MULTIPLE ROLES OF AFADIN IN EPITHELIAL MORPHOGENESIS
Kendall Jacob Lough
A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Curriculum of Genetics and Molecular Biology.
Chapel Hill 2020
Approved by
Scott Williams
Mark Peifer
Victoria Bautch
James Bear
Stephanie Gupton
© 2020 Kendall Jacob Lough ALL RIGHTS RESERVED
ii
ABSTRACT
Kendall Jacob Lough; Multiple Roles of Afadin in Epithelial Morphogenesis (Under the direction of Dr. Scott Williams)
Afadin is an essential actin-binding protein which scaffolds between nectin- and cadherin-based cell-cell adhesions and the underlying cytoskeleton. Previous studies have shown that afadin isrequired for the establishment of polarity cues, maintaining epithelial integrity, bearing molecular contractile forces, and orienting cell divisions. Herein, I explore how afadin contributes to oriented cell division in embryonic epidermal progenitors in order to balance self-renewal and differentiation. Secondly, I detail how the afadin-nectin cell-cell adhesion system in craniofacial development.
During organogenesis, precise control of spindle orientation balances proliferation and differentiation. In the developing murine epidermis, planar and perpendicular divisions yield symmetric and asymmetric fate outcomes, respectively. My research describes a novel mechanism which corrects erroneous anaphase orientations during telophase. The directionality of reorientation correlates with the maintenance or loss of basal contact by the apical daughter. The fidelity of telophase correction also relies on the adherens junction proteins vinculin, α-E-catenin, and afadin. Failure of this corrective mechanism impacts tissue architecture, as persistent oblique divisions induce precocious, sustained differentiation.
The division orientation plasticity provided by telophase correction may enable progenitors to adapt to local tissue needs.
Familial genetic studies have shown that mutations in NECTIN1 , an afadin binding partner, cause cleft lip/palate ectodermal dysplasia (CLPED1). Cleft palate (CP) is one of the most common congenital diseases and arises from failures in secondary palatogenesis during embryonic development. While the genetic link between NECTIN1 and CP is well established, mouse models have largely failed to
iii recapitulate these findings. Here, I provide the first evidence in an animal model that the nectin-afadin
axis is essential for palatogenesis. We demonstrate that conditional loss of afadin ( Afdn )—an obligate
nectin-binding protein—induces a high penetrance of CP. In contrast, loss of Nectin1 or Nectin4 induces
CP with low penetrance, while loss of both causes severe CP with a frequency similar to Afdn loss.
Finally, expression of the human disease mutant NECTIN1 W185X causes CP with greater penetrance than
Nectin1 loss, suggesting this alteration may drive CP via a dominant interfering mechanism. These
disparate projects share afadin as a common thread, weaving together two complex phenomena in
embryonic epithelia morphogenesis.
iv
ACKNOWLEDGMENTS
As co-first student to join the Williams lab, I often think of the lab’s growth and maturation as a metaphor for my own. In my eagerness to begin graduate school, I performed a summer rotation in
Scott’s lab where I was Scott’s first employee—helping unpack boxes and set up equipment. After joining the lab at the same time as another student, Kevin and I spent those first few years somewhat
naïvely throwing grandiose ideas and experiments at the wall—hoping anything would stick. Such was
the optimism and invigorating positivity of our mentor, that we were unafraid to pursue nearly anything.
At the same time, Scott’s unwavering commitment to his students (and a much-needed dose of scientific guidance) ensured we successfully landed on our feet. We both found wonderful projects, helped establish a positive, fun, and productive lab environment, and formed meaningful personal relationships. But this was only possible because Scott empowered us to take joint ownership of the lab—to contribute to something, rather than simply be a trainee. Scott always prioritized the people in the lab and in doing so, has set a wonderful example for how to be a good mentor—regardless of profession—for the numerous undergraduate and graduate students that have come through our doors. Scott has also been a fantastic scientific mentor, striking a balance between guiding and trusting that can be difficult to achieve. Through his mentorship, I’ve come to believe that I can have a career as an academic research scientist and—more importantly—that I can find real joy while doing so. For that, I am eternally grateful.
The Williams lab has always been a wonderful place to do research, in no small part thanks to the diverse, fun, and weird group of undergraduate and graduate students that have been a part of our team.
I’ve had the great fortune to work with and mentor more than a dozen fantastic people, with many of whom I’ve formed lasting friendships. These people have taught me so much about being part of a team,
v about being a rigorous scientist, and most importantly, how to be a supportive friend. Through burnt
fingers (non-work related), grant and manuscript rejections, and personal and profession successes, the people of the Williams lab have kept me laughing and smiling through everything. Thank you all for your giddiness, your goofiness, and your encouragement.
I also want to thank my dissertation committee: Drs. Mark Peifer, Vicky Bautch, Jim Bear, and
Stephanie Gupton, whose help and support have been invaluable. My committee meetings were always productive, insightful and extremely beneficial to both my work and my personal career. Their analysis and guidance significantly improved the rigor and impact of my thesis work and I always felt that they had my best interests at heart. Vicky’s expertise in vascular cell biology and collaborative inclination improved my thesis work and allowed me to explore the tractability of micropatterned substrates as a screening platform for regulators of oriented cell division in keratinocytes. Stephanie’s perspective as an expert cytoskeletal cell biologist and microscopist significantly benefited my studies of actin organization
in cell-culture models and improved the quality of my fluorescent image analyses. Similarly, Jim’s
expertise in cytoskeletal biology and willingness to share their abundance of genetic imaging tools
allowed me to dream big and pursue exciting experiments in actin imaging. I especially want to thank
Mark, who throughout my graduate career has served as a de facto—and with regards to my F31
fellowship, official—secondary mentor to me. Mark’s honest and blunt approach towards scientific rigor
was extremely helpful, as was his expertise on Drosophila canoe and polarity systems. Mark has always been willing to give me his time and attention, whether to provide comments on a grant proposal, a
manuscript, or just some confusing data, and his suggestions have always benefited the science.
I also feel it is important to acknowledge the support of Danelle Devenport, without whom the
live imaging experiments in Chapter 3 would not have been possible. Danelle found me at the annual
ASCB meeting in 2017 and freely offered to share their unpublished protocol to help me address a
specific hypothesis. She similarly took the time to follow up and walk me through, step by step, the
hurdles her lab had overcome to establish and optimize this protocol. Doing so did not help support any
vi ongoing projects in her lab, demonstrating an approach towards scientific collaboration worth aspiring
too.
I’d like to thank the funding sources that have made my research possible. Scott Williams was
supported by a Sidney Kimmel Scholar Award (SKF-15-165). I was supported for two years by an NIH
Ruth L. Kirschstein Predoctoral National Research Service Award (F31 DE026956).
I’d also like to thank my family—both the Lough and Niederkorn sides—who have always been
caring and supportive, and who demonstrate great patience and interest whenever I try to explain some
science tidbit over dinner. Lastly, I’d like to thank Kendra, my wife and best friend, whose constant love, patience, and support has been my rock throughout my PhD.
vii
PREFACE
This dissertation and the work presented herein attempts to describe the role of afadin in two distinct morphogenic processes: oriented cell division and secondary palatogenesis. Chapter 1 aims to summarize the discovery of afadin and its known binding partners (1.1), describe the known roles of afadin in cell-cell adhesion (1.2), introduce the process of asymmetric cell division (1.3) and highlight
studies showcasing afadin’s role in embryonic development and disease (1.4).
Chapter 2 represents a review article I wrote with substantial support from my colleague, Dr.
Kevin Byrd. While I primarily contributed the introduction (2.1) and literature summary of cell-cell
adhesion molecules in palatogenesis (2.2 and 2.3), Dr. Byrd and our mentor, Dr. Scott Williams, co-wrote
the portion summarizing the tools available for validating candidate genetic variants associated with cleft
lip/palate (2.4). The review was published previous to writing this thesis with the following citation:
Lough, K.J., Byrd, K.M., Spitzer, D.C. & Williams, S.E. (2017) Closing the Gap: Mouse Models
to Study Adhesion in Secondary Palatogenesis. J Dent Res 96 , 1210-1220.
KJL, KMB, and SEW outlined the review topics and collaboratively wrote the manuscript with varying
degrees of contribution. DCS provided extensive edits and intellectual input throughout manuscript preparation and revision. Permission to include the article in its entirety in a PhD dissertation was retained from SAGE (publisher of JDR), as explained at: https://us.sagepub.com/en-us/nam/journal-author- archiving-policies-and-re-use
Chapter 3 is derived from a peer-reviewed publication on which I am the lead author. This work began as a simple investigation of a candidate gene ( Afadin ) and its role in oriented cell division in the
embryonic epidermis. This project, however, took on a life of its own, eventually leading to the discovery
viii of a novel mechanism essential for establishing the bimodal distribution of division angles associated
with the bipotency of basal progenitors. Excitingly, afadin, as well as additional actin binding proteins, proved to be essential for this particular mechanism. This article was published previous to the writing of
this thesis with the following citation:
Lough, K.J., Byrd, K.M., Descovich, C.P., Spitzer, D.C., Bergman, A.J., Beaudoin III, G.M.J.,
Reichardt, L.F., Williams, S.E. (2019) Telophase correction refines division orientation in
stratified epithelia. Elife 8 e49249. doi: 10.7554/eLife.49249.
KJL designed, performed, and analyzed all experiments and resultant data with significant intellectual
input from KMB, CPD, and SEW. DCS and AJB provided extensive support in sample preparation and processing. GMJ and LFR created and provided an essential mouse strain. Permission to include the
article in its entirety in a PhD dissertation was retained from eLife sciences, as explained at:
https://reviewer.elifesciences.org/author-guide/journal-policies
Chapter 4 represents unpublished work I have led with the support of several talented
undergraduate students including Danielle C. Spitzer, Abby J. Bergman, and Jessica J. Wu, investigating
the role of the nectin-afadin complex in formation of the secondary or hard palate. This project is the
result of astute observations by the Williams lab’s resident oral biologist, Dr. Kevin Byrd, who happened
to notice that Afdn knockdown mutants displayed with cleft palate. I was equally fortunate to receive an
NIH F31 predoctoral fellowship from the National Institute of Dental and Craniofacial Research (NIDCR;
DE026956) to pursue this project. A first-author manuscript derived from this work is currently under peer-review at Development (submitted February 10, 2020):
Lough, K.J., Spitzer, D.C., Bergman, A.J., Wu, J.J., Byrd, K.M., Williams, S.E. (2020)
Disruption of the nectin-afadin complex recapitulates features of the human cleft lip/palate
syndrome CLPED1. Development. Under Revision.
KJL designed, performed, and analyzed all experiments and resultant data with significant
intellectual input from KMB and SEW. DCS, AJB, and JJW provided extensive support in sample preparation, as well as significant edits and intellectual input during manuscript preparation.
ix
TABLE OF CONTENTS
LIST OF FIGURES ...... xv
LIST OF ABBREVIATIONS AND SYMBOLS ...... xvii
Terminology ...... xvii
Protein/Gene abbreviations ...... xviii
Protein domains/epitopes ...... xix
Symbols ...... xix
CHAPTER 1 – INTRODUCTION. CELL-CELL ADHESION AND AFADIN INFORM EPITHELIAL CELL IDENTITY AND MORPHOGENESIS ...... 1
1.1 Identification and biochemical properties of afadin and its orthologs ...... 1
1.2 Afadin is part of the adherens junction, a canonical cell-cell adhesion complex ...... 3
1.2.1 The afadin-nectin complex in cell-cell adhesion ...... 5
1.3 Asymmetric cell division and cell fate specification ...... 7
1.3.1 Asymmetric cell division in the Drosophila neuroblast ...... 7
1.3.2 Coupling of division orientation and cell fate determination in the mammalian epidermis ...... 10
1.3.3 Biochemical architecture of the spindle orientation complex ...... 13
1.3.4 Cell-cell adhesion and cell mechanics inform oriented cell division...... 14
1.4 Role of afadin in tissue morphogenesis and disease ...... 21
1.4.1 Roles of canoe in Drosophila morphogenesis ...... 22
1.4.2 Roles of afadin and nectins in mammalian development and disease ...... 23
1.5 Figures ...... 26
x CHAPTER 2 – INTRODUCTION. CLOSING THE GAP: MOUSE MODELS TO STUDY CELL-CELL ADHESION IN MAMMALIAN SECONDARY PALATOGENESIS ...... 28
2.1 Introduction to secondary palatogenesis ...... 28
2.2 Genes expressed in palatal epithelium underlie CL/P disorders ...... 29
2.3 Cell-cell adhesion molecules in palatogenesis ...... 30
2.3.1 Nectins and afadin ...... 30
2.3.2 Cadherins and catenins ...... 32
2.3.3 Other cell adhesion molecules ...... 33
2.3.4 Connecting the dots between transcription factors and cell adhesion ...... 34
2.4 Methods to investigate the genetics of CL/P ...... 36
2.4.1 Ex vivo palate cultures ...... 36
2.4.2 Animal models to investigate epithelial cell-cell adhesion in palate closure ...... 36
2.4.3 Other approaches to study epithelial contributions to secondary palate closure ...... 37
2.5 Conclusions ...... 39
2.6 Figures ...... 40
CHAPTER 3 – RESULTS. TELOPHASE CORRECTION REFINES DIVISION ORIENTATION IN STRATIFIED EPITHELIA ...... 45
3.1 Introduction ...... 45
3.2 Results ...... 47
3.2.1 Randomized division orientation persists into anaphase ...... 47
3.2.2 Oblique anaphase divisions reorient during telophase ...... 48
3.2.3 LGN mediates perpendicular telophase correction ...... 50
3.2.4 Directionality of telophase correction is correlated with basement membrane contact ...... 51
xi 3.2.5 The actin-binding protein, vinculin, regulates α-E-catenin conformation...... 52
3.2.6 Afadin is required for normal AJ morphology and is a novel regulator of α-E-catenin conformation...... 54
3.2.7 Ctnna1 , Vcl and Afdn knockdown leads to randomized division orientation ...... 55
3.2.8 Tension-sensitive components of the AJ are essential for telophase correction...... 56
3.2.9 Telophase correction occurs independently of canonical polarity and spindle-orienting cues...... 57
3.2.10 Telophase correction and early mitotic spindle orientation function as parallel pathways ...... 60
3.2.11 Telophase correction also occurs during early stratification ...... 60
3.2.12 Telophase correction impacts cell fate decisions ...... 61
3.4 Discussion ...... 63
3.4.1 A two-step mechanism for division axis determination ...... 63
3.4.2 Corrective mechanisms in oriented cell divisions ...... 64
3.4.3 Insights into epidermal cell fate specification...... 65
3.5 Acknowledgements ...... 66
3.6 Materials and Methods ...... 67
3.7 Figures ...... 76
3.8 Videos ...... 106
CHAPTER 4 – RESULTS. DISRUPTION OF THE NECTIN-AFADIN COMPLEX RECAPITULATES FEATURES OF THE HUMAN CLEFT LIP/PALATE SYNDROME CLPED1 ...... 113
4.1 Introduction ...... 113
4.2 Results and Discussion ...... 115
4.2.1 The obligate nectin binding partner, afadin, is required for secondary palatogenesis ...... 115
xii 4.2.2 LUGGIGE presents advantages over epithelial-specific Cre- recombinase approaches ...... 117
4.2.3 Acute loss of Nectin1 or Nectin4 results in mild cleft palate with low penetrance ...... 117
4.2.4 Dual loss of Nectin1 and Nectin4 causes highly penetrant cleft palate ...... 118
4.2.5 Causal CLPED1 mutations drive CP via dominant negative and/or neomorphic activity ...... 119
4.3 Acknowledgements ...... 121
4.4 Materials and Methods ...... 121
4.5 Figures ...... 126
CHAPTER 5 – DISCUSSION ...... 137
5.1 Updated model of OCD of epidermal progenitors ...... 138
5.1.1 Roles of the Par/aPKC/Par6 apical polarity complex ...... 139
5.1.2 Roles of the Crumbs apical polarity complex ...... 139
5.1.3 Roles of the Scribble basolateral polarity complex ...... 141
5.1.4 Roles for basal cell-matrix adhesions ...... 142
5.2 Corrective mechanisms to ensure orientation of cell division ...... 143
5.3 Speculative mechanisms promoting planar OCD in the epidermis ...... 145
5.4 Insights into epidermal cell fate specification ...... 146
5.4.1 Evidence supporting intrinsic fate determination ...... 147
5.4.2 Evidence supporting extrinsic fate determination ...... 148
5.5 Cell and Molecular mechanisms of CLPED1 ...... 149
5.5 Exploring mutations in other cell-cell adhesion genes and their association with CL/P ...... 151
5.6 Figures ...... 154
APPENDIX 1: CELL-CELL ADHESION PROTEINS PRESENT IN THE MEE ...... 155
xiii APPENDIX 2: GENETIC MOUSE MODELS OF CELL-CELL ADHESION GENES ...... 157
APPENDIX 3: K14-CRE LINES UTILIZED TO GENERATE GENETIC MODELS OF CP ...... 163
REFERENCES ...... 165
xiv LIST OF FIGURES
Figure 1.1 Afadin domain structure and notable binding partners ...... 26
Figure 1.2 Involvement of afadin in the adherens junction ...... 27
Figure 2.1 Secondary palatogenesis ...... 40
Figure 2.2 Palatal gene expression and human orofacial clefting syndromes ...... 42
Figure 2.3 Mutations in NECTIN1 and CDH1 associated with CL/P ...... 43
Figure 2.4 LUGGIGE in oral epithelia ...... 44
Figure 3.1 Telophase reorientation corrects oblique anaphase orientations ...... 76
Figure 3.2 Telophase reorientation corrects oblique anaphase orientations ...... 78
Figure 3.3 LGN mediates perpendicular but not planar telophase correction ...... 80
Figure 3.4 Maintenance of basal contact correlates with planar-directed telophase correction ...... 82
Figure 3.5 A basal endfoot mediates planar telophase correction ...... 84
Figure 3.6 Vinculin and afadin regulate α-E-catenin conformation and AJ linkage to the actin cytoskeleton...... 86
Figure 3.7 The α-E-catenin/vinculin/afadin complex demonstrates reciprocal regulation to form mature adherens junctions in vitro ...... 88
Figure 3.8 The α-E-catenin/vinculin/afadin pathway is required for normal division orientation ...... 90
Figure 3.9 AJ loss-of-function mutants display errors in division orientation ...... 92
Figure 3.10 AJ mutants fail at both planar and perpendicular telophase correction...... 93
Figure 3.11 AJ loss-of-function mutants display errors in division orientation ...... 95
Figure 3.12 AJ mutants alter division orientation via LGN-independent mechanisms ...... 96
Figure 3.13 Afdn loss-of-function does not affect functional apicobasal polarity or downstream components of spindle orientation ...... 98
Figure 3.14 AJ components alter division orientation in an LGN-independent manner...... 99
xv Figure 3.15 Planar telophase correction limits precocious and sustained differentiation and biases clones towards symmetric cell divisions ...... 101
Figure 3.16 Failed telophase correction induces precious, sustained hyperstratification without impacting proliferation or delamination ...... 103
Figure 3.17 Two-step model of division orientation ...... 105
Video 3.1.1 Planar anaphase orientation is fixed ...... 106
Video 3.1.2 Perpendicular anaphase orientation is fixed ...... 107
Video 3.1.3 Oblique anaphase orientations undergo planar telophase reorientation ...... 108
Video 3.1.4 Oblique anaphase divisions display perpendicular correction ...... 109
Video 3.10.1 Persistent oblique division in Ctnna1 912 knockdown mitotic basal cell ...... 110
Video 3.10.2 Persistent oblique division in Vcl 3466 knockdown mitotic basal cell ...... 111
Video 3.10.3 Persistent oblique division in Afdn 2711 knockdown mitotic basal cell ...... 112
Figure 4.1 Afadin is essential for secondary palatogenesis ...... 126
Figure 4.2 Validation of transgenic models highlights improved efficacy of LUGGIGE ...... 128
Figure 4.3 Loss of Nectin1 or Nectin4 does not cause highly penetrant CP ...... 130
Figure 4.4 In vitro validation of Nectin1/4 shRNA efficacy using calcium-shift assays ...... 131
Figure 4.5 Nectin1 and Nectin4 cooperatively prevent highly penetrant CP ...... 132
Figure 4.6 Dual loss of Nectin1 and Nectin4 in a novel, double shRNA construct delays PS elevation and can result in residual MES ...... 134
Figure 4.7 CLPED1 variant W185X acts in a dominant negative fashion to cause CP ...... 136
Figure 5.1 Determination of division orientation ...... 154
xvi LIST OF ABBREVIATIONS AND SYMBOLS
Terminology
ACD Asymmetric cell division; type of division in which daughter cells adopt distinct fates
AJ Adherens junction; a classic cell-cell adhesion complex composed of cadherins/catenins
CLPED1 Cleft lip/palate ectodermal dysplasia syndrome
CL/P Cleft lip/palate
CP Cleft palate
E Embryonic day; e.g. E14 =14-days into gestation
ED Ectodermal dysplasia
F-actin Filamentous actin
GMC Ganglion mother cell
LUGGIGE Lentiviral ultrasound-guided gene inactivation and gene expression
MDCK Madin-Darby Canine Kidney; commonly utilized epithelial cell line.
MEE Medial edge epithelia
MES Medial epithelial seam
MOI Multiplicity of infection
MT Microtubule
OCD Oriented cell division
OFC Orofacial clefting
PS Palatal shelf/shelves
RNAi RNA-interference
SB Suprabasal; non-basal cells within the epidermis shRNA Short-hairpin RNA
TJ Tight junction; classic, impermeable cell-cell adhesion.
WT Wild-type
xvii Protein/Gene abbreviations
α-cat α-catenin/Ctnna1; component of the adherens junction
Afdn Afadin; Mus musculus ortholog of Canoe
aPKC Atypical protein kinase C; component of the apical polarity Par complex
Baz Bazooka; component of the Drosophila apical polarity Par complex
Brat Brain Tumor; fate determinant in Drosophila neuroblast ACD
Cno Canoe; Drosophila protein
Crb Crumbs; Drosophila protein; component of the apical Crumbs polarity complex
Cre Cre-recombinase
Dlg Discs Large; component of basolateral Scribble polarity complex
Insc Inscuteable; component of the Drosophila spindle orientation complex
K5/14 Cytokeratin-5/14; basal cell specific keratins
K10 Cytokeratin-10; suprabasal cell specific keratin
Lgl Lethal Giant Larvae; component of basolateral Scribble polarity complex
LGN Leucine/Glycine/Asparagine repeats; Mus musculus protein and Pins ortholog mInsc Inscuteable; Mus musculus protein and Insc ortholog
Mira Miranda; fate determinant in Drosophila neuroblast ACD
Mud Mushroom Body Defect; component of the Drosophila spindle orientation complex
NuMA Nuclear Mitotic Apparatus; Mus musculus protein and Mud ortholog
Par3 Partitioning defective-3; ortholog of Baz /component of the apical polarity Par complex
Par6 Partitioning defective-6; component of the apical polarity Par complex pHH3 phospho-histone H3; a mitotic biomarker
Pins Partner of Inscuteable; component of the Drosophila spindle orientation complex
Pon Partner of Numb; fate determinant in Drosophila neuroblast ACD
Pros Prospero; fate determinant in Drosophila neuroblast ACD
Scrib Scribble; component of basolateral Scribble polarity complex
xviii Stau Staufen; fate determinant in Drosophila neuroblast ACD
Std Stardust; Drosophila protein; component of the apical Crumbs polarity complex
Vcl Vinculin; binding partner of α-catenin
Protein domains/epitopes
a18 a18 epitope of a-catenin; cryptic epitope exposed by “active” conformation of a-catenin
EC Extracellular cadherin domain; protein interaction domain in cadherins
CBD Catenin-binding domain; protein interaction domain in cadherins
GFP Green fluorescent protein
JMD Juxtamembrane domain; protein interaction domain in cadherins
NICD Notch Intracellular Domain
PDZ PSD-95/Dlg/ZO-1 binding domain; a common protein-protein interaction domain
RA Ras associated; afadin protein binding domain
RFP Red fluorescent protein
TPR Tetratricopeptide repeat; protein structural motif present on the N-terminus of LGN/Pins
YFP Yellow fluorescent protein
Symbols
φ Orientation of cell division at anaphase onset (t=0 min)
θ Orientation of cell division in telophase (t=+60 min)
t Time
xix
CHAPTER 1 – INTRODUCTION. CELL-CELL ADHESION AND AFADIN INFORM EPITHELIAL CELL IDENTITY AND MORPHOGENESIS
1.1 Identification and biochemical properties of afadin and its orthologs
Mammalian afadin (gene name AFDN; also known as MLLT4 or AF6 ) was independently
discovered by two separate lines of investigation, each bestowing it with separate gene names. It was first
identified from patient samples with acute mixed-lineage leukemia, who present with a series of
chromosomal translocations 1, one of which resulted in a fusion protein joining both the AFDN and ALL-1 genes (the name AF-6 is derived from ALL-1 fusion partner located on chromosome 6) 2. Several years later, while searching for actin binding proteins, a separate group isolated afadin via actin co- sedimentation assays from rat brain samples 3. The same study localized the afadin protein at sites of cell- cell contact, where it colocalized with classic adherens junction markers such as E-cadherin, suggesting a role in cell-cell adhesion. Numerous studies since have demonstrated that afadin primarily functions as a scaffold, binding numerous protein partners with pleiotropic functions in cell-cell adhesion and cell signaling.
Afadin is a multidomain protein, with two N-terminal Ras-associated (RA) domains, a forkhead- associated (FHA) domain, a DIL domain, a PDZ domain, three proline-rich (PR) domains, and a C- terminal F-actin binding domain (Fig. 1.1). Myosin-competition experiments suggest afadin binds along the sides of actin filaments 3. Afadin also scaffolds with an α-actinin binding protein, ADIP, through its
DIL domain 4, and to the actin binding protein profilin-15. Afadin’s RA domains primarily bind to the small GTPase Rap1, but can also bind other Ras family members 6, and also mediate homodimerization 7.
Through its PDZ domain, afadin primarily interacts with the four nectin proteins 8, 9 , transmembrane
receptors involved in calcium-independent to cell-cell adhesion and cell sorting. However, afadin’s PDZ
1 domain also contributes to interactions involved in neuronal synapsing, binding to members of the
neurexin 10 and ephrin family 11 . Furthermore, afadin harbors two bindings sites—one including the PDZ
domain and another including the RA domains—for PLEKHA7, a p120-catenin binding protein 12, 13 .
Interestingly, PLEKHA7 and afadin play a significant role in clustering ADAM10 and its trafficking partner TspanC8s to cell-cell junctions, which is required for Staphylococcus aureus -mediated cell death 14 . Afadin also interacts the tight junction proteins JAM-A15 and the scaffold ZO-116 through its PDZ and PR1/2 domains, respectively. The third PR domain binds to the vinculin-binding protein ponsin, which afadin recruits to site of cell-cell adhesion17 . Afadin can also bind to the Notch ligand Jagged 118 , which has tissue specific functions in cellular differentiation. Importantly, afadin also interacts with the
actin binding protein α -catenin 19 , though the interaction has not been mapped to a specific region of
afadin. More recently, studies have characterized an interaction between afadin and the spindle
orientation protein LGN, which binds to a region of afadin proximal to the F-actin binding domain 20, 21 .
In 1984, the famous Drosophila melanogaster forward genetic screen by Jurgens, Wieschaus,
Nusslein, Volhard and Kluding 22-24 characterized more than one-hundred novel mutants, including one
aptly named canoe (cno ). cno mutants present with large gaps in the dorsal cuticle, granting the embryos
a unique ‘canoe-like’ appearance 22 . Cno was later identified as an afadin ortholog, sharing significant sequence homology and domain structure 6. As with afadin, Cno has a pair of N-terminal RA domains which can interact with both Ras 6, 25 , Ran 26 and Rap1 27 . The internal PDZ domain of Cno binds to the nectin ortholog, echinoid 28 , but also binds to DE-cadherin 29 , a classic transmembrane cell-cell adhesion protein, and to the ZO-1 ortholog, polychaetoid 30 . Cno also binds directly to F-actin 29 and the LGN
ortholog Pins 26 via distal C-terminal domains. The scaffolding activity of Cno and afadin—binding numerous proteins involved in adhesion and cell signaling—grants the molecules varied function in cell- cell adhesion (1.2 ), cell fate determination (1.3 ), and tissue morphogenesis (1.4 ).
2 1.2 Afadin is part of the adherens junction, a canonical cell-cell adhesion complex
The adherens junction (AJ) is a cell-cell adhesion complex, classically composed of both
cadherins and catenins (Fig. 1.2). Transmembrane cadherins form calcium-dependent homodimers in
trans via the distalmost five extracellular cadherin (EC) domains 31 . There are four classical type I
cadherins, specified by the cells or tissues that express them (e.g. E-cadherin is the primary cadherin
expressed by epithelia) 32-37 . In the cytoplasm, cadherins interact with α -, β-, and p120-catenin 38-40 . p120-catenin stabilizes cadherins at the plasma membrane 41, 42 while β-catenin—in addition to its
extensively studied role in Wnt signaling 43-45 —enables recruitment of α -catenin into the AJ 46 . There are
three α -catenin homologs; α-N-catenin, α-T-catenin and α-E-catenin, the latter of which is the primary
a-catenin expressed in most epithelia and will be simply referred to as α-catenin for the remainder of this
dissertation. α-catenin links the actin cytoskeleton to the plasma membrane via a C-terminal actin binding
domain. However, scaffolding between AJs and the actin cytoskeleton has proven to be a biomechanically
complicated process. While α -catenin alone can bind F-actin in solution, the α -catenin/β-catenin/E-
cadherin ternary complex has only weak interactions with actin in solution 47 , suggesting that proper
AJ/actin scaffolding is allosterically regulated.
Ultimately, it was discovered that the minimal cadherin/catenin complex binds actin in a tension
dependent manner 48, 49 . In the presence of non-tensile F-actin, α-catenin’s internal M-domain exists in an autoinhibited closed conformation 50, 51 . This behavior is unsurprising given that α -catenin is a homolog of vinculin, another autoinhibited actin scaffold 52-56 . When α -catenin’s actin binding domain engages with tensile actin, the M domain opens, exposing cryptic binding sites for two additional actin binding
proteins: the aforementioned vinculin, and afadin 19, 51, 55, 57 . α-catenin’s M domain is split into three distinct subdomains (M1, M2, M3), with the vinculin binding domain embedded within M1. In coimmunoprecipitation experiments, significantly more afadin bound to a truncated fragment of α-catenin compromising M2 and M3 (residues 385-651) than to full-length α-catenin 19 . Similarly, an N-cadherin/ α-
catenin fusion protein requires both the actin binding domain and M3 to promote afadin recruitment into
3 cardiomyocyte junctions 58 . These studies conclude that both afadin and vinculin require F-actin mediated tension to bind the open conformation of α -catenin, where they occupy exclusive regions within the
tension-sensitive M-domain.
These findings suggest that afadin’s primary role in AJs may be to increase the actin scaffolding potential of the cadherin-catenin complex, thereby allowing it to bear higher tensile forces. Such a role
has been already described for vinculin, which is recruited to AJs in a tension-dependent manner and is
capable of stabilizing the open conformation of α -catenin 49, 59 . Similarly, using a ZO-1/2 double knockdown model 60 in Madin-Darby Canine Kidney (MDCK) epithelial cells, Choi et al. demonstrated that afadin accumulates at hypercontractile adhesions, particularly tricellular junctions where numerous
actin bundles are anchored end-on 61 . In this context, afadin was required to maintain normal cell shape and epithelial barrier function. In other studies, mosaic knockdown of afadin was sufficient to reduce E- cadherin (E-cad) junctional accumulation in MDCK cells, without affecting nectin-1 or α -, β-, and p120- catenin 62, 63 . Strangely, despite these changes in E-cad junctional accumulation, afadin knockdown didn’t reduce E-cad cell surface accumulation, nor its association with the catenins 63 . Using a different cell line
(EpH4 murine mammary epithelial cells), similar experiments demonstrated that the interaction of afadin with PLEKHA7 promotes the junctional accumulation of p120-catenin and E-cadherin 13 . However, these
findings are complicated by results from Choi et al. , where afadin knockdown had no effect on E-cad
localization or accumulation 61 . One key difference between these studies lies in the fact that those
observing reduced E-cad junctional accumulation used mosaic cultures, while Choi et al. used monocultures, suggesting that non-cell autonomous effects such as anisotropic adhesion/mechanical tension may contextualize afadin’s role. For example, afadin may be specifically essential for balancing
anisotropic cortical tension to maintain AJ molecular structure and epithelial integrity under tensile stress.
Regardless, these findings suggest that cooperation between numerous actin-binding scaffolds is required to maintain normal cell-cell adhesion and epithelial integrity. However, whether afadin regulates α -
4 catenin function or conformation—or recruitment of vinculin into the AJ—remains unknown. This
knowledge gap is addressed in Chapter 3 .
1.2.1 The afadin-nectin complex in cell-cell adhesion
Afadin also interacts with the nectins, a separate family of transmembrane cell-cell adhesion molecules 8. In contrast to cadherins, nectins interact in a calcium-independent manner, and are capable of forming both homodimers in cis and heterotetramers in trans 8, 64 . Nectins, of which there are four distinct
family members in mammals (nectin-1, -2, -3, and -4) are part of the immunoglobulin-like superfamily,
each having three extracellular Ig-like loops 9, 65 . The first Ig-like loop is essential for trans interactions,
while the second Ig-like loop is required to form cis homodimers 66, 67 . Evidence suggests the 1 st Ig-like
loop of each nectin is capable of interacting with all four family members, albeit with variable affinity.
For example, nectin-1 can interact in trans with either nectin-2 or nectin-1, but preferentially binds
nectin-3 or nectin-49. The cytoplasmic tail of each nectin forms an obligate interaction with afadin’s PDZ
domain using an EAXYV motif. While nectin-4 lacks this specific motif, it nonetheless binds afadin with
comparable affinity 9. Subsequently, afadin is responsible for recruiting nectins to cadherin-based AJs via
its interaction with α -catenin 8, 65, 68 . However, this interaction is not essential for nectin cis dimerization
or trans interactions, and nectins can still be observed at the cell membrane, albeit with diminished
accumulation, when they lack the afadin-binding motif 8, 65 . While nectins frequently colocalize with AJs,
as observed by both fluorescent and electron microscopy, their overlap is not universal, complicating their
inclusion as canonical AJ molecules 8.
While the role of nectins in cell-cell adhesion is still being uncovered, some studies suggest they may serve as pioneer adhesion factors, preceding cadherins at sites of nascent adhesion assembly 69 . While the requirement of endogenous nectin for cadherin-based AJ assembly has not been shown, overexpression of nectin-1 in cultured cells accelerates assembly of E-cad based AJs 70 . Similar
observations have been made for nectin-2 and nectin-3, which can promote cell-cell adhesion in a
nonadherent cell line expressing low levels of E-cad 71 . Interestingly, overexpression of nectin-3 can
5 override the dominant-negative function of a truncated N-cadherin lacking the EC domains to induce
adhesion formation 72 . Nectins also bind to apical polarity proteins, including the canonical polarity pioneer factor Par3 73 , as well as Mupp1 (Mpdz) and PATJ 74 , two PDZ-scaffolds of the Crumbs complex
(discussed in Chapter 5 ). Similarly, junctional recruitment of zyxin, an actin regulator and α-actinin binding partner, can be modulated through an interaction with nectin-2. Taken together, these findings
suggest that while the nectin-afadin complex may not be required for nascent AJ assembly, it has the potential to augment AJ dynamics and recruit additional polarity and cytoskeletal modulators.
The role of nectins as modulators of cell-cell adhesion is reinforced by their mutant phenotypes in
mice. Germline knockouts of Nectin1 75, 76 , Nectin2 77 , and Nectin3 75 are all viable, though dual loss of both
Nectin1/Nectin3 results in early embryonic lethality 78 . Both Nectin2 and Nectin3 knockouts display
diminished male fertility, which has been attributed to defects in cell-cell adhesion between Sertoli cells
and haploid spermatids during spermatogenesis 77, 79, 80 . Loss of nectin-1 or nectin-3 similarly causes
separation between the pigmented and non-pigmented epithelial layers in the ocular ciliary body, resulting
in microphthalmia 75 . Additionally, the fact that nectins display greater affinity for heterotypic trans -
interactions affords them unique functionality in cell sorting. The inner-ear cochlear epithelium is
composed of hair cells and supporting cells, which form a checkerboard pattern where no two hair cells
share a cell boundary. This pattern is maintained by the trans-interactions of nectin-1 and nectin-3, which
are specifically expressed by hair cells and supporting cells, respectively 81, 82 . Similarly, in the olfactory epithelium, nectin-2 is expressed by olfactory cells (OC) while nectin-3 is expressed in support cells (SC).
Nectin-2/3 trans -interactions cooperate with cadherins to increase the adhesive strength of the OC-SC cell contact at the expense of OC-OC contacts, ensuring normal isolation of OCs 83 . Nectin heterotypic trans -
interactions also play a significant role in the deposition of dental enamel of the murine incisors. While
nectin-1 is expressed by enamel-secreting ameleoblasts, nectin-3 is expressed by juxtaposed stratum
intermedium and their trans -interaction is required to prevent separation of these two layers 76, 78 . The role of nectins in the oral cavity is particularly interesting, as mutations in the human NECTIN1 gene cause cleft lip/palate ectodermal dysplasia syndrome (CLPED1). However, homozygous null nectin-1 mice do
6 not present with cleft palate, nor do combination Nectin1/Nectin3 mutants with loss of three alleles 78 . This
discrepancy is the subject of my work in Chapter 4 , which is preceded by an introduction to palatogenesis and the role of cell-cell adhesion proteins in affecting this developmental program
(Chapter 2 ).
Interestingly, germline Nectin1 knockouts display nonlethal neonatal defects in epidermal
development. Loss of nectin-1 causes reduced expression of loricrin, a marker of suprabasal
differentiation 84 . Differentiation and stratification of the embryonic epidermis is partially regulated by
asymmetric cell divisions (ACD) of basal epidermal progenitors 85 . Additionally, the epidermis of
newborn Nectin1 null mice is red and shiny, and this phenotype has previously been correlated with perturbation of ACD 86 . Furthermore, loss of the obligate nectin binding partner, afadin, causes ACD
defects in murine cortical progenitors 87 and Drosophila neuroblasts 88 . However, whether afadin plays a
significant role in ACD in murine epidermal progenitors is unknown. This knowledge gap is further
outlined below ( 1.3 ) and experimentally addressed in Chapter 3 .
1.3 Asymmetric cell division and cell fate specification
Classically, mitosis allows for one mother cell to duplicate its genetic code and generate two
identical daughter cells. While a majority of cell divisions are symmetric —producing progeny of identical
size with identical fates—stem and progenitor cells are uniquely capable of undergoing asymmetric cell divisions (ACDs), generating two daughter cells with distinct fates. While these asymmetries may refer to any aspect of cellular identity (size, shape, transcript inheritance, protein inheritance, etc.), for the purposes of this dissertation, I’ll be referring to asymmetry in cellular identity as determined through biomarkers of differentiation.
1.3.1 Asymmetric cell division in the Drosophila neuroblast
One classic model for studying ACDs is the Drosophila neuroblast, an embryonic neuronal precursor. At mitotic onset, neuroblasts invaginate from the neuroepithelial monolayer and then orient
7 their metaphase spindle orthogonal to the plane of the tissue. During metaphase, numerous fate
determinants—including Numb, Prospero (Pros) 89 , Miranda (Mira) 90, 91 , Partner of Numb (Pon)92, 93 and
Brain Tumor (Brat)94, 95 —are polarized towards the basal cell cortex. Numb inhibits Notch signaling 96 ,
which normally promotes proliferation and maintenance of the neuroblast identity 97, 98 . Pros is a
transcription factor which both suppresses transcription of hundreds of neuroblast genes, and enhances
expression of differentiation genes, suggesting that it is capable of acting as both a transcriptional
inhibitor and activator to promote neuronal differentiation 99 . Mira and Pon are adapter proteins which promote the basal polarization of Pros 90, 91 and Numb 92, 93 , respectively. Similarly, Mira encourages the basal segregation of Brat, which acts cooperatively with the transcription factors Pros, Deadpan, and
Zelda to suppress proliferation and promote differentiation 94, 95, 100 . As cytokinesis completes, these proteins are asymmetrically inherited by the basal daughter and together promote differentiation into a
ganglion mother cell (GMC) fate. The absence of these factors in the apical daughter allows it to maintain
its progenitor identity and undergo additional mitoses.
During the identification of these fate determinants, questions arose regarding how their
asymmetric inheritance was established. This led Knoblich, Jan and Jan to speculate that additional positional cues acted to orient the mitotic spindle: “… localization of Numb and Pros is microtubule
independent, but recognizes positional information that is provided for the placement of the centrosome and the mitotic spindle.89 ” This line of investigation led to the discovery of the spindle orientation
effector, Inscuteable (Insc), loss of which altered both the orientation of the mitotic spindle and the
localization of fate determinants 101 . Insc localizes to the apical cell cortex, opposite the fate determinants, and its polarization is dependent on an interaction with the canonical polarity protein Bazooka (Baz, the
Drosophila ortholog of vertebrate Par3) 102 . Searching for additional Insc binding partners, Yu, et al. identified an additional regulators of mitotic spindle orientation, Partner of Inscuteable (Pins) 103 , which
104 was later shown to form a tripartite complex with Insc and the heterotrimeric G-protein G αi/o subunit .
As with insc mutants, pins mutants fail to orient their metaphase spindle along the apico-basal axis and
fail to properly segregate their fate determinants 104 . Despite their clear effects on spindle orientation, the
8 mechanism of action of the Insc/Pins/Gαi complex remained elusive; none of the complex members bind
to microtubules, and thus the complex lacked a spindle effector. One potential downstream component
was identified in HeLa cells as the microtubule binding protein NuMA, which was recruited to the cell
cortex through its interactions with the Pins ortholog, LGN 105, 106 . A fly relative of NuMA, Mushroom
Body Defect (Mud) 107 , binds to both dynactin and Lis1 108 , a regulator of the dynein microtubule motor.
Each of these mutants not only fail to properly align their metaphase spindle, but live imaging of larval
neuroblasts show they are incapable of normal spindle rotation, suggesting the complex functions as not just a spindle anchor, but can also physically rotate the spindle until it aligns with a particular polarity
axis.
While proper coordination of the spindle orientation machinery promotes the asymmetric
segregation of fate determinants, there are also several mechanisms which directly link the spindle
orientation complex to the basal polarization of the fate determinants. Bazooka (Baz) binds to additional polarity proteins including Par6 and aPKC, both of which reinforce apical polarization of Baz and are
required to properly localize the spindle orientation machinery and ensure basal segregation of fate
determinants 109 . aPKC directly phosphorylates Mira within its cortical localization domain, which
displaces it from the apical cell cortex 110 . Lgl, a non-polarized cytoskeletal adapter protein, cooperates
with the cortical proteins Dlg and Scrib to competitively inhibit aPKC activity, restricting aPKC to the
apical cortex to enable basal-specific cortical polarization of Mira 110-114 . Additionally, Insc binds directly to and colocalizes with the RNA-binding protein Staufen (Stau) 115 . During interphase, Stau is apically polarized in an Insc-dependent manner and binds pros mRNA in the 3’ UTR. As the neuroblast enters mitosis, Stau then binds to Mira, allowing pros RNA to be basally segregated, where it promotes the
GMC identity 116-118 . These pathways highlight the interconnectivity of apical polarity complexes, spindle
orientation machinery, and fate determinants themselves.
Together, these series of studies spanning multiple decades culminated in the identification of a
spindle orientation complex which captures astral microtubules emanating from the centrosome in order
to rotate the metaphase spindle through the Dynein motor. The apical polarization of the
9 Baz/Insc/Gαi/Pins complex promotes spindle alignment along the apico-basal axis, which encourages the
asymmetric inheritance of basally-polarized fate determinants. Subsequent studies have relied on this pathway as a blueprint for elucidating mechanisms of fate determination and morphogenesis in numerous
tissue systems. Since their discovery, these proteins have been implicated in division orientation of
mammalian cortical neural progenitors 119 and epithelia of the lung 120 , intestine 121, 122 , mammary gland 123-
125 , and skin 85, 86, 126, 127 , among others. Studies in these vertebrate systems and mammalian cell culture models like MDCK and HeLa cells, as well as invertebrate systems of the C. elegans embryo 128 and D.
melanogaster sensory organ precursors 129 , have furthered our understanding of the machinery required for both oriented and asymmetric cell divisions. However, it is important to retain distinct terminology for
referring to oriented cell divisions (OCD), in which the spindle is positioned in response to polarity cues,
and asymmetric cell divisions (ACD), which result in mitotic progeny with distinct cell fates through
asymmetric inheritance of intrinsic or extrinsic fate determinants.
1.3.2 Coupling of division orientation and cell fate determination in the mammalian epidermis
The mammalian epidermis is a stratified epithelium consisting of numerous cell layers which are both morphologically and functionally distinct. During embryogenesis, the epidermis originates as a
simple, monolayered epithelium which, during the 14th through 17 th day of murine gestation (E14-17),
undergoes rapid stratification and differentiation to produce a fully functional barrier prior to birth. The
mechanisms governing epidermal development have been studied for many decades, but the molecular
underpinnings have been only more recently elucidated. Early insights from culture models suggested
delamination—the separation and upward migration of basal progenitors from the underlying
extracellular matrix—correlated with stratification and cellular differentiation 130, 131 . This suggested a model wherein cycling progenitors, restricted to the basal layer of the epidermis, would divide symmetrically within the plane of the epithelium and stratification would be explicitly driven by delamination 132 . However, this model neglected earlier observations suggesting that basal progenitors
10 displayed divisions with a variety of orientations, including both within the tissue plane (i.e. planar
divisions) or orthogonal to it (i.e. perpendicular divisions) 126 .
More recent studies have revealed that basal progenitors display bipotent OCDs, with planar
divisions promoting progenitor expansion while perpendicular divisions serve as potent drivers of
stratification 85 . The canonical spindle orientation machinery proved essential for this behavior, as the
mammalian orthologs of Pins (LGN/Gpsm2), Insc (mInsc), G αi (G αi3 ), Baz (Par3), Mud (NuMA) and p150 glued (dynactin) are all specifically required for perpendicular divisions 86, 127 . In this model, interphase
apical Par3 and Ga i3 recruit the mitotic-specific mInsc. In turn, the mInsc/Par3 and Gαi3 polarity proteins
cooperatively recruit LGN to the apical cell cortex, which then scaffolds with NuMA and the
dynein/dynactin complex on astral microtubules to align the mitotic spindle along the apico-basal axis.
This orientation drives the apical daughter into the superficial layers of the tissue—promoting
differentiation—while the basal daughter retains contact with the basement membrane and can undergo
additional mitoses 127 .
Importantly, LGN is only recruited to the apical cortex in ~50% of mitoses of (pro)metaphase
cells. In later stages of mitosis (ana/telophase), LGN is present in the majority of perpendicular divisions, but noticeably absent from planar divisions, suggesting the presence/absence of LGN specifically serves as an instructive cue for perpendicular divisions 86 . Fittingly, loss of LGN (Gpsm2 ) or NuMA (Numa1 ) results in nearly all divisions becoming planar/symmetric, rather than randomized as in the neuroblast.
Given the bimodal distribution of division behaviors, it is not surprising that multiple groups have found
evidence suggesting the metaphase spindle rotates before determining a final axis of division. Live
imaging of cultured keratinocytes shows that the metaphase spindle rotates within the epithelial plane prior to cytokinesis (i.e. planar rotation) 133 . Similarly, while division orientation measurements made at
telophase in vivo display the bimodality of perpendicular/planar division angles, measurements made at
metaphase result in a near-random distribution of spindle orientations, suggesting the spindle has not yet
committed to a final division axis 86 . Given that the spindle effector machinery
11 (LGN/NuMA/dynein/dynactin) is assumed to operate on astral microtubules emanating from the
metaphase spindle, division orientation (and thereby cell fate) should become fixed at anaphase onset.
