stolbur C-infected tomato (C), stolbur PO-infected tomato (PO). The constitutively expressed Elongation factor 1 (EF1alpha) as control gene. 241 Healthy Stol-C Stol-PO PR7 (69B) 16 14 12 10 8 6 4 2 fold Relative expression 0 1mm Flower bud 3mm Flow er bud 5mm Flow er bud Leaves Figure 9A: Relative expression of pathogenesis related protein PR7 (69B) through real time RT-PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma- infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation . H C PO PR7 (69B) EF1 alpha Figure 9B: Expression of PR7 (69B) through real time RT-PCR in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. 242 Healthy Stol-C Stol-PO PR7 (69A) 2,5 2 1,5 1 0,5 0 Relative fold Relative expression 1mm Flower bud 3mm Flower bud 5mm Flower bud Leaves Figure 10A: Relative expression of pathogenesis related protein PR7 (69A) through real time RT-PCR in 1mm, 3mm, 5mm flower buds and leaves of stolbur C and stolbur PO phytoplasma-infected tomato (from left to right). Green bar for healthy control tomato, light yellow bar for stolbur C phytoplasma-infected tomato, light pink bar for stolbur PO phytoplasma-infected tomato. Expression was normalized by Elongation factor 1 (EF1alpha) as control gene. Gene repression <1 < Gene activation Figure 10B. Expression of PR7 (69B) in stolbur infected Leaves H C PO PR7 (69A) EF1 alpha Figure 10B: Expression of PR7 (69A) through semi-quantitative RT-PCR in leaves of Healthy (H), stolbur C (C) and stolbur PO (PO) phytoplasma-infected tomato (from left to right). Elongation factors 1 (EF1alpha) as control gene. 243 References 244 References Abdeen A, Virgós A, Olivella E, Villanueva J, Avilés X, Gabarra R and Prat S 2005 Multiple insect resistance in transgenic tomato plants over-expressing two families of plant proteinase inhibitors. Plant Molecular Biology 57, 189-202. Abeles F B, Morgan P W and Saltveit J M E 1992 Ethylene in plant biology. 2nd edn. San Diego: Academic Press. Abramovitch R B, Anderson J C and Martin G B 2006 Bacterial elicitation and evasion of plant innate immunity. Nat Rev Mol Cell Biol 7, 601-611. Abramovitch R B and Martin G B 2005 AvrPtoB: a bacterial type III effector that both elicits and suppresses programmed cell death associated with plant immunity. FEMS Microbiol. Lett. 245, 1–8. AbuQamar S, Chai M-F, Luo H, Song F and Mengiste T 2008 Tomato Protein Kinase 1b Mediates Signaling of Plant Responses to Necrotrophic Fungi and Insect Herbivory. The Plant Cell Online 20, 1964- 1983. Achuo E A, K. Audenaert, H. Meziane and M. Höfte, 2004. The salicylic acid-dependent defence pathway is effectiveagainst different pathogens in tomato and tobacco. Plant Pathology, 53, 65–72. Agrios, G N 1997 Plant diseases caused by Mollicutes: phytoplasmas and spiroplasmas. In Plant Pathology, 4th, pp. 457-470. Edited by G. N. Agrios. New York: Academic Press. Agrios G N 2005 Plant pathology. 5th Ed. San Diego, Academic Press. Agius F, Kapoor A and Zhu J K 2006 Role of the Arabidopsis DNA glycosylase/lyase ROS1 in active DNA demethylation. Proc. Natl. Acad. Sci. USA 103, 11796–11801. Agrawal G K, Jwa N S, and Rakwal R 2000 A novel rice ( Oryza sativa L.) acidic PR1 gene highly responsive to cut, phytohormones, and protein phosphatase inhibitors. Biochem. Biophys. Res. Commun. 274:157-165. Aguilar-Martinez J A, Poza-Carrion C and Cubas P 2007 Arabidopsis BRANCHED1 acts as an integrator of branching signals within axillary buds. Plant Cell 19, 458–472. Ahrens U and Seemüller E 1992 Detection of DNA of plant pathogenic mycoplasma-like organisms by a polymerase chain reaction that amplifies a sequence of the 16S RNA gene. Phytopathol 82, 828-832. 245 Aimé S, Cordier C, Alabouvette C and Olivain C 2008 Comparative analysis of PR gene expression in tomato inoculated with virulent Fusarium oxysporum f. sp. lycopersici and the biocontrol strain F. oxysporum Fo47. Physiological and molecular plant pathology 73, 9-15. Alexander L, Grierson D 2002 Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening. Journal of Experimental Botany 53, 2039–2055. Alfano G, Ivey M L L, Cakir C, Bos J I B, Miller S A, Madden L V, Kamoun S and Hoitink H A J 2007 Systemic modulation of gene expression in tomato by Trichoderma hamatum Phytopathology 97, 429-437. Alfano J R, and Collmer A (2004). Type III secretion system effector proteins: Double agents in bacterial disease and plant defense. AnnualReview of Phytopathology 42, 385-414. Alkahtani M, Omer SA, El.Naggar MA, Abdel-Kareem E M. and Mahmoud M A 2011 Pathogenesis-related protein and Phytoalexin Induction against Cucumber Powdery Mildew by Elicitors. International Journal of Plant Pathology 2 (2): 63-71. Altschul S, Madden T, Schaffer A, Zhang J, Zhang Z, Miller W and Lipman D 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389- 3402. Amelio R D, Mazarchi C and Bosco D 2010 Activity of benzothiadiazole on chrysanthemum yellows phytoplasma (‘Candidatus Phytoplasma asteris’) infection in daisy plants. Crop protection 29 (2010) 1094-1099). Amado L, Abranches R, Neves N and Viegas W 1997 Development-dependent inheritance of 5-azacytidine- induced epimutations in triticale: analysis of rDNA expression patterns. Chromosome Research 5, 445-450. Ammar E D and Hogenhout S A 2006 Mollicutes associated with arthropods and plants. In Insect Symbiosis. Eds. K Bourtzis and T A Miller. pp 97–118, Boca Raton, FL: CRC. Andersson U, Levander F and Radstrom P 2001 Trehalose-6-phosphate phosphorylase is part of a novel metabolic pathway for trehalose utilization in Lactococcus lactis. J Biol Chem 276, 42707 - 42713. Andreu A, Tono´n C, Van Damme M, Huarte M, Daleo G 1998 Effect of glucans from different races of Phytophthora infestans on defense reactions in potato tuber. Eur J Plant Pathol 104: 777–783. 246 André A, Maucourt M, Moing A, Rolin D and Renaudin J 2005 Sugar import and phypathogenicity of Spiroplasma citri: glucose and fructose play distinct roles. Mol Plant Microbe Interact 18, 33-42. Anith K N, Momol M T, Kloepper J W, Marois J J, Olson S M and Jones J B 2004 Efficacy of plant growth- promoting rhizobacteria, acibenzolar-s-methyl, and soil amendment for integrated management of bacterial wilt on tomato. Plant Disease 88, 669-673. Antony G, Zhou J, Huang S, Li T and Liu B e a 2011 Rice xa13 recessive resistance to bacterial blight is defeated by induction of the disease susceptibility gene os-11N3. Plant Cell 22. Antoniw JF, White RF (1986) Changes with time in the distribution of virus and PR-protein around single local lesions of TMV infected tobacco. Plant Mo1 Biol 6: 145-149. Antunes A, Rainey F A, Wanner G, Taborda M, Pätzold J, Fernanda Nobre M, Milton S. da Costa and Huber R 2008. "A new lineage of halophilic, wall-less, contractile bacteria from a brine-filled deep of the Red Sea " Journal of Bacteriology 190 (10): 3580–3587. Apold J, Florvaag E, Elsayed S. Comparative studies on tree-pollen allergens: I. Isolation and partial characterization of a major allergen from birch pollen (Betula verrucosa). Int Arch Allergy Appl Immunol 1981;64:439–47. Applebaum S W 1985 Biochemistry of Digestion. Comparative Physiology and Pharmacology of Insects, eds Kerkut GA, Gilbert LI (Pergamon, Toronto), Vol 4, pp 279–311. Arai Y, Watanabe S, Kimira M, Shimoi K, Mochizuki R, Kinae N 2000 Dietary antioxidant flavonols, flavones and isoflavones by Japanese women and the inverse correlation between quercetin intake and plasma LDL cholesterol concentration. J. Nutr. 130: 2243-2250. Arashida R, Kakizawa S, Ishii Y, Hoshi A, Jung H Y, Kagiwada S, Yamaji Y, Oshima K and Namba S 2008 Cloning and characterization of the antigenic membrane protein (Amp) gene and in situ detection of Amp from malformed flowers infected with japanese hydrangea phyllody phytoplasma. Phytopathology 98, 769-775. Aravin A A and Bourchis D 2008 Small RNA guides for de novo DNA methylation in mammalian germ cells. Genes Dev. 22, 970-975. Arimura G, Kost C and Boland W 2005 Herbivore-induced, indirect plant defences. Biochim. Biophys. Acta 1734: 91-111. 247 Asai T, Tena G, Plotnikova J, Willmann M R, Chiu W-L, Gomez-Gomez L, Boller T, Ausubel F M and Sheen J 2002 MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983. Atkinson A H, Heath R L, Simpson R J, Clarke A E, Anderson M A 1993 Proteinase inhibitors in Nicotiana alata stigmas are derived from a precursor protein which is processed into five homologous inhibitors. Plant Cell 5:203–213. Avrova A O, Taleb N, Rokka V, Heilbronn J, Campbell E, Hein I, Gilroy E M, Cardle L, Bradshaw J E and Stewart H E 2004 Potato oxysterol binding protein and cathepsin B are rapidly up-regulated in independent defence pathways that distinguish R gene-mediated and field resistances to Phytophthora infestans. Mol Plant Pathol 5, 45–46. B Bai X, Correa V R, Toruño T Y, Ammar E-D, Kamoun S and Hogenhout S A 2008 AY-WB phytoplasma secretes a protein that targets plant cell nuclei. Molecular Plant-Microbe Interactions 22, 18-30. Bai X, Zhang J, Ewing A, Miller S, Radek A, Shevchenko D, Tsukerman K, Walunas T, Lapidus A, Campbell J and Hogenhout S 2006 Living with genome instability: the adaptation of phytoplasmas to diverse environments of their insect and plant hosts. J Bacteriol 188, 3682 - 3696. Baider A and Cohen Y 2003 Synergistic interaction between BABA and mancozeb in controlling Phytophthora infestans in potato and tomato and Pseudoperonospora cubensis in cucumber. Phytoparasitica 31, 399-409. Bakker P A H M, Pieterse C M J and van Loon L C 2007 Induced Systemic Resistance by Fluorescent Pseudomonas spp. Phytopathology 97, 239-243. Balganesh T S, Reiners L, Lauster R, Noyer-Weidner M, Wilke K and Trautner T A 1987 Construction and use of chimeric SPR/f3T DNA methyltransferases in the definition of sequence recognizing enzyme regions. EMBO J 6, 3543–3549. Banttari E E and Zeyea R J 2003 Interaction of mycoplasma like organisms and viruses in dually infected leafhoppers, planthoppers and plants. Leafhoppers vectors and Plant diseases agents. 327 – 347. 248 Bao K and Cohen S 2003 Recruitment of terminal protein to the ends of Streptomyces linear plasmids and chromosomes by a novel telomere-binding protein essential for linear DNA replication. Genes Dev 17, 774 - 785. Bao K and Cohen S 2004 Reverse transcriptase activity innate to DNA polymerase I and DNA topoisomerase I proteins of Streptomyces telomere complex. Proc Natl Acad Sci USA 101, 14361 - 14366. Baulcombe D 2004 RNA silencing in plants. Nature 431, 356-363. Baulcombe D C, Chapman S and Cruz S S 1995 Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 7, 1045–1053. Beanland L, Hoy C W, Miller S A and Nault L R 2000 Influence of aster yellows phytoplasma on the fitness of aster leafhopper (Homoptera:Cicadellidae). Ann. Entomol. Soc. Am 93, 271–276. Beaubois E, Girard S, Lallechere S, Davies E, Paladian F, Bonnet P, Ledoigt G and Vian A 2007 Intercellular communication in plants: Evidence for two rapidly transmitted systemic signals generated in response to electromagnetic field stimulation in tomato. Plant Cell Environ. 30, 834- 844. Beckers G J M and Spoel S H 2006 Fine-tuning plant defence signalling: Salicylate versus Jasmonate. Plant Biology 8, 1-10. Bell E and Mullet J E 1993 Characterization of an Arabidopsis lipoxygenase gene responsive to methyl jasmonate and wounding. Plant Physiol. 103, 1133-1137. Bell E, Creelman R A and Mullet J E 1995 A chloroplast lipoxygenase is required for wound-induced jasmonic acid accumulation in Arabidopsis. Proc. Natl. Acad. Sci. USA 92, 8675-8679. Bender J 2004 DNA methylation and epigenetics. Annu. Rev. Plant Biol. 55, 41-68. Bendjennat M, Blanchard A, Loutfi M, Montagnier L and Bahraoui E 1999 Role of Mycoplasma penetrans endonuclease P40 as a potential pathogenic determinant. Infect Immun 67, 4456 - 4462. Benhamou N and Belanger R 1998 Induction of systemic resistance to Pythium damping-off in cucumber plants by benzothiadiazole: ultrastructure and cytochemistry of the host response. Plant J 14, 13 - 21. 249 Benhamou N, Joosten M H and De Wit P J 1990 Subcellular Localization of Chitinase and of Its Potential Substrate in Tomato Root Tissues Infected by Fusarium oxysporum f. sp. radicis-lycopersici. Plant Physiol. 92, 1108-1120. Bent E 2005 Induced systemic resistance mediated by plant growth-promoting rhizobacteria (PGPR) and fungi (PGPF). In Multigenic and induced systemic Resistance in Plants , edited by S. Tuzun and E. Bent: Springer, NY. Bennetzen J L 1996 The contributions of retroelements to plant genome organization, function and evolution. Trends in Microbiology 4, 347-353. Bennetzen J L, Brown W E and Springer P S 1988 The state of DNA modification within and flanking maize transposable elements. In: O. Nelson (Ed.) Plant Transposable Elements, Plenum, New York, pp. 237–250. Benhamou N, Joosten M H and De Wit P J 1990 Subcellular Localization of Chitinase and of Its Potential Substrate in Tomato Root Tissues Infected by Fusarium oxysporum f. sp. radicis-lycopersici . Plant Physiol. , 92, 1108-1120. Bent A F, Innes R W, Ecker J R and Staskawicz B J 1992 Disease development in ethylene-insensitive Arabidopsis thaliana infected with virulent and avirulent Pseudomonas and Xanthamonas pathogens. Molecular Plant Microbe Interactions 5, 372-378. Bent A F and Mackey D 2007 Elicitors, effectors, and R genes: the new paradigm and a lifetime supply of questions. Annu. Rev. Phytopathol 45, 399–436. Bentley S, Chater K, Cerdeno-Tarraga A, Challis G, Thomson N, James K, Harris D, Quail M, Kieser H, Harper D, Bateman A, Brown S, Chandra G, Chen C, Collins M, Cronin A, Fraser A, Goble A, Hidalgo J, Hornsby T, Howarth S, Huang C, Kieser T, Larke L, Murphy L, Oliver K, O'Neil S, Rabbinowitsch E, Rajandream M, Rutherford K, Rutter S, Seeger K, Saunders D, Sharp S, Squares R, Squares S, Taylor K, Warren T, Wietzorrek A, Woodward J, Barrell B, Parkhill J and Hopwood D 2002 Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417, 141 - 147. Bernacchia G, Primo A, Giorgetti L, Pitto L and Cella R 1998 Carrot DNA-methyltransferase is encoded by two classes of genes with differing patterns of expression. The Plant Journal 13, 317-329. 250 Bertaccini A., Marani F. 1982. Electron microscopy of two viruses and mycoplasma-like organisms in lilies with deformed flowers. Phytopathologia mediterranea, 21: 8-14. Bertaccini A., Davis R.E., Lee I.-M., Conti M., Dally E.L., Douglas S.M. 1990a. Detection of Chrysanthemum yellows mycoplasmalike organism (MLO) by dot-hybridization and Southern blot analysis. Plant Disease, 74: 40-43. Bertaccini A., Davis R E, Lee I.-M. 1990b Distinctions among mycoplasmalike organisms (MLOs) in Gladiolus , Ranunculus , Brassica and Hydrangea through detection with nonradioactive cloned DNA probes. Phytopathologia mediterranea, 29: 107-113. Bertaccini A, Davis R E, Hammond R W, Bellardi M G, Vibio M, Lee I.-M. 1992a. Sensitive detection of mycoplasmalike organisms in field collected and in vitro propagated plants of Brassica, Hydrangea and Chrysanthemum by polimerase chain reaction. Annals of applied Biology, 121: 593-599. Bertaccini A, Davis R E, Lee I.-M 1992b In vitro micropropagation for maintenance of mycoplasmalike organisms in infected plant tissues. Horticultural Science, 27(9): 1041- 1043. Bertaccini A, Arzone A, Alma A, Bosco D, Vibio M 1993 Detection of mycoplasmalike organisms in Scaphoideus titanus Ball reared on Flavescence dorée infected grapevine by dot hybridizations using DNA probes. Phytopathologia mediterranea, 32: 20-24. Bertaccini A., Vibio M., Stefani E 1995. Detection and molecular characterization of phytoplasmas infecting grapevine in Liguria (Italy). Phytopathologia Mediterranea, 34: 137-141. Bertaccini A, Bellardi M G, Vibio M. 1996 Virus diseases of ornamental shrubs. X. Euphorbia pulcherrima Willd. Infected by viruses and phytoplasmas. Phytopathologia mediterranea, 35: 129- 132. Bertaccini A, Vibio M, Schaff D A, Murari E, Martini M, Danielli A 1997 Geographica distribution of elm yellows-related phytoplasmas in grapevine Flavescence dorée outbreaks in Veneto (Italy). 12th ICVG Meeting, Lisbon, 28 Sept./2 Oct.: 57-58. Bertaccini A, Franova J, Paltrinieri S, Martini M, Navratil M, Lugaresi C, Nabesarova J, Simkova M. 1999 Leek proliferation: a new phytoplasma disease in the Czech Republic and in Italy. European Journal of Plant Pathology, 105: 487-493. 251 Bertaccini A., Botti S., Martini M., Colla R., Mazzali G., Mazio P., Pozza M., Meglioraldi S., Vingione M. 2001. La Flavescenza dorata in Emilia: caratterizzazione molecolare del ceppo in fase di diffusione. L’Informatore Agrario, 47: 97-100. Bertaccini A, Botti S, Fiore N, Gayardo A, Montealegre J 2004 Identification of new phytoplasma (s) infections in grapewine with yellows in Chile. 15th Congress of International organization of Mycoplasmology, July 11-16, Athens Georgia, USA, 37: 63- 64. Bertaccini A, Paltrinieri S, Botti S, Duduk B, Fiore N, Kolber M, Škori ć D, Torres E, Conti M. 2006. Diversity of 16SrXII phytoplasmas detected in grapevine growing areas Bertaccini A 2007 Phytoplasmas: Diversity, taxonomy, and epidemiology. Front Biosci 12, 673–689. Bertaccini A and Duduk B 2009 Phytoplasma and phytoplasma diseases: a review of recent research. Phytopathologia mediterr 48, 355-378. Bestor T, Laudano A, Mattaliano R and Ingram V 1988 Cloning and sequencing of a cDNA encoding DNA methyltransferase of mouse cells: The carboxyl-terminal domain of the mammalian enzymes is related to bacterial restriction methyltransferases. Journal of Molecular Biology 203, 971-983. Bestor T H 1992 Activation of mammalian DNA methyltransferase by cleavage of a Zn binding regulatory domain. EMBO J. 11: 2611–2617. Bestor T H 2000 The DNA methyltransferases of mammals. Human Molecular Genetics 9, 2395-2402. Bhattacharyya A, Stilwagen S, Ivanova N, D'Souza M, Bernal A, Lykidis A, Kapatral V, Anderson I, Larsen N, Los T, Reznik G, Selkov E, Walunas T, Feil H, Feil W, Purcell A, Lassez J, Hawkins T, Haselkorn R, Overbeek R, Predki P and Kyrpides N 2002 Whole-genome comparative analysis of three phytopathogenic Xylella fastidiosa strains. Proc Natl Acad Sci USA 99, 12403 - 12408. Bhattaria K K, Hagop S A, Kaloshian I, and Eulgem, T. 2010. WRKY72-type transcription factors contribute to basal immunity in tomato and Arabidopsis as well as gene-for-gene resistance mediated by the tomato R gene Mi-1 Plant J. Published Online: 19 Apr 2010. Bird A P 1978 Use of restriction enzymes to study eukaryotic DNA methylation: II. The symmetry of methylated sites supports semi-conservative copying of the methylation pattern. Journal of Molecular Biology 118, 49-60. Bird A P 2002 DNA methylation patterns and epigenetic memory. Genes Dev 16, 6–21. 252 Blattny C, Brˇcák, J, Pozdˇena J, Limberk J and BojˇnanskyV 1954 The transmission of stolbur virus in tobacco and tomatoand its virogeographical relationships. Phytopathol. Z. 22 :381–416. in German. Blazquez M A, Green R, Nilsson O, Sussman M R and Weigel D 1998 Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter. Plant cell 10, 791-800. Blazquez M A and Weigel D 2003 A thermosensory pathway controlling flowering time in Arabidopsis thaliana. Nature Genetics 33, 168-171. Block A, LiG F Z and Alfano J R 2008 Phytopathogen type III effector weaponry and their plant targets. Curr. Opin. Plant Biol 11, 396–403. Block A, Schmelz E, O'Donnell P J, Jones J B and Klee H J 2005 Systemic acquired tolerance to virulent bacterial pathogens in tomato. Plant Physiology 138, 1481-1490. Bloemberg, G.V. and Lugtenberg, B.J.J. (2001). Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Curr. Opin. Plant Biol . 4(4):343-350. Boland M J and Christman J K 2008 Characterization of Dnmt3b:thymine-DNA glycosylase interaction and stimulation of thymine glycosylase-mediated repair by DNA methyltransferase(s) and RNA. J. Mol. Biological Control 379, 492–504. Bonnet F, Saillard C, Kollar A, Seemuller E and Bove J M 1990 Detection and differentiation of the mycoplasmalike organism associated with apple proliferation disease using cloned DNA probes. Molecular Plant Microbe Interactions 3, 438-443. Bolton M D 2009 Primary metabolism and plant defense - fuel for the fire. Molecular Plant-Microbe Interactions 22(5), 487-497. Bos J I, Prince D, Pitino M, Maffei M E, Win J and Hogenhout S A 2010 A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (green peach aphid). PLoS Genet 6:e1001216. Bostock R M 2005 Signal Crosstalk and Induced Resistance: Straddling the Line Between Cost and Benefit. Annual Review of Phytopathology 43, 545-580. Botella, M. A., Quesada, M. A., Medina, M. I., Pliego, F. and Valpuesta, V. (1994). Induction of a tomato peroxidase gene in vascular tissue. FEBS Lett. , 347, 195-198. 253 Bouarab K, Melton R, Peart J, Baulcombe D and Osbourn A 2002 A saponin-detoxifying enzyme mediates suppression of plant defences. Nature 418, 889-892. Bové J M, Carle P, Garnier M, Laigret F, Renaudin J and Saillard C 1989 Molecular and celluar biology of spiroplasma. In The Mycoplasma. Eds. R F Whitcomb and J G Tully. Academic Press, New York. Bové J M, Renaudin J, Saillard C, Foissac X and Garnier M 2003 piroplasma citri, a plant pathogenic mollicute: relationships with its two hosts, the plant and the leafhopper vector. Annu. Rev. Phytopathol. 41, 483–500. Bové J M 1988 Spiroplasma citri . In: European handbook of plant diseases (Ed. by Smith IM, Dunez J, Lelliott R A, Phillips D H, Archer S A), pp. 129-131. Blackwell Scientific Publications, Oxford, UK. Bovie C, Ongena M, Thonart P and Dommes J 2004 Cloning and expression analysis of cDNAs corresponding to genes activated in cucumber showing systemic acquired resistance after BTH treatment. BMC Plant Biology 4, 15. Baulcombe D 2004 RNA silencing in plants. Nature 431:356–63 Bowles D 1998 Signal transduction in the wound response of tomato plants. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 353, 1495-1510. Bowman J L, Smyth D R and Meyerowitz E M 1991 Genetic interactions among floral homeotic genes of Arabidopsis. Development 112, 1-20. Bouchard J, and Momparler R L 1983 Incorporation of 5-Aza-2'- deoxycytidine-5'-triphosphate into DNA. Interactions with mammalian DNA polymerase alpha and DNA methylase. Mol Pharmacol 24 , 109-114. Branch C, Hwang C F, Navarre D A and Williamson V M 2004 Salicylic acid is part of the Mi-1-mediated defense response to root-knot nematode in tomato. Plant Microbe Interactions 17, 351-356. Brand U, Grunewald M, Hobe M and Simon R 2002 Regulation of CLV3 expression by two homeobox genes in Arabidopsis. Plant Physiol. 129, 565–575. 254 Brandstädter J, Roßbach C and Theres K 1996 Expression of genes for a defensin and a proteinase inhibitor in specific areas of the shoot apex and the developing flower in tomato. Molecular and General Genetics MGG 252, 146-154. Breiteneder H, Pettenburger K, Bito A, Valenta R, Kraft D, Rumpold H . The gene coding for the major birch pollen allergen Bet v 1 is highly homologous to a pea disease resistance response gene. EMBO J 1989;8:1935–8. Bressan A, Purcell A H. 2005 Effect of benzothiadiazole on transmission of X disease phytoplasma by the vector Colladonus montanus to Arabidopsis thaliana, a new experimental host plant. Plant Dis 89, 1121-1124. Broadway R M, Duffey S S, Pearce G, and Ryan C 1986 Plant proteinase inhibitors: a defense against the herbivorous insects? Entomol. Exp. Appl. 41:33–38. Brownleader, M. D., Ahmed, N., Trevan, M., Chaplin, M. F. and Dey, P. M. (1995). Purification and Partial Characterization of Tomato Extensin Peroxidase. Plant Physiol. , 109, 1115-1123. Brodersen P and Voinnet O 2006 The diversity of RNA silencing pathways in plants. Trends Genet. 22, 268- 280. Brukhin V, Hernould M, Gonzalez N, Chevalier C and Mouras A 2003 Flower development schedule in tomato, Lycopersicon esculentum cv sweet cherry. Sexual Plant Reproduction 15, 311-320. Buchanan, B. B., Gruissem, W. and Jones, R. L. (2000). Biochemistry and Molecular Biology of Plants . Rockville, MD: Wiley. Burn J E, Bagnall D J, Metzger J D, Dennis E S and Peacock W J 1993 DNA methylation, vernalization, and the initiation of flowering. Proceedings of the National Academy of Sciences 90, 287-291. Byrne D N and Bellows T S 1991 Whitefly biology. Annual Review of Entomology 36, 431-457. C Calavan E C and Bové J M 1989 Ecology of spiroplasma citri In The Mycoplasma. Eds. R F Whitcomb and J G Tully. Academic Press, New York. Cameron R K, Dixon R A and Lamb C J 1994 Biologically induced systemic acquired resistance in Arabidopsis thaliana. The Plant Journal 5, 715-725. 255 Camacho-Henriquez A. and Sänger H L. 1984 Purification and partial characterization of the major "pathogenesis-related" tomato leaf protein P14 from potato spindle tuber viroid (PSTV)-infected tomato leaves. Arch Virol. , 81, 263-284. Cao X, Jacobsen S 2002 Locus-specific control of asymmetric and CpNpG methylation by the DRN and CMT3 methyltransferase genes. Proc Natl Acad Sci USA 4:16491-16498. Cao H, Bowling S, Gordon S and Dong X 1994 Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant cell 6, 1583 - 1592. Chao, W. S., Gu, Y.