AN ABSTRACT OF THE DISSERTATION OF

Veli Erdogan for the degree of Doctor of Philosophy in Horticulture presented on April 16, 1999. Title: Genetic Relationships among Hazelnut (Corvlus) Species.

Abstract approved:

Shawn A. Mehlenbacher

Interspecific hybridization, pollen-stigma incompatibility, morphological and phenological characterization, and DNA sequence analysis were studied in hazelnut (Corylus) species. Interspecific crosses resulted in a wide range of cluster set from 0% to 77.8%. Reciprocal differences were common. In general, crosses involving C. avellana and C. heterophylla were more successful when used as pollen parents, but crosses involving C. americana were more successful when it was the female parent. C. cornuta, C. californica and C. sieboldiana intercrossed freely in both directions, as did C. colurna and C. chinensis. The Asian species C. sieboldiana, C. heteropyhlla, and C. chinensis were not cross-compatible with each other. Fluorescence microscopy showed that pollen-stigma incompatibility exists within and among wild hazelnut species, in addition to the cultivated European hazelnut C. avellana. Pollen-stigma incompatibility and embryo abortion (blank nuts) appear to be major blocks to interspecific gene flow. A phylogenetic analysis based on twenty three morphological and five phenological characters placed hazelnut species in three groups. The first two included all representatives of shrub species while the third group contained tree species. In addition, the chloroplast matK. gene and the Internal Transcribed Spacer (ITS) region of the nuclear ribosomal DNA (rDNA) were amplified and sequenced. The ITS region and wa/K were 666 and 1231 bp long, respectively. The matK. gene had extremely low divergence and resulted in ambiguity as the number of informative characters was only 10, thus was not very informative. The nuclear ribosomal ITS region contained relatively low levels of variation that only 22 characters were informative. However, several well supported clades and three distinct groups were formed based on the ITS sequences. First and second groups included the shrub species while the third group contained the tree species. In addition, one species was separated from the three groups. Corylus species were placed into four groups: 1- C. avellana, C. maxima, C. americana and C. heterophylla 2- C. colurna, C. chinensis, paperbark hazelnut and C. jacquemontii 3- C. cornuta, C. californica and C. sieboldiana 4- C. ferox. The strict consensus tree topology was congruent with the results of interspecific hybridization and morphological classification. Copyright by Veli Erdogan

April 16, 1999

All Rights Reserved Genetic Relationships among Hazelnut {Corylus) Species

by

Veli Erdogan

A DISSERTATION

submitted to

Oregon State University

in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

Presented April 16, 1999 Commencement June 1999 Doctor of Philosophy dissertation of Veli Erdogan presented on April 16, 1999

APPROVED:

—1^7""" ^ "-*■ "^™L_" - •*- ^ -^ Major Professor, representing Horticulture

- ^ - ■■— Chair of Department of Horticulture

Dean of Graduate^1 School

I understand that my dissertation will become part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my dissertation to any reader upon request.

Veli^rdogan,HCrd Author ACKNOWLEDGEMENTS

I would like to express my gratitude to my major professor Dr. Shawn A. Mehlenbacher for his guidance, understanding and assistance. I also thank David C. Smith for his assistance and suggestions during my interspecific hybridization studies. I enjoyed working with them during my graduate research assistantship. I am thankful to Drs. Joseph Spatofora, Patrick Hayes, Tony Chen, and Jeffrey J. Jenkins for serving on my committee. I appreciate the technical advice and initial supply of ITS primers provided by Dr. Aaron Listen for my DNA studies. Many thanks go to Drs. Ruth Martin, Nahla Basil, David Martin and Johanne Brunei for technical advice, and help in lab studies and software use. The help of Randy Hopkins and the crew at the Smith Research farm of OSU for construction of pollination cages was greatly appreciated. I would like to acknowledge, the Oregon Hazelnut Commission for their support of my research, the USDA-ARS National Clonal Germplasm Repository for providing me with plant material, the Department of Horticulture for its open- door policy concerning the use of labs, the Central Services Lab of OSU for primer synthesis and DNA sequencing, and Ankara University, where I work, for letting me study abroad. Work in the Department of Horticulture would have not been much fun over the years without sharing feelings, ideas, support and suggestions with Glenn Creasy, Kevin Cook, Joel Davis, China Lunde, Qiang Yao, Rebecca Brown and many other graduate students. I am obliged to Nihat Guner for his invaluable friendship and assistance, and to Hamdi Ogut and Mustafa Toraman for their moral support. I also enjoyed the interactions with faculties especially with Dr Patrick Breen, and with office specialists. Finally, I owe a great debt and respect to my beloved family for their everlasting patience, support and encouragement. TABLE OF CONTENTS

Page

CHAPTER 1. INTRODUCTION AND LITERATURE REVIEW 1

1.1 INTRODUCTION 1

1.2 LITERATURE REVIEW 2

1.2.1 Taxonomy, origin and distribution of hazelnuts 2 1.2.2 Methods and data used in determination of genetic relationships 4 1.2.2.1 Phenetics 5 1.2.2.2 Cladistics 6 1.2.2.3 Types of data 7 1.2.3 Interspecific hybridizations 10 1.2.4 Self-incompatibility 17

1.3 REFERENCES 22

CHAPTER 2. INTERSPECIFIC HYBRIDIZATION IN HAZELNUT (Corylus) 36

2.1 ABSTRACT 36

2.2 INTRODUCTION 37

2.3 MATERIALS AND METHODS 39

2.3.1 Genetic material 39 2.3.2 Crosses 44 2.3.3 Seed germination and growing seedlings 45

2.4 RESULTS ; 46

2.4.1 Interspecific crosses , 46 2.4.2 Seed germination and seedling growth 53

2.5 DISCUSSION 59 TABLE OF CONTENTS (continued)

Page

2.6 REFERENCES 65

CHAPTER 3. SELF-INCOMPATIBILITY IN WILD Corylus SPECIES 69

3.1 ABSTRACT 69

3.2 INTRODUCTION 69

3.3 MATERIALS AND METHODS 71

3.4 RESULTS 73

3.5 DISCUSSION 78

3.6 REFERENCES 83

CHAPTER 4. CHARACTERIZATION OF Corylus SPECIES BASED ON MORPHOLOGY AND PHENOLOGY 86

4.1 ABSTRACT 86

4.2 INTRODUCTION 86

4.3 MATERIALS AND METHODS 95

4.3.1 Phenological data 95 4.3.2 Husk characters 96 4.3.3 Leaf characters 96 4.3.4 Nut characters 100 4.3.5 Other characters 100 4.3.6 Data analysis 101

4.4 RESULTS 101

4.5 DISCUSSION 106 TABLE OF CONTENTS (continued)

Page

4.6 REFERENCES 110

CHAPTER 5. MOLECULAR ANALYSIS OF Corylus SPECIES BASED ON NUCLEAR rDNA ITS AND CHLOROPLAST matK GENE SEQUENCES 113

5.1 ABSTRACT 113

5.2 INTRODUCTION 114

5.3 MATERIALS AND METHODS 116

5.3.1 Plant material 116 5.3.2 Genomic DNA extraction 116 5.3.3 Polymerase Chain Reaction (PCR) amplifications 118

5.4 RESULTS 123

5.5 DISCUSSION 127

5.6 REFERENCES 133

CHAPTER 6. CONCLUSIONS 138

BIBLIOGRAPHY 141

APPENDIX 157 LIST OF FIGURES

Figure Pages

3.1 Intraspecific pollen-stigma reactions in Corylus 75

4.1 Husk variation in C. avellana; (A) Italian geotypes (B) Turkish genotypes 88

4.2 Husk variation in (A) C. maxima and (B) a typical husk of C. americana 89

4.3 A typical husk of (A) C. heterophylla and (B) C. cornuta 90

4.4 A typical husk of (A) C. californica and (B) C. sieboldiana 91

4.5 Husk variation in (A) C. colurna and (B) C. jacquemontii 92

4.6 A typical husk of (A) C. chinensis and (B) C. ferox var. thibetica 93

4.7 Variation in nuts of hazelnut species 94

4.8 Strict consensus tree of 33 taxa based on botanical characters 105

5.1 Structure and relative position of the (A) Internal Transcribed Spacer (ITS) region of nuclear ribosomal DNA, and (B) chloroplast maiK gene, including relative positions of the PCR and sequencing primers used in the present study 120

5.2 Electrophoretic separation of PCR-amplified nuclear rDNA ITS and chloroplast matK. gene bands 122

5.3 Strict consensus tree of 30 genotype based on nuclear rDNA ITS region sequences 124

5.4 Strict consensus tree of 30 genotypes based on maiK. DNA sequences 126 LISTS OF TABLES

Table page

2.1 Female parents ofCorylus species and genotypes used in 1995 40

2.2 Female parents ofCorylus species and genotypes used in 1996 41

2.3 Female parents ofCorylus species and genotypes used in 1997 42

2.4 Male genotypes (mix) used in Corylus crosses 43

2.5 Intra- and interspecific crossing results (% cluster set) of Corylus species in 1995 47

2.6 Intra- and interspecific crossing results (% cluster set) of Corylus species in 1996 48

2.7 Intra- and interspecific crossing results (% cluster set) of Corylus species in 1997 49

2.8 Mean intra- and interspecific crossing results (% cluster set) of Corylus species in three years 50

2.9 Percent blank formation in intra- and interspecific crosses of Corylus species (average of 1995, 1996 and 1997) 52

2.10 Percent seed germination results in intra- and interspecific crosses of Corylus species (average of 1995 and 1996) 54

2.11 Hybrid seedling survival results in intra- and interspecific crosses of Corylus species (average of 1995 and 1996) 56

2.12 Hybrid seedling vigor expressed as trunk diameter (in cm) of intra- and interspecific crosses ofCorylus species (average of 1995 and 1996) 58

3.1 Number of genotypes used in pollinations in Corylus species 72

3.2 Total number of compatible and incompatible pollinations within and between Corylus pecies 76 LIST OF TABLES (continued)

Table Page

4.1 Cultivated and wild Corylus accessions used in evaluation of botanical characters 97

4.2 Character states for the 28 botanical characters investigated 98

4.3 Coding of the character states for Corylus accessions 102

5.1 Cultivated and wild Corylus accessions used in DNA studies 117

5.2 Primer sequences used for PCR amplifications and sequencing 121 LIST OF APPENDIX TABLES

Table Pages

Al. Intra- and interspecific crossing, seed germination and seedling performance results of C. avellana (as female) in 1995 158

A2. Intra- and interspecific crossing, seed germination and seedling performance results of C. americana (as female) in 1995 159

A3. Intra- and interspecific crossing, seed germination and seedling performance results of C. heterophylla (as female) in 1995 160

A4. Intra- and interspecific crossing, seed germination and seedling performance results of C. cornuta(as female) in 1995 161

A5. Intra- and interspecific crossing, seed germination and seedling performance results of C. californica (as female) in 1995 162

A6. Intra- and interspecific crossing, seed germination and seedling performance results of C. sieboldiana (as female) in 1995 163

A7. Intra- and interspecific crossing, seed germination and seedling performance results of C. colurna(as female) in 1995 164

A8. Intra- and interspecific crossing, seed germination and seedling performance results of C. avellana (as female) in 1996 165

A9. Intra- and interspecific crossing, seed germination and seedling performance results of C. americana (as female) in 1996 166

A10. Intra-and interspecific crossing, seed germination and seedling performance results of C. heterophylla (as female) in 1996 168

All. Intra- and interspecific crossing, seed germination and seedling performance results of C. cornuta (as female) in 1996 169 LIST OF APPENDIX TABLES (continued)

Table Pages

A12. Intra- and interspecific crossing, seed germination and seedling performance results of C. californica (as female) in 1996 170

A13. Intra- and interspecific crossing, seed germination and seedling performance results of C. sieboldiana (as female) in 1996 171

A14. Intra- and interspecific crossing, seed germination and seedling performance results of C. colurna (as female) in 1996 172

A15. Intra- and interspecific crossing, seed germination and seedling performance results of C. chinensis (as female) in 1996 173

A16. Intra- and interspecific crossing results of C. avellana (as female) in 1997 174

A17. Intra- and interspecific crossing results of C. americana (as female) in 1997 175

A18. Intra- and interspecific crossing results of C. heterophylla (as female) in 1997 176

A19. Intra- and interspecific crossing results of C. cornuta (as female) in 1997 177

A20. Intra- and interspecific crossing results of C. californica (as female) in 1997 178

A21. Intra- and interspecific crossing results of C. sieboldiana (as female) in 1997 179

A22. Intra- and interspecific crossing results of C. colurna (as female) in 1997 180

A23. Intra- and interspecific crossing results of C. chinensis (as female) In 1997 181 LIST OF APPENDIX TABLES (continued)

Table Pages

A24. Pollen-stigma interactions of self-pollinated genotypes of Corylus species 182

A25. Cross-compatibilities of some genotypes within species in Corylus 183

A26. Cross-compatibilites of C. avellana with other wild Corylus species 185

A27. Cross-compatibilites of C. americana with other Corylus species 186

A28. Cross-compatibilites of C. heterophylla with other Corylus species 187

A29. Cross-compatibilites of C. cornuta with other Corylus species 188

A30. Cross-compatibilites of C. sieboldiana with other Corylus species 189

A31. Sequence alignment (674 bp) of the nuclear ribosomal DNA internal transcribed spacer (ITS) region for Corylus species 190

A32. Sequence alignment (1231 bp) of the chloroplast matYL gene for Corylus Species 200 GENETIC RELATIONSHIPS AMONG HAZELNUT (Corylus) SPECIES

CHAPTER 1

INTRODUCTION AND LITERATURE REVIEW

1.1 INTRODUCTION

Plant breeders use genetic diversity to develop improved cultivars with resistance to disease and insects, adaptation to a greater range of environmental conditions, higher yields and better nutritional composition. Knowledge of genetic diversity in crop plants has important applications for plant breeders. For example, breeders can decide what genotypes to cross based on the degree of genetic relatedness of lines, populations, cultivars or even species. Determination of genetic relatedness in germplasm resources also can be useful for the maintenance of maximum genetic diversity in collections (Hawkes, 1977; Thormann and Osbom, 1992). There is a tremendous amount of genetic variability in Corylus and it remains virtually untouched (Mehlenbacher, 1991). Nuts of wild species are edible, and plants are cultivated for their nuts, for timber and as ornamentals. The European hazelnut, C. avellana, is the only cultivated species due to its superior quality and large size nuts. All of the important commercial cultivars in Europe and Turkey, which is the leading hazelnut producer, were selected from local wild populations of this species over many centuries. Breeding programs to develop new and improved cultivars were established in 1960's and 1970's. A few superior selections have been released from these programs including 'Willamette' (Mehlenbacher, 1991) and very recently 'Lewis' and 'Clark' from Oregon, USA, 'Corabel' from Bordeaux, France and 'Daria' from the Univ. of Torino, Italy (Thompson et al., 1996). C. avellana contains a great amount of genetic diversity. However, there are some highly desirable and economically important traits such as nonsuckering growth habit, tolerance to high soil pH, extreme precocity, exceptionally early maturity, cold hardiness and alternate sources of resistance to eastern filbert blight disease (Thompson et al., 1996) that do not exist within C. avellana but do exist in wild species. Interspecific hybridization then becomes necessary to transfer those characters from the wild species. Despite the abundance of descriptions of Corylus species based on morphology, little is known about their genetic relatedness which is very important to plant breeders. An effort to collect representatives of all hazelnut species (Corylus) from natural, wild populations is in progress at Oregon State University and at the U.S. Department of Agriculture National Clonal Germplasm Repository in Corvallis, Oregon. Many representatives of these species had begun to bear nuts in recent years and were available for use in studies. The objective of this study was to obtain information about the genetic relationships among cultivated and wild Corylus species, and facilitate their use in hazelnut breeding.

1.2 LITERATURE REVIEW

1.2.1 Taxonomy, origin and distribution of hazelnuts Hazelnut is a name given to the genus Corylus which belongs to the birch family Betulaceae of the order Fagales (Furlow, 1997; Kasapligil, 1972; Kubitzki, 1993; Rehder, 1940; Woodland, 1991). The genus is included in one of two clades (Bousquet et al., 1992) or subfamilies, Coryloideae (Furlow, 1997; Kubitzki, 1993). Hazelnuts are not native to the Southern Hemisphere and native fossil forms show no evidence of them in the past (Kasapligil, 1972). Corylus species are widely distributed throughout temperate regions of the Northern Hemisphere from Japan, China and Manchuria through Tibet, Caucasia, Turkey, Europe and North America (Kasapligil, 1972; Ayfer et al., 1986). They are monoecious, mostly dichogamous, anemophilous, deciduous shrubs and trees. Corylus chromosomes are extremely small. The diploid chromosome number appears to be 2n = 2x = 22 except for a few aberrant forms (Botta et al., 1986; Kasapligil, 1968; Salesses, 1973; Wetzel, 1929). However, Woodworth (1929) reported 2n = 28 for several Corylus species. It is most likely that this report was in error because of the poor techniques used for meiotic preparations. Corylus systematics has been mainly based on descriptions and largely restricted to morphology, especially of the husk or involucre, (Bailey, 1914; Drumke, 1964; Everett, 1981; Huxley et al., 1992; Kasapligil, 1964; Krussmann, 1976; Rehder, 1940). Nine to 25 species have been reported by taxonomists (Bailey, 1914; Everett, 1981; Huxley et al., 1992; Kasapligil, 1963, 1972; Krussmann, 1976; Rehder, 1940). However, the most widely accepted include five shrub species, C avellana L., C americana Marshall, C cornuta Marshall, C californica Marshall, C. heterophylla Fischer and C sieboldiana Blume; and the four tree species C. colurna L., C. jacquemontii Decaisne, C. chinensis Franchet and Cferox Wallich (Thompson et al., 1996). There appear to be three groups of species. The first group is the cultivated species, C. avellana and its subgroups which some authorities accept as distinct species (C. maxima Mill., C. pontica Koch., and C. colchica Alb.) (Kasapligil, 1972). However, Mehlenbacher (1991), Thompson et al. (1996), and Rovira (1997) agree that these so-called species show continuous variation in morphology, easily hybridize with each other, and overlap in geographic distribution and they all should be considered as belonging to a single large species, C. avellana. The second group is the morphologically very similar species C cornuta and C. californica. C. californica has been recognized as a distinct species by some authorities (Bailey, 1914; Krussmann 1976; Rehder 1940), but as a subspecies (Furlow, 1997) or a botanical variety of C. cornuta by others (Drumke, 1964; Everett, 1981; Huxley et al., 1992; Sharp, 1951; Thompson et al., 1996). The third group is the Asian species complex which include C. heterophylla, C. sieboldiana, C. chinensis, C. jacquemontii, C. ferox, C. thibetica, and C. papyraceae (Kasapligil, 1972). Their taxonomic positions have not been clearly understood due to the great morphological variation within and among species, and limited croosability of authentic representatives in the western world. For example, a recent report accepts C. thibetica as a botanical variety of C. ferox (Liang and Zhang, 1988), and C. wangii which is virtually unknown outside of China was described by Zheng (1985), and Liang and Zhang (1988) as a distinct species, but Hu (1948) considers it a synonym of C. jacquemontii. The systematics of Corylus have not been very attractive to taxonomists partially due to insufficient variation among wood tissues of the species to be of morphological and statistical importance (Hall, 1952). Most of the studies that included Corylus were at the genus or higher level (Bousquet et al., 1992; Brunner and Fairbrothers, 1979; Savard et al., 1993). The ambiguity in classification of Corylus species is still problematic and a taxonomic revision of the genus was suggested by Furlow (1997).