While anaphase division orientation of epidermal progenitors has never been specifically reported, our
findings in Chapter 3 contradict this assumption, demonstrating that anaphase orientation is not
significantly different from metaphase. Through live imaging of embryonic explants, we discover that
epidermal progenitors frequently initiate anaphase at oblique orientations and these divisions undergo
“correction” during telophase to generate the bimodal distribution of divisions associated with progenitor
self-renewal and differentiation. These findings significantly improve our understanding of OCD in
embryonic epidermal progenitors and are further detailed in Chapter 3 and their implications regarding
the current model of OCD discussed in Chapter 5 .
In the Drosophila neuroblast, Numb operates as an intrinsic fate determinant whose asymmetric
inheritance by the GMC daughter suppresses Notch signaling in order to promote GMC differentiation.
While no such fate determinants have been reported in embryonic epidermal ACDs 86 , numerous studies still implicate Notch signaling as a potent regulator of proliferation and cell fate 134, 135 . The core Notch signaling pathway in vertebrates is composed of four transmembrane Notch receptors and a variety of ligands: Delta, Delta-like, Serrate, and Jagged 136 . Following ligand binding in trans , the Notch receptor is cleaved, releasing the Notch intracellular domain (NICD). NICD then enters the nucleus in complex with
RBPJ and the coactivator MAML (of which there are three homologs in vertebrates). This transcriptional complex activates Notch effector genes such as Hes1. Overall, Notch activity appears to be suppressed in basal epidermal progenitors and most active in the suprabasal differentiated progeny, as determined by
fluorescent RBPJ or Hes1 reporters 86, 137, 138 . While the Notch repressor Numb is not asymmetrically segregated during ACD in embryonic epidermal progenitors 86 , it can be asymmetrically segregated in planar divisions in the adult 139 . Interestingly, knockdown of LGN resulted in a cell-autonomous decrease
in Notch-reporter activity in suprabasal cells 86 . Furthermore, stratification defects observed in LGN mutants can be rescued by overexpression of active Notch 86 , suggesting some asymmetry of Notch
regulation is influenced by the orientation of cell division. Alternatively, OCDs in the epidermis may
12 inform cell fate through competition for niche occupancy, as occurs in other systems 121, 140-142 . Early
studies of epidermal stem cells using colony formation assays identified high levels of β1-integrin
expression—which may promote strong basement membrane adhesion—to be strongly correlated with
colony formation, a surrogate for “stemness.” 132, 143 It is thus enticing to speculate that basement membrane contact may be sufficient for—or at the very least contribute to—defining basal progenitor identity.
1.3.3 Biochemical architecture of the spindle orientation complex
The essential scaffold LGN functions as a linchpin within the spindle orientation complex, linking the upstream polarity components Par3/mInsc/G αi3 to the downstream spindle effectors
NuMA/dynactin/dynein. Through its four C-terminal GoLoco motifs, LGN interacts with four copies of
144 the GDP-bound heterotrimeric G αi/o subunit . LGN also interacts with mInsc (mammalian Insc) via its
eight N-terminal TPR repeats, which bind to the Insc N-terminal LGN-binding domain (LBD) and
structural studies indicate that this interaction is highly conserved between fly and mammalian
orthologs 145 . In vitro studies using purified proteins confirm that mInsc is required to
coimmunoprecipitate LGN with Par3, suggesting that mInsc is required for LGN to respond to apical polarity established by the Par3/Par6/aPKC complex. Furthermore, Pins and Insc form a 2:2 symmetric tetramer, dependent on dimerization of both the C-terminal Armadillo repeats of Insc and the complementation between TPR3-4-5 of Pins 125 . Similarly, size-exclusion chromatography of a
reconstituted Pins/Insc/Baz/G αi ternary complex support a 2:2:2:8 stoichiometry, which allows for a
Pins/Insc tetramer existing within the higher order spindle orientation complex 125 .
One complicating factor, however, is that mInsc and NuMA cannot bind LGN simultaneously, and in fact compete for LGN binding sites along the TPR repeats. In addition, the affinity of LGN for Insc is orders of magnitude higher than for NuMA, suggesting that NuMA is incapable of displacing mInsc from the mInsc/LGN complex 146 . If NuMA cannot outcompete mInsc from the complex, how does
13 polarized LGN engage NuMA to capture astral MTs and orient the mitotic spindle? Studies have shown that LGN can adopt an autoinhibited conformation via intramolecular interactions between its GoLoco and TPR repeats 147 . Interestingly, this conformation allows for interactions with Gai, which releases the
LGN autoinhibitory conformation and enables NuMA binding 148 . While early experiments utilizing a small NuMA fragment (residues 1900-1928) suggested a 1:1 binary interaction with the LGN TPR domains, recent evidence using a longer fragment (1821-2001) suggests they form a higher order hetero- hexameric complex with 3:3 stoichiometry 149 . This oligomerization is required for planar division orientation of HeLa cells and normal Caco-2 cell cyst formation, but dispensable for recruitment of the spindle motor, dynein/dynactin. The same study suggests that this oligomer promotes the formation of multimeric protein aggregates, which in turn are required to properly coordinate spindle motor function to align the mitotic spindle 149 . However, these findings do not explain how diverse populations of mInsc/LGN tetramers and NuMA/LGN hexamers may coexist or cooperate to orient the spindle. While it is possible these complexes form from distinct pools of Gai-bound LGN and serve unique functions in the segregation of fate determinants (mInsc/LGN) and spindle orientation (NuMA/LGN), as recently suggested 125 , the fact that mInsc is required for LGN polarization complicates this hypothetical model.
Alternatively, it remains possible that the LGN/mInsc interaction is allosterically regulated or post- translationally modified by an unknown effector which promotes the exchange of TPR-bound mInsc for
NuMA. Characterization of multiple mutants which impair mInsc- or NuMA-LGN interactions and oligomerization in vivo would further our understanding regarding the role each interaction plays in modulating division orientation and symmetry.
1.3.4 Cell-cell adhesion and cell mechanics inform oriented cell division
Since Hertwig’s observations more than 100 years ago that sea urchin oocytes align their mitotic spindle with the interphase long axis 150 , it has been understood that cell shape and mechanics can provide instructive cues for division orientation. For example, as tissues develop, the epithelia lining them must respond to growth-induced stretch by orienting division to align with these tissue-scale forces and
14 maintain a contiguous barrier. This phenomenon has been observed in cultured keratinocytes, where
uniaxial stretch results in a bias in spindle orientation alignment with the stretched axis 151 . The mechanisms that allow cells to sense and adapt to these external forces varies but several key cellular factors have been described which translate mechanical forces into cell polarity and orientated cell division: acto-myosin contractility 152 (i) , cell-matrix adhesion 153 (ii) , and cell-cell adhesion 154 (iii) .
Additionally, as cells enter and progress through mitosis, they undergo a series of drastic shape changes, which depend on proper coordination of the underlying cytoskeleton and remodeling of their cell-cell and
cell-matrix adhesions. More recently, it has become clear that these structural components of the cell
machinery are also essential for coordinating mitotic spindle positioning with intrinsic polarity cues.
Taken together, there is an undeniable body of evidence suggesting that the acto-myosin cytoskeleton, in
cooperation with cell-matrix and cell-cell adhesions, is an essential component of OCD.
i) Actomyosin contractility in OCD. Numerous studies have demonstrated that the orientation
of cell division requires an intact actin cytoskeleton, most frequently using actin depolymerization agents
to perturb OCD 89, 101, 142, 155 . Early experiments in D. melanogaster neuroblasts confirmed that localization of the apical polarity complex, including the spindle effector Insc, was compromised by actin depolymerization by cytochalasin D treatment 101 . More recently, actomyosin contractility during cell
rounding and mitotic progression was shown to play a significant role in regulating the size asymmetry
generating during neuroblast ACD. In Drosophila neuroblasts, during anaphase onset, myosin flows from
the apical cortex towards a basal-biased lateral domain to position the cleavage furrow 156 . This flow of contractile components induces internal anisotropic hydrostatic pressure which encourages swelling of the apical domain, supporting the resultant size asymmetry between the apical neuroblast and basal GMC daughters 156, 157 . The basal bias of myosin is dependent on the intrinsic spindle polarity protein Pins, loss
of which reduces size asymmetry 158 .
Actomyosin contractility can also function as a force generator to position the mitotic spindle in scenarios where the Pins/LGN spindle orientation complex is not required. For example, in the two-cell
C. elegans embryo, while the P 1 cell requires LGN for spindle positioning, the neighboring AB cell does
15 not 159 . Instead, physical contact is sufficient to dictate the orientation of AB cell division orthogonal to the
site of contact, and coordinated cortical myosin flows are required for normal positioning of the spindle
and cleavage furrow 160 . Similarly, during D. melanogaster segmentation, cells along the parasegment boundary break Hertwig’s rule and instead consistently orient their division orthogonally to this boundary in a Pins- and Mud-independent manner 161 . Each boundary is demarcated by a contiguous actomyosin
cable running orthogonal to the ventral midline. Reduced contractility achieved by either myosin
inhibition or laser ablation of the cable causes boundary-adjacent cells to fail to orient their division
orthogonally, suggesting that actomyosin contractility is both essential and sufficient to dictate the
orientation of cell division. These studies highlight the adaptability of actomyosin tension, which can
serve as either a spindle positioning force or a sufficient polarity cue to dictate OCD.
In contrast, the mammalian embryonic epidermis more closely mirrors early studies from
neuroblasts. Actin depolymerization via latrunculin A treatment diminishes apicobasal polarity, causing
errors in apical LGN recruitment and division orientation 155 . Similarly, epidermal loss of the transcription
factor Srf—a key regulator of many cytoskeletal and contractility genes—causes errors in mitotic cell
rounding and oriented cell division, which have been attributed to defects in myosin accumulation at
mitotic onset 155 . Epidermal knockout of the Arp2/3 actin branching complex causes defects in differentiation of the suprabasal layers, possibly through hyperactivation of the YAP/TAZ growth pathway; though no effect on OCD was reported 162 . More recently, epidermal loss of the actin bundling protein T-plastin resulted in defects in basement membrane deposition and cell polarity, with related alterations to OCD of basal progenitors 163 . Taken together, these studies highlight that the actomyosin
contractile cytoskeleton is an essential component of OCD and ACD in a variety of tissue systems, either
in cooperation with, or independent of, the canonical spindle orientation machinery.
ii) Cell-matrix adhesion in OCD. Fifteen years ago, Thery, et al. performed exciting
experiments using micropatterned fibronectin substrates to demonstrate that HeLa cells orient their
division in response to the shape and force applied by their cell-matrix adhesions 164 . This behavior was attributed to retraction fibers, which served as a memory of interphase cell shape during mitotic
16 rounding 165, 166 . The spindle was oriented via cooperation with NuMA and subcortical “actin clouds” that
align with retraction fibers and orient the spindle in a myosin-10 dependent manner 167 . However, the
relevance of this mechanism to an in vivo , multicellular context remained untested.
Early experiments in the D. melanogaster follicular epithelium demonstrated that perturbation of
cell-matrix adhesions alters OCD, without impairing apicobasal polarity 168 . Additional experiments in other models continued to demonstrate that cell-matrix adhesions may be essential for OCD in a variety of contexts. Loss of β1-integrin—a key component in cell-matrix hemidesmosomal adhesions—in the murine mammary epithelium results in abnormal out-of-plane divisions with consequences for mammary ductal morphogenesis 169 . Integrin-linked kinase (ILK)—a β1-integrin binding partner—can form a direct
interaction with dynactin and regulates its cortical recruitment to coordinate division orientation in HeLa
cells 122 . Additionally, loss of ILK in the murine intestine increases the rate of inappropriate divisions oriented towards the luminal surface 122 . Cell-matrix adhesions operate upstream of apicobasal polarity in
the Drosophila intestine and are required for normal OCD of intestinal stem cells 170 . Similar observations
have been made in the embryonic epidermis, where loss of β1-integrin impairs apicobasal polarity, LGN
cortical localization and division orientation 85 . However, due to the fact that perturbation of the ECM or
cell-matrix adhesion complexes consistently alters apicobasal polarity in the epidermis, it is hard to
determine whether cell-matrix adhesions regulate epidermal OCD in a direct or indirect manner.
Moreover, although loss of β1-integrin—a component of both basal-localized focal adhesions and
desmosomal junctions at lateral cell-cell junctions—impacts division orientation, loss of β4-integrin—a
component of hemidesmosomes at cell-matrix adhesions—does not 85 . Nonetheless, given the
aforementioned association between β1-integrin expression levels and epidermal progenitor capacity 132,
143 , it is intriguing to speculate that these adhesions may play important roles in regulating cell fate
through OCD. Fittingly, our experiments in Chapter 3 suggest that the maintenance or loss of basement
membrane contact directs obliquely oriented epidermal progenitors towards a basal or suprabasal fate,
respectively. How integrin based basal adhesions may impact this process is discussed in Chapter 5 .
17 iii) Cell-cell adhesion in OCD. Cells within an epithelium must remain adherent to one another
throughout morphogenesis to maintain an impermeable barrier. As cells within the epithelial layer divide,
they must rearrange their adhesions with neighboring cells in a manner that both allows for cell rounding, chromosome segregation, and cytokinesis without compromising this barrier. This concept is beautifully
highlighted in the Xenopus laevis embryonic epithelium, where the AJs on the contractile ring are reinforced by the actin-scaffold vinculin and the barrier is maintained by the rapid formation of water impermeable tight junctions at the nascent tricellular junctions formed during cytokinesis 171 . Tissue scale
forces can also be physically sensed by cells through the distribution of junctional tension, which itself
can serve as a spindle positioning cue. For example, in the Drosophila pupal notum epithelium, tissue tension positions the tricelullular junctions during interphase, which in turn serve as positional cues for the spindle effector Mud (NuMA) during mitosis to align division orientation with the direction of tissue
tension 172 .
Additionally, the actin cytoskeleton scaffolds with cell-cell adhesions, which enables cells to
translate contractile and protrusive behaviors from the cytoskeleton to the cell membrane. Similarly,
signals from the cell membrane, such as compression or tension, can be also transduced to the
cytoskeleton via the same intercellular adhesive complexes. Therefore, it should come as no surprise that
the molecular machinery of cell-cell adhesion, particularly the canonical adherens junction, has been
shown to impact OCD in a variety of contexts. E-cad and its D. melanogaster ortholog DE-cadherin (DE-
cad, or shotgun ), were initially implicated as essential factors in OCD in Drosophila sensory organ precursors, where expression of a dominant negative DE-cad caused errors in polarity positioning and
Pins cortical recruitment, resulting in failure to achieve normal division asymmetry 173 . Similar observations were made in the Drosophila testis, where germline stem cells reside in direct contact with
the niche-defining hub cell 174 . In MDCK cultures, cells divide within the plane of the epithelium and
regulate this division orientation in a density dependent manner—but require cadherin-mediated adhesion
to do so 175 . More recent studies in MDCK cells suggest that E-cad binds directly to LGN, via an interaction between LGN’s TPR repeats and the cytosolic juxtamembrane domain (JMD) of E-cad 176 .
18 Through this interaction, E-cad is necessary and sufficient to recruit LGN to the cell cortex, and E-
cad/LGN binding is required to direct divisions to orient within the epithelial plane. This spindle
orientation pathway similarly requires NuMA and Gαi and is negatively regulated by Ric8, a guanine
177 nucleotide exchange factor that promotes the GTP-bound state of Gαi, which precludes LGN binding .
Importantly, this mechanism is also required to align planar division orientation with tissue tension—
uniaxial stretching of epithelial monolayers increased cortical LGN recruitment and improved the
restriction of spindle orientation within the culture plane 178 . Interestingly, in endothelial cells, LGN binding to the E-cad JMD is mutually exclusive with p120-catenin 176 , which has been shown to play a significant role in cadherin stabilization at the cell membrane 41, 179 . In endothelial cells, LGN can regulate the stability of VE-cad AJs and promote branching morphogenesis 180 . Whether cadherins and LGN
interact in other contexts to regulate OCDs, and whether cadherins serve to position LGN or vice versa,
remains to be tested.
Cell-cell adhesion is also likely to be required for OCD In the embryonic epidermis, as loss of the
AJ/actin scaffold α-E-catenin (Ctnna1 ) increases the prevalence of oblique divisions and has been
reported to alter LGN localization 85 . α-catenin has also been shown to play a significant role in regulating the YAP/TAZ growth control system, suggesting it may be responsible for coordinating both mitotic entry as well as OCD to regulate tissue growth and stratification in response to the local tissue environment 181 . Interestingly, the epidermis expresses two distinct cadherins—E- and P-cadherin.
Ablation of E-cad results in compensatory upregulation of P-cadherin and impairs apicobasal polarity 182-
184 . More recent insights suggest that E- and P-cadherin play a role in driving epidermal cell fate
specification due to differences in adhesive strength and cortical tension 185 . However, this model examined how these signals direct decisions to proliferate versus differentiate (via delamination), without investigating whether the orientation of cell division might be affected as well. Collectively, these studies highlight that the tension-sensitive AJ may play a significant role in epidermal growth dynamics as well as cell fate specification, but whether this is achieved through modulating the orientation or symmetry of
19 basal progenitor cell mitoses remains a mystery. Our findings in Chapter 3 suggest that perturbations to
the AJ-actin scaffold through knockdown of α-catenin , vinculin , or afadin , increases the prevalence of oblique divisions by specifically preventing the misoriented daughter from undergoing the novel process of telophase correction. This suggests the coordinated efforts of the cell-cell adhesion machinery and actin cytoskeleton are required to properly specify epidermal cell fate through OCD.
1.3.5 Evidence supporting a role for afadin in oriented cell division
Given that afadin and canoe bind directly to LGN/Pins, as well as α-catenin and actin, previous studies have investigated whether afadin/canoe is required for OCD. In Drosophila neuroblasts, loss of cno results in altered spindle orientation and misspecification of neuronal lineages 88 . This was attributed to errors in the localization of the downstream spindle orientation effector, Mud rather than any impact on the upstream polarity machinery. However, in polarized Drosophila S2 cells, it has been shown that Cno
can bind directly to Pins and is responsible for its recruitment to the cortex 26 . Mammalian afadin can also
interact with LGN directly and this interaction is essential for planar orientation of HeLa cells 20, 21 . Both
canoe and afadin bind Pins/LGN by forming an interaction between the TPR repeats and a domain proximal to the afadin/canoe F-actin binding domain20, 26 . Evidence in HeLa cells suggests that afadin can simultaneously bind to LGN and actin, and this concomitant binding is required for normal division orientation 21 . However, how the afadin/LGN interaction fits within the higher order oligomeric complex is unknown. Afadin’s affinity for the LGN TPR repeats is weaker than both mInsc and NuMA, suggesting that it is unlikely to outcompete these molecules for LGN access. Still, it remains possible that afadin is a
minor interactor within LGN/NuMA multimeric protein scaffolds, or that allosteric regulation may impact
afadin’s ability to insert itself into the complex.
Canoe may also operate on OCD in a Pins-independent manner. In the Drosophila follicular
epidermis, division orientation relative to the epithelial plane (i.e. apico-basal orientation) relies on the
canonical Pins/Mud mechanism 186 . However, these cells also bias their orientations within the epithelial
20 plane orthogonal to the long axis of the egg chamber (i.e. planar orientation). This division axis bias
correlates poorly with cell-shape, instead aligning with the axis of anisotropic apical tension. While Mud
is dispensable for this alignment, loss of Cno impairs both apical myosin organization and alignment of
division orientation to tissue tension 187 . Finally, Cno also has an essential role in the establishment of apicobasal polarity during early cellularization of the Drosophila embryo (further detailed later in this
chapter; 1.4 ). Similarly, loss of afadin disrupts polarity in the murine embryonic kidney 188 , perturbing the
orientation of planar cell divisions and lumen formation 189 . Afadin mutants also lose hallmarks of apicobasal polarity in the developing telencephalon and display errors in the division orientation of cortical radial glia 87 .
Taken together, these studies suggest four (non-exclusive) mechanisms by which afadin may
regulate mitotic spindle orientation: 1) through upstream establishment or maintenance of apical polarity
signals, 2) via direct interaction and recruitment of LGN, 3) by regulating the recruitment or binding of downstream effectors such as NuMA into the spindle orientation complex, or 4) by an LGN-independent mechanism. Regardless of the mechanism, whether afadin regulates division orientation or fate specification in the embryonic epidermis remains unknown. This particular knowledge gap is addressed in
Chapter 3 .
1.4 Role of afadin in tissue morphogenesis and disease
The role of afadin/canoe has been examined in numerous tissues and developmental systems through genetic loss-of-function studies. Attempts to generate germline Afdn knockout mice demonstrated homozygous mutants are nonviable and fail to progress more than 9.5 days through gestation 190 , with knockout embryos displaying defects in ectoderm organization during gastrulation. As with Afdn knockouts, cno mutants are embryonic lethal, displaying severe morphological defects 22, 29 . These early
insights into afadin/canoe highlight its importance in invertebrate morphogenesis ( 1.4.1 ) as well as
vertebrate development and disease ( 1.4.2 ).
21 1.4.1 Roles of canoe in Drosophila morphogenesis
canoe was identified as an embryonic lethal mutant with defects in Drosophila cuticle formation and dorsal closure 22 . While early studies of canoe relied on zygotic mutants, these embryos still received a maternal contribution of canoe, likely underestimating the severity of complete canoe loss. This proved true, as maternal/zygotic canoe null embryos display more severe defects in cuticle development29 .
However, these phenotypes are not as severe as those observed when core AJ components are ablated 191-
193 , suggesting that canoe is not required for junctional integrity but rather serves a modulatory role within
the AJ. This was further supported by the fact that the majority of maternal/zygotic cno mutant AJs
appeared normal, with the exception of nascent AJs formed following mitotic exit in the dorsal
ectoderm 29 . This suggests that canoe/afadin may augment the dynamics of AJ assembly. Similarly, cno loss drives defects in mesoderm invagination 29 —a process involving apical constriction and coordination of the AJ machinery 194 . While these mutants initiate apical constriction, they fail to complete this process
due to separation of the actomyosin cytoskeleton from the lateral AJ 29 . Cno mutants display similar defects during germband extension, where cell intercalation is dependent on an apical contractile network of actin and myosin. Here, as in mesoderm invagination, loss of cno causes defects in AJ-actin scaffolding, with pools of actomyosin separated from AJs at the cell membrane 195 .
Additionally, canoe and polychaetoid (ZO-1) cooperate in dorsal closure 30 , where they regulate the formation of the actin cable at the epidermal leading edge. This promotes zippering of the epidermis as opposing leading edges contact at the midline and recruit additional actin regulators 196 . A recent study resynthesized these observations, highlighting that cno RNAi mutants display defects in AJ assembly and fail to re-establish columnar cell shape following several mechanical challenges: mitosis, cell intercalation, and neuroblast invagination—yet surprisingly maintain epithelial integrity. This appears to be due to partial redundancy with the canoe binding partner, polychaetoid (pyd); loss of both cno and pyd compromises epithelial integrity, primarily at tricellular junctions 197 . Importantly, these studies build upon
observations made in MDCK cells, where afadin is most-essential at tricellular junctions 61 —assumed to be the site of highest molecular tension. Taken together, these studies highlight that canoe can serve a
22 mechanical role in morphogenesis, as it is essential to retain AJ/actin scaffolding, particularly in scenarios of high actomyosin contractility.
As mentioned earlier, canoe also plays a role in establishment of apico-basal polarity. During early cellularization of the Drosophila syncytial embryo, each nucleus is segregated by ingression of new plasma membrane and nascent apico-basal polarity is established by the assembly of polarity and adhesion complexes. Early studies in Drosophila established the canonical AJ as a marker of early polarity positioning by segregating the apical and basolateral domains. However, baz (Par3) mutants mislocalize AJ components during cellularization, while Baz still achieves apical polarity in AJ mutants, suggesting that Baz is upstream in the polarity pathway 198 . Baz is similarly upstream of aPKC and Par6,
though these proteins reinforce apical polarity at later stages of development 199 . Interestingly, Baz polarization requires an intact actin cytoskeleton, suggesting that some unidentified actin binding protein may be required to apically polarize Baz. Fittingly, cno mutants fail to apically position Baz, while Baz and aPKC refine Cno apical localization, placing Cno upstream of Baz in polarity establishment 200 . The small GTPase Rap1 is in turn is both necessary and sufficient to apically position no and Baz 201 .
Interestingly, Cno homodimerizes and is capable of self-recruiting additional Cno molecules to the apical
domain, suggesting Rap1 may primarily serve to seed Cno apically, while Cno itself then generates a positive feedback loop to strengthen apico-basal polarity 201 . However, it is important to note that polarity
is largely rescued at gastrulation onset in both cno and Rap1 mutants in an aPKC-dependent manner, illustrating the redundancy of this process. These studies show that Cno plays meaningful roles in early
development in tissue morphogenesis, both as an AJ-actin scaffold and in defining early apico-basal polarity.
1.4.2 Roles of afadin and nectins in mammalian development and disease
As previously mentioned, Afdn germline null mice are embryonic lethal, primarily due to defects
during gastrulation 190 . Comparison to early embryonic phenotypes of murine core AJ mutants again
suggest that afadin is not an essential component of the AJ; loss of either E-cadherin 202 or α-catenin 203
23 disrupts the trophectoderm epithelia and precludes implantation. However, Afdn mutants do display
defects in AJ organization and polarization in early embryonic ectoderm 190 . In order to explore the requirement of afadin in later development of specific organ and tissue systems, two groups independently developed conditional loss of function alleles for the Afdn gene 204, 205 . Conditional Afdn
deletion in the hippocampus reduced excitatory synaptic transmission, likely due to a reduction in the
number of synapses related to diminished accumulation of N-cadherin synaptic adhesion molecules 204-206 .
Interestingly, in flies, Cno can bind directly to Robo—a cell surface receptor involved in the Slit-Robo
axon guidance pathway—and this interaction is required for normal Robo localization and to prevent
axonal midline crossing in the developing ventral nerve cord 207 . Cno genetically interacts with other
components of Slit-Robo signaling, including Neurexin-IV and Syndecan, and Cno regulates neuron-glia
interactions as well 208, 209 . As previously mentioned, afadin is also required for normal differentiation of cortical radial glia through coordination of OCD 87 . Furthermore, conditional loss of afadin in radial glia
and ependymal cells resulted in neonatal lethality due to hydrocephalus 210 . Taken together, these studies highlight that afadin, through its basic functions in cell-cell adhesion and cell polarity, is an essential component of neuronal differentiation and function in both flies and mammals.
Afadin plays a significant role in epithelial and endothelial tissues as well. Intestinal-specific loss of afadin compromised epithelial barrier function, resulting in increased lethality and inflammation following chemically-induced intestinal injury 211 . Another study reported that afadin loss in the intestine
leads to displacement of Paneth cells from the crypt, coincident with increased apoptosis of crypt
epithelia 212 . Of note, low expression of afadin correlates with a poor prognosis and metastasis of colon
cancer 213 . Similarly, loss of afadin is a poor prognostic marker in breast cancer, where it is associated with
metastasis and increase cancer cell migration 214-216 . In the developing kidney nephron, loss of afadin compromises formation of the contiguous lumen, and results in renal dysplasia and lethality 188, 189 . . It is proposed that this is likely through loss of apicobasal polarity, causing cells to fail to orient their divisions orthogonal to the luminal surface. Similarly, Afdn deletion perturbs lumen morphogenesis in the developing pancreas 217 . Universal endothelial deletion of afadin mediated by Tie2-Cre caused embryonic
24 lethality due to severe subcutaneous edema, primarily attributable to defects in VE-cadherin cell-cell junctions of lymphatic vessels 218 . While the same study found no significant angiogenic defects (i.e. the
epithelium remained largely intact), other have reported that afadin promotes angiogenesis in culture 219 , and accumulates in the intercalated disks of cardiomyocytes where it’s protective against myocardial damage in vivo 220, 221 . These studies highlight afadin’s function in cell-cell adhesion and essential role in development of numerous tissue and organ systems.
Interestingly, the obligate afadin binding partners nectin-1 and nectin-4 have been implicated to two separate human syndromes. Familial genetic studies show mutations in NECTIN4 cause EDSS1
(ectodermal dysplasia syndactyly syndrome 1) while mutations in NECTIN1 underlie CLPED1 (cleft
lip/palate ectodermal dysplasia syndrome 1). CLPED1 is characterized by ectodermal dysplasia,
syndactyly, and cleft lip/palate. However, germline Nectin1 null mice are viable and do not present with
cleft palate 75, 76 . Resolving this discrepancy is the basis of my research in Chapter 4 . Additionally,
mutations in other cell-cell adhesion molecules, including E-cad (CDH1) and p120-catenin (CTNND1)
also cause cleft lip/palate 222 . The relationship between cell-cell adhesion and the developmental process
of palatogenesis is introduced in Chapter 2 .
25 1.5 Figures
Figure 1.1 Afadin domain structure and notable binding partners.
Domain structure and mapped binding sites for afadin-interacting proteins. Interactions mapped to
specific domains are color-coded to match the afadin domain to which they bind. The a-catenin binding
site has not been mapped on afadin. The third proline rich region (PR3) is unlabeled but color coded (teal)
to match PR1/2. Abbreviations: RA, Ras-associated; FHA, Forkhead-associated; DIL, Dilute domain;
PDZ, PSD-95/Dlg1/ZO-1 binding domain; PR, proline-rich; ABD, F-actin binding domain; LBD, LGN- binding domain.
Domain structures and sites of mutations found in patients with CL/P for NECTIN-1 (top, previously
known as PVRL1) and E-cadherin/CDH1 (bottom). Mutation types are color-coded and indicated in the
legend. Abbreviations: EC, extracellular cadherin domain; TM, transmembrane domain; JMD, juxtamembrane domain; CBD, catenin binding domain; IgL: Immunoglobulin-like loop
26
Figure 1.2 Involvement of afadin in the adherens junction.
Cartoon representation of afadin (green) within the adherens junction (AJ). The canonical AJ is
comprised of transmembrane cadherins which bind to the catenins (p120-, β-, and α-cat) through their
cytoplasmic catenin binding domain. In the presence of tensile F-actin, α-cat/F-actin interactions are
longer-lived and the α-cat autoinhibited conformation is released, exposing cryptic binding sites for the actin binding proteins, afadin and vinculin. Afadin binds to the C-terminus of the transmembrane nectin and PLEKHA7, which also interacts with p120-cat.
27
CHAPTER 2 – INTRODUCTION. CLOSING THE GAP: MOUSE MODELS TO STUDY CELL- CELL ADHESION IN MAMMALIAN SECONDARY PALATOGENESIS
2.1 Introduction to secondary palatogenesis
Secondary palate formation is a complex multi-step process that involves 1) emergence of PS from the maxillary prominences 2) vertical outgrowth toward the floor of the mouth, 3) elevation above the dorsal surface of the tongue, 4) horizontal growth, 5) adhesion of the approximating medial edge epithelia (MEE) to form the medial epithelial seam (MES), and 6) fusion by dissolution of the MES
(Figure 2.1A-C). In mice, the secondary palate forms over the course of ~3-4 days, with adhesion and fusion occurring between E14-15 223-225 . In humans, this process occurs comparatively earlier during
embryogenesis, but takes longer to complete, with secondary palatogenesis taking place between the 7 th -
12 th weeks, and hard palate preceding soft palate closure 226 . Failure at any stage can result in a persistent
gap along the midline of the roof of the oral cavity, known as cleft palate (CP).
A recent meta-analysis revealed 234 genes linked to CL/P in humans and 249 in mice, of which
54 are shared 227 . While many non-syndromic and syndromic cases of orofacial clefting (OFC) are due in part to decreased mandibular growth, an unknown proportion of clefts are caused by defective
mechanisms intrinsic to the palate. Since the molecular-genetic control of PS emergence and elevation, as well as MES dissolution, have been extensively reviewed elsewhere (see Cao et al., in this issue)224, 228, 229 ,
here we focus on mechanisms regulating the initial steps of MEE fusion, highlighting the mouse as a
model system.
Forty years ago, Greene and Pratt 223 remarked that “adhesion between apposing epithelial surfaces appears to involve epithelial cell surface macromolecules.” More recently, the critical role of
adhesion in palate closure was demonstrated by identification of human CL/P mutations in the adherens
28 junction (AJ) proteins Nectin-1 ( NECTIN1) and E-cadherin ( CDH1 ). In animal models, adhesion proteins including nectins, desmosomal cadherins and other AJ proteins have been localized to the MEE (Figure
2.1D-F; Appendix 1), but comparatively little is known about their function. Appendix 2 compiles published mouse models of known cell adhesion genes, and whether their role in palatogenesis has been
investigated. A major hurdle to dissecting the role of adhesion proteins in palate closure is extensive
functional redundancy among related family members, and in many cases (e.g. the nectins), a lack of
conditional alleles.
2.2 Genes expressed in palatal epithelium underlie CL/P disorders
Defects in mesenchymal growth and patterning are responsible for a large number of non-
syndromic CL/P disorders, including Online Mendelian Inheritance in Man ( www.omim.org) OFC loci
listed in Figure 2A (e.g. MSX1 and DLX4 ). However, 3/7 known OMIM OFC genes are expressed in palatal epithelium, including the intensively-studied transcription factors IRF6 and TP63 230-232 , and the
cell adhesion molecule NECTIN1 . In an attempt to understand the relative proportions of CP genes expressed in mesenchyme versus epithelium, we examined a dataset of ~50 human CL/P loci 233, 234 . We
searched the primary literature, the Human Protein Atlas ( http://www.proteinatlas.org/) , and the Gene
eXpression Database (GXD, http://www.informatics.jax.org/expression.shtml) using “Theiler stage (TS)
21: palatal shelf epithelium” (EMAPS:1736321) and “TS21: palatal shelf mesenchyme” (EMAPS:
1736421) as filters. Interestingly, the majority of these mRNAs/proteins are expressed in palatal
epithelium, with ~1/3 of them epithelially-enriched (Figure 2.2B). This list of genes includes transcription
factors ( GRHL3, KLF4, RUNX1, TBX1, IRF6, TP63 ), signaling molecules ( SHH, TGFB3 ), and numerous adhesion proteins ( CDH1, EFNB1/ephrin-B1, NECTIN1 ).
29 2.3 Cell-cell adhesion molecules in palatogenesis
2.3.1 Nectins and afadin
Nectins are a family of four Ig-family transmembrane cell-adhesion molecules that bind the
obligate cytoplasmic adapter protein afadin, which signals to the cytoskeleton by interacting with α-
catenin (AJs), ZO-1/Jam-A (tight junctions, TJs), and F-actin 235 . Nectins homodimerize in cis before forming tetramers in trans 65 . Cis -interactions are dependent on the 1 st Ig-like loop, while trans -
interactions involve both the 1 st and 2 nd Ig-like loops 67 . Heterotypic trans -interactions are favored, with
nectin-1:nectin-3 showing the highest affinity, followed by nectin-2:nectin-3, and homotypic interactions
showing the weakest affinity 81 . Heterotypic interactions have been shown to mediate cell sorting via
expression of discrete nectins on neighboring cells81 . Since multiple nectins are expressed on MEE/MES cells 236 , it is tempting to speculate that similar sorting behavior may participate in MES migration during palatal fusion.
CL/P-ectodermal dysplasia syndrome, or CLPED1/OFC7 ( OMIM:225060 ; also, Zlotogora-
Ogur/Margarita Island syndrome) is characterized by numerous ectodermal phenotypes. Positional
mapping and sequence analysis identified a novel, homozygous nonsense mutation (W185X) in
NECTIN1 237 . Further familial studies characterized three additional NECTIN1 variants (T324Yfs*65,
G186Lfs*4, and R134X), plus numerous variants associated with non-syndromic CL/P 238-241 (Figure 2.3).
Despite ample evidence suggesting Nectin-mediated adhesion contributes to palate fusion,
molecular redundancy and embryonic lethality have made modeling these human phenotypes difficult.
Multiple nectins are enriched in MEE and colocalize with afadin 236 . However, germline knockouts of
Nectin1 are viable and lack CP, even when one copy of Nectin3 is deleted 75 . On the other hand, deletion of both Nectin1;Nectin3, or afadin is early embryonic lethal 78 , precluding analysis on palate formation.
Although Nectins-1, 2 and 4 are also present in the MEE, no double mutant of any combination of these alleles has been generated; thus, functional redundancy could account for the lack of phenotype in single
mutants. Additionally, if translated, nonsense and frameshift human NECTIN1 mutations could function
as dominant-negatives. For example, when NECTIN1 is truncated after the 1 st Ig-like loop (Figure 2.3),
30 the free extracellular domain could interact with other nectins and act as a soluble inhibitor, as previously
demonstrated with Fc fusions of Nectin3/Nectin1 extracellular domains 242 . While mouse models have
failed to recapitulate CP associated with NECTIN1 mutation, it remains important to investigate redundancy and/or characterize human disease mutations. Introduction of conditional alleles, compound mouse mutants and new genetic models for unstudied nectins (e.g. Nectin-4) represent important avenues for future research. Given the known and suspected role of multiple nectins in palate closure in humans, but the lack of observed CP in individual nectin mutants, we hypothesize that loss of the obligate
downstream effector of nectin signaling, afadin ( Afdn ), might reveal whether nectins are essential for
secondary palate closure. To support this hypothesis, we observed co-localization of Nectin-1 and Afadin
in the medial edge epithelium during palatal fusion (Figure 2.1F). Although cleft palate was not reported
in a conditional knockout of Afdn in the basal oral epithelial layer 243 , there could be at least two explanations: 1) mosaic expression and function of the Cre transgene (see below) or 2) afadin functions in periderm, whereas the Cre transgene was driven by a K14 promoter which is specific for the basal layer. These observations suggest the need for alternative approaches to probe palate formation (see below).
Other nectins have suspected or confirmed associations with CL/P and related disorders.
NECTIN2 and the nectin-like NECL5 are separated by ~180MB on chromosome 19q13, a region associated with non-syndromic CL/P (OFC3, OMIM:600757 , Figure 2.2B). Although rare variants in both NECL5 and NECTIN2 have been linked to CL/P, the functional significance remains unclear 244 .
Additionally, mutations in NECTIN4 cause ectodermal dysplasia-syndactyly syndrome (EDSS) 245 .
Patient-derived NECTIN4 mutant keratinocytes demonstrated impaired AJ assembly and maintenance,
suggesting these alterations have functional significance in cell-cell adhesion 246 . Interestingly, a recent
study demonstrated that Nectin-4 is expressed in the MEE in a pattern similar to Nectin-1247 . The presence of Nectin-4 in MEE is intriguing, since Nectin-4 and Nectin-1 interact with similar efficiency as
Nectin-1 and Nectin-3, but Nectin-3 appears to be absent from the MEE 9, 236 .
31 2.3.2 Cadherins and catenins
Cadherins are a large family of transmembrane, Ca 2+ -dependent, cell-cell adhesion molecules that form the structural foundation of AJs. Mammalian classical cadherins consist of five N-terminal extracellular cadherin repeats, transmembrane region (TM), intracellular juxtamembrane domain (JMD) and C-terminal catenin-binding domain (CBD) (Figure 2.3). Cell-cell adhesion is mediated by trans -
dimerization between cadherin repeat homodimers. p120-catenin directly binds the JMD and stabilizes
cadherins by inhibiting cleavage-mediated degradation. β-catenin binds directly to the CBD and recruits
α-catenin, forming the minimal cadherin-catenin adhesion system. α-catenin forms numerous tertiary
interactions between the AJ, actin cytoskeleton, and other cell-cell adhesions such as nectins, TJs, and
desmosomes.
E-cadherin ( CDH1 ) is the most ubiquitously expressed of the cadherins, implicated in numerous pathologies, including hereditary diffuse gastric cancer (HDGC). Interestingly, Frebourg, et al. 248 , identified multiple pedigrees of HDGC with CDH1 mutations linked to CL/P, as have other groups 249, 250 .
Several mutations are either missense or in-frame deletions, many occurring within the extracellular cadherin repeats (Figure 2.3). Characterization of these alleles demonstrated functional consequences in vitro, supporting a role for cadherin-mediated adhesion in palatogenesis 250 .
Transmission electron microscopy and immunofluorescence studies have detected the proteins
and structures that comprise AJ in the MEE/MES 251, 252 . However, genetic models have yet to
unequivocally demonstrate a functional role for cadherins in palate closure. Germline Cdh1 null mice,
like many cell adhesion mutants, are embryonic lethal 202 . While numerous studies have genetically ablated Cdh1 via tissue specific Cre drivers, a specific role in palatogenesis has not been directly investigated. Two studies knocked out Cdh1 in the epidermis, but the Krt14-Cre alleles used 253, 254 may not have deleted Cdh1 in the MEE early enough, and also demonstrate compensatory P-cadherin ( Cdh3 ) upregulation upon Cdh1 loss 182, 183 . Since P-cadherin is also expressed in palatal epithelia (according to
the MGI GXD 255 and our unpublished data), it could act redundantly with E-cadherin in palatogenesis.
32 While epidermal-specific E/P-cadherin double mutants have been generated 184 , palate closure was not
investigated.
Interestingly, PS failed to elevate upon mesenchymal deletion of Ctnnb1 (β-catenin) with Osr2-
IRES-Cre 256 , while PS elevated and approximated but failed to fuse upon epithelial deletion with Krt14-
Cre 257 . In addition to its role in AJs, β-catenin has a well-characterized role in Wnt signaling (reviewed by
Niehrs 258 ). However, these Ctnnb1 null phenotypes differ significantly from other Wnt mutants, such as
Gsk3 β knockouts where PS fail to elevate 259 , or a stabilized Ctnnb1 mutant, which showed impaired horizontal outgrowth 257 . These data suggest a complex mechanism, where β-catenin may play important
Wnt-dependent roles in mesenchyme proliferation during palatal-shelf elevation/horizontal outgrowth, in
addition to cell-adhesive roles during MEE fusion.
2.3.3 Other cell adhesion molecules
TJs are water-impermeable junctions consisting of claudin, occludin, and zonula-occludens (ZO)
family members 260 . Several TJ proteins, including Claudin-4, Occludin, and ZO-1, localize to the MEE, where data suggests they form functional TJs between periderm cells 236 . Germline null models for many
TJ components are lethal due to defects in gastrulation or epidermal barrier function (Appendix 2). While
no data exists supporting a link between human CL/P and TJ genes, it is important to explore the role TJs play in periderm formation, maintenance, and MEE fusion.
Desmosomes are cell-cell adhesions consisting of a desmoglein/desmocollin transmembrane molecules bound to a member of the intracellular keratin-binding plakophilin family. Desmogleins and desmocollins are part of the larger classical cadherin family, forming calcium-dependent dimers in trans .
Desmosomal cadherins cluster at much higher density than AJ cadherins, forming hyper-adhesive junctions that ensure structural integrity of exposed epithelia. Due to their electron-dense structure, desmosomes have been readily detected in MEE and between cells forming nascent contacts in the MES by TEM 261, 262 . Immunohistochemical experiments have similarly detected plakoglobin and plakophilin-1
33 in approximating MEE 261, 263 . It is tempting to speculate that these molecules play important roles during palatal fusion by establishing strong cell-cell adhesions between approximating PS. Furthermore, the
desmosomal and AJ component plakoglobin ( γ-catenin) shares functional similarities to β-catenin, activating the LEF/TCF transcription pathway 264 . However, little is known about which desmosomal components are actually expressed in the MEE/MES, and their functional role has not been assessed in mouse models.
The Eph receptor family of tyrosine kinases and their ephrin ligands have long been studied for their role in repulsive axon guidance and boundary formation, but through “reverse signaling”—whereby the ephrin serves as receptor and Eph as ligand—they can also function in adhesion 265 . Mutations in the gene encoding ephrin-B1 ( EFNB1 ) cause craniofrontalnasal syndrome (CFNS, OMIM:304110 ) which
includes CL/P 266, 267 . Efnb1 -/- mice present with CP 268 , as do double mutants in the cognate receptors
EphB2;EphB3 269 . Several studies have shown that the reverse-signaling function of ephrin-B1 is critical for MEE adhesion. Ectopic ephrin-B signaling forces palate fusion in chicken, which have a naturally occurring secondary palatal cleft 270 . Additionally, EphB reverse signaling in murine palate culture could
rescue the CP defect caused by TGFβ3 inhibition 271 . EphA receptors and ligands are also being investigated, but considerable redundancy has complicated genetic analyses 272 .
2.3.4 Connecting the dots between transcription factors and cell adhesion
While direct evidence for an association between human clefting phenotypes and cell adhesion
molecules is currently restricted to NECTIN1 , CDH1 , and EFNB1 , there is evidence suggesting cell
adhesions are affected in other OFC syndromes, including those linked to mutant p63 273 . P63 ( TP63) is a p53 homologue described as an epithelial-defining transcription factor. Variants in TP63 underlie
multiple human CL/P syndromes, including ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC;
OMIM:106260 ) and ectrodactyly, ectodermal dysplasia, cleft lip/palate syndrome 3 (EEC3;
OMIM:604292 ). Murine p63 ( Trp63 ) germline mutants present with CP, and Trp63 +/-;Irf6 +/- double
haploinsufficiency mutants also exhibit a CP phenotype 274, 275 .
34 There is mounting evidence that p63 plays a complex role in palate closure, whereby its early
expression in PS promotes specification of the suprabasal periderm layer, and its later downregulation in
the MEE promotes reorganization of cell-cell adhesions that facilitate periderm migration and MES
dissolution 247 . The presence of periderm is necessary to prevent aberrant intra-oral adhesions, which can prevent PS elevation and cause CP, and p63 plays a role in this process 247, 276, 277 . Interestingly, ΔNp63α,
though highly expressed in PS epithelium, is downregulated during MES formation 275 , suggesting that p63 loss promotes periderm dissolution. In support of this “dual role” of p63 in palatogenesis, the Dixon lab recently demonstrated that haploinsufficiency for Trp63 can rescue CP observed in Tgfb3 mutants— where p63 expression is ectopically maintained in the MES—and that overexpression of ΔNp63α can induce CP by preventing MES dissolution 247 . This study also provided evidence that periderm is not shed during the MEE ‰MES transition, but rather migrates out of the MES toward the nasal and oral surfaces to form “epithelial triangles,” supporting the idea that periderm participates in the formation of nascent adhesions between the MEE.
Interestingly, NECTIN-1 is a direct target of p63, and p63 deletion results in a near-complete loss of Nectin-1 in both epidermis and MEE 278 . Human keratinocytes harboring the AEC L514F mutation
exhibit reduced Nectin-1 expression 278 , suggesting the CP phenotype may be mediated, at least in part, by
Nectin-1 loss in the MEE. Heterozygous knock-in mice expressing the p63 L514F variant display fully- penetrant CP, attributed to defective FGF signaling, and skin fragility, attributed to reduced expression of desmosomal proteins 279, 280 . However, while Irf6 and Fgfr2/3 have gathered much attention as p63 targets,
emerging evidence suggests cell-cell adhesion molecules—including NECTIN1, DSC1, DSG3, DSP, and
CDH3 —may also be relevant 273, 280, 281 . Perhaps the strongest evidence to date comes from in vivo
transcriptional profiling and ΔNp63 CHIP-seq analyses comparing wild-type and Trp63 loss- and gain-of-
function mutants, which have revealed striking alterations in the expression of AJ, desmosomal, and TJ
genes 247 . Of particular interest, E14 Trp63 -/- mutant PS show reduced mRNA expression of Cdh3/P-
cadherin , Nectin-1, and the desmosomal components Pkp1, Pkp3, Dsc3, Dsg2 , and Dsg3 . Moreover,
although Nectin-4 mRNA levels are not altered in Trp63 -/- mutants, Nectin-4 protein becomes
35 mislocalized away from the basal-periderm junction to lateral basal-basal cell junctions. These data provide compelling evidence that p63 plays a critical role in regulating MEE cell-cell adhesions247 .