-Q., Pautot, V., Bray, E. A., and Walling, L. L. 1999. Leucine aminopeptidase mRNAs, proteins and activities increase in response to drought, salinity and the wound signals systemin, methyl jasmonate, and abscisic acid. Plant Physiol. 120:979–992. Carraro L, Ferrini F, Martini M, Ermacora P and Loi N 2008 A serious epidemic of stolbur on celery. Journal of Plant Pathology 90. Carraro L, Osler R, Refatti E and Poggi Pollini C 1988 Transmission of the possible agent of apple proliferation to Vinca rosea by dodder. Riv Patol Vegetale Ser 4 24, 43 - 52. Carrington J C and Ambros V 2003 Role of microRNAs in plant and animal development. Science 301, 336- 338. Casjens S 1999 Evolution of the linear DNA replicons of the Borrelia spirochetes. Curr Opin Microbiol 2, 529 - 534. Casjens S, Murphy M, DeLange M, Sampson L, van Vugt R and Huang W 1997 Telomeres of the linear chromosomes of Lyme disease spirochaetes: nucleotide sequence and possible exchance with linear plasmid telomeres. Mol Microbiol 26, 581 - 596. Cesar R. Rodriguez-Saona & Richard O. Musser, Heiko Vogel & Sue M. Hum-Musser and Jennifer S. Thaler. 2010. Molecular, Biochemical, and Organismal Analyses of Tomato Plants Simultaneously Attacked by Herbivores from Two Feeding Guilds. J Chem Ecol 36:1043–1057. Cettul E and Firrao G 2010 Effects of phytoplasma infection on Arabidopsis thaliana development. Congr. Int. Org. Mycoplasmology, 18th, Cianciano Terme, 48:82. Chaconas G 2005 Hairpin telomeres and genome plasticity in Borrelia: all mixed up in the end. Mol Microbiol 58, 625 - 635. 256 Chaconas G and Chen C 2005 Replication of linear bacterial chromosomes: No longer going around the circle. The Bacterial Chromosome, 525 - 539. Chan S W, Henderson I R and Jacobsen S E 2005 Gardening the genome: DNA methylation in Arabidopsisthaliana. Nature Rev. Genet. 6, 351-360. Chan Y-L, Prasad V, Sanjaya, Chen K H, Liu P C, Chan M-T and Cheng C-P 2005 Transgenic tomato plants expressing Thionin in Arabidopsis driven by fruit-inactive promoter battle against phytopathogenic attack. Planta 221, 386-393. Chang A, Lim M-H, Lee S-W, Robb E J and Nazar R N 2008 Tomato Phenylalanine Ammonia-Lyase Gene Family, Highly Redundant but Strongly Underutilized. Journal of Biological Chemistry 283, 33591- 33601. Chang, J.H., Goel, A.K., Grant, S.R. and Dangl, J.L. (2004). Wake of the flood: ascribing functions to the wave of type III effector proteins of phytopathogenic bacteria. Curr. Opin. Microbiol. 7(1):11-18. Chang P and Cohen S 1994 Bidirectional replication from an internal origin in a linear Streptomyces plasmid. Science 265, 952 - 954. Chakravarthy, S., Tuori, R. P., D'Ascenzo, M. D., Fobert, P. R., Despres, C. and Martin, G. B. (2003). The tomato transcription factor Pti4 regulates defense-related gene expression via GCC box and non- GCC box cis elements. Plant Cell , 15, 3033-3050. Chen G P, Hackett R, Walker D, Taylor A, Lin Z F and Grierson D 2004 Identification of a specific isoform of tomato lipoxygenase (TomloxC) involved in the generation of fatty acid-derived flavor compounds. Plant Physiol . 136(1):2641-2651. Chen Y D, Chen T A 1998 Expression of engineered antibodies in plants: a possible tool for spiroplasma and phytoplasma disease control. Phytopathology, 88: 1367-1371. Chen Z J, Pikaard C S (1997) Epigenetic silencing of RNA polymerase I transcription: a role for DNA methylation and histonemodification in nucleolar dominance. Genes Dev 11:2124–2136 Chen Z, Ricigliano J W and Klessig D F 1993 Purification and characterization of a soluble salicylic acid- binding protein from tobacco. pp 9533-9537. 257 Chen H, Wilkerson C G, Kuchar J A, Phinney B S and Howe G A 2005 Jasmonate-inducible plant enzymes degrade essential amino acids in the herbivore midgut. Proceedings of the National Academy of Sciences of the United States of America 102, 19237-19242. Chen L, MacMillan A M, Chang W, Ezaz-Nikpay K, Lane W S and Verdine G L 1991 Direct identification of the active-site nucleophile in a DNA (cytosine-5)-methyltransferase. Biochemistry 30, 11018- 11025. Chen L Q, Hou B H, Lalonde S, Takanaga H and Hartung M L e a 2010 Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 468, 527–532. Chen F, D'Auria J C, Tholl D, Ross J R, Gershenzon J, Noel J P and Pichersky E 2003 An Arabidopsis thaliana gene for methylsalicylate biosynthesis, identified by a biochemical genomics approach, has a role in defense. The Plant Journal 36, 577-588. Chen P, Lee B and Robb J 2004 Tolerance to a non-host isolate of Verticillium dahliae in tomato. Physiological and Molecular Plant Pathology 64, 283-291. Chen X, Steed A, Harden C and Nicholson P 2006 Characterization of Arabidopsis thaliana–Fusarium graminearum interactions and identification of variation in resistance among ecotypes. Molecular Plant Pathology 7, 391-403. Chen WP, Chen PD, Liu DJ, Kynast R, Friebe B, et al. (1999) Development of wheat scab symptoms is delayed in transgenic wheat plants that constitutively express a rice thaumatin-like protein gene. Theor Appl Genet 99: 755–760. Chisholm S T, Coaker G, Day B and Staskawicz B J 2006 Host-Microbe Interactions: Shaping the Evolution of the Plant Immune Response. Cell 124, 803-814. Choi C-S and Sano H 2007 Abiotic-stress induces demethylation and transcriptional activation of a gene encoding a glycerophosphodiesterase-like protein in tobacco plants. Molecular Genetics and Genomics 277, 589-600. Choi Y, Gehring M, Johnson L, Hannon M, Harada J J, Goldberg R B, Jacobsen S E and Fischer R L 2002 DEMETER, a DNA Glycosylase Domain Protein, Is Required for Endosperm Gene Imprinting and Seed Viability in Arabidopsis. Cell 110, 33-42. 258 Choi Y, Harada J J, Goldberg R B and Fischer R L 2004 An invariant aspartic acid in the DNA glycosylase domain of DEMETER is necessary for transcriptional activation of the imprinted MEDEA gene. Proceedings of the National Academy of Sciences of the United States of America 101, 7481-7486. Christensen N M, Axelsen K B, Nicolaisen M and Schulz A 2005 Phytoplasmas and their interactions with hosts. Trends in Plant Science 10, 526-535. Christensen N M, Nicolaisen M, Hansen M and Schulz A 2004 Distribution of phytoplasma in infected plants as revealed by real-time PCR and bioimaging. Mol Plant Microbe Interact 17, 1175-1184. Castroverde C D M 2010 Defense genes expression in the tomato-verticillium pathogens. A thesis presented to the Faculty of Graduate Studies of The University of Guelph. Chu Y and Lin C 1997 Cloning and characterization of recA gene of phytoplasma associated with peanut witches' broom. Zhi Wu Bing Li Xue Hui Kan 6, 207 - 208. Chuang C F and Meyerowitz E M 2000 Specific and heritable genetic interference by double-strandedRNA in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 97, 4985–4990. Chuang L S-H, Ian H-I, Koh T-W, Ng H-H, Xu G and Li B F L 1997 Human DNA-(Cytosine-5) Methyltransferase-PCNA Complex as a Target for p21WAF1. Science 277, 1996-2000. Cline M 1997 Concepts and terminology of apical dominance. American Journal of Botany 84, 1064. Coen E S and Meyerowitz E M 1991 The war of the whorls: genetic interactions controlling flower development. Nature 353 (6339): 31-37. Cohen A C, Henneberry T J and Chu C C 1996 Geometric relationships between whitefly feeding behavior and vascular bundle arrangements. Entomologia Experimentalis et Applicata 78, 135-142. Campos MA, Ribeiro SG, Rigden DJ, Monte DC, Grossi de Sa MF. 2002. Putative pathogenesis-related genes within Solanum nigrum L. var. americanum genome: isolation of two genes coding for PR5- like proteins, phylogenetic and sequence analysis. Physiological and Molecular Plant Pathology 61: 205–216. Conrath U, Beckers G J M, Flors V, Garcia-Agustin P, Jakab G, Mauch F, Newman M A, Pieterse C M J, Poinssot B, Pozo M J, Pugin A, Schaffrath U, Ton J, Wendehenne D, Zimmerli L and Mauch-Mani B 2006 Priming: Getting ready for battle. Mol. Plant-Microbe Interact. 19, 1062-1071. 259 Constabel C P, Bertrand C. and Brisson N 1993 Transgenic potato plants overexpressing the pathogenesis- related STH-2 gene show unaltered susceptibility to Phytophthora infestans and potato virus X. Plant Mol. Biol. , 22, 775-782. Cooper W R and Goggin F L 2005 Effects of jasmonate-induced defenses in tomato on the potato aphid, Macrosiphum euphorbiae. Entomologia Experimentalis et Applicata 115, 107-115. Coquoz J-L, Buchala A, Me´traux J-P 1998 The biosynthesis of salicylic acid in potato plants. Plant Physiol 117: 1095–1101 Cortina C and Culiáñez-Macià F A 2004 Tomato Transformation and Transgenic Plant Production. Plant Cell, Tissue and Organ Culture 76, 269-275. Cousin M T and Abadie M 1982 Action des mycoplasmes sur l’anthère. Etude en microscopies photonique et électronique. Revue de cytologie et de biologie vegetales - le botaniste 5, 41-57. Cimerman A, Pacifico D, Salar P, Marzachì C and Foissac X 2009 Striking diversity of vmp1, a variable gene encoding a putative membrane protein of the stolbur phytoplasma. Applied and Environmental Microbiology 75, 2951-2957. Creelman R A 1999 Jasmonate perception: characterization of COI1 mutants provides the first clues. Trends Plant Sci. 10, 367-368. Creelman R A and Mullet J E 1995 Jasmonic acid distribution and action in plants: Regulation during development and response to biotic and abiotic stress. Proc. Natl. Acad. Sci. USA 92, 4114-4119. Creelman R A and Mullet J E 1997 Biosynthesis and action of jasmonates in plants. Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 355-381 Creelman R A, Tierney M L. and Mullet J E 1992 Jasmonic acid/methyl jasmonate accumulate in wounded soybean hypocotyls and modulate wound gene expression . Proc. Nati. Acad. Sci. USA 89,4938-4941. Crespi M, Messens E, Caplan A B, van Montagu M and Desomer J 1992 Fasciation induction by the phytopathogen rhodococcus fascians depends upon a linear plasmid encoding a cytokinin synthase gene. EMBO J 11, 795-804. Cubas P, Vincent C and Coen E 1999 An epigenetic mutation responsible for natural variation in floral symmetry. Nature 401, 157-161. 260 Cui J, Bahrami A K, Pringle E G, Hernandez-Guzman G, Bender C L, Pierce N E and Ausubel F M 2005 Pseudomonas syringae manipulates systemic plant defenses against pathogens and herbivores. Proceedings of the National Academy of Sciences of the United States of America 102, 1791-1796. Curkovi ć Perica M 2008 Auxin-treatment induces recovery of phytoplasma-infected periwinkle. Journal of Applied Microbiology 105, 1826-1834. Cutt J R, Klessig D F (1992) Pathogenesis-related proteins. in Genes Involved in Plant Defense. eds BollerT, Meins JrF (Springer-Verlag, Wien, Austria), pp 209–243. Cutt JR, Harpster MH, Dixon DC, Carr JP, Dunsmuir P, Klessig DF (1989) Disease response to tobacco mosaic virus in transgenic tobacco plants that constitutively express the pathogenesisrelated PR-lb gene. Virology 173: 89-97 Cyril Z 2008 Pattern-recognition receptors in plant innate immunity. Current Opinion in Immunology 20, 10-16. D Dalisay R and Kuc J 1995 Persistence of reduced penetration by Colletotrichum lagenarium into cucumber leaves with induced systemic resistance and its relation to enhanced peroxidase and chitinase activities. Physiol Mol Plant Pathol 47, 329 - 338. Danet J L, Foissac X, Zreik L, Salar P, Verdine E, Nourrisseau JG, and Garnier M 2003 “Candidatus Phlomobacter fragariae” is the prevalent agent of marginal chlorosis of strawberry in French production fields and is transmitted by the planthopper Cixius wagneri (China). Phytopathology 93:644–649. Danet J L, Balakishiyeva G, Cimerman A, Sauvion N, Marie-Jeanne V, Labonne G, Lavi ňa A, Batlle A, Križanac I, Škori ć D, Ermacora P, Serçe Ç U, Ça ğlayan K, Jarausch W and Foissac X 2011 Multilocus sequence analysis reveals the genetic diversity of European fruit tree phytoplasmas and supports the existence of inter-species recombination. Microbiology 157, 438-450. Danhash N, Wagemakers C A M, Kan J A L and Wit P J G M 1993 Molecular characterization of four chitinase cDNAs obtained from Cladosporium fulvum infected tomato. Plant Molecular Biology 22, 1017-1029. 261 Datta K, Velazhahan R, Oliva N, Ona I, Mew T 1999 Over-expression of the cloned rice thaumatin-like protein (PR-5) gene in transgenic rice plants enhances environmental friendly resistance to Rhizoctonia solani causing sheath?blight disease. Theor Appl Genet 98: 1138–1145. David McK B 2004 Signaling between nematodes and plants. Current Opinion in Plant Biology 7, 372-376. David P Puthoff, Frances M. Holzer Thomas M. Perring Linda L. Walling, 2010 Tomato Pathogenesis related Protein Genes are Expressed in Response to Trialeurodes vaporariorum and Bemisia tabaci Biotype B Feeding. J Chem Ecol 36:1271–1285. Davidson A and Chen C 2004 ATP-binding cassette transporters in bacteria. Annu Rev Biochem 73, 241 - 268. Davis E L, Hussey R S and Baum T J 2004 Getting to the roots of parasitism by nematodes. Trends in Parasitology 20, 134-141. Dawkins R 1999 The Extended Phenotype: The Long Reach of the Gene. . Oxford, UK: Oxford Univ. Press. Desender S, Andrivon D and Val F 2007 Activation of defence reactions in Solanaceae : where is the specificity? Cell. Microbiol. 9(1):21-30. De Wit P J G M. 2007 Visions & Reflections (Minireview): How plants recognize pathogens defend themselves. Cellular Molecular Life Sciences, 64 :2726-32. De Wit P J G M and Bakker J 1980 Differential changes in soluble leaf proteins after inoculation with virulent and avirulent races of Cladosporium fulvum. Physiol. Plant Pathol., 15, 257-267. De Wit P J G M, Buurlage M B and Hammond K. E 1986 The occurrence of host-, pathogen- and interaction-specific proteins in the apoplast of Cladosporium fulvum (syn. Fulvia fulva) infected tomato leaves. Physiol. Mol. Plant Pathol., 29, 159-172. De Vos M and Jander G 2009 Myzus persicae (green peach aphid) salivary components induce defence responses in Arabidopsis thaliana. Plant, Cell & Environment 32, 1548-1560. De Vos M, Van Oosten V, Van Poecke R, Van Pelt J, Pozo M, Mueller M, Buchala A, Metraux J-P, Van Loon L and Dicke M 2005 Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol Plant Microbe Interact 18, 923–937. 262 De Vos M, Van Zaanen W, Koornneef A, Korzelius J P, Dicke M, Van Loon L C and Pieterse C M J 2006 Herbivore-Induced Resistance against Microbial Pathogens in Arabidopsis. Plant Physiology 142, 352-363. De Wit P J G M 1997 Pathogen avirulence and plant resistance: a key role for recognition. Trends in Plant Science 2, 452-458. De Wit P J G M and Bakker J 1980 Differential changes in soluble tomato leaf proteins after inoculation with virulent and avirulent races of Cladosporium fulvum (syn. Fulvia fulva). Physiological Plant Pathology 17, 121-130. Delaney T, Friedrich L and Ryals J 1995 Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc Natl Acad Sci U S A 92, 6602 - 6606. Delaney T P, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gut-Rella M, Kessmann H, Ward E and Ryals J 1994 A Central Role of Salicylic Acid in Plant Disease Resistance. Science 266, 1247-1250. Delcher A, Harmon D, Kasif S, White O and Salzberg S 1999 Improved microbial gene identification with GLIMMER. Nucleic Acids Res 27, 4636 - 4641. Delker C, Stenzel I, Hause B, Miersch O, 2006 Jasmonate biosynthesis in Arabidopsis thaliana - enzymes, products, regulation. Plant Biol. 8: 297-306. Dempsey D M A, Shah J and Klessig D F 1999 Salicylic acid and disease resistance in plants. Critical Reviews in Plant Sciences 18, 547-575. Demole E, Lederer E and Mercier O 1962 Isolement et détermination de la structure du jasmonate de méthyle, constituant odorant caractéristique de l’essencede jasmin. Helv. Chim. Acta 45: 675-685. Deneke J, Burgin A, Wilson S and Chaconas G 2004 Catalytic residues of the telomere resolvase ResT. J Biol Chem 279, 53699 - 53706. Deneke J, Ziegelin G, Lurz R and Lanka E 2000 The protelomerase of temperate Escherichia coli phage N15 has cleaving-joining activity. Proc Natl Acad Sci USA 97, 7721 - 7726. Deslandes L, Olivier J, Peeters N, Feng D X and Khounlotham M e a 2003 Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proc. Natl. Acad. Sci. USA 100, 8024–8029. 263 Despres C, DeLong C, Glaze S, Liu E and Fobert P 2000 The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors. Plant cell 12, 279 - 290. Devoto A and Turner J 2003 Regulation of Jasmonate-mediated plant responses in Arabidopsis. Annals of Botany 92, 329-337. Dhekney SA, Li ZT, Gray DJ 2010 Genetically engineered grapevines expressing a cisgenic Vitis vinifera thaumatin-like protein exhibit fungal resistance and improved post-harvest characteristics. 12th World congress of the International Association for Plant Biotechnology, St. Louis, June 6th- 11th2010. Diaz J, Ten Have A and Van Kan J A 2002 The role of ethylene and wound signaling in resistance of tomato to Botrytis cinerea . Plant Physiology 129 , 1341–1351 Dicke M, and Baldwin I T 2010 The evolutionary context for herbivore-induced plant volatiles: beyond the ‘cry for help’.Trends Plant Sci. 15:167–175. Dicke M and Hilker M 2003 Induced plant defences: from molecular biology to evolutionary ecology. Basic and Applied Ecology 4, 3-14. Dimroth P and Schink P 1998 Energy conservation in the decarboxlation of dicarboxylic acids by fermenting bacteria. Arch Microbiol 170, 69 - 77. Ding J Y, Jia J W, Yang L T, Wen H B, Zhang C M, Liu W X and Zhang D B 2004 Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes. J. Agric. Food Chem. 52, 3372-3377. Dodds P N and Rathjen J P 2010 Plant immunity: towards an integrated view of plant–pathogen interactions. Nat Rev Genet 11, 539-548. Doerfler W 1983 DNA methylation and gene activity. Annu. Rev. Biochem. 52, 93–124. Doerner P 2001 Plant meristems: A ménage à trois to end it all. Curr Biol. 2001 Oct 2;11(19):R785-7. 11, 785-787. Doherty H M, Selvendran R R and Bowles D J 1988 The wound response of tomato plants can be inhibited by aspirin and related hydroxy-benzoic acids. Physiological and molecular plant pathology 33, 377- 384. 264 Doi Y, Teranaka M, Yora K and Asuyama H 1967 Mycoplasma- or PLT group-like microorganisms found in the phloem elements of plants infected with mulberry dwarf, potato witches’ broom, aster yellows or paulownia witches’ broom. Ann. Phytopathol. Soc. Jpn 33, 259–266. Domenech J, Reddy M, Kloepper J, Ramos B and Gutierrez-Mañero J 2006 Combined application of the biological product LS213 with Bacillus , Pseudomonas ; or Chryseobacterium ; for growth promotion and biological control of soil-borne diseases in pepper and tomato. BioControl 51, 245-258. Domingo C, Conejero V and Vera P 1994 A gene encoding acidic and basic class III beta-1,3-glucanses are expressed in tomato plants upon viroid infection. Plant Mol. Biol. 24, 725-732. Dong X 1998 SA, JA, ethylene, and disease resistance in plants. Current Opinion in Plant Biology 1, 316- 323. Dorweiler J E 2000 mediator of paramutation1 is required for establishment and maintenance of paramutation at multiple maize loci. Plant cell 12, 2101-2118. Duan Y P, Castaneda A, Zhao G, Erdos G and Gabriel D W 1999 Expression of a single, host-specific, bacterial pathogenicity gene in plant cells elicits division, enlargement, and cell death. Mol. Plant- Microbe Interact 12, 556–560. Douet J, Blanchard B, Cuvillier C, Tourmente S. 2008. Interplay of RNA Pol IV and ROS1 during post- embryonic 5S rDNA chromatin remodeling. Plant Cell Physiol. 49:1783–91 Durrant W E and Dong X 2004 Systemic acquired resistance. Annual Review of Phytopathology 42, 185- 209. Dyrlov Bendtsen J, Nielsen H, von Heijne G and Brunak S 2004 Improved prediction of signal peptides: signalP 3.0. Journal of Molecular Biology 340, 783-795. E Ecker 1995 The ethylene signal transduction pathway in plants. Science 268, 667-675. Edreva A. 2005. Pathogenesis-related proteins. Research progress in the last 15 years. General and Applied Plant Physiology 31, 105–124. Efroni I, Blum E, Goldshmidt A and Eshed Y 2008 A protracted and dynamic maturation schedule underlies Arabidopsis leaf development. Plant Cell 20, 2293–2306. 265 Ellis C and Turner J G 2001 The Arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhanced resistance to pathogens. The Plant Cell Online 13, 1025-1033. El-kereamy A, El-sharkawy I, Rengasamy R, Taheri A, Errampalli D, Kumar P, Jayasankar S 2011. Prunus domestica Pathogenesis-Related Protein-5 Activates the Defense Response Pathway and Enhances the Resistance to Fungal Infection. PLoS ONE 6(3): e17973. doi:10.1371. Elvira MI, Molina Galdeano M, Gilardi P, Garcı´a-Luque I, Serra MT. 2008. Proteomic analysis of Pathogenesis-Related proteins (PRs) induced by compatible and incompatible interactions of pepper mild mottle virus (PMMoV) in Capsicum chinense L3 plants. Journal of Experimental Botany 59, 1253–1265. Eric J R 1997 DNA methylation and plant development. Trends in Genetics 13, 319-323. Escobar C, De Meutter J, Aristizábal F A, Sanz-Alférez S, del Campo F F, Barthels N, Van der Eycken W, Seurinck J, van Montagu M, Gheysen G and Fenoll C 1999 Isolation of the LEMMI9 gene and promoter analysis during a compatible plant-nematode interaction. Molecular Plant-Microbe Interactions 12, 440-449. Espinosa A, Guo M, Tam V C, Fu Z Q and Alfano J R 2003 The Pseudomonas syringae type III-secreted protein HopPtoD2 possesses protein tyrosine phosphatase activity and suppresses programmed cell death in plants. Molecular Microbiology 49, 377-387. Eyal Y, Meller Y, Lev-Yadun S, Fluhr R 1993 A basic-type PR-1 promoter directs ethylene responsiveness, vascular and abscission zone-specific expression. Plant J 4: 225-234 Eyal Y, Sagee O, Fluhr R 1992 Dark-induced accumulation of a basic pathogenesis-related (PR-I) transcript and a light requirement for its induction by ethylene. Plant Mo1 Biol 19 589-599 F Fakhouri W D, Neemann M, Walker F and Buchenauer H 2004 Application of fluorescent pseudomonads in combination with acibenzolar-S-methyl induces disease resistance in tomato and tobacco. J. Plant Dis. Prot. 111, 494-505. Fan W and Dong X 2002 In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant cell 14, 1377 - 1389. 266 Farbos I, Mouras A, Bereterbide A and Glimelius K 2001 Defective cell proliferation in the floral meristem of alloplasmic plants of Nicotiana tabacum leads to abnormal floral organ development and male sterility. The Plant Journal 26, 131-142. Farmer E E and Ryan C A 1992 Octadecanoid precursors of jasmonic acid activate the synthesis of wound- inducible proteinase inhibitors. The Plant Cell Online 4, 129-134. Farmer E E, Weber H and Vollenweider S 1998 Fatty acid signaling in Arabidopsis . Planta 206, 167-174. Felix G and Boller T 2003 Molecular sensing of bacteria in plants. The highly conserved RNA-binding motif RNP-1 of bacterial cold shock proteins is recognized as an elicitor signal in tobacco. J. Biol. Chem. 278, 6201–6208. Felix G, Duran J D, Volko S and Boller T 1999 Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. The Plant Journal 18, 265-276. Felton G W, Donato K, Del Vecchio R J and Duffey S S 1989 Activation of plant foliar oxidases by insect feeding reduces nutritive quality of foliage for noctuid herbivores. Journal of Chemical Ecology 15, 2667-2694. Feschotte C, Jiang N,Wessler SR. 2002. Plant transposable elements: where genetics meets genomics. Nat. Rev. Genet. 3:329–41. Feys B, Benedetti C E, Penfold C N and Turner J G 1994 Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen. The Plant Cell Online 6, 751-759. Fidantsef A L, Stout M J, Thaler J S, Duffey S S and Bostock R M 1999 Signal interactions in pathogen and insect attack: expression of lipoxygenase, proteinase inhibitor II, and pathogenesis-related protein P4 in the tomato, Lycopersicon esculentum. Physiological and molecular plant pathology 54, 97-114. Fieldes M and Amyot L 1999 Epigenetic control of early flowering in flax lines induced by 5-azacytidine applied to germinating seed. Journal of Heredity 90, 199-206. Fieldes M A 1994 Heritable effects of 5-azacytidine treatments on the growth and development of flax (Linum usitatissimum) genotrophs and genotypes. Genome 37, 1-11. 267 Fieldes M A and Harvey C G 2004 Differences in developmental programming and node number at flowering in the 5-azacytidine- induced, early-flowering flax lines and their controls. Int J Plant Sci 165, 695–706. Finnegan E J and Dennis E S 1993 Isolation and identification by sequence homology of a putative cytosine methyltransferase from Arabidopsis thaliana. Nucleic Acids Research 21, 2383-2388. Finnegan E J, Genger R K, Peacock W J and Dennis E S 1998 DNA methylation in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 223–247. Finnegan E J, Genger R K, Kovac K, Peacock WJ, Dennis ES (1998) DNA methylation and the promotion of flowering by vernalization. Proc Natl Acad Sci USA 95(10):5824-5829 Finnegan E J, Peacock W J and Dennis E S 1996 Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proceedings of the National Academy of Sciences 93, 8449-8454. Firrao G, Garcia-Chapa M and Marzachi C 2007 Phytoplasmas: genetics, diagnosis and relationships with the plant and insect host. Front. Biosci 12, 1353–1375. Fischer W, Christ U, Baumgartner M, Erismann K H. and Mosinger E 1989 Pathogenesis-related proteins of tomato. 