1.2.2 Methods and data used in determination of genetic relationships Genetic improvement in plants is based on the identification of favorable genes in germplasm accessions and the subsequent introgression of those genes into cultivated varieties. However lack of knowledge of the organization of germplasm resources based on genetic relationships limits the identification of desirable genotypes, and the efficiency of sampling is reduced (Nienhuis, 1994). In plant breeding, estimates of genetic relationships can be useful for cultivar identification, selection of parents for hybridizations and reducing the number of accessions needed to ensure sampling a broad range of genetic variation. Genetic relatedness within and between plant groups can be defined in terms of genetic distance (Dudley, 1994), and this concept is widely used in taxonomic studies as well as plant breeding programs. There are basically two approaches to estimating genetic distance or similarity, phenetics and cladistics (Avis, 1994; Stuessy, 1990; Woodland, 1991).

1.2.2.1 Phenetics In this approach, genetic relationships are determined by comparison of overall similarities between/among genotypes based on available characters. This method, also known as numerical taxonomy, was developed in the 1950s and 1960s. The principles were described by Sneath and Sokal (1973). This method is based on overall similarities and equal weight is given to each character, e.g. no character is more important than any other. Also there is no implication of ancestral relationships. A distance measure is selected which summarizes the data and a clustering procedure is followed. The following discussion is largely based on Stuessy (1990) and Woodland (1991). A variety of statistics are available to calculate genetic distance or similarity using either quantitative or qualitative data. 1. Association (similarity) coefficients measure the agreement between pairs of taxa: There are three basic types: simple matching coefficient, Jaccard's coefficient and Gower's coefficent. 2. Distance (dissimilarity) coefficients measure the distance between taxa. There are three types: Euclidean distance, Manhattan distance and Mean character distance. 3. Correlation coefficients, of which the most widely used is the Pearson product-moment correlation coefficient. 4. Probabilistic similarity coefficients. After distance values are calculated then a type of algorithm is used to compare taxa using a graphical display which could be either clustering or ordination. Mostly hierarchial and agglomerative methods are used in clustering: single linkage (nearest neighbor), complete linkage (farthest neighbor) and average linkage. An arithmetic average is commonly used. It could be either a weighted or unweighted pairwise method of arithmetic averages (WPGMA or UPGMA, respectively). Ordination methods give multi-dimensional scaling. Principal component, principal coordinate and canonical correlation analysis are widely used. For example, Challice and Westwood (1973) analyzed 22 botanical and 29 chemical characters using Gower's similarity coefficient, nearest neighbor linkage algorithm, and principlecoordinate analysis in pear species (Pyrus). The results supported the division of the genus into four principal groups of species: the East Asian pea pears, the large fruited East Asian pears, the North African pears and the European and West Asian pears. In apple {Mains), cluster analysis based on UPGMA revealed that molecular classification was in good agreement with known lineage (Dunemann et al., 1994). A high degree of genetic diversity was found among apple cultivars and wild species. Numerical taxonomic studies have been widely used in determination of genetic relatedness in almond (Bartolozzi et al., 1998), apple (Gardiner et al., 1996), avocado (Rhodes et al., 1971), banana (Simmonds and Weatherup, 1990), blueberry (Levi and Rowland, 1997), grape (Bourquin et al., 1993; Qu et al., 1996), lemon (Deng et al., 1995), olive (Fabbri, et al, 1995), papaya (Stiles et al., 1993; Magdalita et al., 1997), peach (Perez et al., 1993; Warburton and Bliss, 1996), pistachio (Hormoza et al., 1994), wild Malus spp. (Lamboy et al., 1996), cocoa (Wilde et al., 1992), garlic (Al-Zahim et al., 1997), lettuce (Kesseli and Michelmore, 1986), tomato (Williams and Clair, 1993), Allium (Wilkie et al., 1993), Brassica (Ren et al., 1995), Cucurbita (Decker, 1985), sorghum (Anhert et al., 1996), buffalograss (Wu and Lin, 1994), poplar (Castiglione et al., 1993), and rubber tree (Varghese et al., 1997).

1.2.2.2 Cladistics In this approach, taxa groups are defined on the basis of common ancestry. This method is also known as phylogeny. It originated in the 1950s and developed quickly. It is especially used in evolutionary studies. This classification method emphasizes monophyletic groups, which are simply groups arisen through diversification from a single ancestor. Polyphyletic origin, groups originating from more than one ancestor is not recognized (Avis, 1994; Stuessy, 1990; Woodland, 1991). In cladistics, fewer characters, usually qualitative, are used than in phenetic studies. However, characters are selected for which primitive and derived states can be assigned. An algorithm method is selected for tree (cladogram) construction. The most commonly used algorithm method constructs the tree by shared-derived character states (synapomorphy). Frequently used algorithms are based on parsimony which minimizes character state changes among groups and constructs the shortest trees. Parsimony algorithms are Hennig-Wagner, Camin- Sokal, Farris, and Dollo parsimony (Stuessy, 1990). In bananas (Musa), the position of M. angustigemme was questioned (Gawel et al., 1992). Cladistic analysis of RFLP markers showed that M. angustigemme was not a subspecies of M. pekellii, but rather it was a distinct species with a close relationship to M. boman. It was also concluded that M. fehi was derived form M. lolodensis. Phylogenetic analyses are becoming common in the context of plant breeding. Recent examples include avocado (Mhameed, et al., 1997), carrot (Vivek and Simon, 1998), citrus (Fang et al., 1998), strawberry (Harrison et al., 1997), walnut (Fjellstrom, 1994), Oryza (Wang et al., 1992), Medicago (Brummer et al., 1995), lentil (Ahmad et al., 1997), and grasses (Stammers et al., 1995).

1.2.2.3 Types of data Many types of data have been used in studies of genetic relatedness. Morphological characters are the oldest type of data and until recently, all progress in breeding has relied on phenotypic assays of the genotype. Morphological characters include vegetative and floral characteristics. Usually they are easy to observe by naked eye, or with the help of binoculars. However, since cultivars are becoming more and more similar, it is difficult to distinguish closely related cultivars and lines. In many cases adult phase characters are used and tree crops may require many years to reach maturity. Also morphological variability can be an unreliable measure of genetic relatedness because of confounding effects such as environment, partial dominancy, multigenic and quantitative inheritance, pleitropy, or unknown genetic events (Dudley, 1994; Nienhuis et al., 1994; Stuessy, 1990; Tingey and Tufo, 1993). Nevertheless, morphological traits are important to look at the inception of a breeding program. Anatomy, embryology, palynology, cytology, genetics (hybridizations), and ecology are also among the types of data used in taxonomic studies (Hall, 1952, Kasapligil, 1964, and 1968; Magdalita et al., 1997; Stuessy, 1990). In general, they are useful in systematics above the species level. Another class of data comes from micro- and macromolecules. Micromolecules are secondary plant metabolites such as flavanoids, terpenoids and alkaloids. These metabolites are strongly influenced by ecology, many biosynthetic pathways are uncharacterized, and the genetic control responsible for this variability is not known (Crawford, 1990; Stuessy, 1990). Macromolecules are direct gene products such as proteins (Brunner and Fairbrothers, 1979; Woodland, 1991) and isozymes (Decker, 1985; Gardiner 1996; Kesseli and Michelmore, 1986; Lamboy, 1996) or the genetic material itself, nucleic acids. Isozymes are relatively cheaper, safer and easier to work with. They are codominantly inherited and express complete penetrance. Absence of pleitropic and epistatic effects is another advantage. However isozymes may not be expressed in all developmental stages, only 1/4 of base substitutions result in amino acid replacements and post-translational modifications may affect electrophoretic mobility. Protein and isozyme markers have often been of limited use in many crop spcies due to lack of large polymorphism. Nucleic acids are useful at all taxonomic levels and direct study of genetic material provides the most fundamental and objective assessment of the genetic similarities of plant taxa (Crawford, 1990; Woodland, 1991). Nucleic acid studies include determination of total DNA content, DNA-DNA hybridizations, restriction analyses and DNA sequencing. DNA sequencing of the nuclear and chloroplast genomes in plants is being increasingly used in phylogenetic analysis due to improvement in techniques and lower cost compared to 10-15 years ago. It represents a more straightforward approach to comparative systematics and has been most valuable for higher level systematics. Relatively conserved gene sequences such as the nuclear ribosomal rDNA internal transcribed spacer regions (Baldwin et al., 1995; Hsiao, et al. 1993; Liston et al., 1996), and the chloroplast encoded rbcL (Morgan et al., 1994) and matK genes (Johnson and Soltis, 1995; Liang and Hilu, 1996) and a few others are used. DNA markers have been the data of choice for plant breeders. They are potentially limitless and are not affected by the environment. The most used types of markers are restriction fragment length polymorphisms (RFLPs) (Fjellstrom, 1994; Harrison, 1997; Vivek, et al., 1998; Wang et al., 1992) and randomly amplified polymorphic DNA (RAPDs) (Bartolozzi et al., 1998; Brummer et al., 1995; Hormaza et al., 1994; Ren et al., 1995; Stammers et al., 1995; Warburton and Bliss, 1996). RFLPs can be used in mapped restriction site variation analysis (Liston and Wheeler, 1994) or can be coupled with Southern blot hybridizations (Thormann and Osbom, 1992). Restriction fragments hybridizing to a particular probe are homologous and identical sized restriction fragments from different genotypes are inferred to be genetic similarities. RAPD markers are very attractive because they are simpler, easier, lower in cost than RFLPs, and do not require the use of radioactivity. However, identical sized RAPD fragments from different genotypes may not be homologous. Thommann and Osbom (1992) reported that RAPD markers gave similar information to RFLP data when comparing genetic relationships among accessions within Brassica species. However interspecific genetic relationships based on RAPD markers gave different results than RFLP markers due to nonhomology of identical-size fragments. Single sequence repeats (SSR) (Mhameed et al., 1997), and inter-simple sequence repeats (ISSR) (Fang et al., 1998) were among the recently reported DNA molecular markers. 10

1.2.3 Interspecific hybridizations Wild species are invaluable sources to plant breeders for characters such as resistance to diseases, insects, nematodes, temperature extremes, salinity, etc. Utilization of wild relatives of a crop depends on its crossability relations with cultivated species (Kallo, 1992). According to Singh (1993) the crossability rate is an excellent measure of the degree of genomic relationship between the parental species. Interspecific crosses involving parental species with similar genomes usually set normal seeds while crosses between genomically dissimilar species usually lead to seed abortion. In many crosses, success is often genotype dependent. According to Ballington and Galletta (1978), the number of germinated seeds and number of vigorous seedlings are the best criteria for evaluation of crossability in Vaccinium. They observed maternal effects and unilateral partial incompatibility. Interspecific hybridization is a technique commonly used by plant breeders to transfer genes from one species to another (Layne and Sherman, 1986). Interspecific hybrids are usually obtained with greater difficulty than intraspecific hybrids because genetic barriers to hybridization usually increase with an increase in genetic distance. Interspecific hybridization has not always been straightforward or successful. Ladizinsky (1992) classified the crossability relations of crop plants into four types: (1) intercross is complete or nearly complete in both directions; (2) successful crosses are unilateral; (3) crosses are only partially successful or must be aided by embryo culture; (4) crosses are incompatible. Failure of pollen germination, abnormal pollen tube growth, lack of fertilization, aborted zygote development, and seedling death are among the difficulties encountered in interspecific hybridizations (Hadley and Openshaw, 1980; Scorza, 1984). Even if the initial interspecific hybridization is successful, weak growth or sterility of Fi hybrids and degeneration of progeny in the F2 generation (hybrid breakdown) may be encountered. In addition, when the desired 11

genes or gene combinations can be readily transferred between the species, the introduction of undesirable genes usually occurs. Wild species may not be crossable with the cultivated species due to various isolation barriers. Reproductive isolation barriers have been classified into two groups (Hadley and Openshaw, 1980). External barriers physically separate species and include geographical, ecological or seasonal (flowering) barriers. On the other hand, internal barriers include incompatibilities between physiological or cytological systems of plants and can act at many stages: the failure of pollen tubes to penetrate the style, failure of fruit set or seed development (at both early and late stages), and hybrid mortality, sterility, or breakdown in succeeding generations (Bohs, 1991; Ladizinsky, 1992). Disharmony between the reproductive tissues of plants may prevent hybridization. Usually pollen does not germinate on the stigma, or pollen tube growth is inhibited in the style, or a sperm nucleus does not unite with the egg cell (Hadley and Openshaw, 1980). Interspecific pollen-stigma interactions are rather difficult to interpret. Both self-incompatibility (SI) and interspecific incompatibility (incongruity) refer to pollen inhibition on the stigma or in the style. The interspecific incompatibility reaction is usually stigmatic in families where self-incompatibility is expressed in the stigma, and stylar in families where self-incompatibility is expressed in the style (Nettancourt, 1977). Incongruity has been defined as pre- and post-zygotic reproductive barriers due to lack of genetic information between partners (Hogenboom, 1973, Lield and Anderson, 1993). It involves a failure of pollen to hydrate, germinate, or penetrate the stigma, bursting of the pollen tube in the style, failure of pollen tubes to effect fertilization, embryo abortion, endosperm failure and hybrid breakdown. Rougier et al. (1992) attributed the arrest of Populus alba pollen tubes in the lower part of P. deltoides styles to incongruity. Lu and Lamikanra (1996) studied the interspecific crosses between Vitis vinifera (subgenus Euvitis) and V. rotundifolia (subgenus Muscadinia). V. vinifera x V. rotundifolia crosses were succesful with low seed set, partly due to 12

postfertilization barriers since no stylar barrier was observed. However, the reciprocal cross failed. Pollen abortion in the styles of V. vinifera was the cause of failure. Thus the major cause for unilateral incompatibility in the cross of V. rotundifolia x V. vinifera was prefertilization barriers. Unilateral incompatibility (UI) is a phenomenon in which interspecific or intergeneric crosses are successful in one direction but the reciprocal fails. Interspecific incompatibility usually occurs unilaterally and often prevents self incompatible (SI) species from accepting the pollen of self compatible (SC) species, whereas the reciprocal cross SC x SI is successful. However, UI is not restricted to SI x SC crosses but also occurs in SC x SI, SI x SI and SC x SC combinations. The occurrence of UI primarily in SI x SC crosses has led to the hypothesis that UI is controlled by self-compatibility alleles at the S-locus (Dhaliwal, 1992). Pollen rejection either on the stigma or in the style has been associated with unilateral interspecific incompatibility (UI) in many species (Chetelat and DeVama 1991; Hiscock and Dickinson 1993; Lewis and Crowe 1958; Knox et al., 1972; Nettancourt et al., 1974; Nettancourt, 1977). UI is common when the SI parent is pollinated with self compatible (SC) parent. However one way compatibility in SI x SI or SC x SC combinations is also known. Investigation of interspecific pollen- stigma interactions and physiological similarities between UI and SI suggest an involvement of the S-locus in UI (Hadley and Openshaw, 1980; Hiscock and Dickinson, 1993). UI in Lycopersicon esculentum pollen tubes is governed by a single gametophytic factor which is either linked or allelic to the S-locus (Nettancourt et al., 1974). On the other hand, UI in L. peruvianum is controlled in the styles by a number of different dominant genes. These dominant genes, the S- locus and the gametophytic factor regulating the unilateral reaction in L. esculentum pollen probably belong to the same linkage group. Linkage analysis in L. pennellii presented evidence that three pollen expressed UI loci were identified on chromosomes 1, 6 and 10 (Chetelat and DeVama, 1991). Linkage data supported the hypothesis that UI is controlled by an interaction between the S-locus 13

and other loci. On the other hand, the unilateral response was found to be different from SI in the timing and location of expression in the style in crosses of L pennellii x L. esculentum (Lield et al., 1996). This unilateral response was called 'unilateral incongruity' rather than interspecific incompatibility. Unilateral SI x SI could be explained by 'a lock and key' analogy that a small key may be able to open a large lock but a large key cannot open a small lock (Hiscock and Dickinson, 1993; Sampson, 1962). These 'key differences' would be considered analogous to structural and functional differences between the pollen molecules that overcome the stigmatic barrier. Pollen of each SI species contains a specific molecule or molecules able to overcome the stigmatic barrier in crosses within the species, whereas a SI species cannot overcome the barrier in another SI species because of specific differences in these molecules (Hiscock and Dickinson, 1993). Thus SI x SI compatibility would therefore be due to similarities between the specific component of the pollen molecules of the two species. These components would be proteins. In poplar, proteins held in pollen grain walls were associated with inhibition of pollen germination in interspecific crosses (Knox et al, 1972). A strong unilateral incompatibility was reported between black and red raspberries (Hellman et al., 1982). Seed set of Rubus occidentalis x R. idaeus was 35.6 to 54.0%, while in the reciprocal red x black crosses it was 0.0 to 2.5%. In the genus Pyrus (pears) no major crossing barriers appear to exist, in spite of the wide geographic distribution of the genus (Bell and Hough, 1986). Unilateral cross incompatibility has not been found in Pyrus and interspecific cross incompatibility or incongruity is of only minor consequence. On the other hand, hybrid sterility is a possible consequence of wide interspecific hybridization. Some species can be crossed to produce hybrid zygotes, but Fi's are either inviable or weak. The causes of hybrid weakness or inviability can be due to incompatibilities 1- between genomes of the parental species, 2- between the genome of one species and the cytoplasm of the other, 3- between the genotype of the Fi zygote and the genotype of the endosperm or the maternal tissue (Hadley and 14

Openshaw, 1980). Overcoming the disharmonies between the genomes is very difficult or impossible. On the other hand genome x cytoplasm interaction which could be deleterious can be overcome by making the reciprocal cross. Healthy embryo development depends on simultaneous endosperm development and also depends on the harmonious interaction among embryo, endosperm and maternal tissue. A possible difference in gene dosage effect might cause embryo abortion, but the reciprocal cross could be successful. Narasimha-Rao (1979), reports that barriers to hybridization between Solarium melongena (eggplant) and other Solanum species include complete failure of fruit set, formation of parthenocarpic fruits, production of shrunken seeds, well developed but non-germinable seeds and seedling mortality. The failure of crosses was generally a post fertilization phenomenon. He argues that in unilateral incompatibility, embryo-endosperm incompatibility, or reaction of a gene or gene complexes of the male parent with the cytoplasm of the female parent, or complementary action of a gene or gene complexes derived from different genomes, are possible causes of failure in interspecific crosses. Particularly the cytoplasm of S. melongena is intolearant to particular genes or gene complexes of S. indicum, while the cytoplasm of S. indicum can tolerate the genotype of S. melongena. According to Rabakoarihanta et al. (1979) there was no prefertilization barriers between selfing and interspecific crosses of Phaseolus vulgaris with other Phaseolus species. However a large difference between reciprocal crosses was found in the time of endosperm and embryo division in relation to the time of fertilization. The severe delay in embryo and endosperm divisions may be the major cause of failure in P. lunatus x P. vulgaris crosses while the reciprocal was successful. They speculated that limited mitosis of the embryos was not the direct effect of slower endosperm development. The possibility of interactions between the embryo and the maternal parent resulting in slower embryo development was proposed. 15