2.4 Methods to investigate the genetics of CL/P
2.4.1 Ex vivo palate cultures
Before the advent of genetically engineered mice, the most widely used system to perturb palatogenesis was ex vivo palate cultures. Given the inaccessibility of the palate region, it is difficult to perform intravital imaging, but exciting recent live-imaging studies of ex vivo cultures have granted new insights into the processes that regulate palatal fusion, including cell extrusion 282 . Since the initial
development of ex vivo palate culture by Moriarty et al 283 , the technique has been adapted to include
numerous model organisms that present different contexts for studying palatogenesis. Most birds and
reptiles have incomplete secondary palatal fusion 284 , while chick palates can complete fusion when cultured with recombinant TGF β3, reinforcing the importance of TGF β in regulating palate closure 262 .
One notable advantage of palatal cultures is the ability to “mix and match” PS from different
organisms or genetic backgrounds. For example, it was demonstrated that LacZ + cells from the Rosa26- lacZ mouse exhibited preferential migration in the nasal and posterior directions into the opposing LacZ - shelf during MES fusion 285 . More recently, murine PS culture have incorporated the ever-expanding
molecular-genetic toolkit, including fluorescent reporters, genetic manipulation, and live-imaging that
allow for a unique opportunity to rapidly study the palatal closure 263, 285-287 .
2.4.2 Animal models to investigate epithelial cell-cell adhesion in palate closure
Differences in the craniofacial development and structure between fish, birds, reptiles and
mammals make the mouse the most tractable genetic organism to study secondary palate fusion as it
relates to humans. Both germline and conditional mouse knockouts have been used to recapitulate human
CP disorders with remarkable fidelity (see Figure 2.2B), and the latter has been particularly important in
deciphering mesenchymal versus epithelial contributions to CL/P. While a vast arsenal of tissue-specific
36 Cre driver lines has been used to query mesenchymal gene function in PS morphogenesis, comparatively
few epithelial drivers exist, limited largely to Shh-Cre 288 , Tgfb3-Cre 289 , Pitx2-Cre 290 and Krt14-Cre .
Cytokeratin-14 (Krt14) is expressed throughout the basal layer of stratified epithelia, including the epidermis, cornea, and oral epithelia. Interestingly, however, its expression at the protein level appears to be notably lower in the PS epithelium than in neighboring buccogingiva or tongue epithelium (Figure
2.4A). Complicating matters, there are no less than seven distinct published Krt14-Cre alleles, of which
three have been used to study palatogenesis 253, 291, 292 . These alleles vary widely in the timing, tissues, and
mosaicism of expression, although one allele seems to be most widely utilized in the field 291 . A summary
of the various Krt14-Cre lines used to study palate closure is shown in Appendix 3. While many groups have verified Krt14-Cre activity during embryonic palate development through reporter mice 285, 292-294 , it must be noted that the timing of reporter expression cannot be used as a surrogate for the timing of protein loss, which is affected by factors such as protein and mRNA stability. For example, the McMahon
Krt14-Cre line could be used to induce recombination of a GFP reporter gene for imaging purposes, but
was less effective at deleting Myh9 for functional analyses 282 . Additionally, studies of Krt14-Cre-
mediated loss of Shh highlight the significant differences that exist between these transgenic lines. Using
the McMahon line, two groups failed to report cleft palate 292, 295 , while another reported CP with 85% penetrance 296 , and studies using the Millar line reported CP with 70% penetrance 297 . This variable penetrance can be attributed to many factors, including differences in the timing of initiation of transgene
expression, mosaicism, and potentially strain differences. While the utility of these lines in studying palatogenesis is evident, caution is advised in the choice of which line to use, and in the application for
which it is intended.
2.4.3 Other approaches to study epithelial contributions to secondary palate closure
Viral vectors provide a powerful and versatile means to query and modulate gene function in a
more rapid and high-throughput fashion than can be accomplished by traditional transgenic approaches.
One elegant example of how this can be applied to study palatogenesis was recently demonstrated by Wu
37 and colleagues 298 . Using intra-amniotic delivery of an adenovirus encoding TGFβ3, the authors were able to show that restoration of TGFβ3 expression specifically in periderm could rescue the CP defect observed in TGFβ3 -null mice, providing evidence that TGFβ3 is required in periderm for it to be removed
from the MEE surface prior to fusion. More recently, Ke and colleagues 263 used lentiviral and adenoviral transduction in palatal cultures to show that IRF6 acts downstream of TGFβ3 to promote epithelial- mesenchymal transitions during palate fusion.
If performed prior to periderm formation (E9.5), virus delivered into the amniotic space can transduce single-layered surface epithelia, leading to expression in basal cells and their progeny, including differentiated suprabasal cells and periderm 299 . Using this approach (Figure 2.4B-C), ultrasound-guided intra-amniotic delivery of lentiviruses harboring shRNAs can transduce the epidermis at >90% efficiency, allowing for elucidation of the genetic pathways that regulate epidermal stratification 86, 127, 299 . We recently showed that this technique, which we term LUGGIGE (Lentiviral
Ultrasound-Guided Gene Inactivation and Gene Expression), can efficiently transduce oral epithelia at all
stages of palatogenesis (Figure 2.4D-G), and that oral epithelial stratification is dependent on oriented cell
divisions 300 . Importantly, lentiviruses can be engineered for a variety of applications (Figure 2.4C),
including over/mis-expression, expression of disease variants, reporter gene expression, shRNA
knockdown, and expression of constitutive or inducible Cre recombinase, which can be used to excise
floxed alleles in a spatially and temporally controlled manner 86, 127 .
LUGGIGE represents an alternative method for probing gene function in periderm during palate
fusion. Lane and Kaartinen speculated that part of the reason why Krt14-Cre conditional cKOs of TGFβ family members cause CP with lower penetrance than germline mutants is due at least in part to inactivity of Krt14-Cre in the periderm 229 . Thus, while it is likely that LUGGIGE can induce gene expression/loss earlier and more uniformly in the palatal epithelium than Krt14-Cre alleles, as has been demonstrated in the epidermis 299 , it must also be considered that the ability to transduce periderm may be important in the
context of palate closure.
38 2.5 Conclusions
Adhesion between epithelial cells of apposing palatal shelves is an obligate first step of palatal
fusion. Human genetic studies reveal that AJ components of both the nectin and cadherin family are
essential for proper palate closure, and it is likely that other cell-cell adhesions, including desmosomes, play important roles as well. A challenge going forward will be to develop better tools, including
combinations of gene knockouts and more faithful disease models mimicking the mutations found in
humans. Armed with an array of powerful culture systems, imaging techniques, and animal models,
researchers are poised in the next decade to make significant advances in closing the gap between
suspected and known CL/P genes, and deciphering the cellular and molecular mechanisms by which they
operate.
39 2.6 Figures
Figure 2.1 Secondary palatogenesis
A) Timeline of morphogenetic processes that occur during palate growth and closure in mice and humans.
Human data is based on the timing of hard palate closure, with soft palate fusion occurring later. B)
Schematics, in the coronal plane, of the position of the secondary palatal shelves (PS, purple) relative to
40 the tongue during representative stages of palatogenesis. C) Scanning EM micrographs of the roof of the
mouth at indicated ages. PS initiate outgrowth from the MxP at ~E11.5-E12 (i), depending on the mouse
strain 225 , and initially grow downward (ii) before elevating above the tongue at ~E13.5-E14.0 (iii).
Horizontal growth follows until opposing medial edge epithelia (MEE) meet at the midline (iv). PS fusion occurs between E14.5-E15.5 and proceeds anteriorly and posteriorly over the course of ~6 hrs 225 (v). D)
Cartoon depicting a coronal view of approximating palatal shelves (~E14.0). Adhesive-competent basal cells (purple) are separated from the mesenchyme by a basement membrane (dark purple). Non-adhesive periderm cells (tan) prevent the formation of intra-oral adhesions. The periderm is lost prior to the formation of the MES. E) Molecular view of inset from (D) (rotated 90 °) demonstrating the distribution of cell-cell adhesions within the MEE. Proteins that have been localized to MEE via immunohistological staining are listed. More detail regarding evidence for the proteins listed, including references, can be found in Appendix 1. The non-adhesive apical surface of periderm cells is demarcated in green. F)
Afadin immunofluorescence (green, Sigma A-0224) in the oral side of the early MES in E14.5 wild-type
Afdn fl/fl littermates colocalizes with nectin-1 (red, MBL D146-3).(i) Multicolor image. Panels (ii) and (iii) are isolated, greyscale images of the Afadin and nectin-1 staining, respectively. Scale bars: 500 µm (C),
30 µm (F); pseudocolors: purple (PS), light blue (lip), green (NS, nasal septum), yellow (1°P, primary palate); yellow arrows in (C) indicate direction of palatal fusion. Images in (C) adapted from Facebase; timeline in (A) inspired by Bush & Jiang 224 .
41
Figure 2.2 Palatal gene expression and human orofacial clefting syndromes
A) Table of non-syndromic orofacial clefting (OFC) disorders listed in OMIM. The presence of cleft palate in corresponding mouse mutants is also noted. B) Genes mapped to cleft palate phenotypes in humans, tabulated based on their pattern of expression. Sources: MGI Gene eXpression Database (GXD),
234, 255 .
42
Figure 2.3 Mutations in NECTIN1 and CDH1 associated with CL/P
Domain structures and sites of mutations found in patients with CL/P for NECTIN-1 (top, previously
known as PVRL1) and E-cadherin/CDH1 (bottom). Mutation types are color-coded and indicated in the
legend. Abbreviations: EC, extracellular cadherin domain; TM, transmembrane domain; JMD, juxtamembrane domain; CBD, catenin binding domain; IgL: Immunoglobulin-like loop.
43
Figure 2.4 LUGGIGE in oral epithelia
A) Expression of keratins in E13.5 pre-elevation PS. K14 (in gray, Origene BP5009) is reduced is PS
(indicated by arrowhead) compared to nearby tongue and buccogingiva, while the oral keratin K6A
(green, Biolegend Poly19057) and periderm marker K8 (red, Developmental Studies Hybridoma Bank
TROMA-I) are present. B,C) LUGGIGE. B) Ultrasound image of lentiviral injection into the amniotic fluid surrounding E9.5 embryos. C) LUGGIGE-transduced E17.5 embryo showing epithelial-specific expression of the nuclear histone H2B-mRFP1 reporter in epidermis and oral tissues. D) Examples of lentiviral constructs harboring an shRNA and H2B-RFP1 reporter (left) for knocking down target genes, as for Afdn 2711 (see Fig. 5B,D), or Cre-RFP (right) for generating conditional knockouts, as in Afdn fl/fl
mice (see Fig. 5A). E) Schematic of palate region viewed by coronal section. F-H) LUGGIGE can
achieve high transduction in palatal cells at both early (F) and late (G,H) stages of palatogenesis. Hollow
arrowheads indicate RFP+ cells within the mesenchyme, possibly representing MES cells that have
undergone EMT. Abbreviations: NS, Nasal septum; To, tongue; PS, palatal shelf, BG, buccogingiva;
MES, medial epithelial seam. Scale bars: 100µm.
44
CHAPTER 3 – RESULTS. TELOPHASE CORRECTION REFINES DIVISION ORIENTATION IN STRATIFIED EPITHELIA
3.1 Introduction
Stem and progenitor cells utilize asymmetric cell divisions to balance self-renewal and differentiation. Cell fate decisions can be influenced by the division axis, with the choice between symmetric and asymmetric fate outcomes dictated by positioning of the mitotic spindle. Mechanistically, precise control of division orientation may serve to equally or unequally partition fate determinants, or restrict access to a stem cell niche 301, 302 . Errors in division orientation can lead to defects in
differentiation and cell identity with the potential to drive overgrowths associated with cancer 303-305 .
The developing murine epidermis serves as an excellent model for studying how oriented cell
divisions direct cell fate choices. Basal progenitors are capable of dividing either within the plane of the
epithelium or perpendicular to it, resulting in symmetric or asymmetric divisions, respectively 85, 126 . This process is governed by a conserved complex of spindle orienting proteins, including the essential linker
LGN/Gpsm2 86, 127 . During epidermal and oral epithelial stratification, LGN is recruited to the apical cortex in ~50% of mitoses, and LGN loss leads to increased planar divisions and severe differentiation defects 86, 127, 300 . Thus, a parsimonious explanation for the observed bimodal distribution of division
angles is that perpendicular divisions occur when sufficient levels of LGN are recruited to the apical
cortex during early mitosis, and planar divisions occur when this apical recruitment fails.
In this and other models, it is assumed that the division axis is established relatively early in
mitosis, either through directed centrosome migration or spindle rotation. As an example of the former, in the Drosophila melanogaster testis and larval neuroblasts, one centrosome migrates to the opposite side of the cell during prophase, and the metaphase spindle forms along, and remains fixed by, this
45 centrosomal axis 107, 140, 306 . In other systems—including the C. elegans early embryo, D. melanogaster
embryonic neuroblasts, and progenitors of the vertebrate neuroepithelia—the spindle dynamically rotates
during metaphase to align with extrinsic niche-derived or intrinsic polarity cues 307-310 . Collectively, these studies support the view that spindle orientation generally operates prior to anaphase onset.
On the other hand, there are hints from other studies that the metaphase-anaphase transition involves dynamic reorganization of the spindle orientation machinery. For example, in HeLa cells it has been shown that while LGN is essential for NuMA localization during early mitosis, LGN becomes dispensable during anaphase, when NuMA’s cortical localization is dependent upon phosphoinositides 311 .
However, whether LGN functions to orient spindles at late stages of mitosis in other, polarized cell types,
remains unknown.
Here, utilizing ex vivo live imaging in combination with mosaic RNAi, we find that division orientation in the developing murine epidermis is not determined solely by LGN localization during early mitosis. Surprisingly, LGN appears to play a “maintenance” role during anaphase/telophase, while an
LGN-independent pathway involving adherens junction (AJ) proteins also acts to refine imprecise initial spindle positioning. We show that spindle orientation remains dynamic even into late stages of mitosis, and surprisingly, division axes remain random and uncommitted long after metaphase. While most cells enter anaphase with planar (0-30°) or perpendicular (60-90°) orientations and maintain this division axis through telophase, a significant proportion (30-40%) are initially oriented obliquely (30-60°), but undergo dramatic reorientation, a process we term telophase correction. In addition, we demonstrate that the α-E- catenin/vinculin/afadin cytoskeletal scaffolding complex is required for this correction to occur, and
likely functions to modulate the tensile properties of the cell cortex by altering how actin is recruited to
AJs. Mutants defective for telophase correction display precocious stratification which persists into later
stages, highlighting the importance for this mechanism in generating normal tissue architecture.
Furthermore, using genetic lineage tracing in afadin (Afdn ) mutants, we confirm that uncorrected oblique
divisions result in a strong bias toward differentiation over self-renewal.
46 Collectively, these studies support a novel two-step model of oriented cell division, where
intrinsic factors such as LGN provide spatial cues that guide initial spindle positioning during early
mitosis, while extrinsic factors such as cell-cell adhesions may provide a tension or density-sensing
mechanism that refines the division plane during telophase to ensure normal tissue architecture. Our data
further suggest that these mechanisms are modulated over developmental time to coordinate progenitor-
expansive and differentiative programs.
3.2 Results
3.2.1 Randomized division orientation persists into anaphase
During peak stratification, epidermal basal cells undergo either LGN-dependent perpendicular
divisions or LGN-independent planar divisions, with roughly equal frequency. LGN is invariably apical
when recruited to the cell cortex during prophase and remains apical at telophase in perpendicular
divisions 86, 127 . However, this bimodal distribution of division angles only emerges by ~E16.5, because the apical polarization of LGN is less efficient at earlier ages, resulting in a high proportion of oblique angles, and fewer perpendicular divisions 127 . Our previous studies reported a bimodal distribution of division angles at late stages of mitosis and randomized division angles during metaphase 86, 127 , while
other groups have reported that spindle rotation occurs during prometaphase and is fixed to a bimodal
distribution by late metaphase/early anaphase 133, 312 . While these studies agree that spindle rotation
occurs, they come to different conclusions about when and how the spindle axis becomes fixed to a bimodal distribution.
Because these studies vary in the ages examined and the method used to identify mitotic cells at specific stages, we sought to apply a rigorous and unambiguous methodology to identify metaphase, anaphase and telophase cells at a single timepoint (E16.5), when nearly all divisions are either planar or perpendicular. Because phosphorylation at Ser10 and Ser28 of histone-H3 (pHH3) decline rapidly after metaphase 313 antibodies raised against pHH3 vary in their ability to detect anaphase cells, and do not label telophase cells at all. Thus, we used another marker, Survivin (Birc5), which localizes to
47 centromeres through metaphase, and redistributes to central spindle fibers and the cleavage furrow during
anaphase and telophase, respectively 314, 315 . In this manner, anaphase and telophase cells can be readily distinguished by their pattern of Survivin staining (Fig. 3.1A). Since its original use 86 , Survivin has been used by multiple groups across a variety of tissues to measure the division axis 127, 163, 300, 316-325 .
We examined a large cohort of fixed sections of dorsal back skin epidermis from twenty-five
E16.5 mouse embryos of varying strains (CD1, 129S4/SvJae and C57Bl6/J), and identified and imaged
536 Survivin+ metaphase, anaphase and telophase cells. We noted that anaphase and metaphase cells were comparatively rare, each occurring at ~1/5 the frequency of telophase cells (Fig. 3.1B). In agreement with our previous observation, metaphase plates were oriented randomly, suggesting that spindle rotation occurs during metaphase. Surprisingly, however, the distribution of division angles remained random at anaphase, only establishing a bimodal distribution during telophase (Fig. 3.1B,C). This trend held for each mouse strain (Fig. 3.2A), demonstrating that differences in genetic background are unlikely to explain discrepancies in anaphase orientation reported by our group and others. Of note, because of the relative scarcity of anaphase divisions, they make a negligible contribution (Fig. 3.1B, compare
“telophase” to “ana+telo”), perhaps explaining why in previous studies, so few oblique divisions are reported in total Survivin+ pools. Nonetheless, these data demonstrate that basal cells remain uncommitted to a final plan of division beyond metaphase and suggest that a previously uncharacterized spindle orientation mechanism occurs after anaphase onset.
3.2.2 Oblique anaphase divisions reorient during telophase
As a next step, we performed ex vivo live imaging of E16.5 embryonic epidermal explants 326 , in order to examine the dynamics of spindle orientation at late stages of mitosis. To easily discriminate the basal layer of the epidermis from the underlying dermis and visualize cell nuclei during mitosis we
utilized two combinations of alleles: 1) Rosa26 mT/mG + Krt14 Cre , where cell membranes are GFP+ in the epidermis and tdTomato+ in the dermis, and 2) Rosa26 mT/mG + Krt14 H2B-GFP , where epidermal cell membranes are tdTomato+ and nuclei are H2B-GFP+ (Figure 1D). In both allele combinations, accurate
48 measurements of the division angle relative to the epidermal-dermal border could be made in z- projections (Fig. 3.1E). The Rosa26 mT/mG + Krt14 H2B-GFP combination was particularly useful for visualizing both the initiation of cleavage furrow ingression and the separation of nuclei that occurs at anaphase onset (defined as t=0). Since cell nuclei could not be visualized in the Rosa26 mT/mG + Krt14 Cre background, we defined anaphase onset as the frame in which cleavage furrow ingression could be first
visualized. Of note, in both allele combinations, the duration of anaphase was observed to be short—
typically two 5’ frames elapsed where mGFP or mTdTom was not visible between daughter nuclei— providing an explanation for why anaphase cells were rarely observed in fixed tissue.
In both imaging paradigms, we observed a high proportion (~2/3) of basal cells which entered
anaphase at either planar or perpendicular orientations that remained relatively fixed for the duration of
the imaging period (Fig. 3.2B,C; Videos 3.1.1, 3.1.2). However, as suggested by our analyses of fixed
tissue, many basal progenitors also frequently initiated anaphase at oblique angles (Fig. 3.1E; t=0,
φ=division angle). Notably, these oblique divisions invariably corrected to either planar or perpendicular
within an hour (Fig. 3.1E; Fig. 3.2D,E; Videos 3.1.3, 3.1.4). When the angle of division was plotted over
time, we noted that this reorientation, hereafter referred to as telophase correction, generally occurred
within the first 30 minutes of anaphase onset. (Fig. 3.1F). Since little or no reorientation occurred after 1h,
we assigned this as the imaging endpoint (t=+60min, θ=division angle). Of note, the distribution of
division angles observed in these movies at anaphase onset ( φ) and 1h later ( θ) was remarkably similar to
the distribution of anaphase and telophase orientations observed in fixed tissue (compare Figure 1G to
1C). When the behavior of individual cells was plotted at anaphase onset relative to 1h later, we observed
that when φ>60°, correction tended to occur toward perpendicular, and when φ<30°, correction tended to
occur toward planar, while oblique angles were less predictable (Fig. 3.1H). This suggested that the
directionality of correction is not purely stochastic.
49 3.2.3 LGN mediates perpendicular telophase correction
Previous studies have shown that LGN (Pins in Drosophila )—along with its binding partners Insc
(Inscuteable), NuMA (Mud), and G αi—play key roles in oriented cell divisions 101, 104, 106, 107, 127, 327-330 . In the conventional view, LGN functions primarily during prometaphase-metaphase by facilitating capture and anchoring of astral microtubules to the cell cortex. In developing stratified epithelia, LGN first localizes to the apical cortex during prophase 85, 86, 127, 300 . However, our finding that a large proportion of
anaphase cells are oriented obliquely suggests that initial perpendicular spindle positioning by LGN may be imprecise and raises the question of whether LGN may also function during perpendicular telophase correction.
To test this, we performed ex vivo live imaging of Krt14 Cre ; Rosa26 mT/mG epidermal explants
mosaically-transduced with a previously validated shRNA targeting LGN/Gpsm2 (Gpsm2 1617 ) or non- targeting Scramble shRNA control 86, 127 . The H2B-RFP reporter allowed us to track pronuclear separation
during anaphase onset and distinguish RFP+ transduced/knockdown basal cells from non-
transduced/wild-type RFP- internal controls (Fig. 3.3A,B). Like wild-type explants, Scramble RFP+ and
Gpsm2 1617 RFP- control cells were randomly oriented at anaphase onset but corrected to a bimodal
distribution 1h later (Fig. 3.3C-E). Compared to wild-type cells, a higher proportion of Gpsm2 1617 RFP+
cells entered anaphase at planar ( φ<30) orientations (75% vs 30% for Gpsm2 1617 RFP- and 32% for
Scramble RFP+). In addition, very few Gpsm2 1617 RFP+ cells (2%, n=49) entered anaphase at perpendicular ( φ>60) orientations (Fig. 3.3D,E). These data support our previous findings that LGN is
required for initial positioning of perpendicular spindles. Interestingly, however, the minority (23%) of
Gpsm2 1617 RFP+ cells that entered anaphase at oblique angles invariably corrected toward planar (Fig.
3.3D,E). Taken together, these data suggest that, in addition to its known role in orienting spindles along the apicobasal axis during prometaphase, LGN also serves a second maintenance function later in mitosis,
where it promotes perpendicular correction during telophase.
50 3.2.4 Directionality of telophase correction is correlated with basement membrane contact
We next sought to address the mechanisms underlying planar directed telophase correction. In our
WT live imaging experiments, we observed that while initial orientations of φ>60° typically corrected to perpendicular, and φ<30° to planar, the behavior of intermediate orientations ( φ=30-60°) was less predictable (Fig. 3.1H). However, we noted that apical daughters undergoing planar telophase correction frequently displayed a unique, balloon-shaped morphology and appeared to maintain contact with the basement membrane (open arrowheads in Fig. 3.4A). Remarkably, maintenance of this basal endfoot predicted planar reorientation, while loss of contact predicted the opposite (Fig. 3.4B,C; Fig. 3.5A).
Importantly, this correlation between basal contact and telophase correction was unaltered by expression of Scramble or Gpsm2 1617 shRNAs (Fig. 3.5B,C). These data suggest that transient oblique metaphase- anaphase orientations are corrected in a manner dependent on whether they retain contact with the basement membrane following cleavage furrow ingression.
Telophase corrective basal contacts display hallmarks of elevated actomyosin contractility
Given the dynamic changes to cell shape that occur during telophase correction, we hypothesized that they may correlate with distinct molecular changes in the underlying actomyosin cytoskeleton. To test this, we performed immunostaining on E16.5 epidermal whole mounts for actin (phalloidin) and active phosphorylated (Ser19) myosin light chain II (pMLC2), and identified rare, oblique divisions with the characteristic basal endfoot. Interestingly, the intensity of pMLC2 was higher specifically in the endfoot process compared to the apical cortex of the same daughter cell, while actin levels were similar
(Fig. 3.4D; Fig. 3.5D). This anisotropy suggests that the basal endfoot may be enriched in contractile actomyosin, which we speculate may serve the function of pulling the apical daughter back into the basal layer.
Increased actomyosin contractility can be indicative of elevated tension across adherens junctions
(AJs) that anchor the cytoskeleton to the cell membrane. The AJ is canonically composed of
51 transmembrane cadherins, which couple neighboring cells through trans-dimerization in the extracellular space and link to the underlying actin-cytoskeleton via α-E-catenin 331 . In the presence of actin-dependent tension, α-E-catenin undergoes a conformational change, exposing an epitope within its mechanosensitive modulatory (M) domain that is recognized by the α18 antibody 48, 51, 332, 333 (Fig. 3.4E). To investigate whether α -E-catenin undergoes conformational changes during telophase correction, we performed whole mount immunofluorescence for total and tensile α-E-catenin, seeking out rare anaphase cells undergoing oblique divisions. In agreement with the observed increase in pMLC2 in the basal endfoot of oblique telophase cells, levels of α18 were also higher in the basal endfoot compared to the apical cell cortex in these cells (Fig. 3.4F). Importantly, this increased intensity was specific to the α18 epitope as levels of
total α-E-catenin did not display similar anisotropy (Fig. 3.5E). This elevated α18: α-E-catenin ratio was
only observed in the basal endfoot of oblique divisions, and not in planar divisions, metaphase cells, or
non-mitotic neighbors (Fig. 3.4G). These data suggest that increased actomyosin contractility and
associated conformational changes to α-E-catenin could play a role in planar directed telophase
correction.
3.2.5 The actin-binding protein, vinculin, regulates ααα-E-catenin conformation.
α-E-catenin (Ctnna1) serves as the core mechanosensor at AJs, such that force across AJs induces
a conformational change in α-E-catenin which exposes a vinculin-binding domain within the M region 31,
51 . The binding of α-E-catenin to both actin and vinculin (Vcl)—another cytoplasmic actin-binding protein that functions at both AJs and focal adhesions—is force dependent, and vinculin and α-E-catenin
cooperate to strengthen AJ-mediated adhesion 49, 50, 55, 57, 334, 335 . Other studies have shown that the actin scaffold afadin (Afdn) is capable of binding directly to α-E-catenin via an internal domain proximal to the vinculin binding domain, and that afadin is recruited to sites of α-E-catenin activation together with vinculin 3, 19, 336 .
52 Due to the challenges of finding rare oblique-correcting cells in vivo , to further investigate the interplay between AJ complex proteins and actomyosin contractility, we turned to a calcium-shift adhesion assay in primary cultured keratinocytes 337 . Following 8h of exposure to 1.5mM (high) Ca 2+ ,
Scramble control keratinocytes form linear AJs containing both vinculin and α-E-catenin (Fig. 3.6A).
Ctnna1 knockdown led to a reduction in junctional vinculin, while Vcl knockdown led to a reduced fluorescence intensity ratio of α18 (“tensile”) to total α-E-catenin (Fig. 3.6A-C), confirming that the tension sensitivity of α-E-catenin is vinculin-dependent in keratinocytes. Interestingly, while Vcl loss reduced the proportion of tensile α-E-catenin, this was a result of a net increase in total α-E-catenin, while total α18 intensity remained unchanged or even increased (Fig. 3.7A). This suggests that higher levels of junctional α-E-catenin may partially compensate for Vcl loss to maintain a threshold level of tensile α-E-catenin.
While α-E-catenin is still recruited to AJs in Vcl knockdown keratinocytes, Vcl -deficient junctions appeared abnormal, in agreement with a recent report 333 . Vcl -deficient junctions were wider and
more punctate than controls, with a morphology reminiscent of immature “spot AJs” or “adhesion
zippers” 337 . In WT keratinocytes cultured for 30 minutes in high Ca 2+ , nascent cell-cell junctions displayed discontinuous E-cadherin puncta associated with loosely-organized radial actin filaments, while after 8h, E-cadherin and actin became tightly associated in a circumferential belt (Fig. 3.7B). We developed a quantitative method to measure E-cadherin puncta as a means of assessing junctional maturation, such that higher “continuity” values represent mature linear junctions (e.g., 8h Ca 2+ shift)
while lower continuity values represent spot junctions (e.g., 30 min Ca 2+ shift) (Fig. 3.7C). Similar to WT controls, following an 8h Ca 2+ shift, Scramble keratinocytes displayed junctions with linear actin that was
closely aligned with E-cadherin. In contrast, in Ctnna1 and Vcl knockdown keratinocytes E-cadherin was punctate and discontinuous, and displaced from the cortical actin belts (Fig. 3.6D,E). These data
demonstrate that α-E-catenin and vinculin are required for the proper maturation of AJs.
53 3.2.6 Afadin is required for normal AJ morphology and is a novel regulator of ααα-E-catenin conformation
Afadin and Cno are required to stabilize actin-AJ associations during moments of high actomyosin contractility, suggesting a role in establishing/maintaining tensile loads 61, 195 . To examine whether afadin loss influences AJ-associated actin in keratinocytes, we generated mosaic cultures of wild- type and Afdn fl/fl cells transduced with lentiviral Cre-RFP (Fig. 3.6F). E-cadherin+ AJs between wild-type
uninfected cells (WT:WT) showed normal junctional accumulation of afadin, while AJs between RFP+
cells (KO:KO) lacked afadin (Fig. 3.6F, red). Afdn fl/fl Cre-RFP+ cells also demonstrated increased levels of cytoplasmic E-cadherin, and KO:KO junctions displayed punctate, rather than linear, E-cadherin (Fig.
3.6G), reminiscent of immature “spot” junctions. In addition, while WT:WT junctions showed tight association of actin with E-cad, like Vcl and Ctnna1 912 knockdown AJs, Afdn KO:KO AJs showed reduced junctional actin, with actin bundles frequently displaced ~1 µm from the junction (Fig. 3.6F,H).
These data suggest that afadin plays an essential role in linking cortical actin to the AJ complex, with potential consequences on E-cadherin clustering.
Since it has been shown that AJ components such as E-cadherin regulate junctional recruitment of
vinculin from focal adhesions in a tension dependent manner 333, 338 , and we noted that α-E-catenin and
vinculin are required for afadin accumulation in the AJ (Fig. 3.7D,E), we wondered whether afadin
reciprocally regulates α-E-catenin or vinculin. Similar to observations in Vcl knockdown, knockout or knockdown of Afdn resulted in increased junctional accumulation of α-catenin, with no observable increase in the α18 epitope, reducing the α18: α-E-catenin fluorescence intensity ratios (Fig. 3.6I; Fig.
3.7F-H). Importantly, loss of Afdn also reduced vinculin accumulation in the junction, highlighting a reciprocal regulatory relationship (Fig. 3.7I,J). Collectively, these data suggest that afadin is a novel regulator of AJ maturation by affecting α -E-catenin conformation and vinculin recruitment.
54 3.2.7 Ctnna1 , Vcl and Afdn knockdown leads to randomized division orientation
The enrichment of pMLC2 and tensile α-E-catenin in the basal endfoot that we observed in vivo —in addition to the aberrant adhesion and actin organization that we observed in vitro in Ctnna1 , Vcl and Afdn mutants—prompted us to investigate whether loss of AJ components alters spindle orientation.
To this end, we utilized Survivin to label late-stage mitotic cells and integrin-β4 to label the basement membrane to assess division orientation in E16.5 fixed back skin sections where AJ components where knocked down using our in utero lentiviral delivery method ( Ctnna1 , Vcl and Afdn ), or conditionally knocked out in the epidermis ( Afdn ) (Fig. 3.9A). We first confirmed the efficacy of knockdown/knockout in vivo using antibodies specific to α-E-catenin, vinculin, and afadin (Fig. 3.8A-C). Each AJ protein was localized to the lateral and apical cortex in WT basal cells, as well as to cell membranes in differentiated suprabasal cells. This staining was strongly reduced in RFP+ regions transduced with each shRNA and eliminated in regions where Afdn was knocked out by either lentiviral-mediated delivery of Cre-RFP or by conditional deletion using Afdn fl/fl ;Krt14 Cre (hereafter referred to as Afdn cKO) (Fig. 3.8A-C).
In each AJ knockdown cohort, we observed a normal bimodal distribution of division angles in
WT littermate and non-transduced RFP- controls in late stage mitotic cells. However, RFP+ cells displayed randomized division orientation (Fig. 3.8D-G), similar to what we observed at anaphase onset
in fixed tissue and live imaging. We further validated this phenotype using Afdn fl/fl embryos 204 , and confirmed that division orientation was randomized whether Afdn was deleted by lentiviral delivery of
Cre-RFP or transgenic expression of Krt14 Cre , and analyzed in either sections or wholemounts (Fig. 3.8H;
Fig. 3.9B,C). Finally, because both afadin and vinculin interact directly with α-E-catenin, we sought to test genetically whether afadin and vinculin operate in the same molecular pathway. To do so, we performed embryonic lentiviral injection of the Vcl 3466 shRNA on an Afdn cKO or Afdn fl/fl background.
Examination of division orientation in single and double mutants revealed that vinculin loss did not exacerbate the Afdn cKO phenotype, suggesting that these proteins do not act additively in the context of division orientation (Fig. 3.8I).
55 3.2.8 Tension-sensitive components of the AJ are essential for telophase correction.
We next sought to address whether the randomized division orientation phenotype observed in AJ
mutants was due to errors in initial spindle positioning or telophase correction. To this end, we performed live imaging of lentiviral-transduced Ctnna1 912 , Vcl 3466 and Afdn 2711 H2B-mRFP1 epidermal explants on a
Krt14 Cre ; Rosa26 mT/mG background. We began with α-E-catenin, because it had previously been shown that Ctnna1 loss leads to randomized division orientation in the developing epidermis 85 . As observed earlier with WT and Gpsm2 1617 cells, many Ctnna1 912 RFP+ basal cells entered anaphase at oblique
orientations, with the apical daughter possessing a basal endfoot extending to the basement membrane
(Fig. 3.10A; Fig. 3.11A; Video 3.10.1). Because of the high efficiency of transduction achieved with the
Ctnna1 lentivirus in these experiments, we utilized WT littermates as controls rather than RFP- cells,
which were rare. We imaged 74 Ctnna1 RFP+ mitotic cells and observed that α-E-catenin loss had no
effect on initial anaphase orientation, which was randomized, akin to WT littermates. However, while WT
cells corrected to a bimodal distribution within 1h of anaphase onset, there was no change in the
distribution of division angles in Ctnna1 RFP+ cells between anaphase onset and 1h later (Fig. 3.10B).
Whether or not apical daughters maintained basal contact, there appeared to be no obvious pattern to the
directionality of telophase reorientation, with a majority of cells showing little or no change over 1h
following anaphase onset (Fig. 3.10C; Fig. 3.11B,F).
Like Ctnna1 912 knockdown cells, Vcl 3466 RFP+ cells frequently entered anaphase at oblique
orientations and showed little movement during telophase (Fig. 3.11C; Video 3.10.2). RFP- cells
corrected to a bimodal distribution, although in these experiments a higher proportion of planar
corrections were observed than in previous studies, perhaps due to the slight differences in their
developmental stage (Fig. 3.10D). Nevertheless, as a population, Vcl 3466 RFP+ cells displayed a randomized distribution of division angles at both anaphase onset and 1h later (Fig. 3.10D). As with
Ctnna1 loss, Vcl knockdown reduced the magnitude of telophase reorientation, and eliminated the
56 predictiveness of basal contacts for correction directionality, causing failure in both perpendicular and planar correction (Fig. 3.10E; Fig. 3.11D,F).
In Drosophila , the afadin homologue Canoe (Cno) is essential for asymmetric cell division of
embryonic neuroblasts 88 . Recent studies in mammals have similarly described a role for afadin in
regulating division orientation in the embryonic kidney and cerebral cortex 87, 189 . In fixed tissue, we knocked down or knocked out Afdn by three different methods, each resulting in randomized division orientation in Survivin+ late-stage mitotic cells (Fig. 3.8G,H; Fig. 3.9). Because the native fluorescence of Cre-RFP is dim and photobleaches rapidly, and live imaging of Afdn knockouts requires a complex breeding scheme involving four alleles, we utilized the Afdn 2711 shRNA for ex vivo imaging experiments
(Fig. 3.10F). As with α-E-catenin and vinculin loss, Afdn knockdown had no effect on initial anaphase
orientation, while oblique divisions failed to undergo either planar or perpendicular-directed telophase
correction (Fig. 3.10G,H; Fig. 3.11E,F; Video 3.10.3). Afdn knockdown phenocopied loss of vinculin and
α-E-catenin, with minimal or randomized reorientation of oblique divisions (Fig. 3.10I). Moreover, while
endfoot contact at anaphase onset was predictive of telophase correction directionality in RFP- cells, this
was not the case in Afdn 2711 RFP+ cells (Fig. 3.10J). Notably, however, while oblique Ctnna1 912 and
Vcl 3466 cells generally retained basal endfoot processes if they were present at anaphase onset, 73% of
oblique Afdn 2711 cells lost contact during telophase, suggesting that afadin may function in endfoot
retention. Collectively, these studies demonstrate that mechanosensitive AJ proteins do not appear to
function in initial spindle positioning, but play important modulatory roles in mediating telophase
correction, which, when disrupted, lead to persistent division orientation errors.
3.2.9 Telophase correction occurs independently of canonical polarity and spindle-orienting cues.
The Drosophila afadin ortholog Cno is essential for early establishment of apical-basal polarity
during cellularization 200, 201 . A similar role has been described for afadin in mammalian development 87,
188, 339 . Furthermore, both Par3 and its Drosophila ortholog Bazooka are required for oriented cell
57 divisions via regulation of LGN localization 102, 127, 340 . Thus, we asked whether Afdn loss impacts expression of the canonical apical polarity cue Par3. In Afdn fl/fl controls, Par3 accumulates at the apical
cortex throughout the cell cycle (Fig. 3.13A). We measured Par3 radial fluorescence intensity at
interphase and determined that Afdn cKO epidermis shows a 15-30% reduction in apical accumulation
(Fig. 3.13A,B). However, this had no effect on the apical positioning of centrosomes (Fig. 3.13C,D),
suggesting that apical-basal polarity remains largely intact in Afdn mutants.
Previous studies have shown that Cno interacts directly with the LGN ortholog Pins and regulates its cortical recruitment 26, 88 . Mammalian afadin and LGN also directly interact in HeLa cells, where they function to promote planar divisions 21 . In addition, E-cadherin is capable of regulating division orientation through a direct interaction with LGN 176, 178 . Finally, Ctnna1 knockout has been reported to perturb LGN localization in epidermal basal cells 85 . These studies suggested that the division orientation defects we observed in Ctnna1 and Afdn mutants could be due to mislocalized LGN.
Using pHH3 to label cells in early mitosis in Afdn fl/fl controls and Afdn cKO mutants, we observed
similar patterns of LGN crescent localization, cortical intensity, and efficiency of apical polarization (Fig.
3.12A-D). In addition, we did not observe any obvious or significant changes to LGN localization in
Afdn 2711 , Ctnna1 912 or Vcl 3466 cells (Fig. 3.12C,D; Fig. 3.13E). Thus, AJ components appear to be dispensable for initial apical positioning of LGN. In Drosophila neuroblasts, genetic epistasis and protein localization studies support the view that Cno/afadin acts downstream of Pins/LGN and upstream of
Mud/NuMA 88 . However, we find that neither NuMA, nor its downstream binding partner dynactin,
appears to be mislocalized in Afdn mutants (Fig. 3.13F-H). In addition, NuMA staining overlapped with
LGN in early mitotic cells, regardless of afadin presence/absence (91% in Afdn fl/fl , n = 22; 93% in Afdn cKO, n = 14). These data suggest that afadin plays little, if any role, in regulating the LGN-NuMA- dynactin pathway during initial spindle positioning.
We previously demonstrated that the mitotic spindle can become misaligned with cortical LGN during metaphase, e.g. following NuMA ( Numa1 ) knockdown 86 . Thus, we sought to examine whether
Afdn loss could also lead to uncoupling of the division axis from LGN polarity cues during mitosis,
58 perhaps independently of NuMA. To test this, we co-stained prefixed E16.5 Afdn fl/fl and Afdn cKO
sections with LGN and α-tubulin in order to visualize spindles during metaphase, and cleavage furrow
ingression later in telophase (Fig. 3.12E). Importantly, while afadin loss altered telophase division
orientation, it had no effect during metaphase, where spindles were randomly-oriented (Fig. 3.14A).
Furthermore, the apical LGN crescent aligned with the metaphase spindle axis—regardless of its
orientation—in both Afdn cKO and control embryos (Fig. 3.12E,F; Fig. 3.14B). By all these metrics,
LGN localization was also unperturbed in Afdn 2711 , Ctnna1 912 , Vcl 2803 and Vcl 3466 knockdowns as well
(Fig. 3.12C-F). However, in telophase cells, while LGN remained apically-positioned in both controls and
Afdn mutants, the orientation of the spindle axis became uncoupled from LGN in Afdn mutants (Fig.
3.12F; Fig. 3.14B,D). Similarly, knockdown of α-E-catenin or vinculin phenocopied afadin loss,
demonstrating that AJ perturbation does not alter LGN localization, but does affect the ability of
telophase cells to reorient in response to apical cues (Fig. 3.12F; Fig. 3.14C,D).
These findings, together with our observation that AJ and LGN mutants differ in their planar
telophase correction phenotypes, suggest that afadin, α-E-catenin and vinculin act independently of LGN
in the context of spindle orientation. As further evidence, we find that while LGN strongly colocalizes
with known binding partners G αi3 and Insc, afadin demonstrates minimal colocalization with LGN either pre- or post-chromosome segregation (Fig. 3.14E). Finally, there are several contexts during epidermal
development where LGN is not required for division orientation. First, although hair placode progenitors
undergo perpendicular asymmetric divisions 341 , LGN is weakly expressed in mitotic placode cells, and is not required for proper division orientation 300, 341 . Second, while LGN loss reduces perpendicular divisions in the interfollicular epidermis at E16.5, LGN is dispensable at E14.5, when the majority of divisions are planar and LGN is rarely cortical 127 . Conversely, Afdn knockdown increases the frequency
of oblique divisions in both contexts, suggesting an LGN-independent function for afadin in both perpendicular and planar divisions (Fig. 3.14F,G). Together, these data suggest that afadin is a minor or
59 transient LGN-interactor in vivo and support a polarity- and LGN-independent role for afadin in telophase correction.
3.2.10 Telophase correction and early mitotic spindle orientation function as parallel pathways
We next sought to test genetically whether the telophase correction pathway can override the initial spindle positioning cues provided by LGN. To address this, we generated afadin and LGN dual loss-of-function embryos by injecting the Gpsm2 1617 lentivirus into either a WT ( Afdn fl/fl ) or Afdn cKO background. While loss of LGN alone recapitulated the previously described phenotype of impaired
stratification 86 , loss of Afdn on an Gpsm2 mutant background partially rescued this differentiation defect
(Fig. 3.12G,H). Fittingly, the predominantly planar division orientation observed in Gpsm2 single mutants became more randomized upon dual loss with Afdn , generating an intermediate phenotype (Fig 3.7I).
These epistasis experiments suggest that telophase correction operates in parallel with, rather than downstream of, the canonical spindle orientation pathway.
Of note, double mutants largely lacked perpendicular (70 °-90 °) divisions, further supporting a specific role for the LGN complex to generate this division type. Taken together, these data suggest that early spindle orientation cues direct imprecise perpendicular divisions in an LGN-dependent manner.
These divisions are then refined into the characteristic bimodal pattern of perpendicular or planar divisions by telophase correction. However, these data also suggest that LGN-directed perpendicular correction is still dependent on the AJ components driving telophase correction.
3.2.11 Telophase correction also occurs during early stratification
The observations that afadin is required for telophase correction at E16.5 (Fig. 3.10F-J), and that
Afdn mutants display division orientation defects at both early and peak stages of stratification (Fig. 3.8G-
I; Fig. 3.14G) prompted us to examine whether telophase correction occurs throughout epidermal
morphogenesis. Thus, we performed live imaging on wild-type Krt14 Cre ; Rosa26 mT/mG epidermal explants
at E14.5, when stratification initiates (Fig. 3.15A). Even though nearly all divisions at E14.5 are planar 85,
60 127 , remarkably, in WT cells at telophase onset, the distribution of observed orientations was randomly-
distributed, similar to what was observed at E16.5 (Fig. 3.15B; compare to Fig. 3.1G). However, while
47% of cells (n=78) entered telophase oriented obliquely, the vast majority of these possessed a basal
endfoot and corrected to planar within 1h of telophase onset (Fig. 3.15C). On the other hand, the few cells
(28%) that did not maintain basal contact corrected randomly at E14.5, in contrast to E16.5, when they
invariably corrected to perpendicular (compare Fig. 3.15C to 3.3B). Since LGN does not localize
cortically or influence division orientation at E14.5 127 , this provides additional evidence that LGN is
necessary for perpendicular telophase correction.
3.2.12 Telophase correction impacts cell fate decisions
At E14.5, Afdn mutants displayed fewer planar and more oblique divisions compared to controls
(Fig. 3.14G), which led us to ask whether afadin loss could promote precocious differentiation. In E14.5
Afdn 2711 mosaic epidermis, we noted that Keratin-10 (K10)—a marker of differentiated cells—was enriched in RFP+ mutant regions compared to RFP- WT regions (Fig. 3.15D). While basal cell density was similar between Afdn 2711 embryos and non-transduced littermates, the density of differentiated cells—
whether assessed by their suprabasal (SB) position or K10 expression—was significantly higher in Afdn
mutants (Fig. 3.15E, Fig. 3.16A). This was unlikely to be caused by hyperproliferation because similar
levels of mitotic cells were observed at both E14.5 and E16.5 in Afdn 2711 RFP+ and WT littermate
controls (Fig. 3.16B). Like afadin, loss of α-E-catenin resulted in a hyperstratified epidermis and
increased suprabasal cell density (Fig. 3.15F; Fig. 3.16C). Consistent with previous observations in E18.5
Ctnna1 knockout epidermis 299, 342 , the precocious differentiation observed in these mutants persisted into
later ages (Fig. 3.16D,E). Notably, in contrast to a previous report that late embryonic Ctnna1 epidermis
is hyperproliferative 342 , we do not observe any elevation in mitotic cells in either E14.5 or E16.5 Ctnna1
epidermis (Fig. 3.16F), which is more in agreement with a more recent study that showed a mild increase
in BrdU+ cells but net growth disadvantage of Ctnna1 912 basal cells 299 . Thus, we feel it is more likely that
the precocious differentiation observed in Ctnna1 912 mutants is due to persistent oblique divisions caused
61 by errors in telophase correction, rather than to hyperproliferation. Collectively, these data suggest that telophase correction influences differentiation throughout epidermal development.