2. Biochemical and immunological characterization. Physiol. Mol. Plant Pathol. , 35, 67-83. Fitchette-Laine A, Gomord V, Cabanes M, Michalski J-C, Saint Macary M, Foucher B, Cavelier B, Hawes C, Lerouge P and Faye L 1997 N-glycans harboring the Lewis a epitope are expressed at the surface of plant cells. Plant J 12, 1411 - 1417. Fletcher J, Schultz G A, Davis R E, Eastman C E and Goodman R M 1981 Brittle root disease of horseadish: evidence for aan etiological role of Spiroplasma citri. Phyopathology 71, 1073-1080. Fletcher J, Wayadande A, Melcher U and Ye F 1998 The phytopathogenicmollicute-insect vector interface: a closer look. Phytopathology 88, 1351–1358. Fletcher J C, Brand U, Running M P, Simon R and Meyerowitz E M 1999 Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems. Science 283, 1911–1914. Flores T, Alape-Gir´A, Flores-D´ıaz M, FloresH E 2002 Ocatin,anoveltuberstorage protein from the and eantubercropoca with antibacterial and antifungal activities. PlantPhysiol 128:1291–302. Flor H H 1971 Current status for the gene-for-gene concept. Annual Reviews of Phytopathoogy. 9, 275-296. 268 Fos A, Danet J L, Garnier M and Bové J M 1992 Use of monoclonal antibody to detect the stolbur mycoplasma like organism in plants and insects and to identify a vector in France. Plant Dis. 76 : 103–234. Fos A, Bové J M, Lallemand J, Saillard C, Vignault J C, Ali Y, Brun P and Vogel R 1986 The leafhopper Neoaliturus haematoceps is a vector of Spiroplasma citri in the mediterranean area. Annales De L'institue Pasteur Microbiology 137A, 97-107. Foissac X, Danet J L, Saillard C, Gaurivaud P, Laigret F, Paré, C, and Bové, JM 1997c Mutagenesis by Insertion of Tn 4001 into the Genome of Spiroplasma citri : Characterization of Mutants Affected in Plant Pathogenicity and Transmission to the Plant by the Leafhopper Vector Circulifer haematoceps. Molecular Plant-microbe Interactions. 10,454-461. Forslund K, Pettersson J, Bryngelsson T, and Jonsson L 2000 Aphid infestation induces PR-proteins differently in barley susceptible or resistant to the birdcherry-oat aphid ( Rhopalosiphum padi ). Physiol. Plant 110:496-502. Fraser C, Casjens S, Huang W, Sutton G, Clayton R, Lathigra R, White O, Ketchum K, Dodson R, Hickey E, Gwinn M, Dougherty B, Tomb J, Fleischmann R, Richardson D, Peterson J, Kerlavage A, Quackenbush J, Salzberg S, Hanson M, vanVugt R, Palmer N, Adams M, Gocayne J, Weidman J, Utterback T, Watthey L, McDonald L, Artiach P, Bowman C, Garland S, Fujii C, Cotton M, Horst K, Roberts K, Hatch B, Smith H and Venter J 1997 Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390, 580 - 586. Friedrich L, Lawton K, Ruess W, Masner P, Specker N, Rella M G, Meier B, Dincher S, Staub T, Uknes S, Métraux J-P, Kessmann H and Ryals J 1996 A benzothiadiazole derivative induces systemic acquired resistance in tobacco. The Plant Journal 10, 61-70. Fritig B, Heitz T and Legrand M 1998 Antimicrobial proteins in induced plant defense. Current Opinion in Immunology 10, 16-22. Frohlich M W and Parker D S 2000 The mostly male theory of flower evolution: from genes to fossils. Systematic Botany 25, 155-170. Frommer M 1992 A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl Acad. Sci. USA 89, 1827-1831. 269 Fu Z Q, Guo M, Jeong B-r, Tian F, Elthon T E, Cerny R L, Staiger D and Alfano J R 2007 A type III effector ADP-ribosylates RNA-binding proteins and quells plant immunity. Nature 447, 284-288. Fumiaki K 2004 A global view of defense gene expression regulation – a highly interconnected signaling network. Current Opinion in Plant Biology 7, 506-511. Fumiaki K 2004 A global view of defense gene expression regulation – a highly interconnected signaling network. Current Opinion in Plant Biology 7, 506-511. G Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E, Kessmann H and Ryals J 1993 Requirement of Salicylic Acid for the Induction of Systemic Acquired Resistance. Science 261, 754- 756. Gail E G 2010 Spiroplasmas and phytoplasmas: Microbes associated with plant hosts. Biologicals 38, 193- 203. Gal T, Aussenberg E, Burdman S, Kapulnik Y and Koltai H 2006 Expression of a plant expansin is involved in the establishment of root knot nematode parasitism in tomato. Planta 224, 155-162. Galaud J-P, Gaspar T and Boyer N 1993 Effect of anti-DNA methylation drugs on growth, level of methylated DNA, peroxidase activity and ethylene production of Bryonia dioica internodes. Physiologia Plantarum 87, 528-534. Gallois J L, Woodward C, Reddy G V and Sablowski R 2002 Combined shoot meristemless and wuschel trigger ectopic organogenesis in Arabidopsis. Development 129, 3207–3217. Gal-Mor O and Finlay B B 2006 Pathogenicity islands: a molecular toolbox for bacterial virulence. Cell Microbiol. 8, 1707–1719. Garcia Breijo, F. J., Garro, R. and Conejero, V. (1990). C7 (P32) and C 6 (P34) PR proteins induced in tomato leaves by citurs exocortis viroid infection are chitinases. Physiol. Mol. Plant Pathol. , 36, 249-260. Gasparich G E, Whitcomb R F, Dodge D, French F E, Glass J, David L and Williamson 2004 The genus Spiroplasma and its non-helical descendants: phylogenetic classification, correlation with phenotype and roots of the Mycoplasma mycoides clade. International Journal of Systematic and Evolutionary Microbiology, 54, 893–918. 270 Gasparich G E 2010 Spiroplasmas and phytoplasmas: microbes associated with plant hosts. Biologicals 38, 193–203. Gatehouse J A 2002 Plant resistance towards insect herbivores: a dynamic interaction. New Phytol. 156: 145- 169. Gatineau, Larrue J, Claire D, Lorton F, Richard-Molard M. and Boudon-Padieu E 2001 A new natural planthopper vector of stolbur phytoplasma in the genus Pentastiridius (Hemiptera: Cixiidae). Eur. J. Plant Pathol . 107 : 263–271. Guo M, Tian F, Wamboldt Y and J R Alfano 2009 The majority of the type III effector inventoryof Pseudomonas syringae pv. tomato DC3000 can suppress plant immunity. Mol. Plant Microbe Interact. 22: 1069-1080. Gehring M 2006 DEMETER DNA glycosylase establishes MEDEA polycomb gene self-imprinting by allele-specific demethylation. Cell 124, 495-506. Gehring M, Huh J H, Hsieh T-F, Penterman J, Choi Y, Harada J J, Goldberg R B and Fischer R L 2006 DEMETER DNA Glycosylase Establishes MEDEA Polycomb Gene Self-Imprinting by Allele- Specific Demethylation. Cell 124, 495-506. Genger R K, Kovac K A, Dennis E S, Peacock W J and Finnegan E J 1999 Multiple DNA methyltransferase genes in Arabidopsis thaliana. Plant Molecular Biology 41, 269-278. Genger RK, Peacock W J, Dennis E S, Finnegan E J 2003 Opposing effects of reduced DNA methylation on flowering time in Arabidopsis thaliana. Planta 216:461–466. Gheysen G and Fenoll C 2002 Gene expression in nematode feeding sites. Annual Review of Phytopathology 40, 191-219. Ghosh R and Chakrabarti C 2008 Crystal structure analysis of NP24-I: a thaumatin-like protein. Planta 228, 883-890. Glazebrook J 2001 Genes controlling expression of defense responses in Arabidopsis-2001 status. Curr Opin Plant Biol 4, 301 - 308. Glazebrook J 2005 Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43, 205-227. 271 Glazebrook J, Chen W, Estes B, Chang H-S, Nawrath C, Métraux J-P, Zhu T and Katagiri F 2003 Topology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. The Plant Journal 34, 217-228. Glazebrook J 1999 Genes controlling expression of defense responses in Arabidopsis. Current Opinion in Plant Biology 2, 280-286. Gocal G F, King R W, Blundell C A, Schwartz O M, Andersen C H and Weigel D 2001 Evolution of floral meristem identity genes. Analysis of Lolium temulentum genes related to APETALA1 and LEAFY of Arabidopsis. Plant Physiol 125, 1788-1801. Godard J-F, Ziadi S, Monot C, Le Corre D, Silue D 1999 Benzothiadiazole (BTH) induces resistance in cauliflower (Brassica oleracea var. botrytis) to downy mildew of crucifers caused by Peronospora parasitica. Crop Protect 18:397-405. Göhre V and Robatzek S 2008 Breaking the barriers: Microbial effector molecules subvert plant immunity. Annual Review of Phytopathology, 46, 189-215. Gómez-Gómez L, Felix G and Boller T 1999 A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. The Plant Journal 18, 277-284. Gomez-Gomez L, Boller T (2002) Flagellin perception: a paradigm for innate immunity. Trends Plant Sci 7: 251-256. Gong Z 2002 ROS1, a repressor of transcriptional gene silencing in Arabidopsis, encodes a DNA glycosylase/lyase. Cell 111, 803-814. Goode M J and Sasser M 1980 Prevention–The key to controlling bacterial spot and bacterial speck of tomato. Plant Dis. , 831-834. Goodwin P B 1983 Molecular size limit for movement in the symplast of the Elodea leaf. Planta 157, 124- 130. González-Carranza Z H, Whitelaw C A, Swarup R, Roberts J A 2002 Temporal and spatial expression of a polygalacturonase during leaf and flower abscission in oilseed rape and Arabidopsis. Plant Physiol .128 , 534-543. Viewing and editing assembled sequences using Consed. Current Protocols in Bioinformatics, 11.12.11 - 11.12.43. 272 Gorlach J, Volrath S, Knauf-Beiter G, Hengy G, Beckhove U, Kogel K H, Oostendorp M, Staub T, Ward E, Kessmann H and Ryals J 1996 Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. The Plant Cell Online 8, 629- 643. Görlach J, Raesecke H R, Rentsch D, Regenass M, Roy P, Zala M, Keel C, Boller T, Amrhein N and Schmid J 1995 Temporally distinct accumulation of transcripts encoding enzymes of the prechorismate pathway in elicitor-treated, cultured tomato cells. Proc. Natl. Acad. Sci. U. S. A ., 92, 3166-3170. Gorovista R and Czosnek H 2008 Expression of stress gene networks in tomato lines susceptible and resistant to tomato yellow leaf curl virus in response to abiotic stress. Plant Physiol. Biochem., 46: 482-492. Graham J S, Pearce G, Merryweather J, Titani K, Ericsson L H, and Ryan C A 1985b Wound- induced proteinase inhibitors from tomato leaves. II. The cDNA-deduced primary structure of pre-inhibitor II. J. Biol. Chem. 260:6561-6564. Granell A, Belles J M. and Conejero V 1987 Induction of pathogenesis-related proteins in tomato by citrus exocortis viroid, silver ion and ethephon. Physiol. Mol. Plant Pathol ., 31, 83-90. Green T R and Ryan C A 1972 Wound-induced proteinase inhibitor in plant leaves: a possible defense mechanism against insects. Science 175: 776-777. Griffiths-Jones S, Moxon S, Marshall M, Khanna A, Eddy S and Bateman A 2005 Rfam: annotating non- coding RNAs in complete genomes. Nucleic Acids Res. 33, D121- D124. Grylls N E 1979 Leafhoppers vectors and Plant diseases Agents they transmit in Australia. Page 179-213 in Leafhoppers vectors and Plant diseases Agents. K Maramoroch and K Harris, eds. Academic Press, New Yark. Grossniklaus U, Vielle-Calzada J-P, Hoeppner M A and Gagliano W B 1998 Maternal Control of Embryogenesis by MEDEA, a Polycomb Group Gene in Arabidopsis. Science 280, 446-450. Guevara-Morato M A N, de Lacoba M C, Luque I G and Serra M T 2010 Characterization of a pathogenesis- related protein 4 (PR-4) induced in Capsicum chinense L3 plants with dual Rnase and DNase activities Journal of Experimental Botany, Vol. 61, No. 12, pp. 3259–3271. 273 Guevara M G, Oliva C R, Huarte M and Daleo G R 2002 An Aspartic Protease With Antimicrobial Activity is Induced after Infection and Wounding in Intercellular Fluids of Potato Tubers. European Journal of Plant Pathology 108, 131-137. Gu Y-Q, Yang C, Thara V K, Zhou J and Martin G B 2000 Pti4 Is Induced by Ethylene and Salicylic Acid, and Its Product Is Phosphorylated by the Pto Kinase. pp 771-786. Gundersen D E and Lee I M 1996 Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs Phytopathologia Mediterranea 35, 144-151. Gundersen D E, Lee I M, Rehner S A, Davis R E and Kingsbury D T 1994 Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification. J. Bacteriol. 176, 5244-5254. Gundersen D E, Lee I-M, Schaff D A, Harrison N A, Chang C J, Davis R E and Kingsbury D T 1996 Genomic diversity and differentiation among phytoplasma strains in 16S rRNA groups I (aster yellows and related phytoplasmas) and III (X-disease and related phytoplasmas). International Journal of Systematic Bacteriology 46, 64-75. Guo M, Tian F, Wamboldt Y and Alfano J R 2009 The Majority of the Type III Effector Inventory of Pseudomonas syringae pv. tomato DC3000 Can Suppress Plant Immunity. Molecular Plant-Microbe Interactions 22, 1069-1080. H Hadidi A, Czosnek H. and Barba M. 2004 DNA microarrays and their potential applications for the detection of plant viruses, viroids, and phytoplasmas. J. Plant Pathol. 86, 97–104. Hagen G and Guilfoyle T 2002 Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Molecular Biology 49, 373-385. Hammerschmidt R. and Kuc J 1995 Iduced Systemic Resistance to Disease in Plants. Dordrecht, the Netherlands: Kluwer Acad. Publ. Hammond-Kosack K E and Jones J D 1997 Plant disease resistance genes. Annual Review of Plant Physiology Plant Molecular Biology 48, 575–607. Harborne J B, Williams C A 2000 Advances in favonoid research since 1992. Phytochemistry, 55: 481-504. 274 Harrison N A, Bourne C M, Cox R L, Tsai J H and Richardson P A 1992 DNA probes for detection of mycoplasmalike organisms associated with lethal yellowing disease of palms in Florida. Phytopathology 82, 216-224. Harman G E, Howell C R, Viterbo A, Chet I and Lorito M 2004 Trichoderma species-opportunistic, avirulent plant symbionts. Nature Reviews Genetics 2, 43-56. Hase S, Takahashi S, Takenaka S, Nakaho K , Arie T, Seo S 2008 Involvement of jasmonic acid signaling in bacterial wilt disease resistance induced by biocontrol agent Pythium oligandrum in tomato. P lant Pathol. 57: 870 – 876. Havsteen B H 2002 The biochemistry and medical significance of the flavonoids. Pharmacol. Ther. 96: 67- 202. Hause B, Stenzel I, Miersch O, Maucher H 2000 Tissue-specific oxylipin signature of tomato flowers: allene oxide cyclase is highly expressed in distinct flower organs and vascular bundles. Plant J. 24: 113- 126. Hause B, Hause G, Kutter C, Miersch O 2003 Enzymes of jasmonate biosynthesis occur in tomato sieve elements. Plant Cell Physiol. 44: 643-648. Hayat S, Ali B and Ahmad A 2007 Salicylic Acid: Biosynthesis, Metabolism and Physiological Role in Plants Salicylic Acid: A Plant Hormone. Eds. S Hayat and A Ahmad. pp 1-14. Springer Netherlands. Heath M 2000 Hypersensitive response related death. Plant Mol Biol 44, 321 - 334. Heidel A J and Baldwin I T 2004 Microarray analysis of salicylic acid- and jasmonic acid-signalling in responses of Nicotiana attenuata to attack by insects from multiple feeding guilds. Plant, Cell & Environment 27, 1362-1373. Heil M 2010 Plastic defence expression in plants. Evol. Ecol. 24:555–569. Heitz T, Bergey D R, and Ryan C A. 1997 A gene encoding a chloroplast- targeted lipoxygenase in tomato leaves is transiently induced by wounding, systemin, and methyl jasmonate. Plant Physiol. 114:1085- 1093 Heitz T, Fritig B, Legrand M (1994a) Local and systemic accumulation of pathogenesis-related proteins in tobacco plants infected with tobacco mosaic virus. Mo1 Plant Microbe Interact 7: 776-779 275 Heitz T, Geoffroy P, Fritig B, Legrand M 1991 Twa apoplastic a-amylases are induced in tobacco by virus infec,tion. Plant Physiol 97: 651456 Heitz T, Segond S, Kauffmann S, Geoffroy P, Prasad V, Brunner F, Fritig B, Legrand M (1994b) Molecular characterization of a novel tobacco PR protein: a new plant chitinase/lysozyme. Mo1Gen Genet 245 246-254 Henikoff S and Comai L 1998 A DNA Methyltransferase Homolog With a Chromodomain Exists in Multiple Polymorphic Forms in Arabidopsis. Genetics 149, 307-318. Herman M A, Davidson J K and Smart C D 2008 Induction of plant defence gene expression by plant activators and Pseudomonas syringae pv. tomato in greenhouse-grown tomatoes. Phytopathology 98, 1226-1232. Heslop-Harrison J S 1990 Gene expression and parental dominance in hybrid plants. Development 108, 21- 28. Hill A V 1943 Insect transmission and host plants of virescence (big bud of tomato). Counc. Sci. industry. Res 16, 85-90. Himeno M, Kojima N, Neriya Y, Sugawara K and Ishii Y e a 2010 Characterization of floral morphogenesis and expression of floral development genes in phytoplasma-infected Hydrangea and petunia. Congr. Int. Org. Mycoplasmology, 18th, Cianciano Terme, 222:198. Himmelreich R, Hilbert H, Plagens H, Pirkl E, Li B and Herrmann R 1996 Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res 24, 4420 - 4449. Hirokawa T, Boon-Chieng S and Mitaku S 1998 SOSUI: classification and secondary structure prediction system for membrane proteins. Bioinformatics 14, 378-379. Hodgetts J, Ball T, Boonham N, Mumford R. and Dickinson, M 2007 Use of terminol restriction fragment length polymorphism (T-RFLP) for identification of phytoplasmas in plants. Plant Pathol. 56, 357–365. Hoffland E, Pieterse C M J, Bik L and van Pelt J A 1995 Induced systemic resistance in radish is not associated with accumulation of pathogenesis-related proteins. Physiological and molecular plant pathology 46, 309-320. 276 Hoffmann G M, Schmutterer H 1999 Parasitäre Krankheiten und Schädlinge an landwirtschaftlichen Nutzpflanzen -Sonnenblume-. Verlag an Eugen Ulmer, Stuttgart, 2. Aufl., 626-632. Hogenhout S A and Loria R 2008 Virulence mechanisms of gram-positive plant pathogenic bacteria. Curr. Opin. Plant Biol. 11, 449–456. Hogenhout S A and Music M 2010 Phytoplasma genomics, from sequencing to comparative and functional genomics: what have we learnt? Phytoplasmas. Genomes, Plant Hosts and Vectors.Wallingford, UK: CABI, 19–36. Hogenhout S A, Oshima K, Ammar L D, Kakizawa S K, H N and Namb S 2008 Phytoplasmas: Bacteria that manipulate plants and insects. Mol Plant Pathol 9, 403-423. Hogenhout S A, Van d R A, Terauchi R and Kamoun S 2009 Emerging concepts in effector biology of plant- associated organisms. Mol. Plant-Microbe Interact 22, 115–122. Hong J K and Hwang B K 2002 Temporal and subcellular localization of PR-1 proteins in tomato stem tissues infected by virulent and avirulent isolates of <i>Phytophthora capsici</i>. Protoplasma 219, 131-139. Hong J K, Jung H W, Lee B K, Lee S C, Lee Y K and Hwang B K 2004 An osmotin-like protein gene, CAOSM1, from pepper: differential expression and in situ localization of its mRNA during pathogen infection and abiotic stress. Physiological and molecular plant pathology 64, 301-310. Hopwood D 1965 A circular linkage map of the actinomycete Streptomyces coelicolor. J Mol Biol 12, 514 - 516. Horton P, Park K-J, Obayashi T, Fujita N, Harada H, Adams-Collier C J and Nakai K 2007 WoLF PSORT: protein localization predictor. Nucleic Acids Research 35, W585-W587. Horváth E, Szalai G, Janda T, Páldi E, Rácz I and Lásztity D 2003 Effect of vernalisation and 5-azacytidine on the methylation level of DNA in wheat (Triticum aestivum L., cv. Martonvásár 15). Plant Science 165, 689-692. Hoshi A, Oshima K, Kakizawa S, Ishii Y and Ozeki J e a 2009 A unique virulence factor for proliferation and dwarfism in plants identified from a phytopathogenic bacterium. Proc.Natl. Acad. Sci. USA 106:6416–21. 277 Hossain M M, Sultana F, Kubota M, Koyama H and Hyakumachi M 2007 The Plant Growth-Promoting Fungus Penicillium simplicissimum GP17-2 Induces Resistance in Arabidopsis thaliana by Activation of Multiple Defense Signals Plant Cell Physiol. 48(12): 1724–1736. Hotson A, Chosed R, Shu H, Orth K and Mudgett M B 2003 Xanthomonas type III effector XopD targets SUMO-conjugated proteins in planta. Molecular Microbiology 50, 377-389. Howe G A 2004 Jasmonates as Signals in the Wound Response. Journal of Plant Growth Regulation 23, 223- 237. Howe G A and Jander G 2008 Plant immunity to insect herbivores. Annu. Rev. Plant Biol. 59:41–66. Hu P, Meng Y and Wise R P 2009 Functional contribution of chorismate synthase, anthranilate synthase, and chorismate mutase to penetration resistance in barley-powdery mildew interactions. Mol. Plant Microbe Interact 22, 311-320. Huang JC, Chang FC, Wang CS. Characterization of a lily tapetal transcript that shares sequence similarity with a class of intracellular pathogenesis-related (IPR) proteins. Plant Mol Biol 1997;34:681–6. Huettel B 2006 Endogenous targets of RNA-directed DNA methylation and Pol IV in Arabidopsis. EMBO J. 25, 2828-2836. Huh JH, Bauer MJ, Hsieh TF, Fischer RL. 2008. Cellular programming of plant gene imprinting. Cell 132:735–44 Hussey R S, Davis E L and Baum T J 2002 Secrets in secretions: genes that control nematode parasitism of plants. Brazilian Journal of Plant Physiology 14, 183-194. I Ihara Y, Yoshimura M, Miyoshi E, Nishikawa A, Sultan A, Toyosawa S, Ohnishi A, Suzuki M, Yamamura K-I, Ijuhin N and Taniguchi N 1998 Ectopic expression of N-acetylglucosaminyltransferase III in transgenic hepatocytes disrupts apolipoprotein B secretion and induces aberrant cellular morphology with lipid storage. Proc Natl Acad Sci U S A 95, 2526 - 2530. Imlau A, Truernit E and Sauer N 1999 Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. The Plant Cell Online 11, 309-322. Inbar M, Doostdar H, Sonoda M, Leibee GL, Mayer RT, 1998. Elicitors of plant defensive systems reduce 278 insect densities and disease incidence. Journal of Chemical Ecology 24 , 135–49. International Research Program on Comparative Mycoplasmology P 2004 'Candidatus Phytoplasma', a taxon for the wall-less, non-helical prokaryotes that colonize plant phloem and insects. Int J Syst Evol Microbiol 54, 1243 - 1255. Irani K and Goldschimidt-Clermont P 1998 Ras, superoxide and signal transduction. Biochem Pharmacol 55, 1339 - 1346. Irish V F 2010 The flowering of Arabidopsis flower development. Plant J. 61, 1014–1028. Ishitani M, Xiong L, Stevenson B and Zhu J K 1997 Genetic analysis of osmotic and cold stress signal transduction in Arabidopsis: interactions and convergence of abscisic acid-dependent and abscisic acid-independent pathways. Plant cell 9, 1935-1949. J Jacobsen S E, Sakai H, Finnegan E J, Cao X. and Meyerowitz E M 2000 Ectopic hypermethylation of flower-specific genes in Arabidopsis. Curr. Biol. 10, 179-186. Jacobsen S E and Meyerowitz E M 1997 Hypermethylated SUPERMAN Epigenetic Alleles in Arabidopsis. Science 277, 1100-1103. Jaffe J, Stange-Thamann N, Smith C, DeCaprio D, Fisher S, Butler J, Calvo S, Elkins T, FitzGerald M, Hafez N, Kodira C, Major J, Wang S, Wilkinson J, Nicol R, Nusbaum C, Birren B, Berg H and Church G 2004 The complete genome and proteome of Mycoplasma mobile. Genome Res 14, 1447 - 1461. Jakobek J L, Smith J A, Lindgren P B 1993 Suppression of bean defense responses by Pseudomonas syringae . Plant Cell 1993;5:57–63. Jammes F, Lecomte P, de Almeida-Engler J, Bitton F, Martin-Magniette M-L, Renou J P, Abad P and Favery B 2005 Genome-wide expression profiling of the host response to root-knot nematode infection in Arabidopsisa. The Plant Journal 44, 447-458. Janjusevic R, Abramovitch R B, Martin G B and Stebbins C E 2006 A bacterial inhibitor of host programmed cell death defenses is an E3 ubiquitin ligase. Science 311, 222-226. Janowski B A 2006 Involvement of AGO1 and AGO2 in mammalian transcriptional silencing. Nature Struct. Mol. Biol. 13, 787-792. 279 Janowski B A 2007 Activating gene expression in mammalian cells with promoter-targeted duplex RNAs. Nature Chem. Biol. 3, 166-173. Jarausch W, Jarausch-Wehrheim B, Danet J L, Broquaire J M, Dosba F, Saillard C and Garnier M 2001 Detection and indentification of european stone fruit yellows and other phytoplasmas in wild plants in the surroundings of apricot chlorotic leaf roll-affected orchards in southern france. European Journal of Plant Pathology 107, 209-217. Jarausch W, Saillard C, Helliot B, Garnier M and Dosba F 2000 Genetic variability of apple proliferation phytoplasmas as determined by PCR-RFLP and sequencing of a non-ribosomal fragment. Molecular and Cellular Probes 14, 17-24. Jasencakova Z, Meister A, Walter J, Turner B M and Schubert I 2000 Histone H4 acetylation of euchromatin and heterochromatin is cell cycle dependent and correlated with replication rather than with transcription. Plant cell 12, 2087-2100. Jayasankar S, Li Z, Gray D J 2003 Constitutive expression of Vitis vinifera thaumatin-like protein after in vitro selection and its role in anthracnose resistance. Funct Plant Biol 30: 1105–1115. Jensen B J, Latunde-Dada A O, Hudson D, Lucas J A 1998 Protection of Brassica seedlings against downy mildew and damping-off by seed treatment with CGA 245704, an activator of systemic acquired resistance. Pest Sci 52:63– 69. Jwa N S, Agrawal G K, Rakwal R, Park C H, and Agrawal V P 2001. Molecular cloning, characterisation of a novel jasmonate inducible pathogenesis-related class 10 protein gene, JIOsPR10 , from rice (Oryza sativa L.) seedling leaves. Biochem. Biophys. Res. Commun. 286:973-983. Ji P Campbell H L, Kloepper J W, Jones J B, Suslow T V and Wilson M 2006 Integrated biological control of bacterial speck and spot of tomato under field conditions using foliar biological control agents and plant growth-promoting rhizobacteria. Biological Control 36, 358-367. Jia Y and Martin G B 1999 Rapid transcript accumulation of pathogenesis-related genes during an incompatible interaction in bacterial speck disease-resistant tomato plants. Plant Molecular Biology 40, 455-465. jiang F, Zheng X and Chen J 2009 Microarray analysis of gene expression profile induced by the biocontrol yeast Cryptococcus laurentii in cherry tomato fruit. Gene 430, 12-16. 