A number of parental combinations in Phaseolus vulgaris produced abnormal Fi hybrids (Shii et al., 1980). The primary phenotypic abnormalities were stunted growth and yellowing and chlorosis of the young trifoliate leaves. It was suspected that the abnormal development was of a genetic nature rather than pathological or nutritional. A genetic hypothesis was formulated that the abnormal phenotypes of the Fi's may be conditioned by the heterozygous loci as designated DLi (dosage dependent lethal) and DL2. According to this, the F2 individuals that are homozygous dominant at both loci are lethal, and plants that were homozygous dominant at one locus and heterozygous at the other also perished but at a slower rate. Different ratios of chromosome numbers in the endosperm and embryo may result in disharmony. Abnormal endosperm development may be characterized by a low but steady rate of cell division which may cause difficult embryo development, or by an early rapid rate associated with lack of cell wall formation followed by a sudden cessation of mitosis and the degeneration of existing endosperm tissue resulting in embryo starvation (Hadley and Openshaw, 1980). According to Johnston and Hanneman (1982) the success of interspecific and interploidy crosses depends on the ratio of maternal to paternal genomes (chromosomes) in the hybrid endosperm. This ratio must be in a 2:1 for normal embryo development. They showed how endosperm balance number (EBN) is applied in Solanums. On the other hand, Masuelli and Camadro (1997) argued that EBN is possibly a part of a more complex system of interspecific barriers, acting at the post-zygotic level especially in Solanums, among which a range of crossability between species and genotypes with different degrees of compatibility are usually found. Excessive growth of maternal tissue might reduce the capacity for endosperm development and lead to starvation of the endosperm and the collapse of the embryo (Cooper and Brink, 1940). Disharmonies between the parental genomes or between the genome of one species and the cytoplasm of the other may cause Fi hybrid sterility. It might be 16

due to structural differences in chromosomes leading to failure of chromosome pairing in meiosis (Hadley and Openshaw, 1980). In this case sterility results from abnormal distribution of chromosomes in the gametes. Sometimes chromosome pairing proceeds normally but small differences in chromosome structure such as inversions or translocations may cause sterility. Sterility may also be induced by some combinations of cytoplasm of one species and the genome of the other leading to cytoplasmic-genetic male sterility. Hybrid sterility is a possible consequence of wide interspecific hybridization in Pyrus (Bell and Hough, 1986). Pollen sterility occurs in great frequency in genotypes of P. pyrifolia and interspecific hybrids between P. pyrifolia and other oriental species, notably P. betulaefolia and P. ussuriensis. In hybrid breakdown, Fi plants are normal, vigorous, and fertile but they give rise to F2 plants that are weak or sterile. This has been attributed to either small structural differences between the chromosomes of genomes or complementary genetic systems (Hadley and Openshaw, 1980). In Corylus, interspecific hybridizations have been reported (Farris, 1989; Gellatly, 1956, 1964, 1966; Liang et al., 1994; Reed, 1936; Slate 1961; Weschcke 1970). Most studies concentrated on crosses with C. avellana due to its economic importance. For many Asian species, the ease or difficulty with which they can be crossed with the cultivated hazelnut has not yet been documented. In other cases, reports are conflicting and clarification is needed. Previous attempts indicate that some Corylus species freely intercross, some cross with difficulty, some cross in one direction only and some do not cross in either direction (Erdogan and Mehlenbacher, 1997; Mehlenbacher, 1991; Thompson et al., 1996). To overcome the barriers in hybridization, several techniques have been used. Khus and Brar (1992), and Hadley and Openshaw (1980) summarized these techniques. Chromosome number manipulations (doubling) especially for crosses between species with different ploidy levels, use of a third species (bridging) when two species are impossible or very difficult to cross, shortening the styles, use of mentor pollen, use of growth hormones to stimulate pollen tube growth and embryo 17

development, in vitro fertilization and protoplast fusion are the methods used to overcome prefertilization barriers. Post-fertilization barriers are overcome by several methods. Embryo rescue, in vivo/vitro embryo culture, ovary culture, ovule culture, grafting hybrids, reciprocal crosses, regeneration of plants from callus of hybrid embryos, and altering the genomic ratio are the methods used to overcome hybrid inviability and weakness barriers. Chromosome doubling and backcrossing are used to overcome hybrid sterility. Hybrid breakdown can be overcome by limiting recombination via manipulation of the chromosome pairing system or inducing chromosomal translocations by irradiation, and tissue culturing the wide hybrids. Many of these methods have been used in Prunus breeding studies as summarized by Layne and Sherman (1986).

1.2.4 Self-incompatibility Self-incompatibility (SI) is a specific mechanism that prevents self- fertilization and encourages fertilization by genetically unrelated individuals (Gaude and Dumas, 1987; Nasrallah and Nasrallah, 1993; Nettancourt, 1977; Newbigin et al., 1993). SI is widespread among many important cultivated plant species, and among the wild relatives which are a source of important genetic traits such as disease resistance, hardiness or precocity. The control of SI is generally attributed to a single S-locus expressing multiple alleles (Nasrallah and Nasrallah, 1986; Nettancourt, 1977). Incompatibility occurs if the alleles expressed in the pollen and pistil are identical. There are two basic types of SI, gametophytic and sporophytic. Pollen and pistil interact on a cell-to-cell basis. Biochemical signaling between cell surface components seems to be required in SI (Dickinson, 1990). The rejection of incompatible pollen or pollen tubes is based upon the interaction between the products of identical S-alleles carried in the pollen and pistil (Gaude 18

and Dumas, 1987). The rejection of one pollen grain does not affect adjacent compatible grains. Callose deposition is a common feature of SI. Proteins are stored in the intine and exine layers of the pollen (Heslop- Harrison et al., 1973). Intine-held proteins of angiosperms are always produced by the male gametophyte while those in exine cavities are of sporophytic origin, being derived from the tapetum. It is likely that control of intraspecific gametophytic incompatibility is mediated through intine-held 'recognition substances', whereas in sphorophytic systems the exine-held materials are suspected. Gametophytic self-incompatiblity (GSI) is the most common type and is present in nearly half of the flowering plant families (Ebert et al., 1989). The S- allele carried by the pollen grain determines its compatibility (i.e. the phenotype of the pollen is determined by its own haplotype). In this system, pollen germinates on the stigmatic surface and penetrates into the style. Rejection occurs in the style where pollen tube growth is arrested (Bell, 1995; Ebert et al., 1989; Newbigin et al., 1993). In an incompatible reaction, the pollen tube becomes irregular, the pollen tube walls become thicker and tips may burst in the style. GSI is usually controlled by a single S-locus as in field poppy, (Papaveraceae) (Rudd et al., 1997), cherry, apricot, almond and apple (Rosaceae), (Egea and Burgos, 1996; Janssens et al., 1995; Kester et al., 1994; Mau et al., 1982; Sakurai et al., 1997), tomato (Solanaceae) (Chawla et al., 1997), or occasionally by two loci, S and Z, as in grasses (Li et al., 1997), or by four loci as in sugar beet (Chenopodiaceae) (Larsen, 1977). In the Solanaceae, SI is determined by a multiallelic S-locus whose only known product is an S RNase. The hypervariable regions of S RNases were found to control allelic specifity (Matton et al., 1997), and one allelic form of the S RNase molecule could be changed into another S RNase molecule by substitution of only four amino acids. No difference in early and late pollen tube growth patterns between compatible and incompatible interspecific crosses in poplar, in which GSI exists, were observed (Rougier et al., 1992). Pollen tubes of the incompatible cross 19

P.deltoides x P alba were arrested in the lower part of the style 19h after pollination. Heavy thickening of cell the wall at the swollen apex of arrested pollen tube was due to the accumulation of callose. They concluded that the arrest of pollen tube growth was due to incongruity. Unlike GSI, in sporophytic self-incompatibility (SSI) systems, the incompatibility reaction occurs at the pollen-stigma interface in the very early stages of germination, and inhibition of self-pollen is very rapid (Ebert et al., 1989; Nasrallah and Nasrallah, 1986, 1993, 1997; Volker et al., 1990). Incompatible pollen usually fails to germinate or pollen tubes are prevented from penetrating into the style. The genotype of the parent plant (sporophyte) which produces the pollen grain determines the phenotype of the pollen. The control of SSI has been attributed to a single S-locus expressing high numbers of alleles. Codominant and/or dominant allelic interactions are common between the alleles. SSI has been described in the Brassicaceae, Asteraceae, Convolvulaceae and Betulaceae. SSI is best characterized in Brassica. Molecular analysis of the S-locus has identified two linked genes: an S-locus glycoprotein (SLG) gene which codes for secreted glycoprotein (Nasrallah and Nasrallah, 1985) and the S receptor kinase (SRK) gene which encodes a transmembrane serine/threonine protein kinase (Stein et al., 1991). These two genes are required for a self-incompatible response (Nasrallah and Nasrallah, 1993). SLG and SRK are specifically expressed in the anthers and in the papillar cells of the stigma. The gene products are secreted on the papillar cell surface. SRK protein kinase is activated by contact between a papillar cell and self pollen. By phosphorylating the intracellular substrates, the SRK protein could couple the initial molecular recognition events at the papillar cell-pollen interface to the signal transduction chain that leads ultimately to pollen rejection (Nasrallah and Nasrallah, 1993; Nasrallah, 1997). SLG functions cooperatively with SRK (Stein et al., 1996). There are S-locus related (SLR) loci not linked to the S-locus that are also required for self-incompatibility in the stigma (Nasrallah and Nasrallah, 1993). 20

These loci belong to a secreted glycoprotein-encoding subfamily and are active in reproductive tissues. They may encode proteins of the SRK signaling pathway. Recently, SI was also associated with the absence of a gene that encodes a protein related to aquaporins (Ikeda et. al., 1997). It was suggested that a water channel is required for the SI response. Structural differences between S-alleles may not be large. Only four amino acid changes in hypervariable domains of self-incompatibility RNases in Solanaceae resulted in conversion of one allelic form (Sn) into other (Sn) (Matton etal., 1997). Incompatibility in C. avellana was first reported by Schuster (1924) and Johansson (1927). Thompson (1979a) revealed the genetics of self-incompatibility in hazelnuts. Subsequently the first incompatibility alleles were reported (Thompson 1979b) and currently 25 unique S-alleles are known to exist (Mehlenbacher and Thompson 1988; Mehlenbacher 1997). The cultivated hazelnuts (Corylus avellana L.) express SSI. The cultivars studied so far show that a dominance hierarchy exists among S-alleles in the pollen. Stylar S-alleles are codominant and pollen alleles are either codominant or dominant (Mehlenbacher and Thompson, 1988). Pollen in other sporophytically incompatible families, Brassicaceae and Asteraceae, is tricellular whereas C avellana pollen is bicelluar (Heslop-Harrison et al., 1986). As a characteristic of the SSI system, the stylar surface is covered with dry papillae (Hampson et al., 1993; Heslop-Harrison et al., 1986). Compatible pollen may hydrate and germinate on the stylar surface as does compatible pollen. However, no tubes were observed to penetrate into the style. Reduced germination, coiled and bulbous pollen tubes are characteristics of incompatible reactions in hazelnut (Hampson et al., 1993; Thompson et al., 1996). In addition, incompatible pollen produces a characteristic callose rejection in the stigma and also pollen eluates induce the response (Heslop-Harrison et al., 1986). A form of protein storage in the pollen grain wall has no obvious parallels in other families with the SSI system. 21

The determination of gametophytic or sporophytic nature of interspecific incompatibility is a difficult procedure because it involves studies of segregation in hybrid progenies which are often impossible, or complicated by the sterility or self- incompatibility (Nettancourt, 1977). Estimation of self incompatibility response needs a satisfactory assay system such as measuring seed set or following the pollen tube growth in the pistil by microscopic methods (Gaude and Dumas, 1987). However, seed set measurements are time-consuming and then seed viability needs to be tested because it involves segregation studies of hybrid progenies which are often impossible, or complicated by the sterility or self-incompatibility (Nettancourt, 1977), whereas progress after pollination can be followed more rapidly by microscopic methods. Rejection of incompatible pollen grains or tubes is based upon the interaction between the products of identical S alleles carried in the pollen and the pistil (Gaude and Dumas, 1987). Heslop-Harrison et al. (1986) reported that S- factors in C. avellana are held in the pollen wall, and it is possible that they form one component of the poral proteins which are of sporophytic origin (from the tapetum). The sporophytically derived pollen wall glycoproteins were shown to be responsible for the rejection response induced in the stigmatic papillae in Brassicaceae (Heslop-Harrison et al., 1974). 22

1.3 REFERENCES

Ahmad, M, D. L. McNeil, and J. R. Sedcole. 1997. Phylogenetic relationships in Lens species and their interspecific hybrids as measured by morphological characters. Euphytica 94: 101-111.

Al-Zahim, M., H. J. Newbury, and B. V. Ford-Lloyd. 1997. Classification of genetic variation in garlic (Allium sativum L.) revealed by RAPD. HortScience 32: 1102-1104.

Anhert, D., M. Lee, D. F. Austin, C. Livini, W. L. Woodman, S. J. Openshaw, J. S. C. Smith, K, Porter, and G. Dalton. 1996. Genetic diversity among elite sorghum inbred lines assessed with DNA markers and pedigree information. Crop Sci. 36: 1385-1392.

Avis, J. C. 1994. Molecular markers, natural history and evolution. Chapman & Hall, pp 511, New York.

Ayfer, M., A. Uzun, and F. Bas. 1986. Turkish hazelnut cultivars. Black Sea Hazelnut Exporters Union. Giresun/Ankara.

Bailey, L. H. 1914. The standard cyclopedia of horticulture, Vol.2. McMillan Co. London, University of Tennessee.

Baldwin, B. G., M. J. Sanderson, J. M. Porter, M. F. Wojciechowski, C. S. Campbell, and M. J. Donoghue. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann. Missouri Bot. Gard. 82: 247-277.

Ballington, J. R. and G. J. Galletta. 1978. Comparative crossability of 4 diploid Vaccinium species. J. Amer. Soc. Hort. Sci. 103: 554-560.

Bartolozzi, F, M. L. Warburton, S. Arulsekar, and T. M. Gradziel. 1998. Genetic characterization and relatedness among California almond cultivars and breeding lines detected by randomly amplified polymorphic DNA (RAPD) analysis. J. Amer. Soc. Hort. Sci. 123: 381-387.

Bell, P. 1995. Incompatibility in flowering plants: Adaptation of an ancient response. Plant Cell 7: 5-16.

Bell, R. L. and L. F. Hough. 1986. Interspecific and intergeneric hybridization of Pyrus. HortScience 21:62-64. 23

Bohs, L. 1991. Crossing studies in Cyphomandra (Solanaceae) and their systematic and evolutionary significance. Amer. J. Bot. 78: 1683-1693.

Botta, R., E. Emanuel, G. Me, S. Sacerdote, and R. Vallania. 1986. Indagine cariologica in alcune specie del genere Corylus. Riv. Ortoflorofrutt. It. 70: 323-329.

Bourquin, J.-C, A. Sonko, L. Otten, and B. Walter. 1993. Restriction fragment length polymorphism and molecular taxonomy in Vitis vinifera L. Theor. Appl. Genet. 87:431-438.

Bousquet, J., S. H. Strauss, and P. Li. 1992. Complete congruence between morphological and rbc-L based molecular phylogenies in birches and related species (Betulaceae). Mol. Biol. Evol. 9: 1076-1088.

Brummer, E. C, J. H. Bouton, and G. Kochert. 1995. Analysis of annual Medicago species using RAPD markers. Genome 38: 362-367.

Brunner, F., and D. E. Fairbrothers. 1979. Serological investigation of the Corylaceae. Bull. Tony. Bot. Club. 106: 97-103.

Castiglione, S., G. Wang, G. Damiani, C. Bandi, S. Bisoffi, and F. Sala. 1993. RAPD fingerprints for identification and taxonomic studies of elite poplar (Populus spp.) clones. Theor. Appl. Genet. 87: 54-59.

Challice, J. S., and M. N. Westwood. 1973. Numerical taxonomic studies of the genus Pyrus using both chemical and botanical characters. Bot. J. Linn. Soc. 67: 121-148.

Chawla, B., R. Bematzky, W. Liang, and M. Marcotrigiano. 1997. Breakdown of Self-incompatibility in tetraploid Lycopersicon peruvianum: inheritance and expression of S-related proteins. Theor. Appl. Genet. 95: 992-996.

Chetelat, R.T. and J.W. De Varna. 1991. Expression of unilateral incompatibility in pollen of Lycopersicon pennelli is determined by major loci on chromosomes 1,6, and 10. Theor. Appl. Genet. 82: 704-712.

Cooper, D. C. and R. A. Brink. 1940. Somatoplastic sterility as a cause of seed failure after interspecific hybridization. Genetics 25: 593-617.

Crawford, D. J. 1990. Plant molecular systematics. John Wiley and Sons, New York. 24

Decker, D. S. 1985. Numerical analysis of allozyme variation in Cucurbitapepo. Econ. Bot. 39: 300-309.

Deng, Z. N., A. Genetile, E. Nicolosi, F. Domina, A. Vardi, and E. Tribulato. 1995. Identification of in vivo and in vitro lemon mutants by RAPD markers. J. Hort. Sci. 70: 117-125.

Dhaliwal, H.S. 1992. Unilateral Incompatibility, p. 32-46. In: G. Kallo and J.B. Chowdhury (Eds.). Distant hybridization of crop plants. Monographs on Theoretical and Applied Genetics 16. Springer Verlag, Berlin, Germany.

Dickinson, H. G. 1990. Self-incompatibility in flowering plants. BioEssays 12: 155-161.

Drumke, J. S. 1964. A systematic survey ofCorylus in North America. Ph.D. Thesis, University of Tennessee.

Dudley, J. W. 1994. Comparison of genetic distance estimators using molecular marker data. Proc. of Symp. Analysis of molecular data. pp. 3-7. Joint Plant Breeding Symposia series ASHS, CSSA. 1994.

Dunemann, F., R. Kahnau, and H. Schmidt. 1994. Genetic relationships in Malus evaluated by RAPD fingerprinting of cultivars and wild species. Plant Breeding 113: 150-159.

Ebert, P. R., M. A. Anderson, R. Bematzky, M. Altschuler, and A. E. Clarke. 1989. Genetic polymorphism of self-incompatibility in flowering plants. Cell 56: 255-262.

Egea, J. and L. Burgos. 1996. Detecting cross-incompatibility of three North American apricot cultivars and establishing the first incompatibility group in apricot. J. Amer. Soc. Hort. Sci. 121: 1002-1005.

Erdogan, V. and S. A. Mehlenbacher. 1997. Preliminary results on interspecific hybridization in Corylus. Acta Hort. 445: 65-71.

Everett, T. H. 1981. The New York Botanical Garden illustrated encyclopedia of horticulture. Vol. 3, Garland Publishing, New York. p. 886-888.

Fabri, A., J. I. Hormoza and V. S. Polito. 1995. Random amplified polymorphic DNA analysis of olive {Olea europaea L.) cultivars. J. Amer. Soc. Hort. Sci. 120: 538-542. 25

Fang, D., R. R. Krueger, and M. L. Roose. 1998. Phylogenetic relationships among selected Citrus germplasm accessions revealed by inter-simple sequence repeat (ISSR) markers. J. Amer. Soc. Hort. Sci. 123: 612-617.

Farris, C. W. 1989. Two new introductions: 'Grand Traverse' hazelnut and 'Spartan' seedless grape. Ann. Rep. Northern Nut Growers Assoc. 80: 102- 103.