While the previous experiments demonstrated that AJ loss alters both division orientation and promotes differentiation, they do not address whether telophase correction errors directly impact cell fate
choices. To explore whether afadin loss alters fate decisions, we performed short term (72 hour) lineage
tracing experiments using Krt14 CreER ; Rosa26 Confetti reporter mice in combination with Afdn 2711 knockdown and examined the number of progenitor (basal) and differentiated (SB, K10+) progeny within resultant clones (Fig. 3.15G). The lentiviral shRNA strategy was chosen to target Afdn because the alternative—
Krt14 CreER -mediated deletion of the Afdn fl allele—would result in Afdn deletion occurring simultaneous
with, rather than prior to, clonal induction. Moreover, in contrast to lentiviral-delivered Afdn 2711 , Krt14 Cre -
mediated deletion of Afdn did not cause obvious differentiation defects (compare Fig. 3.12H to Fig.
3.16E), likely because Afdn deletion occurs later with Krt14 Cre 299 .
We administered a single dose of tamoxifen at E14.5 by oral gavage, then harvested embryos at
E17.5, when we analyzed clones obtained from Afdn 2711 RFP+ and uninjected (WT) littermates. In
agreement with our mitotic index measurements, knockdown of Afdn did not alter the distribution of
clone sizes (Fig. 3.16G). However, Afdn 2711 clones frequently displayed a greater proportion of suprabasal
cells per clone when compared to uninjected littermates (Fig. 3.15H; Fig. 3.16H). We utilized clonal
density arrays (CDAs) to display clone size distributions, such that basal and SB cells/clone are plotted on
x and y axes, respectively, and darker colors indicate higher frequencies of specific clone types (Byrd et
al., 2019). These data demonstrate that Afdn 2711 contain a higher proportion of SB-rich clones (Fig. 3.15I).
We further characterized clones into four subtypes: 1) balanced (1:1 ratio of basal:SB cells), 2) basal-rich (basal:SB ratio>1), 3) SB-rich (basal:SB ratio<1), and delamination (basal cells=0).
Delamination is an alternative differentiation mechanism to asymmetric cell division, whereby a basal cell detaches from the underlying basement membrane and initiates differentiation without dividing. We previously showed through lineage tracing that delamination drives the initial phase of stratification, while asymmetric cell divisions predominate during peak stratification 127 . While we did not observe clear
62 delamination events in our 3-6 hour live imaging experiments, genetic lineage tracing revealed that a
similar and significant fraction of clones in both WT and Afdn 2711 epidermis (48% vs 40%) arose from delamination (Fig. 3.16I). A comparison of the mitotic clone distribution between WT and Afdn 2711 clones revealed that Afdn 2711 epidermis contains a much greater number of SB-rich clones (24% vs 2% in WT), at the expense of the basal-rich (29% vs 41%) subtype (Fig. 3.16I). Since delamination events slightly decrease in Afdn mutants compared to WT controls, this further suggests that the excess differentiation observed in Afdn mutants is attributable to an increase in asymmetric cell divisions rather than
compensatory delamination.
We conclude that the excess oblique divisions observed in Afdn mutants, which fail to be
corrected during telophase—impacts cell fate decisions, favoring differentiation over self-renewal. This further implies that a high proportion of oblique divisions are operationally asymmetric. In conclusion, we provide several lines of evidence that telophase correction contributes to establishing proper epidermal
architecture: 1) the tensile AJ components afadin, α-E-catenin and vinculin fail to correct during
telophase, leading to a persistent excess of oblique divisions, 2) AJ mutants which fail at telophase
correction induce excess stratification, and 3) the failure of oblique divisions to correct to planar during telophase leads to a bias toward differentiation over self-renewal.
3.4 Discussion
3.4.1 A two-step mechanism for division axis determination
These studies shed new light on the mechanisms governing oriented cell divisions in the developing epidermis and identify telophase correction as an important contributor to balancing symmetric and asymmetric divisions throughout stratification. While previous studies have demonstrated essential roles for canonical spindle orientation genes in division orientation, we now show that initial spindle positioning is only one part of the process (Fig. 3.17). Our data suggest that LGN and associated proteins operate early in mitosis to promote perpendicular divisions, but do so with a high degree of imprecision, resulting in a wide distribution of anaphase division angles. While this function of LGN is
63 required for perpendicular divisions to occur, this fails to explain the bimodal distribution of division
angles observed in telophase. In the second phase of our model, telophase cells undergo dynamic
reorientation towards a planar or perpendicular orientation, where the direction of correction is dependent
on contact with the basement membrane via a basal endfoot. We further demonstrate that LGN is also
required for this second phase of spindle orientation, as its maintenance at the apical cortex promotes perpendicular-directed telophase correction. Moreover, the fidelity of telophase correction relies on the
actin-scaffolding α-E-catenin/vinculin/afadin pathway, highlighting a role for cell adhesion and
cytoskeletal dynamics in division orientation. In this way, our findings now provide a mechanistic
explanation for the randomized division orientation observed in Ctnna1 mutants more than a decade ago
85 . Importantly, while our data support a model wherein vinculin regulates dynamic assembly of AJs, we cannot exclude the possibility that vinculin may play similar roles in cell-matrix integrin adhesions, which may also impact telophase correction.
3.4.2 Corrective mechanisms in oriented cell divisions
Our findings contribute to a growing number of corrective mechanisms which can counterbalance stem cell division orientation errors in order to preserve tissue homeostasis. In Drosophila neuroblasts, the “telophase rescue” pathway—mediated by the scaffolding protein Dlg and motor protein Khc73—can compensate for errors in spindle orientation by relocalizing fate determinants, thus preserving normal daughter cell fates 112, 343, 344 . However, telophase rescue differs from the telophase correction we report here in that division orientation errors are not corrected in telophase, but rather, the fate determinants themselves are repositioned relative to the new division axis. In the developing epidermis, it has been shown that Insc overexpression can promote apical LGN localization and drive an increase of perpendicular divisions 86, 133 , but that under some circumstances, NuMA can redistribute laterally, perhaps in an effort to prevent the hyper-differentiation that would be driven by excessive asymmetric
64 divisions 133 . Our data here, where afadin, α-E-catenin, and vinculin can override the perpendicular- correcting cue provided by LGN, provide a potential molecular explanation for this plasticity.
Other examples of dynamic oriented cell divisions include cyst stem cells of the Drosophila
testis, which display randomized spindle angles until anaphase, at which point one centrosome becomes
anchored at the interface with the niche-defining hub cell, driving division away from the niche 345 . In addition, dividing cells within the monolayered Drosophila follicular epidermis partially extrude during mitosis and frequently demonstrate oblique division angles, which are corrected by reinsertion into the epithelium in an adhesion-dependent manner 346 . A more extreme example of this extrusion/reinsertion
model has been observed in intestinal organoids, where mitotic intestinal stem cells migrate to the luminal
surface and undergo planar divisions before reinserting into the epithelium on either side of a Paneth cell
142 . Furthermore, genetic alterations in MDCK cells—specifically, Gpsm2 knockdown or Par1b
overexpression—can drive out-of-plane divisions which are capable of correcting during anaphase via an apical actomyosin compressive force 347, 348 . Taken together, these studies and ours suggest that many of
these corrective mechanisms rely on polarity, cell-adhesion, and actin dynamics.
3.4.3 Insights into epidermal cell fate specification
In the Drosophila neuroblast, the orientation of cell division is directly linked to cell fates via the
asymmetric inheritance of transcription factors and other fate determinants which promote differentiation
in one daughter cell and preserve stemness in the other 301, 349 . While no such fate determinant has been
identified in epidermal progenitors, our results add to a growing body of evidence that division orientation
and cell fates are tightly linked. While previous studies have used short-term lineage tracing to correlate patterns of division orientation with fate choices 127, 133 , the lineage tracing experiments performed in this
study are the first to demonstrate that perturbations to division orientation lead to altered cell fate
outcomes.
Importantly, given the timing of telophase correction, our observations also shed new light on the
timing and speculative mechanisms of cell fate commitment during mitosis. In the normal developing
65 epidermis, a large proportion of mitoses (30-40%) progress to anaphase at oblique orientations. While
telophase reorientation normally sorts these indeterminate divisions into symmetric or asymmetric
outcomes, the evidence from loss-of-function experiments in Ctnna1 and Afdn mutants—resulting in a
hyper-stratified epidermis and lineages biased toward differentiation—suggests that a significant portion
of oblique divisions are operationally asymmetric, likely resulting in differentiation of the obliquely- positioned daughter cell. Furthermore, these data suggest that retention of basement membrane contact is a potentially potent driver of basal progenitor identity. Taken together, our results indicate that while the early presence of LGN in pro/metaphase may bias cells towards adopting an asymmetric outcome, the finality of this decision is not determined until telophase reorientation mechanisms push or pull cells into the suprabasal or basal layers, respectively. Telophase correction thus provides a potential source of plasticity in the fate choices made by epidermal basal cells. It is tempting to speculate that AJ components in mitotic cells function as a mechanosensor that transduces information about the local cellular environment that favors planar correction when tension is high and perpendicular correction when tension is low.
3.5 Acknowledgements
We thank members of the Williams and Peifer Labs for their critical feedback. We thank Dr.
Danelle Devenport (Princeton) for graciously sharing her live imaging protocol. We thank Dr. Akira
Nagafuchi (Nara Medical University) for sharing the α18 antibody. We thank Dr. Brent Hoffman and
Evan Gates (Duke University) for their effort and feedback regarding E-cadherin mediated junctional
tension. We thank Dr. Keith Burridge (UNC) for sharing the vinculin (Rb) polyclonal antibody. We thank
Kendra Niederkorn for design input into the model in Figure 9. KJL was supported by an NIH Ruth L.
Kirschstein Predoctoral National Research Service Award (F31 DE026956). KMB is supported by an
NIH/NIDCR K08 Mentored Clinical Scientist Research Career Development Award (DE026537). SW was supported by a Sidney Kimmel Scholar Award (SKF-15-165).
66 3.6 Materials and Methods
Animals. Mice were housed in an AAALAC-accredited (#329; June 2017), USDA registered (55-R-
0004), NIH welfare-assured (D16-00256 (A3410-01)) animal facility. All procedures were performed under IACUC-approved animal protocols (16-162). For live imaging experiments we utilized either: 1) mT/mG ( Gt(ROSA)26Sor tm4(ACTB-tdTomato,-EGFP)Luo/J ; Jackson Labs #007576 via Liqun Luo, Stanford
University) homozygous females with at least one copy of the Krt14 Cre allele 292 (crossed to males of the identical genotype), or 2) Krt14 H2B-GFP 350 and Rosa26 mT/mG heterozygous females (crossed to identical males). For lineage tracing experiments (see below for additional details) we crossed Krt14 CreER ;
Rosa26 Confetti females to identical males (Tg(KRT14-cre/ERT)20Efu; Jackson Labs
#005107/Gt(ROSA)26Sor tm1(CAG-Brainbow2.1)Cle ; Jackson Labs #013731). For fixed sample imaging, wild-
type CD1 mice (Charles River; #022) were utilized. Afdn fl/fl animals 204 were maintained on a mixed
C57B6/J CD1 background and either bred to the same Krt14-Cre allele or injected with lentiviral Cre-
mRFP1 (see below). The procedure for producing, concentrating and injecting lentivirus into amniotic
fluid of E9.5 embryos has been previously described and is briefly detailed below 299 .
Live Imaging. The live imaging protocol used in this study was adapted from the technique recently
described by the Devenport lab 326 . A 1% agar solution/media solution containing F-media (3:1
DMEM:F12 + 10% FBS + 1% Sodium bicarbonate + 1% Sodium Pyruvate + 1% Pen/Strep/L-glut mix),
was cooled and cut into 35mm discs. Epidermal samples measuring ~4-6mm along the AP axis and ~2-
3mm along the medial-lateral axis were extracted from the mid-back of E16.5 mT/mG embryos. These
explants were placed dermal-side down onto the gel/media disc, then sandwiched between the gas- permeable membrane of a 35mm lumox culture dish (Sardstedt; 94.6077.331). Confocal imaging was performed utilizing a Zeiss LSM 710 Spectral confocal laser scanning microscope equipped with a
40X/1.3 NA Oil Plan Neo objective. Images were acquired with 5 minute intervals and a Z-series with 0.5
µm step-size (total depth ranging from 20-30 microns) for 3-9 hours. Explants were cultured at 37 °C with
5.0% CO 2 for >1.5 hours prior to- and throughout the course of imaging. Divisions occurring close to the
67 tissue edge or showing any signs of disorganization/damage were avoided to exclude morphological
changes associated with wound-repair. 4D image sets were deconvolved using AutoQuant X3 and processed using ImageJ (Fiji).
Lentiviral Injections. For full protocol, please see Beronja, et al. (ref. 24). This protocol is approved via
IACUC #16-162/19-155. Pregnant CD1 , mTmG/Krt14-Cre , or Afdn fl/fl females were anesthetized and the
uterine horn pulled into a PBS filled dish to expose the E9.5 embryos. Embryos and custom glass needles
were visualized by ultrasound (Vevo 2100) to guide microinjection of ~0.7 µl of concentrated lentivirus
into the amniotic space. Three to ten embryos were injected depending on viability and litter size.
Following injection, the uterine horn(s) were reinserted into the mother’s thoracic cavity, which was
sutured closed. The incision in the skin was resealed with surgical staples and the mother provided
subcutaneous analgesics (5 mg/kg meloxicam and 1-4 mg/kg bupivacaine). Once awake and freely
moving, the mother was returned to its housing facility for 5-7 days, at which point E14.5-16.5 embryos
were harvested and processed accordingly.
Lineage Tracing. Krt14 CreER ; Rosa26 Confetti females were mated to males with the identical genotype. At
E9.5, ~half of the viable embryos were injected with Afdn 2711 H2B-mRFP1 high titer lentivirus (see above for detailed surgical procedure). Activation of the Krt14 CreER allele was initiated by tamoxifen (dosed at
100 µg per gram dam mass) delivered by oral gavage at E14.5, five days following lentiviral injection).
Females were monitored for 24 hours following tamoxifen dosing for signs of abortion or distress.
Embryos were harvested at E17.5 (~72 hours after tamoxifen delivery) and backskins were embedded in
OCT and sectioned sagittally (8 µm thick sections). Slides were stained with Abcam Chicken αGFP polyclonal antibody (Abcam ab13970) which enhanced the membrane-CFP, nuclear-GFP, and
cytoplasmic-YFP fluorophores of the Confetti allele. Images were acquired for every labeled clone using
a 40x/1.15NA objective with a 1.5X digital zoom. Sparse clones (<1% total cells) were evaluated for both
68 the number of basal and suprabasal cells (distinguished by staining with αKrt10 antibody; Figure 8I).
Clones with only suprabasal cells in the stratum spinosum or first stratum granulosum (SG3) layer were
assumed to be delamination events – those above SG3 were excluded. Suprabasal (SB) to basal cell ratios
were quantified for each clone by dividing the # of SB cells by the # of basal cells. Clones with a ratio >1
were binned as “SB-rich” while clones with a ratio <1 were binned as “basal-rich” – clones with an equal
number (ratio = 1) were binned as “balanced.”
Constructs and RNAi. For afadin and vinculin RNAi targeting, we tested ~10 shRNAs for knockdown
efficiency in primary keratinocytes. These sequences were selected from The RNAi Consortium (TRC)
Mission shRNA library (Sigma) versions 1.0, 1.5, and 2.0 and cloned using complementary annealed
oligonucleotides with AgeI/EcoRI linkers. For LGN and α-catenin, we utilized an shRNA that had been previously validated with our lentiviral injection technique 86, 299 . shRNA clones are identified by the gene name with the nucleotide base (NCBI Accession number) where the 21-nucleotide target sequence begins in superscript (e.g. Afdn 2711 ). Lentivirus was packaged in 293FT or TN cells using the pMD2.G and psPAX2 helper plasmids (Addgene plasmids #12259 and #12260, respectively). For knockdown screening, primary keratinocytes were seeded at a density of ~150,000 cells per well into 6-well plates
and grown to ~80% confluency in E-Low calcium medium and infected with a MOI of ~1.
Approximately 48 h post-infection, keratinocytes were treated with puromycin (2 µg/mL) to generate
stable cell lines. After 3-4 days of puromycin selection, cells were lysed and RNA isolated using the
RNeasy Mini Kit (Qiagen). cDNA was generated and amplified from 10-200 µg total RNA using either
Superscript VILO (Invitrogen) or iScript (Bio-Rad). mRNA knockdown was determined by RT-qPCR
(Applied Biosystems 7500 Fast RT-PCR) using 2 independent primer sets for each transcript with Hprt1 and cyclophilin B ( Ppib2 ) as reference genes and cDNA from stable cell lines expressing Scramble shRNA as a reference control. Primer efficiencies were determined using dose-response curves and required to be >1.8, with relative transcript abundance determined by the ∆∆ CT method. RT-qPCR runs
69 were performed in triplicate with the mean knockdown efficiency determined by calculating the
geometric mean of the ∆∆ CT values for at least two independent technical replicates. The following primer sequences were used: Afdn (fwd-1: 5’- ACGCCATTCCTGCCAAGAAG -3’, rev-1: 5’-
GCAAAGTCTGCGGTATCGGTAGTA -3’; fwd-2: 5’- GGGGATGACAGGCTGATGAAA -3’, rev-2:
5’- CGATGCCGCTCAAGTTGGTA -3’), Vcl (fwd-1: 5’- TACCAAGCGGGCACTTATTCAGT -3’, rev-1: 5’- TTGGTCCGGCCCAGCATA -3’; fwd-2: 5’- AAGGCTGTGGCTGGAAACATCT -3’, rev-2:
5’- GGCGGCCATCATCATTGG -3’). The following shRNA targeting sequences were used: Afdn 2711
(5’- CCTGATGACATTCCAAATATA -3’), Vcl 3466 (5’- CCCTGTACTTTCAGTTACTAT -3’), Vcl 2803
(5’- CCACGATGAAGCTCGGAAATG -3’), Ctnna1 912 (5’-CGCTCTCAACAACTTTGATAA -3’),
Gpsm2 1617 (5’- GCCGAATTGGAACAGTGAAAT -3’), Scramble (5’-
CAACAAGATGAAGAGCACCAA-3’).
Antibodies, immunohistochemistry, and fixed imaging. E14.5 embryos were mounted whole in OCT
(Tissue Tek) and frozen fresh at -20 °C. E16.5 embryos were skinned and flat-mounted on Whatman paper. In both cases, infected and uninfected littermate controls were mounted in the same blocks to allow for direct comparisons on the same slide. For α-tubulin staining of metaphase spindles, samples were kept warm and pre-fixed with room-temperature 4% paraformaldehyde for 10 minutes before OCT embedding. Frozen samples were sectioned (8 µm thick) on a Leica CM1950 cryostat, mounted on
SuperFrost Plus slides (ThermoFisher) and stored at -80 °C. For staining, sections were thawed at 37 °C for
5-15 min, fixed for 5 min with 4% paraformaldehyde, washed with PBS and blocked for 1h with gelatin block (5% NDS, 3% BSA, 8% cold-water fish gelatin, 0.05% Triton X-100 in PBS). Primary antibodies were diluted in gelatin block and incubated overnight in a humidity chamber at 4 °C. Slides were then washed with PBS and incubated with secondary antibodies diluted in gelatin block at room temperature
(~25 °C) for 2 hours, counterstained with DAPI (1:2000) for 5 minutes and mounted in ProLong Gold
(Invitrogen). Actin was visualized by phalloidin-AF647 staining (Life Technologies; 1:500)
70 simultaneously with secondary antibody incubation. Images were acquired using LAS AF software on a
Leica TCS SPE-II 4 laser confocal system on a DM5500 microscope with ACS Apochromat 20x/0.60
multi-immersion, ACS Apochromat 40x/1.15 oil, or ACS Apochromat 63x/1.30 oil objectives.
The following primary antibodies were used: survivin (rabbit, Cell Signaling 2808S, 1:500), LGN
86 (guinea pig, 1:500), LGN (rabbit, Millipore ABT174, 1:2000), phospho-histone H3 (rat, Abcam
ab10543, 1:1,000), mCherry (rat, Life Technologies M11217, 1:1000-3000), β4-integrin (rat,
ThermoFisher 553745, 1:1,000), G αi3 (rabbit, EMD Millipore 371726, 1:500), GFP (chicken, Abcam
ab13970, 1:1,000), dynactin (goat, Abcam ab11806, 1:500), NuMA (mouse IgM, BD Transduction Labs
610562, 1:300), α-tubulin (rat, EMD Millipore CBL270, 1:500), pericentrin (rabbit, Covance PRB-432C,
1:500), Par3 (rabbit, EMD Millipore 07-330, 1:500), E-cadherin (rat, Life Technologies 131900, 1:1,000),
E-cadherin (goat, R&D System AF748, 1:1,000), α-E-catenin (rabbit, Invitrogen 71-1200, 1:300) α18
(rat, generous gift of Dr. Nagafuchi at Nara Medical University, 1:10,000), vinculin (mouse IgG, Sigma
V9131, 1:500), vinculin (rabbit, generous gift of Dr. Keith Burridge at University of North Carolina,
1:1000), afadin (rabbit, Sigma A0224, 1:500), pMLC2 (Ser19) (mouse IgG, Cell Signaling 3675S,
1:1000). Actin labeling achieved via Phalloidin-AF647 (Life Technologies A22287, 1:500) in secondary antibodies
The following secondary antibodies were used (all antibodies produced in donkey): anti-rabbit
AlexaFluor 488 (Life Technologies, 1:1000), anti-rabbit Rhodamine Red-X (Jackson Labs, 1:500), anti- rabbit Cy5 (Jackson Labs, 1:400), anti-rat AlexaFluor 488 (Life Technologies, 1:1000), anti-rat
Rhodamine Red-X (Jackson Labs, 1:500), anti-rat Cy5 (Jackson Labs, 1:400), anti-guinea pig AlexaFluor
488 (Life Technologies, 1:1000), anti-guinea pig Rhodamine Red-X (Jackson Labs, 1:500), anti-guinea pig Cy5 (Jackson Labs, 1:400), anti-goat AlexaFluor 488 (Life Technologies, 1:1000), anti-goat Cy5
(Jackson Labs, 1:400), anti-mouse IgG AlexaFluor 488 (Life Technologies, 1:1000), anti-mouse IgG Cy5
(Jackson Labs, 1:400), anti-mouse IgM Cy3 (Jackson Labs, 1:500).
71 Keratinocyte culture and Calcium-shift assays. Primary mouse keratinocytes were maintained in E
medium with 15% chelated FBS and 50 µM CaCl 2 (E low medium). For viral infection, keratinocytes
were plated at ~150,000 cells per well in a 6-well plate and incubated with lentivirus in the presence of polybrene (1 µg/mL) and centrifuged at 1,100 x g for 30 min at 37 °C. All shRNA cell lines were derived from the same wild-type lineage (primary CD1 mouse keratinocytes isolated from P3 backskins). Stable cell lines were generated/maintained by adding puromycin (2 µg/mL) 48 h after infection and continual antibiotic treatment following. The Afdn fl/fl and Afdn fl/fl ; Krt14 Cre (Afdn -cKO) keratinocyte lines were
isolated from P3 littermates and used at low passage ( L-lysine, collagen, and fibronectin. Once cells reached ~85% confluency (~12-16 hours) cells were switch to high Ca 2+ (1.5mM) medium and grown for the indicated period of time (30 min to 8 hours). Cells were fixed with 4% paraformaldehyde in PBS warmed to room-temperature. Immunostaining was performed using the same protocol as for tissue sections (see above). 3T3 fibroblasts and HEK-293 cells – both of which are included on the International Cell Line Authentication Committee’s register of misidentified cell lines (version 9) were specifically used in primary keratinocyte isolation and lentiviral production, respectively. Neither cell line was utilized in any experimental procedures. Measurements, quantification, graphing, and statistics. Spindle and Division Orientation. Mitotic cells in metaphase were identified based on nuclear morphology. Metaphase spindle orientation was measured as the angle between a vector orthogonal to the metaphase plate and parallel to the basement membrane. Anaphase cells were identified by both nuclear condensation and widely distributed surviving staining between daughter cells. Telophase cells were 72 distinguished due to reduced nuclear condensation and dual-punctate Survivin staining. Division orientation was measured as the angle between a vector connecting the center of each daughter nucleus and a vector running parallel to the basement membrane. The same methodology was used to measure division orientation in live imaging experiments. In cases lacking nuclear labeling, the position of the nuclei was inferred based on cell volume/shape changes. Telophase correction ( θ-φ) was quantified as the difference between division orientation at anaphase onset ( φ) and division orientation 1 h later ( θ). The presence of basal contact for the more apical daughter was determined by analyzing cell morphology in both en face and orthogonal perspectives. Adhesion Assays. Quantification of fluorescence intensity in adhesion assays was performed by orthogonal linescans at three positions along the junction length (~25 th , 50 th , and 75 th quarter). In cases where junctions appeared punctate, discreet puncta were evaluated to avoid measuring regions lacking junction formation. Signal centers were set based on maximum intensity of either E-cadherin or α-E- catenin (where appropriate). To quantify ratios, the geometric mean fluorescent intensities of the 3 values nearest the junction center were used. Quantification of junction continuity was performed by linescans of E-cadherin fluorescence intensity along the entire length of the junction, excluding the vertex of multiple cells (i.e. tricellular junctions). We then calculated % of these intensity measurements above a threshold, which was evaluated for each individual junction using the mean center intensity of three orthogonal scans described earlier in this paragraph. LGN localization/intensity. LGN localization patters (e.g. apical, weak/absent, or other) were determined for cells labeled with pHH3, irrespective of the lentiviral H2B-RFP reporter to avoid bias. Imaging was performed with WT controls and experimental samples on the same slide to avoid variation in antibody staining. Radial localization of LGN was measured by determining the angle between two vectors: one drawn from the LGN signal center to the center of the nucleus, the other drawn parallel to the basement membrane. Crescents oriented at the apical side were given positive values, while those at the basal side were given negative values. Radial variance between LGN signal and spindle or division axis were 73 determined by drawing two vectors: one for the radial orientation of the LGN signal center and a second between either the spindle poles or between the center of the daughter nuclei. Radial fluorescent intensity values were measured by linescans originating at the site of basement membrane contact and tracing the edge of the cell. Each measurement along the length of the scan was then set as a part of whole, operating with the assumption that ~50% of the total length would represent the apical surface. Whole mount fluorescence intensity. Quantification of fluorescence intensity in wholemount imaging of oblique telophase cells (as performed for pMLC2, phalloidin, α18 and α-E-catenin in Figure 3.3) was performed by drawing linescans in the en-face perspective around the entire cortex at a series of focal planes: apical plane of the apical daughter, “endfoot” of the apical daughter, mid-cell of the basal daughter and mid-cell of an interphase basal neighboring cell. For each image, background levels were determined using mean fluorescent intensity for each channel in a neighboring cell nucleus. This background value was subtracted from the mean cortical intensity of the appropriate channel. Fluorescence intensity ratios were quantified using background subtracted mean fluorescence intensities. Cell density and live cell division orientation. Local cell density was calculated by counting the number of neighboring cells and dividing this number by their area. Area was measured in a single z-plane determined to be the cell center by orthogonal slices. Regions where the tissue sloped at an extreme angle were excluded due to inability to capture cell centers for all neighbors. Differentiation/stratification analyses. E14.5 differentiation was quantified by imaging ~10 regions of the backskin in sagittal sections stained with β4 integrin, K10 and H2B-RFP. For each region, the number of basal and suprabasal cells were counted and the length of the region measured by the length of the underlying basement membrane (to account for tissue wrinkling/curvature). To quantify cell density, cell counts were divided by the length of each region in microns. At later stages (E16.5 or E18.5) we quantified K10 thickness by imaging ~10 regions of the backskin in sagittal sections stained with β4 integrin, K10 and H2B-RFP. Using the K10 channel, a thresholded, binary mask was created and filled, then used to measure the area above threshold. This thresholded area was then divided by the length of 74 the underlying basement membrane (measured by β 4 integrin stain). n values for these analyses are representative of the number of regions imaged. Mitotic Index. Mitotic Index was quantified at E14.5 and E16.5 by imaging the entire length of sagittally- sectioned backskin stained for β4 and pHH3. pHH3+ basal cells were counted and the length of the entire backskin was measured by length of the underlying basement membrane. n values are indicative of the number of individual embryos analyzed. All statistical analyses and graphs were generated using GraphPad Prism 8 and Origin 2015 (OriginLab). Error bars represent standard error of the mean (s.e.m.) unless otherwise noted. Statistical tests of significance were determined by Mann-Whitney U-test (non-parametric) or student’s t-test (parametric) depending on whether the data fit a standard distribution (determined by pass/fail of majority of the following: Anderson-Darling, D’Agostino & Pearson, Shapiro-Wilk, and Kolmogorov-Smirnov tests). Cumulative frequency distributions were evaluated for significant differences by Kolmogorov-Smirnov test. 2 tests were utilized to evaluate expected (control) against experimental distributions of categorical values (e.g. LGN apical/absent/other distributions). All box-and-whisker plots are displayed as Tukey plots where the box represents the interquartile range (IQR, 25th-75th percentiles) and the horizontal line represents the median. Whiskers represent 1.5x IQR unless this is greater than the min or max value. Figures were assembled using Adobe Photoshop and Illustrator CC 201 75 3.7 Figures Figure 3.1 Telophase reorientation corrects oblique anaphase orientations (A) Sagittal sections from E16.5 embryos showing mitotic basal cells at indicated stages. Yellow arrows indicate division axis relative to basement membrane (dashed white line). Apical LGN (red) is generally present in oblique and perpendicular divisions, but absent from planar divisions. Survivin (green) is diffusely distributed between daughter pairs at anaphase, transitioning to stereotypic dual-puncta by 76 telophase. (B) Radial histograms of division orientation at metaphase, anaphase, telophase and anaphase+telophase in E16.5 wild-type controls; n indicates number of divisions measured from >20 embryos per mitotic stage. (C) Same data as in (B), plotted as a cumulative frequency distribution. Note sigmoidal pattern at telophase (black, solid line), characteristic of bimodal distribution of division angles. Compare to linear pattern, characteristic of random distributions at metaphase (red) and anaphase (blue). (D) Schematic of experimental design for live imaging of embryonic epidermal explants. Krt14 Cre ; Rosa mT/mG is used to label epidermis with membrane (m)-GFP and other tissues (including dermis) with mTdTomato. Alternatively, Krt14 H2B-GFP is used to label nuclei while Rosa-mT/mG without Cre ubiquitously labels cells with membrane-TdTomato. (E) Z-projection stills from a movie of a Krt14 Cre ; Rosa mT/mG (top) and Krt14 H2B-GFP ; Rosa mT/mG (bottom) mitotic cell as it enters anaphase (defined as t=0), through 60 minutes post-anaphase onset, depicting planar telophase correction. Epidermal-dermal boundary shown by red line. Dividing daughter pairs are outlined with yellow dashed lines. Division orientation angles are shown below ( φ, anaphase onset; θ, +1h). (F) Traces of division orientation at five minute intervals for 15 representative cells from telophase onset to +1 h. (G) Cumulative frequency distribution of division angles from Krt14 Cre ; Rosa mT/mG live imaging experiments of E16.5 embryos at anpahse onset (blue; φ) and +1 hour later (black; θ). n indicates number of divisions from 4 embryos across 4 independent sessions. (H) Data from (G) depicting division orientations at anaphase onset and 1 h later. Connecting lines demonstrate that ~60% oblique anaphase divisions reorient to planar (black lines) while the remaining ~40% correct to perpendicular (grey lines). Scale bars, 5 µm (A), 10 µm (E). ** P < 0.01, *** P < 0.001, by Kolmogorov-Smirnov test. See also Figure 1–figure supplement 1. 77 Figure 3.2 Telophase reorientation corrects oblique anaphase orientations (A) Cumulative frequency histograms of division angles from fixed sagittal sections organized by mouse background strain: CD1 (left), C57 (middle), and 129 (right) all show randomized division orientation at anaphase and metaphase, which shifts to a clear bimodal distribution of planar and perpendicular 78 orientation at telophase. (B-E) Time-course stills from live imaging experiments using ROSA mT/mG (grey) and Krt14 H2B-GFP (red) alleles. Shown are examples of divisions that display planar (B), perpendicular (C), or oblique (D,E) orientations at anaphase onset. While those with planar or perpendicular anaphase division angles persist in their orientation through time, oblique anaphase divisions undergo rapid correction towards either planar (D) or perpendicular (E) orientations. Scale bars, 5 µm. 79 Figure 3.3 LGN mediates perpendicular but not planar telophase correction (A) Schematic of modified experimental protocol of live imaging of epidermal explants (see Figure 1D) incorporating lentiviral shRNA transduction to generate mosaic knockdown tissue. Transduced/knockdown regions are marked with histone H2B-mRFP1 (H2B-RFP). (B) Stills from live imaging of Scramble (top) or Gpsm2 1617 H2B-RFP+ cells (bottom) undergoing planar correction, annotated as in Figure 1E. (C,D) Cumulative frequency distributions of division orientation from (C) Scramble or (D) Gpsm2 1617 H2B-RFP (+/-) live imaging experiments at anaphase onset ( φ) and one hour later ( θ). Scramble RFP+ and Gpsm2 1617 RFP- cells display similar patterns of telophase correction as observed in WT explants (Figure 1G). While Gpsm2 1617 RFP+ cells are more biased toward planar/oblique at anaphase onset, significant planar correction still occurs; n indicates observed divisions from 5 embryos imaged in 4 technical replicates. (E) Data from (C,D) depicting orientation at anaphase onset ( φ) and 1 hour later ( θ) for Scramble RFP+ and Gpsm2 1617 RFP- and RFP+ cells. ~95% of LGN 80 knockdown cells correct to planar (<30) 1h later. Scale bars, 10 µm. * P < 0.05 by Kolmogorov-Smirnov test. 81 Figure 3.4 Maintenance of basal contact correlates with planar-directed telophase correction (A) (top) z-projection stills from a movie of a mitotic cell as it enters anaphase (t=0) through 60 minutes post-anaphase onset, depicting planar telophase correction. Epidermal-dermal boundary shown by red line. Dividing daughter pairs are outlined with yellow dashed lines. Division orientation angles are shown 82 below ( φ, telophase onset; θ, +1 h). (bottom), xz en face views at same timepoints. Yellow and white arrowheads indicate plane of optical section for apical and basal daughters, respectively. In most cases, planar correction is preceded by maintenance of basement membrane contact (open arrowheads), which are most apparent in the en face basal focal plane, where they appear as small membrane circles. (B) Data from Figure 1G,H sorted based on presence or absence of basal contact. Connecting lines demonstrate that oblique-dividing daughters retaining basal contact correct towards a planar orientation, while those losing contact correct towards perpendicular. (C) Data from (B) demonstrating that the degree of correction correlates with initial anaphase orientation. (D) Whole mount imaging of WT E16.5 epidermis stained with phalloidin and phosphorylated myosin-light chain 2 (pMLC2). Orthogonal views (top) of DAPI highlight oblique division orientation. The basal endfoot observed in live imaging of telophase correction (see panel A) can be observed in the basal en face view. Pair-wise measurements (inset graph) of pMLC2 at the cell cortex in the apical plane and basal endfoot of oblique divisions are connected by the gray line. (E) Cartoon representation of tension-sensitive model of AJ assembly. In the absence of tension, α-E-catenin exists in an autoinhibited closed conformation, masking the α18 epitope. In the presence of actin-mediated tension, α-E-catenin opens, exposing the α18 epitope and vinculin binding domain. (F) Whole mount images prepared as in (D) stained with total α-E-catenin and open conformation-specific α18 antibody. Pair-wise measurements (inset graph) of α18 at the cell cortex in the apical plane and basal endfoot of oblique daughter cells are connected by the gray line demonstrates increased open or ‘tensile’ α-E-catenin in the basal endfoot. (G) Quantification of α18: α -E-catenin fluorescence intensity ratio in variable division types or stages of mitosis. Anisotropy is greatest in oblique divisions between the basal endfoot and apical cortex of the oblique daughter cell. Scale bars, 10 µm (A,D,F). P values determined by Wilcoxon test (D,F). * P < 0.05, ** P < 0.01. See also Figure 3– figure supplement 1. 83 ABCBasal contact maintained 1617 Basal contact lost Scramble RFP(+) Basal Contact LGN RFP(+) Basal Contact Scramble No contact RFP(+) No Contact RFP(-) Basal Contact 100 60 60 RFP(-) No Contact ep Planar Perp. ep Planar Perp. 75 30 30 50 0 0 radial degrees) 25 radial degrees) -30 -30 n = 20 = n % of divisions% of n = 15 = n 3 = n n = 22 = n 40 = n 33 = n n = 37 = n 15 = n 12 = n θ−φ; ( 0 θ−φ; ( Telophase reorientation Telophase -60 reorientation Telophase -60 WT WT WT 0 30 60 90 0 30 60 90 RFP(-) RFP(-) RFP(-) RFP(+) RFP(+) RFP(+) Orientation at anaphase onset ( φ) Orientation at anaphase onset ( φ) planar oblique perp DE n.s. * n.s. ** 100 1.0 40 1.5 80 0.8 30 1.0 60 0.6 20 -E-catenin 40 0.4 α 0.5 18: α -E-catenin fluor. 10 Phalloidin fluor. intensity (A.U.) intensity (A.U.) 20 0.2 intensity ratio fluor. α pMLC2:phalloidin fluor. intensity ratiofluor. 0 0.0 0 0.0 Basal Apical Basal Apical Basal Apical Basal Apical endfoot cortex endfoot cortex endfoot cortex endfoot cortex Figure 3.5 A basal endfoot mediates planar telophase correction (A) On the x-axis, divisions are grouped by orientation at anaphase onset ( φ, planar = 0-30°; oblique = 30- 60°; perpendicular = 60-90°) and Gpsm2 1617 status. The y-axis depicts the proportion of divisions that lack (white), maintain (black/red), or lose (grey/pink) basal contact in the following hour. ~95% of planar divisions initiate and maintain basal contact; oblique divisions make and initiate contact less frequently (~75% of the time); while perpendicular divisions almost never make contact. LGN knockdown (red bars) does not alter this behavior. (B-C) Radial anaphase correction ( θ-φ) plotted versus initial anaphase orientation. Cells where apical daughter basal contacts were detected are shown as black/red circles, while those lacking basal contacts are shown in grey/pink. In WT controls (left) basal contact correlates with planar reorientation, while lack of contact results in perpendicular reorientation. (B) Telophase correction (θ-φ) in Scramble RFP+ cells (middle panel), grouped by basal contact status. Like WT cells, Scramble RFP+ cells undergo telophase reorientation in a basal contact-dependent manner. (C) Both Gpsm2 1617 RFP+ (right panel; red) and WT RFP- cells (black) with basal contacts correct to planar, demonstrating that LGN is not required for this behavior. LGN knockdown cells only rarely (n=3) lack basement membrane contact, so this group is not shown. (D) Pair-wise measurements of phalloidin fluorescence 84 intensity and pMLC2:phalloidin fluorescence intensity ratio at the cell cortex in the apical plane and basal endfoot of oblique daughter cells are connected by the gray line. (E) Pair-wise measurements of α-E- catenin fluorescence intensity and α18: α -E-catenin fluorescence intensity ratio at the cell cortex in the apical plane and basal endfoot of oblique daughter cells are connected by the gray line. * P < 0.05, determined by Wilcoxon test (D,E). 85 Figure 3.6 Vinculin and afadin regulate ααα-E-catenin conformation and AJ linkage to the actin cytoskeleton (A) Stable primary murine keratinocytes cell lines grown in the presence of high (1.5 mM) Ca 2+ for 8h form nascent cell-cell adhesions, stained for total α-E-catenin (green); open, “tensile” α-E-catenin ( α18, red); and vinculin (grey). Single junction magnifications (yellow dashed region) shown below, demonstrate that Vcl knockdown results in a reduced α18: α -E-catenin ratio, quantified in (B,C). (B) Fluorescence intensity quantification of junctional vinculin in Scramble and Ctnna1 knockdown keratinocytes. Loss of Ctnna1 reduces vinculin accumulation in nascent AJs. (C) Quantification of α18: α -E-catenin fluorescence intensity ratio in Scramble and two independent Vcl shRNA cell lines. Vcl knockdown reduces the proportion of α-E-catenin in the open conformation. (D) Primary mouse keratinocytes after 8h Ca 2+ shift—labeled with phalloidin (red) and E-cad (green)—which accumulate in linear bands at cell-cell junctions in Scramble control cells. Yellow boxed region shown at high 86 magnification below; n indicates junctions evaluated. Vcl and Ctnna1 knockdown cells show defects in linear actin accumulation and immature “zipper” junctional morphology. (E) Junction continuity quantification based on % of junction length above threshold for E-cad (see Methods). Loss of Vcl or Ctnna1 reduces junction continuity. (F) Afdn fl/fl primary keratinocytes mosaically infected with Cre-RFP (red) after 8h 1.5 mM Ca 2+ shift, stained for E-cad (green), afadin (red), and phalloidin (grey). Junctions between two uninfected cells (WT:WT) show linear morphology with consistent E-cad (green), afadin (red) and phalloidin (grey) labeling. In contrast, junctions between two infected cells are punctate, with less junction-associated phalloidin. (G) Quantification of E-cad continuity along junction length, as in Figure 4E. (H) Quantification of fluorescence intensity of actin (phalloidin) measured by orthogonal linescans. Phalloidin is decentralized in KO:KO junctions (red) compared to WT:WT (black; n indicates junctions evaluated. ( I) Quantification of α18: α -E-catenin fluorescence intensity ratios from homogenous Afdn fl/fl , Afdn -cKO, Scramble, and Afdn 2711 primary keratinocytes stained as in (A); n indicates junctions analyzed. Scale bars, 20 µm or 5 µm (junctional insets). P values determined by student’s unpaired t-test; *** P < 0.001. See also Figure 4–figure supplement 1. 87 A BC 30 minutes 8 hours 150 *** 125 WT WT 100 125 100 E-cad 100 E-cad 75 75 75 50 18 fluor. 50 50 Afadin Afadin α 25 E-catenin fluor. 25 intensity(A.U.) n = n23 = n20 = n20 intensity (A.U.) n = n = 23 n = 20 n = 20 0 α− 0 25 Ecadcontinuity 3466 2803 3466 2803 above (% threshold) Phalloidin Vcl Vcl Vcl Vcl 0 Phalloidin 30 min 8 h Scramble Scramble *** D E *** *** Scramble Ctnna1 912 Vcl 3466 0.75 Phalloidin 0.50 0.25 Afadin n =n 20 =n 20 =n 21 =n 22 Afadin Ratio: Afadin Ecad 0 E-cad 912 3466l 2803l c rambleVc V c tnna1 S C F G I Scramble Afdn 2711 *** 2.0 100 *** 1.5 Vinculin -cat α 18 50 1.0 α 18 fluor. α 0.5 -cat Vinculin: α intensity (A.U.) n= 18 n= 18 n= 23 n= 18 flour. intensity flour. ratio 0 0.0 n18 = n18 = n23 = n18 = fl/fl cKO Scr Afdn 2711 fl/fl cKO Scr Afdn 2711 Afdn fl/fl Afdn cKO H J 100 125 *** 100 *** Vinculin 75 18 α 50 50 -cat Vinculinfluor. 25 intensity(A.U.) α -E-catenin fluor. intensity (A.U.) n= 18 n= 18 n= 23 n= 18 =n 18 =n 18 =n 23 =n 18 α 0 0 fl/fl cKO Scr Afdn 2711 fl/fl cKO Scr Afdn 2711 Figure 3.7 The ααα-E-catenin/vinculin/afadin complex demonstrates reciprocal regulation to form mature adherens junctions in vitro (A) Quantification of α18 (left) and α-E-catenin (right) fluorescence intensity in 8h Ca 2+ -shift assays in Scramble and Vcl shRNA expressing primary keratinocytes. (B) Time-course of junction formation in WT primary keratinocytes 30 min (left) and 8h (right) after the addition of 1.5 mM Ca 2+ , stained for E- cad (green), afadin (red), and phalloidin (grey). Between early and late timepoints, junctions transform from punctate to linear and actin becomes tightly associated with the junction. (C) Quantification of E-cad continuity along junction length in WT primary keratinocytes at 30 min and 8 h timepoints. (D) Primary mouse keratinocytes after 8h Ca 2+ shift—labeled with afadin (red), E-cadherin (green) and actin 88 (phalloidin, grey)—which accumulate in linear bands at cell-cell junctions in Scramble control cells. Yellow boxed region shown at high magnification to the right; n indicates junctions evaluated. Vcl and Ctnna1 knockdown cells show defects in linear actin accumulation as well as afadin recruitment to AJs, quantified in (E). (F) Scramble, Afdn 2711 , Afdn fl/f , and Afdn-cKO keratinocytes after 8h Ca 2+ shift and stained for α18 (red), α-E-catenin (green), and vinculin (grey). (G-H) fluorescence intensity quantification of α18 (G) and α-E-catenin (H) in 8h calcium-shifted Afdn mutant cell lines; n indicates junctions analyzed. ( I) Quantification of vinculin:total α-E-catenin fluorescence intensity ratios and (J) raw vinculin fluorescence intensity in 8h Ca 2+ -shifted Afdn mutant cell lines; n indicates junctions analyzed. Scale bars, 20 µm. P values determined by student’s unpaired t-test. *** P < 0.001. 