280 Johnson R, Lee J S and Ryan C A 1990 Regulation of expression of a wound-inducible tomato inhibitor I gene in transgenic nightshade plants. Plant Molecular Biology 14, 349-356. Jomantiene R, Davis R E, Maas J and Dally E L 1998 Classification of new phytoplasmas associated with diseases of strawberry in Florida, based on analysis of 16S rRNA and ribosomal protein gene operon sequences. International Journal of Systematic Bacteriology 48, 269-277. Jomantiene R R, Maas J L, Takeda F and Davis R E 2002 Molecular Identification and Classification of Strawberry Phylloid Fruit Phytoplasma in Group 16SrI, New Subgroup. Plant Disease 86, 920-920. Jomantiene R R, Zhao Y, Lee I M, Davis R E 2011 Phytoplasmas infecting sour cherry and lilac represent two distinct lineages having close evolutionary affinities with clover phyllody phytoplasma.- European Journal of Plant Pathology ,130: 97-107. Jones J B, Stall R E and Zitter T A 1991 Compendium of tomato diseases. American Phytopathological Society, St. Paul, MN. Jones J D G and Dangl J L 2006 The plant immune system. Nature 444, 323-329. Jones P, 1984 Gene activation by 5-azacytidine. In DNA methylation biochemistry and biological significance. Eds. A Razin, H Cedar and A D Riggs. Springer, Berlin Heidelberg New York, pp 165–188. Jones P A, 1985 Effects of 5-azacytidine and its 2-deoxyderivative on cell differentiation and DNA methylation. Pharmacol. Ther. 28:17–27. Joosten M H A J and De W P 1989 Identification of severa1 pathogenesis-related proteins in tomato leaves inoculated with Cladosporiutn fulvum (syn. Fulvia fulva) as 1,3-P-glucanases and chitinases. Plant Physiology 89, 945-951. Joosten MHAJ, Bergmans CJB, Meulenhoff EJS, Cornelissen BJC, De Wit PJGM (1990) Purification and serological characterization of three basic 15-kilodalton pathogenesis-related proteins from tomato. Plant Physiol 94: 585-591 Jordá L, Coego A, Conejero V and Vera P 1999 A Genomic Cluster Containing Four Differentially Regulated Subtilisin-like Processing Protease Genes Is in Tomato Plants. Journal of Biological Chemistry 274, 2360-2365. 281 Jordá L, Conejero V and Vera P 2000 Characterization of P69E and P69F, Two Differentially Regulated Genes Encoding New Members of the Subtilisin-Like Proteinase Family from Tomato Plants. Plant Physiology 122, 67-74. Jovi J, Cvrkovi T, Mitrovi M, Krnjaji S, Pratt R, Gingery R, Hogenhout S-O and To Evski - C 2007 Roles of Stolbur phytoplasma and Reptalus panzeri (Cixiinae, Auchenorrhyncha) in the epidemiology of Maize redness in Serbia. European Journal of Plant Pathology 118, 85-89. Jullien P E, Kinoshita T, Ohad N and Berger F 2006 Maintenance of DNA Methylation during the Arabidopsis Life Cycle Is Essential for Parental Imprinting. The Plant Cell Online 18, 1360-1372. Jun Tao, Chunyan Cao1, Daqiu Zhao1, Chunhua Z and Guohua L 2011 Molecular analysis and expression of phenylalanine ammonia-lyase from poinsettia ( Euphorbia pulcherrima willd.) African Journal of Biotechnology Vol. 10 (2), pp. 126-135. Jutidamrongphan W, Mackinnon G, Manners J and Scott K 1989 Sequence of a near-full length cDNA clone for a mRNA of barley induced by fungal infection. Nucleic Acids Res 17, 9478. K Kakizawa S, Oshima K, Nishigawa H, Jung H Y and Wei W e a 2004 Secretion of immunodominant membrane protein from onion yellows phytoplasma through the Sec protein-translocation system in Escherichia coli. Microbiology 150, 135–142. Kamoun S 2003 Molecular genetics of pathogenic oomycetes. Eukaryot Cell 2: 191–199 Karban R, Baldwin I T 1997 Induced Responses to Herbivory. University of Chicago Press, Chicago. Kankel M W, Ramsey D E, Stokes T L, Flowers S K, Haag J R, Jeddeloh J A, Riddle N C, Verbsky M L, Richards E J 2003 Arabidopsis MET1 cytosine methyltransferase mutants. Genetics 163:1109– 1122. Kaplan I, Halitschke R, Kessler A, Sardanelli S and Denno R F 2008 Constitutive and induced defenses to herbivory in above- and belowground plant tissues. Ecology 89, 392–406. Kapoor A, Agius F and Zhu J K 2005 Preventing transcriptional gene silencing by active DNA demethylation. FEBS Lett. 579, 5889-5898. 282 Kasschau K D, Xie Z, Allen E, Llave C, Chapman E J, Krizan K A and Carrington J C 2003 P1/HC-Pro, a viral suppressor of RNA silencing, interferes with arabidopsis development and miRNA function. Developmental cell 4, 205-217. Kavroulakis N, Papadopoulou K K, Ntougias S, Zervakis G I and Ehaliotis C 2006 Cytological and Other Aspects of Pathogenesis-related Gene Expression in Tomato Plants Grown on a Suppressive Compost. Annals of Botany 98, 555-564. Kawasaki T, Henmi K, Ono E, Hatakeyama S, Iwano M, Satoh H and Shimamoto K 1999 The small GTP- binding protein Rac is a regulator of cell death in plants. Proc Natl Acad Sci U S A 96, 10922 - 10926. Kay S, Hahn S, Marois E, Hause G and Bonas U 2007 A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science 318, 648–651. Kazan K and Manners J M 2008 Jasmonate Signaling: Toward an Integrated View. Plant Physiology 146, 1459-1468. Keen N T 1990 Gene-for-gene complimentary in plant-pathogen interactions. Annual Review of Genetics 24, 447-463. Kempers R and van Bel A J E 1997 Symplasmic connections between sieve element and companion cell in the stem phloem of Vicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta 201, 195-201. Kempema L A, Cui X, Holzer F M and Walling L L 2007 Arabidopsis transcriptome changes in response to phloem-feeding silverleaf whitefly nymphs. Similarities and distinctions in responses to aphids. pp 849-865. Kessmann H, Staub T, Hofmann C, Maetzke T, Herzog J, Ward E, Uknes S and Ryals J 1994 Induction of systemic acquired resistance in plants by chemicals. Annu Rev Phytopathol 32, 439 - 459. Kessler A and Baldwin I T 2002 Plant responses to insect herbivory: the emerging molecular analysis. Annu. Rev. Plant Biol. 53: 299-328. Kessler A and Baldwin I T 2001 Defensive function of herbivore-induced plant volatile emissions in nature. Science 291:2141-2144. 283 Kim B, Masuta C, Matuura H, Takahashi H and Inukai T 2008 Veinal necrosis induced by Turnip mosaic virus infection in Arabidopsis is a form of defense response accompanying HR-like cell death. M ol. Plant-Microbe Interact. 21: 260 – 268. Kim D H, Villeneuve L M, Morris K V and Rossi J J 2006 Argonaute-1 directs siRNA-mediated transcriptional gene silencing in human cells. Nature Struct. Mol. Biol. 13, 793-797. Kim S H, Lee JR, Hong ST, Yoo YK, An G, Kim SR 2003 Molecular cloning and analysis of anthocyanin biosynthesis genes preferentially expressed in apple skin. Plant Sci. 165: 403-413. Kim S H, Lee JR, Kim SR 2006. Characterization of an apple anthocyanidin synthase gene in transgenic tobacco plants. J. Plant Biol. 49: 326-330. Kim M G. da Cunha L, McFall A J, Belkhadir Y, DebRoy S, Dangl J L and Mackey D 2005 Two Pseudomonas syringae Type III Effectors Inhibit RIN4-Regulated Basal Defense in Arabidopsis. Cell 121, 749-759. King G J 1995 Morphological development in Brassica oleracea is modulated by in vivo treatment with 5- azacytidine. J Hort Sci 70:333–342 King G J, Turner V A., Hussey C E, Wurtele E S and Lee M 1988 Isolation and characterization of a tomato cDNA clone which codes for a salt-induced protein. Plant Mol. Biol ., 10, 401-412. Kingdom H N and Hogenhout S A 2007 Survival rates of Macrosteles quadrilineatus and Dalbulus maidis on various plant species. Bull. Insectology 60, 225–226. Kinoshita T, Miura A, Choi Y, Kinoshita Y, Cao X, Jacobsen S E, Fischer R L and Kakutani T 2004 One- Way Control of FWA Imprinting in Arabidopsis Endosperm by DNA Methylation. Science 303, 521-523. Kirkpatrick B C, Stenger D C, Morris T J and Purcell A H 1987 Cloning and detection of DNA from a nonculturable plant pathogenic mycoplasma-like organism. Science 238, 197-200. Kishimoto N, Sakai H, Jackson J, Jacobsen S E, Meyerowitz E M, Dennis E S and Finnegan E J 2001 Site specificity of the Arabidopsis methyltransferase demonstrated through hypermethylation of the superman locus. Plant Mol. Biol. 46 171-183. Kison H, Schneider B, Seemuller E, 1994 Restriction fragment length polymorphisms within the apple proliferation mycoplasma like organisms. Journal of phytpathology. 141 395-401. 284 Kiyosue T, Ohad N, Yadegari R, Hannon M, Dinneny J, Wells D, Katz A, Margossian L, Harada J J, Goldberg R B and Fischer R L 1999 Control of fertilization-independent endosperm development by the MEDEA polycomb gene in Arabidopsis. Proceedings of the National Academy of Sciences 96, 4186-4191. Klass M, John M.C, Crowell DN and Amasino RM 1989 Rapid induction of genomic demethylation and T- DNA gene expression in plant cells by 5-azacytosine derivatives. Plant Mol. Biol. 12: 413-423. Klarzynksi O and Fritig B (2001) Stimulation of plant natural defense C R Acad Sci III 324: 953-963. Klessig D F and Malamy J 1994 The salicylic acid signal in plants. Plant Molecular Biology 26, 1439-1458. Kloepper J W, Reddy M S, Rodriguez-Kabana R, Kenney D S, Kokalis-Burelle N and Martinez-Ochoa N 2004 Application for rhizobacteria in transplant production and yield enhancement. Acta Hortic. 631, 217-229. Kloepper J W, Ryu C-M and Zhang S 2004 Induced Systemic Resistance and Promotion of Plant Growth by Bacillus spp. Phytopathology 94, 1259-1266. Kloek A P, Verbsky M L, Sharma S B, Schoelz J E, Vogel J, Klessig D F and Kunkel B N 2001 Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine-insensitive (coi1) mutation occurs through two distinct mechanisms. The Plant Journal 26, 509-522. Kobryn K and Chaconas G 2002 ResT, a telomere resolvase encoded by the Lyme disease spirochete. Mol Cell 9, 195 - 201. Kohler A, Schwindling S and Conrath U 2002 Benzothiadiazole-induced priming for potentiated responses to pathogen infection, wounding, and infiltration of water into leaves requires the NPR1/NIM1 gene in arabidopsis. Plant Physiology 128, 1046-1056. Kollar A and Seemuller E 1989 Base composition of the DNA of mycoplasmalike organisms associated with various plant diseases. J Phytopathol 127, 177 - 186. Kollar A and Seemuller E 1990 Chemical composition of the phloem exudate of mycoplasma-infected trees. J Phytopathol 128, 99 - 111. Kollar A, Seemuller E, Bonnet F, Saillard C and Bove J 1990 Isolation of the DNA of various plant pathogenic mycoplasmalike organisms from infected plants. Phytopathology 80, 233 - 237. 285 Koltai H, Dhandaydaham M, Opperman C, Thomas J and Bird D 2001 Overlapping plant signal transduction pathways induced by a parasitic nematode and a rhizobial endosymbiont. Molecular Plant Microbe Interactions 14, 1168–1177. Koornneef A and Pieterse C M J 2008 Cross Talk in Defense Signaling. Plant Physiology 146, 839-844. Koornneef A, Verhage A, Leon-Reyes A, Snetselaar R, van Loon L and Pieterse C M 2008 Towards a reporter system to identify regulators of cross-talk between salicylate and jasmonate signaling pathways in Arabidopsis. Arabidopsis. Plant Signal Behav 3. Kosma D K, Nemacheck J A, Jenks M A and Williams C E 2010 Changes in properties of wheat leaf cuticle during interactions with Hessian fly. Plant J. 63, 31–43. Kosman E and Cohen Y 1996 Procedures for calculating and differentiating synergism and antagonism in action of fungicide mixtures. Phytopathology 86, 1263-1272. Kostoff D 1933 Virus diseases causing sterility. Phytopath 5, 593-602. Krishnaveni S, Muthukrishnan S, Liang G, Wilde G, and Manickam A 1999 Induction of chitinases and beta-1,3-glucanases in resistant and susceptible cultivars of sorghum in response to insect attack, fungal infection and wounding. Plant Science 144:9-16. Krizek A and Meyerowitz E M 1996 The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the class B organ identity function. Development 122, 11-22. Krizek B A and Fletcher J C 2005 Molecular mechanisms of flower development: an armchair guide. Nature Reviews Genetics 6 , 688-698. Krüger J, Thomas C M, Golstein C, Dixon M S, Smoker M, Tang S, Mulder L and Jones J D G 2002 A Tomato Cysteine Protease Required for Cf-2-Dependent Disease Resistance and Suppression of Autonecrosis. Science 296, 744-747. Kube M, Beck A, Zinder S, Kuhl H, Reinhardt R and Adrian L 2005 Genome sequence of the chlorinated compound-respiring bacterium Dehalococcoides species strain CBDB1. Nature Biotech 23, 1269 - 1273. Kube M, Schneider B, Kuhl H, Dandekar T, Heitmann K, Migdoll A, Reinhardt R and Seemuller E 2008 The linear chromosome of the plant-pathogenic mycoplasma 'Candidatus Phytoplasma mali'. BMC Genomics 9, 306. 286 Kube M, Schneider B, Kuhl H, Dandekar T and Heitmann K e a 2008 The linear chromosome of the plant- pathogenic mycoplasma “Candidatus Phytoplasma mali”. BMC Genomics Kuc J 1982 Induced immunity to plant disease. Bioscience 32, 854 - 860. Ku ć J 2001 Concepts and Direction of Induced Systemic Resistance in Plants and its Application. European Journal of Plant Pathology 107, 7-12. Kunkel B N and Brooks D M 2002 Cross talk between signaling pathways in pathogen defense. Current Opinion in Plant Biology 5, 325-331. Kumpatla SP, Hall TC. 1998a. Longevity of 5-azacytidine-mediated gene expression and re-establishment of silencing in transgenic rice. Plant Mol. Biol. 38:1113-1122. Kumpatla SP, Hall TC. 1998b. Recurrent onset of epigenetic silencing in rice harboring a multi-copy transgene. Plant J. 14:129-135.Kumpatla SP, Hall TC. 1999. Organizational complexity of a rice transgene locus susceptibleto methylation-based silencing. IUBMB Life 48:459-467. Kumpatla SP, Teng W, Buchholz WG, Hall TC. 1997. Epigenetic transcriptional silencing and5-azacytidine- mediated reactivation of a complex transgene in rice. Plant Physiol. 115:361-373. Kunkel B N, Chen Z 2005 Virulence strategies of plant pathogenic bacteria. In The Prokaryotes: An Evolving Electronic Resource for the Microbiological Community, 3rd edn (Dworkin, M. et al., eds). New York: Springer-Verlag. http://141.150.157.117:8080/prokPUB/index.htm. Kunze G, Zipfel C, Robatzek S, Niehaus K, Boller T and Felix G 2004 The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 16, 3496–3507. Kuske C R and C K B 1992 Phylogenetic relationships between the western aster yellows mycoplasma-like organisms and other prokaryotes established by 16S rRNA gene sequence. . Int. J. Sys. Bacteriol. 42, 75-80. Kwon M O, Wayadande A C and Fletcher J 1999 Spiroplasma citri movement into the intestines and salivary glands of its leafhopper vector, Circulifer tenellus. Phytopathology 89, 1144–1151. L Langer M and Maixner M 2004 Molecular characterization of grapevine yellows associated phytoplasmas of stolbur group based on RFLP-analysis of non-ribosomal DNA. vitis 43, 191-199. 287 Lauer U and Seemuller E 2000 Physical map of the chromosome of the apple proliferation phytoplasma. J Bacteriol 182, 1415 - 1418. Laux T, Mayer K F, Berger J and Jurgens G 1996 The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122, 87–96. Lawrence CB, Josten MHAJ, Tuzun S (1996) Differential induction of pathogenesis-related proteins in tomato by Alternaria solani and the association of basic chitinase isozyme with resistance. Physiol Mol Plant Pathol 48: 361–377 Lawton K, Beck J, Potter S, Ward E and Ryals J 1994 Regulation of cucumber class III chitinase gene expression. Mol Plant-Microbe Interact 7, 48 - 57. Lawton K A, Friedrich L, Hunt M, Weymann K, Delaney T, Kessmann H, Staub T and Ryals J 1996 Benzothiadiazole induces disease resistance in Arabidopsis by activation of the systemic acquired resistance signal transduction pathway. Plant J. 10, 71-82. Lawton K A, Potter S L, Uknes S and Ryals J 1994 Acquired Resistance Signal Transduction in Arabidopsis Is Ethylene Independent. The Plant Cell Online 6, 581-588. Lawton K A, Weymann D, Friedrich L, Vernoij B, Uknes S and Ryals J 1995 Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Molecular Plant Microbe Interactions 8, 863– 870. Lawton K, Uknes S, Friedrich L, Gaffney T, Alexander D, Goodman R, Metraux J-P,Kessmann H, Ahl Goy P, Gut Rella M, Ward E, Ryals J 1993 The molecular biology of systemic acquired resistance. in Mechanisms of Defense Responses in Plants. eds FritigB, LegrandM (Kluwer Academic Publishers, Dordrecht, The Netherlands), pp 410–420. Lay F T and Anderson M A 2005 Defensins--components of the innate immune system in plants. Curr. Protein Pept. Sci. 6, 85-101. Le L Q, Lorenz Y, Scheurer S, Fötisch K, Enrique E, Bartra J, Biemelt S, Vieths S and Sonnewald U 2006 Design of tomato fruits with reduced allergenicity by dsRNAi-mediated inhibition of ns-LTP (Lyc e 3) expression. Plant Biotechnology Journal 4, 231-242. Lebel E, Heifetz P, Thorne L, Uknes S, Ryals J and Ward E 1998 Functional analysis of regulatory sequences controllingPR-1 gene expression in Arabidopsis. The Plant Journal 16, 223-233. 288 Lee I M, Bottner K D, Secor G and V R V 2006b 'Candidatus phytoplasma americanum' a phytoplasma associated with a potato purple top wilt disease complex. International Journal of Systematic and Evoluntionary Microbiology 56, 1593-1597. Lee I M and Davis R E 1988 Detection and investigation of genetic relatedness among aster yellow and other mycoplasma like organism by using cloned DNA and RNA probes. Plant Microbe Interactions 1, 303-310. Lee I M and Davis R E 1992 Mycoplasmas which infect plants and insects. In Mycoplasmas : Molecular Biology and Pathogenesis. Eds. J Maniloff, R N McElhansey, R L Finch and J B Baseman. pp 379- 390. Am. Soc. Microbiol, Washington, DC. Lee I M, Davis R E and Gundersen-Rindal D E 2000 Phytoplasma: phytopathogenic mollicutes. Annu. Rev. Microbiol. 54, 221–255. Lee I M, Gundersen D E, Hammond R W and Davis R E 1994 Use of mycoplasmalike organism (MLO) group-specific oligonucleotide primers for nested-PCR assays to detect mixed-MLO infections in a single host plant. Phytopathology 84, 559-566. Lee I M, Gundersen-Rindal D E and Bertaccini A 1998 Phytoplasma: Ecology and genomic diversity. Phytopathol 88, 1359-1366. Lee I M, Pastore M, Vibio M, Danielle A, Attathom S, Davis R E and A B 1997b Detection and characterization of a phytoplasma associated with annual blue grass (Poa annua) white leaf disease in southern Italy. European Journal of Plant Pathology 103, 251-254. Lee I M, Zhao Y and D B K 2006a SecY gene sequence analysis for finer differentiataion of diverse straints in the aster yellows phytoplasma group. Molecular and Cellular Probes 20, 87-91. Lee I-M, Bottner-Parker K D, Zhao Y, Davis R E and Harrison N A 2010 Phylogenetic analysis and delineation of phytoplasmas based on secY gene sequences. International Journal of Systematic and Evolutionary Microbiology 60, 2887-2897. Lee O S, Lee B, Park N, Koo J C, Kim Y H, Prasad D T, Karigar C, Chun H J, Jeong B R, Kim D H, Nam J, Yun J-G, Kwak S-S, Cho M J and Yun D-J 2003 Pn-AMPs, the hevein-like proteins from Pharbitis nil confers disease resistance against phytopathogenic fungi in tomato, Lycopersicum esculentum. Phytochemistry 62, 1073-1079. 289 Legendre L, Heinstein P F and Low P S 1992 Evidence for participation of GTP-binding proteins in elicitation of the rapid oxidative burst in cultured soybean cells. Journal of Biological Chemistry 267, 20140-20147. Lenhard M, Bohnert A, Jürgens G and Laux T 2001 Termination of stem cell maintenance in Arabidopsis floral meristems by interactions between WUSCHEL and AGAMOUS. Cell 105, 805-814. Lenhard M, Jurgens G and Laux T 2002 The WUSCHEL and SHOOTMERISTEMLESS genes fulfil complementary roles in Arabidopsis shoot meristem regulation Development 129, 3195–3206. Leonhardt H, Page A W, Weier H-U and Bestor T H 1992 A targeting sequence directs DNA methyltransferase to sites of DNA replication in mammalian nuclei. Cell 71, 865-873. Lepka P, Stitt M, Moll E and Seemüller E 1999 Effect of phytoplasmal infection on concentration and translocation of carbohydrates and amino acids in periwinkle and tobacco. Physiol. Mol. Plant Pathol. 55, 59-68. Lherminier J, Prensier G, Boudon-Padieu E and Caudwell A 1990 Immunolabeling of grapevine flavescence doreeMLOin salivary glands of Euscelidius variegatus: a light and electronmicroscopy study J. Histochem. Cytochem. , 79–85. Li C, Bonnema G, Che D, Dong L, Lindhout P, Visser R. and Bai Y 2007 Biochemical and molecular mechanisms involved in monogenic resistance responses to tomato powdery mildew. Mol. Plant Microbe Interact ., 20, 1161-1172. Li L C 2006 Small dsRNAs induce transcriptional activation in human cells. Proc. Natl Acad. Sci. USA 103, 17337-17342. Li E, Beard C, Jaenisch R 1993 Role for DNA methylation in genomic imprinting. Nature 366:362–65 Liang P and Pardee A 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967 - 971. Liefting L, Havukkala I, Andersen M, Lough T and Beever R 2006 The complete genome sequence of 'Candidatus Phytoplasma australiense'. Proc 16th Congr Int Org Mycoplasmol , 9-14 July 2006, Cambridge, UK, 43 - 43. 290 Liefting L and Kirkpatrick B 2003 Cosmid cloning and sample sequencing of the genome of the uncultivable mollicute, Western X-disease phytoplasma, using DNA purified by pulsed-field gel electrophoresis. FEMS Microbiol Lett 221, 203 - 211. Lin Y, Kieser H, Hopwood D and Chen C 1993 The chromosomal DNA of Streptomyces lividans 66 is linear. Mol Microbiol 10, 923 - 933. Linthorst H J, Danhash N, Brederode F T, Van Kan J A, De Wit P J and Bol J F 1991 Tobacco and tomato PR proteins homologous to win and pro-hevein lack the "hevein" domain. Mol. Plant Microbe Interact 4, 586-592. Lister R 2008 Highly integrated single base resolution maps of the epigenome in Arabidopsis. Cell 133, 523- 536. Lita P Y, Miller A K and Clark S E 2003 POLTERGEIST encodes a protein phosphatase 2C that regulates CLAVATA pathways controlling stem cell identity at Arabidopsis shoot and flower meristems. Curr. Boil. 13, 179-188. Liu D, Raghothama KG, Hasegawa PM, Bressan RA (1994) Osmotin overexpression in potato delays development of disease symptoms. Proc Natl Acad Sci USA 91: 1888–1892. Liu J J, Ekramoddoullah A K, Piggott N, Zamani A. 2005 Molecular cloning of a pathogen/wound- inducible PR10 promoter from Pinus monticola and characterization in transgenic Arabidopsis plants. Planta ;221:159–69. Liu C, Thong Z and Yu H 2009 Coming into bloom: the specification of floral meristems. Development 136, 3379–3391. Liu C, Zhou J, Bracha-Drori K, Yalovsky S and ItoT Y 2007 Specification of Arabidopsis floralmeristem identity by repression of flowering time genes. Development 134, 1901–1910. Liu J J, Ekramoddoullah A K. The family 10 of plant pathogenesis-related proteins: Their structure, regulation, and function in response to biotic and abiotic stresses. Physiol Mol Plant Pathol 2006;68:3–13. Liu H Y, Gumpf D J, Oldfield G N and Calavan E C 1983 The relationship of Spiroplasma citri and Circulifer tendellus. Phytopathology 73, 585-590. 291 Liu Y, Oakeley E J, Sun L and Jost J P 1998 Multiple domains are involved in the targeting of the mouse DNA methyltransferase to the DNA replication foci. Nucl. Acids Res 26, 1038–1045. Liu Y, Schiff M and Dinesh-Kumar S P 2002 Virus-induced gene silencing in tomato. The Plant Journal 31, 777-786. Liu H Y, Gumpf D J, Oldfield G N, Calavan E C 1983 The relationship of Spiroplasma citri and Circulifer tenellus . Phytopathology 73 , 585-590. Liu Y, Zhang S and Klessig D 2000 Molecular cloning and characterization of a tobacco MAP kinase kinase that interacts with SIPK. Mol Plant-Microbe Interact 13, 118 - 124. Loake G and Grant M 2007 Salicylic acid in plant defence—the players and protagonists. Current Opinion in Plant Biology 10, 466-472. Lohmann J U, Hong R L, Hobe M, Busch M A, Parcy F, Simon R and Weigel D 2001 A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell 105, 793-803. Lohmann J U and Weigel D 2002 Building beauty: The genetic control of floral patterning. Developmental cell 2, 135-142. López M A, Bannenberg G and Castresana C 2008 Controlling hormone signaling is a plant and pathogen challenge for growth and survival. Current Opinion in Plant Biology 11, 420-427. Lorenzo O and Solano R 2005 Molecular players regulating the jasmonate signalling network. Current Opinion in Plant Biology 8, 532-540. LoSchiavo F, Pitto L, Giuliano G, Torti G, Nuti-Ronchi V, Marazziti D, Vergara R, Orselli S and Terzi M 1989 DNA methylation of embryogenic carrot cell cultures and its variations as caused by mutation, differentiation, hormones and hypomethylating drugs. TAG Theoretical and Applied Genetics 77, 325-331. Louws F J, Wilson M, Campbell H L, Cuppels D A, Jones J B, Shoemaker P B, Sahin F and Miller S A 2001 Field control of bacterial spot and bacterial speck of tomato using a plant activator. Plant Disease 85, 481-488. Lowe T and Eddy S 1997 tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25, 955 - 964. 