Fjellstrom, R. G., D. E. Parfitt, and G. H. McGranahan. 1994. Genetic relationships and characterization of Persian walnut (J. regia L.) cultivars using restriction fragment length polymorphisims (RFLPs). J. Amer. Soc. Hort. Sci. 119:833-839.

Furlow, J. J. 1997. Betulaceae Gray, Birch family, p. 507-538. In: Anonymous (ed.). Flora of North America, north of Mexico. Vol: 3 Magnoliophyta: Magnoliidae and Hamamelidae. Oxford Univ. Press, New York.

Gardiner, S. E., H. C. M. Basset, C. Madie, and D. A. M. Noiton. 1996. Isozyme, randomly amplified polymorphic DNA (RAPD), and restriction fragment- length polymorphism (RFLP) markers used to deduce a putative parent for the 'Braebum' apple. J. Amer. Soc. Hort. Sci. 121: 996-1001.

Gaude, T. and C. Dumas. 1987. Molecular and cellular events of self- incompatibility. Intern. Rev. Cytol. 107: 333-366.

Gawel, N. J., R. L. Jarret, and A. P. Whittemore. 1992. Restriction fragment length polymorphism (RFLP)-based phylogenetic analysis of Musa. Theor. Appl. Genet. 84: 286-290.

Gellatly, J. U. 1956. Filazels. Ann. Rep. Northern Nut Growers Assoc. 47: 112- 114.

Gellatly, J. U. 1964. Filazels. Ann. Rep. Northern Nut Growers Assoc. 55: 153- 155.

Gellatly, J. U. 1966. Tree hazels and their improved hybrids. Ann. Rep. Northern Nut Growers Assoc. 57: 98-101.

Hadley, H. H. and S. J. Openshaw. 1980. Interspecific and intergeneric hybridization, p. 133-159. In: W. R. Fehr and H. H. Hadley (eds.). Hybridization in crop plants. Amer. Soc. Agronomy, Madison, WI.

Hall, J. W. 1952. The comparative anatomy and phylogeny of the Betulaceae. Bot. Gazette 113: 235-270. 26

Hampson, C. R., A. N. Azarenko, and A. Soeldner. 1993. Pollen-stigma interactions following compatible and incompatible pollinations in hazelnut. J. Amer. Soc. Hort. Sci. 118: 814-819.

Harrison, R. E., J. J. Luby, and G. R. Fumier. 1997. Chloroplast DNA restriction fragment variation among strawberry {Fragaria spp.) taxa. J. Amer. Soc. Hort. Sci. 122:63-68.

Hawkes, J.G. 1977. The importance of wild germplasm in plant breeding. Euphytica 26: 615-621.

Hellman, E. W., R. M. Skirvin, and A.G. Otterbacher. 1982. Unilateral incompatibility between red and black raspberries. J. Amer. Soc. Hort. Sci. 107: 781-784.

Heslop-Harrison J., Y. Heslop-Harrison, R. B. Knox , and B. Howlet. 1973. Pollen-wall proteins: gametophytic and sporophytic fractions in the pollen walls of the Malvaceae. Ann. Bot. 37: 403-412.

Heslop-Harrison J., R. B. Knox, and Y. Heslop-Harrison. 1974. Pollen wall proteins: exine-held fractions associated with the incompatibility response in Cruciferae. Theor. Appl. Genet. 44: 133-137.

Heslop-Harrison Y., J. S. Heslop-Harrison, and J. Heslop-Harrison. 1986. Germination of Corylus avellana L. (hazel) pollen: hydration and the function of the oncus. Acta Bot. Neerl. 35: 265-284.

Hiscock, S. J. and H. G. Dickinson. 1993. Unilateral incompatibility within the Brassicaceae: further evidence for the involvement of the self- incompatibility (S)-locus. Theor. Appl. Genet. 86: 744-753.

Hogenboom, N. G. 1973. A model for incongruity in intimate partner relationships. Euphytica 22: 219-233.

Hormoza, J. I., L. Dollo, and V. S. Polito. 1994. Determination of relatedness and geographical movements of Pistacia vera (Pistachio; Anacardiaceae) germplasm by RAPD analysis. Econ. Bot. 48: 349-358.

Hsiao, C, N. J. Chatterkon, K. H. Asay, and K. B. Jensen. 1993. Phylogenetic relationships of 10 grass species: an assessment of phlogenetic utility of the internal transcribed spacer region in nuclear ribosomal DNA in monocots. Genome 37: 112-120. 27

Hu, H. H. 1948. The silva of China: a description of the trees which grow naturally in China. Vol 2, Betulaceae-Corylaceae. Fan Memorial Institue of Biology and National Forest Res. Bureau. Ministry of Agriculture and Forestry.

Huxley, A., M. Griffiths, and L. Margot. 1992. The new Royal Horticultural Society dictionary of gardening 1. McMillan Press Ltd., London.

Ikeda, S., J. B. Nasrallah, R. Dixit,. S. Preiss, and M. E. Nasrallah. 1997. An aquaporin-like gene required for the Brassica self-incompatibility response. Science 276: 1564-1566.

Janssens, G. A., I. J. Goderis, W. F. Broekaert, and W. Broothaerts. 1995. A molecular method for S- allele identification in apple based on allele- specific PCR. Theor. Appl. Genet. 91: 691-698.

Johnson, L. A., and D. E. Soltis. 1995. Phylogenetic inference in Saxifragaceae sensu stricto and Gillia (Polemoniaceae) using matK sequences. Ann. Missouri Bot. Gard. 82:149-175.

Johansson, E. 1927. Floral biology trials with hazel at Alnarp 1924-1926 (in Swedish). Sveriges Pom. Foren. Arsskrift 1927. pp. 3-20.

Johnston, S. A. and R. E. Hanneman. 1982. Manipulations of endosperm balance number overcome crossing barriers between diploid Solarium species. Science. 217: 446-448.

Kallo, G. 1992. Utilization of wild species, p. 149-167. In: Kallo, G. and J.B. Chowdhury (Eds.). Distant hybridization of crop plants. Monographs on Theoretical and Applied Genetics 16. Springer Verlag, Berlin.

Kasapligil, B. 1963. Corylus colurna and its varieties. Calif. Hort. Soc. J. 24: 95- 104.

Kasapligil, B. 1964. A contribution to the histotaxonomy of Corylus (Betulaceae). Adansonia. Tome IV, Fascicule 1, p. 43-90.

Kasapligil, B. 1968. Chromosome studies in the genus Corylus. Scientific Reports of the Faculty of Science, Ege University No. 59.

Kasapligil, B. 1972. A bibliography on Corylus (Betulaceae) with annotations. Ann. Rep. Northern Nut Growers Assoc. 63:107-162. 28

Kesseli, R. V., and R. W. Michelmore. 1986. Genetic variation and phylogenies detected from isozyme markers in species of Lactuca. J. Heredity 77: 324- 331.

Kester, D. E., W. C. Micke, and M. Viveros. 1994. A mutation in 'Nonpareil' almond conferring unilateral incompatibility. J. Amer. Soc. Hort. Sci. 119: 1289-1292.

Khus, G. S., and D. S. Brar. 1992. Overcoming the barriers in hybridization. In: G. Kallo and J. B. Chowdhury (eds.). Distant hybridization of crop plants, pp. 47-61. Springer-Verlag, New York.

Knox, R. B., R.. R. Willing and A. E. Ashford. 1972. Role of pollen-wall proteins as recognition substances in interspecific incompatibility in poplars. Nature 237: 381-383.

Krussmann, G. 1976. Manual of cultivated broad-leaved trees and shrubs. Timber Press, Portland, OR.

Kubitzki, K. 1993. Betulaceae, p. 152-157. In: K. Kubitzki (ed.). The families and genera of vascular plants. Vol, II. Flowering plants, Dicotyledons. Springer- Verlag, Berlin.

Ladizinsky, G. 1992. Crossability relations, p. 15-31. In: G. Kallo and J. B. Chowdhury (Eds.). Distant hybridization of crop plants. Monographs on Theoretical and Applied Genetics 16: Springer Verlag, Berlin.

Lamboy, W. F., J. Yu, P. L. Forsline, and N. F. Weeden.1996. Partitioning of allozyme diversity in wild populations of Malm sieversii L. and implications for germplasm collection. J. Amer. Soc. Hort. Sci. 121: 982- 987.

Larsen, K. 1977. Self-incompatibility in Beta vulgaris L. I. Four gametophytic, complementary S-loci in sugar beet. Hereditas 85: 227-248.

Layne, R. E. C. and W. B. Sherman. 1986. Interspecific hybridization ofPrunus. HortScience 21: 48-51.

Levi, A., and L. J. Rowland. 1997. Identifying blueberry cultivars and evaluating their genetic relationships using randomly amplified polymorphic DNA (RAPD) and simple sequence repeat- (SSR) anchored primers. J. Amer. Soc. Hort. Sci. 122: 74-78. 29

Lewis, D. and L. K. Crowe. 1958. Unilateral interspecific incompatibility in flowering plants. Heredity 12: 233-256.

Li, X., N. Paech, J. Nield, D. Hayman, and P. Langridge. 1997. Self-incompatibilty in the grasses: evolutionary relationship of the S gene from Phalaris coerulescens to homologous sequences in other grasses. Plant Mol. Biol. 34: 223-232.

Liang, H. and K. W. Hilu. 1996. Application of the matY*. gene sequences to grass systematics. Can. J. Bot. 74: 125-134.

Liang, W. J., and Y. M. Zhang. 1988. Investigation and study of filbert resources in China. Proc. Intl. Symp. on Hort. Germplasm, Cultivated and Wild, Beijing, Sept. 1988.

Liang, W., X. Ming, and X. Wanying. 1994. Studies on hazelnut breeding in northern China. Acta Hort. 351: 59-66.

Lield, B. E. and N. O. Anderson. 1993. Reproductive barriers: identification, uses and circumvention. Plant Breed. Rev. 11: 11-154.

Lield, B. E., S. McCormick, and M. A. Mutschler. 1996. Unilateral incongruity in crosses involving Lycopersicon pennelli and L. esculentum is distinct from self-incompatibility in expression, timing and location. Sex. Plant Reprod. 9: 299-308.

Listen, A. and J. A. Wheeler. 1994. The phylogenetic position of the genus Astragalus (Fabaceae): evidence from the chloroplast genes rpoC\ and rpoCl. Bio. Syst. Ecol. 22: 377-388.

Listen, A., W. A. Robinson, J. M. Oliphant, and E. R. Alvarez-Buylla. 1996. Length variation in the nuclear ribosomal DNA internal transcribed spacer region of non-flowering seed plants. Syst. Bot. 21: 109-120.

Lu, J. and Lamikanra, O. 1996. Barriers to intersubgeneric crosses between Muscadinia and Euvitis. HortScience 31: 269-271.

Magdalita, P. M., R. A. Drew, S. W. Adkins, and I. D. Godwin. 1997. Morphological, molecular and cytological analyses of Carica papaya x C. cauliflora interspecific hybrids. Theor. Appl. Genet. 95: 224-229.

Masuelli, R. W., and El L. Camadro. 1997. Crossability relationships among wild potato species with different ploidies and endosperm balance numbers (EBN). Euphytica 94: 227-235. 30

Matton, D.P., O. Maes, G. Laublin, Q. Xike, C. Bertrand, D.Morse, and M. Cappadocia. 1997. Hypervariable domains of self-incompatibility RNases mediate allele-specific pollen recognition. Plant Cell 9: 1757-1766.

Mau, S. L., J. Raff, and A. E. Clarke. 1982. Isolation and partial characterization of components of Primus avium L. styles, including an antigenic glycoprotein associated with a self-incompatibility genotype. Planta 156: 505-516.

Mehlenbacher, S. A. 1991. Hazelnuts (Corylus). Genetic resources of temperate fruit and nut crops. Acta Hort. 290: 791-836.

Mehlenbacher, S. A. 1997. Revised dominance hierarchy for S-alleles in Corylus avellana L. Theor. Appl. Genet. 94: 360-366.

Mehlenbacher, S. A. and M. M. Thompson. 1988. Dominance relationships among S-alleles in Corylus avellana L. Theor. Appl. Genet. 76: 669-672.

Mhameed, S., D. Sharon, D. Kaufinan, E. Lahav, H. Hillel, C. Degani, and U. Lavi. 1997. Genetic relationships within avocado (Persea americana Mill) cultivars and between Persea species. Theor. Appl. Genet. 94: 279-286.

Morgan, D. R., D. E. Soltis, and K. R. Roberstson. 1994. Systematic and evolutionary implications of rbcL sequence variation in Rosaceae. Amer. J. Bot. 81:890-903.

Narasimha Rao, N. 1979. The barriers to hybridization between Solarium melongena and some other species of Solarium, p. 605-614. In: J. G. Hawkes, R. N. Lester, and A. D. Skelding (eds.). The biology and taxonomy of the Solanacea. Linn. Soc. Sym. Series 7, Academic Press, London.

Nasrallah, J. B. 1997. Signal perception and response in the interactions of self- incompatibility in Brassica. Essays in Biochemistry 32: 143-159.

Nasrallah, M. E. and J. B. Nasrallah. 1985. A cDNA clone encoding an S-locus glycoprotein from Brassica olearaceae. Nature 318: 263-267.

Nasrallah, M. E. and J. B. Nasrallah. 1986. Molecular biology of self incompatibility in plants. Trends Genet. 2: 239-244.

Nasrallah, M. E. and J. B. Nasrallah. 1993. Pollen-stigma signaling in the sporophytic self-incompatibility response. Plant Cell 5: 1325-1335. 31

Nettancourt, D. De. 1977. Incompatibility in Angiosperms. Monographs on Theor. Appl. Genet. 3. Springer-Verlag, Berlin and New York.

Nettancourt, D. De, M. Devreux, U. Laneri, M. Cresti, E. Pacini, and G. Sarfatti. 1974. Genetical and ultrastructrual aspects of self and cross incompatibility in interspecific hybrids between self-compatible Lycopersicum esculentum and self-incompatible L peruvicmum. Theor. Appl. Genet. 44: 278-288.

Newbigin, E., M. A. Anderson, and A. E. Clarke. 1993. Gametophytic self- incompatibility systems. Plant Cell 5: 1315-1324.

Nienhuis, J., J. Tivang, and P. Skroch. 1994. Analysis of genetic relationships among genotypes based on molecular marker data. p. 8-14. In: Proc. of Symp. Analysis of molecular data. Joint Plant Breeding Symposia series ASHS,CSSA. 1994.

Perez, S., S. Montez, and C. Mejia. 1993. Analysis of peach germplasm in Mexico. J. Amer. Soc. Hort. Sci. 118: 519-524.

Qu, X., J. Lu, and O. Lamikanra. 1996. Genetic diversity in Muscadine and American bunch grapes based on randomly amplified polymorphic DNA (RAPD) analysis. J. Amer. Soc. Hort. Sci. 121: 1020-1023.

Rabakoarihanta, A., D. W. S. Mok and M. C. Mok. 1979. Fertilization and early embryo development in reciprocal interspecific crosses of Phaseolus. Theor. Appl. Genet. 54: 55-59.

Reed, C. A. 1936. New filbert hybrids. J. Heredity 27: 427-431.

Rehder, A. 1940. Manual of cultivated trees and shrubs hardy in North America, p. 143-146. 2nd edition., McMillan Company, New York.

Ren, J., J. R. McFerson, R. Li, S. Kresovich, and W. F. Lamboy. 1995. Identities and relationships among Chinese vegetable Brassicas as determined by random amplified polymorphic DNA markers. J. Amer. Soc. Hort. Sci. 120: 548-555.

Rhodes, A. M., S. E. Malo, C. W. Campbell, and S. G. Carmer. 1971. A numerical taxonomic study of avocado (Persea americana Mill). J. Amer. Soc. Hort. Sci. 96: 391-395.

Rougier, M., N. Jnoud, C. Said, S. Russel, and C. Dumas. 1992. Interspecific incompatibility in Populus: inhibition of tube growth and behaviour of the male germ unit in P. deltoides x P. alba. Protoplasma 168: 107-112. 32

Rovira, M. 1997. Genetic variability among hazelnut (C. avellana L.) cultivars. ActaHort. 445: 45-50.

Rudd, J., F. Christopher, H. Franklin, and V. E. Franklin-Tong. 1997. Ca2 independent phosphorylation of a 68 kDa pollen protein is stimulated by the self-incompatibiliy response in Papaver rhoeas. Plant J. 12: 507-514.

Sakurai, K., S. K. Brown, and N. F. Weeden. 1997. Determining the self- incompatibility alleles of Japanese apple cultivars. HortScience. 32: 1258- 1259.

Salesses, G. 1973. Cytological study of genus Corylus. A heterozygotic translocation in some low male fertile varieties of hazelnut (C. avellana). Ann. Amelior. Plantes 23: 59-66.

Sampson, D. R. 1962. Intergeneric pollen-stigma incompatibility in Cruciferae. Can. J. Genet. Cytol. 4: 38-49.

Saward, L., M. Michaud, and J. Bousquet. 1993. Genetic diversity and phylogenetic relationships between birches and alders using ITS, 18S rRNA, and rbcl gene sequences. Mol. Phyl. Evol. 2: 112-118.

Schuster, C. E. 1924. Filberts: 2. Experimental data on filbert pollination. Oregon Agric. Expt. Sta. Bull. No. 208548-555.

Scorza, R. 1984. Introduction to the workshop: Overcoming the barriers to interspecific hybridization of perennial fruit crops. Held at 81st ASHS annual meeting, Vancuver, B.C. 6 August, 1984. (HortScience 21: 41).

Sharp, A. J. 1951. Relationships between the floras of California and southern United States. Contrib. Dudley Herbarium 4: 59-61.

Shii, C. T., M. C. Mok, S. R. Temple, and D. W. S. Mok. 1980. Expression of developmental abnormalities in hybrids of Phaseolus vulgaris. J. Heredity. 71:218-222.

Simmonds, N. W. and S. T. C. Weatherup. 1990. Numerical taxonomy of the cultivated bananas. Trop. Agric. (Trinidad) 67: 90-92.

Singh, R. J. 1993. Plant cytogenetics. CRC press.

Slate, G. L. 1961. The present status of filbert breeding. Ann. Rep. Northern Nut Growers Assoc. 52: 24-26. 33

Sneath, P. H. A. and R. R. Sokal. 1973. Numerical taxonomy: the principles and practice of numerical classification. Freeman Press, San Francisco.

Stammers, M., J. Harris, G. M. Evans, M. D. Hayward, and J. W. Forster. 1995. Use of random PCR (RAPD) technology to analyse phylogenetic relationships in the LoliumlFestuca complex. Heredity 74: 19-27.

Stein, J. C, B. Howlett, D. C. Boyes, M. E. Nasrallah, and J. B. Nasrallah. 1991. Molecular cloning of a putative receptor protein kinase gene encoded at the self incompatibility locus of Brassica oleraceae. Proc. Natl. Acad. Sci. USA. 88: 8816-8820.

Stein, J. C, R. Dixit, M. E. Nasrallah, and J. B. Nasrallah. 1996. SRK, the stigma- specific S locus receptor kinase of Brassica, is targeted to the plasma membrane in transgenic tobacco. Plant Cell. 8: 429-445.

Stiles, J. I., C. Lemme, S. Sondur, M. B. Morshidi, and R. Manshardt. 1993. Using randomly amplified polymorphic DNA for evaluating genetic relationships among papaya cultivars. Theor. Appl. Genet. 85: 697-701.