89 AB C WT WT Afadin 2711 Afdn fl/fl E-cad 4 β RFP/E-cad RFP/ Afadin H2B-RFP Afadin Ctnna1 912 Vcl 3466 Afdn fl/fl +Cre-RFP Afdn- cKO E-cad Vinculin -catenin RFP/β4 α Afadin Afadin DEFVcl 2803 RFP(+) (n=40) Vcl 3466 RFP(+) (n=47) 912 Ctnna1 (n=78) 2803 Vcl 3466 ** Vcl RFP(-) (n=25) * RFP(-) (n=39) * WT littermates (n=74) * WT (n=25) 100 100 WT littermates (n=53) 100 75 75 75 50 50 50 25 25 25 Cumulative frequency Cumulative Cumulative frequency Cumulative 0 0 frequency Cumulative 0 0 10 20 30 40 50 60 70 80 90 0 10 20 30 40 50 60 70 80 90 0 10 20 30 40 50 60 70 80 90 Division angle (fixed tissue) Division angle (fixed tissue) Division angle (fixed tissue) GHI Afdnfl/fl (n=117) Afdn 2711 RFP(+) (n=56) Afdn fl/fl + Cre-RFP (n=77) 2711 Afdn- cKO (n=41) Afdn RFP(-) (n=41) * Afdn fl/fl (n=56) ** WT littermates (n=25) Afdn- cKO + Vcl 3466 (n=33) 100 100 100 75 75 75 50 50 50 25 25 25 0 frequency Cumulative 0 0 Cumulative frequency Cumulative 0 10 20 30 40 50 60 70 80 90 0 10 20 30 40 50 60 70 80 90 frequency Cumulative 0 10 20 30 40 50 60 70 80 90 Division angle (fixed tissue) Division angle (fixed tissue) Division angle (fixed tissue) Figure 3.8 The α-E-catenin/vinculin/afadin pathway is required for normal division orientation (A) Immunofluorescent images taken from E16.5 sagittal sections of wild-type littermate controls (left) or transduced with Ctnna1 912 H2B-RFP (right). Epidermal junctional α-E-catenin (green) is lost in Ctnna1 912 RFP+ epidermis. (B) E16.5 epidermis infected with Vcl 3466 H2B-RFP (red) and stained rabbit with anti- vinculin antibody. While suprabasal staining is dramatically reduced in infected samples, some non- specific cytoplasmic basal-layer staining remains. (C) Afadin (green) and E-cadherin (red) immunostaining in E16.5 sections. Mosaic region of Afdn 2711 H2B-RFP (top panel) or Cre-RFP (in Afdn fl/fl embryo; bottom panel) lentiviral transduction. Region of high transduction (red line) demonstrates 90 efficient loss of junctional afadin signal, spared in region of low transduction (white line). E16.5 Afdn fl/fl controls (right, top) with conditional deletion mediated by Krt14-Cre (cKO) (right, bottom). (D-I) Cumulative frequency distributions of telophase division angles from fixed E16.5 sections of shRNA knockdown samples and littermate controls. (D) Ctnna1 912 knockdown (red) and control littermates (black); n indicates measurements from 6-7 independent embryos. (E) Vcl 2803 H2B-RFP mosaic samples showing RFP+ mutants (red) alongside RFP- internal (grey) and WT littermate (black) controls; n indicates measurements from 3-4 independent embryos. (F) Vcl 3466 H2B-RFP mosaic samples shown as in E; n indicates measurements from 3-4 independent embryos. (G) Afdn 2711 H2B-RFP mosaic samples shown as in E-F; n indicates measurements from 3-6 independent embryos. (H) Afdn fl/fl Cre-RFP samples (red) shown alongside uninjected littermates (black); n indicates measurements from 3-4 independent embryos. (I) Cumulative frequency distribution of E16.5 telophase division angles in Afdn fl/fl , Afdn-cKO, and Afdn-cKO + Vcl 3466 H2B-RFP epidermis. Vinculin knockdown does not exacerbate Afdn knockout phenotype. Scale bars, 20 µm ( A-C). P values determined by Kolmogorov-Smirnov test (D-I). * P < 0.05, ** P < 0.01. See also Figure 5–figure supplement 1. 91 Figure 3.9 AJ loss-of-function mutants display errors in division orientation (A) Telophase cells marked by Survivin (green), from E16.5 wild-type littermates (left, top), Afdn 2711 RFP- (top right), Afdn 2711 RFP+ (bottom right), and Vcl 2803 RFP+ knockdowns (bottom left). (B) Cumulative frequency distributions of telophase division angles from E16.5 sagittal sections of Afdn-cKO results in randomized division orientation at telophase; n indicates number of observed divisions from 3-4 independent embryos. (C) Cumulative frequency distributions of telophase division angles from E16.5 whole mount sections of Afdn knockouts. Loss of Afdn results in randomized division orientation at telophase. Note, fewer perpendicular divisions are observed in whole mounts compared to sections, likely due to 1) the relative difficulty of detecting perpendicular divisions compared to planar divisions in whole mounts, and 2) the likelihood of undercounting planar-mediolateral divisions in sagittal sections. Scale bars, 5 µm. P values determined by Kolmogorov-Smirnov test. *** P < 0.001. 92 Figure 3.10 AJ mutants fail at both planar and perpendicular telophase correction. (A) Movie stills of Ctnna1 912 RFP+ mitotic cell, annotated as in Figure 3A. While the presence of basal contact (open arrowhead) would predict planar correction, this division remains oblique when reevaluated 1 h later. (B) Cumulative frequency distribution of division angles from E16.5 live imaging experiments of Ctnna1 912 RFP+ and WT littermates; n values indicate cells imaged from 3 embryos images in 2 separate sessions. (C) Division orientation at anaphase onset ( φ) and 1h later ( θ) for Ctnna1 912 knockdown and WT littermates, plotted from data in (B). Ctnna1 912 RFP+ cells show no obvious correction pattern. (D) Cumulative frequency distribution of division orientation at anaphase onset ( φ) and 1 h post-anaphase 93 (θ) for RFP+ and RFP- populations, from movies of Vcl 3466 mosaic tissue; n indicates divisions from 4 embryos imaged in 3 separate sessions. (E) Data from (D) depicting orientation at anaphase onset ( φ) and 1 h later ( θ) for RFP- and RFP+ cells. RFP- controls sort anaphase orientation ( φ) into bimodal distribution within 1 h ( θ) in a basal-contact dependent manner; Vcl 3466 RFP+ cells display minimal change or correct irrespective of basal contact. (F) An obliquely-oriented Afdn 2711 RFP+ cell fails to reorient, while losing basal contact (open arrowhead). (G) Timelines of division orientation at 5-minute intervals from movies of Afdn 2711 RFP- (black) and RFP+ (red) for 15 representative cells per group. Telophase reorientation establishes bimodal distribution within ~30 minutes in RFP- control cells that enter anaphase at oblique angles, while RFP+ cells fail to demonstrate any sorting behavior over a full hour following anaphase onset. (H) Cumulative frequency distributions of division orientation from E16.5 live imaging of Afdn 2711 RFP+ and WT littermates; n indicates observed divisions from 3 embryos imaged in 2 separate sessions. (I) Radial change ( φ-θ) for oblique anaphase divisions (30 °-60 °) in several shRNA conditions. While loss of LGN allows for normal telophase correction, Afdn , Ctnna1 , and Vcl knockdown results in incoherent or minimal radial change; n indicates number of divisions from 3-6 individual embryos images in 2-4 technical replicates. (J) Division orientation at anaphase onset ( φ) and one hour later ( θ) for Afdn 2711 RFP+ and RFP- cells, plotted from data in (C). RFP- controls correct into a bimodal distribution, while RFP+ cells reorient randomly. Scale bars, 10 µm. P values determined by Kolmogorov-Smirnov test (B,D,H) or student’s t-test (I). * P < 0.05, ** P < 0.01, *** P < 0.001. See also Figure 6–figure supplement 1. 94 Figure 3.11 AJ loss-of-function mutants display errors in division orientation (A) Time-course stills from Ctnna1 912 H2B-RFP (red) and mGFP (grey) live imaging experiment demonstrating failed telophase correction. (B) Telophase reorientation ( θ-φ) quantification in Ctnna1 912 (red) and WT littermates (black). Ctnna1 912 knockdown reduces the overall amount of cell reorientation following anaphase onset. (C) Time-course stills from Vcl 3466 H2B-RFP (red) and mGFP (grey) live imaging experiment demonstrating failed telophase correction. (D) Telophase reorientation ( θ-φ) quantification in Vcl 3466 (red) and WT littermates (black). (E) Time-course stills from Afdn 2711 H2B-RFP (red) and mGFP (grey) live imaging experiment demonstrating failed telophase correction. (F) Radial correction ( θ-φ) for Ctnna1 912 , Vcl 3466 , and Afdn 2711 , RFP-negative (black/grey) and RFP+ (red/pink) plotted versus initial anaphase orientation ( φ). Knockdown cells are less responsive to the orienting function of basal contacts compared to RFP-negative controls. Scale bars, 5 µm. P values determined by student’s t-test. *** P < 0.001. 95 Figure 3.12 AJ mutants alter division orientation via LGN-independent mechanisms (A) Immunostaining for LGN (green) in E16.5 Afdn fl/fl and Afdn-cKO epidermis. LGN localizes at the apical cortex during mitosis regardless of afadin loss. (B) Quantification of LGN radial fluorescence intensity in E16.5 mitotic cells; n indicates LGN+ mitoses from 2-3 independent embryos. (C) Orientation of LGN crescents in E16.5 mitotic cells from indicated groups. Knockdown or knockout of AJ components does not significantly alter the tendency of LGN to localize apically. (D) (top) LGN (red) localization patterns in mitotic (green) basal keratinocytes. (Bottom) Quantification of LGN rate of recruitment, binned by genotype. LGN localizes to the apical cortex in ~50% of mitoses (black/red), is absent in ~45% (grey/pink), and “other” in the remaining ~5% (white), remaining unchanged in AJ knockdown/knockout mutants; n indicates mitotic cells from 2-3 independent embryos. (E) Costaining of E16.5 metaphase (left) and telophase (right) divisions with α-tubulin (red) and LGN (green) in Afdn-cKO (bottom) and Afdn fl/fl control littermates (top). (F) Quantification of the deviation between the metaphase 96 spindle or division axis (red arrow in E) and LGN radial orientation (green arrow in E). Afdn knockout does not disrupt early spindle-LGN linkage but shows oblique telophase orientation despite normal localization of LGN. (G) Immunostaining for the differentiation marker K10 (green) and lentiviral H2B- RFP reporter simultaneously with β4-integrin (red) in E16.5 Gpsm2 1617 infected embryos with an Afdn fl/fl (left) or Afdn-cKO (right) background. Dual loss of Afdn and Gpsm2 results in increased stratification relative to Gpsm2 loss alone. (H) Quantification of spinous layer (K10+) thickness from images as in (G). (I) Cumulative frequency distribution of telophase division angles from fixed sagittal sections of E16.5 embryos. n indicates number of divisions from 2-3 independent embryos. Scale bars, 5 µm (A,D,E), 25 µ m (G). ** P < 0.01, *** P < 0.001, determined by Kolmogorov-Smirnov test (I) or student’s t-test (F,H). See also Figure 7–figure supplements 1,2. 97 Figure 3.13 Afdn loss-of-function does not affect functional apicobasal polarity or downstream components of spindle orientation (A) Immunostaining of E16.5 interphase cell with Par3 (red). (B) Quantification of Par3 radial fluorescent intensity. Apical accumulation is reduced by afadin knockout via Krt14 Cre (Afdn-cKO) or lentiviral Cre- RFP; n indicates interphase cells from 2-3 independent embryos. (C) E16.5 sagittal sections show that centrosomes (green) localize to the apical cortex of interphase cells in both Afdn-cKO basal progenitors and Afdn fl/fl controls. (D) Quantification of centrosome radial position in basal keratinocytes; n indicates interphase cells from 2 independent embryos. (E) E16.5 Ctnna1 912 (top) and Vcl 3466 (bottom) RFP+ mitotic cell (pHH3+, white), showing normal apical localization of LGN (green). (F) NuMA (red) immunostaining in E16.5 mitotic cells. NuMA localizes predominantly in a bipolar manner but displays unique patterns in the presence/absence of LGN (green). (G) Quantification of NuMA localization patterns binned by LGN presence/absence and genotype. Knockout of Afdn does not alter NuMA accumulation. ( H) Dynactin (red) localization in LGN+ mitoses is unaffected by afadin knockout. Scale bars, 5 µm. 98 ABC fl/fl Afdn WT littermate A cKO p Afdn 90 i (meta) c cKO a 100 Afdn l (telo) 60 75 30 survivin 0 50 cKO 2711 Afdn H2B-RFP/β4 Afdn -30 WT (meta) (latemitosis) LGN 25 B LGN orientation -60 WT (telo) *** a LGN s Cumulative frequency Cumulative a 0 -90 l 0 10 20 30 40 50 60 70 80 90 fl/fl cKO WT RFP(+) WT RFP(+) WT RFP(+) WT RFP(+) Division angle (fixed tissue ) Afdn fl/fl Afdn 2711 Ctnna1 912 Vcl 3466 Vcl 2803 D E LGN Insc-YFP Gαi3 Wild-type RFP+ Insc-YFP i3 200 80 ** * *** ** α G 150 60 100 40 LGN 50 20 YFP LGN-survivin axis deviation deviation (degrees) 0 0 Fluor intensity (A.U.) Afdn 2711 Ctnna1 912 Vcl 3466 Vcl 2803 0 2 4 6 8 Aligned Misaligned Distance ( µm) LGN Afadin F AfdncKO hair placodes (n=21) fl/fl Afdn hair placodes (n=21) * 120 100 Afdn fl/fl 75 80 50 Afadin 40 25 LGN 0 Fluorintensity (A.U.) Cumulative frequency Cumulative 0 0 4 8 0 10 20 30 40 50 60 70 80 90 Distance ( µm) Division angle (hair placodes) LGN Afadin G 100 120 75 Afdn fl/fl 50 80 Afadin 25 E14.5 Afdn 2711 RFP(+) (n=34) 40 E14.5 WT littermates (n=30) * Cumulative frequency Cumulative 0 LGN 0 0 10 20 30 40 50 60 70 80 90 Fluorintensity (A.U.) Division angle (fixed tissue) 0 5 10 Distance ( µm) Figure 3.14 AJ components alter division orientation in an LGN-independent manner (A) Cumulative frequency distribution of spindle orientation at metaphase, and division orientation at telophase, in Afdn-cKO and Afdn fl/fl control littermates. WT spindle orientation (grey line) is random at metaphase before becoming bimodal at telophase (black). In contrast, Afdn-cKO orientation remains random at both metaphase (pink) and telophase (red); n indicates number of observed divisions from 2-3 independent embryos. (B) Afdn knockdown or knockout increases radial deviation between LGN (green) and the division plane (red line) (C) Quantification of LGN radial localization in late-stage 99 (anaphase/telophase, Survivin+) mitoses. LGN apical bias is unaffected by loss of AJ components. (D) Deviation between telophase division axis (labeled with Survivin) and LGN orientation upon afadin, α-E- catenin, or vinculin knockdown (as measured in B). α -E-catenin and vinculin loss phenocopies Afdn knockout/knockdown. (E) Costaining of LGN (green) and afadin (red) in metaphase (top, middle) and telophase (bottom) mitoses from E16.5 epidermis with annotated genotype. Fluorescence intensity linescan across LGN crescent is displayed in the right panel. Regions of colocalization (yellow arrows) are more prevalent between LGN and mInsc or G αi3 than with afadin, which display more regions lacking signal overlap (black arrows). (F) Cumulative frequency distribution of division orientation in E16.5 hair placodes (determined by P-cad staining). Afdn knockout (red) results in an increase in oblique orientations when compared to predominantly perpendicular orientation observed in Afdn fl/fl control littermates; n indicates observed divisions from 3-4 independent embryos. (G) Cumulative frequency distribution of E14.5 division orientation in Afdn fl/fl controls (black) and Afdn 2711 (red). Afdn knockout increases the frequency of oblique OCDs; n indicates observed divisions from 3-4 independent embryos. Scale bars, 5 µm. P values determined by Kolmogorov-Smirnov test (A,F,G), or student’s t-test/Mann- Whitney test depending on tests of normality (D). * P < 0.05, ** P < 0.01, *** P < 0.001. 100 Figure 3.15 Planar telophase correction limits precocious and sustained differentiation and biases clones towards symmetric cell divisions (A) (top) z-projection stills from a movie of an E14.5 mitotic cell, annotated as in Figure 1E. (B) Cumulative frequency distribution of division angles from live imaging experiments of E14.5 embryos at telophase onset (blue; φ) and one hour later (black; θ); n indicates number of divisions from 3 embryos across 2 independent sessions. (C) Data from (B) depicting division orientations at telophase and 1h later, sorted based on retention/loss of basal contact throughout cell division. Connecting lines demonstrate that, at E14.5, planar correction occurs in a contact dependent manner, while mitoses that lose contact demonstrate no obvious pattern of correction. (D) Sagittal section of E14.5 epidermis with mosaic Afdn 2711 H2B-RFP transduction. Regions of high infection display increased stratification, as demonstrated by K10 (green) positivity. (E-F) Quantification of epidermal differentiation from E14.5 101 sagittal sections. Afdn (E) or Ctnna1 (F) knockdown increases suprabasal cell density, suggesting precocious differentiation. (G) (top) Graphical depiction of clonal lineage tracing strategy; (bottom) Representative images of E17.5 sagittal sections from lineage tracing experiments stained with GFP (green), K10 (red), and RFP/ β4-integrin (grey). Afdn 2711 knockdown clones display asymmetric (suprabasal) bias. (H) Clonal density arrays (CDAs) representing all evaluated clones (except delamination events) from experiments outlined in (G). The proportion of total clones for each possible combination of basal/suprabasal cells is coded on a color spectrum correlating to 0-12% of all clones. (I) Quantification of SB:basal cell ratio for individual clones. Knockdown of Afdn results in a higher ratio of SB cells in individual clones compared to WT littermates. Scale bars, 5 µm (A), 25 µm (D). * P < 0.05, *** P < 0.001, determined by Kolmogorov-Smirnov test (B) or student’s t-test (F). See also Figure 8– figure supplement 1. 102 A B C 0.75 WT (E14.5) * 2 0.50 1 RFP/β4 0.25 Ctnna1 912 2 8 3 1 ( K10+, % K10+, ( total) Suprabasalcells = = pHH3+Cells/mm n = 4 n = 3 n = 5 n = 5 0 n n 0 2711 2711 WT Afdn 2711 WT Afdn WT Afdn K10 E14.5 E14.5 E16.5 D E Afadin 2711 4 WT (E18.5) β E16.5 E18.5 1.5 ** *** RFP/ ** *** * 1.0 K10 0.5 912 4 WT (E16.5) Ctnna1 β n = = n 34 = n 34 n = 23 n = 38 n = 18 n = 13 n = 20 n = 30 n = 23 n = 28 (K10+) thickness 0 Normalized spinous WT KDWT KO WT KD WT KD WT KO 2711 fl/fl 912 2711 fl/fl RFP/ Afdn Afdn Ctnna1 Afdn Afdn K10 Delamination I Basal Rich Balanced F GH SB Rich 4 12 100 *** 3 9 75 n = 44 n = 42 2 2 6 50 1 Cells/clone 3 25 n=4 n=3 n=5 n=5 n= 23 n= 25 n= 23 n= 25 Total ells per clone ells per Total pHH3 + cells/mm 0 0 912 912 0 2711 2711 WT Ctnna1 WT Ctnna1 WT Afdn WT Afdn type of % clones by (exlduding delamination) WT Afdn 2711 0 E14.5 E16.5 Basal Suprabasal WT Afdn 2711 Figure 3.16 Failed telophase correction induces precious, sustained hyperstratification without impacting proliferation or delamination. (A) Quantification of K10+ suprabasal proportion in E14.5 WT and Afdn 2711 mutants. (B) Mitotic index quantification at E14.5 and E16.5 in WT and Afdn 2711 mutants. (C) Immunofluorescence of E14.5 sagittal sections from WT and Ctnna1 912 backskins stained with the differentiation marker K10 (green). (D) Immunofluorescence of sagittal sections from WT, Afdn 2711 , and Ctnna1 912 backskins stained with the 103 differentiation marker K10 (green), RFP and β4-integrin (red). (E) Quantification of spinous (K10+) thickness at E16.5 and E18.5 for Afdn or Ctnna1 mosaic knockdown (red) and lentiviral Cre-RFP mediated Afdn knockout (pink). (F) Mitotic index quantification at E14.5 and E16.5 in WT and Ctnna1 912 mutants. (G) Comparison of total clone size (basal + SB cells) from lineage tracing experiments in WT and Afdn knockdown samples. (H) Comparison of basal cell and SB cell counts per clone from lineage tracing experiments in WT and Afdn knockdown samples. (I) Grouped column graph demonstrating rates of delaminated (red), basal rich (black), balanced (grey), and SB rich (white) clones. Afdn knockdown biases clones towards SB-rich (asymmetric) outcomes. Scale bars, 25 µm (C), 50 µm (D). P values determined by student’s t-test/Mann-Whitney test depending on tests of normality (A,E) or by binomial test (I). * P < 0.05, ** P < 0.01, *** P < 0.001. 104 Figure 3.17 Two-step model of division orientation Model of OCD in the embryonic epidermis. During stratification, LGN (green) is recruited to the apical cortex in ~50% of mitoses, promoting perpendicular divisions. For OCDs with perpendicular and planar anaphase orientations, the division angle is fixed at anaphase onset, exhibiting minimal change in radial orientation during telophase. Importantly, the activity of LGN and its binding partners is imprecise, frequently resulting in oblique orientations at anaphase. In these cases, the apical daughter either retains or loses basement membrane contact following cytokinesis (red or blue nuclei, respectively). If contact is maintained, the apical daughter will reorient into a planar position. In contrast, if contact is lost, the apical daughter further stacks above its basal partner. Upon loss of α-E-catenin, vinculin, or afadin, telophase reorientation in either direction fails, resulting in persistent oblique divisions. In comparison, LGN loss reduces perpendicular anaphase orientations, while oblique divisions are properly corrected in a contact dependent manner. Afdn loss on a Gpsm2 mutant background restores oblique divisions and largely rescues the Gpsm2 differentiation defect. 105 3.8 Videos Video 3.1.1 Planar anaphase orientation is fixed Z-projection of Krt14 H2B-GFP ; Rosa mT/mG epidermal explant taken from an E16.5 embryo imaged in 5 minute intervals. The mitotic cell (white dashed outline) orients its division parallel to the basement membrane (red) resultig in a persistent planar OCD. Nuclei (H2B-GFP) are shown in red and cell membranes (mTdTomato) in grey. Scale bar: 5 µm. 106 Video 3.1.2 Perpendicular anaphase orientation is fixed Z-projection of Krt14 H2B-GFP ; Rosa mT/mG epidermal explants taken from E16.5 embryos imaged in 5 minute intervals. The mitotic cell (white dashed outline) orients its division orthogonal to the basement membrane (red) resulting in a persistent perpendicular OCD. Scale bar: 5 µm. 107 Video 3.1.3 Oblique anaphase orientations undergo planar telophase reorientation Z-projection of Krt14 H2B-GFP ; Rosa mT/mG epidermal explants taken from E16.5 embryos imaged in 5 minute intervals. The mitotic cell (white dashed outline) initiates anaphase at an oblique (30-60°) orientation relative to the basement membrane (red). However, the apical daughter retains basement membrane contact (yellow arrowhead) and corrects into a planar orientation within one hour. Scale bar: 5 µm. 108 Video 3.1.4 Oblique anaphase divisions display perpendicular correction Z-projection of Krt14 H2B-GFP ; Rosa mT/mG epidermal explants taken from E16.5 embryos imaged in 5 minute intervals. The mitotic cell (white dashed outline) initiates anaphase at an oblique (30-60°) orientation relative to the basement membrane (red). However, the apical daughter corrects into a perpendicular orientation within one hour. Scale bar: 5 µm. 109 Video 3.10.1 Persistent oblique division in Ctnna1 912 knockdown mitotic basal cell Z-projection of RFP+ basal cell from Krt14 Cre ; Rosa mT/mG epidermal explants transduced with Ctnna1 912 shRNA, taken from E16.5 embryos imaged in 5 minute intervals. The mitotic cell (white dashed outline) initiates anaphase at an oblique (30-60°) orientation relative to the basement membrane (red) and remains oblique throughout the 1h imaging period. H2B-mRFP1 labels nuclei (red) and mGFP labels cell membranes (grey). Scale bar: 5 µm. 110 Video 3.10.2 Persistent oblique division in Vcl 3466 knockdown mitotic basal cell Z-projection of RFP+ basal cell from Krt14 Cre ; Rosa mT/mG epidermal explants transduced with Vcl 3346 shRNA, taken from E16.5 embryos imaged in 5 minute intervals. The mitotic cell (white dashed outline) initiates anaphase at an oblique (30-60°) orientation relative to the basement membrane (red) and remains oblique throughout the 1h imaging period. H2B-mRFP1 labels nuclei (red) and mGFP labels cell membranes (grey). 111 Video 3.10.3 Persistent oblique division in Afdn 2711 knockdown mitotic basal cell Z-projection of RFP+ basal cell from Krt14 Cre ; Rosa mT/mG epidermal explants transduced with Afdn 2711 shRNA, taken from E16.5 embryos imaged in 5 minute intervals. The mitotic cell (white dashed outline) initiates anaphase at an oblique (30-60°) orientation relative to the basement membrane (red) and remains oblique throughout the 1h imaging period. H2B-mRFP1 labels nuclei (red) and mGFP labels cell membranes (grey). Scale bar: 5 µm. 112 CHAPTER 4 – RESULTS. DISRUPTION OF THE NECTIN-AFADIN COMPLEX RECAPITULATES FEATURES OF THE HUMAN CLEFT LIP/PALATE SYNDROME CLPED1 4.1 Introduction Orofacial clefting is one of most common congenital defects, with an incidence of ~1/700 births, affecting nearly 200,000 infants each year worldwide. These heritable, frequently monogenetic, developmental malformations usually include cleft lip and/or cleft palate (CP), which can occur in isolation, or as part of a syndrome. Cleft lip/palate-ectodermal dysplasia syndrome 1 (CLPED1; OMIM #225060)—also known as orofacial cleft 7 (OFC7), Zlotogora-Ogur syndrome, and Margarita Island ectodermal dysplasia (ED4)—is one of the better studied orofacial clefting syndromes, originally identified as a recessive disorder affecting isolated populations in the Middle East, South America and the Caribbean 351-354 . Homozygous nonsense mutations in NECTIN1 are suspected to be the casual variants underlying CLPED1, since both Margarita Island and Israeli families were found to have mutations that truncate the receptor within its extracellular domain at Trp185 237, 355 . However, mouse models have thus far failed to confirm that Nectin1 loss can result in CP or ED 75, 76, 78 . With its similarity to human craniofacial development and genetic malleability, the mouse is an excellent model for studying the molecular and cellular processes that underlie palatogenesis 224 . Further supporting its utility in modeling CP, there are ~50 genes linked to orofacial clefting in humans and >100 in mice, and many of these are orthologs 234 . In mice, palatogenesis initiates with formation of the palatal shelves (PS) at E11.5, which grow and extend downward towards the floor of the mouth between E12- E13.5, rapidly elevate over the tongue at ~E14, and subsequently elongate horizontally to approximate and fuse along the midline by E15.5 223-225 . By E12.5, the PS are lined by a bilayered epithelium consisting of p63-positive basal cells overlaid with a protective periderm layer, which prevents the formation of intraoral adhesions between juxtaposed epithelia, such as the PS and the tongue 356, 357 . As 113 the PS meet at the midline, the opposing epithelia adopt an adhesive-competent identity as the medial edge epithelia (MEE), which fuse to form the midline (medial) epithelial seam (MES). By E16.5, the MES is removed through a combination of apoptosis, differentiation, and migration 282, 357 . Failure of any step throughout palatogenesis can result in CP, perhaps explaining the high occurrence rate, and genetic heterogeneity associated with the disease 227, 234, 358 . The nectins are a family of transmembrane cell-cell adhesion proteins—consisting of four members in mice and humans 8, 9, 64 —which homodimerize in cis and generally heterotetramerize in trans 66, 67 . Different nectin homodimers have variable affinity for other family members. For example, in trans , nectin-1 preferentially binds to nectin-3 and nectin-4 but can also bind nectin-2 or nectin-1 9. This hierarchical affinity affords the nectins cell sorting functionality, as demonstrated in the olfactory epithelia and cochlea 81, 83 . The cytoplasmic tail of each nectin forms an obligate interaction with the actin-binding protein afadin 8, 65 . In turn, afadin scaffolds nectins to both the cytoskeleton and the adherens junction (AJ) 3, 19 . Through afadin, nectins cluster with AJs and augment cell-cell adhesion to support interactions between cell types expressing complementary nectin pairs. In addition to NECTIN1 being linked to CLPED1, mutations in NECTIN4 underlie a related disorder, ectodermal dysplasia syndactyly syndrome (EDSS1; OMIM #613573) 245 . Recent work suggests that an interaction between nectin-1 and nectin-4 may be important for palatogenesis 247, 278 . However, the lack of a mouse model for Nectin4 loss has prevented functional characterization of its role in palatogenesis. Here, we utilize a versatile in utero lentiviral genetic toolkit to provide the first functional evidence in an animal model that the nectin-afadin cell-adhesion complex is required for proper palate closure. Moreover, we demonstrate that Nectin1 and Nectin4 act cooperatively during palatogenesis, and that human CLPED1 mutations operate in a dominant negative fashion to induce CP and syndactyly in mice. 114 4.2 Results and Discussion 4.2.1 The obligate nectin binding partner, afadin, is required for secondary palatogenesis Given that previous studies of Nectin1 germline null mice did not report CP 75, 76, 78 , we hypothesized that other nectins may compensate for the loss of nectin-1. To mimic loss of all nectin function, we targeted the obligate nectin binding partner, afadin. While afadin is not essential for nectins to accumulate at the plasma membrane, it is required for proper clustering at sites of cell-cell adhesion 65 . Since germline afadin ( Afdn ) knockouts are non-viable 190, 359 , we utilized a well-characterized in utero , epithelial-specific genetic manipulation technique 299 we’ve termed LUGGIGE (lentiviral ultrasound-guided gene inactivation and/or gene expression) to generate conditional loss-of-function mutants. This approach efficiently transduces surface epithelia of the embryo including the epidermis and oral epithelia 299, 300, 360 . Moreover, when performed at E9.5, lentiviral-delivered Cre drives reporter gene expression as early as E10.5, 2-3 days earlier than a transgenic Krt14-Cre line 299 . In the context of palatogenesis, another group has used a similar approach to inject adenovirus expressing TGF β3 into the amniotic fluid between E12.5-E14.5, which specifically transduced periderm and partially rescued TGF β3 loss-induced CP 298 . Thus, in utero delivery of viral vectors represents a powerful and versatile approach to genetically manipulate oral epithelia during palatogenesis, offering several advantages over traditional transgenics 360 . We utilized LUGGIGE to generate two tissue-specific Afdn loss-of-function mutants (Fig. 4.1A): 1) knockdown with the previously validated Afdn 2711 shRNA; and 2) knockout using RFP-tagged Cre recombinase injected into Afdn fl/fl mice 204, 361 . We injected E9.5 CD1 mice with lentivirus packaging the Afdn 2711 shRNA as well as an mRFP1 fluorescent reporter fused to histone-2B (H2B-RFP) (Fig. 4.1A). Mutants and wild-type (WT), uninjected littermates were collected at E16.5-E18.5 to evaluate for CP or E12.5-E14.5 to validate shRNA efficiency in vivo (Fig. 4.1B). Afdn 2711 mutants displayed near-complete loss of afadin accumulation in palatal epithelia by E14.5 (Fig. 4.2A). While WT littermates rarely 115 exhibited CP (1/16; 4 litters), a striking majority of Afdn 2711 embryos (13/17; 4 litters) presented with CP (Fig. 4.1C,D). To better visualize the entirety of the oral cavity, we developed a novel contrast-enhanced µCT technique which allows complete imaging of the embryonic head with 6 µm resolution in three dimensions (see Methods) (Fig. 4.1E,F). This technique, alongside serial cryosectioning and immunofluorescence, demonstrated that Afdn 2711 mutants displayed a variety of CP phenotypes where both palatal shelves either elevated but failed to approximate/fuse (Fig. 4.2B), or where one or both shelves failed to elevate entirely (Fig. 4.1E,F). This diversity of phenotypes may be due to a variety of factors including mosaicism/multiplicity of infection, precise timing of injection and lentiviral expression, or inherent variability in the progression of palatogenesis between littermates. However, in nearly all cases, the PS remained in direct contact with the tongue – a hallmark of persistent intraoral adhesions. To investigate how afadin promotes palatogenesis, we surveyed the orientation of the palatal shelves and gross progression through palatogenesis at earlier timepoints in Afdn 2711 mutants. At E14.5, Afdn 2711 mutants displayed delays in shelf elevation, with this phenotype becoming more apparent by E15.5 (Fig. 4.1G). At E15.5, all WT littermates present with fully elevated and approximated palatal shelves (15/15) with many displaying nearly complete shelf fusion as determined by MES dissolution (Fig. 1H, left). In contrast, Afdn 2711 mutants presented with either both shelves still descended (Fig. 4.1H, right) or both elevated but not yet approximated. Interestingly, E15.5 Afdn 2711 mutants with near complete lentiviral transduction formed intraoral adhesions between the distal portion of the descended PS and the lateral tongue, which lacked a K8-positive periderm layer between the apposed epithelia (Fig. 4.1I). These data suggest that afadin loss delays in palatal shelf elevation, which may cause – or be attributed to – the formation of intraoral adhesions between the PS and the tongue epithelium, leading to frequent CP. 116 4.2.2 LUGGIGE presents advantages over epithelial-specific Cre-recombinase approaches To further validate that afadin is essential for palatogenesis, we created conditional knockouts by injecting homozygous Afdn fl/fl animals with Cre-RFP lentivirus (hereafter referred to as Afdn lenti-cKO; Fig. 4.1A), which resulted in complete loss of afadin within the palatal epithelia by E13.5 (Fig. 4.2C, top). As with the Afdn 2711 mutants, nearly all E16.5 Afdn lenti-cKO mutants displayed CP (4/5 embryos; 2 litters) (Fig. 4.2D,E). Interestingly, when we crossed animals to an epithelial-specific Cre line [ Krt14- Cre; 292 ] to generate Krt14-Cre; Afdn fl/fl conditional knockout embryos, none of these animals displayed CP (0/17 embryos; 3 litters) (Fig. 4.2D). We attribute this discrepancy to variation in the timing of recombination; while Afdn lenti-cKOs display complete loss of afadin protein in palatal epithelia by E13.5, Krt14-Cre; Afdn fl/fl embryos still show residual protein (Fig. 4.2C, bottom left), which could be ablated cell autonomously via Cre-RFP infection (Fig. 4.2C, bottom right). These results confirm that afadin is essential for palatogenesis. Additionally, they highlight potential concerns in utilizing classic Krt14-Cre strains to validate epithelial candidate genes in palatogenesis, as recombination may not occur early enough. It should be noted, however, that other Krt14-Cre lines have been used to generate CP models 253, 291, 292 , suggesting that differences in the timing and/or expression of Cre recombinase must be considered 360 . In contrast, LUGGIGE is active several days earlier, circumventing this issue and allowing for exploration of early palatogenesis phenotypes. 4.2.3 Acute loss of Nectin1 or Nectin4 results in mild cleft palate with low penetrance Despite the well-characterized link between NECTIN1 and NECTIN4 mutations with CP and ectodermal dysplasia, mouse models have failed to recapitulate these phenotypes. Germline knockouts of Nectin1 , Nectin2 or Nectin3 are viable, while combinations of double knockouts are early embryonic lethal. CP has not been reported in any single mutant or in compound mutants where three Nectin alleles are deleted 75, 77, 78 . In addition to nectin-1 and nectin-2, nectin-4 is also expressed in the MEE 236, 247 , but the consequence of Nectin4 loss in mice has not been reported. 117 Because “transcriptional adaptation” can lead to the compensatory upregulation of related genes in germline knockouts 362 , we reevaluated the role of nectin-1 and nectin-4 in palatogenesis using LUGGIGE-mediated knockdown. To do so, we generated two independent shRNAs for each target transcript ( Nectin1 4402 , Nectin1 2732 , Nectin4 2589 , Nectin4 2632 ) and validated their efficacy in cultured keratinocytes (Fig. 4.4). An advantage of the LUGGIGE technique is that its mosaic transduction facilitates studies of cell autonomy. Previous studies have shown that nectin-1 and nectin-4 localize to the interface between palatal basal epithelium and the periderm 247 , but have not established which cell populations express each nectin. At E14.5, transduction of basal cells, but not periderm, with the Nectin1 4402 H2B-mRFP1 lentivirus was sufficient to ablate nectin-1 accumulation at this interface (Fig. 4.3A). In contrast, in Nectin4 2589 H2B-mRFP1-transduced palatal epithelium, nectin-4 protein loss was seen with periderm- specific infection (Fig. 4.3B,C). These data strongly suggest that nectin-1 is expressed by basal cells while nectin-4 is enriched in periderm cells. We next examined the requirement of nectin-1 and nectin-4 in palatogenesis. LUGGIGE delivery of each of two independent Nectin4 shRNAs resulted in CP, albeit with low penetrance ( Nectin4 2589 : 2/10 embryos; Nectin4 2632 : 1/5 embryos); moreover, the phenotype was less severe than observed in Afdn mutants (Fig. 4.3D,E). Similar results were obtained when we targeted Nectin1 : 1/9 embryos for Nectin1 4402 and 2/5 embryos for Nectin1 2732 (Fig. 4.3D-F) showed CP. While Nectin1 mutants always presented with CP along the entirety of the anterior-posterior axis, Nectin4 mutants frequently presented with a unique, posterior-specific CP (Fig. 4.3D). These data suggest that both nectin-1 and nectin-4 play a role in palatogenesis, but neither is sufficient to cause highly penetrant CP on its own. 4.2.4 Dual loss of Nectin1 and Nectin4 causes highly penetrant cleft palate To test whether Nectin1 or Nectin4 can functionally compensate for loss of the other, we injected pooled lentiviruses expressing both Nectin1 4402 H2B-RFP and Nectin4 2589 H2B-YFP (Fig. 3A). This resulted in increased CP penetrance compared to loss of only one nectin (3/7 embryos; 3 litters) (Fig. 118 4.5B,C). Furthermore, several embryos presented with a posterior submucosal cleft (SMC; 2/7 embryos; Fig. 4.5B,C). Taken together, these data suggest that dual loss of Nectin1 and Nectin4 results in an additive CP phenotype. However, due to the mosaicism of infection, dual RFP/YFP positive cells were rare (Fig. 4.6A), suggesting this model underestimates the penetrance of the CP phenotype. We therefore improved upon our Nectin1/4 dual loss model by generating a lentiviral construct that allowed for the simultaneous expression of multiple shRNAs (Fig. 4.5D). To do so, we added a second Pol III promoter (H1) upstream of the original U6 promoter to express both Nectin1 4402 and Nectin4 2589 shRNAs with a single H2B-RFP reporter (hereafter referred to as N1 4402 ; N4 2589 ). At E14.5, N1 4402 ; N4 2589 H2B-RFP+ epithelia displayed efficient loss of both nectin-1 and nectin-4 (Fig. 4.6B). At E16.5, nearly all RFP+ embryos displayed CP (11/12 embryos; 3 litters; Fig. 4.5E,F), confirming that our pooled lentivirus approach underrepresented CP penetrance. Additionally, in the single RFP+ embryo in which the PS did approximate, we observed persistent K14+ epithelia within the palatal mesenchyme, indicating a failure to complete MES dissolution (Fig. 4.6C). Taken together, these data suggest that expression of both nectin-1 or nectin-4 is essential for normal palatogenesis. As with Afdn mutants, we investigated which stage of palatogenesis N1 4402 ; N4 2589 mutants fail to complete. At E14.5, N1 4402 ; N4 2589 mutants were more likely to have both shelves still descended, compared to WT littermates (Fig. 4.5G; Fig. 4.6D). At E15.5, when WT littermates had largely completed palatogenesis (9/10 embryos; 2 litters), half of N1 4402 ; N4 2589 mutants displayed a rare phenotype with only one PS elevated (Fig. 4.5G,H). While not as dramatic as Afdn mutants, we observed direct contact between the PS and lateral tongue in E14.5 N1 4402 ; N4 2589 mutants, with similar gaps in K8+ periderm coverage (Fig. 4.6E). This suggests that dual loss of Nectin1 and Nectin4 delays PS elevation, possibly due to transient intraoral adhesions, resulting in highly penetrant CP. 4.2.5 Causal CLPED1 mutations drive CP via dominant negative and/or neomorphic activity Twenty years ago, mutations in NECTIN1 were identified as casual variants associated with CLPED1 237 . The majority of the CP-causing mutations in NECTIN1 are nonsense mutations leading to a 119 truncated variant that includes only the 1 st Ig-like loop, which is responsible for nectin-1 trans interactions 237, 241, 360 . One of the better characterized CLPED1 disease variants is the W185X truncation 237, 238 . While the NECTIN1 W185X mutant transcript may undergo nonsense-mediated decay, it could alternatively function as a dominant-negative. For example, an Fc-fusion of the 1 st Ig-like loop of nectin-1 can be used to bind to and inhibit endogenous interactions between nectins-1, 3, and 4 242 . Therefore, we hypothesized that truncating mutations might block interactions between nectin-1 and nectin-4, leading to a more severe phenotype than Nectin1 loss alone. To test this, we created a lentiviral construct to express human NECTIN1 W185X with a C-terminal V5 epitope tag, together with an H2B-mRFP1 reporter. To mimic homozygosity of the NECTIN1 W185X mutation, we included the Nectin1 4402 shRNA to knockdown endogenous murine Nectin1 (Fig. 4.7A). Following LUGGIGE-mediated injection of the NECTIN1 W185X construct, both the H2B-mRFP1 reporter—labeling transduced cells—and the V5 tag—labeling the truncated NECTIN W185X protein—were detected in E16.5 palatal epithelia (Fig. 4.7B). While all Nectin1 4402 ;NECTIN1 W185X mutant PS underwent normal elevation, most failed to approximate (4/7 embryos; 2 litters), and those that did approximate displayed abnormal fusion (Fig. 4.7C,D). Four lines of evidence support the conclusion that the truncated NECTIN1 W185X protein functions in a dominant-negative manner. First, compared to Nectin1 4402 knockdowns, the penetrance of palate closure defects was much higher in Nectin1 4402 ;NECTIN1 W185X mutants (7/7 vs. 1/9) Second, we observed a novel phenotype in Nectin1 4402 ;NECTIN1 W185X mutants not seen in Nectin1 or Nectin4 knockdowns: in embryos without a patent cleft, the PS seemed to make contact but maintained a highly disorganized MES (Fig. 4.7D). Third, the subcellular localization of NECTIN1 W185X is abnormal and disrupts the expression of endogenous nectin-1 in neighboring cells (Fig. 4.7E,F). Unlike endogenous nectin-1, the NECTIN1 W185X mutation fails to accumulate at the basal cell-periderm interface, instead displaying circumferential, cytoplasmic accumulation (Fig. 4.7E). Furthermore, while the Nectin1 4402 shRNA acts cell autonomously in basal cells, expression of NECTIN1 W185X in periderm was sufficient to disrupt endogenous nectin-1 localization non-cell autonomously in neighboring basal cells (Fig. 4.7F). Fourth, 120 we observed syndactyly—a clinical feature of CLPED1 where digits are fused—in 2/7 of E16.5 NECTIN1 W185X mutant embryos (Fig. 4.7G), but never in either Nectin1 or Nectin4 knockdowns. The presence of intraoral adhesions and syndactyly in various nectin/afadin mutants suggests the most likely mechanism of action for the NECTIN1 W185X mutation is disruption of periderm formation or function during embryogenesis. Our results also resolve a longstanding debate regarding the role of nectins in mammalian palatogenesis, confirming that, despite the lack of CP in Nectin1 germline knockouts, these genes are required for normal palate elevation and fusion. This study further demonstrates the complexity of human genetic disorders and reinforces the value of utilizing human mutations in addition to loss-of-function alleles when validating CP-associated genes. 4.3 Acknowledgements We thank members of the Williams Lab for their critical feedback throughout the process. We thank Dr. Louis Reichardt (UCSF) and Dr. Gerard M. Beaudoin III (Trinity University) for sharing the Afdn fl/fl strain. We thank Dr. Hong Yuan, Jon Frank and the Small Animal Imaging Facility at the UNC Biomedical Imaging Research Center for providing the µCT imaging service. The imaging core is supported in part by an NCI cancer core grant, P30-CA016086-40. KJL was supported by an NIH Ruth L. Kirschstein Predoctoral National Research Service Award (F31 DE026956). KMB was supported by an NIH/NIDCR K08 Mentored Clinical Scientist Research Career Development Award (DE026537) and L40 (Loan Repayment Program for Pediatric Researcher). SW was supported by a Sidney Kimmel Scholar Award (SKF-15-165). 4.4 Materials and Methods Animals. Mice were housed in an AAALAC-accredited (#329; June 2017), USDA registered (55-R- 0004), NIH welfare-assured (D16-00256 (A3410-01)) animal facility. All procedures were performed under IACUC-approved animal protocols (19-155). CD1 mice (Charles River; #022) were utilized for all shRNA experiments. Afdn fl/fl animals 204 were maintained on a mixed C57B6/J CD1 background and either 121 bred to the same K14-Cre allele or injected with lentiviral Cre-mRFP1 (see below). The procedure for producing, concentrating and injecting lentivirus into amniotic fluid of E9.5 embryos has been previously described 299 and is briefly detailed below. Lentiviral injections. This protocol is approved via IACUC #19-155. Pregnant CD1 or Afdn fl/fl females were anesthetized and the uterine horn pulled into a PBS filled dish to expose the E9.5 embryos. Embryos and custom glass needles were visualized by ultrasound (Vevo 2100) to guide microinjection of ~0.7 µl of concentrated lentivirus into the amniotic space. Three to ten embryos were injected depending on litter size. Following injection, the uterine horn(s) were reinserted into the mother’s abdominal cavity, which was sutured closed. The incision in the skin was resealed with surgical staples and the mother provided subcutaneous analgesics (5 mg/kg meloxicam and 1-4 mg/kg bupivacaine). Once awake and freely moving, the mother was returned to its housing facility for 4-9 days, at which point E13.5-18.5 embryos were harvested and processed accordingly. Micro computerized tomography ( µµµCT) imaging. E14.5-E16.5 embryos were decapitated and heads were fixed for 90 minutes in 4% paraformaldehyde at room temperature and rinsed with PBS. Heads were then submerged in a 0.3% (w/v) solution of phosphotungstic acid hydrate (Sigma-Aldrich P4006) and diluted in 70% ethanol for 72 hours or longer with agitation. Samples were rinsed in PBS for >20 minutes prior to image collection using a Scanco Medical microCT-40 machine using a holder with diameter of 12mm, voxel size of 6 µm, and 114 µA/70kVp/8W energy exposure. Constructs and RNAi. For Nectin1 and Nectin4 RNAi targeting, we tested ~10 shRNAs for knockdown efficiency in primary keratinocytes. These sequences were selected from The RNAi Consortium (TRC) Mission shRNA library (Sigma) versions 1.0, 1.5, and 2.0 and cloned using complementary annealed oligonucleotides with AgeI/EcoRI linkers. For Afdn , we utilized an shRNA that had been previously 122 validated with our lentiviral injection technique 361 . shRNA clones are identified by the gene name with the nucleotide base (NCBI Accession number) where the 21-nucleotide target sequence begins in superscript (e.g. Afdn 2711 ). Lentivirus was packaged in 293FT or TN cells using the pMD2.G and psPAX2 helper plasmids (Addgene plasmids #12259 and #12260, respectively). For knockdown screening, primary keratinocytes were seeded at a density of ~150,000 cells per well into 6-well plates and grown to ~80% confluency in E-Low calcium medium and infected with a MOI of ~1. Approximately 48 h post- infection, keratinocytes were treated with puromycin (2 µg/mL) to generate stable cell lines. After 3-4 days of puromycin selection, cells were lysed and RNA isolated using the RNeasy Mini Kit (Qiagen). cDNA was generated and amplified from 10-200 µg total RNA using either Superscript VILO (Invitrogen) or iScript (Bio-Rad). mRNA knockdown was determined by RT-qPCR (Applied Biosystems 7500 Fast RT-PCR) using 2 independent primer sets for each transcript with Hprt1 and cyclophilin B (Ppib2 ) as reference genes and cDNA from stable cell lines expressing Scramble shRNA as a reference control. Primer efficiencies were determined using dose-response curves and required to be >1.8, with relative transcript abundance determined by the ∆∆ CT method. RT-qPCR runs were performed in triplicate with the mean knockdown efficiency determined by calculating the geometric mean of the ∆∆ CT values for at least two independent technical replicates. The following primer sequences were used: Nectin4 (fwd-1: 5’- CAGCCCCCTCCCAAATACAA -3’, rev-1: 5’- TATGATCACTGAGGCGGACACC -3’; fwd-2: 5’- AGATGTGGGGCCCTGAAGC -3’, rev-2: 5’- GCATTCGTACTCGCCCTCATC -3’), Nectin1 (fwd-1: 5’- TAACCCGCCAGCCACTGAGT -3’, rev-1: 5’- CTGCGCAGGGCCACTATGA -3’; fwd-2: 5’- CAAACAGAACATGGCCATCTACAAC -3’, rev-2: 5’- TCGCCCTTTAGCCGTGTTTC -3’). The following shRNA targeting sequences were used: Afdn 2711 (5’- CCTGATGACATTCCAAATATA -3’), Nectin1 4402 (5’- TAAACGAGAAACCTGTATTAA -3’), Nectin1 2732 (5’- GAATGCGAGGCACAGAATTAT -3’), Nectin4 2589 (5’- TACGTACCTTCTGTAAATTAA -3’), Nectin4 2631 (5’- CTGCTTAGACTCCCTTAATAA -3’). 