292 Lu R 2005 Animal virus replication and RNAi-mediated antiviral silencing in Caenorhabditis elegans. Nature 436, 1040-1043. Luderer R, De Kock M J D, Dees R H L, De Wit P J G M and Joosten M H A J 2002 Functional analysis of cysteine residues of ECP elicitor proteins of the fungal tomato pathogen Cladosporium fulvum. Molecular Plant Pathology 3, 91-95. Ludwig W, Schleifer K H and Whitman W B 2009 Revised road map to the phylum Firmicutes. In In Bergey’s Manual of Systematic Bacteriology. Eds. P D Vos, G Garrity, D Jones, N R Krieg and W e a Ludwig, New York: Springer-Verlag. Lund S T, Stall R E and Klee H J 1998 Ethylene regulates the susceptible response to pathogen infection in tomato. pp 371-382. M Mackintosh CA, Lewis J, Radmer LE, Shin S, Heinen SJ, et al. (2007) Overexpression of defense response genes in transgenic wheat enhances resistance to Fusarium head blight. Plant Cell Rep 26: 479–488. MacLean A M, Sugio A, Kingdom H N, Grieve V M and Hogenhout S A 2011 Arabidopsis thaliana as amodel plant for understanding phytoplasmas interactions with plant and insect hosts. Bull. Insectology. In Press. Madigan M T, Martinko J M and Parker J 2003 Brock biology of microorganisms. Pearson Education, Inc, Upper Saddle River, NJ. Madamanchi N R and Kuc J 1991 Induced systemic resistance in plants. In the fungal spore and diseases initiaton in plants and animals. New Yark: Plenum press, pp 347-365. m(1991)Induced systemic resistance Mathieu O, Reinders J, Caikovski M, Smathajitt C, Paszkowski J. 2007. Transgenerational stability of the Arabidopsis epigenome is coordinated by CG methylation. Cell 130:851–62. Maillet, P.L., and Gouranton, L. 1971. Étude du cycle biologique du mycoplasma de la phyllodie du trèfle dans l'insecte vecteur Euscelis lineolatus Brullé (Homoptéra, Jassidae). Journal of Microscopy , 11: 143–162. Malamy J, Carr J, Klessig D and Raskin I 1990 Salicylic acid: A likely endogenous signal in the resistance response of tobacco to viral infection. Science 250, 1002 - 1004. 293 Malamy J, Sanchez-Casas P, Henning J, Guo A and Klessig D 1996 Dissection of the salicylic acid signaling pathway in tobacco. Mol Plant-Microbe Interact 9, 474 - 482. Maleck K and Dietrich RA 1999 Defense on Arabidopsis thaliana leads to attraction of the parasimultiple fronts: how do plants cope with diverse ene- toid Cotesia rubecula: chemical, behavioral and genemies Trends Plant Sci. 4, 215-219. Milligan S B and Gasser C S 1995 Nature and regulation of pistil-expressed genes in tomato. Plant Mol. Biol., 28, 691-711. Milligan S B, Bodeau J, Yaghoobi J, Kaloshian I, Zabel P and Williamson V M 1998 The root knotnematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell,10, 1307-1319. Manes C-L, Beeckman T, Ritsema T, Van Montagu M, Goethals K and Holsters M 2004 Phenotypic alterations in Arabidopsis thaliana plants caused by Rhodococcus fascians infection. Journal of Plant Research 117, 139-145. Maniloff J 2002 Phylogeny and evolution. Molecular biology and pathogenicity of mycoplasmas, 31 - 43. Mansfield J W 1983 Antimicrobial compounds. In Biochemical Plant Pathology. Ed. J A Callow. pp 237- 265. Chichester, UK: John Wiley Sons. Maramorosch K 1985 Beneficial effect of virus diseased plants on non-vector insects. Tijdschr. Plantenziekten 63, 383–391. Marchoux G, Giannotti J and Laterrot H 1969 Le stolbur P, une nouvelle maladie de type jaunisse chez la tomate. Symptômes et examen cytologique des tissus au microscope électronique. Ann. Phytopathol. 4, 633-640. Marchoux G and Messiaen C M 1967 Note sur le virus du stolbur de la tomate chez le piment. Etudes de virologie. Ann. Epiphyties 18, 179-182. Marcone C, Neimark H, Ragozzino A, Lauer U and Seemuller E 1999 Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopathology 89, 805 - 810. Marcone C, Ragozzino A and SeemÜLler E 1997 Detection and identification of phytoplasmas in yellows- diseased weeds in Italy. Plant Pathology 46, 530-537. 294 Marcone C and Seemuller E 2001 A chromosome map of the European stone fruit yellows phytoplasma. Microbiology 147, 1213 - 1221. Markham P G 1983 Spiroplasmas in leafhoppers: a review. Yale J. Biol. Med 56, 745–751. Martienssen R A and Colot V 2001 DNA methylation and epigenetic inheritance in plants and filamentous fungi. Science 293, 1070-1074. Martinez d I O, Xie Q and Kaloshian I 2003 Aphid-Induced Defense Responses in Mi-1-Mediated Compatible and Incompatible Tomato Interactions. Molecular Plant-Microbe Interactions 16, 699- 708 Martini M, Botti S, Marcone C, Marzach ı C, Casati P, Bianco P A, Benedetti R and Bertaccini A 2002 Genetic variability among flavescence dorée phytoplasmas from different origins in Italy and France. Molecular and Cellular Probes 16, 197-208. Martini M, Lee I M, Bottner K D, Zhao Y, Botti S, Bertaccini A, Harrison N A, Carraro L, Marcone C, Khan A J and Osler R 2007 Ribosomal protein gene-based phylogeny for finer differentiation and classification of phytoplasmas. Int J Syst Evol Microbiol. 57, 2037-2051. Martin-Trillo M and Cubas P 2010 TCP genes: a family snapshot ten years later. Trends Plant Sci. 15, 31– 39. Marwitz R, Petzold H and Ozel M 1974 Untersuchungen zur Ubertragbarkeit des moglichen Erregers der Triebsucht des Apfels auf einen krautigen Wirt. Phytopathol Z 81, 85 - 91. Mattoo A K and Suttle J C 1991 The plant hormone ethylene. Boca Raton, FA: CRC Press, Inc. Matzke M, Kanno T, Huettel B, Daxinger L, Matzke AJ 2007Targets of RNA-directed DNA methylation. Curr Opin Plant Biol 10:512-519 Matzke M A and Birchler J A 2005 RNAi-mediated pathways in the nucleus. Nature Rev. Genet. 6, 24-35. Mauch F, Mauch-Mani B and Boller 1988 Antifungal hydrolases in pea tissue. II. Inhibition of fungal growth by combinations of chitinases and b-1, 3-glucanase. Plant Physiology 88, 936–942. Mauch-Mani B and Mauch F 2005 The role of abscisic acid in plant–pathogen interactions. Current Opinion in Plant Biology 8, 409-414. Mauch-Mani, B, Métraux J.P. (1998). Salicylic Acid Systemic Acquired Resistance to Pathogen Attack. Annals of Botany, 82 : 535-540. 295 Mauch-Mani B and Slusarenko A J 1996 Production of salicylic acid precursors is a major function of phenylalanine ammonia lyase in the resistance of Arabidopsis to Perenospora parasitica. The Plant Cell 8, 203–212. Mauch F, Mauch-Mani B, Gaille C, Kull B, Haas D and Reimmann C 2001. Manipulation of salicylate content in Arabidopsis thaliana by the expression of an engineered bacterial salicylate synthase. Plant J. 25(1):62-77. Maust B E, Espedas F, Talavera C, Aguilar M, Santamaria J M and Oropeza C 2003 Changes in carbohydrate metabolism in coconut palms infected with the lethal yellowing phytoplasma. Phytopathology 93, 976-981. Maixner M 1994 Transmission of German grapevine yellows (Vergilbungskrankheit) by the planthopper Hyalesthes obsoletus (Auchenorrhyncha: Cixiidae). Vitis 33 : 103–104. Mayer C J, Vilcinskas A and Gross J 2008 Pathogen-induced release of plant allomone manipulates vector insect behavior. J. Chem. Ecol 34, 1518–1522. Mayer C J, Vilcinskas A and Gross J 2008 Phytopathogen lures its insect vector by altering host plant odor. J. Chem. Ecol. 34, 1045–1049. McDowell J M and Dangl J L 2000 Signal transduction in the plant immune response. Trends in Biochemical Sciences 25, 79-82. McCoy RE, Caudwell A, Chang C J, Chen T-A, Chiykowski L N 1989 Plant diseases associated with mycoplasma-like organisms. In The Mycoplasmased.R F Whitcomb, JG Tully, 5:545–60. NewYork: Academic. McDowell J M and Simon S 2008 Molecular diversity at the plant-Pathogen interface. Developmental Comparative Immunology 32, 736-744. Mei C, Qi M, Sheng G and Yang Y (2006). Inducible overexpression of a rice allene oxide synthase gene increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal infection. Mol. Plant Microbe Interact. 19: 1127-1137. Meissner R, Jacobson Y, Melamed S, Levyatuv S, Shalev G, Ashri A, Elkind Y and Levy A 1997 A new model system for tomato genetics. The Plant Journal 12, 1465-1472. 296 Memelink J, Linthorst HJM, Schilperoort RA, Hoge JHC (1990) Tobacco genes encoding acidic and basic isoforms o f pathogenesis- related proteins display different expression patterns. PlantMo1 Biol 14: 119-126 Merkouropoulos. G and Shirsat. A. 2003. The unusual Arabidopsis extensin gene atExt1 is expressed throughout plant development and is induced by a variety of biotic and abiotic stresses. Planta, 217: 356–366 Messiaen C M and Marrou J 1967 Comparaison de la virulence sur diverses solanacées de trois souches de stolbur et d’un virus attaquant la tomate. Etudes de virologie. Ann. Epiphyties 18, 173-178. Métraux J P, Ahl Goy P, Staub T, Speich J, Steinemann A and Ryals J 1991 Induced resistance in cucumber in response to 2,6-dichloroisonicotinic acid and pathogens. In Advances in molecular genetics of plant-microbe interactions. Eds. H Hennecke and D P S Verma. pp 432–439, Dordrecht, The Netherlands. Metraux J-P, Burkhart W, Moyer M, Dincher S, Middlesteadt W, Williams S, Payne G, Carnes M and Ryals J 1989 Isolation of a complementary DNA encoding a chitinase with structural homology to a bifunctional lysosyme / chitinase. Proc Natl Acad Sci U S A 86, 896 - 900. Metraux J-P, Signer H, Ryals J, Ward E, Wyss-Benz M, Gaudin J, Rascdorf K, Schmid E, Blum W and Inverardi B 1990 Increase in salicylic acid at the onset of systemic acquired resistance in cucumber. Science 250, 1004 - 1006. Miles R 1992 Catabolism in Mollicutes. J Gen Microbiol 138, 1773 - 1783. Milligan S B and Gasser C S 1995 Nature and regulation of pistil-expressed genes in tomato. Plant Molecular Biology 28, 691-711. Mitrovi ć J, Kakizawa S, Duduk B, Oshima K, Namba S and Bertaccini A 2011 The groEL gene as an additional marker for finer differentiation of ‘Candidatus Phytoplasma asteris'-related strains. Annals of Applied Biology 159, 41-48. Mittapalli O, Shukle R H, Sardesai N, Giovanini M P and Williams C E 2006 Expression patterns of antibacterial genes in the Hessian fly. Journal of Insect Physiology 52, 1143-1152. 297 Moore S, Payton P, Wright M, Tanksley S and Giovannoni J 2005 Utilization of tomato microarrays for comparative gene expression analysis in the Solanaceae. Journal of Experimental Botany 56, 2885- 2895. Mooney K A, Halitschke R, Kessler A, and Agrawal A A 2010 Evolutionary trade-offs in plants mediate the strength of trophic cascades. Science 327:1642–1644. Morales-Ruiz T 2006 DEMETER and REPRESSOR OF SILENCING 1 encode 5-methylcytosine DNA glycosylases. Proc. Natl Acad. Sci. USA 103, 6853-6858. Moran P J, Cheng Y, Cassell J L and Thompson G A 2002 Gene expression profiling of Arabidopsis thaliana in compatible plant-aphid interactions. Archives of Insect Biochemistry and Physiology 51, 182-203. Moran P J and Thompson G A 2001 Molecular Responses to Aphid Feeding in Arabidopsis in Relation to Plant Defense Pathways. pp 1074-1085. Moraes M G 1998 Mecanismos da resistência sistêmica adquirida em plantas. In: Luz WC, Fernandes JM, Prestes AM, Picinini EC Revisão Anual de Patologia de Plantas. Passo Fundo, Embrapa Trigo 6:261- 284. Mori Y, Nishimura T and Koshiba T 2005 Vigorous synthesis of indole-3-acetic acid in the apical very tip leads to a constant basipetal flow of the hormone in maize coleoptiles. Plant Science 168, 467-473. Morris S W, Vernooij B, Titatarn S, Starrett M, Thomas S, Wiltse C C, Frederiksen R A, Bhandhufalck A, Hulbert S and Uknes S 1998 Induced Resistance Responses in Maize. Molecular Plant-Microbe Interactions 11, 643-658. Mudgett M B 2005 New insights to the function of phytopathogenic bacterial type III effectors in plants. pp 509-531 Mur L A J, Kenton P, Atzorn R, Miersch O and Wasternack C 2006 The Outcomes of Concentration- Specific Interactions between Salicylate and Jasmonate Signaling Include Synergy, Antagonism, and Oxidative Stress Leading to Cell Death. Plant Physiology 140, 249-262. Murral D J, Nault L R, Hoy C W, Madden L V and Miller S A 1996 Effects of temperature and vector age on transmission of two Ohio strains of aster yellows phytoplasma by the aster leafhopper. J. Econ. Entomol 89, 1223–1232. 298 Mushegian A R and Koonin E V 1996 A minimal gene set for cellular life drived by comparison of complete bacterial genomes. Proc. Natl. Acad. Sci. USA 93, 10268-10273. N Nakabachi A, Yamashita.A., Toh H, Ishikawa H, Dunbar H, Moran N and Hattori M 2006 The 160-kilobase genome of the bacterial endosymbiont Carsonella. Science 314, 267. Nakai K and Horton P 1999 PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem. Sci. 24, 34–36. Namba S, Kato S, Iwanamic S, Oyaizu H, Shioawa H and Tsuchizaki T 1993 Detection and differentiation of plant-pathogenic mycoplasmalike organisms using polymerse chain reaction. Phyopathology 83, 786-791. Namba S, Oshima K and Gibb K 2005 Phytoplasma genomics. Mycoplasmas: Molecular Biology, Pathogenicity and Strategies for Control, 97 - 133. Narusaka Y, Narusaka M, Horio T and Ishii H 1999 Comparison of local and systemic induction of acquired disease resistance in cucumber plants treated with benzothiadiazoles or salicylic acid. Plant Cell Physiol 40, 388 - 395. Nault L R 1980 Maize bushy stunt and corn stunt: a comparison of disease symptoms, pathogen host ranges and vectors. Phytopathology 70, 659-662. Nault L R 1990 Evolution of an insect pest: maize and the corn leafhopper, a case study. Maydica 35, 165– 175. Nault L R 1997 Arthropod transmission of plant viruses: a new synthesis. Ann. Entomol. Soc. Am 90, 521– 541. Navrátil M, Válová P, Fialová R, Lauterer P, Šafá řová D and Starý M 2009 The incidence of stolbur disease and associated yield losses in vegetable crops in South Moravia (Czech Republic). Crop Protection 28, 898-904. Nawrath C and Métraux J-P 1999 Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. pp 1393-1404. Niderman T, Genetet I, Bruyere T, Gees R, Stintzi A, Legrand M, Fritig B and Mosinger E 1995 Pathogenesis-related PR-1 proteins are antifungal (isolation and characterization of three 14- 299 kilodalton proteins of tomato and of a basic PR-1 of tobacco with inhibitory activity against phytophthora infestans). Plant Physiology 108, 17-27. Nielsen H, Engelbrecht J, Brunak S and von Heijne G 1997 Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10, 1–6. Nimchuk Z, Eulgem T, Holt B F 3rd, Dangl J L 2003 Recognition and response in the plant immune system. Annu Rev Genet 37: 579–609. Nishida H and Sugiyama J 1993 Phylogenetic relationships among taphrina, saitoella, and other higher fungi. Mol Biol Evol 10, 431–436. Nishimura M T and Dangl J L 2010 Arabidopsis and the plant immune system. Plant J. 61, 1053–1066. Niven D J and Jones R A 1987 Tomato Biotechnology. New York: Alan R. Liss, Inc. Norman-Setterblad C, Vidal S, Palva T E 2000 Interacting signal pathways control defense gene expression in Arabidopsis in response to cell wall-degrading enzymes from Erwinia carotovora. Molecular Plant-Microbe Interactions 13, 430–438. Nürnberger T, Brunner F, Kemmerling B and Piater L 2004 Innate immunity in plants and animals: striking similarities and obvious differences. Immunological Reviews 198, 249-266. Nürnberger T and Scheel D 2001 Signal transmission in the plant immune response. Trends Plant Sci. 6(8):372-379. O Obradovic A, Jones J B, Momol M T, Olson S M, Jackson L E, Balogh B, Guven K and Iriarte F B 2005 Integration of biological control agents and systemic acquired resistance inducers against bacterial spot on tomato. Plant Disease 89, 712-716. O'Donnell P, Truesdale M, Calvert C, Dorans A, Roberts M and Bowles D 1998 A novel tomato gene that rapidly responds to wound- and pathogen-related signals. Plant J 14, 137 - 142. O'Donnell P J, Calvert C, Atzorn R, Wasternack C, Leyser H M O and Bowles D J 1996 Ethylene as a Signal Mediating the Wound Response of Tomato Plants. pp 1914-1917. O'Donnell P J, Jones J B, Antoine F R, Ciardi J and Klee H J 2001 Ethylene-dependent salicylic acid regulates an expanded cell death response to a plant pathogen. The Plant Journal 25, 315-323. 300 O'Donnell P J, Schmelz E, Block A, Miersch O, Wasternack C, Jones J B and Klee H J 2003 Multiple Hormones Act Sequentially to Mediate a Susceptible Tomato Pathogen Defense Response. pp 1181- 1189. O'Donnell P J, Schmelz E A, Moussatche P, Lund S T, Jones J B and Klee H J 2003 Susceptible to intolerance – a range of hormonal actions in a susceptible Arabidopsis pathogen response. The Plant Journal 33, 245-257. Ohto M-a, Onai K, Furukawa Y, Aoki E, Araki T and Nakamura K 2001 Effects of sugar on vegetative development and floral transition in arabidopsis. Plant Physiology 127, 252-261. Oldfield G N, Kaloostain G H, Pierce H D, Calavan E C, Granett A L and VBlue R L 1976 Beet leafhopper transmit citrus stubborn disease. California Agriculture 30, 15. Olhoft P M 1998 Cloning and characterization of the 5-methylcytosine methyltransferase gene in maize (Zea mays) plants and tissue cultures. PhD thesis, University of Minnesota, St Paul, MN. Ongena M, Daayf F, Jacques P, Thonart P, Benhamou N, Paulitz T, Cornelis P, Koedam N and Belanger R 1999 Protection of cucumber against Pythium root rot by fluorescent pseudomonads: predominant role of induced resistance over siderophores and antibiosis. Plant Pathol 48, 66 - 76. Ongena M, Duby F, Jourdan E, Beaudry T, Jadin V, Dommes J and Thonart P 2005 Bacillus subtilis ; M4 decreases plant susceptibility towards fungal pathogens by increasing host resistance associated with differential gene expression. Applied Microbiology and Biotechnology 67, 692-698. Osborn RW, De Samblanx GW, Thevissen K, Goderis I, Torrekens S, Van Leuven F, Attenborough S, Rees SB, Broekaert WF (1995) Isolation and characterisation of plant defensins from seeds of Asteraceae, Fabaceae, Hippocastanaceae and Saxifragaceae. FEBS Lett 368:257–262. Osborn A E 1996 Preformed Antimicrobial Compounds and Plant Defense against Funga1 Attack. The Plant Cell, Vol. 8, 1821-1831. Oshima K, Kakizawa S, Arashida R, Ishii Y, Hoshi A, Hayashi Y, Kagiwada S and Namba S 2007 Presence of two glycolytic gene clusters in a severe pathogenic line of Candidatus Phytoplasma asteris. Mol Plant Pathol 8, 481 - 489. 301 Oshima K, Kakizawa S, Nishigawa H, Jung H-Y, Wei W, Suzuki S, Arashida R, Nakata D, Miyata S-i, Ugaki M and Namba S 2004 Reductive evolution suggested from the complete genome sequence of a plant-pathogenic phytoplasma. Nat Genet 36, 27-29. Oostendorp M, Kunz W, Dietrich B and Staub T 2001 Induced Disease Resistance in Plants by Chemicals. European Journal of Plant Pathology 107, 19-28. Ozbek E, Miller S A, Meulia T and Hogenhout S A 2003 Infection and replication sites of Spiroplasma kunkelii (Class: Mollicutes) in midgut and Malphagian tubules of the leafhopper Dalbulus maidis. J. Invertebr. Pathol 82, 167–175. P Padovan A, Firrao G, Schneider B and Gibb K 2000 Chromosome mapping of the sweet potato little leaf phytoplasma reveals genome heterogeneity within the phytoplasmas. Microbiology 146, 893 - 902. Pancheva T V, Popova L P and Uzunova A N 1996 Effects of salicylic acid on growth and photosynthesis in barley plants. Plant Physiol. 149, 57-63. Parcy F, Nilsson O, Busch M A, Lee I and Weigel D 1998 A genetic framework for floral patterning. Nature 395, 561-566. Park C J, Kim K J, Shin R, Park J M, Shin Y C, Paek K H. Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J 2004;37:186–98. Parker J E 2003 Plant recognition of microbial patterns. Trends Plant Sci. 8(6):245-247. Paro R and Hogness D S 1991 The Polycomb protein shares a homologous domain with a heterochromatin- associated protein of Drosophila. Proceedings of the National Academy of Sciences 88, 263-267. Pavet V, Quintero C, Cecchini N M, Rosa A L and Alvarez M E 2006 Arabidopsis Displays Centromeric DNA Hypomethylation and Cytological Alterations of Heterochromatin Upon Attack by Pseudomonas syringae. Molecular Plant-Microbe Interactions 19, 577-587. Pedley K F and Martin G B 2003 Molecular basis of Pto-mediated resistance to bacterial speck disease in tomato. Annual Review of Phytopathology 41, 215-243. Peña-Cortés H, Fisahn J and Willmitzer L 1995 Signals involved in wound-induced proteinase inhibitor II gene expression in tomato and potato plants. Proceedings of the National Academy of Sciences 92, 4106-4113. 302 Penninckx I A M A, Thomma B P H J, Buchala A, Métraux J-P and Broekaert W F 1998 Concomitant Activation of Jasmonate and Ethylene Response Pathways Is Required for Induction of a Plant Defensin Gene in Arabidopsis. The Plant Cell Online 10, 2103-2114. Penterman J 2007 DNA demethylation in the Arabidopsis genome. Proc. Natl Acad. Sci. USA 104, 6752- 6757. Peng J, Deng X, Huang J, Jia S, Miao X, and Huang Y 2004 Role of Salicylic Acid in Tomato Defense against Cotton Bollworm, Helicoverpa armigera Hubner. Z. Naturforsch. 59c, 856-862. Penterman J, Uzawa R and Fischer R L 2007 Genetic Interactions between DNA Demethylation and Methylation in Arabidopsis. Plant Physiology 145, 1549-1557. Perez-Donoso A G, Sun Q, Roper M C, Greve L C, Kirkpatrick B and Labavitch J M 2010 Cell wall– degrading enzymes enlarge the pore size of intervessel pit membranes in healthy and Xylella fastidiosa–infected grapevines. Plant Physiol 152, 1748–1759. Petrášek J, Mravec J, Bouchard R, Blakeslee J J, Abas M, Seifertová D, Wi śniewska J, Tadele Z, Kubeš M, Čovanová M, Dhonukshe P, Sk ůpa P, Benková E, Perry L, K řeček P, Lee O R, Fink G R, Geisler M, Murphy A S, Luschnig C, Zažímalová E and Friml J 2006 PIN proteins perform a rate-limiting function in cellular auxin efflux. Science 312, 914-918. Pieterse C M J, Antonio Leon-Reyes, Sjoerd Van der Ent and Saskia C M Van Wees, 2009 Networking by small-molecule hormones in plant immunity. Nature Chemical Biology 5, 308 – 316. Pieterse C and Van Loon L 1999 Salicylic acid-independent plant defence pathways. Trends Plant Sci 4, 52 - 58. Pieterse C, van Wees S, Hoffland E, van Pelt J and van Loon L 1996 Systemic resistance in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis- related gene expression. Plant cell 8, 1225 - 1237. Pieterse C M J and Dicke M 2007 Plant interactions with microbes and insects: from molecular mechanisms to ecology. Trends in Plant Science 12, 564-569. Pieterse C M J, Ton J and Van loon L C 2001 Cross-talk between plant defenses signaling pathways: boost or burden. Ag. Biotech.Net, 8, 1- 8. 303 Pieterse C M J, Van Wees S C M, Ton J, Van Pelt J A and Van Loon L C 2002 Signaling in rhizobacteria- induced systemic resistance in Arabidopsis thaliana. Plant biol (Stuttg) 4, 535,544. Pieterse C M J, van Wees S C M, van Pelt J A, Knoester M, Laan R, Gerrits H, Weisbeek P J and van Loon L C 1998 A Novel Signaling Pathway Controlling Induced Systemic Resistance in Arabidopsis. The Plant Cell Online 10, 1571-1580. Piggott N, Ekramoddoullah AKM, Liu JJ, Xu XS. 2004. Gene cloning of a thaumatin-like (PR5) protein of western pine (Pinus monticola D.Don) and expression studies of the PR-5 group. Physiological andMolecular Plant Pathology 64: 1–8. Pikaard C S 2006 Cell biology of the arabidopsis nuclear siRNA pathway for RNA-directed chromatin modification. Cold Spring Harbor Symposia on Quantitative Biology 71, 473-480. Pinto P M and Ricardo C 1995 Lupinus albus L. Pathogenesis-Related Proteins That Show Similarity to PR- 10 Proteins. Plant Physiology 109, 1345-1351. Ploaie P G 1981 Mycoplasma-like organisms and plant diseases in Europe. Pages 61-104 In Plant Diseases and Vectors: Ecology and Epidemiology. Maramorosch, K., and Harris, K. F., Academic Press, New York. Potlakayala SD, Reed DW, Covello PS, Fobert PR. Systemic acquired resistance in canola is linked with pathogenesis-related gene expression and requires salicylic acid. Phytopathology 2007;97:794–802 Poelman E H, van Loon J J A and Dicke M 2008 Consequences of variation in plant defense for biodiversity at higher trophic levels. Trends in Plant Science 13, 534-541. Pollack J 1992 Carbohydrate metabolism and energy conservation. Mycoplasmas. Molecular Biology and Pathogenesis, 181 - 200. Pollack J 2002 Central carbohydrate pathways: Metabolic flexibility and the extra role of some "housekeeping" enzymes. Molecular Biology and Pathogenicity of Mycoplasmas, 163 - 199. Pollack J, Williams M and McElhaney R 1997 The comparative metabolism of mollicutes (mycoplasmas): The utility for taxonomic classification and the relationship of putative gene annotation and phylogeny to enzymatic function in the smallest free-living cells. Crit Rev Microbiol 23, 269 - 354. 304 Pontes O 2006 The Arabidopsis chromatin-modifying nuclear siRNA pathway involves a nucleolar RNA processing center. Cell 126, 79-92. Pontier D, Balagué C and Roby D 1998 The hypersensitive response. A programmed cell death associated with plant resistance. Comptes Rendus de l'Académie des Sciences - Series III - Sciences de la Vie 321, 721-734. Potenza C, Thomas S H and Sengupta-Gopalan C 2001 Genes induced during early response to Meloidogyne incognita in roots of resistant and susceptible alfalfa cultivars. Plant Science 161, 289-299. Pozo M J, Van Loon L C and Pieterse C M J 2004 Jasmonates - Signals in Plant-Microbe Interactions. Journal of Plant Growth Regulation 23, 211-222. Pracros P, Desqué D, Baron J, Bonnet P, Foissac X and Garnier M 2001 Phylogenic characterisation of phytoplasma isolates maintained in the sieve tube-restricted bacterial pathogens collection in Bordeaux. In 14th Int Cong IOM, Vienna, Austria. Pracros P, Hernould M, Teyssier E, Eveillard S and Renaudin J 2007 Stolbur phytoplasma-infected tomato showed alteration of SlDEF methylation status and deregulation of methyltransferase genes expression. Bull. Insectology 60, 221–222. Pracros P, Renaudin J, Eveillard S, Mouras A and Hernould M 2006 Tomato flower abnormalities induced by stolbur phytoplasma infection are associated with changes of expression of floral development genes. Mol. Plant-Microbe Interact. 