Stuessy, T. F. 1990. Plant taxonomy. Columbia Univ. Press, pp 514, New York.

Thompson, M. M. 1979a. Genetics of incompatibility in Corylus avellana L. Theor. Appl. Genet. 54: 113-116.

Thompson, M. M. 1979b. Incompatibility alleles in Corylus avellana L. cultivars. Theor. Appl. Genet. 55: 29-33.

Thompson, M. M., H. B. Lagerstedt, and S. A. Mehlenbacher. 1996. Hazelnuts, p. 125-184. In: J. Janick, J. N. Moore (eds.). Fruit Breeding Vol: III, Nuts. John Wiley and Sons Inc., New York.

Thormann, C. E. and T. C. Osbom. 1992. Use of RAPD and RFLP markers for germplasm evaluation, p. 9-11. In: Applications of RAPD technology to plant breeding (Joint plant breeding symposia series). ASSA, ASHS, AGA, Minneapolis, Minn.

Tingey, S. V. and J. P. del Tufo. 1993. Genetic analysis with random amplified Polymorphic DNA markers. Plant. Physiol 101: 349-352.

Varghese, Y. A., C. Knaak, M. R. Sethuraj, and W. Ecke. 1997. Evaluation of random amplified polymorphic DNA (RAPD) markers in Hevea brasiliensis. Plant Breeding 116: 47-52. 34

Vivek, B. S. and P. W. Simon. 1998. Genetic relationships and diversity in carrot and other Daucus taxa based on nuclear restriction fragment length polymorphisims. J. Amer. Soc. Hort. Sci. 123: 1053-1057.

Volker, H., J. E. Gray, B. A. McClure, M. A. Anderson, and A. E. Clarke. 1990. Self-incompatibility: A self-recognition system in plants. Science 250: 937- 941.

Wang, Z. Y., G. Second, and S. D. Tanksley. 1992. Polymorphisim and phylogenetic relationships among species in the genus Oryza as determined by analysis of nuclear RFLPs. Theor. Appl. Genet. 83: 565-581.

Warburton, M. L. and F. A Bliss. 1996. Genetic diversity in peach {Prunuspersica L. Batch) revealed by randomly amplified polymorphic DNA (RAPD) markers and compared to inbreeding coefficients. J. Amer. Soc. Hort. Sci. 121: 1012-1019.

Weschcke, C. 1970. A little nut history. Ann. Rep. Northern Nut Growers Assoc. 61:113-116.

Wetzel, V. G. K. 1929. Chromosomen studien bei den Fagales. Botanisches Rachiv. 25: 257-283.

Wilde, H., R. Waugh, and W. Powell. 1992. Genetic fingerprinting oiTheobroma clones using randomly amplified polymorphic DNA markers. Theor. Appl. Genet. 83: 871-877.

Wilkie, S. E., P. G. Isaac, and R. J. Slater. 1993. Random amplified polymorphic DNA (RAPD) markers for genetic analysis in Allium. Theor. Appl. Genet. 86: 497-504.

Williams, C. E. and D. A. St. Clair. 1993. Phenetic relationships and levels of variability detected by restriction fragment length polymorphism and random amplified polmorphic DNA analysis of cultivated and wild accessions of Lycopersicon esculentum. Genome 36: 619-630.

Woodland, D. W. 1991. Contemporary plant systematics. Prentice Hall, Englewood Cliffs, pp 582, N. J.

Woodworth, R. H. 1929. Cytological studies in Betulaceae, II: Corylus andAlnus. Bot Gaz. 88: 383-399. 35

Wu, L., and H. Lin. 1994. Identifying buffalograss [Buchloe dactyloides (Nutt.) Engelm.] cultivar breeding lines using randomly amplified polymorphic DNA (RAPD) markers. J. Amer. Soc. Hort. Sci. 119: 126-130.

Zheng, W. J. 1985. Taxonomy of Chinese forest trees (in Chinese). Forest Publishing House of China, Beijing. 36

CHAPTER 2

INTERSPECIFIC HYBRIDIZATION IN HAZELNUT (Corylus)

2.1 ABSTRACT

Eight Corylus species were intercrossed to reveal genetic relationships. Crosses were made in all possible combinations. Pollinations were made on either individually bagged branches or trees entirely covered with polyethylene using mixtures of pollen of 5 genotypes to prevent possible incompatibility. Percent cluster set, seed germination rate and hybrid seedling survival rate were determined. Hybridity of seedlings was verified by morphological traits. The cultivated European hazelnut, C. avellana could be crossed with most of the wild species either freely or with some degree of difficulty. In general, C. avellana was more successful as a pollen parent. Neither C. cornuta nor C. sieboldiana was cross-compatible with C. avellana in either direction, but C. americana and C. avellana were cross-compatible reciprocally. C. cornuta, C. californica and C. sieboldiana were cross-compatible reciprocally. The cross between C. colurna and C. avellana is difficult but possible. Unilateral incompatibility was observed. The following crosses were successful C. californica x C avellana, C. chinensis x C. avellana, C americana x C. heterophylla, C. cornuta x C heterophylla, C. californica x C. colurna, and C. americana x C. sieboldiana, but the reciprocals were not. However, the Asian species C. heterophylla x C. chinensis and C. chinensis x C. sieboldiana were reciprocally incompatible. Based on percent cluster set, seed germination rate and hybrid seedling survival rate along with the observed morphological similarities, Corylus species were placed in four groups as follows: (1) C. avellana; (2) C heterophylla, C 37

heterophylla var. sutchuensis, and C. americana; (3) C. cornuta, C. californica, and C. sieboldiana; (4) C. colurna, and C. chinensis.

2.2 INTRODUCTION

'Hazelnut' is a name given to the genus Corylus which is a member of the birch family, Betulaceae, of the order Fagales. As many as 25 species have been reported in the genus by taxonomists (Bailey, 1914; Everett, 1981; Huxley et al., 1992; Kasapligil, 1972; Krussman, 1976; Rehder, 1940). However, only the five shrubby species, C. avellana L., C. americana Marshall, C. cornuta Marshall, C. heterophylla Fischer and C. sieboldiana Blume; and the four tree species C. colurna L., C. jacquemontii Decaisne, C. chinensis Franchet and C. ferox Wallich have been most widely recognized (Thompson et al., 1996). Hazelnuts are not native to the Southern Hemisphere and native fossil forms show no evidence of them in the past (Kasapligil, 1972). Corylus species are widely distributed throughout temperate regions of the Northern Hemisphere from Japan, China and Manchuria through Tibet, Caucasia, Turkey, Europe and North America (Ayfer et al., 1986; Kasapligil, 1972). They are deciduous trees and shrubs. All species are monoecious and wind-pollinated (Lagerstedt, 1975). The chromosome number of the genus is 2n = 2x = 22 (Botta et al., 1986; Kasapligil, 1968; Salesses, 1973; Wetzel, 1929). C. avellana, the European hazelnut, is the only cultivated species and contains a great amount of genetic diversity (Mehlenbacher, 1991; Rovira, 1997). All of the important commercial cultivars in Europe and Turkey were selected from local wild populations of this species over many centuries. These high quality cultivars form the foundation of breeding programs initiated in the 1960's and 1970's. A few superior selections have been released from these programs including 'Willamette' (Mehlenbacher, 1991) and very recently 'Lewis' and 38

'Clark' from Oregon, USA, 'Corabel' from Bordeaux, France and 'Daria' from the Univ. of Torino, Italy (Thompson et al., 1996). Nuts of C. avellana have superior quality and large size and thus this species has been extensively used in breeding programs. However, there are some highly desirable and economically important traits such as nonsuckering growth habit, tolerance to lime, extreme precocity, exceptionally early maturity, cold hardiness and alternate sources of resistance to eastern filbert blight disease (Thompson et al., 1996) that do not exist within the C. avellana but do exist in wild species. Interspecific hybridization then becomes necessary to transfer those characters from wild species. Such interspecific hybridizations have been reported (Farris, 1989; Gellatly, 1956, 1964, 1966; Liang et al., 1994; Reed, 1936; Slate 1961; Weschcke 1970). Most studies concentrated on crosses with C. avellana due to its economic importance. For many Asian species, the ease or difficulty with which they can be crossed with the cultivated hazelnut has not yet been documented. In other cases, reports are conflicting and clarification is needed. Previous attempts indicate that some Corylus species freely intercross, some cross with difficulty, some cross in one direction only and some do not cross in either direction (Erdogan and Mehlenbacher, 1997; Mehlenbacher, 1991; Thompson et al., 1996). An effort to collect representatives of all hazelnut species from natural, wild populations is in progress at Oregon State University and at the U.S. Department of Agriculture National Clonal Germplasm Repository in Corvallis, Oregon. Many representatives of these species had reached maturity and were available for use in this study. The objective of this study was to obtain information about the crossability of Corylus species using true-to-name genotypes. This information will provide light on their genetic relationships, and facilitate their use in hazelnut breeding. 39

2.3 MATERIALS AND METHODS

2.3.1 Genetic material Crossing studies were performed in 1995, 1996 and 1997 at the Smith Horticulture research farm of Oregon State University, and the U.S. Department of Agriculture National Clonal Germplasm Repository, Corvallis, OR. Several female and male parents were used for each species. Wild species were represented by seedlings grown from imported open pollinated seeds as well as grafted trees propagated from imported scions. Cultivars and advanced selections from the OSU breeding program were used for C. avellana. Female parents (Tables 2.1, 2.2 and 2.3) were selected based on their performance in previous years, plant size, time of flowering and male flower (catkin) number which is an indication of the abundance of female flowers. We planned to use at least two different female genotypes for each species every year. However it was not possible in some cases. For C. colurna, only 2 genotypes were available and alternate bearing was pronounced. Q.) In C. chinensis, many seedlings were available but only one or a few were in the adult phase as this species which has a long juvenility period. (3) In C. heterophylla, female flowers were rare on most seedlings as well as selections. (4) Wind and heavy rain storms damaged the pollination cages, and floods lifted the cages up in some plots and allowed unwanted open pollination as in C. americana. Newly elongated catkins were collected from many genotypes in each wild species since there was no available information about their pollen quality and quantity (Table 2.4). Some species produced very small and few catkins, yielding small amounts of pollen as in C. cornuta and C. heterophylla. Collected catkins were brought to the lab in the afternoon, laid on paper and allowed to dry overnight. As they dried, the anthers dehisced and shed pollen on the paper. Pollen was collected and stored in cotton-stoppered glass vials at -20oC until used. Quantity and quality of pollen determined the selection of male parents in all species. Some genotypes produced light colored pollen and some pollen appeared grainy. Table 2.1 Female parents ofCorylus species and genotypes used in 1995.

Species Genotype Origin

C. avellana L. Ennis (2 grafted trees) (Si.Sn)* Washington, USA Casina (2 grafted trees) (S'^S^i)* Asturias, Spain

C americana Marsh. COR.059 (2 seedlings of same seed lot) Mississippi, USA

C. heterophylla Fisch. HetOOl (2 grafted trees) China Het013 (2 grafted trees) China

C. cornuta Marsh. 88403 (3 seedlings of same seed lot) New York, USA 84016 (2 seedlings of same seed lot) British Columbia, Canada

C. californica Marsh. B0509 (2 grafted trees) Oregon, USA B0849 (2 grafted trees) Oregon, USA

C. sieboldiana Blume. 87801 (2 seedlings of same seed lot) Korea COR350 (2 grafted trees) Korea

C. colurna L. XI1 (seedling tree) Europe X13 (seedling tree) Europe

* Self-incompatibility alleles are shown for C. avellana cultivars.

o Table 2.2 Female parents ofCorylus species and genotypes used in 1996.

Species Genotypes Origin

C. avellana. 276.076 (2 grafted trees) (Si.Sg)* Tombul Ghiaghli x Willamette

C. americana Marsh. 88301 (2 seedlings of same seed lot) Pennsylvania, USA 88309 (2 seedlings of same seed lot) Kentucky, USA 88312 (2 seedlings of same seed lot) New Jersey, USA

C. heterophylla Fisch. 86025 (seedling tree) Korea

C. cornuta Marsh. 88401 (2 seedlings of same seed lot) Quebec, Canada 89413 (2 seedlings of same seed lot) Manitoba, Canada

C. californica Marsh. Repository 4/41-42 (2 grafted trees) Oregon, USA

C. sieboldiana Bl. 86030 (2 seedlings of same seed lot) Korea 86031 (seedling tree) Korea

C. colurna L. XI1 (seedling tree) Europe

C. chinensis Franch. W5 (seedling tree) China

* Self-incompatibility alleles are shown for C. avellana selection. Table 2.3 Female parents ofCorylus species and genotypes used in 1997.

Species Genotypes Origin

C. avellana L. Butler (2 grafted trees) (82, S3)* Oregon, USA 245.098 (2 grafted trees) (83,8 g)* (Barcelona x Tombul Ghiaghli) x Willamette C. americana Marsh. 88317 (2 seedlings of same seed lot) Iowa, USA

C. heterophylla Fisch. Het013 (2 grafted trees) China 88452 (2 seedlings of same seed lot) China COR 067 (seedling tree) China

C. cornuta Marsh. 89404 (2 seedlings of same seed lot) New York, USA 89401 (2 seedlings of same seed lot) Wisconsin, USA

C. californica Marsh. Repository 2/43-44 (2 grafted trees) Oregon, USA Repository 3/43-44 (2 grafted trees) Oregon, USA

C. sieboldiana Bl. 86028 (2 seedlings of same seed lot) Korea 86029 (2 seedling of same seed lot) Korea

C. colurna L. XI3 (seedling tree) Europe

C. chinensis Franch. W5 (seedling tree) China

* Self-incompatiblity alleles are shown for C. avellana cultivar and selection.

to 43

Table 2.4 Male genotypes (mix) used in Corylus crosses.

Species Genotypes 1995 1996 1997

C. avellana L. 243.002 (Sj s,)* Mortarella 1[S 2:. S ,7)* Casina(S1o S2i)* 256.005 (Sj .S"4)* 264.148 (S2 s,,2)* 228.084(8, S2)* 278.113(8^.s,)* 452.014 (S4 s" .9)* 313.078 (S2S12)* 381.053 (S2 ,s;2)* 464.029 (S2' s" 5)* 455.087(S9S2o)* 443.107(8^2)* 513.007(85 s 9")* 513.007(85,89)*

C. americana Marsh. 403.040 356.063 400.008 530.081 366.069 401.023 531.034 401.028 530.039 532.014 405.070 532.014 532.069 530.063 532.061

C. heterophylla Fisch. 402.009 T26 404.045 402.050 402.009 404.061 404.010 404.023 530.015 404.054 530.025 530.021 406.007 559.062 559.059

C. heterophylla \ar.sutchuensis ... 566.044 ***

C. cornuta Marsh. CC3.002 CC3.006 CC3.038*** CC3.024 CC3.054 CC3.059 CC4.002 CC4.007 CC4.007 CC4.039 CC4.025 CC4.024 CC4.052 CC4.053 CC4.034

C. californica Marsh. X37 X37** Y30 *** X39 X39 Y31 Y20 Y20 CC2.088 Y34 Y34 CC1.100 CC2.040 CC2.040 CC1.103

C. sieboldiana Bl. CC 1.021 CC1.021 ** CC1.043 *** CC 1.043 CC 1.043 CC1.057 CC 1.061 CC 1.061 CC2.070 CC4.103 CC4.103 CC2.073 CC4.104 CC4.104 CC4.104

C. colurna L Xll Xll Xll X13 X13 X13 Peavy Peavy

C. chinensis Franch. -- W5 W5

* Self-incompatiblity alleles in C. avellana. ** Pollen used for 1996 hybridizations collected in 1995 and stored at -20oC. *** Pollen used for 1997 hybridizations collected in 1996 and stored at-20oC. 44

For C. avellana, cross-compatible selections or cultivars were used as the pollen parents. Sporophytic pollen-stigma incompatibility in C. avellana has been well- studied (Mehlenbacher, 1997; Thompson, 1979a, 1979b) but this information is not available for the wild Corylus species. Thus, mixtures of pollen of five genotypes for each species were used to minimize the potential pollen-stigma incompatibility.

2.3.2 Crosses Controlled crosses of all possible combinations including reciprocals were made on individual branches or entire trees depending on plant size. Female parents were emasculated before the start of pollen shed and emergence of female flowers. Individual branches were bagged in Tyvek (Dupont) housewrap (Smith and Mehlenbacher, 1994). The Tyvek bag was enclosed in a cotton-polyester bag for protection from punctures and abrasion. Entire trees were enclosed in wooden framed structures covered with white polyethylene. Female flowers were pollinated by hand when styles were visible outside the bud or had reached beyond the red dot stage (>2mm). It was not always possible to have high quality flowers, for several reasons; (1) early female flowers emerged in January yet pollen of other species was not available until April, and (2) some genotypes produced low quality (not healthy) female flowers. In 1996 and 1997, stored pollen from the previous year was used in crosses for late-shedding species C. cornuta, C. californica and C. sieboldiana. Hybrid seeds were harvested when the nuts could be easily turned in the husk in August, September or October depending on the year and species. The numbers of pollinated flowers and harvested nut clusters were counted and percent cluster set was calculated as the ratio of nut clusters to flowers pollinated. Crosses with percent cluster set greater than 10% were considered compatible, crosses with less than 5% cluster set were considered incompatible and Cluster set between 5 and 10% was considered intermediate. 45

2.3.3 Seed germination and growing seedlings In 1995, all available hybrid seeds of most crosses and 200 randomly taken seeds from crosses which had high cluster set were used. A total of 3012 kernels were extracted from nuts by hand-cracking the shells. Numbers of empty nuts and abnormal embryos were recorded. To break dormancy, seeds were treated with 50 ppm Gibberellic Acid (GA3) for 48 hours in November (Mehlenbacher, 1994). After treatment, seeds were placed between two layers of moist filter paper in plastic boxes, and planted in flats as roots appeared. Plantings were repeated at intervals of 7-20 days. Approximately 50 seedlings per cross were transplanted into 4L plastic pots when they were 15-25 cm long. A pH adjusted mix of peat moss, volcanic pumice and bark (4:3:3) was used as the growth medium. Seedlings were grown in the greenhouse. They were moved outdoors for chilling in December 1996, and planted in the field in July 1997. Similar germination procedures with modifications were followed for hybrid seeds from 1996 crosses. All hybrid seeds for most crosses and 100 randomly taken seeds for the few crosses which had high cluster set were used. The seeds were stratified at 50C from December 11, 1996 to March 27, 1997 in moist vermiculite. Prior to stratification nuts were surface sterilized with 2.7% bleach (sodium hypochlorite) for 1 min. 204 germinated nuts were planted at the end of the stratification. Ungerminated nuts were cracked by hand and seeds were extracted. They were treated with 50 ppm GA3 for 24h. Over the following 42 days, 1242 embryos germinated. The remaining 74 seeds were retreated with the hormone, then planted. A total of 935 seedlings were transplanted. Greenhouse- grown seedlings were moved outdoors in December 1997 and planted in the field in June 1998. Data for empty nuts were obtained by visual inspection. Empty seeds were identified either (1) by external characteristics such as color of shell, presence of large black spots on the shell, adherence to the husk, and weight of the nut, or (2) by internal characters such as absence of embryo, very small embryo size and abnormal embryo development. Seeds were considered germinated when the root 46

and shoot were seen. Hybridity of seedlings was verified as they grew outdoors under natural conditions by observing species-specific morphological characters such as leaf shape and size, production of dead lesions or spots on leaves, terminal branching habit, trunk color and bark appearance. Seedling survival data was taken during seedling growth from the very early stages of development (just after emergence) to the day of field planting. Trunk diameter of seedlings was measured in the dormant season with a digital caliper (Mitutoyo Mfg. Co. Ltd., Tokyo, Japan) when 1995 and 1996 seedlings were 14 and 9 months old, respectively. Seedling trunk diameter in centimeters (cm) indicated vigor as follows: weak = <0.5 cm, medium = 0.5-0.8 cm, vigorous = 0.8-1.0 cm and very vigorous = >1.0 cm.