123 Antibodies, immunohistochemistry, and fixed imaging. E13.5-E16.5 embryonic heads were fixed for 1 hour at RT in 4% paraformaldehyde (in PBS) and submerged in 15% sucrose overnight (4 °C). The next day, heads were submerged in 30% sucrose at RT for >6 hours (until they sank) then mounted whole in OCT (Tissue Tek) and frozen at -20 °C. Infected and uninfected littermate controls were mounted in the same blocks to allow for direct comparisons on the same slide. Frozen samples were sectioned (8-12 µm thick) on a Leica CM1950 cryostat, mounted on SuperFrost Plus slides (ThermoFisher) and stored at - 80 °C. For staining, sections were thawed at 37 °C for 15 min, washed with PBS and blocked for 1h with gelatin block (5% NDS, 3% BSA, 8% cold-water fish gelatin, 0.05% Triton X-100 in PBS). Primary antibodies were diluted in gelatin block and incubated overnight in a humidity chamber at 4 °C. Slides were then washed with PBS and incubated with secondary antibodies diluted in gelatin block at room temperature (~25 °C) for 2 hours, counterstained with DAPI (1:2000) for 5 minutes and mounted in ProLong Gold (Invitrogen). Images were acquired using LAS AF software on a Leica TCS SPE-II 4 laser confocal system on a DM5500 microscope with ACS Apochromat 20x/0.60 multi-immersion, ACS Apochromat 40x/1.15 oil, or ACS Apochromat 63x/1.30 oil objectives. The following primary antibodies were used: mCherry (rat, Life Technologies M11217, 1:1000- 3000), GFP (chicken, Abcam ab13970, 1:1,000), E-cadherin (rat, Life Technologies 131900, 1:1,000), E- cadherin (goat, R&D System AF748, 1:1,000), afadin (rabbit, Sigma A0224, 1:500), nectin-1 (rat, MBL International D146-3, 1:250), nectin-4 (rabbit, Millipore HPA010775, 1:100), K14 (guinea pig, OriGene BP5009, 1:1000), K8 (rat, Developmental Studies Hybridoma Bank TROMA-1, 1:500), V5 (rabbit, Abcam ab9113, 1:500). The following secondary antibodies were used (all antibodies highly cross-absorbed and produced in donkey): anti-rabbit AlexaFluor 488 (Life Technologies, 1:1000), anti-rabbit Rhodamine Red-X (Jackson Labs, 1:500), anti-rabbit Cy5 (Jackson Labs, 1:400), anti-rat AlexaFluor 488 (Life Technologies, 1:1000), anti-rat Rhodamine Red-X (Jackson Labs, 1:500), anti-rat Cy5 (Jackson Labs, 1:400), anti-guinea pig AlexaFluor 488 (Life Technologies, 1:1000), anti-guinea pig Rhodamine Red-X 124 (Jackson Labs, 1:500), anti-guinea pig Cy5 (Jackson Labs, 1:400), anti-goat AlexaFluor 488 (Life Technologies, 1:1000), anti-goat Cy5 (Jackson Labs, 1:400). Keratinocyte culture and calcium-shift assays. Primary mouse keratinocytes were maintained in E medium with 15% chelated FBS and 50 µM CaCl 2 (E low medium). For viral infection, keratinocytes were plated at ~150,000 cells per well in a 6-well plate and incubated with lentivirus in the presence of polybrene (1 µg/mL) and centrifuged at 1,100 x g for 30 min at 37 °C. Stable cell lines were generated/maintained by adding puromycin (2 µg/mL) 48 h after infection and continual antibiotic treatment following. Calcium shifts were performed by seeding ~45,000 cells per well into 8-well Permanox chamber slides (Lab-Tek 177445) coated with poly-L-lysine, collagen, and fibronectin. Once cells reached ~85% confluency (~12-16 hours) cells were switch to high Ca 2+ (1.5mM) medium and grown for 8 hours. Cells were fixed with 4% paraformaldehyde in PBS warmed to room-temperature. Immunostaining was performed using the same protocol as for slides (see above). Measurements, quantification, graphing, and statistics. Palatogenesis phenotypes, including CP, residual MES, submucosal cleft, and the orientation of the PS, were determined by either stereoscopic imaging (as in Fig. 1C), µCT scanning (as in Fig. 1E), or cryosectioning and immunofluorescent confocal imaging (as in Fig. 1H). For animals E16.5 or older, statistical testing between genotypes was performed by Fisher’s exact test, using a binary grouping of phenotypes into either “fused” or “abnormal” groups, the latter of which included embryos displaying submucosal cleft or residual MES as well as classic CP. For younger timepoints (i.e. E14.5 or E15.5) statistical testing was performed by binning the number of PS which were elevated or descended in each genotype (i.e., for Fig. 1G WT E15.5 animals had 30 PS elevated and 0 descended while Afdn 2711 animals had 4 PS elevated and 4 descended) and evaluating significance by Fisher’s exact test. All statistical analyses and graphs were generated using GraphPad Prism 8. Figures were assembled using Adobe Photoshop and Illustrator CC 2020. 125 4.5 Figures Figure 4.1 Afadin is essential for secondary palatogenesis (A) LUGGIGE experimental approach. (B) Timeline of LUGGIGE and experimental endpoints. (C) Darkfield (top) and fluorescent (bottom) stereoscope images of E18.5 Afdn 2711 infected embryo and uninjected littermate. H2B-RFP (red) is overlaid in the top panel. Afdn 2711 embryos consistently present with CP (yellow outline). (D) Rate of CP penetrance in Afdn 2711 mutant embryos and littermate controls. (E-F) Contrast enhanced µCT images of E16.5 Afdn 2711 mutant and littermate heads. Afdn mutants 126 frequently display with one (E) or both (F) PS still descended (yellow arrows). (G) Rate of PS elevation phenotypes at E14.5 and E15.5 in Afdn 2711 mutants and WT littermates. (H) E15.5 coronal sections of Afdn 2711 mutant and WT oral cavity immunostained with K14 (green), K8 (grey) and lentiviral H2B-RFP (red). (I) Zoom of dashed box in (H) showing region of intraoral adhesion between PS and tongue epithelia. Scale bars, 1 mm (C,E,F), 100 µ m (H, I). * P < 0.05, *** P < 0.001, by Fisher’s exact test. 127 ABE14.5 coronal section E16.5 coronal section WT Afdn 2711 WT SC H2B-RFP PS Tongue PS Nectin1 2711 H2B-RFP Afdn SC Afadin Tongue Tongue K14 Tongue PS PS WT Afdn 2711 Tongue C D E13.5 Afdn fl/fl Fused Uninjected +Cre-RFP Cleft *** 100 Tongue Tongue 75 Cre-RFP 50 PS Afadin 25 PS 6 7 1 5 1 = = = 0 n n n % of% embryos (≥E16.5) fl/fl fl/fl fl/fl Afdn lenti cKO E13.5 Krt14-Cre ; Afdn fl/fl Afdn Uninjected +Cre-RFP Afdn Krt14-Cre; E E16.5 coronal section Tongue Cre-RFP Afdn lenti-cKO Tongue PS PS SC Afadin PS PS Cre-RFP K14 Tongue Figure 4.2 Validation of transgenic models highlights improved efficacy of LUGGIGE (A) E14.5 coronal sections of WT (left) and Afdn 2711 mutant (right) PS immunostained with Afadin (green), nectin-1 (red) and H2B-RFP (grey), demonstrating effective loss of Afadin accumulation in transduced epithelia; high magnification images of boxed region are shown in grayscale below. (B) Immunofluorescent image of E16.5 Afdn 2711 mutant and WT oral cavity. Some Afdn 2711 mutants display normal PS elevation but fail to approximate. (C) (Top) E13.5 Afdn fl/fl PS including Cre-RFP injected (right) and uninjected (left) samples stained for Afadin (green; grey isolated channel) and Cre-RFP (red). LUGGIGE-mediated recombination results in efficient loss of Afadin accumulation by E13.5. (Bottom) E13.5 Krt14-Cre; Afdn fl/fl PS including Cre-RFP injected (right) and uninjected (left) samples stained for 128 Afadin (green; grey isolated channel) and Cre-RFP (red). While Krt14-Cre; Afdn fl/fl embryos still display robust Afadin signal (compared to uninjected Afdn fl/fl PS in Fig. S1C), addition of Cre-RFP results in mosaic loss of Afadin accumulation in transduced epithelia. High magnification images of boxed regions are shown below. (D) Rate of CP phenotypes at E16.5 in Afdn fl/fl controls, Afdn fl/fl lenti-Cre, and Afdn fl/fl K14-Cre knockout littermates. Afdn knockout via lenti-Cre is sufficient to cause CP, while K14-Cre is insufficient. (E) Immunofluorescent image of E16.5 Afdn fl/fl lenti-Cre oral cavity, demonstrating CP. Scale bars 50 µ m (A), 200 µm (B,D), 25 µ m (C,F). *** P < 0.001, by Fisher’s exact test. 129 ABC Nectin1 4402 H2B-RFP E14.5 coronal section E14.5 coronal section E16.5 WT Basal transduction RFP- WT littermate Nectin4 2589 WT littermate Nectin4 2589 RFP- RFP+ Tongue RFP+ nectin-1 nectin-4 nectin-1 Tongue Periderm transduction RFP- PS PSnectin-4intensity RFP- RFP+ H2B-RFP H2B-RFP RFP+ nectin-1 DEE16.5 wholemount F E16.5 coronal section WT littermate Nectin4 2589 Nectin1 4402 Fused Cleft WT Littermate 100 75 H2B-mRFP1 50 H2B-RFP Nectin1 4402 25 3 0 3 1 5 9 5 K8 = = = = = n n n n n % of embryos%of (≥E16.5) 0 2589 2632 4402 2732 WT H2B-mRFP1 N4 N4 N1 N1 Figure 4.3 Loss of Nectin1 or Nectin4 does not cause highly penetrant CP (A) E14.5 Nectin1 4402 palatal epithelia immunostained for nectin-1 (green) and H2B-RFP reporter (red). Zoomed panels are dashed regions showing nectin-1 in greyscale. (B-C) E14.5 PS in Nectin4 2589 mutant and WT littermate showing loss of nectin-4 (green) in H2B-RFP+ (red) cells. Zoom (bottom) is highlighted in dashed yellow region in top panel. (C) Nectin-4 channel in (B) displayed as fire LUT. (D) Darkfield (top) and fluorescent (bottom) stereoscope images of E16.5 Nectin4 2589 (middle) and Nectin1 4402 (right) infected embryos with uninjected littermate (left). H2B-RFP (red) is overlaid in the top panel. CP is highlighted by yellow dashed outline. (E) Rate of CP penetrance in Nectin1 and Nectin4 mutant embryos. (F) E16.5 palate in Nectin1 4402 mutant showing complete fusion. Scale bars, 4 µm (A), 25 µm (B,C), 1 mm (D), 100 µm (F). 130 Figure 4.4 In vitro validation of Nectin1/4 shRNA efficacy using calcium-shift assays (A) Primary mouse keratinocytes after 8h Ca 2+ shift—labeled with E-cad (red) and nectin-1 (green)— which accumulate in linear bands at cell-cell junctions. Yellow boxed region shown at high magnification below. Nectin1 4402 knockdown cells show robust loss of nectin-1, while Nectin1 2732 cells show intermediate loss compared to Scramble controls. (B) 8h Ca 2+ -shifted keratinocytes stained for nectin-4 (green) and E-cad (red). Nectin4 2589 knockdown cells show robust loss of nectin-4 protein at cell-cell junctions. Scale bars 20 µ m (large), 5 µm (zoom). 131 Figure 4.5 Nectin1 and Nectin4 cooperatively prevent highly penetrant CP (A) Pooled lentiviral approach for dual Nectin1/4 knockdown. (B) Darkfield (top) and fluorescent (bottom) stereoscope images of E16.5 Nectin1 4402 H2B-RFP/ Nectin4 2589 H2B-YFP infected embryo. H2B-RFP fluorescence (red) is overlaid in the top panel. CP outlined in yellow. Zoom (far right) from dashed region in image to the left, showing submucosal cleft (yellow arrow). (C) Rate of palatal phenotypes in Nectin1 4402 H2B-RFP/ Nectin4 2589 H2B-YFP mutant embryos. SMC = submucosal cleft. (D) Double shRNA lentiviral construct for simultaneous Nectin1/Nectin4 knockdown. (E) Contrast enhanced µCT images of E16.5 Nectin1 4402 ;Nectin4 2589 mutant and littermate heads. (F) Rate of palatal phenotypes in Nectin1 4402 ;Nectin4 2589 mutant embryos. (G) Rate of PS elevation phenotypes at E14.5 and E15.5 in 132 Nectin1 4402 ;Nectin4 2589 mutants and WT littermates. (H) Contrast enhanced µCT images of E15.5 Nectin1 4402 ;Nectin4 2589 mutant and littermate heads. Mutant shows example of PS still descended (yellow arrows). Scale bars, 1 mm (B,E,H). * P < 0.05, ** P < 0.01, *** P < 0.001, by Fisher’s exact test. 133 A B 4402 2589 N1 4402 RFP + N4 2589 YFP E14.5 WT E14.5 N1 ; N4 SC nectin-1 nectin-4 nectin-1 nectin-4 PS H2B-YFP H2B-RFP Tongue nectin-1 OC PS Tongue H2B-RFP PS nectin-4 D E14.5 coronal C WT littermate E N1 4402 ; N4 2589 PS PS N1 4402 ; N4 2589 4 1 4 K 1 K P Tongue P F F P R - F R - B R - B 2 4402 2589 Tongue N1 ; N4 2 B H PS 2 H H 8 PS K 4 1 PS Tongue K Figure 4.6 Dual loss of Nectin1 and Nectin4 in a novel, double shRNA construct delays PS elevation and can result in residual MES. (A) E16.5 coronal sections of Nectin1 4402 H2B-RFP/ Nectin4 2589 H2B-YFP mutant PS immunostained with GFP (green) and mCherry (red), demonstrating rare dual-transduced cells (yellow arrows in high magnification image of boxed region, below). (B) Immunofluorescent image of E14.5 Nectin1 4402 ;Nectin4 2589 mutant and WT PS stained with nectin-1 (red), nectin-4 (green) and H2B-RFP. Cells transduced with the double shRNA construct show efficient loss of both nectin-1 and nectin-4. (C) E16.5 Nectin1 4402 ;Nectin4 2589 mutant oral cavity immunostained for K14 (green) and H2B-RFP (red) showing K14+ epithelia within the palatal mesenchyme. Zoomed region (greyscale K14 image) highlighted by yellow dashed box above. (D) Immunofluorescent image of E14.5 Nectin1 4402 ;Nectin4 2589 134 mutant and WT littermate demonstrating delays in PS elevation. (E) Zoom of yellow boxed region in (D) showing direct contact between transduced H2B-RFP+ (red) cells of the PS and lateral tongue with gap in K8+ (grey) periderm layer, suggesting possible intraoral adhesion. Scale bars 100 µ m (A), 50 µm (B,E), 1 mm (C; large), 0.5 mm (C; zoom), 200 µ m (D).* P < 0.05, ** P < 0.01, *** P < 0.001, by Fisher’s exact test. 135 A B E16.5 coronal section P F V5 V5 R - B U6 PGK H2B mRFP T2A N1 W185X V5 2 N1 4402 H shRNA V5 Ecad Fused C Cleft D E Residual MES E16.5 coronal section E14.5 coronal section ** 1 - 100 V5 n V5 i t c 75 e P n F RFP 50 R 1 - n i t 25 3 7 c = = e Ecad n n 0 n % embryos (≥E16.5) WT F W185X G E14.5 coronal section W185X V5 V5 nectin-1 WT littermate NECTIN1 1 - n i t c e n PS Fluor. Fluor. intensity RFP Figure 4.7 CLPED1 variant W185X acts in a dominant negative fashion to cause CP (A) CLPED1 mutant lentiviral construct. (B) E16.5 oral cavity in NECTIN1 W185X mutant with CP showing V5-tagged transgene (green) in H2B-RFP+ (red) epithelia outlined by E-cadherin (E-cad, grey). Zooms of V5 immunostaining in each PS (right) are highlighted in dashed yellow region in left panel. (C) Rate of palatal phenotypes in NECTIN1 W185X mutant embryos. (D) E16.5 oral cavity in NECTIN1 W185X mutant showing disorganized residual MES, noted by the presence of E-cad+ (grey) epithelia in the palatal mesenchyme. Zoom is highlighted in yellow dashed region in left panel. (E-F) E14.5 NECTIN1 W185X palatal epithelia showing failure of V5-tagged NECTIN1 W185X transgene (green) to rescue endogenous nectin-1 localization (red) in lentiviral-transduced cell labeled with H2B-RFP (grey) (E) and non-cell autonomous reduction of endogenous nectin-1 (F). (G) Darkfield stereoscope images of E16.5 NECTIN1 W185X forepaws, showing syndactyly of the first two digits. Scale bars, 50 µm (B,D), 10 µm (E,F), 1 mm (G). ** P < 0.01, by Fisher’s exact test. 136 CHAPTER 5 – DISCUSSION The results in Chapters 3 and 4 highlight two novel roles for afadin in distinct developmental processes. In embryonic epidermal development, afadin is required for a newly discovered mechanism called telophase correction, which is the final step in refining the orientation of division of epidermal progenitors into planar/symmetric and perpendicular/asymmetric outcomes. Our results indicate that afadin, possibly through its interaction with the α-catenin/vinculin complex in adherens junctions, is required for obliquely dividing progeny to coordinate cellular movements during telophase and establish unambiguous perpendicular or planar orientations. Loss of afadin causes persistent oblique divisions and a bias towards asymmetric cell fate outcomes, resulting in precocious and persistent hyperstratification of the epidermis. These results, their impact on the field, and future research directions regarding epidermal OCD ( 5.1, 5.2, 5.3 ) and cell fate specification ( 5.4 ) are discussed below. In contrast, during craniofacial development, loss of afadin mirrors dual loss of nectin-1 and nectin-4, both of which result in highly penetrant cleft palate (CP). These findings resolve a decades-long discrepancy between human genetic data and mammalian genetic models, proving that the nectin-afadin complex is essential for normal palatogenesis. We are the first to utilize in utero lentiviral delivery to express human cleft palate mutations, validating that expression of the NECTIN1 W185X nonsense mutation associated with CLPED1 can recapitulate many of the human disease phenotypes in mice. Our data also suggest the NECTIN1 W185X mutation may harbor dominant negative activity, as expression of this mutation on a Nectin1 knockdown background causes CP with greater penetrance than Nectin1 loss alone. These findings and remaining knowledge gaps regarding the role of nectins ( 5.5 ) and other CP-associated cell-adhesion genes ( 5.6 ) are further detailed later in this Chapter. 137 5.1 Updated model of OCD of epidermal progenitors In the classic model of OCD, the final axis of division is determined by 1) asymmetric positioning of a polarity cue (e.g. apico-basal polarity, planar-cell polarity, etc.), 2) centrosome duplication and migration of one or both centrosomes towards opposite poles, 3) rotation and anchoring of the metaphase spindle relative to the polarity cue, and 4) cleavage orthogonal to the axis of division during cytokinesis (Fig. 5.1). In this model, the presence of spindle orientation machinery operating on metaphase astral microtubules is the deciding factor in determining the division axis, suggesting the cell is committed to a particular orientation at anaphase onset. Our prior understanding of OCD in embryonic epidermal progenitors has supported this model. However, our findings in Chapter 3 alter this perspective in several important ways. First, we find that while the LGN-associated spindle orientation machinery promotes perpendicular divisions in early mitosis, it does so imprecisely, and large proportion of divisions enter anaphase with oblique orientations. Second, we show that cells which initiate chromosome segregation at oblique, indeterminate angles undergo a novel process called telophase correction, which ensures the final orientation of division is either planar or perpendicular. The direction of telophase correction (i.e. planar- or perpendicular-correction) correlates with the preservation of basement membrane contact; cells that maintain this contact undergo planar correction, while cells losing contact display perpendicular correction. This mechanism is dependent on the coordination of AJ/actin scaffolding through the collective function of α-catenin, vinculin, and afadin. Third, we find that LGN plays a novel role in late mitotic cells to further promote perpendicular-directed telophase correction. While this discovery represents significant progress, it also raises additional questions regarding the molecular machinery involved in this complicated process. More specifically, questions remain regarding the role of (5.1.1) Par3/aPKC/Par6 and (5.1.2) Crumbs apical polarity complexes, (5.1.3) the Scribble basolateral polarity complex, and (5.1.4) basal cell-matrix adhesions. 138 5.1.1 Roles of the Par/aPKC/Par6 apical polarity complex While telophase correction becomes the de facto final step in the OCD model outlined in the preceding paragraph, our understanding of the first step—establishment of a polarity cue—remains limited. The canonical polarity protein Par3 ( Pard3 ) is essential for a proper distribution of OCDs in the developing epidermis, presumably through its interaction with mInsc, which cooperatively recruits LGN to the apical cortex during mitosis 127 . Classically, Par3 forms a tripartite complex with two other polarity proteins, Par6 and aPKC. Mammals have two aPKC homologs; aPKC ι/λ (Prkci ) and aPKC ζ (Prkcz ). In the epidermis, aPKC ι/λ is the predominant isoform 363 and displays similar localization to Par3, where both are apically polarized in basal progenitors and circumferentially cortical in the suprabasal layers. Surprisingly, whereas Pard3 knockdown causes an increase of oblique divisions 127 , Prkci loss increases the proportion of perpendicular divisions 325 , mirroring the AGS3/Gpsm1 knockdown phenotype 86 (discussed further in 5.2 ). This suggests that aPKC and Par3 may not operate in the same pathway to direct epidermal OCDs. Interestingly, aPKC can directly phosphorylate Ser408 of LGN, which lies within its flexible linker domain and promotes LGN binding to 14-3-3 at the expense of the LGN/G αi interaction 364, 365 . Furthermore, while loss of Par6B—one of the three mammalian Par6 homologs—causes errors in spindle orientation and aPKC polarization in Caco-2 cysts 366 , little else is known regarding the role of Par6 in mammalian apico-basal polarity or OCD. 5.1.2 Roles of the Crumbs apical polarity complex Another well-studied apical polarity complex consisting of Crumbs (Crb), Stardust (Std), and Patj, is relatively understudied in mammalian systems. In flies, the Crumbs complex establishes a super- apical domain distinct from the Par complex, in a Baz-dependent manner 199, 367-370 . The Crumbs complex performs distinct functions during apical polarity establishment and maintenance, but can recruit Par6/aPKC to the apical domain to regionally regulate aPKC activity 199, 368 . While the complicated relationship between the Crumbs/Par complexes has been studied extensively regarding polarity 139 positioning, it remains unclear whether the Crumbs complex has any role in OCD. Relatedly, the Crb complex doesn’t appear to regulate polarity in neuroblasts 371 . Mice have three Crb homologs (Crb1, 2, and 3) and a single Stardust ortholog (Pals1) which exclusively binds one of two Patj orthologs—PATJ and Mupp1 372, 373 . Crb1 is primarily expressed in the brain, cornea, and retina, and mutations in human CRB1 are associated with retinopathies 374, 375 . Crb2 is also expressed in the retina, as well as the kidney and is required for gastrulation 376 . In contrast, Crb3 is mostly enriched in epithelia372, 377 and is the predominant Crb homolog expressed in the epidermis 363 . Ubiquitous Crb3 knockout causes neonatal lethality due to mucosal accumulations in the lungs, while also causing fusion of neighboring villi in the embryonic intestine 378, 379 . Std/Pals1 is an obligate cytoplasmic scaffold downstream of transmembrane Crumbs, and loss of std results in the same epithelial defects as loss of crumbs 371, 380-384 . Like Crb3 , loss of murine Pals1 is embryonic lethal, while neural-specific Pals1 loss causes severe defects in cortical development385 . Interestingly, Pals1 null embryonic cortical progenitors fail to undergo normal self-renewal and lose hallmarks of apical polarity, suggesting that OCD—a potent factor for dictating cortical progenitor cell fate 119 —may be compromised 385 . Pals1 binds to PATJ or Mupp1, two secondary scaffolding proteins with ten and thirteen PDZ domains, respectively 373 . Pals1 displays higher affinity for PATJ than Mupp1 and cooperates with PATJ and the Par complex in TJ formation 74 . While Patj knockouts have yet to be described, Mupp1 (Mpdz ) loss causes postnatal lethality due to hydrocephalus, mirroring observations in humans with homozygous MPDZ nonsense mutations 386 . Loss of Mupp1 also reduced the cortical accumulation of Pals1 and compromised TJ assembly in neuroepithelia 387 . None of the Crumbs complex members have specifically been modulated in the epidermis, meaning their role in the establishment or maintenance of apicobasal polarity in stratified epithelia, or involvement in OCD of epidermal progenitors, remain unexplored. The Par and Crumbs apical polarity complexes are particularly intriguing within the context of telophase correction; could either complex play a meaningful role in promoting perpendicular-directed telophase correction along with LGN? 140 5.1.3 Roles of the Scribble basolateral polarity complex Par and Crumbs complexes cooperatively establish apicobasal polarity by reinforcing the apical positioning of each other, and by promoting the exclusion of the Scribble module from the apical domain 369, 388-390 . This classic basolateral polarity module described from Drosophila embryos includes Scribble (Scrib), Discs large (Dlg), and Lethal giant larvae (Lgl), which cooperate with the basolateral kinase Par1. aPKC can phosphorylate both Lgl and Par1 to displace them from the apical cortex 391-393 . Similarly, Par1 can phosphorylate Baz to prevent it from seeding the Par complex within the basolateral domain 388 , and Lgl can inhibit aPKC kinase activity 110 . Importantly, each component of the Scribble complex is essential for asymmetric cell division in Drosophila neuroblasts 112, 113, 344 , primarily through basal positioning of the fate determinants. However, their role in the bimodal OCDs of epidermal progenitors is unknown. Mammals have a single ortholog of scribble (Scrib ) which cooperates with two additional LAP protein family members, Erbin and Lano 394 . Mammals also have two orthologs of lgl (Llgl1/2 ), but five orthologs of dlg (Dlg1-5) . In both Drosophila neuroblasts and artificially polarized S2 cells, Pins binds and recruits Dlg to the cell cortex, where Dlg can affect spindle microtubules through the plus end kinesin motor Khc73 344, 364 . In other epithelial systems—such as the Drosophila follicular epithelium and chick neuroepithelium—this role is reversed, as laterally localized Dlg binds and recruits Pins/LGN to promote planar OCD 186, 395 . In the Drosophila imaginal wing disc, where Pins is nonessential for OCD, Dlg is essential for lateral localization of Mud and planar OCD 396 . This suggests that Dlg can, in different contexts, function upstream, downstream or independently of the LGN/NuMA/dynactin/dynein complex. However, exploring this relationship in mammalian epidermal development is difficult, as at least three of the five Dlg homologs are expressed in the epidermis 397-399 . Interestingly, Dlg binding to Pins is dependent on Pins phosphorylation by Aurora-A364 , suggesting that exogenous expression of a nonphosphorylatable LGN (S492A) could be an elegant method to explore the requirement of this interaction. Regardless, the three members of the canonical Scribble pathway represent attractive candidates for effecting OCD of epidermal progenitors, either via their classical effects in establishing polarity domains, or through non-canonical spindle orienting pathways. The fact that they typically 141 localize to the basolateral cortex also places them as potential effectors of planar-directed telophase correction. 5.1.4 Roles for basal cell-matrix adhesions Given the observation that planar-directed telophase correction involves maintenance of basement membrane contact, it seems likely that cytoskeletal-associated cell-matrix adhesions may be required for this process. Basal progenitors form two distinct cell-matrix adhesion complexes, hemidesmosomes and focal adhesions. Both hemidesmosomes and focal adhesions are molecularly constituted of a transmembrane integrin heterodimeric pair which interacts with laminins within the extracellular matrix 400 . Hemidesmosomes primarily include integrin α6β4 dimers which bind laminin-332, while focal adhesions primarily form α2β1 or α3β1 pairs and bind to laminin-511. A dozen or so additional integrins are present in the epidermis, though many of them are only expressed in specific compartments of the hair follicle, during wound healing or under pathologic conditions, and therefore will not be discussed here. In the extracellular space, hemidesmosomal integrin-α6 binds to BPAG2 (COL17A1), another transmembrane laminin-332 binding protein. Within the cytoplasm, hemidesmosomes interact with keratin-based intermediate filaments through the scaffolds plectin and BPAG2 (DST). In contrast, focal adhesions are linked to the actin cytoskeleton through numerous intermediates including vinculin, paxillin, and talin, among others 401 . Genetic knockout in murine epidermis of integrins and their binding partners results in severe skin blistering phenotypes due to separation of the dermis-epidermis interface 402- 411 . These phenotypes are observed in humans with rare autoimmune pemphigoid disorders or genetic mutations causing hereditary epidermolysis bullosa 412, 413 . Of note, loss of integrin-β1 ( Itgb1) causes blistering 404, 405 , loss of apico-basal polarity, mislocalization of LGN, and errors in OCD 85 . In contrast, loss of integrin-β4 ( Itgb4 ) has no effect on LGN localization, while effects on OCD have not been reported 85 . While knockout or complete knockdown of these genes produces severe blistering phenotypes that would preclude exploration of OCD phenotypes, hypomorphic alleles such as intermediate or weak 142 RNAi might circumvent this potential limitation. Alternatively, Focal adhesion kinase (FAK)—an integrin-β1 binding partner—is dispensable for cell-matrix adhesion in the murine epidermis and epidermal FAK knockout mice display reduced differentiation and hypostratification 414 . Fak -null keratinocytes display reduced migration, as well as defects in focal adhesion turnover and cytoskeletal abnormalities, suggesting that FAK primarily functions to destabilize focal adhesion complexes 415, 416 . It is therefore intriguing to speculate that loss of FAK may promote planar telophase correction through increased stability of focal adhesions in oblique dividing daughters. Additionally, talin is a mechanosensitive actin-binding protein that binds integrin-β1 through an interaction between the N- terminal FERM-domain of talin and the cytoplasmic tail of the integrin. Talin also harbors thirteen C- terminal Rod domains, nine of which contain cryptic vinculin binding sites and allow for multimeric actin scaffolding in response to mechanical force. Given this function, it is possible that talin may serve an important role in regulating contractile forces associated with planar directed telophase correction. While talin ( Tln1 ) has not been ablated in the epidermis, mice expressing a mutant Tln1 (E1770A) unable to adopt the autoinhibited conformation display increased focal adhesion stability and adhesive-strength, which reduced cell migration and impaired epidermal wound healing 417 . However, its role in OCD and telophase correction are unknown. Additionally, integrins and their binding partners coordinate numerous signaling cascades 400, 418 . Moreover, the presence or absence of integrin based cell-matrix adhesions may influence cell identity, as has long been suggested through colony formation assays where high expression of integrin-β1 is correlated with increased colony formation 132, 143 , a hallmark attribute of stem cells. Ultimately, the prominent role of cell-matrix contact in telophase correction suggests that the adhesive complexes at this interface may be essential for this phenomenon. 5.2 Corrective mechanisms to ensure orientation of cell division Telophase correction contributes to a growing body of examples of tissue systems utilizing corrective mechanisms to regulate proper division orientation. In Drosophila neuroblasts, early observers 143 were surprised to find that while insc, pins, dlg, and lgl mutants fail to align the mitotic spindle with the basal fate determinants in metaphase, the same fate determinants were often correctly positioned during telophase to ensure asymmetric segregation and “rescue” fate specification 101, 102, 104, 112 . This phenomenon was termed “telophase rescue” and required the transcription factors Snail, Escargot, and Worniu 343 . Similarly, the Dlg/Khc73 spindle orientation pathway is essential for telophase rescue in the absence of insc 344 . However, this telophase rescue mechanism significantly differs from the mechanism we describe in Chapter 3 in that “telophase rescue” repositions fate determinants while “telophase correction” repositions the entire daughter cell. In the Drosophila testis, germline stem cells (GSCs) directly contact the niche-defining hub cell and two supportive cyst stem cells (CySCs) 140 . While both GSCs and CySCs undergo ACD by orienting the division orthogonal to the hub cell contact, CySCs do not achieve orthogonal spindle orientation during metaphase. Instead, the spindle establishes orthogonal OCD in anaphase when one centrosome becomes repositioned near the site of hub cell contact in a dynein- and myosin-dependent manner 345 . Another anaphase correction mechanism has been observed in mutant MDCK cells, where out of plane divisions have been induced by LGN knockdown 347 or Par1b overexpression. These erroneous division angles are suppressed by the apical accumulation of contractile actomyosin which flattens the mitotic mother cell during anaphase to “press” the oblique division back into plane in an E-cad and Rho-dependent manner 348 . A similar mechanism exists in the monolayered Drosophila follicular epithelium, where out of plane divisions are corrected by post-mitotic epithelial reinsertion of misplaced daughters back into the monolayer 346 . Further exploration revealed that this behavior also occurs in the neuroepithelium of the optic lobe and the embryonic ectoderm, and that the molecular mechanism is dependent on later cell-cell adhesion through Neuroglian-167 and Fasciclin II 346 . In the mammalian epidermis, it has been reported that overexpression of mInsc increases the rate of perpendicular divisions 127 , but this increase can be compensated by an unknown mechanism which allows NuMA to ignore apical LGN/mInsc crescents and reposition laterally to restore the balance of planar OCDs 127, 133 . Whether this compensation involves planar directed telophase correction or is driven by an active mechanism which competitively promotes planar division orientation at the expense of 144 perpendicular divisions is unknown (further discussed in 5.3 ). Taken together, these studies highlight a trend wherein misorientation of metaphase spindles can be corrected by mechanisms involving cell polarity, cell-cell adhesion and/or the actin cytoskeleton. 5.3 Speculative mechanisms promoting planar OCD in the epidermis While LGN promotes perpendicular/asymmetric cell divisions in the epidermis, it remains unclear whether planar divisions are the result of a “default” mechanism or if they are promoted by a separate “active” mechanism. However, there are several lines of evidence to suggest that an active pathway may compete with LGN to bias progenitors towards planar/symmetric divisions. First, epidermal progenitors are cuboidal to columnar, meaning that aligning their division plane with the long axis of the cell as a “default” (Hertwig’s rule) mechanism would result in primarily oblique or perpendicular divisions in the absence of an active spindle orientation cue. Second, loss of LGN or NuMA results in nearly all divisions becoming planar, rather than oblique or randomized. Third, telophase correction refines oblique divisions in both the perpendicular and planar direction, meaning planar OCDs may be driven, at least in part, by mechanisms promoting planar telophase correction. Fourth, epidermal loss of AGS3 /Gpsm2 —a homolog of LGN—or aPCK λ (Prkci ) increases the proportion of perpendicular divisions at the expense of planar divisions 86, 325 . Similarly, AGS3 is essential for normal division 419 orientation of neuronal progenitors in the developing neocortex and binds G αi, NuMA and mInsc with similar affinity to LGN 144, 146, 420-422 . These observations raise the possibility that AGS3 may contribute to an active mechanism which competes with the canonical apical machinery to promote planar divisions, possibly by competing with LGN for binding partners. However, in other systems, recent evidence argues that AGS3 has lost the conserved spindle orienting functionality of LGN, likely due to variation in the interdomain regions between the C-terminal GoLoco motifs, which are required for cortical accumulation 423 . These findings cast doubt on the competitive binding mechanism of AGS3, raising the possibility that AGS3 or aPKC λ operate during telophase to promote planar telophase correction. 145 Regardless of how planar OCD is achieved, our understanding of the mechanisms governing the ‘choice’ between planar/symmetric and perpendicular/asymmetric divisions in the epidermis remain incomplete. 5.4 Insights into epidermal cell fate specification In classic models of asymmetric cell division, the orientation of division is coupled to the asymmetric segregation of intrinsic fate determinants during mitosis to promote differentiation in one daughter cell and preserve stemness in the other. While embryonic epidermal progenitors display bipotency in regard to both cell fate and division orientation, a direct link between these two observations has remained elusive. In Chapter 3, we present the first lineage tracing experiments demonstrating that perturbation of epidermal OCD directly leads to altered epidermal cell fate outcomes. However, whether the orientation of division dictates cell fate through asymmetric inheritance of intrinsic or extrinsic fate determinants remains unknown. Our results show that a large proportion of progenitor divisions initiate anaphase at oblique, indeterminant angles and that these divisions are normally refined into planar or perpendicular outcomes by telophase correction. While LGN mutants are unable to establish unambiguous perpendicular orientations (70-90 °) prior to anaphase, a large proportion of these cells still achieve oblique orientations (30-60 °). In the absence of LGN, all obliquely oriented progeny undergo planar telophase correction. When correlated with the reduced differentiation observed in LGN mutants, this suggests that obliquely- oriented apical daughters are capable of adopting a basal identity. In contrast, Afdn mutants fail telophase correction in both perpendicular and planar directions, with a striking proportion of oblique Afdn knockdown divisions losing contact with the basement membrane. Results from lineage tracing experiments suggest this loss of contact and oblique persistence biases cells towards asymmetric fate outcomes, suggesting oblique daughter cells—even those which initially make contact with the basement membrane—may also be capable of differentiating and adopting a suprabasal identity. Taken together, these findings suggest two, non-exclusive theories: 1) obliquely dividing daughter cells harbor the 146 necessary intrinsic cues to remain bipotent throughout mitosis, and 2) epidermal cell fate is primarily informed by niche occupancy, wherein extrinsic fate cues are provided in a manner dependent on the final position of oblique progeny. In particular, telophase correction suggests that the presence or absence of basement membrane contact may be a potent driver of basal cell identity. These experiments do not definitively determine how epidermal cell fate is specified but add context to the arguments regarding (5.3.1) intrinsic or (5.3.2) extrinsic signals in moderating embryonic epidermal cell fate specification. 5.4.1 Evidence supporting intrinsic fate determination In the Drosophila neuroblast, intrinsic fate determinants, including the Notch inhibitor Numb 89 , are basally segregated during metaphase and their asymmetric inheritance by the basal daughter promotes differentiation. Studies in numerous other systems have reinforced that asymmetric inheritance of intrinsic Notch regulators is a common mechanism of ACD. For example, mouse intestinal stem cells undergo symmetric and asymmetric cell divisions but prioritize ACDs in response to inflammation 424 . Asymmetric differentiation is dependent on suppressing Notch signaling through an incoherent feed forward loop established by the Notch inhibitors Numb and microRNA-34a (miR-34a) 424 . While counterintuitive, miR-34a inhibits translation of both Notch 425 and Numb 424 , but does so using distinct mechanisms; while miR-34a establishes a thresholded response to Notch levels, it represses Numb gradually. This establishes an incoherent feed-forward loop that promotes bimodal levels of high and low Notch activity to better define cell identity 424 . Fittingly, Numb and miR-34a are co-inherited asymmetrically during intestinal stem cell divisions and intrinsically promote Notch suppression. While Numb can be asymmetrically inherited in adult epidermal planar divisions 139 , it doesn’t appear to be so during embryonic ACD 86 . Nevertheless, knockdown of LGN results in a cell-autonomous decrease in Notch-reporter activity in suprabasal keratinocytes, and the stratification defects observed in LGN mutants can be rescued by overexpression of active Notch 86 , suggesting that differential Notch activity is somehow correlated with the orientation of division. While the evidence suggesting intrinsic 147 fate determinants are asymmetrically segregated in epidermal ACD is minimal, the role of telophase correction in affecting cell fate suggests that extrinsic cues may play a significant role. 5.4.2 Evidence supporting extrinsic fate determination Extrinsic cues are known to regulate stem cell identity in numerous contexts. In the Drosophila testis, germline stem cells (GSCs) reside in direct contact with the “hub”—an aggregate of niche specifying somatic cells—and two supporting cyst stem cells. The hub cells express the ligand Unpaired, which activates the JAK-STAT pathway in neighboring GSCs to promote self-renewal and the stem cell identity 426, 427 . In ACD, GSCs orient their division orthogonal to the site of hub contact, allowing the proximal daughter to retain contact with the hub—and thus its stem cell identity—while pushing the distal, differentiative daughter away from the stem-preserving hub signals 140 . Additionally, a growing body of evidence suggests that Notch signaling in vertebrates is frequently regulating extrinsically by trans interactions between ligands and the Notch receptors. For example, in the murine intestinal crypt, Lgr5+ intestinal stem cells (ISCs) reside in the crypt base, flanked by post-mitotic Paneth cells. Paneth cells express the Notch ligand Dll4 which promotes Notch signaling in neighboring ISCs to maintain stemness 141, 428 . ISCs also coordinate division orientation to maintain their position within the niche. In intestinal organoids, as both ISCs and Paneth cell precursors undergo mitosis, they extrude from the epithelial layer into the luminal space and undergo planar/symmetric divisions, but allow a neighboring Paneth cell or ISC to insert between the two nascent daughter cells, thus maintaining the Paneth cell/ISC patterning required define the niche 142 . Similarly, adult murine neuronal stem cells in the subventricular zone asymmetrically segregate Dll1 into the differentiating daughter, which then maintain contact with the more quiescent stem cells to provide a positive feedback loop reinforcing high Notch activity in the quiescent population 429 . While Notch activity is thought to be low in epidermal basal cells, use of fluorescent Notch reporters suggests there is heterogeneity in the Notch activation amongst progenitors 430 . Similarly, the Notch ligand Dll1 is expressed in a subpopulation of embryonic murine basal progenitors 138 . Integrin-β1Hi 148 expressing epidermal stem cells also express high levels of Dll1 431 , supporting speculation that integrin levels may correlate with planar telophase correction behavior through strengthening basal endfoot attachments, and thereby activate sporadic Notch signaling within the basal layer. Further exploration of the heterogeneity and timing of mitotic segregation of basal specific biomarkers and transcriptional effectors—including Notch and its associated ligands—may be a productive approach towards gaining new insights into how epidermal OCD coordinates the symmetric or asymmetric inheritance of intrinsic and extrinsic cell fate determinants. 