19, 62–68. Pradhan S, Cummings M, Roberts R J and Adams R L P 1998 Isolation, characterization and baculovirus- mediated expression of the cDNA encoding cytosine DNA methyltransferase from Pisum sativum. Nucl. Acids Res. 26 1214–1222. Pressey R 1997 Two isoforms of NP24: a thaumatin-like protein in tomato fruit. Phytochemistry , 44, 1241- 1245. Prince J P, Davis R E, Wolft K, Ing-Ming L, Mogen B D, Dally A E L, Bertaccina A, Credi R and Barba M 1993 Molecular detection of diverse mycoplasmalike organims (MLOs) associated with grapevine yellows and their classification with aster yellows, X-disease, and elm yellows MLOs. Phyopathology 83, 1130-1137. 305 Pruss G, Ge X, Shi X M, Carrington J C and Vance V B 1997 Plant viral synergism: The potyviral genome encodes a broad-range pathogenicity enhancer that transactivates replication of heterologous viruses. The Plant Cell Online 9, 859-868. Preuss S, Pikaard CS. 2007.rRNAgene silencing and nucleolar dominance: insights into a chromosomescale epigenetic on/off switch. Biochim. Biophys. Acta 1769:383–92. Purcell A H 1983 Insect vector relationships with procaryotic plant pathogens. Annual Reviews of Phytopathalogy 20, 397-417. Purcell A H 1988 Increased survival rates of Dalbulus maidis DeLong & Walcott, a specialist on maize on nonhost plants infected with mollicute plant pathogens. Entomol. Exp. Appl 46, 187–196. Puthoff D P, Nettleton D, Rodermel S R and Baum T J 2003 Arabidopsis gene expression changes during cyst nematode parasitism revealed by statistical analyses of microarray expression profiles. The Plant Journal 33, 911-921. Q Qian N, Stanley G, Bunte A and Radstrom P 1997 Product formation and phosphoglucomutase activities in Lactococcus lactis: cloning and characterization of a novel phosphoglucomutase gene. Microbiology 143, 855 - 865. Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler R and Lopez R 2005 InterProScan: protein domains identifier. Nucleic Acids Research 33, W116-W120. Quiroga, M., Guerrero, C., Botella, M. A., Barceló, A., Amaya, I., Medina, M. I., Alonso, F. J., de Forchetti, S. M., Tigier, H. and Valpuesta, V. (2000). A tomato peroxidase involved in the synthesis of lignin and suberin. Plant Physiol ., 122, 1119-1127. R Rabus R, Kube M, Beck A, Widdel F and Reinhardt R 2002 Genes involved in the aerobic degradation of ethylbenzene in a denitrifying bacterium, strain EbN1. Arch Microbiol 178, 506 - 516. Raaijmakers, J.M., Leeman, M., Van Oorschot, M.M.P., van der Sluis, I., Schippers, B. and Bakker, P.A.H.M. (1995). Dose-response relationships in biological control of Fusarium wilt of radish by Pseudomonas spp. Phytopathology . 85(10):1075-1081. Rakwal, R., and Komatsu, S. 2000. Role of jasmonate in rice ( Oryza sativa L.) self-defense mechanism using 306 proteome analysis. Electrophoresis 21:2492-2500. Ramos Solano B, Barriuso Maicas J, Pereyra de la Iglesia M T, Domenech J and Gutiérrez Mañero F J 2008 Systemic disease protection elicited by plant growth promoting rhizobacteria strains: Relationship between metabolic responses, systemic disease protection, and biotic elicitors. Phytopathology 98, 451-457. Ramamoorthy, V., Viswanathan, R., Raguchander, T., Prakasam, V. and Samiyappan, R. (2001). Induction of systemic resistance by plant growth promoting rhizobacteria in crop plants against pests and diseases. Crop Protect . 20(1):1-11. Rasmussen J, Hammerschmidt R and Zook M 1991 Systemic induction of salicylic acid accumulation in cucumber after inoculation with Pseudomonas syringae pv syringae. Plant Physiol 97, 1342 - 1347. Rayapuram C, Wu J, Haas C and Baldwin I T 2008 PR-13/Thionin But Not PR-1 Mediates Bacterial Resistance in Nicotiana attenuata in Nature, and Neither Influences Herbivore Resistance. Molecular Plant-Microbe Interactions 21, 988-1000. Reymond P and Farmer E E 1998 Jasmonate and salicylate as global signals for defense gene expression. Current Opinion in Plant Biology 1, 404-411. Razin A, Yogev D and Naot Y 1998 Molecular biology and pathogenicity of mycoplasma. Microbiology and Molecular Biology Reviews 62, 1094-1156. Real M D, Company P, García-Agustín P, Bennett A B and González-Bosch C 2004 Characterization of tomato endo-ß-1,4-glucanase Cel1 protein in fruit during ripening and after fungal infection. Planta 220, 80-86. Reeves P H and Coupland G 2001 Analysis of flowering time control in arabidopsis by comparison of double and triple mutants. Plant Physiology 126, 1085-1091. Reiners S and Petzoldt C 2007 The integrated crop and pest management guidelines for vegetable. Cornell University Press, Ithaca,, New York. Rep M, Dekker H L, Vossen J H, de Boer A D, Houterman P M, Speijer D, Back J W, de Koster C G and Cornelissen B J C 2002 Mass Spectrometric Identification of Isoforms of PR Proteins in Xylem Sap of Fungus-Infected Tomato. Plant Physiology 130, 904-917. 307 Ribnicky D, Shulaev V, Raskin I (1998) Intermediates of salicylic acid biosynthesis in tobacco. Plant Physiol 118: 565–572 Richards E J 1997 DNA methylation and plant development. Trends Genet 13:319–323 Ridley A 1997 The GTP-binding protein Rho. Int J Biochem Cell Biol 29, 1225 - 1229. Rivas S and Thomas C M 2005 Molecular Interactions Between Tomato and the Leaf Mold Pathogen Cladosporium fulvum. Annual Review of Phytopathology 43, 395-436. Robb J 2007 Verticillium tolerance: resistance, susceptibility, or mutualism? Canadian Journal of Botany 85, 903-910. Robb J, Castroverde C D M, Shittu H O and Nazar R N 2009 Patterns of defence gene expression in the tomato–Verticillium interaction. Botany 87, 993-1006. Robb J, Lee S-W, Mohan R and Kolattukudy P E 1991 Chemical characterization of stress-induced vascular coating in tomato. Plant Physiology 97, 528-536. Roberts R J and Cheng X 1998 Base flipping. Annu. Rev. Biochem. 67, 181–198. Robert N, Ferran J, Breda C, Coutos-Thevenot P, Boulay M, Buffard D. 2001; Molecular characterization of the incompatible interaction of Vitis vinifera leaves with Pseudomonas syringae pv. pisi: expression of genes coding for stilbene synthase and class 10 PR protein. Eur J Plant Pathol 107:249–61. Rocha E, Sirand-Pugnet P and Blanchard A 2005 Genome analysis: Recombination, repair and recombinational hotspots. Mycoplasmas, 31 - 73. Rodrigo I, Vera P, Frank R and Conejero V 1991 Identification of the viroid-induced tomato pathogenesis- related (PR) protein P23 as the thaumatin-like tomato protein NP24 associated with osmotic stress. Plant Molecular Biology 16, 931-934. Romanazzi G, D’Ascenzo D, Murolo S, 2009 Field treatment with resistance inducers for the control of grapevine bois noir. J. Plant pathology. 91, 677-682. Ronemus M J, Galbiati M, Ticknor C, Chen J and Dellaporta S L 1996 Demethylation-Induced Developmental Pleiotropy in Arabidopsis. Science 273, 654-657. 308 Rooney HC, Van’t Klooster JW, van der Hoorn RA, JoostenMH, Jones JD, de Wit PJ (2005) Cladosporium Avr2 inhibits tomato Rcr3 protease required for Cf-2-dependent disease resistance. Science 308: 1783–1786. Rosch J and Caparon M 2004 A microdomain for protein secretion in gram-positive bacteria. Science 304, 1513 - 1515. Rose J K C, Ham K-S, Darvill A G and Albersheim P 2002 Molecular Cloning and Characterization of Glucanase Inhibitor Proteins: Coevolution of a Counterdefense Mechanism by Plant Pathogens. The Plant Cell Online 14, 1329-1345. Ross F A (1961) Systemic acquired resistance induced by localized virus infections in plants. Virology 14: 340-358 Rose T M, Schultz E R, Henikoff J G, Pietrokovski S, McCallum C M and Henikoff S 1998 Consensus- degenerate hybrid oligonucleotide primers for amplification of distantly related sequences. Nucleic Acids Research 26, 1628-1635. Russell P 1997 Two isoforms of NP24: A thaumatin-like protein in tomato fruit. Phytochemistry 44, 1241- 1245. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Radjandream M and Barrell B 2000 Artemis: sequence visualization and annotation. Bioinformatics 16, 944 - 945. Ryals J A, Neuenschwander U H, Willits M G, Molina A, Steiner H Y and Hunt M D 1996 Systemic acquired resistance. Plant Cell 8 1809-1819. Ryan C A 1990 Protease inhibitors in plants - genes for improving defenses against insects and pathogens. Annual Review of Phytopathology, 28, 425-449. S Sablowski R 2007 Flowering and determinacy in Arabidopsis. J. Exp. Bot. 58, 899–907. Santi D V, Garrett C E and Barr P J 1983 On the mechanism of inhibition of DNA-cytosine methyltransferases by cytosine analogs. Cell 33: 9-10. Saglio P, Laflèche D, Dupont G, Bové J M, Tully J G and Freundt E A 1973 Spiroplasma citri gen and sp. nov.: a mcyoplasma-like organism associated with stubborn disease of citrus. International Journal of Systematic Bacteriology 23, 1387-1390. 309 Saillard C, Vignault J C, Bové J M, Raie A, Tully J G, Williamson D L, Fos A, Garnier M, Gadeau A, Carle P and Whitcomb R F 1987 Spiroplasma phoeniceum sp. nov., a new plant pathogenic species from syria. International Journal of Systematic Bacteriology 37, 106-115. Salzberg S, Salzberg A, Kerlavage A and Tomb J 1998 Skewed oligomers and origin of replication. Gene 217, 57 - 67. Sanchez-Serrano,J., Schmidt,R., Schell,J. and Willmitzer,L. (1986) Mol. Gen. Genet., 203, 15-20. Sanchez L M, Ohno Y, Miura Y, Kawakita K, Doke N 1992 Host selective suppression by water-soluble glucans from Phytophthora spp. of hypersensitive cell death of suspension-cultured cells from some solanaceous plants caused by hyphal wall elicitors of the fungi. Ann Phytopathol Soc Japan 58: 664– 670. Sano H, Kamada I, Youssefian S, Katsumi M, Wabiko H (1990) A single treatment of rice seedlings with 5- azacytidine induces heritable dwarfism and undermethylation of genomic DNA. Mol Gen Genet 220:441–447 Sano H, Kamada I, Youssefian S, Katsumi M and Wabiko H 1990 A single treatment of rice seedlings with 5-azacytidine induces heritable dwarfism and undermethylation of genomic DNA. Molecular and General Genetics MGG 220, 441-447. Sano H and Ohashi Y 1995 Involvement of small GTP-binding proteins in defense signal-transduction pathways of higher plants. Proc Natl Acad Sci U S A 92, 4138 - 4144. Sanz-Alférez, S., B Mateos, R Alvarado and M Sánchez 2008 SAR induction in tomato plants is not effective against root-knot nematode infection. Eur J Plant Pathol (2008) 120:417–425 Sato Y, Takahashi M, Shibukawa Y, Jain S, Hamaoaka R, Miyagawa J-I, Yaginuma Y, Honke K, Ishikawa M and Tanigushi N 2001 Overexpression of N-acetylglucosaminyltransferase III enhances the epidermal growth factor-induced phosphorylation of ERK in HeLaS3 cells by up-regulation of the internalization rate of the receptors. J Biol Chem 276, 11956 - 11962. Scarponi L, Buonaurio R and Martinetti L 2001 Persistence and translocation of a benzothiadiazole derivative in tomato plants in relation to systemic acquired resistance against Pseudomonas syringae pv. tomato. Pest Manag. Sci. 57, 262-268. 310 Schaad N W, Jones J B and Chun W 2001 Laboratory guide for identification of plant pathogenic bacteria. American Phytopathological Society,, St. Paul, MN. Schaller F 2001 Enzymes of the biosynthesis of octadecanoid derived signalling molecules. Journal of Experimental Botany 52, 11-23. Schiene K, Puhler A and Niehaus K 2000 Transgenic tobacco plants that express an antisense construct derived from a Medicago sativa cDNA encoding a Rac-related small GTP-binding protein fail to develop necrotic lesions upon elicitor infiltration. Mol Gen Genet 263, 761 - 770. Schneider B and Seemuller E 1994 Presence of two sets of ribosomal genes in phytopathogenic mollicutes. Appl Environ Microbiol 60, 3409 - 3412. Schommer C, Palatnik J F, Aggarwal P, Chételat A, Cubas P, Farmer E E, Nath U and Weigel D 2008 Control of Jasmonate Biosynthesis and Senescence by miR319 Targets. PLoS Biol 6, e230. Schornack S, vanDamme M, Bozkurt T O, Cano L M and Smoker M e a 2010 Ancient class of translocated oomycete effectors targets the host nucleus. Proc. Natl. Acad. Sci. USA 107, 17421–17426. Schultheiss H, Dechert C, Kogel K and Huckelhoven R 2002 A small GTP-binding host protein is required for entry of powdery mildew fungus into epidermal cells of barley. Plant Physiol 128, 1447 - 1454. Schwessinger B and Zipfel C 2008 News from the frontline: recent insights into PAMP-triggered immunity in plants. Curr. Opin. Plant Biol 11, 389–395. Schweizer, P., Buchala, A., and Métraux. J.-P. 1997a. Gene-expression patterns and levels of jasmonica acid in rice treated with the resistance inducer 2, 6-dichloroisonicotinic acid. Plant Physiol. 115:61-70. Schweizer, P., Buchala, A., Silverman, P., Seskar, M., Raskin, I., and Métraux, J.-P. 1997b. Jasmonate- inducible genes are activated in rice by pathogen attack without a concomitant increase in endogenous jasmonic acid levels. Plant Physiol. 114:79-88. Scott S C, Goldberg M S and Mayo N E 1997 Statistical assessment of ordinal outcomes in comparative studies. Journal of Clinical Epidemiology 50, 45-55. Seemüller E, Marcone C, Lauer U, Ragozzino A and Göschl M 1998 Current status of molecular classification of the phytoplasmas. J. Plant Pathol. 80, 3-26. Seemuller E, Garnier M and Schneider B 2002 Mycoplasmas of plants and insects. Molecular Biology and Pathology of Mycoplasmas, 91 - 116. 311 Seemuller E and Schneider B 2004 'Candidatus Phytoplasma mali', 'Candidatus Phytoplasma pyri' and 'Candidatus Phytoplasma prunorum', the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. Int J Syst Evol Microbiol 54, 1217 - 1226. Segura A, Moreno M, Madueño F, Molina A and García-Olmedo F 1999 Snakin-1, a Peptide from Potato That Is Active Against Plant Pathogens. Molecular Plant-Microbe Interactions 12, 16-23. Sels J, Mathys J, De Coninck B M A, Cammue B P A and De Bolle M F C 2008 Plant pathogenesis-related (PR) proteins: A focus on PR peptides. Plant Physiology and Biochemistry 46, 941-950. Sela-Buurlage M B, Ponstein A S, Bres-Vloemans S A, Melchers L S, van den Elzen P J M and Cornelissen B J C 1993 Only Specific Tobacco (Nicotiana tabacum) Chitinases and [beta]-1,3-Glucanases Exhibit Antifungal Activity. pp 857-863. Seo H S, Song J T, Cheong J J, Lee Y H 2001 Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-regulated plant responses. Proc. Natl. Acad. Sci. U. S. A. 98: 4788-4793. Sequeira L 1983 Mechanisms of induced resistance in plants. Ann. Rev. Microbiol. 37:51-79. Sforza R, Clair D, Daire X, Larrue J and Boudon-Padieu E 1998 The Role of Hyalesthes obsoletus (Hemiptera: Cixiidae) in the Occurrence of Bois noir of Grapevines in France Bedeutung von Hyalesthes obsoletus (Hemiptera: Cixiidae) für das Auftreten der Bois-noir-Krankheit der Weinrebe in Frankreich. Journal of Phytopathology 146, 549-556. Shah J 2003 The salicylic acid loop in plant defense. Current Opinion in Plant Biology 6, 365-371. Shah J and Klessig D F 1999 Salicylic acid: signal perception and transduction. In Biochemistry and molecular biology of plant hormones. Eds. P J J Hooykaas, M A Hall and K R Libbenga. Amsterdam: Elsevier Science Publications, 513-541. Shao F, Merritt P M, Bao Z, Innes R W and Dixon J E 2002 A yersinia effector and a pseudomonas avirulence protein define a family of cysteine proteases functioning in bacterial pathogenesis. Cell 109, 575-588. Schaller F 2001 Enzymes of the biosynthesis of octadecanoid- derived signaling molecules. J. Exp. Bot. 52, 11-23. Shanmugam V 2005. Role of extracytoplasmic leucine rich repeat proteins in plant defence mechanisms. Microbiological Research, 160: 83-94. 312 Shibukawa Y, Takahashi M, Laffont I, Honke K and Taniguchi N 2003 Down-regulation of hydrogen peroxide-induced PKCdelta activation in N-acetylglucosaminyltransferase III-transfected HeLaS3 cells. J Biol Chem 278, 3197 - 3203. Shiomi T and Sugiora M 1984 Grouping of mycoplasma like organisms transmitted by the leafhopper vector Macrosteles orientalis Virvast, based on host range. Annals of phytopathological society of Japan 50, 149 - 157. Shin R, Lee G J, Park C J, Kim T Y, You J S, Nam Y W, Paek K H 2001 Isolation of pepper mRNAs diVerentially expressed during the hypersensitive response to tobacco mosaic virus and characterization of a proteinase inhibitor gene. Plant Sci 161:727–737. Shittu H, Castroverde D, Nazar R and Robb J 2009 Plant-endophyte interplay protects tomato against a virulent Verticillium. Planta 229, 415-426. Silva Z, Sampaio M, Henne A, Bohm A, Gutzat R, Boos W, da Costa M and Santos H 2005 The high- affinity maltose/trehalose ABC transporter in the extremely thermophilic bacterium Thermus thermophilus HB27 also recognizes sucrose and palatinose. J Bacteriol 187, 1210 - 1218. Smart C, Schneider B, Blomquist C, Guerra L, Harrison N, Ahrens U, Lorenz K, Seemuller E and Kirkpatrick B 1996 Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Appl. Environ. Microbiol. 62, 2988-2993. Smart C D, Myers K L, Restrepo S, Martin G B and Fry W E 2003 Partial Resistance of Tomato to Phytophthora infestans Is Not Dependent upon Ethylene, Jasmonic Acid, or Salicylic Acid Signaling Pathways. Molecular Plant-Microbe Interactions 16, 141-148. Singh N K, Nelson D E, Kuhn D, Hasegawa P M, and Bressan R A 1989 Molecular cloning of osmotin and regulation of its expression by ABA and adaptation to low water potential. Plant Physiol. 90, 1096- 1101. Sobczak I and Lolkema J 2005 The 2-hydroxycarboxylate transporter family: Physiology, structure, and mechanisms. Microbiol Mol Biol Rev 69, 665 - 695. Sonnhammer E and Durbin R 1994 A workbench for large scale sequence homology analysis. Comput Applic Biosci 10, 301 - 307. 313 Soppe W J J, Jacobsen S E, Alonso-Blanco C, Jackson J P, Kakutani T, Koornneef M and Peeters A J M 2000 The late flowering phenotype of fwa mutants is caused by gain-of-function epigenetic alleles of a homeodomain gene. Molecular Cell 6, 791-802. Speletzer M E and Enyedi A J 1999 Salicylic acid induced resistance to Alternaria solani in hydroponically grown tomato. Phytopathology 89: 722 – 727. Spoel S, Koorneef A, Claessens S, Korzelius J, Van Pelt J, Mueller M, Buchala A, Metraux J-P, Brown R, Kazan K, Van Loon L, Dong X and Pieterse C 2003 NPR1 modulates cross-talk between salicylate and jasmonate-dependent defense pathways through a novel fonction in the cytosol. Plant cell 15, 760 - 770. Spoel S H, Johnson J S and Dong X 2007 Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proceedings of the National Academy of Sciences 104, 18842-18847. Stadler R, Wright K M, Lauterbach C, Amon G and Gahrtz M e a 2005 Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, 319–331. Stadnik M J, Buchenauer H. 1999 Accumulation of autofluorogenic compounds at the penetration site of Blumeria graminis f. sp. tritici is associated with both benzothiadiazole-induced and quantitative resistance in wheat. Journal of Phytopathology 147: 615-622 Stahl EA, Bishop JG (2000) Plant-pathogen arms races at the molecular level. Curr Opin Plant Biol 3: 299– 304. Stafstrom J P, Ripley B D, Devitt M L and Drake B 1998 Dormancy-associated gene expression in pea axillary buds. Planta 205, 547-552. Stanley P 2002 Biological consequences of overexpressing or eliminating N-acetylglucosaminyltransferase- TIII in the mouse. Biochim Biophys Acta 1573, 363 - 368. Stebbins C E and Galan J E 2001 Structural mimicry in bacterial virulence. Nature 412, 701-705. Stec B 2006 Plant thionins – the structural perspective. Cellular and Molecular Life Sciences 63, 1370-1385. Sticher L, Mauch-Mani B, Métraux and JP 1997 Systemic acquired resistance. Annual Review of Phytopathology 35, 235-270. 314 Stintzi A, Heitz T, Prasad V, Wiedemann-Merdinoglu S, Kauffmann S, Geoffroy P, Legrand M and Fritig B 1993 Plant ‘pathogenesis-related’ proteins and their role in defense against pathogens. Biochimie 75, 687-706. Stintzi A, Heitz T, Kauffmann S, Legrand M, and Fritig B 1991 ldentification of a basic pathogenesis-related thaumatin-like protein of virus-infected tobacco as osmotin. Physiol. MOI. Plant Pathol. 38, 137- 146. Stokes T L, Kunkel B N and Richards E J 2002 Epigenetic variation in Arabidopsis disease resistance. Genes & Development 16, 171-182. Stotz H, Spence B and Wang Y 2009 A defensin from tomato with dual function in defense and development. Plant Molecular Biology 71, 131-143. Stout M J, Fidantsef A L, Duffey S S and Bostock R M 1999 Signal interactions in pathogen and insect attack: systemic plant-mediated interactions between pathogens and herbivores of the tomato,Lycopersicon esculentum. Physiological and molecular plant pathology 54, 115-130. Stout M J, Thaler J S and Thomma B P H J 2006 Plant-mediated interactions between pathogenic microorganisms and herbivorous arthropods. Annu. Rev. Entomol 51, 663–689. Strasser R, Steinkellner H, Boren M, Altmann F, Mach L, Glossl J and Mucha J 1999 Molecular cloning of cDNA encoding N-acetylglucosaminyltransferase II from Arabidopsis thaliana. Glycoconj J 16, 787 - 791. Strassner J, Schaller F, Frick U B, Howe G A, Weiler E W, Amrhein N, Macheroux P and Schaller A 2002 Characterization and cDNA-microarray expression analysis of 12-oxophytodienoate reductases reveals differential roles for octadecanoid biosynthesis in the local versus the systemic wound response. The Plant Journal 32, 585-601. Strauss E 2009 Microbiology. Phytoplasma research begins to bloom. Science 325, 388–390. Strauss S Y 1991 Direct, Indirect, and Cumulative Effects of Three Native Herbivores on a Shared Host Plant. Ecology 72, 543-558. Strawn MA, Marr SK, Inoue K, Inada N, Zubieta C, Wildermuth MC (2007) Arabidopsis isochorismate synthase functional in pathogeninduced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses. J Biol Chem 282: 5919–5933 315 Subramaniam R, Desveaux D, Spickler C, Michnick S and Brisson N 2001 Direct visualization of protein interactions in plant cells. Nat Biotechnol 19, 769 - 772. Sugio A, Kingdom H N, Nicholls V M and Hogenhout S A 2010 The phytoplasma effector protein SAP11 improves vector fitness. Congr. Int. Org. Mycoplasmol., 18th, Cianciano Terme, 47:82. Summers M, Denton M and McDermott T 1999 Genes coding for phosphotransacetylase and acetate kinase in Sinorhizobium meliloti are in an operon that is inducible by phosphate stress and controlled by PhoB. J Bacteriol 181, 2217 - 2224. Sun B, Xu Y, Ng K H and Ito T 2009 A timing mechanism for stem cell maintenance and differentiation in the Arabidopsis floral meristem. Genes Dev. 23, 1791–1804. Sunkar R and Zhu J K 2004 Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant cell 16, 2001-2019. Suzuki S, Oshima K, Kakizawa S, Arashida R, Jung H-Y, Yamaji Y, Nishigawa H, Ugaki M and Namba S 2006 Interaction between the membrane protein of a pathogen and insect microfilament complex determines insect-vector specificity. Proceedings of the National Academy of Sciences of the United States of America 103, 4252-4257. T Takahashi S, Komatsu K, Kagiwada S, Ozeki J, Mori T, Hirata H, Yamaji Y, Ugaki M and Namba S 2006 The efficiency of interference of potato virus X infection depends on the target gene. Virus Research 116, 214-217. Tally A, Oostendorp M, Lawton K, Staub T, Bassi B, 1999. Commercial development of elicitors of induced resistance to pathogens. In: Agrawal AA, Tuzun S, Bent E, eds. Induced Plant Defences against Pathogens and Herbivores: Biochemistry, Ecology, and Agriculture . St Paul, MN, USA: APS Press, 357–69 Tariq M and Paszkowski J 2004 DNA and histone methylation in plants. Trends Genet. 20, 244-251. Tasset C, Bernoux M, Jauneau A, Pouzet C and Briere C e a 2010 Autoacetylation of the Ralstonia solanacearum effector PopP2 targets a lysine residue essential for RRS1-R-mediated immunity in Arabidopsis. PLoS Pathog. 6:e1001202. 316 Tatra G S, Miranda J, Chinnappa C C and Reid D M 2000 Effect of light quality and 5-azacytidine on genomic methylation and stem elongation in two ecotypes of Stellaria longipes. Physiologia Plantarum 109, 313-321. Taxonomy I-P G and Firrao G 2004 “Candidatus Phytoplasma,” a taxon for the wall-less, nonhelical prokaryotes that colonize plant phloem and insects. Int. J. Syst. Evol. Microbiol 54, 1243–1255. Terras FRG, Eggermont K, Kovaleva V, Raikhel NV, Osborn RW, Kester A, Rees SB, Torrekens S, Van LF, Vanderleyden J, Cammue BPA, Broekaert WF (1995) Small cysteine-rich antifungal proteins from radish: their role in host defense. Plant Cell 7:573–588 Teyssier E, Bernacchia G, Maury S, How Kit A, Stammitti-Bert L, Rolin D, Gallusci P. 2008 Tissue dependent variations of DNA methylation and endoreduplication levels during tomato fruit development and ripening. Planta. 