2.4 RESULTS

2.4.1 Interspecific crosses Interspecific crosses resulted in a wide range of cluster set from 0% to 77.8% (Tables 2.5, 2.6, 2.7 and 2.8). The European species, C. avellana, was not cross-compatible with C. cornuta or C. sieboldiana in either direction. Crosses of C. avellana with C. californica and C. chinensis were compatible (36.3% and 41.7%, respectively) only when C. avellana was the pollen parent. C. avellana, exhibited good cross compatibility with C. americana in both directions, but C. avellana as a pollen parent resulting in higher cluster set (40.3% vs. 35.4%). C. avellana gave good (27.4%) cluster set when pollinated with C. heterophylla but set was very low (2.6%) for the reciprocal crosses. This is the only cross-combination where C. avellana is compatible as the female parent with another wild species. In addition, C. heterophylla var. sutchuensis was also highly cross compatible with C. avellana. C. colurna x C. avellana always set nuts (20.3%) when C. avellana was the pollen parent. However, as a seed parent, C. avellana resulted in only 7.1% set. Table 2.5 Intra-and interspecific crossing results (% cluster set) oiCorylus species in 1995.

Male parent

Female parent avellana americana heterophylla cornuta californica sieboldiana colurna

avellana 38.1 11.7 0.1 0.1 0.0 0.3 0.0 americana 40.5 45.8 29.2 0.0 2.4 22.4 0.7 heterophylla* 1.8 0.2 9.4 0.0 0.0 0.0 0.0 cornuta 0.0 4.2 19.0 32.7 32.2 44.5 0.0 californica 9.1 10.6 5.0 40.7 45.2 44.4 15.6 sieboldiana 0.0 0.0 0.0 18.6 32.9 32.6 0.0 colurna 6.5 3.2 2.1 0.0 0.0 0.0 22.1

Flower quality was low (old) in one of the female parents, and this reduced the nut set.

*. ^j Table 2.6 Intra- and interspecific crossing results (% cluster set) ofCorylus species in 1996.

Male parent

Female parent avellana americana heterophylla cornuta californica sieboldiana colurna chinensis

. avellana 73.9 46.3 47.1 0.0 0.0 0.0 21.3 americana 20.2 44.1 28.5 0.0 12.8 43.8 9.0 0.0 heterophylla 0.0 0.0 36.0 0.0 - - - - cornuta 7.2 0.7 17.4 28.5 61.1 40.0 0.0 - californica 48.3 13.3 56.0 51.4 35.4 15.4 20.0 - sieboldiana 0.1 0.6 8.6 35.7 14.1 52.4 0.0 0.0 colurna 30.4 11.1 14.3 0.0 2.2 3.0 20.0 39.0 chinensis 35.7 0.0 0.0 0.0 0.0 0.0 42.9 0.0*

* No nut set was obtained due to self-incompatibility of the one C. chinensis clone. Table 2.7 Intra- and interspecific crossing results (% cluster set) ofCorylus species in 1997.

Male parent

avellana americana heterophylla heterophylla cornuta californica sieboldiana colurna chinensis Female parent vai.sutchuensis

avellana 64.7 48.1 35.0 43 A 0.0 0.0 0.0 0.0 0.0 americana 60.3 43.8 63.3 65.0 8.1 0.0 43.3 0.0 3.4 heterophylla 6.0 1.7 13.5 15.7 0.0 0.0 0.4 1.1 3.3 cornuta 5.5 4.6 59.2 1.9 46.2 29.3 63.8 11.9 0.0 californica 51.5 40.9 48.5 28.7 45.0 53.3 55.4 45.7 10.0 sieboldiana 0.0 2.7 2.2 1.6 21.1 38.3 58.6 1.8 0.0 colurna 24.0 0.0 0.0 0.0 0.0 0.0 0.0 47.6 40.0 chinensis 47.6 28.6 0.0 0.0 0.0 23.1 0.0 77.8 0.0*

* No nut set was obtained due to self-incompatibility of the one C. chinensis clone.

«-u Table 2.8 Mean intra- and interspecific crossing results (% cluster set) of Corylus species in there years.

Male Parents avellana americana heterophylla heterophylla cornuta californica sieboldiana colurna chinensis ** var. Female parents sutchuensis*

avellana 58.9 35.4 27.4 43 A 0.0 0.0 0.1 7.1 0.0 americana 40.3 44.6 40.3 65.0 2.7 5.1 36.5 3.2 1.7 heterophylla 2.6 0.6 19.6 15.7 0.0 0.0 0.2 0.4 3.3 cornuta 4.2 3.2 31.9 1.9 35.8 40.9 49.4 4.0 0.0 californica 36.3 21.6 36.5 28.7 45.7 44.6 38.4 27.1 10.0 sieboldiana 0.0 1.1 3.6 1.6 25.1 28.4 47.9 0.6 0.0 colurna 20.3 4.8 5.5 0.0 0.0 0.7 1.0 29.9 39.5 chinensis 41.7 14.3 0.0 0.0 0.0 11.6 0.0 60.4 0.0***

* One year of data from 1997 ** Two years of data from 1996 and 1997. *** The male and female parent was the same genotype, so there was no seed set due to self-incompatibility. 51

C. americana was not cross compatible with C. colurna or C. cornuta in either direction as indicated by cluster set below 5%. C. americana set nuts with C. chinensis and C. californica (14.3% and 21.6%, respectively) when C. americana was the pollen parent. On the other hand, C. americana crosses were only successful with C. sieboldiana (36.5%) and C. heterophylla (40.3%) when C. americana was used as the seed parent. C. americana x C. heteropylla var. sutchuensis showed very high cluster set (65.0%). Generally C. heterophylla gave low cluster set as a female parent in intra- and interspecific crosses. C. heterophylla was not cross compatible with C. colurna, C. chinensis and C. sieboldiana in either direction (<5%). However it showed good cross compatibility with C. cornuta (31.9%) and C. californica (36.5%) only when C. heterophylla was pollen parent. The intraspecific cross, C. heterophylla x C. heterophylla var. sutchuensis was successful. C. heterophylla var. sutchuensis could only be used as pollen parent in interspecific crosses. Its crosses with C. californica set nuts (28.7%) while other crosses with C. cornuta, C. sieboldiana, C. colurna , and C. chinensis did not. C. cornuta, C. californica, and C. sieboldiana were cross compatible (between 25.1 and 49.9%) with each other as a group in either direction. However, C. sieboldiana gave higher cluster set with the other two species when C. sieboldiana was the pollen parent. C. cornuta and C. sieboldiana were not compatible with C. colurna or C. chinensis in either direction (<5%). C. californica x C.chinensis crosses and reciprocals were somewhat successful (10- 11.6%). But C. californica was only cross-compatible with C. colurna when the latter was the pollen parent (27.1%). C. colurna and C. chinensis were highly cross compatible with each other in both directions. All crosses resulted in some empty nut (blank) formation (Table 2.9). The frequency of blanks ranged from 4.2% to 100%. In many of the incompatible combinations most of the nuts were blank. For example, the cross C. avellana x C. cornuta produced few nuts, and 66.7% of those nuts did not contain seeds while all Table 2.9 Percent blank formation in intra- and interspecific crosses ofCorylus species (average of 1995,1996 and 1997).

Male parents

Female parents avellana americana heterophylla heterophylla var. cornuta californica sieboldiana colurna chinensis sutchuensis avellana 18.3 16.3 39.4 73.8 66.7 - 50.0 9.4 - americana 26.8 23.4 29.5 15.2 80.0 27.8 42.8 56.3 50.0 heterophylla 43.2 4.2 42.2 88.9 - - 100.0 100.0 100.0 cornuta 100.0 54.9 54.6 25.0 28.6 31.7 35.8 28.6 - californica 33.5 54.2 56.4 27.6 39.1 17.2 38.1 41.3 64.7 sieboldiana 100.0 48.7 82.2 100.0 47.5 28.4 22.9 50.0 - colurna 91.6 93.4 97.8 - - 100.0 100.0 13.5 12.7 chinensis 25.8 4.6 .* - - 75.0 - 19.5 -

* No nuts were available to evaluate because crosses were not successful.

to 53

of the nuts (100%) of the reciprocal were empty. However cross-compatible combinations produced fewer empty nuts. C. avellana x C. americana and its reciprocal resulted in 16.3% and 26.8% blanks. Empty or blank nuts were mostly small in size and tightly adhered to the husk. The color of the shell was usually lighter. Some shells had large black spots on them. In some nuts, part of the shell had collapsed. Most blank nuts had very small (about 1-2 mm in size) dark brown ovule(s) at the end of the fiiniculus and some fiber in the shell. In other blanks, the embryo was usually smaller than 1/3 of full size, and usually dry and shriveled. In general all species produced some abnormal embryos. Usually they were about the half size of normal embryos. Split cotyledons and shrunken cotyledons were common. Unequally developed cotyledons, seed coats failing to completely cover the cotyledons and reversely oriented root and shoot axes were observed during germination. C. californica, C. cornuta, and C. americana had an especially high number of abnormal embryos. Interestingly, most of those resulted from intraspecific crosses. The lowest abnormal embryo formation was in C. avellana crosses either as a female or male.

2.4.2 Seed germination and seedling growth Germination of the hybrid seeds from 1995 crosses continued for 100 days. GA3 treatment to break seed dormancy caused some adverse effects on the seedlings. Affected plants were taller but weaker due to elongated stems. Some seed rot occurred in almost all hybrid seed lots and was most serious on C. avellana seeds. The germination rate for C. avellana was 35.1% in 1995 due to rot compared to 67.8% in 1996 (Table 2.10). Fungicide treatments did not prevent the rot but only somewhat slowed the spread. Most (86.6%) of the 1996 hybrid seeds failed to germinate after 3.5 months of stratification. Complementary hormone treatment was necessary, and induced Table 2.10 Percent seed germination results in intra- and interspecific crosses ofCorylus species (average of 1995 and 1996).

Male parents Female parents avellana americana heterophylla cornuta californica sieboldiana colurna chinensis

avellana 59.0 27.7 68.8 100.0 - 50.0 55.0 . americana 82.0 73.9 76.1 .* 90.3 66.5 41.7 - heterophylla 47.9 75.0 51.0 - - - - - cornuta - 87.5 57.2 35.8 72.9 49.6 - - californica 49.9 50.0 76.7 44.8 52.4 65.9 76.2 - sieboldiana - 100.0 62.5 71.0 85.6 83.4 - - colurna 83.3 100.0 50.0 - - - 84.0 73.8 chinensis 94.1 - - - - - 94.4 -

' No seeds were available for germination because either crosses were not successful or the nuts were blank. 55

1242 seeds out of 1316 to germinate in 42 days. Tests were continued for the remaining 74 seeds for another 95 days. From those, however, 23 never germinated (six from C. cornuta x C. cornuta, five from C. cornuta x C. californica, four from C. californica x C. californica, and two each from C. americana x C. americana, C americana x C. sieboldiana, C. cornuta x C. heterophylla and C. sieboldiana x C. cornuta). In normal embryos, the embryonic axis is located at the top or tip (pointed side) of the kernels where the two cotyledons are joined together. During germination this embryonic axis produces a thick, fleshy root and shoot tip. However, in some abnormal embryos, roots came out from the side of the embryo between the cotyledons. In many instances, instead of a single root, several fine roots came out from the embryonic axis. Many of the abnormal embryos formed weak roots but no shoot came out, and later they all died. Hybrid seed germination ranged from 27.7% to 94.4% (Table 2.10). High germination rates were between 70-90%. Although a 100% germination is occasionally shown in the Table, these were obtained from very small numbers of incompatible crosses (e.g. C. avellana x C. cornuta or C. colurna x C. americana). The germination of intraspecific C. cornuta seeds was lowest (35.8%) among the species, probably due to higher chilling requirements. Cross-compatible combinations usually gave higher seed germination rates than incompatible crosses. In C. colurna x C. chinensis and the reciprocal, the seed germination rates were very high, 73.8% and 94.4%, respectively. In C. americana x C. heterophylla and the reciprocal, germination rates were also very high, 76.1% and 75.0%, respectively. Some reciprocal differences in germination rate were observed. Seed germination was only 27.7% in C. avellana x C. americana cross while the reciprocal gave 82.0% germination. Once the germinated seeds reached the seedling stage, most of them survived (Table 2.11) except in two instances. Only 41.5% of the seedlings of C. Table 2.11 Hybrid seedling survival results in intra- and interspecific crosses ofCorylus species (average of 1995 and 1996).

Male parents

Female parents avellana americana heterophylla cornuta californica sieboldiana colurna chinensis

avellana 89.2 96.9 100.0 100.0* - 100.0* 100.0* - americana 98.5 89.9 98.5 - 100.0 84.7 91.7 - heterophylla 0.0 100.0* 86.3 - - - - - cornuta - 100.0* 79.8 77.8 71.7 71.1 - - californica 87.5 90.0 93.8 89.1 84.8 100.0 91.7 - sieboldiana - 0.0 100.0* 79.7 91.1 87.6 - - colurna 100.0* 100.0* 100.0* - - - 86.6 87.2 chinensis 86.7 - - - - - 94.1 -

Data was obtained from less than 5 seedling.

OS 57

californica x C. colurna hybrids survived, and all hybrid seedlings (100%) of C. heterophylla x C. avellana died. These seedlings were very weak, and stopped growing after reaching 20-50 cm height before they died. This was probably caused by 'hybrid weakness or inviability' due to incompatibility either (1) between the genomes of parental species or (2) between the genome of one species and the cytoplasm of the other or (3) between the genotype of the Fi zygote and the genotypes of endosperm or the maternal tissue with which the developing Fi embryo is associated (Hadley and Openshaw, 1980). During the early growth of seedlings from 1995 crosses, in the greenhouse, some abnormalities were observed. 36 seedlings had stems that were twisted around at the soil level. They were all from C. avellana crosses, and most (86%) were from C. avellana x C. avellana. Chlorosis was noted on 158 seedlings, and 88.6% of them were from intra- and interspecific hybridizations among C. cornuta, C. californica and C. sieboldiana. Soil nutrient levels was probably not the cause of chlorosis since all hybrid plants were treated equally. Powdery mildew symptoms were noted on 115 seedlings, 65% of them from C. californica x C. californica and 15% of them from C. californica x C. cornuta crosses. Both chlorosis and powdery mildew symptoms disappeared later in the season. Seedling vigor was recorded as trunk diameter in cm and was very variable among the interspecific crosses (Table 2.12). In general, the cultivated hazelnut C. avellana, and the tree species C. colurna and C. chinensis gave very vigorous seedlings in their interspecific crosses. The weakest seedlings were those of intraspecific C. cornuta (0.37 cm) and C. heterophylla (0.41 cm) hybrids. Their cross with each other also resulted in weak seedlings (0.42 cm). C. avellana was the highest in seedling vigor among the species (1.06 cm). Hybrid vigor as larger trunk size than that of both parents was observed in some combinations such as C. americana x C. californica (but not in the reciprocal). Table 2.12 Hybrid seedling vigor expressed as trunk diameter (in cm) in intra- and interspecific crosses of Corylus species (average of 1995 and 1996).

Male Parents

Female parents avellana americana heterophylla cornuta californica sieboldiana colurna chinensis

avellana 1.06 0.98 1.04 1.20 - 0.67 1.09 - americana 0.86 0.60 0.58 - 0.96 0.63 0.72 - heterophylla - 0.28 0.41 - - - - - cornuta - 0.51 0.42 0.37 0.61 0.54 - - californica 0.82 0.56 0.69 0.67 0.76 0.79 0.42 - sieboldiana - - 0.49 0.39 0.64 0.44 - - colurna 0.96 0.85 0.54 - - - 0.60 1.00 chinensis 1.26 - - - - - 1.03 -

CO 59

2.5 DISCUSSION

Interspecific crosses, hybrid seed germination tests and seedling growth data confirm the statement of Erdogan and Mehlenbacher (1997), and Thompson et al. (1996) that some Corylus species freely intercross, some can be crossed with difficulty, some can be crossed in only one direction and others cannot be crossed in either direction. In general, the success of the crosses involving C. avellana was higher when cultivated C. avellana was used as a pollen parent. C. avellana showed different degrees of compatibility with other wild Corylus species. Crosses of C. avellana x C. cornuta were unsuccessful (0%). More than 1500 pollinations resulted in only one seedling which did not look like a true hybrid. In the reciprocal, all of the resulting seeds were blank. Contrary to our results, Gellatly (1950, 1956, 1964), reported interspecific hybrids named 'filazels' which he obtained by removing all the catkins from C. cornuta and assuming the resulting seeds to have resulted from C. cornuta x C. avellana crosses. His crosses were not carefully controlled and the hybrid origin of the seedlings is in doubt. However, a successful backcross of one of those filazels to C avellana was reported (Mehlenbacher, 1991). Similar results were obtained from C. avellana x C. sieboldiana crosses. Over 1500 pollination resulted in only one live seedling but hybridity could not be verified. In the reciprocal, there was no seed production. In the Republic of Korea, C. sieboldiana clones have been selected for direct use or for hybridization with introduced C. avellana cultivars (Kim, 1985). A selection named "Gaem # 2" (C. sieboldinana No. 9 x 76-1 where 76-1 = C. heterophylla x 'Butler') was reported. According to Mehlenbacher (1991), the wild species must be used as the female parent. Schuster (1924), was the first to report that the cross C. avellana x C. californica was not compatible, but Mehlenbacher (1991) was successful in making 60

the reciprocal cross. Our data confirms that C. avellana is unilaterally compatible with C californica. Gellatly (1966) described 'Chinoka' a presumed hybrid of C. chinensis x C. avellana. Hybridity was assumed as it did not result from a controlled cross, and Thompson et al. (1996) placed this cross in "uncertain crossability group". Our results show that pollen of C. avellana gives good set on C. chinensis pistillate flowers. Most of the hybrid seeds germinated and the seedlings survived. In fact, the vigor of these seedlings was the highest among all Corylus hybrids. The reciprocal cross was unsuccessful. C. avellana was easily crossed with C. americana in both directions, but the crosses were more successful when C. avellana was used as the pollen parent. John F. Jones was the first to report that this cross was successful only if C. americana was used as the pistillate parent (Reed, 1936). But according to Slate (1961), both species hybridize with each other. McKay (1966) observed cytogenetic abnormalities and sterility in some second generation hybrids. Our results do not show complete failure but rather difficulty in making C. avellana x C. americana crosses as cluster set was lower and most of the seeds were not viable compared to the reciprocal. However, morphological traits indicated that the seedlings were true hybrids, and were obtained from crosses made in either direction as verified in both 1995 and-1996. C. heterophylla x C. avellana hybridiztion has been extensively used in the Chinese hazelnut breeding program (Liang and Zhang, 1988) where C. heterophylla x C. avellana crosses gave better set than the reciprocal (Liang et al., 1994). Low to moderate (21% set) compatibility was reported in C. heterophylla (clone #H13) x C. avellana OSU 55.129 but failure in the reciprocal (Thompson et al., 1996). Our results showed the only successful cross was C. avellana x C. heterophylla but not the reciprocal as stated above. In addition, the related cross C. avellana x C. heterophylla var. sutchuensis also gave good seed set. We were unable to do the reciprocal of this cross. Although a few seeds were obtained from the C. heterophylla x C. avellana cross, most of the seeds were not viable and the 61

resulting seedlings did not survive. The low female flower quality of C. heterophylla and late pollinations may have played a significant role in the failure of C. heterophylla x C. avellana crosses. Usually leaf buds were opening in response to spring weather and some little leaves were already out when the female flower buds started to open. The styles of most of those females stayed in the bud. In the summer, many leaves suffered from sunburn. We believe that the accessions we had were either abnormal in the process of flowering or they may not have performed well in Oregon's environment since they come from a very cold climate. Kasapligil (1963, 1964) does not believe that crosses between C. avellana and C. colurna are possible in either direction, but Gellatly (1956) reported some hybrid selections and named them 'trazels'. His selections resulted from open- pollination but they do look like true hybrids. Two of those hybrids, 'Morrisoka' and 'Faroka,' were backcrossed to C. avellana and C. colurna by Farris (1982). Our data indicate that crossability between these two species is difficult but possible, and morphological traits indicate that the seedlings obtained from both directions were true hybrids. C. colurna x C. avellana resulted in seed set every year, but more than 90% of the nuts were empty. Nonetheless five live seedlings were obtained. On the other hand the reciprocal was successful only in 1996 and only one hybrid seedling was obtained. A large number of crosses must be made in order to get hybrid seedlings between these two species. There has been no available information on the crossabilities of C. chinensis and C. americana. The cross C. chinensis x C. americana was compatible and only a few nuts (<5%) were empty, while set in the reciprocal was very low and resulted in only two nuts. As a seed parent, C. americana gave successful hybridizations with the Asian species C. heterophylla and C. heterophylla var. sutchuensis. These American and Asian species are geographically separated from each other yet quite similar in growth habit and husk morphology. Our results show that a good cross is possible when C. americana pistillate flowers are pollinated with C. heterophylla pollen. Many true hybrid seedlings were obtained. But the reciprocal failed. 62