5.5 Cell and Molecular mechanisms of CLPED1 Cleft lip/palate ectodermal dysplasia syndrome (CLPED1; OMIM#225060) is a human genetic syndrome characterized by cleft lip/palate, ectodermal dysplasia, and partial syndactyly 351-354, 432 . While multiple familial studies have established that CLPED1 is caused by nonsense mutations in the NECTIN1 gene 237, 241 , germline Nectin1 null mice are viable and only present with microphthalmia 75 and defects in dental enamel 76 . This discrepancy between human genetic associations and murine models has persisted for nearly 15 years, with no explanation for the gap in our understanding. Recent observations suggested that both nectin-1 and nectin-4 were expressed in the palatal epithelia and periderm, respectively 247 , suggesting that loss of one may be ameliorated by compensation from the other. In fitting with this hypothesis, while nectins preferentially form heterotetramers in trans 8, 66, 67 , they show mild affinity for trans homotypic interactions as well 9, 64 , suggesting a potential compensatory mechanism. The findings presented in Chapter 4 highlight that while loss of nectin-1 is insufficient to cause highly penetrant cleft palate (CP) in mice, dual loss of nectin-1 and its homolog nectin-4, or loss of the obligate downstream nectin binding partner, afadin 9, 65 , results in highly penetrant CP, suggesting that nectin-1 and -4 cooperate to promote normal palatogenesis. However, the role of the human truncation mutations remained unclear. Previous studies have highlighted that heterozygosity of one CLPED causal variant, NECTIN1 W185X is associated with nonsyndromic cleft lip/palate in a geographically restricted Venezuelan population 238 . This nonsense mutation results in early truncation of NECTIN1, potentially 149 forming a protein fragment consisting of only the N-terminal 1 st Ig-like loop. This domain is specifically required for nectin-1 trans interactions 67 and Fc-fusions of this fragment are capable of inhibiting the trans interactions of nectin-1, -3, and -4242 . Together, these studies suggested that this mutation may be capable of operating in a dominant-negative fashion to cause CP. In support of this hypothesis, I show that expression of the human NECTIN1 W185X variant on a Nectin1 knockdown background causes palatal phenotypes with much greater penetrance and severity than Nectin1 loss alone. Furthermore, the NECTIN1 W185 phenotype varied from those observed in either afadin or nectin-1/nectin-4 double knockdown animals. While most NECTIN1 W185X mutants display patent CP, several presented with a persistent medial epithelial seam (MES), suggesting that this mutation uniquely has the capacity to prevent MES dissolution, possibly through disruption of coordinated cell migration 282 . Additionally, several NECTIN1 W185 embryos developed syndactyly of the first and second digits on the forepaws, further recapitulating the human CLPED1 phenotype 351, 352, 354 . While these findings resolve a long- standing dispute between human familial studies and mouse genetic models, numerous questions remain. Our experiments still do not address the dominant-negative molecular mechanism of the NECTIN1 W185 variant, nor do they explicitly define how nectin-1 and nectin-4 may compensate for one another upon single loss of the other. Recent studies have begun to characterize a novel mechanism of genetic compensation called “transcriptional adaptation” wherein mRNA degradation products of mutant transcripts—such as those commonly generated via recombination in knockout alleles—can be utilized to increase the transcription of similar genes 362 . This phenomenon appears to explain a number of phenotypic variances between knockout alleles and loss-of-function alleles achieved by RNAi or morpholino for the very same gene 433 . Since the latter techniques do not produce mRNA degradation products as many knockout alleles do, they are less likely to display transcriptional adaptation. This mechanism could explain the differences between CP phenotypes in Nectin1 null mice compared to our Nectin1 RNAi alleles, as the Nectin1 knockout allele may induce transcriptional adaptation from nectin-2, -3, or -4. However, this still would not explain how nectin-1 and nectin-4 may 150 compensate for loss of the other in our RNAi experiments. The most likely mechanism has to do with the ability of different nectins to form homo- or heterotypic trans interactions with each of the other family members. Based on our findings, we assume that nectin-1 cis dimers on the apical surface of the basal palatal epithelia form heterotetramers with necitn-4 cis dimers on the basal surface of periderm. Upon loss of nectin-4, nectin-1 may be able to form homotypic trans interactions between the two cell layers, and vice versa. Alternatively, we did not explore the expression patterns of nectin-2, which has previously been reported to be expressed in the palatal epithelia 236 . Therefore, it remains possible that nectin-2 plays a significant role in compensating for loss of nectin-1 or necint-4 alone but is unable to compensate for loss of both. While previous studies have suggested that nectin-3 is not expressed by the palatal epithelium 236 , Nectin1/Nectin3 double knockouts display early embryonic lethality 78 , suggesting that nectin-3 may play an important role compensating for Necitn1 loss in a variety of contexts. These theories similarly explain the most likely mechanism of the NECTIN1 W185 mutant’s dominant negative activity. Given that this truncation still includes the 1 st Ig-like loop, it theoretically retains the ability to form trans interactions with nectin-4. In this way, it could bind the extracellular domains of cell-surface nectin-4, as well as any residual endogenous nectin-1, and inhibit their ability to form trans interactions. However, whether expression of the NECTIN1 W185 truncation interferes with endogenous nectin-4 localization or function, or is even capable of interacting with nectin-4 in vivo remains to be seen. Nonetheless, the studies in Chapter 4 demonstrate that the nectin-afadin complex is essential for secondary palatogenesis and that human CLPED1 mutations cause CP in a dominant negative fashion in transgenic mouse models. However, the molecular mechanisms underlying these observations remain fruitful ground for further exploration. 5.5 Exploring mutations in other cell-cell adhesion genes and their association with CL/P As discussed in Chapter 2, mutations in additional cell-cell adhesion genes cause nonsyndromic cleft lip/palate. These include the canonical AJ proteins E-cadherin ( CDH1 )248-250 and p120-catenin (CTNND 1) 222 . The majority of CP mutations in CDH1 are missense mutations within the extracellular 151 cadherin (EC) repeats, which facilitate trans -homodimerization. The molecular significance of several CDH1 mutations—P30T, D370Y, and D805N—has been explored by expression in nonadherent CHO cells to determine their functional capacity for inducing cell-cell adhesion 250 . P30T occurs in EC1, while D370Y is within EC3, suggesting that both mutations may impact trans-dimerization. D805N occurs in the cytoplasmic tail, just upstream of the catenin binding domain but was predicted to have a “pathogenic effect” in silico 250 . All three mutations showed reduced junctional accumulation by immunofluorescence and failed to induce cell-cell adhesion to the same degree as full-length E-cadherin, suggesting that these variants operate as loss-of-function alleles 250 . Epithelial specific E-cadherin knockout mice are either viable 182 or neonatally lethal 183 depending on the Cre stain used. Palatal epithelia also express P-cadherin (according to MGI GXD 255 ), and combined E- and P-cadherin ( Cdh3 ) loss-of-function mice display defects in epidermal barrier function and neonatal lethality 184 . While, CP has not been reported in the aforementioned mouse transgenics, our results indicate that many Krt14-Cre alleles may not be active early enough to induce recombination and protein degradation prior to palatogenesis. Similarly, knockout of E-cadherin results in compensatory upregulation of P-cadherin in the epidermis 182, 183 . Therefore, LUGGIGE may present significant advantages for investigating cadherin function in palatogenesis. The novel double shRNA construct utilized in Chapter 4 could similarly be used to express validated shRNAs targeting Cdh1 and Cdh3 . Additionally, an array of CDH1 CP mutations have been described, some of which have been validated to effect cell-cell adhesion in vitro . Whether these mutations cause CP in mice and what the pathogenic mechanism is, remains unknown. Similarly, a recent study identified eight CP-associated mutations in p120-catenin ( CTNND 1) 222 , which binds to the E-cadherin juxtamembrane domain and regulates its stability at the cell membrane. Four of these mutations were predicted to result in nonsense mediated decay—likely functioning as CTNND1 loss of function alleles—while the remaining four were missense mutations (D499G, L558F, R584W, and W690C) within the Armadillo repeats required for p120-catenin binding to E-cadherin. These latter mutations may function by impairing the p120-catenin/E-cadherin interaction, causing E- 152 cadherin to be destabilized at sites of cell-cell contact. The same group validated the role of Ctnnd1 loss in vivo using a murine conditional floxed allele crossed to an epithelial specific Tfap2-Cre strain. The resultant Ctnnd1 knockouts displayed numerous craniofacial defects, including moderately penetrant CP and a variety of cleft lip phenotypes 222 . These findings confirm that p120-catenin is required for palatogenesis, though whether the mechanism is mediated through p120-catenin’s role in E-cadherin stabilization, or some other pathway, is unknown. Expression of the CP causal variants in CDH1 and CTNND1 in embryonic mice would further elucidate how these mutations impair palatogenesis and open avenues for future in utero genetic therapies. 153 5.6 Figures Polarity cue Spindle orientation machinery 4 1 2 3 Figure 5.1 Determination of division orientation Classically, the final axis of division is determined by four progressive factors during mitosis. (1) First, asymmetric positioning of a polarity cue (e.g. apico-basal polarity; green crescent) may occur during interphase or upon mitotic entry. (2) Secondly, the centrosome is duplicated and one or both centrosomes migrate towards opposite poles. (3) The metaphase spindle is built in alignment with the centrosome axis. Concurrently, the spindle orientation machinery (red crescent) are recruited in a polarity-dependent manner. Once established, the spindle ‘rocks’—changing rotational direction numerous times—as the spindle orientation machinery pulls on astral microtubules. As metaphase ends, the spindle completes its rotation to align more precisely with the polarity cue. (4) At this point, cytokinesis begins with the formation of the cleavage furrow orthogonal to the axis of the mitotic spindle. Abscission completes, resulting in two daughter cells. 154 APPENDIX 1: CELL-CELL ADHESION PROTEINS PRESENT IN THE MEE Common Cellular Gene Name Name Complex/Role Evidence of presence Antibody Localization Evidence Notes Reference Additional evidence that these cells form Enriched between periderm cells (E13.5). functional tight junctions (while basal cells do not) Cldn4 Claudin-4 Tight Junction Immunofluorescence Present throughout MEE (E14.5). via inside-out biotin barrier assay. Yoshida, et al. 2012. Ocln Occludin Tight Junction Immunofluorescence Enriched between periderm cells (E13.5-14.5) (See above) Yoshida, et al. 2012. Tjp1 ZO-1 Tight Junction Immunofluorescence Enriched between periderm cells (E13.5-14.5) (See above) Yoshida, et al. 2012. The ca dh erin/ca te nin co mpl ex molecu les appe ar to all colocalize in basal cells and between alpha-E- Adherens Present throughout basal cells of MEE (E13.5- periderm cells as well. All are absent from the Tudela, et al. 2002. Ctnna1 catenin Junction Immunofluorescence E15.5) apical surface of periderm cells. Yoshida, et al. 2012. Adherens Present throughout basal cells of MEE (E13.5- Tudela, et al. 2002. Ctnnb1 beta-catenin Junction Immunofluorescence E15.5) (See above) Yoshida, et al. 2012. Luning, et al. 1994. Tudela, et al. 2002. Adherens Present throughout basal cells of MEE (E13.5- Yoshida, et al. 2012. Cdh1 E-cadherin Junction Immunofluorescence E15.5) (See above) Kim, et al. 2015 Difficu lt to de te rmine su bce llular loca lizati on or Adherens Present throughout basal cells of MEE (E13.5- presence in periderm cells due to low resolution Vcl Vinculin Junction Immunofluorescence E15.5) of microscopy. Tudela, et al. 2002. Api ca lly enrich ed in ba sa l ce lls (E13.5). Ne cti n 1 and 2 sh ow di fferenti al loca lizati on Marti nez-Sanz, et al. Present throughout MEE (E14.5). Absent within the developing MEE while nectin 3 appears 2008. Yoshida, et al. 155 Nectin1 Nectin-1 Nectin/Afadin Immunofluorescence from MES (E15.5). to be absent entirely. 2012. Present thoughout basal cells of MEE (E13.5- Nectin2 Nectin-2 Nectin/Afadin Immunofluorescence E15.5) Absent from periderm cells? (See above) Yoshida, et al. 2012. Inte resti ngl y, afadi n appe ars to be enrich ed in periderm cells, even at the apical surface, despite the lack of any apical Nectin (based on Afdn Afadin Nectin/Afadin Immunofluorescence Present thoughout the MEE (E13.5-E15.5) Yoshida, et al. 2012) Yoshida, et al. 2012. According to RT-PCR and WB data, it would appear that all three desmogleins are expressed in the developing MEE. However, we were unable Single transcript detected by RT-PCR (E13- to find any attempts to immunostain for these Dsg1 Desmoglein-1 Desmosome RT-PCR E16) proteins in tissue sections. Mogass, et al. 2000. Single transcript detected by RT-PCR (E13- Dsg2 Desmoglein-2 Desmosome RT-PCR E16) (See above) Mogass, et al. 2000. Immunostaining present in mouse palate lysates (E13-E15); RT-PCR demonstrates Dsg3 Desmoglein-3 Desmosome Western Blot/RT-PCR similar results (See above) Mogass, et al. 2000. Immunohistochemistry/RT- Detected via both IHC (E14.5) and RT-PCR Dsp Desmoplakin Desmosome PCR (E13-E16) in the develping MEE. N/A Mogass, et al. 2000. Inte resti ngl y, RT-PC R da ta indi ca te d th at DSC-2 Two splice variants detected at similar levels and DSC-3, but not DSC-1, are expressed in the Dsc2 Desmocollin 2 Desmosome RT-PCR by RT-PCR (E13-E16) developing MEE. Mogass, et al. 2000. Single transcript detected by RT-PCR (E13- Dsc3 Desmocollin 3 Desmosome RT-PCR E16) (See above) Mogass, et al. 2000. Appendix 1 | Cell-cell adhesion proteins present in the MEE This table lists the cell-cell adhesion molecules shown to be present in the MEE, as well as the evidence supporting this claim. It is important to highlight the relatively few studies that have characterized expression and/or localization of cell-cell adhesion molecules within the MEE. Even fewer have characterized the expression or localization patterns of these molecules across developmental stages or sought to clearly distinguish between basal cell/periderm homo- or heterotypic contacts. 156 APPENDIX 2: GENETIC MOUSE MODELS OF CELL-CELL ADHESION GENES 157 158 159 160 161 Appendix 2 | Genetically engineered mouse models of cell-cell adhesion genes This table summarizes data from the Mouse Genome Informatics database, listing all known alleles for cell-cell adhesion genes utilized in peer-reviewed studies. This table includes notes on the specifics of the allele generated, whether the allele has any effects on animal viability, and whether any studies have reported CL/P associated with that allele. References listed are either the original reference, or the study most likely to have affected palate closure (i.e. in the case of a previously generated floxed allele, the reference may be the first study to simultaneously express Cre in the MEE). 162 APPENDIX 3: K14-CRE LINES UTILIZED TO GENERATE GENETIC MODELS OF CP 163 Appendix 3 | K14-Cre mouse lines utilized to generate genetic models of CP This table summarizes, to the best of our knowledge, studies of cleft palate incidence using Krt14- Cre transgenic lines to conditionally ablate the indicated gene(s) in palatal epithelium. The specific Krt14-Cre driver line is indicated by the name of the senior author of the lab that created the line. As evidenced from this table, Sarah Millar’s lines are the most widely used. It is also important to note that there are actually three separate transgenic founders created by the Millar lab: line 40 (MGI:3046574), 43 (MGI:3046575) and 52 (MGI:3046576). Also of note is the varying penetrance of CP in different conditional knockouts of the same gene, depending on the Krt14-Cre driver used (e.g. Ctnnb1, Shh, Smad4 ). 164 REFERENCES 1. Cimino, G. et al. Cloning of ALL-1, the locus involved in leukemias with the t(4;11)(q21;q23), t(9;11)(p22;q23), and t(11;19)(q23;p13) chromosome translocations. Cancer Res 51 , 6712-6714 (1991). 2. Prasad, R. et al. Cloning of the ALL-1 fusion partner, the AF-6 gene, involved in acute myeloid leukemias with the t(6;11) chromosome translocation. Cancer Res 53 , 5624- 5628 (1993). 3. Mandai, K. et al. Afadin: A novel actin filament-binding protein with one PDZ domain localized at cadherin-based cell-to-cell adherens junction. The Journal of cell biology 139 , 517-528 (1997). 4. Asada, M. et al. ADIP, a novel Afadin- and alpha-actinin-binding protein localized at cell-cell adherens junctions. The Journal of biological chemistry 278 , 4103-4111 (2003). 5. Boettner, B., Govek, E.E., Cross, J. & Van Aelst, L. The junctional multidomain protein AF-6 is a binding partner of the Rap1A GTPase and associates with the actin cytoskeletal regulator profilin. Proceedings of the National Academy of Sciences of the United States of America 97 , 9064-9069 (2000). 6. Kuriyama, M. et al. Identification of AF-6 and canoe as putative targets for Ras. The Journal of biological chemistry 271 , 607-610 (1996). 7. Liedtke, M., Ayton, P.M., Somervaille, T.C., Smith, K.S. & Cleary, M.L. Self-association mediated by the Ras association 1 domain of AF6 activates the oncogenic potential of MLL-AF6. Blood 116 , 63-70 (2010). 8. Takahashi, K. et al. Nectin/PRR: an immunoglobulin-like cell adhesion molecule recruited to cadherin-based adherens junctions through interaction with Afadin, a PDZ domain-containing protein. The Journal of cell biology 145 , 539-549 (1999). 9. Reymond, N. et al. Nectin4/PRR4, a new afadin-associated member of the nectin family that trans-interacts with nectin1/PRR1 through V domain interaction. The Journal of biological chemistry 276 , 43205-43215 (2001). 165 10. Zhou, H. et al. Solution structure of AF-6 PDZ domain and its interaction with the C- terminal peptides from Neurexin and Bcr. The Journal of biological chemistry 280 , 13841-13847 (2005). 11. Buchert, M. et al. The junction-associated protein AF-6 interacts and clusters with specific Eph receptor tyrosine kinases at specialized sites of cell-cell contact in the brain. The Journal of cell biology 144 , 361-371 (1999). 12. Pulimeno, P., Bauer, C., Stutz, J. & Citi, S. PLEKHA7 is an adherens junction protein with a tissue distribution and subcellular localization distinct from ZO-1 and E-cadherin. PloS one 5, e12207 (2010). 13. Kurita, S., Yamada, T., Rikitsu, E., Ikeda, W. & Takai, Y. Binding between the junctional proteins afadin and PLEKHA7 and implication in the formation of adherens junction in epithelial cells. The Journal of biological chemistry 288 , 29356-29368 (2013). 14. Shah, J. et al. A Dock-and-Lock Mechanism Clusters ADAM10 at Cell-Cell Junctions to Promote alpha-Toxin Cytotoxicity. Cell Rep 25 , 2132-2147 e2137 (2018). 15. Severson, E.A., Lee, W.Y., Capaldo, C.T., Nusrat, A. & Parkos, C.A. Junctional adhesion molecule A interacts with Afadin and PDZ-GEF2 to activate Rap1A, regulate beta1 integrin levels, and enhance cell migration. Molecular biology of the cell 20 , 1916-1925 (2009). 16. Yamamoto, T. et al. The Ras target AF-6 interacts with ZO-1 and serves as a peripheral component of tight junctions in epithelial cells. The Journal of cell biology 139 , 785-795 (1997). 17. Mandai, K. et al. Ponsin/SH3P12: an l-afadin- and vinculin-binding protein localized at cell-cell and cell-matrix adherens junctions. The Journal of cell biology 144 , 1001-1017 (1999). 18. Popovic, M. et al. The interaction of Jagged-1 cytoplasmic tail with afadin PDZ domain is local, folding-independent, and tuned by phosphorylation. Journal of molecular recognition : JMR 24 , 245-253 (2011). 19. Pokutta, S., Drees, F., Takai, Y., Nelson, W.J. & Weis, W.I. Biochemical and structural definition of the l-afadin- and actin-binding sites of alpha-catenin. The Journal of biological chemistry 277 , 18868-18874 (2002). 166 20. Carminati, M., Cecatiello, V. & Mapelli, M. Crystallization and X-ray diffraction of LGN in complex with the actin-binding protein afadin. Acta Crystallogr F Struct Biol Commun 72 , 145-151 (2016). 21. Carminati, M. et al. Concomitant binding of Afadin to LGN and F-actin directs planar spindle orientation. Nat Struct Mol Biol 23 , 155-163 (2016). 22. Jurgens, G., Wieschaus, E., Nusslein-Volhard, C. & Kluding, H. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : II. Zygotic loci on the third chromosome. Wilehm Roux Arch Dev Biol 193 , 283-295 (1984). 23. Nusslein-Volhard, C., Wieschaus, E. & Kluding, H. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : I. Zygotic loci on the second chromosome. Wilehm Roux Arch Dev Biol 193 , 267-282 (1984). 24. Wieschaus, E., Nusslein-Volhard, C. & Jurgens, G. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : III. Zygotic loci on the X-chromosome and fourth chromosome. Wilehm Roux Arch Dev Biol 193 , 296-307 (1984). 25. Matsuo, T., Takahashi, K., Kondo, S., Kaibuchi, K. & Yamamoto, D. Regulation of cone cell formation by Canoe and Ras in the developing Drosophila eye. Development 124 , 2671-2680 (1997). 26. Wee, B., Johnston, C.A., Prehoda, K.E. & Doe, C.Q. Canoe binds RanGTP to promote Pins(TPR)/Mud-mediated spindle orientation. J Cell Biol 195 , 369-376 (2011). 27. Boettner, B. et al. The AF-6 homolog canoe acts as a Rap1 effector during dorsal closure of the Drosophila embryo. Genetics 165 , 159-169 (2003). 28. Wei, S.Y. et al. Echinoid is a component of adherens junctions that cooperates with DE- Cadherin to mediate cell adhesion. Developmental cell 8, 493-504 (2005). 29. Sawyer, J.K., Harris, N.J., Slep, K.C., Gaul, U. & Peifer, M. The Drosophila afadin homologue Canoe regulates linkage of the actin cytoskeleton to adherens junctions during apical constriction. The Journal of cell biology 186 , 57-73 (2009). 30. Takahashi, K., Matsuo, T., Katsube, T., Ueda, R. & Yamamoto, D. Direct binding between two PDZ domain proteins Canoe and ZO-1 and their roles in regulation of the 167 jun N-terminal kinase pathway in Drosophila morphogenesis. Mechanisms of development 78 , 97-111 (1998). 31. Ladoux, B., Nelson, W.J., Yan, J. & Mege, R.M. The mechanotransduction machinery at work at adherens junctions. Integr Biol (Camb) 7, 1109-1119 (2015). 32. Takeichi, M. Functional correlation between cell adhesive properties and some cell surface proteins. The Journal of cell biology 75 , 464-474 (1977). 33. Gallin, W.J., Edelman, G.M. & Cunningham, B.A. Characterization of L-CAM, a major cell adhesion molecule from embryonic liver cells. Proceedings of the National Academy of Sciences of the United States of America 80 , 1038-1042 (1983). 34. Hatta, K. & Takeichi, M. Expression of N-cadherin adhesion molecules associated with early morphogenetic events in chick development. Nature 320 , 447-449 (1986). 35. Nose, A. & Takeichi, M. A novel cadherin cell adhesion molecule: its expression patterns associated with implantation and organogenesis of mouse embryos. The Journal of cell biology 103 , 2649-2658 (1986). 36. Lampugnani, M.G. et al. The molecular organization of endothelial cell to cell junctions: differential association of plakoglobin, beta-catenin, and alpha-catenin with vascular endothelial cadherin (VE-cadherin). The Journal of cell biology 129 , 203-217 (1995). 37. Franke, W.W. Discovering the molecular components of intercellular junctions--a historical view. Cold Spring Harb Perspect Biol 1, a003061 (2009). 38. Ozawa, M., Baribault, H. & Kemler, R. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. The EMBO journal 8, 1711-1717 (1989). 39. Peifer, M. & Wieschaus, E. The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin. Cell 63 , 1167- 1176 (1990). 40. Reynolds, A.B. et al. Identification of a new catenin: the tyrosine kinase substrate p120cas associates with E-cadherin complexes. Molecular and cellular biology 14 , 8333- 8342 (1994). 168 41. Davis, M.A., Ireton, R.C. & Reynolds, A.B. A core function for p120-catenin in cadherin turnover. The Journal of cell biology 163 , 525-534 (2003). 42. Xiao, K. et al. Cellular levels of p120 catenin function as a set point for cadherin expression levels in microvascular endothelial cells. The Journal of cell biology 163 , 535- 545 (2003). 43. Harris, T.J. & Peifer, M. Decisions, decisions: beta-catenin chooses between adhesion and transcription. Trends Cell Biol 15 , 234-237 (2005). 44. Clevers, H. & Nusse, R. Wnt/beta-catenin signaling and disease. Cell 149 , 1192-1205 (2012). 45. Schaefer, K.N. & Peifer, M. Wnt/Beta-Catenin Signaling Regulation and a Role for Biomolecular Condensates. Developmental cell 48 , 429-444 (2019). 46. Oda, H. et al. Identification of a Drosophila homologue of alpha-catenin and its association with the armadillo protein. The Journal of cell biology 121 , 1133-1140 (1993). 47. Drees, F., Pokutta, S., Yamada, S., Nelson, W.J. & Weis, W.I. Alpha-catenin is a molecular switch that binds E-cadherin-beta-catenin and regulates actin-filament assembly. Cell 123 , 903-915 (2005). 48. Buckley, C.D. et al. Cell adhesion. The minimal cadherin-catenin complex binds to actin filaments under force. Science 346 , 1254211 (2014). 49. Yao, M. et al. Force-dependent conformational switch of alpha-catenin controls vinculin binding. Nat Commun 5, 4525 (2014). 50. Choi, H.J. et al. alphaE-catenin is an autoinhibited molecule that coactivates vinculin. Proceedings of the National Academy of Sciences of the United States of America 109 , 8576-8581 (2012). 51. Yonemura, S., Wada, Y., Watanabe, T., Nagafuchi, A. & Shibata, M. alpha-Catenin as a tension transducer that induces adherens junction development. Nature cell biology 12 , 533-542 (2010). 169 52. Geiger, B. A 130K protein from chicken gizzard: its localization at the termini of microfilament bundles in cultured chicken cells. Cell 18 , 193-205 (1979). 53. Burridge, K. & Feramisco, J.R. Microinjection and localization of a 130K protein in living fibroblasts: a relationship to actin and fibronectin. Cell 19 , 587-595 (1980). 54. Geiger, B., Tokuyasu, K.T., Dutton, A.H. & Singer, S.J. Vinculin, an intracellular protein localized at specialized sites where microfilament bundles terminate at cell membranes. Proceedings of the National Academy of Sciences of the United States of America 77 , 4127-4131 (1980). 55. Weiss, E.E., Kroemker, M., Rudiger, A.H., Jockusch, B.M. & Rudiger, M. Vinculin is part of the cadherin-catenin junctional complex: complex formation between alpha- catenin and vinculin. The Journal of cell biology 141 , 755-764 (1998). 56. Johnson, R.P. & Craig, S.W. F-actin binding site masked by the intramolecular association of vinculin head and tail domains. Nature 373 , 261-264 (1995). 57. Thomas, W.A. et al. alpha-Catenin and vinculin cooperate to promote high E-cadherin- based adhesion strength. The Journal of biological chemistry 288 , 4957-4969 (2013). 58. Merkel, C.D., Li, Y., Raza, Q., Stolz, D.B. & Kwiatkowski, A.V. Vinculin anchors contractile actin to the cardiomyocyte adherens junction. Molecular biology of the cell 30 , 2639-2650 (2019). 59. le Duc, Q. et al. Vinculin potentiates E-cadherin mechanosensing and is recruited to actin-anchored sites within adherens junctions in a myosin II-dependent manner. The Journal of cell biology 189 , 1107-1115 (2010). 60. Fanning, A.S., Van Itallie, C.M. & Anderson, J.M. Zonula occludens-1 and -2 regulate apical cell structure and the zonula adherens cytoskeleton in polarized epithelia. Molecular biology of the cell 23 , 577-590 (2012). 61. Choi, W. et al. Remodeling the zonula adherens in response to tension and the role of afadin in this response. J Cell Biol 213 , 243-260 (2016). 62. Ooshio, T. et al. Cooperative roles of Par-3 and afadin in the formation of adherens and tight junctions. Journal of cell science 120 , 2352-2365 (2007). 170 63. Sato, T. et al. Regulation of the assembly and adhesion activity of E-cadherin by nectin and afadin for the formation of adherens junctions in Madin-Darby canine kidney cells. The Journal of biological chemistry 281 , 5288-5299 (2006). 64. Satoh-Horikawa, K. et al. Nectin-3, a new member of immunoglobulin-like cell adhesion molecules that shows homophilic and heterophilic cell-cell adhesion activities. The Journal of biological chemistry 275 , 10291-10299 (2000). 65. Miyahara, M. et al. Interaction of nectin with afadin is necessary for its clustering at cell- cell contact sites but not for its cis dimerization or trans interaction. The Journal of biological chemistry 275 , 613-618 (2000). 66. Momose, Y. et al. Role of the second immunoglobulin-like loop of nectin in cell-cell adhesion. Biochemical and biophysical research communications 293 , 45-49 (2002). 67. Yasumi, M., Shimizu, K., Honda, T., Takeuchi, M. & Takai, Y. Role of each immunoglobulin-like loop of nectin for its cell-cell adhesion activity. Biochemical and biophysical research communications 302 , 61-66 (2003). 68. Tachibana, K. et al. Two cell adhesion molecules, nectin and cadherin, interact through their cytoplasmic domain-associated proteins. The Journal of cell biology 150 , 1161-1176 (2000). 69. Honda, T. et al. Antagonistic and agonistic effects of an extracellular fragment of nectin on formation of E-cadherin-based cell-cell adhesion. Genes to cells : devoted to molecular & cellular mechanisms 8, 51-63 (2003). 70. Honda, T., Shimizu, K., Fukuhara, A., Irie, K. & Takai, Y. Regulation by nectin of the velocity of the formation of adherens junctions and tight junctions. Biochemical and biophysical research communications 306 , 104-109 (2003). 71. Peng, Y.F. et al. Restoration of E-cadherin-based cell-cell adhesion by overexpression of nectin in HSC-39 cells, a human signet ring cell gastric cancer cell line. Oncogene 21 , 4108-4119 (2002). 72. Tanaka, Y. et al. Role of nectin in formation of E-cadherin-based adherens junctions in keratinocytes: analysis with the N-cadherin dominant negative mutant. Molecular biology of the cell 14 , 1597-1609 (2003). 171 73. Takekuni, K. et al. Direct binding of cell polarity protein PAR-3 to cell-cell adhesion molecule nectin at neuroepithelial cells of developing mouse. The Journal of biological chemistry 278 , 5497-5500 (2003). 74. Adachi, M. et al. Similar and distinct properties of MUPP1 and Patj, two homologous PDZ domain-containing tight-junction proteins. Molecular and cellular biology 29 , 2372- 2389 (2009). 75. Inagaki, M. et al. Roles of cell-adhesion molecules nectin 1 and nectin 3 in ciliary body development. Development 132 , 1525-1537 (2005). 76. Barron, M.J. et al. The cell adhesion molecule nectin-1 is critical for normal enamel formation in mice. Hum Mol Genet 17 , 3509-3520 (2008). 77. Bouchard, M.J. et al. Defects in nuclear and cytoskeletal morphology and mitochondrial localization in spermatozoa of mice lacking nectin-2, a component of cell-cell adherens junctions. Mol Cell Biol 20 , 2865-2873 (2000). 78. Yoshida, T., Miyoshi, J., Takai, Y. & Thesleff, I. Cooperation of nectin-1 and nectin-3 is required for normal ameloblast function and crown shape development in mouse teeth. Developmental dynamics : an official publication of the American Association of Anatomists 239 , 2558-2569 (2010). 79. Ozaki-Kuroda, K. et al. Nectin couples cell-cell adhesion and the actin scaffold at heterotypic testicular junctions. Current biology : CB 12 , 1145-1150 (2002). 80. Inagaki, M. et al. Role of cell adhesion molecule nectin-3 in spermatid development. Genes to cells : devoted to molecular & cellular mechanisms 11 , 1125-1132 (2006). 81. Togashi, H. et al. Nectins establish a checkerboard-like cellular pattern in the auditory epithelium. Science 333 , 1144-1147 (2011). 82. Fukuda, T. et al. Aberrant cochlear hair cell attachments caused by Nectin-3 deficiency result in hair bundle abnormalities. Development 141 , 399-409 (2014). 83. Katsunuma, S. et al. Synergistic action of nectins and cadherins generates the mosaic cellular pattern of the olfactory epithelium. The Journal of cell biology 212 , 561-575 (2016). 172 84. Wakamatsu, K. et al. Up-regulation of loricrin expression by cell adhesion molecule nectin-1 through Rap1-ERK signaling in keratinocytes. The Journal of biological chemistry 282 , 18173-18181 (2007). 85. Lechler, T. & Fuchs, E. Asymmetric cell divisions promote stratification and differentiation of mammalian skin. Nature 437 , 275-280 (2005). 86. Williams, S.E., Beronja, S., Pasolli, H.A. & Fuchs, E. Asymmetric cell divisions promote Notch-dependent epidermal differentiation. Nature 470 , 353-358 (2011). 87. Rakotomamonjy, J. et al. Afadin controls cell polarization and mitotic spindle orientation in developing cortical radial glia. Neural Dev 12 , 7 (2017). 88. Speicher, S., Fischer, A., Knoblich, J. & Carmena, A. The PDZ protein Canoe regulates the asymmetric division of Drosophila neuroblasts and muscle progenitors. Curr Biol 18 , 831-837 (2008). 89. Knoblich, J.A., Jan, L.Y. & Jan, Y.N. Asymmetric segregation of Numb and Prospero during cell division. Nature 377 , 624-627 (1995). 90. Ikeshima-Kataoka, H., Skeath, J.B., Nabeshima, Y., Doe, C.Q. & Matsuzaki, F. Miranda directs Prospero to a daughter cell during Drosophila asymmetric divisions. Nature 390 , 625-629 (1997). 91. Shen, C.P., Jan, L.Y. & Jan, Y.N. Miranda is required for the asymmetric localization of Prospero during mitosis in Drosophila. Cell 90 , 449-458 (1997). 92. Lu, B., Rothenberg, M., Jan, L.Y. & Jan, Y.N. Partner of Numb colocalizes with Numb during mitosis and directs Numb asymmetric localization in Drosophila neural and muscle progenitors. Cell 95 , 225-235 (1998). 93. Wang, H., Ouyang, Y., Somers, W.G., Chia, W. & Lu, B. Polo inhibits progenitor self- renewal and regulates Numb asymmetry by phosphorylating Pon. Nature 449 , 96-100 (2007). 94. Betschinger, J., Mechtler, K. & Knoblich, J.A. Asymmetric segregation of the tumor suppressor brat regulates self-renewal in Drosophila neural stem cells. Cell 124 , 1241- 1253 (2006). 173 95. Lee, C.Y., Wilkinson, B.D., Siegrist, S.E., Wharton, R.P. & Doe, C.Q. Brat is a Miranda cargo protein that promotes neuronal differentiation and inhibits neuroblast self-renewal. Developmental cell 10 , 441-449 (2006). 96. Schweisguth, F. Regulation of notch signaling activity. Current biology : CB 14 , R129- 138 (2004). 97. Lee, C.Y. et al. Drosophila Aurora-A kinase inhibits neuroblast self-renewal by regulating aPKC/Numb cortical polarity and spindle orientation. Genes & development 20 , 3464-3474 (2006). 98. Wang, H. et al. Aurora-A acts as a tumor suppressor and regulates self-renewal of Drosophila neuroblasts. Genes & development 20 , 3453-3463 (2006). 99. Choksi, S.P. et al. Prospero acts as a binary switch between self-renewal and differentiation in Drosophila neural stem cells. Developmental cell 11 , 775-789 (2006). 100. Reichardt, I. et al. The tumor suppressor Brat controls neuronal stem cell lineages by inhibiting Deadpan and Zelda. EMBO reports 19 , 102-117 (2018). 101. Kraut, R., Chia, W., Jan, L.Y., Jan, Y.N. & Knoblich, J.A. Role of inscuteable in orienting asymmetric cell divisions in Drosophila. Nature 383 , 50-55 (1996). 102. Wodarz, A., Ramrath, A., Kuchinke, U. & Knust, E. Bazooka provides an apical cue for Inscuteable localization in Drosophila neuroblasts. Nature 402 , 544-547 (1999). 103. Yu, F., Morin, X., Cai, Y., Yang, X. & Chia, W. Analysis of partner of inscuteable, a novel player of Drosophila asymmetric divisions, reveals two distinct steps in inscuteable apical localization. Cell 100 , 399-409 (2000). 104. Schaefer, M., Shevchenko, A., Shevchenko, A. & Knoblich, J.A. A protein complex containing Inscuteable and the Galpha-binding protein Pins orients asymmetric cell divisions in Drosophila. Current biology : CB 10 , 353-362 (2000). 105. Du, Q., Taylor, L., Compton, D.A. & Macara, I.G. LGN blocks the ability of NuMA to bind and stabilize microtubules. A mechanism for mitotic spindle assembly regulation. Current biology : CB 12 , 1928-1933 (2002). 174 106. Du, Q. & Macara, I.G. Mammalian Pins is a conformational switch that links NuMA to heterotrimeric G proteins. Cell 119 , 503-516 (2004). 107. Siller, K.H., Cabernard, C. & Doe, C.Q. The NuMA-related Mud protein binds Pins and regulates spindle orientation in Drosophila neuroblasts. Nature cell biology 8, 594-600 (2006). 108. Siller, K.H. & Doe, C.Q. Lis1/dynactin regulates metaphase spindle orientation in Drosophila neuroblasts. Developmental biology 319 , 1-9 (2008). 109. Rolls, M.M., Albertson, R., Shih, H.P., Lee, C.Y. & Doe, C.Q. Drosophila aPKC regulates cell polarity and cell proliferation in neuroblasts and epithelia. The Journal of cell biology 163 , 1089-1098 (2003). 110. Atwood, S.X. & Prehoda, K.E. aPKC phosphorylates Miranda to polarize fate determinants during neuroblast asymmetric cell division. Current biology : CB 19 , 723- 729 (2009). 111. Lee, C.Y., Robinson, K.J. & Doe, C.Q. Lgl, Pins and aPKC regulate neuroblast self- renewal versus differentiation. Nature 439 , 594-598 (2006). 112. Peng, C.Y., Manning, L., Albertson, R. & Doe, C.Q. The tumour-suppressor genes lgl and dlg regulate basal protein targeting in Drosophila neuroblasts. Nature 408 , 596-600 (2000). 113. Albertson, R. & Doe, C.Q. Dlg, Scrib and Lgl regulate neuroblast cell size and mitotic spindle asymmetry. Nature cell biology 5, 166-170 (2003). 114. Justice, N., Roegiers, F., Jan, L.Y. & Jan, Y.N. Lethal giant larvae acts together with numb in notch inhibition and cell fate specification in the Drosophila adult sensory organ precursor lineage. Current biology : CB 13 , 778-783 (2003). 115. Li, P., Yang, X., Wasser, M., Cai, Y. & Chia, W. Inscuteable and Staufen mediate asymmetric localization and segregation of prospero RNA during Drosophila neuroblast cell divisions. Cell 90 , 437-447 (1997). 116. Broadus, J., Fuerstenberg, S. & Doe, C.Q. Staufen-dependent localization of prospero mRNA contributes to neuroblast daughter-cell fate. Nature 391 , 792-795 (1998). 175 117. Matsuzaki, F., Ohshiro, T., Ikeshima-Kataoka, H. & Izumi, H. miranda localizes staufen and prospero asymmetrically in mitotic neuroblasts and epithelial cells in early Drosophila embryogenesis. Development 125 , 4089-4098 (1998). 118. Jia, M. et al. The structural basis of Miranda-mediated Staufen localization during Drosophila neuroblast asymmetric division. Nat Commun 6, 8381 (2015). 119. Lancaster, M.A. & Knoblich, J.A. Spindle orientation in mammalian cerebral cortical development. Curr Opin Neurobiol 22 , 737-746 (2012). 120. Tang, N., Marshall, W.F., McMahon, M., Metzger, R.J. & Martin, G.R. Control of mitotic spindle angle by the RAS-regulated ERK1/2 pathway determines lung tube shape. Science 333 , 342-345 (2011). 121. Quyn, A.J. et al. Spindle orientation bias in gut epithelial stem cell compartments is lost in precancerous tissue. Cell Stem Cell 6, 175-181 (2010). 122. Morris, E.J., Assi, K., Salh, B. & Dedhar, S. Integrin-linked kinase links dynactin- 1/dynactin-2 with cortical integrin receptors to orient the mitotic spindle relative to the substratum. Sci Rep 5, 8389 (2015). 123. Cicalese, A. et al. The tumor suppressor p53 regulates polarity of self-renewing divisions in mammary stem cells. Cell 138 , 1083-1095 (2009). 124. Regan, J.L. et al. Aurora A kinase regulates mammary epithelial cell fate by determining mitotic spindle orientation in a Notch-dependent manner. Cell Rep 4, 110-123 (2013). 125. Culurgioni, S. et al. Insc:LGN tetramers promote asymmetric divisions of mammary stem cells. Nat Commun 9, 1025 (2018). 126. Smart, I.H. Variation in the plane of cell cleavage during the process of stratification in the mouse epidermis. Br J Dermatol 82 , 276-282 (1970). 127. Williams, S.E., Ratliff, L.A., Postiglione, M.P., Knoblich, J.A. & Fuchs, E. Par3-mInsc and Galphai3 cooperate to promote oriented epidermal cell divisions through LGN. Nat Cell Biol 16 , 758-769 (2014). 176 128. Cowan, C.R. & Hyman, A.A. Asymmetric cell division in C. elegans: cortical polarity and spindle positioning. Annual review of cell and developmental biology 20 , 427-453 (2004). 129. Furman, D.P. & Bukharina, T.A. Drosophila mechanoreceptors as a model for studying asymmetric cell division. Int J Dev Biol 55 , 133-141 (2011). 130. Watt, F.M. & Green, H. Stratification and terminal differentiation of cultured epidermal cells. Nature 295 , 434-436 (1982). 131. Watt, F.M. Selective migration of terminally differentiating cells from the basal layer of cultured human epidermis. The Journal of cell biology 98 , 16-21 (1984). 132. Watt, F.M. Epidermal stem cells: markers, patterning and the control of stem cell fate. Philos Trans R Soc Lond B Biol Sci 353 , 831-837 (1998). 133. Poulson, N.D. & Lechler, T. Robust control of mitotic spindle orientation in the developing epidermis. J Cell Biol 191 , 915-922 (2010). 134. Rangarajan, A. et al. Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. The EMBO journal 20 , 3427-3436 (2001). 135. Blanpain, C., Lowry, W.E., Pasolli, H.A. & Fuchs, E. Canonical notch signaling functions as a commitment switch in the epidermal lineage. Genes & development 20 , 3022-3035 (2006). 136. Watt, F.M., Estrach, S. & Ambler, C.A. Epidermal Notch signalling: differentiation, cancer and adhesion. Current opinion in cell biology 20 , 171-179 (2008). 137. Moriyama, M. et al. Notch signaling via Hes1 transcription factor maintains survival of melanoblasts and melanocyte stem cells. The Journal of cell biology 173 , 333-339 (2006). 138. Estrach, S., Cordes, R., Hozumi, K., Gossler, A. & Watt, F.M. Role of the Notch ligand Delta1 in embryonic and adult mouse epidermis. J Invest Dermatol 128 , 825-832 (2008). 139. Clayton, E. et al. A single type of progenitor cell maintains normal epidermis. Nature 446 , 185-189 (2007). 177 140. Yamashita, Y.M., Jones, D.L. & Fuller, M.T. Orientation of asymmetric stem cell division by the APC tumor suppressor and centrosome. Science 301 , 1547-1550 (2003). 141. Sato, T. et al. Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 469 , 415-418 (2011). 142. McKinley, K.L. et al. Cellular aspect ratio and cell division mechanics underlie the patterning of cell progeny in diverse mammalian epithelia. Elife 7 (2018). 143. Jones, P.H. & Watt, F.M. Separation of human epidermal stem cells from transit amplifying cells on the basis of differences in integrin function and expression. Cell 73 , 713-724 (1993). 144. Jia, M. et al. Crystal structures of the scaffolding protein LGN reveal the general mechanism by which GoLoco binding motifs inhibit the release of GDP from Galphai. The Journal of biological chemistry 287 , 36766-36776 (2012). 145. Yuzawa, S., Kamakura, S., Iwakiri, Y., Hayase, J. & Sumimoto, H. Structural basis for interaction between the conserved cell polarity proteins Inscuteable and Leu-Gly-Asn repeat-enriched protein (LGN). Proceedings of the National Academy of Sciences of the United States of America 108 , 19210-19215 (2011). 146. Culurgioni, S., Alfieri, A., Pendolino, V., Laddomada, F. & Mapelli, M. Inscuteable and NuMA proteins bind competitively to Leu-Gly-Asn repeat-enriched protein (LGN) during asymmetric cell divisions. Proceedings of the National Academy of Sciences of the United States of America 108 , 20998-21003 (2011). 147. Pan, Z. et al. An autoinhibited conformation of LGN reveals a distinct interaction mode between GoLoco motifs and TPR motifs. Structure 21 , 1007-1017 (2013). 148. Takayanagi, H. et al. Intramolecular interaction in LGN, an adaptor protein that regulates mitotic spindle orientation. The Journal of biological chemistry 294 , 19655-19666 (2019). 149. Pirovano, L. et al. Hexameric NuMA:LGN structures promote multivalent interactions required for planar epithelial divisions. Nat Commun 10 , 2208 (2019). 178 150. Hertwig, O. Untersuchungen zur morphologie und physiologie der Zelle: das Problem der Befruchtung und der Isotropie des Eies, eine Theorie der Vererbung , Vol. 3. (Fischer, 1884). 151. Seldin, L., Poulson, N.D., Foote, H.P. & Lechler, T. NuMA localization, stability, and function in spindle orientation involve 4.1 and Cdk1 interactions. Molecular biology of the cell 24 , 3651-3662 (2013). 152. van Leen, E.V., di Pietro, F. & Bellaiche, Y. Oriented cell divisions in epithelia: from force generation to force anisotropy by tension, shape and vertices. Current opinion in cell biology 62 , 9-16 (2020). 153. Manninen, A. Epithelial polarity--generating and integrating signals from the ECM with integrins. Exp Cell Res 334 , 337-349 (2015). 154. Pannekoek, W.J., de Rooij, J. & Gloerich, M. Force transduction by cadherin adhesions in morphogenesis. F1000Res 8 (2019). 155. Luxenburg, C., Pasolli, H.A., Williams, S.E. & Fuchs, E. Developmental roles for Srf, cortical cytoskeleton and cell shape in epidermal spindle orientation. Nature cell biology 13 , 203-214 (2011). 156. Roubinet, C. et al. Spatio-temporally separated cortical flows and spindle geometry establish physical asymmetry in fly neural stem cells. Nat Commun 8, 1383 (2017). 157. Pham, T.T. et al. Spatiotemporally Controlled Myosin Relocalization and Internal Pressure Generate Sibling Cell Size Asymmetry. iScience 13 , 9-19 (2019). 158. Tsankova, A., Pham, T.T., Garcia, D.S., Otte, F. & Cabernard, C. Cell Polarity Regulates Biased Myosin Activity and Dynamics during Asymmetric Cell Division via Drosophila Rho Kinase and Protein Kinase N. Developmental cell 42 , 143-155 e145 (2017). 159. Srinivasan, D.G., Fisk, R.M., Xu, H. & van den Heuvel, S. A complex of LIN-5 and GPR proteins regulates G protein signaling and spindle function in C elegans. Genes & development 17 , 1225-1239 (2003). 160. Sugioka, K. & Bowerman, B. Combinatorial Contact Cues Specify Cell Division Orientation by Directing Cortical Myosin Flows. Developmental cell 46 , 257-270 e255 (2018). 179 161. Scarpa, E., Finet, C., Blanchard, G.B. & Sanson, B. Actomyosin-Driven Tension at Compartmental Boundaries Orients Cell Division Independently of Cell Geometry In Vivo. Developmental cell 47 , 727-740 e726 (2018). 162. Zhou, K. et al. Actin-related protein2/3 complex regulates tight junctions and terminal differentiation to promote epidermal barrier formation. Proceedings of the National Academy of Sciences of the United States of America 110 , E3820-3829 (2013). 163. Dor-On, E. et al. T-plastin is essential for basement membrane assembly and epidermal morphogenesis. Sci Signal 10 (2017). 164. Thery, M. et al. The extracellular matrix guides the orientation of the cell division axis. Nature cell biology 7, 947-953 (2005). 165. Thery, M., Jimenez-Dalmaroni, A., Racine, V., Bornens, M. & Julicher, F. Experimental and theoretical study of mitotic spindle orientation. Nature 447 , 493-496 (2007). 166. Fink, J. et al. External forces control mitotic spindle positioning. Nature cell biology 13 , 771-778 (2011). 167. Kwon, M., Bagonis, M., Danuser, G. & Pellman, D. Direct Microtubule-Binding by Myosin-10 Orients Centrosomes toward Retraction Fibers and Subcortical Actin Clouds. Developmental cell 34 , 323-337 (2015). 168. Fernandez-Minan, A., Martin-Bermudo, M.D. & Gonzalez-Reyes, A. Integrin signaling regulates spindle orientation in Drosophila to preserve the follicular-epithelium monolayer. Current biology : CB 17 , 683-688 (2007). 