228 (3):391-399. Thaler J S, Fidantsef A L and Bostock R M 2002 Antagonism between jasmonate- and salicylate-mediated induced plant resistance: Effects of concentration and timing of elicitation on defense-related proteins, herbivore, and pathogen performance in tomato. Journal of Chemical Ecology 28, 1131- 1159. Thaler J S, Fidantsef A L, Duffey S S, Bostock R M. Trade-offs in plant defense against pathogens and herbivores: a field demonstration of chemical elicitors of induced resistance. J Chem Ecol 1999;25: 1597–609. Thibaud M-C, Gineste S, Nussaume L and Robaglia C 2004 Sucrose increases pathogenesis-related PR-2 gene expression in Arabidopsis thaliana through an SA-dependent but NPR1-independent signaling pathway. Plant Physiology and Biochemistry 42, 81-88. Thevissen, K., Warnecke, D. C., François, I. E., Leipelt, M., Heinz, E., Ott, C., Zähringer, U., Thomma, B. P., Ferket, K. K. and Cammue, B. P. (2004). Defensins from insects and plants interact with fungal glucosylceramides. J. Biol. Chem ., 279, 3900-3905. Thomma B P H J, Cammue B P A and Thevissen K 2003 Mode of Action of Plant Defensins Suggests Therapeutic Potential. Current Drug Targets - Infectious Disorsers 3, 1-8. Thomma B, Cammue B and Thevissen K 2002 Plant defensins. Planta 216, 193-202. 317 Thomma B, Penninckx I, Broekaert W F and Cammue B P A 2001 The complexity of disease signaling in Arabidopsis . Current Opinion in Immunology 13, 63–68.glucosylceramides. J. Biol. Chem ., 279, 3900-3905. Thomma B P H J, Eggermont K, Tierens K F M-J and Broekaert W F 1999 Requirement of functional ethylene-insensitive 2gene for efficient resistance of arabidopsis to infection by botrytis cinerea. Plant Physiology 121, 1093-1101. Thordal-Christensen H 2003 Fresh insights into processes of nonhost resistance. Curr Opin Plant Biol 6: 351–357 Tian M, Benedetti B and Kamoun S 2005 A Second Kazal-Like Protease Inhibitor from Phytophthora infestans Inhibits and Interacts with the Apoplastic Pathogenesis-Related Protease P69B of Tomato. Plant Physiology 138, 1785-1793. Tian M, Huitema E, da Cunha L, Torto-Alalibo T and Kamoun S 2004 A Kazal-like Extracellular Serine Protease Inhibitor from Phytophthora infestans Targets the Tomato Pathogenesis-related Protease P69B. Journal of Biological Chemistry 279, 26370-26377. Tímár E, Groma G, Kiss A and Venetianer P 2004 Changing the recognition specificity of a DNA- methyltransferase by in vitro evolution. Nucleic Acids Research 32, 3898-3903. Timpte C, Wilson A K and Estelle M 1994 The axr2-1 mutation of arabidopsis thaliana is a gain-of-function mutation that disrupts an early step in auxin response. Genetics 138, 1239-1249. Tiwari S, Schulz R, Ikeda Y, Dytham L, Bravo J, et al. MATERNALLY EXPRESSED PAB CTERMINAL, a novel imprinted gene in Arabidopsis, encodes the conserved C-terminal domain of polyadenylate binding proteins. Plant Cell. 2008; 20:2387–98. Toda T and Itaya M 1995 I-CeuI recognition sites in the rrn operons of the Bacillus subtilis 168 chromosome: inherent landmarks for genome analysis. Microbiology 141, 1937 - 1945. Ton J, De Vos M, Robben C, Buchala A, Métraux J-P, Van Loon L C and Pieterse C M J 2002 Characterization of Arabidopsis enhanced disease susceptibility mutants that are affected in systemically induced resistance. The Plant Journal 29, 11-21. Tooker J F, Peiffer M, Luthe D S and Felton G W 2010 Trichomes as sensors: detecting activity on the leaf surface. Plant Signal. Behav 5, 73–75 318 Tornero P, Gadea J, Conejero V and Vera P 1997 Two PR-1 genes from tomato are differentially regulated and reveal a novel mode of expression for a pathogenesis-related gene during the hypersensitive response and development. Molecular Plant-Microbe Interactions 10, 624-634. Tornero P, Conejero V and Vera P 1994 A gene encoding a novel isoform of the PR-1 protein family from tomato is induced upon viroid infection. Molecular and General Genetics MGG 243, 47-53. Torres E, Botti S, Rahola J, Martin M P and Bertaccini A 2005 Grapevine yellows disease in Spain: eight years survey of disease speard and molecular characterization of phytoplasma involved. Annales de Jardin botanio de Mardrid 62, 127-133. Toruno T Y, Music M S, Simi S, Nicolaisen M and Hogenhout S A 2010 Phytoplasma PMU1 exists as linear chromosomal and circular extrachromosomal elements and has enhanced expression in insect vectors compared with plant hosts. Mol. Microbiol 77, 1406–1415. Touchon M and Rocha E 2007 Causes of insertion sequences abundance in prokaryotic genomes. Mol Biol Evol 24, 969 - 981. Tran-Nguyen L T and Gibb K S 2006 Extrachromosomal DNA isolated from tomato big bud and Candidatus Phytoplasma australiense phytoplasma strains. Plasmid 56, 153–166. Tran-Nguyen L T, Kube M, Schneider B, Reinhardt R and Gibb K 2007 An overview of the genome sequence of 'Candidatus Phytoplasma australiense' - Australian strain. Bull Insectol 60, 111 - 112. Tran-Nguyen L T, Kube M, Schneider B, Reinhardt R and Gibb K S 2008 Comparative genome analysis of “Candidatus Phytoplasma australiense” (subgroup tuf-Australia I; rp-A) and “Ca. Phytoplasma asteris” Strains OY-M and AY-WB J. Bacteriol. 190, 3979–3991. Trevino, M. B. and O’Connell, M. A. (1998). Three drought-responsive members of the nonspecific lipid- transfer protein gene family in Lycopersicon pennellii show different developmental patterns of expression. Plant Physiol ., 116, 1461-1468. Truman W, Bennett M H, Kubigsteltig I, Turnbull C, Grant M 2007 Arabidopsis systemic immunity uses conserved defense signaling pathways and is mediated by jasmonates. Proc Natl Acad Sci USA 104: 1075–1080. Tsai J H 1979 Vector transmission of mycoplasal agents of plant diseases. In The Mycoplasmas, edition 3, 265-307. 319 Turner J G, Ellis C and Devoto A 2002 The Jasmonate Signal Pathway. The Plant Cell Online 14, S153- S164. U Uknes S, Winter A, Delaney T, Vernooij B, Morse A, Friedrich L, Nye G, Potter S, Ward E and Ryals J 1993 Biological induction of systemic acquired resistance in Arabidopsis. Mol Plant-Microbe Interact 6, 692 - 698. Ullah H, Chen J, Young J, Im K, Sussman M and Jones A 2001 Modulation of cell proliferation by heterodimeric G protein in Arabidopsis. Science 292, 2066 - 2069. Uppalapati S R, Ishiga Y, Wangdi T, Kunkel B N, Anand A, Mysore K S, Bender C L 2007 The phytotoxin coronatine contributes to pathogen fitness and is required for suppression of salicylic acid accumulation in tomato inoculated with Pseudomonas syringae pv. tomato DC3000. Mol Plant Microbe Interact 20: 955–965 Uppalapati S R 2005 The phytotoxin coronatine and methyl jasmonate impact multiple phytohormone pathways in tomato. Plant J. 42, 201–217. V Valenta V, Musil M and Mišiga S 1961 Investigations on European Yellows-type Viruses I. The Stolbur Virus. Journal of Phytopathology 42, 1-38. Vallad G E and Goodman R M 2004 Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Sci. 44, 1920-1934. Vallad G E and Subbarao K V 2008 Colonization of resistant and susceptible lettuce cultivars by a green fluorescent protein-tagged isolate of verticillium dahliae. Phytopathology 98, 871-885. Van den Ackerveken G F J M, Van Kan J A L and De Wit P J G M 1992 Molecular analysis of the avirulence gene avr9 of the fungal tomato pathogen Cladosporium fulvum fully supports the gene- for-gene hypothesis. The Plant Journal 2, 359-366. van den Heuvel, K. J., Hulzink, J. M., Barendse, G. W. and Wullems, G. J. (2001). The expression of tgas118 , encoding a defensin in Lycopersicon esculentum , is regulated by gibberellin. J. Exp. Bot ., 52, 1427-1436. 320 Van der Eycken W, de Almeida Engler J, Inzé D, Van Montagu M and Gheysen G 1996 A molecular study of root-knot nematode-induced feeding sites. The Plant Journal 9, 45-54. Van der Luit A H, Olivari C, Haley A, Knight M R and Trewavas A J 1999 Distinct calcium signaling pathways regulate calmodulin gene expression in tobacco. Plant Physiology 121, 705-714. VanderMolen, G. E., Beckman, C. H. and Rodehorst, E. (1977). Vascular gelation: A general response phenomenon following infection. Physiol. Plant Pathol., 11, 95-100. Vander Molen, G. E., Labavitch, J. M. and DeVay, J.E. (1982). Carbohydrate composition and structure of vascular gels from wilt-diseased banana roots. Plant Physiol. 69 (suppl.), 143. van Peer, R., Niemann, G.J. and Schippers, B. (1991). Induced resistance and phytoalexin accumulation in biological control of Fusarium wilt of carnation by Pseudomonas sp. Strain WCS417r. Phytopathology . 81(9):728-734. Van Loon L C 1997 Induced resistance in plants and the role of pathogenesis-related proteins. European Journal of Plant Pathology 103, 753-765. Van Loon LC, van Strien EA 1999. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 55: 85–97 Van Loon L 1983 The induction of pathogenesis-related proteins by pathogens and specific chemicals. European Journal of Plant Pathology 89, 265-273. Van Loon L C 1999 Occurrence and properties of plant pathogenesisrelated proteins. In Pathogenesis- Related Proteins in Plants. Eds. S K Datta and S Muthukrishnan. pp 1-20. CRC Press Boca Raton, FL. Van Loon L C, Geraats B P J and Linthorst H J M 2006 Ethylene as a modulator of disease resistance in plants. Trends Plant Sci 11, 184-191. Van Loon L C, Rep M and Pieterse C M J 2006 Significance of inducible defense-related proteins in infected plants. Annual Review of Phytopathology 44, 135-162. Van Kan J A L, Joosten M H A J, Wagemakers C A M, Berg-Velthuis G C M and Wit P J G M 1992 Differential accumulation of mRNAs encoding extracellular and intracellular PR proteins in tomato induced by virulent and avirulent races of Cladosporium fulvum. Plant Molecular Biology 20, 513- 527. 321 Van Kan J A L, Cozijnsen T, Danhash N, and De Wit P J G M 1995 Induction of tomato stress protein mRNAs by ethephon, 2,6-dichloroisonicotinic acid and salicylate. Plant Mol. Biol. 27:1205– 1213. Van Kan J A L, Joosten M H A J, Wagemakers C A M, Berg-Velthuis G C M and Wit P J G M 1992 Differential accumulation of mRNAs encoding extracellular and intracellular PR proteins in tomato induced by virulent and avirulent races of Cladosporium fulvum. Plant Molecular Biology 20, 513- 527. Van Wees S C M, de Swart E A M, van Pelt J A, van Loon L C and Pieterse C M J 2000 Enhancement of induced disease resistance by simultaneous activation of salicylate- and jasmonate-dependent defense pathways in Arabidopsis thaliana. Proceedings of the National Academy of Sciences 97, 8711-8716. Van Wees S C M, Van der Ent S and Pieterse C M J 2008 Plant immune responses triggered by beneficial microbes. Current Opinion in Plant Biology 11, 443-448. Vaucheret H and Fagard M 2001 Transcriptional gene silencing in plants: targets, inducers and regulators. Trends Genet. 17, 29-35. Vera P and Conejero V 1988 Pathogenesis-Related Proteins of Tomato : P-69 as an Alkaline Endoproteinase. Plant Physiology 87, 58-63. Vera, P., Tornero, P. and Conejero, V. (1993). Cloning and expression analysis of a viroid-induced peroxidase from tomato plants. Mol. Plant. Microbe Interact ., 6, 790-794. Verberne M C, Hoekstra J, Bol J F and Linthorst H J M 2003 Signaling of systemic acquired resistance in tobacco depends on ethylene perception. The Plant Journal 35, 27-32. Vercauteren I, de Almeida Engler J, De Groodt R and Gheysen G 2002 An Arabidopsis thaliana pectin acetylesterase gene is upregulated in nematodo feeding sites induced by root-knot and cyst nematodos. Molecular Plant Microbe Interactions, 15, 404-407. Veronese P, Crino P, Tucci M, Colucci F, Yun D J, Hasegawa M P, Bressan R A and Saccardo F, 1999 Pathogenesis-related proteins for the control of fungal diseases of tomato. Genetics and Breeding for Crop Quality and Resistance Proceedings of the XV-EUCARPIA Congress , pp: 15–24. Viterbo, Italy, September, 20-25, 1999 322 Vigers A J, Roberts W K and Selitrennikoff C P 1991 A new family of plant antifungal proteins. Mol. Plant Microbe Interact 4, 315-323. Vigers AJ, Wiedemann S, Roberts WK, Legrand M, Selitrennikoff C P 1992 Thaumatin-like pathogenesis-related proteins are antifungal. Plant Sci 83: 155–161. Von Dahl C and Baldwin I 2007 Deciphering the Role of Ethylene in Plant–Herbivore Interactions. Journal of Plant Growth Regulation 26, 201-209. Vongs A, Kakutani T, Martienssen RA, Richards EJ (1993) Arabidopsis thaliana DNA methylation mutants. Science 260:1926–1928 Vos M, Berrocal S M, Karamaouna F, Hemerik L and Vet L E M 2001 Plant-mediated indirect effects and the persistence of parasitoid–herbivore communities. Ecology Letters 4, 38-45. Vyskot B, Araya A, Veuskens J, Negrutiu I, Mouras A (1993) DNA methylation of sex chromosomes in a dioecious plant, Melandrium album. Mol Gen Genet 239:219–224 Vyskot B, Koukalova B, Kovarik A, Sachambula L, Reynolds D, Bezdek M (1995) Meiotic transmission of a hypomethylated repetitive DNA family in tobacco. Theor Appl Genet 91:659–664 W Wada Y, Miyamoto K, Kusano T, Sano H (2004) Association between up-regulation of stress-responsive genes and hypomethylation of genomic DNA in tobacco plants. Mol Genet Genom 271:658-666 Walling, L. L. 2009. Adaptive defense responses to pathogens and pests. Adv. Bot. Res. 51:551–612. Walling L L 2008 Avoiding Effective Defenses: Strategies Employed by Phloem-Feeding Insects. Plant Physiology 146, 859-866. Walling L L 2000 The Myriad Plant Responses to Herbivores. Journal of Plant Growth Regulation 19, 195- 216. Walters D and Heil M Costs and trade-offs associated with induced resistance. Physiological and molecular plant pathology 71, 3-17. Wasternack C and Parthier B 1997 Jasmonate-signalled plant gene expression. Trends in Plant Science 2, 302-307. Wasternack C 2007 Jasmonates: an update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann. Bot. 100: 681-697 323 Wang H, Jiang Y P, Yu H J, Xia X J, Shi K, Zhou Y H and Yu JQ 2010 Light quality affects incidence of powdery mildew, expression of defense-related genes and associated metabolism in cucumber plants. Eur. J. Plant Pathology, 127: 125-135. Wang K L-C, Li H and Ecker J R 2002 Ethylene biosynthesis and signaling networks. The Plant Cell Online 14, S131-S151. Ward E, Uknes S, Wlilliams S, Dincher S, Wiederhold D, Alexander D, Ahl-Goy P, Metraux J-P and Ryals J 1991 Coordinate gene activity in response to agents that induce systemic acquired resistance. Plant cell 3, 1085 - 1094. Wassenegger M 2000 RNA-directed DNA methylation. Plant Mol. Biol. 43, 203-220. Wayadande A C, Baker G R and Fletcher J 1997 Comparative ultrastructure of the salivary glands of two phyopathogen vectors, the beet leafhopper, Circulifer tenellus Baker, and the corn leafhopper, Dalbulus maidis De Long and Wolcott (Homoptera: Cicadellidae). Int. J. Insect Morphol. Embryol 26, 113–120. Wei W, Davis R E, Jomantiene R and Zhao Y 2008 Ancient, recurrent phage attacks and recombination shaped dynamic sequence-variable mosaics at the root of phytoplasma genome evolution. Proc. Natl. Acad. Sci. USA 105, 11827–11832. Weigel D and Meyerowitz E M 1993 Activation of floral homeotic genes in arabidopsis. Science 261, 1723- 1726. Weigel D and Meyerowitz E M 1994 The ABCs of floral homeotic genes. Cell 78, 203-209. Weigel D and Nilsson O 1995 A developmental switch sufficient for flower initiation in diverse plants. Nature 377 495-500. Weintraub P G and Beanland L A 2006 Insect vectors of phytoplasmas. Annual Revue of Entomology 51, 91-111. Weintraub P G and Jones P 2010 Phytoplasmas. Genomes, Plant Hosts and Vectors.Wallingford, UK: CABI. Weisburg W G, Tully J G, Rose D L, Petzel J P, Oyaizu H, Yang D, Mandelco L, Sechrest J, Lawrence T G and Van Etten J 1989 A phylogenetic analysis of the mycoplasmas: basis for their classification. J. Bacteriol. 171, 6455-6467. 324 Weisshaar B, Jenkins G I 1998 Phenylpropanoid biosynthesis and its regulation. Curr. Opin. Plant Biol . 1, 251-257. Wenderoth I and von Schaewen A 2000 Isolation and characterization of plant N- acetylglucosaminyltransferase I (GntI) cDNA sequences. Functional analyses in the Arabidopsis cgl mutant and in antisense plants. Plant Physiol 123, 1097 - 1108. Whitcomb R F, Chen T A, Williamson D L, Liao C, Tully J G, Bové J M, Mouchés C, Rose D L, Coan M E and Clark T B 1986 Spirolasma kunkelii sp. nov.: characterization of the etiologic agent of corn stunt disease. International Journal of Systematic Bacteriology 36, 170-178. Whitcomb R F and Tully E D 1989 The Mycoplasmas Vol. V. San Diego: Academic Press, Inc. White F F, Potnis N, Jones J B and Koebnik R 2009 The type III effectors of Xanthomonas. Mol. Plant Pathol. 10, 749–766. Wildermuth, M. C., Dewdney, J., Wu, G. and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature . 414(6863):562-565. Williamson V M and Gleason C A 2003 Plant–nematode interactions. Current Opinion in Plant Biology 6, 327-333. Wilson M, Campbell H L, Ji P, Jones J B and Cuppels D A 2002 Biological Control of Bacterial Speck of Tomato Under Field Conditions at Several Locations in North America. Phytopathology 92, 1284- 1292. Woese C R 1987 Bacterial evolution. Microbiological Reviews 51, 221-271. Wu J and Baldwin I T 2010 New insights into plant responses to the attack from insect herbivores. Annu. Rev. Genet. 44, 1–24. Wu X, Dabi T and Weigel D 2005 Requirement of homeobox gene STIMPY/WOX9 for arabidopsis meristem growth and maintenance. Current Biology 15, 436-440. Wyatt G 1967 The biochemistry of sugars and polysaccharides in insects. Advances in insect physiology, 287 - 360. X 325 Xiao W, Gehring M, Choi Y, Margossian L, Pu H, Harada J J, Goldberg R B, Pennell R I and Fischer R L 2003 Imprinting of the MEA Polycomb Gene Is Controlled by Antagonism between MET1 Methyltransferase and DME Glycosylase. Developmental cell 5, 891-901. Xinnian D 2001 Genetic dissection of systemic acquired resistance. Current Opinion in Plant Biology 4, 309- 314. Xiong L 2001 FIERY1 encoding an inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress signaling in Arabidopsis. Genes Dev. 15, 1971-1984. Xu P, Blancaflor E B and Roossinck M J 2003 In Spite of Induced Multiple Defense Responses, Tomato Plants Infected with Cucumber mosaic virus and D Satellite RNA Succumb to Systemic Necrosis. Molecular Plant-Microbe Interactions 16, 467-476. Xu X, Chen C, Fan B and Chen Z 2006 Physical and Functional Interactions between Pathogen-Induced Arabidopsis WRKY18, WRKY40, and WRKY60 Transcription Factors. pp 1310-1326. Xu Y, Chang P F L, Liu D, Narasimhan M L, Raghothama K G, Hasegawa P M and Bressan R A 1994 Plant defense genes are synergistically induced by ethylene and methyl jasmonate. pp 1077-1085. Y Yalpani N, Leon J, Lawton MA, Raskin I 1993 Pathway of salicylic acid biosynthesis in healthy and virusinoculated tobacco. Plant Physiol 103: 315–321 Yalpani N, Silverman P, Wilson T, Kleier D A and Raskin I 1991 Salicylic Acid Is a Systemic Signal and an Inducer of Pathogenesis-Related Proteins in Virus-Infected Tobacco. The Plant Cell Online 3, 809- 818. Yalpani N, Enyedi A J, León J and Raskin I 1994 Ultraviolet light and ozone stimulate accumulation of salicylic acid, pathogenesis-related proteins and virus resistance in tobacco. Planta 193, 372-376. Yalpani N, Schulz M, Davis M P and Balke N E 1992 Partial purification and properties of an inducible uridine 5 diphosphateglucose: salicylic acid glucosyltransferase from oat roots. Plant Physiol Plant 100, 457–463. Yang J Y, Iwasaki M, Machida C, Machida Y, Zhou X and Chua N H 2008 betaC1, the pathogenicity factor of TYLCCNV, interacts with AS1 to alter leaf development and suppress selective jasmonic acid responses. Genes. Dev. 22, 2564–2577. 326 Yang T and Poovaiah B W 2002 A Calmodulin-binding/CGCG Box DNA-binding protein family involved in multiple signaling pathways in plants. J. Biol. Chem. 277, 45049-45058. Yanofsky M F 1995 Floral meristems to floral organs: Genes controlling early events in arabidopsis flower development. Annual Review of Plant Physiology and Plant Molecular Biology 46, 167-188. Ye X S, Pan S Q, Kuc J 1990 Association of pathogenesis-related proteins and activities of peroxidase, β- 1,3-glucanase and chitinase with systemic induced resistance to blue mould of tobacco but not to systemic tobacco mosaic virus. Physiol. Mol. Plant Pathol. 36 , 523-531. Yeboah N A, Arahira M, Nong V H, Zhang D, Kadokura K, Watanabe A and Fukazawa C 1998 A class III acidic endochitinase is specifically expressed in the developing seeds of soybean (Glycine max [L.] Merr.). Plant Molecular Biology 36, 407-415. Yoshida K, Kaothien P, Matsui T, Kawaoka A. and Shinmyo A. 2003 Molecular biology and application of plant peroxidase genes. Appl. Microbiol. Biotechnol ., 60, 665-670. Yun J J, Heisler L E, Hwang I I L, Wilkins O, Lau S K, Hyrcza M, Jayabalasingham B, Jin J, McLaurin J, Tsao M-S and Der S D 2006 Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Research 34, e85. Yun J I, Lee H, Coca M, Narasimhan M, Uesono Y, et al. (1998) Osmotin, a Plant Antifungal Protein, Subverts Signal Transduction to Enhance Fungal Cell Susceptibility. Mol Cell 1: 807–817. Z Zeng L-R, Qu S, Bordeos A, Yang C, Baraoidan M, Yan H, Xie Q, Nahm B H, Leung H and Wang G-L 2004 Spotted leaf11, a Negative Regulator of Plant Cell Death and Defense, Encodes a U- Box/Armadillo Repeat Protein Endowed with E3 Ubiquitin Ligase Activity. The Plant Cell Online 16, 2795-2808. Zhang J. Z, Creelman R A and Zhu J-K 2004 From Laboratory to Field. Using Information from Arabidopsis to Engineer Salt, Cold, and Drought Tolerance in Crops. pp 615-621. Zhang J, Hogenhout S A, Nault L R, Hoy C W and Miller S A 2004 Molecular and symptom analyses of phytoplasma strains from lettuce reveal a diverse population. Phytopathology 94, 842–849. Zhang J, Li C, Wu C, Xiong L, Chen G, Zhang Q and Wang S 2006 RMD: a rice mutant database for functional analysis of the rice genome. pp D745-D748. 327 Zhang S and Klessig D 1998 The tobacco wounding-activated mitogen-activated protein kinase is encoded by SIPK. Proc Natl Acad Sci 95, 7225 - 7230. Zhang Z, Li Q, Li Z, Staswick P E, Wang M, Zhu Y and He Z 2007 Dual Regulation Role of GH3.5 in Salicylic Acid and Auxin Signaling during Arabidopsis-Pseudomonas syringae Interaction. pp 450- 464. Zhao Y, Sun Q, Wei W, Davis R E, Wu W and Liu Q 2009 'Candidatus Phytoplasma tamaricis', a novel taxon discovered in witches'-broom diseased salt cedar (Tamarix chinensis Lour.). International Journal of Systematic and Evolutionary Microbiology 59, 2496-2504. Zhao Y, Thilmony R, Bender C L, Schaller A, He S Y and Howe G A 2003 Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. The Plant Journal 36, 485-499. Zhao J, Davis L C and Verpoorte R 2005 Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnology Advances 23, 283-333. Zheng X, Pontes O, Zhu J, Miki D, Zhang F, Li W-X, Iida K, Kapoor A, Pikaard C S and Zhu J-K 2008 ROS3 is an RNA-binding protein required for DNA demethylation in Arabidopsis. Nature 455, 1259-1262. Zheng X, Zhu J, Kapoor A and Zhu J K 2007 Role of Arabidopsis AGO6 in siRNA accumulation, DNA methylation and transcriptional gene silencing. EMBO J. 26, 1691-1701. Zheng Z, Mosher S L, Fan B, Klessig D F and Chen Z 2007 Functional analysis of Arabidopsis WRKY25 transcription factor in plant defense against Pseudomonas syringae. BMC Plant Biology 7:2. Zhou, S., Sauvé, R. and Thannhauser, T. W. (2009). Proteome changes induced by aluminium stress in tomato roots. J. Exp. Bot., 60, 1849-1857. Zhou, S., Sauvé, R., Boone, B. and Levy, S. (2008). Identification of genes associated with aluminium toxicity in tomato roots using cDNA microarrays. Plant Stress, 2, 113–120. Zhou J-M, Trifa Y, Silva H, Pontier D, Lam E, Shah J and Klessig D 2000 NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Mol Plant-Microbe Interact 13, 191 - 202. 328 Zhou, T. and Paulitz, T. C. (1994). Induced resistance in the biocontrol of Pythium aphanidermatum by Pseudomonas spp. on cucumber. J. Phytopathol. 142(1):51-63. Zhu J, Kapoor A, Sridhar V V, Agius F and Zhu J-K 2007 The DNA Glycosylase/Lyase ROS1 Functions in Pruning DNA Methylation Patterns in Arabidopsis. Current Biology 17, 54-59. Zhu J-K 2008 Epigenome Sequencing Comes of Age. Cell 133, 395-397. Ziadi S, Barbedette S, Godard J F, Monot C, Le Corre D, Silue D 2001 Production of pathogenesis-related proteins in the cauliflower ( Brassica oleracea var. botrytis )-downy mildew ( Peronospora parasitica ) pathosystem treated with acibenzolar-S-methyl. Plant Pathology 50:579-586. Zipfel C and Felix G 2005 Plants and animals: a different taste formicrobes? Curr. Opin. Plant Biol 8, 353– 360. Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones J D G, Boller T and Felix G 2006 Perception of the Bacterial PAMP EF-Tu by the Receptor EFR Restricts Agrobacterium-Mediated Transformation. Cell 125, 749-760. Zupan J, Muth T R, Draper O and Zambryski P 2000 The transfer of DNA from Agrobacterium tumefaciens into plants: a feast of fundamental insights. Plant J. 23, 11–28. 