Farris (1970) reported successful cross of C. americana x C. heterophylla var. sutchuensis. From the cross C. americana x C. sieboldiana many true hybrid seedlings were obtained, but the reciprocal failed. Hundreds of pollinations resulted in only one seedling, which could not be verified as a true hybrid. No information was previously available on this cross. Percent cluster set was less than 5% in C. americana x C. cornuta and in the reciprocal. Only three very weak seedlings were obtained from the reciprocal. According to Drumke (1964), these two North American species are distinct in morphology. They grow together in some places but few, if any, interspecific hybrids are formed. C. californica x C. americana resulted in higher percent seed set than the reciprocal but we could not verify the hybridity of those seedlings. However, the seedlings resulted from the reciprocal cross (C. americana x C. californica) in 1995 and 1996 were true hybrids. There had not been any previous report on this cross. Crossing C. americana with Turkish tree hazel, (C. colurna) pollen was very difficult. Four of the nine resulting seedlings appeared to be true hybrids, but neither of the two seedlings from the reciprocal cross looked like hybrids. C. colurna pollen on C. americana cultivar 'Littlepage' was apparently successful (Reed, 1936). A few seedlings resulted from Reed's cross were true hybrids as bark color and bark character was typical of the pollen parent. A limited number of nuts were obtained from this progeny; they were mostly blanks. The cross between the two Asian species C. sieboldiana x C. heterophylla was very difficult. Percent cluster set was less than 5%, and the resulting nuts were mostly blank. However, a few true hybrid seedlings were obtained. In the reciprocal, cluster set was nearly zero and all of the resulting seeds were blank. C. sieboldiana x C. heterophylla var. sutchuensis was very difficult and all the nuts formed were blanks. In the Republic of Korea, a cross of C. sieboldiana x (C. heterophylla x C. avellana) was reported (Kim, 1985). 63

C. heterophylla x C. chinensis and C. chinensis x C sieboldiana were not compatible in either direction. In fact, these three species are from Asia but they are very distinct in plant size, vigor, leaf shape, and husk and nut morphology. C. heterophylla was cross compatible as a pollen parent with all three North American species, C. cornuta, C. californica and C. americana. The crosses resulted in true hybrids. The cross with C. americana was discussed above. There were no previous reports on crosses of C. heterophylla with the other two species. Pollen of C. heterophylla var. sutchuensis was also compatible on C. californica pistillate flowers but not on C. cornuta. C. heterophylla x C. colurna crosses were not successful while the reciprocal resulted in only one seedling and we are not sure about its hybridity. No reports indicate that this cross had been attempted previously. The cross of C. colurna x C. heterophylla var. sutchuensis failed. According to Farris (1976), the reciprocal cross also fails, but we were unable to attempt that cross. They also reported uncertain success of the cross C. colurna x (C heterophylla var. sutchuensis x C. avellana). The other Asian species, C. sieboldiana, was compatible with the North American species C. cornuta and C. californica in either direction. These crosses had not previously been attempted. As a group their husk and nut morphology is very similar to each other but very distinct from other Corylus species. The two North American species, C. californica and C. cornuta were highly cross compatible in both directions and gave many hybrid seedlings. C. californica presents the most difficult taxonomic problem of the genus in North America. It has been described as a separate species by some authorities (Bailey, 1914; Krussmann, 1976; Rehder, 1940) and a botanical variety of C. cornuta by others (Drumke, 1964; Everett, 1981; Huxley et al., 1992; Sharp, 1951; Thompson et al., 1996). Although interpretation of crossing behavior in a phylogenetic context is usually not straightforward, it indicates at least some degree of genomic similarity (Bohs, 1991). In this context our crossing results may be inferred as supporting evidence of the conclusion of Drumke (1964) who after a 64

detailed study of this complex, concluded that C. californica is a true botanical variety of C. cornuta. Likewise, in addition to observed morphological similarities, the high reciprocal cross compatibility between C. sieboldiana and the North American species C. cornuta and (from now on) its variety californica likely indicate a close relationship between them. Most of the species ofCorylus are Asiatic (Drumke, 1964). The two North American species may have descended from Corylus in Asia i.e. C. americana from C. heterophylla or similar plants, and C. cornuta from C. sieboldiana or similar species. However, no Asiatic plants are identical to North American plants, though some are very similar. Drumke (1964) hypothesized that as Corylus migrated from Asia to North America a gradual change took place creating a cline between Asian and North American materials. When the Pleistocene glaciers covered the northern part of North America, the intermediate forms between the Asian ancestors and the southernmost plants in America would perhaps have been eliminated. In the genus Corylus, interspecific hybridization is widespread with many possible combinations. The cultivated hazelnut could be crossed with most of the wild species and hybrid seedlings obtained freely or with some degree of difficulty. Our results confirm several previous reports, clarify some conflicting reports, and present information on combinations not previously attempted. On the other hand, Fi progeny performance and fertility remain to be evaluated. Based on observed and reported morphological similarities, reported crossability relationships, and our results on the presence of seeds in the hybrid nuts and their germination ability, and capability to germinate and the true hybrid appearance of the seedlings, we propose following four groups of closely related species; (1) C. avellana; (2) C. heterophylla, C. heterophylla var. sutchuensis, and C americana; (3) C. cornuta, C. californica, and C. sieboldiana; (4) C. chinensis, and C. colurna. 65

2.6 REFERENCES

Ayfer, M., A. Uzun, and F. Bas. 1986. Turkish hazelnut cultivars. (In Turkish). Black Sea Hazelnut Exporters Union. Giresun/Ankara.

Bailey, L. H. 1914. The standard cyclopedia of horticulture, Vol.2. McMillan Co. London, University of Tennessee.

Bohs, L. 1991. Crossing studies in Cyphomandra (Solanaceae) and their systematic and evolutionary significance. Amer. J. Bot. 78: 1683-1693.

Botta, R., E. Emanuel, G. Me, S. Sacerdote, and R. Vallania. 1986. Indagine cariologica in alcune specie del genere Corylus. Riv. Ortoflorofrutt. It. 70: 323-329.

Drumke, J. S. 1964. A systematic survey of Corylus in North America. Ph.D. Thesis, University of Tennessee.

Erdogan, V. and S. A. Mehlenbacher. 1997. Preliminary results on interspecific hybridization in Corylus. Acta Hort. 445: 65-71.

Everett, T. H. 1981. The New York botanical garden illustrated encyclopedia of horticulture. Vol. 3, p. 886-888. Garland Publishing, New York.

Farris, C. W. 1970. Inheritance of parental characteristcis in filbert hybrids. Ann. Rep. Northern Nut Growers Assoc. 61: 54-58.

Farris, C. W. 1976. An introduction to the stars: A new family of filbert hybrids. Ann. Rep. Northern Nut Growers Assoc. 67: 80-82.

Farris, C. W. 1982. A progress report on the development of F2 hybrids of Corylus colurna x C. avellana. Ann. Rep. Northern Nut Growers Assoc. 73: 15-16.

Farris, C. W. 1989. Two new introduction; 'Grand Traverse' hazelnut and 'Spartan' seedless grape. Ann. Rep. Northern Nut Growers Assoc. 80: 102-103.

Gellatly, J. U. 1950. Description of filazel varieties. Ann. Rep. Northern Nut Growers Assoc. 41: 116-117.

Gellatly, J. U. 1956. Filazels. Ann. Rep. Northern Nut Growers Assoc. 47:112-114.

Gellatly, J. U. 1964. Filazels. Ann. Rep. Northern Nut Growers Assoc. 55:153-155. 66

Gellatly, J. U. 1966. Tree hazels and their improved hybrids. Ann. Rep. Northern Nut Growers Assoc. 57: 98-101.

Hadley, H. H. and S. J. Openshaw. 1980. Interspecific and intergeneric hybridization, p. 133-159. In: W. Fehr and H. Hadley (eds.). Hybridization of crop plants. Amer. Soc. Agr. and Crop Sci. Soc. Amer. Madison, WI.

Huxley, A., M. Griffiths, and L. Margot. 1992. The new royal horticultural society dictionary of gardening 1. McMillan Press Ltd., London.

Kasapligil, B. 1963. Corylus colurna and its varieties. Calif. Hort. Soc. J. 24: 95- 104.

Kasapligil, B. 1964. A contribution to the histotaxonomy of Corylus (Betulaceae). Adansonia. Tome IV, Fascicule 1, p. 43-90.

Kasapligil, B. 1968. Chromosome studies in the genus Corylus. Scientific Reports of the Faculty of Science, Ege University No. 59.

Kasapligil, B. 1972. A bibliography on Corylus (Betulaceae) with annotations. Ann. Rep. Northern Nut Grrowers Assoc. 63: 107-162.

Kim, J. H. 1985. Horticultural crops research highlights 1984-85. Horticultural Experiment Station. Rural Development Administration. Suweon, Korea, p. 24.

Krussmann, G. 1976. Manual of cultivated broad-leaved trees and shrubs. Timber Press, Portland, OR.

Lagerstedt, H. B. 1975. Filberts, p. 456-489. In: J. Janick and J. N. Moore (eds.). Advances in fruit breeding. Purdue Univ. Press, West Lafayette, IN.

Liang, W. J. and Y. M. Zhang. 1988. Investigation and study of filbert resources in China. Proc. Int. Symp. on Horticultural Germplasm, Cultivated and Wild. Beijing.

Liang, W., X. Ming, and X. Wanying. 1994. Studies on hazelnut breeding in northern China. Acta Hort. 351: 59-66.

McKay, J. W. 1966. Sterility in filbert {Corylus). Proc. Amer. Soc. Hort. Sci. 88:319-324.

Mehlenbacher, S. A. 1991. Hazelnuts {Corylus). Genetic resources of temperate fruit and nut crops. Acta Hort. 290: 791-836. 67

Mehlenbacher, S. A. 1994. Genetic improvement of the hazelnut. Acta Hort. 351: 23-38.

Mehlenbacher, S. A. 1997. Revised dominace hierarchy for S-alleles in Corylus avellana L. Theor. Appl. Genet. 94: 360-366.

Mehlenbacher, S. A., A. N. Miller, M. M. Thompson, H. B. Lagerstedt, and D. C. Smith. 1991. 'Willamette' hazelnut. HortScience 26: 1341-1342.

Reed, C. A. 1936. New filbert hybrids. J. Heredity 27: 427-431.

Rehder, A. 1940. Manual of cultivated trees and shrubs hardy in North America, p. 143-146. 2nd edition, McMillan Company, New York.

Rovira, M. 1997. Genetic variability among hazelnut (C. avellana L.) cultivars. Acta Hort. 445: 45-50.

Salesses, G. 1973. Cytological study of genus Corylus. A heterozygotic translocation in some low male fertile varieties of hazelnut (C avellana). Ann. Amelior. Plantes 23: 59-66.

Schuster, C. E. 1924. Filberts, 2: Experimental data on filbert pollination. Oregon Agric. Exp. Sta. Bull. 208.

Sharp, A. J. 1951. Relationships between the floras of California and southern United States. Contrib. Dudley Herbarium 4: 59-61.

Slate, G. L. 1961. The present status of filbert breeding. Ann. Rep. Northern Nut Growers Assoc. 52: 24-26.

Smith, D. C. and S. A. Mehlenbacher. 1994. Use of Tyvek housewrap for pollination bags in breeding hazelnut {Corylus avellana L.). HortScience. 29: 918.

Thompson, M. M. 1979a. Genetics of incompatibility in Corylus avellana L. Theor. Appl. Genet. 54: 113-116.

Thompson, M. M. 1979b. Incompatibility alleles in Corylus avellana L. cultivars. Theor. Appl. Genet. 55: 29-33.

Thompson, M. M., H. B Lagerstedt, and S. A. Mehlenbacher. 1996. Hazelnuts, p. 125-184. In: J. Janick and N. Moore (eds.) Fruit Breeding, Volume III. Nuts. John Wiley and Sons Inc., New York. 68

Weschcke, C. 1970. A little nut history. Ann. Rep. Northern Nut Growers Assoc. 61: 113-116.

Wetzel, V. G. K. 1929. Chromosomen studien bei den Fagales. Botanisches Rachiv. 25: 257-283. 69

CHAPTER 3

SELF-INCOMPATIBILITY IN WILD Corylus SPECIES

3.1 ABSTRACT

Fluorescence microscopy was used to study incompatibility in the wild Corylus species C. americana, C. heterophylla, C. cornuta, C. californica, C. sieboldiana, C. colurna, C. chinensis and C. jacquemontii. Self-pollinations as well as intraspecific and interspecific crosses were made. Clearly incompatible reactions were observed following all self pollinations, indicated by reduced pollen germination and pollen tubes that were short, usually 'comma' shaped, often terminated in pronounced bulbs, and failed to penetrate the stigma. Both compatible and incompatible reactions were observed in intra- and interspecific pollinations with some reciprocal differences. Unilateral incompatibility is also a barrier in interspecific crosses. Pollen-stigma interactions suggest that sphorophytic self-incompatibility exists in wild Corylus species and that a large number of S-alleles is involved.

3.2 INTRODUCTION

Self-incompatibility (SI) is a specific mechanism that prevents self- fertilization and encourages fertilization by genetically distinct individuals (Gaude and Dumas, 1987; Nasrallah and Nasrallah, 1993; Nettancourt, 1977; Newbigin et al., 1993). SI is widespread among many important cultivated plant species, and among the wild relatives which are a source of important genetic traits such as disease-resistance, hardiness or precocity. The control of SI is generally attributed to a single S-locus expressing multiple alleles (Nasrallah and Nasrallah, 1986; 70

Nettancourt, 1977). Incompatibility occurs if the alleles expressed in the pollen and pistil are identical. There are two basic types of SI, gametophytic and sporophytic. In gametophytic self-incompatibility (GSI), pollen germinates and penetrates into the style. Rejection occurs in the style where pollen tube growth is arrested (Bell, 1995; Ebert et al., 1989; Newbigin, et al., 1993). The S-allele carried by the pollen grain determines its compatibility (i.e. the phenotype of the pollen is determined by its own haplotype). Unlike GSI, in sporophytic self-incompatibility (SSI) systems, the incompatibility reaction occurs at the pollen-stigma interphase in the very early stages of germination and inhibition of self-pollen is very rapid (Ebert et al., 1989; Nasrallah and Nasrallah, 1986, 1993, 1997; Volker et al., 1990). Incompatible pollen usually fails to germinate or pollen tubes are prevented from penetrating into the style. The genotype of the parent plant (sporophyte) which produces the pollen grain determines the phenotype of the pollen. Codominant and/or dominant allelic interactions are common between the alleles. SSI has been described in the Brassicaceae, Asteraceae, Convolvulaceae and Betulaceae. The cultivated hazelnut {Corylus avellana L.) expresses SSI. Stylar S- alleles are codominant, pollen alleles are either codominant or dominant, and a dominance hierarchy exists among S-alleles in the pollen (Mehlenbacher and Thompson, 1988). Pollen in the families Brassicaceae and Asteraceae is tricellular whereas C. avellana pollen is bicellular (Heslop-Harrison et al., 1986). As a characteristic of the SSI system, the stylar surface is covered with papilla and is dry (Hampson et al., 1993; Heslop-Harrison et al., 1986). Incompatible pollen may hydrate and germinate on the stylar surface as does compatible pollen. However, incompatible pollen tubes cannot penetrate into the style. Reduced germination, coiled and bulbous pollen tubes are characteristics of incompatible reactions in hazelnut (Hampson et al., 1993; Thompson et al., 1996). In addition, incompatible pollen produces a characteristic callose rejection in the stigma; pollen eluates induce the same response (Heslop-Harrison et al., 1986). A form of protein storage 71

in the pollen grain wall has no obvious parallels in other families with the SSI system. The genus Corylus belongs to the family Betulaceae. Five shrub and four tree species are generally recognized (Thompson et al., 1996), although as many as 25 species have been reported (Kasapligil, 1972). All species are deciduous, monoecious, wind-pollinated and usually dichogamous (Lagerstedt 1975, Thompson et. al., 1996). Schuster (1924) first reported the existence of incompatibility in C. avellana, and Thompson (1979a) revealed the genetics. The alleles present in common cultivars were first listed by Thompson (1979b). Currently 25 unique S-alleles are known to exist (Mehlenbacher and Thompson 1988; Mehlenbacher 1997). Despite the abundant knowledge of self-incompatibility in C. avellana, the presence of such a system has not been demonstrated in wild Corylus species. Such information would be invaluable in hazelnut breeding. Thompson et al. (1996) suggested that a similar system might be operating, however, no data are available. The objective of this study was to investigate the existence of incompatibility in wild Corylus species by in vivo pollinations and the use of fluorescence microscopy, and its possible role in preventing intra- and interspecific crosses.