169. Taddei, I. et al. Beta1 integrin deletion from the basal compartment of the mammary epithelium affects stem cells. Nature cell biology 10 , 716-722 (2008). 170. Goulas, S., Conder, R. & Knoblich, J.A. The Par complex and integrins direct asymmetric cell division in adult intestinal stem cells. Cell Stem Cell 11 , 529-540 (2012). 171. Higashi, T., Arnold, T.R., Stephenson, R.E., Dinshaw, K.M. & Miller, A.L. Maintenance of the Epithelial Barrier and Remodeling of Cell-Cell Junctions during Cytokinesis. Current biology : CB 26 , 1829-1842 (2016). 180 172. Bosveld, F. et al. Epithelial tricellular junctions act as interphase cell shape sensors to orient mitosis. Nature 530 , 495-498 (2016). 173. Le Borgne, R., Bellaiche, Y. & Schweisguth, F. Drosophila E-cadherin regulates the orientation of asymmetric cell division in the sensory organ lineage. Current biology : CB 12 , 95-104 (2002). 174. Inaba, M., Yuan, H., Salzmann, V., Fuller, M.T. & Yamashita, Y.M. E-cadherin is required for centrosome and spindle orientation in Drosophila male germline stem cells. PloS one 5, e12473 (2010). 175. den Elzen, N., Buttery, C.V., Maddugoda, M.P., Ren, G. & Yap, A.S. Cadherin adhesion receptors orient the mitotic spindle during symmetric cell division in mammalian epithelia. Molecular biology of the cell 20 , 3740-3750 (2009). 176. Gloerich, M., Bianchini, J.M., Siemers, K.A., Cohen, D.J. & Nelson, W.J. Cell division orientation is coupled to cell-cell adhesion by the E-cadherin/LGN complex. Nat Commun 8, 13996 (2017). 177. Tall, G.G. & Gilman, A.G. Resistance to inhibitors of cholinesterase 8A catalyzes release of Galphai-GTP and nuclear mitotic apparatus protein (NuMA) from NuMA/LGN/Galphai-GDP complexes. Proceedings of the National Academy of Sciences of the United States of America 102 , 16584-16589 (2005). 178. Hart, K.C. et al. E-cadherin and LGN align epithelial cell divisions with tissue tension independently of cell shape. Proceedings of the National Academy of Sciences of the United States of America 114 , E5845-E5853 (2017). 179. Xiao, K. et al. p120-Catenin regulates clathrin-dependent endocytosis of VE-cadherin. Molecular biology of the cell 16 , 5141-5151 (2005). 180. Wright, C.E., Kushner, E.J., Du, Q. & Bautch, V.L. LGN Directs Interphase Endothelial Cell Behavior via the Microtubule Network. PloS one 10 , e0138763 (2015). 181. Schlegelmilch, K. et al. Yap1 acts downstream of alpha-catenin to control epidermal proliferation. Cell 144 , 782-795 (2011). 181 182. Tinkle, C.L., Lechler, T., Pasolli, H.A. & Fuchs, E. Conditional targeting of E-cadherin in skin: insights into hyperproliferative and degenerative responses. Proceedings of the National Academy of Sciences of the United States of America 101 , 552-557 (2004). 183. Tunggal, J.A. et al. E-cadherin is essential for in vivo epidermal barrier function by regulating tight junctions. The EMBO journal 24 , 1146-1156 (2005). 184. Tinkle, C.L., Pasolli, H.A., Stokes, N. & Fuchs, E. New insights into cadherin function in epidermal sheet formation and maintenance of tissue integrity. Proceedings of the National Academy of Sciences of the United States of America 105 , 15405-15410 (2008). 185. Miroshnikova, Y.A. et al. Adhesion forces and cortical tension couple cell proliferation and differentiation to drive epidermal stratification. Nature cell biology 20 , 69-80 (2018). 186. Bergstralh, D.T., Lovegrove, H.E. & St Johnston, D. Discs large links spindle orientation to apical-basal polarity in Drosophila epithelia. Current biology : CB 23 , 1707-1712 (2013). 187. Finegan, T.M. et al. Tissue tension and not interphase cell shape determines cell division orientation in the Drosophila follicular epithelium. The EMBO journal 38 (2019). 188. Yang, Z. et al. De novo lumen formation and elongation in the developing nephron: a central role for afadin in apical polarity. Development 140 , 1774-1784 (2013). 189. Gao, L. et al. Afadin orients cell division to position the tubule lumen in developing renal tubules. Development 144 , 3511-3520 (2017). 190. Ikeda, W. et al. Afadin: A key molecule essential for structural organization of cell-cell junctions of polarized epithelia during embryogenesis. The Journal of cell biology 146 , 1117-1132 (1999). 191. Cox, R.T., Kirkpatrick, C. & Peifer, M. Armadillo is required for adherens junction assembly, cell polarity, and morphogenesis during Drosophila embryogenesis. The Journal of cell biology 134 , 133-148 (1996). 192. Muller, H.A. & Wieschaus, E. armadillo, bazooka, and stardust are critical for early stages in formation of the zonula adherens and maintenance of the polarized blastoderm epithelium in Drosophila. The Journal of cell biology 134 , 149-163 (1996). 182 193. Tepass, U. et al. shotgun encodes Drosophila E-cadherin and is preferentially required during cell rearrangement in the neurectoderm and other morphogenetically active epithelia. Genes & development 10 , 672-685 (1996). 194. Dawes-Hoang, R.E. et al. folded gastrulation, cell shape change and the control of myosin localization. Development 132 , 4165-4178 (2005). 195. Sawyer, J.K. et al. A contractile actomyosin network linked to adherens junctions by Canoe/afadin helps drive convergent extension. Molecular biology of the cell 22 , 2491- 2508 (2011). 196. Choi, W. et al. The single Drosophila ZO-1 protein Polychaetoid regulates embryonic morphogenesis in coordination with Canoe/afadin and Enabled. Molecular biology of the cell 22 , 2010-2030 (2011). 197. Manning, L.A., Perez-Vale, K.Z., Schaefer, K.N., Sewell, M.T. & Peifer, M. The Drosophila Afadin and ZO-1 homologues Canoe and Polychaetoid act in parallel to maintain epithelial integrity when challenged by adherens junction remodeling. Molecular biology of the cell 30 , 1938-1960 (2019). 198. Harris, T.J. & Peifer, M. Adherens junction-dependent and -independent steps in the establishment of epithelial cell polarity in Drosophila. The Journal of cell biology 167 , 135-147 (2004). 199. Harris, T.J. & Peifer, M. The positioning and segregation of apical cues during epithelial polarity establishment in Drosophila. The Journal of cell biology 170 , 813-823 (2005). 200. Choi, W., Harris, N.J., Sumigray, K.D. & Peifer, M. Rap1 and Canoe/afadin are essential for establishment of apical-basal polarity in the Drosophila embryo. Molecular biology of the cell 24 , 945-963 (2013). 201. Bonello, T.T., Perez-Vale, K.Z., Sumigray, K.D. & Peifer, M. Rap1 acts via multiple mechanisms to position Canoe and adherens junctions and mediate apical-basal polarity establishment. Development 145 (2018). 202. Larue, L., Ohsugi, M., Hirchenhain, J. & Kemler, R. E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proceedings of the National Academy of Sciences of the United States of America 91 , 8263-8267 (1994). 183 203. Torres, M. et al. An alpha-E-catenin gene trap mutation defines its function in preimplantation development. Proceedings of the National Academy of Sciences of the United States of America 94 , 901-906 (1997). 204. Beaudoin, G.M., 3rd et al. Afadin, a Ras/Rap effector that controls cadherin function, promotes spine and excitatory synapse density in the hippocampus. J Neurosci 32 , 99- 110 (2012). 205. Majima, T. et al. Involvement of afadin in the formation and remodeling of synapses in the hippocampus. Biochemical and biophysical research communications 385 , 539-544 (2009). 206. Toyoshima, D. et al. Afadin regulates puncta adherentia junction formation and presynaptic differentiation in hippocampal neurons. PloS one 9, e89763 (2014). 207. Slovakova, J., Speicher, S., Sanchez-Soriano, N., Prokop, A. & Carmena, A. The actin- binding protein Canoe/AF-6 forms a complex with Robo and is required for Slit-Robo signaling during axon pathfinding at the CNS midline. The Journal of neuroscience : the official journal of the Society for Neuroscience 32 , 10035-10044 (2012). 208. Slovakova, J. & Carmena, A. Canoe functions at the CNS midline glia in a complex with Shotgun and Wrapper-Nrx-IV during neuron-glia interactions. Development 138 , 1563- 1571 (2011). 209. Perez-Gomez, R., Slovakova, J., Rives-Quinto, N., Krejci, A. & Carmena, A. A Serrate- Notch-Canoe complex mediates essential interactions between glia and neuroepithelial cells during Drosophila optic lobe development. Journal of cell science 126 , 4873-4884 (2013). 210. Yamamoto, H. et al. Genetic deletion of afadin causes hydrocephalus by destruction of adherens junctions in radial glial and ependymal cells in the midbrain. PloS one 8, e80356 (2013). 211. Tanaka-Okamoto, M. et al. Involvement of afadin in barrier function and homeostasis of mouse intestinal epithelia. Journal of cell science 124 , 2231-2240 (2011). 212. Tanaka-Okamoto, M. et al. Genetic ablation of afadin causes mislocalization and deformation of Paneth cells in the mouse small intestinal epithelium. PloS one 9, e110549 (2014). 184 213. Sun, T.T. et al. Disrupted interaction between CFTR and AF-6/afadin aggravates malignant phenotypes of colon cancer. Biochimica et biophysica acta 1843 , 618-628 (2014). 214. Letessier, A. et al. Correlated break at PARK2/FRA6E and loss of AF-6/Afadin protein expression are associated with poor outcome in breast cancer. Oncogene 26 , 298-307 (2007). 215. Fournier, G. et al. Loss of AF6/afadin, a marker of poor outcome in breast cancer, induces cell migration, invasiveness and tumor growth. Oncogene 30 , 3862-3874 (2011). 216. Elloul, S., Kedrin, D., Knoblauch, N.W., Beck, A.H. & Toker, A. The adherens junction protein afadin is an AKT substrate that regulates breast cancer cell migration. Molecular cancer research : MCR 12 , 464-476 (2014). 217. Azizoglu, D.B., Braitsch, C., Marciano, D.K. & Cleaver, O. Afadin and RhoA control pancreatic endocrine mass via lumen morphogenesis. Genes & development 31 , 2376- 2390 (2017). 218. Majima, T. et al. An Adaptor Molecule Afadin Regulates Lymphangiogenesis by Modulating RhoA Activity in the Developing Mouse Embryo. PloS one 8, e68134 (2013). 219. Tawa, H. et al. Role of afadin in vascular endothelial growth factor- and sphingosine 1- phosphate-induced angiogenesis. Circulation research 106 , 1731-1742 (2010). 220. Zankov, D.P., Sato, A., Shimizu, A. & Ogita, H. Differential Effects of Myocardial Afadin on Pressure Overload-Induced Compensated Cardiac Hypertrophy. Circ J 81 , 1862-1870 (2017). 221. Zankov, D.P., Shimizu, A., Tanaka-Okamoto, M., Miyoshi, J. & Ogita, H. Protective effects of intercalated disk protein afadin on chronic pressure overload-induced myocardial damage. Sci Rep 7, 39335 (2017). 222. Cox, L.L. et al. Mutations in the Epithelial Cadherin-p120-Catenin Complex Cause Mendelian Non-Syndromic Cleft Lip with or without Cleft Palate. American journal of human genetics 102 , 1143-1157 (2018). 185 223. Greene, R.M. & Pratt, R.M. Developmental aspects of secondary palate formation. J Embryol Exp Morphol 36 , 225-245 (1976). 224. Bush, J.O. & Jiang, R. Palatogenesis: morphogenetic and molecular mechanisms of secondary palate development. Development 139 , 231-243 (2012). 225. Walker, B.E., and Fraser, F.C. Closure of the Secondary Palate in Three Strains of Mice. Development 4, 176-189 (1956). 226. Danescu, A., Mattson, M., Dool, C., Diewert, V.M. & Richman, J.M. Analysis of human soft palate morphogenesis supports regional regulation of palatal fusion. J Anat 227 , 474- 486 (2015). 227. Kousa, Y.A., Mansour, T.A., Seada, H., Matoo, S. & Schutte, B.C. Shared molecular networks in orofacial and neural tube development. Birth Defects Res 109 , 169-179 (2017). 228. Lan, Y., Xu, J. & Jiang, R. Cellular and Molecular Mechanisms of Palatogenesis. Current topics in developmental biology 115 , 59-84 (2015). 229. Lane, J. & Kaartinen, V. Signaling networks in palate development. Wiley Interdiscip Rev Syst Biol Med 6, 271-278 (2014). 230. Rinne, T., Brunner, H.G. & van Bokhoven, H. p63-associated disorders. Cell cycle 6, 262-268 (2007). 231. Vanbokhoven, H., Melino, G., Candi, E. & Declercq, W. p63, a story of mice and men. J Invest Dermatol 131 , 1196-1207 (2011). 232. Schutte, B.C., Saal, H.M., Goudy, S. & Leslie, E. IRF6-Related Disorders, in GeneReviews(R) . (eds. R.A. Pagon et al. ) (Seattle (WA); 1993). 233. Ma, L., Shi, B. & Zheng, Q. Targeted mutations of genes reveal important roles in palatal development in mice. Annals of plastic surgery 74 , 263-268 (2015). 234. Dixon, M.J., Marazita, M.L., Beaty, T.H. & Murray, J.C. Cleft lip and palate: understanding genetic and environmental influences. Nature reviews. Genetics 12 , 167- 178 (2011). 186 235. Mandai, K., Rikitake, Y., Shimono, Y. & Takai, Y. Afadin/AF-6 and canoe: roles in cell adhesion and beyond. Progress in molecular biology and translational science 116 , 433- 454 (2013). 236. Yoshida, M. et al. Periderm cells covering palatal shelves have tight junctions and their desquamation reduces the polarity of palatal shelf epithelial cells in palatogenesis. Genes to cells : devoted to molecular & cellular mechanisms 17 , 455-472 (2012). 237. Suzuki, K. et al. Mutations of PVRL1, encoding a cell-cell adhesion molecule/herpesvirus receptor, in cleft lip/palate-ectodermal dysplasia. Nature genetics 25 , 427-430 (2000). 238. Sozen, M.A. et al. Mutation of PVRL1 is associated with sporadic, non-syndromic cleft lip/palate in northern Venezuela. Nat Genet 29 , 141-142 (2001). 239. Avila, J.R. et al. PVRL1 variants contribute to non-syndromic cleft lip and palate in multiple populations. Am J Med Genet A 140 , 2562-2570 (2006). 240. Aslar, D. & Tastan, H. Novel insertion mutation in the PVRL1 gene in Turkish patients with non-syndromic cleft lip with/without cleft palate. Arch Oral Biol 59 , 237-240 (2014). 241. Yoshida, K. et al. Novel homozygous mutation, c.400C>T (p.Arg134*), in the PVRL1 gene underlies cleft lip/palate-ectodermal dysplasia syndrome in an Asian patient. J Dermatol 42 , 715-719 (2015). 242. Kawakatsu, T. et al. Trans-interactions of nectins induce formation of filopodia and Lamellipodia through the respective activation of Cdc42 and Rac small G proteins. The Journal of biological chemistry 277 , 50749-50755 (2002). 243. Yoshida, T. et al. Afadin requirement for cytokine expressions in keratinocytes during chemically induced inflammation in mice. Genes to cells : devoted to molecular & cellular mechanisms 19 , 842-852 (2014). 244. Warrington, A. et al. Genetic evidence for the role of loci at 19q13 in cleft lip and palate. J Med Genet 43 , e26 (2006). 187 245. Brancati, F. et al. Mutations in PVRL4, encoding cell adhesion molecule nectin-4, cause ectodermal dysplasia-syndactyly syndrome. American journal of human genetics 87 , 265- 273 (2010). 246. Fortugno, P. et al. Nectin-4 mutations causing ectodermal dysplasia with syndactyly perturb the rac1 pathway and the kinetics of adherens junction formation. J Invest Dermatol 134 , 2146-2153 (2014). 247. Richardson, R. et al. p63 exerts spatio-temporal control of palatal epithelial cell fate to prevent cleft palate. PLoS Genet 13 , e1006828 (2017). 248. Frebourg, T. et al. Cleft lip/palate and CDH1/E-cadherin mutations in families with hereditary diffuse gastric cancer. J Med Genet 43 , 138-142 (2006). 249. Brito, L.A. et al. Rare Variants in the Epithelial Cadherin Gene Underlying the Genetic Etiology of Nonsyndromic Cleft Lip with or without Cleft Palate. Hum Mutat 36 , 1029- 1033 (2015). 250. Vogelaar, I.P. et al. Identification of germline mutations in the cancer predisposing gene CDH1 in patients with orofacial clefts. Hum Mol Genet 22 , 919-926 (2013). 251. Tudela, C. et al. TGF-beta3 is required for the adhesion and intercalation of medial edge epithelial cells during palate fusion. Int J Dev Biol 46 , 333-336 (2002). 252. Kitase, Y. & Shuler, C.F. Microtubule disassembly prevents palatal fusion and alters regulation of the E-cadherin/catenin complex. Int J Dev Biol 57 , 55-60 (2013). 253. Vasioukhin, V., Degenstein, L., Wise, B. & Fuchs, E. The magical touch: genome targeting in epidermal stem cells induced by tamoxifen application to mouse skin. Proceedings of the National Academy of Sciences of the United States of America 96 , 8551-8556 (1999). 254. Hafner, M. et al. Keratin 14 Cre transgenic mice authenticate keratin 14 as an oocyte- expressed protein. Genesis 38 , 176-181 (2004). 255. Finger, J.H. et al. The mouse Gene Expression Database (GXD): 2017 update. Nucleic Acids Res 45 , D730-D736 (2017). 188 256. Chen, J., Lan, Y., Baek, J.A., Gao, Y. & Jiang, R. Wnt/beta-catenin signaling plays an essential role in activation of odontogenic mesenchyme during early tooth development. Developmental biology 334 , 174-185 (2009). 257. He, F. et al. Epithelial Wnt/beta-catenin signaling regulates palatal shelf fusion through regulation of Tgfbeta3 expression. Developmental biology 350 , 511-519 (2011). 258. Niehrs, C. The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol 13 , 767-779 (2012). 259. He, F. et al. Gsk3beta is required in the epithelium for palatal elevation in mice. Developmental dynamics : an official publication of the American Association of Anatomists 239 , 3235-3246 (2010). 260. Zihni, C., Mills, C., Matter, K. & Balda, M.S. Tight junctions: from simple barriers to multifunctional molecular gates. Nat Rev Mol Cell Biol 17 , 564-580 (2016). 261. Mogass, M., Bringas, P., Jr. & Shuler, C.F. Characterization of desmosomal component expression during palatogenesis. Int J Dev Biol 44 , 317-322 (2000). 262. Sun, D., Vanderburg, C.R., Odierna, G.S. & Hay, E.D. TGFbeta3 promotes transformation of chicken palate medial edge epithelium to mesenchyme in vitro. Development 125 , 95-105 (1998). 263. Ke, C.Y., Xiao, W.L., Chen, C.M., Lo, L.J. & Wong, F.H. IRF6 is the mediator of TGFbeta3 during regulation of the epithelial mesenchymal transition and palatal fusion. Sci Rep 5, 12791 (2015). 264. Miravet, S. et al. The transcriptional factor Tcf-4 contains different binding sites for beta- catenin and plakoglobin. The Journal of biological chemistry 277 , 1884-1891 (2002). 265. Kania, A. & Klein, R. Mechanisms of ephrin-Eph signalling in development, physiology and disease. Nat Rev Mol Cell Biol 17 , 240-256 (2016). 266. Twigg, S.R. et al. Mutations of ephrin-B1 (EFNB1), a marker of tissue boundary formation, cause craniofrontonasal syndrome. Proceedings of the National Academy of Sciences of the United States of America 101 , 8652-8657 (2004). 189 267. Wieland, I. et al. Mutations of the ephrin-B1 gene cause craniofrontonasal syndrome. American journal of human genetics 74 , 1209-1215 (2004). 268. Bush, J.O. & Soriano, P. Ephrin-B1 forward signaling regulates craniofacial morphogenesis by controlling cell proliferation across Eph-ephrin boundaries. Genes & development 24 , 2068-2080 (2010). 269. Risley, M., Garrod, D., Henkemeyer, M. & McLean, W. EphB2 and EphB3 forward signalling are required for palate development. Mechanisms of development 126 , 230-239 (2009). 270. San Miguel, S. et al. Ephrin reverse signaling controls palate fusion via a PI3 kinase- dependent mechanism. Developmental dynamics : an official publication of the American Association of Anatomists 240 , 357-364 (2011). 271. Serrano, M.J., Liu, J., Svoboda, K.K., Nawshad, A. & Benson, M.D. Ephrin reverse signaling mediates palatal fusion and epithelial-to-mesenchymal transition independently of Tgfss3. Journal of cellular physiology 230 , 2961-2972 (2015). 272. Agrawal, P., Wang, M., Kim, S., Lewis, A.E. & Bush, J.O. Embryonic expression of EphA receptor genes in mice supports their candidacy for involvement in cleft lip and palate. Developmental dynamics : an official publication of the American Association of Anatomists 243 , 1470-1476 (2014). 273. Ferone, G., Mollo, M.R. & Missero, C. Epidermal cell junctions and their regulation by p63 in health and disease. Cell Tissue Res 360 , 513-528 (2015). 274. Yang, A. et al. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 398 , 714-718 (1999). 275. Thomason, H.A. et al. Cooperation between the transcription factors p63 and IRF6 is essential to prevent cleft palate in mice. J Clin Invest 120 , 1561-1569 (2010). 276. Richardson, R.J. et al. Periderm prevents pathological epithelial adhesions during embryogenesis. J Clin Invest 124 , 3891-3900 (2014). 277. Hu, L. et al. TGFbeta3 regulates periderm removal through DeltaNp63 in the developing palate. Journal of cellular physiology 230 , 1212-1225 (2015). 190 278. Mollo, M.R. et al. p63-dependent and independent mechanisms of nectin-1 and nectin-4 regulation in the epidermis. Exp Dermatol 24 , 114-119 (2015). 279. Ferone, G. et al. Mutant p63 causes defective expansion of ectodermal progenitor cells and impaired FGF signalling in AEC syndrome. EMBO Mol Med 4, 192-205 (2012). 280. Ferone, G. et al. p63 control of desmosome gene expression and adhesion is compromised in AEC syndrome. Hum Mol Genet 22 , 531-543 (2013). 281. Shimomura, Y., Wajid, M., Shapiro, L. & Christiano, A.M. P-cadherin is a p63 target gene with a crucial role in the developing human limb bud and hair follicle. Development 135 , 743-753 (2008). 282. Kim, S. et al. Convergence and extrusion are required for normal fusion of the mammalian secondary palate. PLoS biology 13 , e1002122 (2015). 283. Moriarty, T.M., Weinstein, S. & Gibson, R.D. The Development in Vitro and in Vivo of Fusion of the Palatal Processes of Rat Embryos. J Embryol Exp Morphol 11 , 605-619 (1963). 284. Ferguson, M.W. Palate development. Development 103 Suppl , 41-60 (1988). 285. Jin, J.Z. & Ding, J. Analysis of cell migration, transdifferentiation and apoptosis during mouse secondary palate fusion. Development 133 , 3341-3347 (2006). 286. Narhi, K. Embryonic Explant Culture: Studying Effects of Regulatory Molecules on Gene Expression in Craniofacial Tissues. Methods Mol Biol 1537 , 367-380 (2017). 287. Zhang, Y. et al. Activation of Notch1 inhibits medial edge epithelium apoptosis in all- trans retinoic acid-induced cleft palate in mice. Biochemical and biophysical research communications 477 , 322-328 (2016). 288. Ahn, Y., Sanderson, B.W., Klein, O.D. & Krumlauf, R. Inhibition of Wnt signaling by Wise (Sostdc1) and negative feedback from Shh controls tooth number and patterning. Development 137 , 3221-3231 (2010). 289. Yang, L.T. & Kaartinen, V. Tgfb1 expressed in the Tgfb3 locus partially rescues the cleft palate phenotype of Tgfb3 null mutants. Developmental biology 312 , 384-395 (2007). 191 290. Xiong, W. et al. Hand2 is required in the epithelium for palatogenesis in mice. Developmental biology 330 , 131-141 (2009). 291. Andl, T. et al. Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 131 , 2257-2268 (2004). 292. Dassule, H.R., Lewis, P., Bei, M., Maas, R. & McMahon, A.P. Sonic hedgehog regulates growth and morphogenesis of the tooth. Development 127 , 4775-4785 (2000). 293. He, F. et al. Modulation of BMP signaling by Noggin is required for the maintenance of palatal epithelial integrity during palatogenesis. Developmental biology 347 , 109-121 (2010). 294. Hosokawa, R. et al. Epithelial-specific requirement of FGFR2 signaling during tooth and palate development. J Exp Zool B Mol Dev Evol 312B , 343-350 (2009). 295. Economou, A.D. et al. Periodic stripe formation by a Turing mechanism operating at growth zones in the mammalian palate. Nat Genet 44 , 348-351 (2012). 296. Rice, R. et al. Disruption of Fgf10/Fgfr2b-coordinated epithelial-mesenchymal interactions causes cleft palate. J Clin Invest 113 , 1692-1700 (2004). 297. Lan, Y. & Jiang, R. Sonic hedgehog signaling regulates reciprocal epithelial- mesenchymal interactions controlling palatal outgrowth. Development 136 , 1387-1396 (2009). 298. Wu, C. et al. Intra-amniotic transient transduction of the periderm with a viral vector encoding TGFbeta3 prevents cleft palate in Tgfbeta3(-/-) mouse embryos. Mol Ther 21 , 8-17 (2013). 299. Beronja, S., Livshits, G., Williams, S. & Fuchs, E. Rapid functional dissection of genetic networks via tissue-specific transduction and RNAi in mouse embryos. Nat Med 16 , 821- 827 (2010). 300. Byrd, K.M. et al. LGN plays distinct roles in oral epithelial stratification, filiform papilla morphogenesis and hair follicle development. Development 143 , 2803-2817 (2016). 301. Knoblich, J.A. Mechanisms of asymmetric stem cell division. Cell 132 , 583-597 (2008). 192 302. Siller, K.H. & Doe, C.Q. Spindle orientation during asymmetric cell division. Nature cell biology 11 , 365-374 (2009). 303. Neumuller, R.A. & Knoblich, J.A. Dividing cellular asymmetry: asymmetric cell division and its implications for stem cells and cancer. Genes & development 23 , 2675-2699 (2009). 304. Knoblich, J.A. Asymmetric cell division: recent developments and their implications for tumour biology. Nat Rev Mol Cell Biol 11 , 849-860 (2010). 305. Martin-Belmonte, F. & Perez-Moreno, M. Epithelial cell polarity, stem cells and cancer. Nat Rev Cancer 12 , 23-38 (2011). 306. Rebollo, E., Roldan, M. & Gonzalez, C. Spindle alignment is achieved without rotation after the first cell cycle in Drosophila embryonic neuroblasts. Development 136 , 3393- 3397 (2009). 307. Geldmacher-Voss, B., Reugels, A.M., Pauls, S. & Campos-Ortega, J.A. A 90-degree rotation of the mitotic spindle changes the orientation of mitoses of zebrafish neuroepithelial cells. Development 130 , 3767-3780 (2003). 308. Haydar, T.F., Ang, E., Jr. & Rakic, P. Mitotic spindle rotation and mode of cell division in the developing telencephalon. Proceedings of the National Academy of Sciences of the United States of America 100 , 2890-2895 (2003). 309. Hyman, A.A. & White, J.G. Determination of cell division axes in the early embryogenesis of Caenorhabditis elegans. The Journal of cell biology 105 , 2123-2135 (1987). 310. Kaltschmidt, J.A., Davidson, C.M., Brown, N.H. & Brand, A.H. Rotation and asymmetry of the mitotic spindle direct asymmetric cell division in the developing central nervous system. Nature cell biology 2, 7-12 (2000). 311. Kotak, S., Busso, C. & Gonczy, P. NuMA interacts with phosphoinositides and links the mitotic spindle with the plasma membrane. The EMBO journal 33 , 1815-1830 (2014). 312. Seldin, L., Muroyama, A. & Lechler, T. NuMA-microtubule interactions are critical for spindle orientation and the morphogenesis of diverse epidermal structures. eLife 10.7554/eLife.12504 (2016). 193 313. Hans, F. & Dimitrov, S. Histone H3 phosphorylation and cell division. Oncogene 20 , 3021-3027 (2001). 314. Caldas, H. et al. Survivin splice variants regulate the balance between proliferation and cell death. Oncogene 24 , 1994-2007 (2005). 315. Beardmore, V.A., Ahonen, L.J., Gorbsky, G.J. & Kallio, M.J. Survivin dynamics increases at centromeres during G2/M phase transition and is regulated by microtubule- attachment and Aurora B kinase activity. J Cell Sci 117 , 4033-4042 (2004). 316. Ichijo, R. et al. Tbx3-dependent amplifying stem cell progeny drives interfollicular epidermal expansion during pregnancy and regeneration. Nat Commun 8, 508 (2017). 317. Ding, X. et al. mTORC1 and mTORC2 regulate skin morphogenesis and epidermal barrier formation. Nat Commun 7, 13226 (2016). 318. Asrani, K. et al. mTORC1 loss impairs epidermal adhesion via TGF-beta/Rho kinase activation. The Journal of clinical investigation 127 , 4001-4017 (2017). 319. Aragona, M. et al. Defining stem cell dynamics and migration during wound healing in mouse skin epidermis. Nat Commun 8, 14684 (2017). 320. Cohen, J. et al. The Wave complex controls epidermal morphogenesis and proliferation by suppressing Wnt-Sox9 signaling. J Cell Biol 218 , 1390-1406 (2019). 321. Liu, N. et al. Stem cell competition orchestrates skin homeostasis and ageing. Nature 568 , 344-350 (2019). 322. Ellis, S.J. et al. Distinct modes of cell competition shape mammalian tissue morphogenesis. Nature 569 , 497-502 (2019). 323. Jones, K.B. et al. Quantitative Clonal Analysis and Single-Cell Transcriptomics Reveal Division Kinetics, Hierarchy, and Fate of Oral Epithelial Progenitor Cells. Cell Stem Cell 24 , 183-192 e188 (2019). 324. Wang, X. et al. E-cadherin bridges cell polarity and spindle orientation to ensure prostate epithelial integrity and prevent carcinogenesis in vivo. PLoS genetics 14 , e1007609 (2018). 194 325. Niessen, M.T. et al. aPKClambda controls epidermal homeostasis and stem cell fate through regulation of division orientation. J Cell Biol 202 , 887-900 (2013). 326. Cetera, M., Leybova, L., Joyce, B. & Devenport, D. Counter-rotational cell flows drive morphological and cell fate asymmetries in mammalian hair follicles. Nature cell biology 20 , 541-552 (2018). 327. Zigman, M. et al. Mammalian inscuteable regulates spindle orientation and cell fate in the developing retina. Neuron 48 , 539-545 (2005). 328. Mora-Bermudez, F., Matsuzaki, F. & Huttner, W.B. Specific polar subpopulations of astral microtubules control spindle orientation and symmetric neural stem cell division. Elife 3 (2014). 329. Bowman, S.K., Neumuller, R.A., Novatchkova, M., Du, Q. & Knoblich, J.A. The Drosophila NuMA Homolog Mud regulates spindle orientation in asymmetric cell division. Developmental cell 10 , 731-742 (2006). 330. Izumi, Y., Ohta, N., Hisata, K., Raabe, T. & Matsuzaki, F. Drosophila Pins-binding protein Mud regulates spindle-polarity coupling and centrosome organization. Nature cell biology 8, 586-593 (2006). 331. Ratheesh, A. & Yap, A.S. A bigger picture: classical cadherins and the dynamic actin cytoskeleton. Nat Rev Mol Cell Biol 13 , 673-679 (2012). 332. Hansen, S.D. et al. alphaE-catenin actin-binding domain alters actin filament conformation and regulates binding of nucleation and disassembly factors. Molecular biology of the cell 24 , 3710-3720 (2013). 333. Rubsam, M. et al. E-cadherin integrates mechanotransduction and EGFR signaling to control junctional tissue polarization and tight junction positioning. Nat Commun 8, 1250 (2017). 334. Huang, D.L., Bax, N.A., Buckley, C.D., Weis, W.I. & Dunn, A.R. Vinculin forms a directionally asymmetric catch bond with F-actin. Science 357 , 703-706 (2017). 335. Seddiki, R. et al. Force-dependent binding of vinculin to alpha-catenin regulates cell-cell contact stability and collective cell behavior. Mol Biol Cell 29 , 380-388 (2018). 195 336. Matsuzawa, K., Himoto, T., Mochizuki, Y. & Ikenouchi, J. alpha-Catenin Controls the Anisotropy of Force Distribution at Cell-Cell Junctions during Collective Cell Migration. Cell reports 23 , 3447-3456 (2018). 337. Vasioukhin, V., Bauer, C., Yin, M. & Fuchs, E. Directed actin polymerization is the driving force for epithelial cell-cell adhesion. Cell 100 , 209-219 (2000). 338. Noethel, B. et al. Transition of responsive mechanosensitive elements from focal adhesions to adherens junctions on epithelial differentiation. Molecular biology of the cell 29 , 2317-2325 (2018). 339. Komura, H. et al. Establishment of cell polarity by afadin during the formation of embryoid bodies. Genes to cells : devoted to molecular & cellular mechanisms 13 , 79-90 (2008). 340. Schober, M., Schaefer, M. & Knoblich, J.A. Bazooka recruits Inscuteable to orient asymmetric cell divisions in Drosophila neuroblasts. Nature 402 , 548-551 (1999). 341. Ouspenskaia, T., Matos, I., Mertz, A.F., Fiore, V.F. & Fuchs, E. WNT-SHH Antagonism Specifies and Expands Stem Cells prior to Niche Formation. Cell 164 , 156-169 (2016). 342. Vasioukhin, V., Bauer, C., Degenstein, L., Wise, B. & Fuchs, E. Hyperproliferation and defects in epithelial polarity upon conditional ablation of alpha-catenin in skin. Cell 104 , 605-617 (2001). 343. Cai, Y., Chia, W. & Yang, X. A family of snail-related zinc finger proteins regulates two distinct and parallel mechanisms that mediate Drosophila neuroblast asymmetric divisions. The EMBO journal 20 , 1704-1714 (2001). 344. Siegrist, S.E. & Doe, C.Q. Microtubule-induced Pins/Galphai cortical polarity in Drosophila neuroblasts. Cell 123 , 1323-1335 (2005). 345. Cheng, J., Tiyaboonchai, A., Yamashita, Y.M. & Hunt, A.J. Asymmetric division of cyst stem cells in Drosophila testis is ensured by anaphase spindle repositioning. Development 138 , 831-837 (2011). 346. Bergstralh, D.T., Lovegrove, H.E. & St Johnston, D. Lateral adhesion drives reintegration of misplaced cells into epithelial monolayers. Nature cell biology 17 , 1497-1503 (2015). 196 347. Zheng, Z. et al. LGN regulates mitotic spindle orientation during epithelial morphogenesis. The Journal of cell biology 189 , 275-288 (2010). 348. Lazaro-Dieguez, F. & Musch, A. Cell-cell adhesion accounts for the different orientation of columnar and hepatocytic cell divisions. The Journal of cell biology 216 , 3847-3859 (2017). 349. Bergstralh, D.T., Dawney, N.S. & St Johnston, D. Spindle orientation: a question of complex positioning. Development 144 , 1137-1145 (2017). 350. Tumbar, T. et al. Defining the epithelial stem cell niche in skin. Science 303 , 359-363 (2004). 351. Zlotogora, J. & Ogur, G. Syndactyly, ectodermal dysplasia, and cleft lip and palate. J Med Genet 25 , 503 (1988). 352. Rodini, E.S. & Richieri-Costa, A. Autosomal recessive ectodermal dysplasia, cleft lip/palate, mental retardation, and syndactyly: the Zlotogora-Ogur syndrome. Am J Med Genet 36 , 473-476 (1990). 353. Bustos, T. et al. Autosomal recessive ectodermal dysplasia: I. An undescribed dysplasia/malformation syndrome. Am J Med Genet 41 , 398-404 (1991). 354. Zlotogora, J. Syndactyly, ectodermal dysplasia, and cleft lip/palate. J Med Genet 31 , 957- 959 (1994). 355. Suzuki, K., Bustos, T. & Spritz, R.A. Linkage disequilibrium mapping of the gene for Margarita Island ectodermal dysplasia (ED4) to 11q23. American journal of human genetics 63 , 1102-1107 (1998). 356. Richardson, R.J., Dixon, J., Jiang, R. & Dixon, M.J. Integration of IRF6 and Jagged2 signalling is essential for controlling palatal adhesion and fusion competence. Hum Mol Genet 18 , 2632-2642 (2009). 357. Hammond, N.L., Dixon, J. & Dixon, M.J. Periderm: Life-cycle and function during orofacial and epidermal development. Semin Cell Dev Biol 91 , 75-83 (2019). 197 358. Mossey, P.A., Little, J., Munger, R.G., Dixon, M.J. & Shaw, W.C. Cleft lip and palate. Lancet 374 , 1773-1785 (2009). 359. Zhadanov, A.B. et al. Absence of the tight junctional protein AF-6 disrupts epithelial cell-cell junctions and cell polarity during mouse development. Current biology : CB 9, 880-888 (1999). 360. Lough, K.J., Byrd, K.M., Spitzer, D.C. & Williams, S.E. Closing the Gap: Mouse Models to Study Adhesion in Secondary Palatogenesis. J Dent Res 96 , 1210-1220 (2017). 361. Lough, K.J. et al. Telophase correction refines division orientation in stratified epithelia. Elife 8 (2019). 362. El-Brolosy, M.A. et al. Genetic compensation triggered by mutant mRNA degradation. Nature 568 , 193-197 (2019). 363. Helfrich, I. et al. Role of aPKC isoforms and their binding partners Par3 and Par6 in epidermal barrier formation. J Invest Dermatol 127 , 782-791 (2007). 364. Johnston, C.A., Hirono, K., Prehoda, K.E. & Doe, C.Q. Identification of an Aurora- A/PinsLINKER/Dlg spindle orientation pathway using induced cell polarity in S2 cells. Cell 138 , 1150-1163 (2009). 365. Hao, Y. et al. Par3 controls epithelial spindle orientation by aPKC-mediated phosphorylation of apical Pins. Current biology : CB 20 , 1809-1818 (2010). 366. Durgan, J., Kaji, N., Jin, D. & Hall, A. Par6B and atypical PKC regulate mitotic spindle orientation during epithelial morphogenesis. The Journal of biological chemistry 286 , 12461-12474 (2011). 367. Tepass, U. Crumbs, a component of the apical membrane, is required for zonula adherens formation in primary epithelia of Drosophila. Developmental biology 177 , 217-225 (1996). 368. von Stein, W., Ramrath, A., Grimm, A., Muller-Borg, M. & Wodarz, A. Direct association of Bazooka/PAR-3 with the lipid phosphatase PTEN reveals a link between the PAR/aPKC complex and phosphoinositide signaling. Development 132 , 1675-1686 (2005). 198 369. Bilder, D., Schober, M. & Perrimon, N. Integrated activity of PDZ protein complexes regulates epithelial polarity. Nature cell biology 5, 53-58 (2003). 370. Hutterer, A., Betschinger, J., Petronczki, M. & Knoblich, J.A. Sequential roles of Cdc42, Par-6, aPKC, and Lgl in the establishment of epithelial polarity during Drosophila embryogenesis. Developmental cell 6, 845-854 (2004). 371. Hong, Y., Stronach, B., Perrimon, N., Jan, L.Y. & Jan, Y.N. Drosophila Stardust interacts with Crumbs to control polarity of epithelia but not neuroblasts. Nature 414 , 634-638 (2001). 372. Bazellieres, E., Assemat, E., Arsanto, J.P., Le Bivic, A. & Massey-Harroche, D. Crumbs proteins in epithelial morphogenesis. Front Biosci (Landmark Ed) 14 , 2149-2169 (2009). 373. Assemat, E. et al. The multi-PDZ domain protein-1 (MUPP-1) expression regulates cellular levels of the PALS-1/PATJ polarity complex. Exp Cell Res 319 , 2514-2525 (2013). 374. den Hollander, A.I. et al. Mutations in a human homologue of Drosophila crumbs cause retinitis pigmentosa (RP12). Nat Genet 23 , 217-221 (1999). 375. den Hollander, A.I. et al. Isolation of Crb1, a mouse homologue of Drosophila crumbs, and analysis of its expression pattern in eye and brain. Mechanisms of development 110 , 203-207 (2002). 376. Xiao, Z. et al. Deficiency in Crumbs homolog 2 (Crb2) affects gastrulation and results in embryonic lethality in mice. Developmental dynamics : an official publication of the American Association of Anatomists 240 , 2646-2656 (2011). 377. Makarova, O., Roh, M.H., Liu, C.J., Laurinec, S. & Margolis, B. Mammalian Crumbs3 is a small transmembrane protein linked to protein associated with Lin-7 (Pals1). Gene 302 , 21-29 (2003). 378. Charrier, L.E., Loie, E. & Laprise, P. Mouse Crumbs3 sustains epithelial tissue morphogenesis in vivo. Sci Rep 5, 17699 (2015). 379. Whiteman, E.L. et al. Crumbs3 is essential for proper epithelial development and viability. Molecular and cellular biology 34 , 43-56 (2014). 199 380. Tepass, U. & Knust, E. Crumbs and stardust act in a genetic pathway that controls the organization of epithelia in Drosophila melanogaster. Developmental biology 159 , 311- 326 (1993). 381. Bachmann, A., Schneider, M., Theilenberg, E., Grawe, F. & Knust, E. Drosophila Stardust is a partner of Crumbs in the control of epithelial cell polarity. Nature 414 , 638- 643 (2001). 382. Hong, Y., Ackerman, L., Jan, L.Y. & Jan, Y.N. Distinct roles of Bazooka and Stardust in the specification of Drosophila photoreceptor membrane architecture. Proceedings of the National Academy of Sciences of the United States of America 100 , 12712-12717 (2003). 383. Nam, S.C. & Choi, K.W. Interaction of Par-6 and Crumbs complexes is essential for photoreceptor morphogenesis in Drosophila. Development 130 , 4363-4372 (2003). 384. Bulgakova, N.A. & Knust, E. The Crumbs complex: from epithelial-cell polarity to retinal degeneration. Journal of cell science 122 , 2587-2596 (2009). 385. Kim, S. et al. The apical complex couples cell fate and cell survival to cerebral cortical development. Neuron 66 , 69-84 (2010). 386. Feldner, A. et al. Loss of Mpdz impairs ependymal cell integrity leading to perinatal- onset hydrocephalus in mice. EMBO Mol Med 9, 890-905 (2017). 387. Yang, J. et al. Murine MPDZ-linked hydrocephalus is caused by hyperpermeability of the choroid plexus. EMBO Mol Med 11 (2019). 388. Benton, R. & St Johnston, D. Drosophila PAR-1 and 14-3-3 inhibit Bazooka/PAR-3 to establish complementary cortical domains in polarized cells. Cell 115 , 691-704 (2003). 389. Tanentzapf, G. & Tepass, U. Interactions between the crumbs, lethal giant larvae and bazooka pathways in epithelial polarization. Nature cell biology 5, 46-52 (2003). 390. Bonello, T.T., Choi, W. & Peifer, M. Scribble and Discs-large direct initial assembly and positioning of adherens junctions during the establishment of apical-basal polarity. Development 146 (2019). 200 391. Betschinger, J., Mechtler, K. & Knoblich, J.A. The Par complex directs asymmetric cell division by phosphorylating the cytoskeletal protein Lgl. Nature 422 , 326-330 (2003). 392. Plant, P.J. et al. A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nature cell biology 5, 301-308 (2003). 393. Hurov, J.B., Watkins, J.L. & Piwnica-Worms, H. Atypical PKC phosphorylates PAR-1 kinases to regulate localization and activity. Current biology : CB 14 , 736-741 (2004). 394. Choi, J., Troyanovsky, R.B., Indra, I., Mitchell, B.J. & Troyanovsky, S.M. Scribble, Erbin, and Lano redundantly regulate epithelial polarity and apical adhesion complex. The Journal of cell biology 218 , 2277-2293 (2019). 395. Saadaoui, M. et al. Dlg1 controls planar spindle orientation in the neuroepithelium through direct interaction with LGN. The Journal of cell biology 206 , 707-717 (2014). 396. Bergstralh, D.T. et al. Pins is not required for spindle orientation in the Drosophila wing disc. Development 143 , 2573-2581 (2016). 397. Ezhkova, E. et al. Ezh2 orchestrates gene expression for the stepwise differentiation of tissue-specific stem cells. Cell 136, 1122-1135 (2009). 398. Sennett, R. et al. An Integrated Transcriptome Atlas of Embryonic Hair Follicle Progenitors, Their Niche, and the Developing Skin. Developmental cell 34 , 577-591 (2015). 399. Asare, A., Levorse, J. & Fuchs, E. Coupling organelle inheritance with mitosis to balance growth and differentiation. Science 355 (2017). 400. Margadant, C., Charafeddine, R.A. & Sonnenberg, A. Unique and redundant functions of integrins in the epidermis. FASEB J 24 , 4133-4152 (2010). 401. Hynes, R.O. Integrins: bidirectional, allosteric signaling machines. Cell 110 , 673-687 (2002). 402. Dowling, J., Yu, Q.C. & Fuchs, E. Beta4 integrin is required for hemidesmosome formation, cell adhesion and cell survival. The Journal of cell biology 134 , 559-572 (1996). 201 403. van der Neut, R., Krimpenfort, P., Calafat, J., Niessen, C.M. & Sonnenberg, A. Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nat Genet 13 , 366-369 (1996). 404. Brakebusch, C. et al. Skin and hair follicle integrity is crucially dependent on beta 1 integrin expression on keratinocytes. The EMBO journal 19 , 3990-4003 (2000). 405. Raghavan, S., Bauer, C., Mundschau, G., Li, Q. & Fuchs, E. Conditional ablation of beta1 integrin in skin. Severe defects in epidermal proliferation, basement membrane formation, and hair follicle invagination. The Journal of cell biology 150 , 1149-1160 (2000). 406. Lorenz, K. et al. Integrin-linked kinase is required for epidermal and hair follicle morphogenesis. The Journal of cell biology 177 , 501-513 (2007). 407. Guo, L. et al. Gene targeting of BPAG1: abnormalities in mechanical strength and cell migration in stratified epithelia and neurologic degeneration. Cell 81 , 233-243 (1995). 408. Georges-Labouesse, E. et al. Absence of integrin alpha 6 leads to epidermolysis bullosa and neonatal death in mice. Nat Genet 13 , 370-373 (1996). 409. Andra, K. et al. Targeted inactivation of plectin reveals essential function in maintaining the integrity of skin, muscle, and heart cytoarchitecture. Genes & development 11 , 3143- 3156 (1997). 410. DiPersio, C.M., Hodivala-Dilke, K.M., Jaenisch, R., Kreidberg, J.A. & Hynes, R.O. alpha3beta1 Integrin is required for normal development of the epidermal basement membrane. The Journal of cell biology 137 , 729-742 (1997). 411. Nishie, W. et al. Humanization of autoantigen. Nat Med 13 , 378-383 (2007). 412. Schmidt, E. & Zillikens, D. Pemphigoid diseases. Lancet 381 , 320-332 (2013). 413. Fine, J.D. et al. Inherited epidermolysis bullosa: updated recommendations on diagnosis and classification. J Am Acad Dermatol 70 , 1103-1126 (2014). 414. Essayem, S. et al. Hair cycle and wound healing in mice with a keratinocyte-restricted deletion of FAK. Oncogene 25 , 1081-1089 (2006). 202 415. Ilic, D. et al. Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature 377 , 539-544 (1995). 416. Schober, M. et al. Focal adhesion kinase modulates tension signaling to control actin and focal adhesion dynamics. The Journal of cell biology 176 , 667-680 (2007). 417. Haage, A. et al. Talin Autoinhibition Regulates Cell-ECM Adhesion Dynamics and Wound Healing In Vivo. Cell Rep 25 , 2401-2416 e2405 (2018). 418. Goult, B.T., Yan, J. & Schwartz, M.A. Talin as a mechanosensitive signaling hub. The Journal of cell biology 217 , 3776-3784 (2018). 419. Sanada, K. & Tsai, L.H. G protein betagamma subunits and AGS3 control spindle orientation and asymmetric cell fate of cerebral cortical progenitors. Cell 122 , 119-131 (2005). 420. Izaki, T., Kamakura, S., Kohjima, M. & Sumimoto, H. Two forms of human Inscuteable- related protein that links Par3 to the Pins homologues LGN and AGS3. Biochemical and biophysical research communications 341 , 1001-1006 (2006). 421. Zhu, J. et al. LGN/mInsc and LGN/NuMA complex structures suggest distinct functions in asymmetric cell division for the Par3/mInsc/LGN and Galphai/LGN/NuMA pathways. Molecular cell 43 , 418-431 (2011). 422. Mauser, J.F. & Prehoda, K.E. Inscuteable regulates the Pins-Mud spindle orientation pathway. PloS one 7, e29611 (2012). 423. Saadaoui, M. et al. Loss of the canonical spindle orientation function in the Pins/LGN homolog AGS3. EMBO reports 18 , 1509-1520 (2017). 424. Bu, P. et al. A miR-34a-Numb Feedforward Loop Triggered by Inflammation Regulates Asymmetric Stem Cell Division in Intestine and Colon Cancer. Cell Stem Cell 18 , 189- 202 (2016). 425. Bu, P. et al. A microRNA miR-34a-regulated bimodal switch targets Notch in colon cancer stem cells. Cell Stem Cell 12 , 602-615 (2013). 203 426. Kiger, A.A., Jones, D.L., Schulz, C., Rogers, M.B. & Fuller, M.T. Stem cell self-renewal specified by JAK-STAT activation in response to a support cell cue. Science 294 , 2542- 2545 (2001). 427. Tulina, N. & Matunis, E. Control of stem cell self-renewal in Drosophila spermatogenesis by JAK-STAT signaling. Science 294 , 2546-2549 (2001). 428. VanDussen, K.L. et al. Notch signaling modulates proliferation and differentiation of intestinal crypt base columnar stem cells. Development 139 , 488-497 (2012). 429. Kawaguchi, D., Furutachi, S., Kawai, H., Hozumi, K. & Gotoh, Y. Dll1 maintains quiescence of adult neural stem cells and segregates asymmetrically during mitosis. Nat Commun 4, 1880 (2013). 430. Estrach, S., Ambler, C.A., Lo Celso, C., Hozumi, K. & Watt, F.M. Jagged 1 is a beta- catenin target gene required for ectopic hair follicle formation in adult epidermis. Development 133 , 4427-4438 (2006). 431. Tan, D.W. et al. Single-cell gene expression profiling reveals functional heterogeneity of undifferentiated human epidermal cells. Development 140 , 1433-1444 (2013). 432. Zlotogora, J., Zilberman, Y., Tenenbaum, A. & Wexler, M.R. Cleft lip and palate, pili torti, malformed ears, partial syndactyly of fingers and toes, and mental retardation: a new syndrome? J Med Genet 24 , 291-293 (1987). 433. Rossi, A. et al. Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature 524 , 230-233 (2015). 204