329 330 LIST OF ABBREVIATIONS 331 Abbreviations ACC Aminocyclopropane carboxylic acid AFLP Amplified fragment length polymorphism AOC Allene oxide cyclase AOS Allen Oxide Synthase avr - Avirulence AUGSY Australian Grapevine Yellows AY-WB Aster yellows-witch’s broom BGL2 β -1,3-glucanase BSA Bovine serum albumin BTH Acid benzol (1,2,3) thiadiazole-7- arbothioic s-methyl ester bp Base pair C Cytocine Ct Thresh hold cycle Ca Candidatus cDNA Complementary DNA CBP Calcium-binding EF hand family protein CDP-star Disodium2-chloro-5-(4-methoxyspiro (1,2-dioxetane-3,2’-(5’-chloro) tricyclo (3.3.1.1) decan)-4-yl)-1-phenyl phosphate CTAB Cetyltrylmethyl ammonium bromide CHS Chalcone synthase CMT Chromomethylase DEM DEMETER DML DEMETER like DNAase Deoxyribonuclease DNA Deoxyribonucleic acid DNMT DNA Methyltransferase DTT Dithiothreitol EDTA Ethylene diamine tetra acetate ET Ethylene ETI Effector triggered immunity ERF Ethylene response factor G Guanine 332 GFP Green Fluorescent Protein g Gramme HR Hypersensitive Response HRGP Hydroxyproline-rich glycoproteins h Heure ICS Isochorismate synthase IPTG Isopropyl-Beta-D-thiogalactopyranoside ISR Induced systemic resistance JA Jasmonic acid k Da kilo Dalton kbp kilo base pair LoxD Lipoxygenase D M Mole per litre M Metre MAMP Microbe-associated molecular pattern MAP Mitogen-activated protein MET Methyl transferase MeJA Methyl jasmonate MSRE Methylation sensitive restriction enzymes min Minute MS Murashige and Skoog Medium MLO Mycoplasma like organism OPDA 12-oxophytodienoic acid PAL Phenylalanine ammonia lyase PAMPS Pathogen associated molecular patterns PCR Polymerase Chain reaction PGPR Plant Growth Promoting rhizobacteria PIN2 Proteinase inibitor 2 PR Pathogenesis-related PTGS Post transcriptional gene silencing PTI PAMP triggered immunity pv Pathovar PRRs Pattern recognition receptors q-RT-PCR Real time RT-PCR ROS Reactive oxygen species ROS1 Repressor of silencing 1 RNA Ribonucleic acid 333 rRNA Ribosomal RNA rp Ribosomal proteins SDS Sodiumdodecyl sulphate SA Salicylic acid SAR Systemic acquired resistance TTSS Type III secretion system TE Tris-EDTA Tn Transposon Tris Tris-(hydroxymethyl1)-aminoethane TEMED N,N,N1,N1-tetramethyleneethylenediamine U Uracil UV Ultra voilet V volt v/v volume/ volume X-Gal 5-bromo-4-chloro-3-indolyl-beta-D-galactoside 334 Résumé En Français 335 Résumé de la thèse de Monsieur Jam Nazeer AHMAD Titre Etude de l’expression de gènes impliqués dans les voies de défense et les mécanismes épigénétiques chez la tomate infectée par le phytoplasme du stolbur Introduction Les phytoplasmes sont des bactéries phytopathogènes sans parois cellulaires appartenant à la classe des Mollicutes. Ils sont responsables de nombreuses maladies de plantes d'espèces diverses dans le monde entier. Ils ont une petite taille de génome et ne peuvent pas être cultivés in vitro . Dans la plante hôte, les phytoplasmes sont limités au tissu du phloème dans lequel ils se multiplient et où ils se déplacent pour envahir toute la plante. Ils sont naturellement transmis de plante à plante par des insectes piqueurs-suceurs appartenant aux familles des Cicadellidae (leafhoppers) et des Fulgoridae (planthoppers) dans lesquels les phytoplasmes se multiplient. Les phytoplasmes du groupe du stolbur sont transmis par une cicadelle polyphage ( Hyalesthes obsoletus ) qui peut s’alimenter sur de nombreuse espèces de plantes comme les labiaceae (lavande…), les convolvulaceae (liseron…), la vigne et les solanaceae (tomate, pomme de terre, poivron…). Ils induisent des symptômes sévères aboutissant à la perte de récolte en raison de la croissance limitée, du déclin et de la mort des plantes, mais aussi à cause d’anomalies florales ou d’avortement des fleurs et des fruits. L’infection par le phytoplasme du stolbur est en effet connue pour affecter fortement la morphologie des fleurs. Chez la tomate, deux isolats du phytoplasme du stolbur, nommés C et PO, induisent des symptômes différents. Les tomates infectées par le phytoplasme du stolbur PO montrent un développement anormal des fleurs comme des sépales hypertrophiés, voire des symptômes de big-bud, ainsi que des étamines et des pétales avortés. Les feuilles infectées sont de taille normale, mais chlorotiques et recourbées en forme de crochet. Les symptômes sont différents chez les tomates infectées par le phytoplasme du stolbur C. En effet, les feuilles sont petites et découpées, alors que les fleurs sont presque normales et produisent des fruits. 336 Il a été montré que les anomalies des fleurs de tomate induites par l'infection par le phytoplasme du stolbur PO sont associées aux changements d'expression de certains gènes du développement floral (Pracros et al., 2006). Par exemple, le gène SlDEFICIENS ( SlDEF ), impliqué dans la formation des pétales des fleurs, est réprimé, alors que son facteur de transcription, le gène FALSIFLORA ( FA ), a une expression inchangée ou légèrement activée. La répression de l’expression du gène SlDEF ne peut donc pas être due à l’action de son facteur de transcription FA . La méthylation de l’ADN est un mécanisme connu pour inhiber l'expression des gènes (Chan et al., 2005). Ainsi, chez les plantes et les animaux, la méthylation de la cytosine est un processus qui régule l’expression des gènes de façon épigénétique. Les gènes peuvent être réprimés lorsque le nombre de cytosines méthylées est plus grand comparé au statut normal de méthylation (Jacobsen et al., 2000). Ce phénomène est appelé "hyperméthylation". Les méthylases et les déméthylases sont les enzymes qui déterminent le schéma de méthylation de l'ADN génomique. Elles pourraient être impliquées dans la répression des gènes du développement floral chez les tomates infectées par l’isolat PO du phytoplasme du stolbur. Il a d’ailleurs été suggéré chez Arabidopsis, que la répression de l’expression du gène APETALA3 (orthologue du gène SlDEF de tomate) peut résulter de son hyperméthylation (Finnegan et al., 1996). Peu de choses sont connues quand aux mécanismes moléculaires intervenant dans l’apparition des symptômes observés chez les plantes infectées par des phytoplasmes. Pour comprendre les processus moléculaires associés aux anomalies florales et l'implication de la méthylation dans la dérégulation des gènes du développement floral, nous avons étudié l'expression de certains de ces gènes ainsi que des gènes impliqués dans les processus de méthylation (méthylases) et déméthylation (déméthylases). Nous avons également déterminé le statut de méthylation du gène SlDEF chez les tomates infectées par le phytoplasme du stolbur. Ceci est l’objet du premier chapitre de la thèse. Par ailleurs, il est connu que de nombreux organismes pathogènes et parasites, virus, bactéries, champignons, nématodes et herbivores, attaquent les plantes. Pour se défendre face à ces attaquants potentiels, les plantes emploient des stratégies différentes. Elles synthétisent notamment différentes phytohormones qui sont 337 essentielles pour leur croissance, leur développement, et leur reproduction, mais qui sont également utilisées comme des molécules signal dans les réponses de défense. L’acide salicylique (SA), l’acide Jasmonique (JA) et l'éthylène (ET) sont les signaux principaux des voies de défense des plantes contre les pathogènes et les insectes herbivores. L'induction de protéines de pathogénie (les PR protéines) est l’un des principaux évènements associés aux voies de défense. Chaque voie de défense possède ses propres marqueurs moléculaires qui permettent de les étudier. Les phytoplasmes pourraient altérer le niveau de diverses phytohormones. En effet, les changements saisissants dans la morphologie et le développement des plantes (feuilles plus petites, ou courbées, hypertrophie des sépales…) causés par les phytoplasmes suggèrent que ces pathogènes changent l'équilibre des signaux régulateurs dans les plantes infectées. A l’heure actuelle, peu de choses sont connues sur les mécanismes de défense des plantes face à l’infection par des phytoplasmes. Récemment, il a été montré que les phytoplasmes possédaient un système de translocation Sec-dépendant fonctionnel, permettant à ces pathogènes de sécréter des protéines, tels que des effecteurs comme SAP11 et TENGU du phytoplasme de l’Aster Yellows ou de l’Onion Yellows respectivement, qui sont retrouvées dans les cellules hôtes des plantes et des insectes (Hogenhout et al., 2010; Bai et al., 2009). Il a été montré notamment que chez des lignées d’Arabidopsis transgéniques exprimant la protéine SAP11, une protéine effectrice sécrétée par le phytoplasme de l’Aster Yellows, l'expression du gène Lox2 et l'accumulation de JA sont réduites (Sugio et al., 2010). La voie de signalisation dépendante de JA semble donc impliquée dans la réponse de défense des plantes au phytoplasme de l’Aster Yellows AY-WB, la protéine SAP11 interférant avec la synthèse de JA. Ainsi il a été montré que SAP11 intervient dans la régulation des voies de défense des plantes et module la production de phytohormones comme le JA. Jusqu’à présent, dans les quelques séquences connues du génome du phytoplasme du stolbur, aucun effecteur n'a été identifié. Nous ne savons pas si ce phytoplasme réprime les voies de défense afin de stimuler la colonisation des tissus infectés. C’est dans ce but que nous avons étudié l'expression de 15 gènes faisant partie des voies de défenses dépendantes de SA, JA ou ET chez des tomates infectées par le phytoplasme du stolbur isolats C et PO. Nous avons également étudié l'effet de la pré activation des voies de défenses 338 dépendantes de SA et JA sur le développement des symptômes de la maladie. Ceci fait l’objet du deuxième et du troisième chapitre de la thèse. Chapitre I L'expression transcriptionnelle des gènes du développement floral a été étudiée chez les tomates infectées par le phytoplasme du stolbur par RT-PCR semi-quantitative. Il a été trouvé que l’expression du facteur de transcription du gène SlDEF , c'est-à-dire le gène FA (orthologue de LEAFY chez Arabidopsis) était inchangée ou légèrement activée chez les tomates infectées par l’isolat PO du phytoplasme du stolbur, tandis que, en accord avec le fait que les fleurs des plantes infectées n’ont pas de pétales, l’expression du gène SlDEF , orthologue d' APETALA3 et impliqué dans la formation des pétales, était réprimée. La répression du gène SlDEF ne pouvant pas être associée à l’action de son facteur de transcription FA , nous avons fait l’hypothèse qu’elle pouvait être due à sa méthylation. Ceci a été conforté par les résultats obtenus lors d’expériences utilisant la 5-azacytidine. Cette molécule est connue pour diminuer le niveau de méthylation global des plantes. Les plants de tomates ont donc été traités avec la 5-aza-C puis infectés par le phytoplasme du stolbur. Le développement des symptômes a été noté et l'expression du gène SlDEF a été déterminée par RT-PCR. Les tomates traitées avec la 5-aza-C et infectées par le phytoplasme du stolbur isolat PO ont montré un développement normal des fleurs dans 2% des cas ainsi qu’une 'expression rétablie de SlDEF . La méthylation est effectué par des enzymes nommées ADN méthylases, et se fait généralement chez les plantes dans des contextes CG, CNG ou CNN. La déméthylation est effectuée par des ADN déméthylases. Nous avons étudié l’expression transcriptionnelle de gènes de méthytransferases et de déméthylases chez des tomates infectées par les phytoplasmes du stolbur isolats C et PO, par RT-PCR semi-quantitative. Les résultats ont montré que l'expression des gènes de classe II (Chromomethylases) qui sont spécifiques des plantes, est réprimée chez les tomates infectées par l’isolat PO du phytoplasme du stolbur. Le niveau de transcriptions des gènes des ADN déméthylases a été aussi étudié par RT-PCR semi-quantitative et en temps réel. Les résultats ont indiqué que l’expression des gènes des ADN déméthylases est réprimée chez les tomates infectées par l’isolat PO du phytoplasme du stolbur, mais activée par l’isolat C du phytoplasme du stolbur. 339 Le statut de méthylation du gène SlDEF a été déterminé par MSRE-PCR (Methylation Sensitive Restriction Enzyme Polymerase Chain Reaction). En utilisant deux enzymes de restriction, Mbo I et Sau 3AI, de sensibilité différente à la méthylation, il a été trouvé qu’un site CGATC situé dans la séquence du gène SlDEF était légèrement plus méthylé chez les tomates infectées par le phytoplasme du stolbur isolat PO en comparaison aux tomates saines. Ce résultat semble être en faveur d’une méthylation plus importante du gène SlDEF chez les tomates infectées par l’isolat PO et supporte l’hypothèse que la répression du gène SlDEF pourrait être due à la méthylation. L’état de méthylation de la région promotrice du gène SlDEF a été déterminé par séquençage au bisufite. Le traitement au bisulfite convertit les cytosines non méthylées en thymine (T) ou uracyl (U) tandis que les cytosines méthylées (C) restent inchangées. Après analyse, il a été noté que l’état de méthylation était fluctuant au long de la séquence étudiée du gène SlDEF , avec des positions plus méthylées que d'autres, mais aucune différence significative n’a pas été observée entre les plantes saines et les plantes infectées. Conclusion du chapitre I Bien qu'une répression de l'expression de gènes impliqués dans la méthylation et la déméthylation ait été observée chez les tomates infectées par le phytoplasme du stolbur isolat PO, ce qui semblait indiquer une absence de déméthylation, ceci n’a pas été confirmé par l’étude de l’état de méthylation de l’ADN, notamment du gène SlDEF . La répression du gène SlDEF ne peut donc pas être reliée fermement avec la méthylation de son promoteur. Chapitre II L'expression de 15 gènes impliqués dans les voies de défense des plantes a été étudiée chez les tomates infectées par le phytoplasme du stolbur isolats C et PO par RT-PCR semi-quantitative et en temps réel. Ces gènes impliqués dans les voies de défenses dépendantes de SA, ET ou JA, incluent aussi quelques facteurs de transcription ainsi que des gènes intervenant dans la biosynthèse de ces phytohormones. Les résultats ont montré clairement que des voies de défense différentes ont été activées chez les tomates infectées par le phytoplasme du stolbur C et chez celles infectées par le phytoplasme du stolbur PO. 340 Chez les tomates infectées par le phytoplasme du stolbur C, le gène de la phenylalanine ammonia lyase (PAL) qui agit en amont de la biosynthèse de SA et qui est impliqué dans les voies de défense, a été activé. Par contre, la transcription des gènes d’enzymes de la biosynthèse de SA, l’isochorismate synthase (ICS) et la chalcone synthase 2 (CHS2), n’a pas été activée. Les gènes de certaines protéines PR de la voie de SA, PR1a, PR1b, PR2a, PR5, PR7 (69B) et PR10 , ont été activés, suggérant que la voie de défense dépendante de SA est présente et active chez les tomates infectées par l’isolat C du phytoplasme du stolbur. Les gènes de la voie de défense dépendante de l'éthylène (ET) ainsi que des gènes de facteurs de transcription, TSR et Pti4 , des gènes marqueurs de la voie de l’ET, PR1b, PR4 , et PR7 (69B) ont été activés. Le gène de la lipoxygenase D (LoxD ) qui est impliqué dans la biosynthèse de JA, ainsi que des gènes marqueurs de la voie dépendante de JA tel que l’inhibiteur de protéase 2 ( PIN2 ) et des gènes de protéines PR2 ( PR2 basique, BGL2 et GluB ) ont été activés, suggérant que la voie de défense dépendante de JA est aussi présente et active chez les tomates infectées par l’isolat C du phytoplasme du stolbur. Chez les tomates infectées par l’isolat PO du phytoplasme du stolbur, l'expression du gène PAL a été réprimée tandis que celle des gènes ICS et CHS2 a été activée, en parallèle avec l'activation de gènes de PR protéines de la voie dépendante de SA tels que PR1a, PR1b, PR2a, PR5, PR7 (69B) et PR10 . Ceci suggère que la voie de défense dépendante de SA a été activée chez les tomates infectées par l’isolat PO du phytoplasme du stolbur. De la même façon, l’expression des gènes de la voie de défense dépendante de ET a aussi été activé parce que les gènes des facteurs de transcription TSR et Pti4 , ainsi que les gènes des PR protéines PR1b, PR4, et PR7 (69B) ont été activés chez les tomates infectées par l’isolat PO du phytoplasme du stolbur. Cependant, à la différence des tomates infectées par l’isolat C, les gènes de la voie de défense dépendante de JA n'ont pas été activés. En effet, le gène de l'enzyme de biosynthèse de JA, LoxD , ainsi que des gènes marqueurs de la voie dépendante de JA comme PIN2 et PR2 basique ( PR2 basique, BGL2 et GluB ) était sévèrement réprimés. Conclusion du chapitre II -La transcription des gènes impliqués dans les voies de défense dépendantes de SA, de ET et de JA a été activée chez les tomates infectées par l’isolat C du phytoplasme du stolbur. Il est donc possible qu’une 341 interaction synergique existe entre ces différentes voies de défense chez les tomates infectées par l’isolat C du phytoplasme du stolbur -La transcription des gènes impliqués dans les voies de défense dépendantes de SA et de ET a été activée chez les tomates infectées par l’isolat PO du phytoplasme du stolbur. Par contre, une répression a été observée pour les gènes de la voie dépendante de JA. Le niveau d'expression des gènes ICS et CHS2 a été supérieur, contrairement au gène PAL qui était réprimé. Ainsi, une interaction synergique pourrait exister entre les voies de défense dépendantes de SA et ET, mais antagoniste avec la voie de défense dépendante de JA. -L'expression de tous les gènes mentionnés ci-dessus a été étudiée après l'infection des tomates par deux isolats différents du phytoplasme du stolbur. Les résultats de l'expression des gènes dans les feuilles et dans les boutons floraux ont suggéré le même schéma d'expression dans les deux organes. Chapitre III Il a été montré que la pré activation des voies de défense dépendantes de SA et de JA pouvait être efficace pour lutter contre différentes bactéries phytopathogènes. Peu de choses sont connues concernant l’importance des voies de défense dépendantes de SA et JA dans la relation tomate-phytoplasme du stolbur. Il n’est pas encore clair si les voies de transduction de signal et les stratégies de défense déclenchées par l’infection par l’isolat PO du phytoplasme du stolbur sont les mêmes que celles observés lors de la résistance contre d'autres pathogènes foliaires ou contre des insectes piqueurs-suceurs. Nous avons donc déterminé si la pré activation et/ou la stimulation des voies de défense dépendantes de SA ou celle dépendante de JA pouvaient avoir un rôle dans l’établissement de la maladie. Pour ceci, des traitements ont été effectués avec l'analogue de SA, le benzo (1, 2, 3) thiadiazole-7-carbothioic l'ester de S- méthyle acide (BTH) ainsi qu’avec l’Acide Méthyle Jasmonique (MeJA) pour activer les voies de défense respectives. L’expression du gène PR1 acide a été utilisée comme marqueur de la voie dépendante de SA, et le gène PIN2 comme marqueur de la voie dépendante de JA. Comme attendu, chez les tomates traitées avec le BTH, 342 nous avons observé une activation de la transcription du gène marqueur PR1 acide en parallèle avec une répression du gène PIN2 . L’opposé a été observé chez les tomates traitées par le MeJA. Les résultats ont montré que la pré activation de la voie de défense dépendante de SA par l'application de BTH modifiait peu l'évolution des symptômes de la maladie chez les tomates infectées par l’isolat PO du phytoplasme du stolbur. Même si après 2 semaines de transmission du phytoplasme du stolbur isolat PO, seulement 30 % des tomates traitées par le BTH ont montré des symptômes, en comparaison avec les tomates non traitées, après 3 à 4 semaines, toutes les tomates étaient symptomatiques. Tous les échantillons prélevés sur les tomates infectées, traitées ou non au BTH, ont été trouvés positifs pour la présence de phytoplasmes. Le traitement au BTH semble cependant avoir un effet sur la multiplication des phytoplasmes du stolbur PO puisque une plus faible amplification était observée chez les tomates traitées au BTH en comparaison des non traitées. Le traitement au MeJA active la voie de défense dépendante de JA et réprime la voie de défense dépendante de SA. En effet, le gène marqueur de la voie dépendante de JA, PIN2 , a été activé tandis que le gène de marqueur de la voie dépendante de SA, PR1 , a été réprimé. Les observations ont montré que la pré activation de la voie de défense dépendante de JA n'a pas contribué à la modification de l'évolution de la maladie et n’a eu aucun effet sur la multiplication de l’isolat PO du phytoplasme du stolbur chez les tomates traitées. L’étude de l’expression d’autres gènes marqueurs des voies de défense chez les tomates traitées par le BTH ou le MeJA a permis de montrer que ces deux composés activaient bien les voies correspondantes chez les tomates traitées par aspersion, et ceci dès 2 jours après application. Conclusion du chapitre III -Chez les tomates, le traitement au BTH active la voie de défense dépendante de SA et active l'expression transcriptionnelle de gènes marqueurs comme PR1 acide, et réprime la voie dépendante de JA et réprime entre autre le gène marqueur PIN2 . -Chez les tomates, la pré activation de la voie de défense dépendante de SA par l'application de BTH modifie peu l'évolution des symptômes de la maladie causée par l’isolat PO du phytoplasme du stolbur. Ainsi, même si seulement 30 % des tomates traitées au BTH montrent des symptômes après deux semaines d’infection alors que 100% des non traitées sont symptomatiques, toutes les tomates infectées sont symptomatiques après 3 semaines. 343 -Le traitement au BTH semble avoir un effet sur la multiplication de l’isolat PO du phytoplasme du stolbur. Les signaux d'ADN amplifiés pour la détection sont en effet plus faibles chez les tomates traitées au BTH. -le traitement au MeJA active la voie de défense dépendante de JA et réprime la voie de défense dépendante de SA. En effet, le gène marqueur de la voie dépendante de JA, PIN2 , a été activé, alors que le gène de marqueur de la voie dépendante de SA, PR1 , a été réprimé. -Le traitement au MeJA a peu d’influence sur l’évolution de la maladie ainsi que sur la multiplication de l’isolat PO du phytoplasme du stolbur chez les tomates. -Comme attendu, le niveau d'expression des gènes de la voie dépendante de SA a été augmenté après traitement au BTH, et le niveau d'expression des gènes de la voie dépendante de JA a été augmenté après traitement au MeJA. -La pré activation des voies de défense dépendantes de SA et/ou JA n’intervient pas, ou très peu, dans le déroulement de la maladie et ne pourra donc pas servir de piste pour étudier les mécanismes de défense des tomates vis-à-vis de l’infection par le phytoplasme du stolbur. 344 345 Phytoplasma are cell wall-less, phytopathogenic bacteria belonging to the class Mollicutes . They have not been cultured in vitro and are restricted to the phloem sieve tubes. They cause hundreds of diseases in many plant species worldwide, resulting in important crop losses. Phytoplasmas are naturally transmitted by sap- sucking insects in which they multiply. They induce severe symptoms including yellowing, restricted growth, decline, as well as major flowers and fruits abnormalities. The stolbur phytoplasma infection, in particular, has been reported to strongly affect floral morphology. In tomato, two different isolates of stolbur phytoplasma, named C and PO, induce different symptoms. The stolbur PO phytoplasma-infected plants show abnormal flower development such as hypertrophied sepals, and aborted petals and stamens leading to sterility. In contrast, stolbur C phytoplasma- infected tomato have small indented leaves but nearly normal flowers, and produce fruits. We have previously shown that SlDEF , one gene involved in petal formation, was repressed in stolbur PO phytoplasma-infected tomato. However, the expression of its transcription factor, encoded by the gene FA , was unchanged or slightly up-regulated. So we hypothesized that SlDEF repression could be due to DNA methylation. To test this hypothesis, we studied the expression of DNA methylases and demethylases genes. They were in general down-regulated in stolbur PO infected tomato, which was in agreement with the hypothesis. However, the regulation of SlDEF expression could not be firmly correlated to the DNA methylation status of its promoter region. In addition, we studied the plant defense pathways activated in stolbur phytoplasma-infected tomato. To defend themselves, plants used signalling molecules like Salicylic acid (SA), Jasmonic acid (JA) and Ethylene (ET). We studied the expression of 21 SA/JA/ET regulated defense and biosynthesis genes including transcription factors in stolbur C and PO phytoplasma-infected tomato as compared to healthy ones. We also studied the effect of pre-activation of SA and JA mediated defense pathways on symptom production. Our results clearly showed that defense pathways were activated differently in stolbur C and PO phytoplasma-infected tomato. Indeed, SA ET and JA dependant pathways were activated in stolbur C- infected tomato while only SA and ET dependant pathways were activated in stolbur PO-infected plants. In addition, pre-activation of SA-dependent defense pathway by application of BTH slightly modify the evolution of disease symptoms caused by stolbur PO phytoplasma whereas no effect was observed after treatment with an analogue of JA. Key words: Phytoplasma, Flower development Genes, DNA Methylation, DNA Demethylation, Defense Pathways, Pathogenesis related Proteins Genes, Plant activators, SAR, PCR. 346