3.3 MATERIALS AND METHODS

Pollen-stigma incompatibility studies were performed in 1996 and 1997. Seedlings of the wild Corylus species, C americana, C heterophylla, C cornuta, C. californica and C sieboldiana, which appeared to have a sufficient number of female flowers, and trees of known cultivars and advanced selections of C. avellana were used. Attention was paid primarily to the wild species as incompatibility in C. avellana has been studied in great detail. Female flowers on C. colurna, C. chinensis and C. jacquemontii were not available at time of this 72

study but we could use their pollen. All plant material was located in the hazelnut germplasm collection at the Smith Research Farm of Oregon State University, Corvallis, OR. Since female inflorescences were not visible at the time of genotype selection, the staminate catkin load of plants was used as an indication of potential female flower production. The number of available plants varied from species to species due to abnormalities in flowering or inability of plants to flower because of juvenility or alternate bearing (Table 3.1). Branches of selected plants were marked for emasculation and staminate catkins clipped in mid-December to mid- January. Emasculated branches were bagged with Tyvek housewrap to protect female inflorescences from wind-borne pollen (Smith and Mehlenbacher, 1994). A second bag of either polyester cloth or Tyvek was used to cover and protect the inner bag from damage by wind. In general, one bag was placed on each plant, however in some small or unproductive genotypes two bags were used to ensure a sufficient number of flowers.

Table 3.1 Number of genotypes used in pollinations in Corylus species.

Intra-specific Inter-specific pollinations pollinations Species Selfed* As As As As female male female male

C. avellana 4 12 11 13 37 C. amehcana 6 12 28 11 36 C. heterophylla 6 9 26 8 39 C. cornuta 1 8 22 8 27 C. californica 7 9 18 4 21 C. sieboldiana 10 14 23 12 31

* The number of good-quality female flowers was limited, as most of them were used for within and between species pollinations rather than self pollinations. 73

Staminate catkins were collected before they shed pollen (Mehlenbacher and Thompson, 1988). They were placed on paper in the laboratory in the late afternoon, and allowed to dry overnight at room temperature (20oC). The following morning catkins were discarded and the pollen collected and stored in cotton-stoppered vials in the freezer (-20oC). Male catkin development and pollen shed was very late (end of March-April) in genotypes of some species, so pollen placed in the freezer the previous year was used. Check pollinations and pollen germination tests indicated that there was no loss of viability of stored pollen (data not shown). Female clusters were detached from bagged branches when styles protruded 2-6 mm and placed in petri dishes on a double layer of moist but not wet filter paper. Pollinations were made in the laboratory on the day of collection by dipping the stigmatic styles in the pollen vial, shaking off excess pollen, and leaving the flowers on a double layer of moist filter paper in a covered petri dish overnight. Two flower clusters (buds) were used for each pollination. Styles were separated from the buds and squashed 16h-18h after pollination in aniline blue dye [0.1% aniline blue (methyl blue No. M-5528 Sigma), 0.71% K3PO4] and examined with a fluorescence microscope (Thompson, 1979b). Freshly picked high quality female clusters were used whenever possible. In a few instances young collected flowers were kept on moist filter paper in petri dishes in the refrigerator for 3-5 days prior to pollination. All microscopic examinations were completed 16-18h after pollination or occasionally they were kept in the refrigerator for 12-24h until time permitted. Pollinations were classified as compatible or incompatible based on germination, pollen tube length, orientation of the tubes, and presence of bulbs.

3.4 RESULTS

Most pollinations could be easily classified as either compatible or incompatible (Fig 3.1). In incompatible reactions, pollen germination was often 74

reduced, and in some crosses was completely inhibited so that only fluorescing dots could be observed on styles. Germinated pollen grains produced short tubes that failed to penetrate the stigmatic surface. Generally they had a "comma" shape rather than straight tubes. Many of these tubes ended with a pronounced bulb formation. In compatible pollinations, pollen gains germinated well and the tubes penetrated the stigmatic surface. Pollen tubes were long, straight and parallel to each other. Many strongly fluorescing callose plugs were observed. The quality of the female inflorescence was of primary importance in obtaining very clear and easily distinguishable reactions. Female flower quality was generally high among Corylus genotypes. Old female flowers resulted in ambiguous and inconsistent reactions. For example, self pollen, pollen of other genotypes and pollen of other Corylus species on old female flowers of C. colurna XI3 and C. califomica Y37, showed compatible reactions associated with very good pollen germination and tube growth. In another instance, the pollen of C. cornuta genotypes CC3.059, CC4.007, CC4.018, CC4.034 on two female flowers of C. cornuta CC3.056 gave low germination with very short pollen tubes (comma like) on one flower but excellent pollen tube growth on the other. Similar abnormalities were observed in C. sieboldiana CC 1.074 x C. heterophylla 559.059 pollinations as well. These abnormal pollinations were probably due to low female flower quality in one of the two flowers squashed on the same slide. This may happen when there is a large range in time of development of female flowers on the plant, which we observed in some genotypes. These inconclusive pollinations were excluded when compiling the data. A total of 34 self-pollinations were made in Corylus species and in every case an excellent incompatible reaction was observed (Table 3.2) with only one exception. Self-pollination of 'Tombul Extra Ghiaghli' (C. avellana) resulted in good pollen germination and tube growth. The pseudo self-compatibility of this cultivar was reported by Mehlenbacher and Smith (1991). In incompatible self-pollinations, there was usually reduced pollen germination and a few short and curled pollen tubes. These pollen tubes usually 75

Fig 3.1 Intraspecific pollen-stigma reactions in Corylus. (A) Compatible, (C. heterophylla T28 x C. heterophylla T27). Many thin and long pollen tubes are parallel to each other. (B) incompatible, (C cornuta CC2.046 x C. cornuta CC4.007). Pollen germination is reduced. Ungerminated pollen is seen as dots. Germinated pollen produce thick, short and curled tubes. Some pollen tubes end with pronounced bulbs. Table 3.2 Total number of compatible and incompatible pollinations within and between Corylus species. C= compatible, 1= incompatible.

Pollen Genotypes Female Genotypes avellana* americana heterophylla cornuta californica sieboldiana colurna chinensis jacquemontii

C I C I C I C I C I C I C I C I C I

avellana* 25 2 8 6* 13 7 9 9 9 8 11 3 3 18 1 16 4 2

americana 9 1 90 9 22 1 2 28 0 26 18 1 0 10 0 4 0 6

heterophylla 14 4 10 12 44 20 0 11 4 6 1 18 1 10 1 6 4 4

cornuta 5 1 8 11 12 4 38 11 12 1 11 3 3 5 0 2 1 4

californica ** 1 0 — 1 1 3 1 41 12 3 2 0 1 — 0 1

sieboldiana 8 1 2 4 4 21 7 3 8 7 68 21 0 9 3 1 1 5

* Self-incompatibility alleles in C. avellana may not be well represented; most of the chosen genotypes used were cross-compatible due to their different S-alleles. ** Number of female flowers in C. californica was very limited.

ON 77

ended with pronounced bulbs. Examples are C. avellana 'Henneman #3' and 'Segorbe', C. sieboldiana CC1.074, and C. heterophylla 530.021. In some self pollinations, there was a very strong pollen-stigma reaction such that no pollen germination was observed. Examples include C. californica Y3, Y18, Y28, Y32 and Y34, C. americana 366.088, and C. sieboldiana CC 1.054 and CC2.070 genotypes. Pollen of a total of 128 genotypes was tested on female flowers of 64 genotypes for intra-specific pollinations. Compatible and incompatible reactions were observed within each species. Appendix Table A25 shows some of these combinations and Table 3.2 shows the total number of pollinations made within each species. Most of the pollinations between genotypes within each Corylus species were compatible. Among the species, C. americana had the highest number of compatible pollinations, 90 out of 99, among its genotypes. The pollen of 191 genotypes was used in pollinations on styles of 56 various accessions of Corylus species. Inter-specific pollinations resulted in both compatible and incompatible reactions as in intra-specific pollinations (Table 3.2). In a few combinations, reciprocal differences were observed. Some of these combinations are presented in Appendix Tables A26, A27, A28, A29, and A30. Pollen of wild species, except C. colurna and C. chinensis, were mostly compatible on C. avellana female flowers. However, pollen-stigma reactions were mostly compatible when C. avellana genotypes were the pollen source. Pollen-stigma interactions between female genotypes of C. americana and male genotypes of other Corylus species were mostly compatible except C. cornuta and C. californica. Interestingly none of the pollen of the tree species, C. colurna, C. chinensis and C jacquemontii, was able to penetrate the stigma of C. americana plants. The pollen of all C. cornuta selections on C. heterophylla stigmas was incompatible but the reciprocal resulted in good compatibility. The reciprocal combinations between C. heterophylla and C. sieboldiana were mostly 78

incompatible. Pollen of C. heterophylla was more successful on C. americana than the reciprocal. Pollen of the tree species C. colurna, C. chinensis, and C. jacquemontii was incompatible on C. cornuta stigmas, but pollen of the shrub species was mostly compatible.

3.5 DISCUSSION

The use of wild Corylus species may be necessary to obtain specific traits such as disease resistance, especially resistance to eastern filbert blight, cold hardiness, tolerance to lime (high pH)-induced chlorosis, precocity, exceptionally early maturity, and non-suckering habit to improve existing hazelnut cultivars (Thompson et al., 1996). Cultivars of the European hazelnut, C. avellana L., are self-incompatible. Incompatibility necessitates the use of pollinizers in commercial orchards, and it also prevents many desirable crosses in breeding programs. Self-incompatibility in hazelnuts is of the sporophytic type and controlled by a single S-locus with multiple alleles (Thompson, 1979a). It would be logical assumption that wild species in the genus Corylus also have sporophytic self-incompatibility. In fact, Thompson et al. (1996) suspected that a similar system might be operating in Corylus. They reported a clone of C. heterophylla which expresses the Si allele, the most common allele in C. avellana cultivars. Our results showed that all of the tested genotypes of wild Corylus species tested are self-incompatible which resulted in reduced pollen germination and short pollen tubes. Pronounced bulbs were observed at the end of pollen tubes and tubes usually had a comma shape. Ungerminated pollen was observed as dots due to fluorescent emission. Reduced germination, and coiled and bulbous pollen tubes are characteristics of incompatible reactions in C. avellana (Mehlenbacher and Thompson, 1988). Incompatible pollen tubes are inhibited on the stigma surface 79

and do not penetrate into papillae (Hampson et al., 1993; Heslop-Harrison et al., 1986) which is a characteristic of SSI systems (Nasrallah and Nasrallah, 1993). The pollen of cultivar 'Tombul Extra Ghiaghli' was compatible on its own stigma. This was not unexpected since pseudo self-incompatibility has been reported in this cultivar and 'Montebello' (Mehlenbacher and Smith, 1991). Both cultivars have fully functional S-alleles. One possibility is that the ability to reject self-pollen may decrease with female flower age. A similar response was observed in old C. colurna XI3 female flowers; all of the self, intra- and interspecific pollinations resulted in good pollen germination and tube growth on old females of this clone. Pollen-stigma reactions in compatible crosses among intra-specific Corylus genotypes showed good pollen germination and a mass of long, thin pollen tubes with many callose deposits, as in compatible crosses within C. avellana. Pollinations between C. avellana cultivars and selections used in this study may not reflect the natural variation within the species for self-incompatibility. Because C. avellana is the species of this genus in which self-incompatibility was first found and studied in detail, the C. avellana genotypes used in this study were mostly cross-compatible because they were chosen for their different S-alleles (see Mehlenbacher and Thompson, 1988; Mehlenbacher, 1997 for S-alleles of cultivars). The number of compatible and incompatible crosses between genotypes was variable in wild Corylus species but compatible crosses were about two to ten fold more common than incompatible ones. For example, in C. americana no pollen inhibition occurred in 90 out of 99 pollinations. The presence of such a high number of cross-compatible genotypes suggests that many S-alleles exist in wild Corylus species, as compatible pollen-stigma reactions occur when the S-alleles expressed in pollen and the pistil are not identical (Nettancourt, 1977). Wild populations of some species may express large number of distinct alleles; more than 60 in Brassica, 60-80 in Papaver, and 150-200 in Trifolium (Dickinson, 1990; Nasrallah and Nasrallah, 1986). 80

Interspecific pollen-stigma interactions are rather difficult to interpret. Both self-incompatibility and interspecific incompatibility (incongruity) refer to pollen inhibition on the stigma or in the style. The interspecific incompatibility reaction is usually stigmatic in families where self-incompatibility is expressed in the stigma and stylar- in families where self-incompatibility is expressed in the style (Nettancourt, 1977). Incongruity has been defined as pre- and post-zygotic reproductive barriers due to a lack of genetic information between partners (Hogenboom, 1973, Lield and Anderson, 1993). It involves a failure of pollen to hydrate, germinate, or penetrate the stigma, bursting of the pollen tube in the style, failure of pollen tubes to effect fertilization, embryo abortion, endosperm failure and hybrid breakdown. Rougier et al. (1992) attributed the arrest ofPopulus alba pollen tubes in the lower part of P. deltoides styles to incongruity. In our interspecific reciprocal crosses (SI x SI) we observed both compatible and incompatible reactions, unlike Lewis and Crowe (1958) who obtained only compatible results from the SI x SI interspecific crosses in Brassicaceae. They indicated that in SI x SC pollinations, pollen germination is inhibited on the stigma and results in interspecific incompatibility. On the other hand, in Brassica, Hiscock and Dickinson (1993) showed that results of SI x SI crosses were not predictable. Out of 35 reciprocal SI x SI crosses, 22 showed unilateral SI x SI incompatibility, 9 showed reciprocal incompatibility and 4 showed reciprocal compatibility. Crosses among the closely related species C. avellana, C. americana and C. heterophylla mostly gave compatible pollen-stigma reactions (from 45.5% to 95.7%). Pollen of each SI species contains a specific molecule or molecules able to overcome the stigmatic barrier in crosses within the species, whereas a SI species cannot overcome the barrier in another SI because of specific differences in these molecules (Hiscock and Dickinson, 1993). Thus SI x SI compatibility would therefore be due to similarities between the specific component of the pollen molecules of the two species. These components would be proteins. In poplar, 81

proteins held in pollen grain walls were associated with inhibition of pollen germination in interspecific crosses (Knox et al., 1972). Neither C. cornuta nor C. sieboldiana is closely related and cross compatible with C. avellana (Chapter 2). However, 50% of C. avellana x C. cornuta pollinations and 83.3% of the reciprocal crosses did not show pollen- stigma inhibition. The same holds for C. avellana x C. sieboldiana, and the reciprocal pollinations (78.6% and 88.9% respectively). This leads to a question of whether interspecific incompatibility in Corylus results from prezygotic (incompatible pollen-stigma reactions) or from post zygotic events or both? Since most of the reciprocal pollen-stigma reactions in distantly related C. avellana x C. cornuta and C. avellana x C. sieboldiana species were compatible, our data suggest that pollen-stigma incompatibility is only partly involved, and the majority of failed crosses is due to abnormalities after pollen germination and tube growth such as abnormalities in fertilization and embryo growth (incongruity). In the cross C. heterophylla x C. cornuta, all of the pollinations were incompatible, but 75% of the reciprocal crosses did not show pollen inhibition. Interspecific hybridizations in the field (Chapter 2) confirm this unilateral incompatibility (UI); successful results could be obtained only when C. heterophylla was the pollen parent. Unilateral SI x SI could be explained by 'a lock and key' analogy that a small key may be able to open a large lock but a large key cannot open a small lock (Hiscock and Dickinson, 1993; Sampson, 1962). These 'key differences' would be considered analogous to structural and functional differences between the pollen molecules that overcome the stigmatic barrier. Pollen rejection either on the stigma or in the style has been associated with unilateral interspecific incompatibility in many species (Chetelat and DeVama 1991; Hiscock and Dickinson 1993; Knox et al., 1972; Lewis and Crowe 1958; Nettancourt et al, 1974; Nettancourt 1977). Investigation of interspecific pollen- stigma interactions and physiological similarities between UI and SI suggested an involvement of the S-locus in UI (Hiscock and Dickinson, 1993). UI in Lycopersicon esculentum pollen tubes is governed by a single gametophytic factor 82

which is either linked or allelic to the S-locus (Nettancourt et al., 1974). On the other hand UI in L. peruvianum is controlled in the styles by a number of different dominant genes. These dominant genes, the S-locus of SI and the gametophytic factor regulating the unilateral reaction in L. esculentum pollen probably belong to the same linkage group. Linkage analysis in L. pennellii presented evidence that three pollen expressed UI loci were identified on chromosomes 1, 6 and 10 (Chetelat and DeVama, 1991). Linkage data supported the hypothesis that UI is controlled by an interaction between the S-locus and other loci. On the other hand, the unilateral response was found to be different from SI in the timing and location of expression in the style in crosses of L. pennellii x L. esculentum. (Lield et al., 1996). This unilateral response was called 'unilateral incongruity' rather than interspecific incompatibility. In conclusion, our study of pollen-stigma interactions provides abundant evidence that self-incompatibility exists in wild Corylus species and suggests that a large number of alleles is involved. Reciprocal differences in compatible and incompatible pollinations and unilateral incompatibility were observed in some interspecific crosses. 83

3.6 REFERENCES

Bell, P. 1995. Incompatibility in flowering plants: Adaptation of an ancient response. Plant Cell 7: 5-16.

Chetelat, R.T. and J.W. DeVama. 1991. Expression of unilateral incompatibility in pollen of Lycopersicon pennelli is determined by major loci on chromosomes 1, 6, and 10. Theor. Appl. Genet. 82: 704-712.

Dickinson, H. G. 1990. Self-incompatibility in flowering plants. BioEssays 12: 155-161.

Ebert, P. R., M. A. Anderson, R. Bematzky, M. Altschuler, and A. E. Clarke. 1989. Genetic polymorphism of self-incompatibility in flowering plants. Cell 56: 255-262.

Gaude, T. and C. Dumas. 1987. Molecular and cellular events of self- incompatibility. Intern. Rev. Cytol. 107: 333-366.

Hampson, C. R., A. N. Azarenko, and A. Soeldner. 1993. Pollen-stigma interactions following compatible and incompatible pollinations in hazelnut. J. Amer. Soc. Hort. Sci. 118: 814-819.

Heslop-Harrison Y., J. S. Heslop-Harrison, and J. Heslop-Harrison. 1986. Germination of Corylns aveliana L. (Hazel) pollen: hydration and the function of the oncus. Acta Bot. Neerl. 35: 265-284.

Hiscock, S. J. and H. G. Dickinson. 1993. Unilateral incompatibility within the Brassicaceae: further evidence for the involvement of the self- incompatibility (S)-locus. Theor. Appl. Genet. 86: 744-753.

Hogenboom, N. G. 1973. A model for incongruity in intimate partner relationships. Euphytica 22: 219-233.

Kasapligil, B. 1972. A bibliography on Corylus (Betulaceae) with annotations. Ann. Rep. Northern Nut Growers Assn. 63: 107-162.

Knox, R. B., R. R. Willing, and A. E. Ashford. 1972. Role of pollen-wall proteins as recognition substances in interspecific incompatibility in poplars. Nature. 237:381-383.

Lagerstedt, H. B. 1975. Filberts, p. 456-489. In: J. Janick and J. N. Moore (eds.). Advances in fruit breeding. Purdue Univ. Press. West Lafayette, IN. 84

Lewis D. and L. K. Crowe. 1958. Unilateral interspecific incompatibility in flowering plants. Heredity 12: 233-256.

Lield, B. E. and N. O. Anderson. 1993. Reproductive barriers: identification, uses and circumvention. Plant Breed. Rev. 11: 11-154.

Lield, B. E., S. McCormick, and M. A. Mutschler. 1996. Unilateral incongruity in crosses involving Lycopersicon pennelli and L. esculentum is distinct from self-incomptaibility in expression, timing and location. Sex. Plant Reprod. 9: 299-308.

Mehlenbacher, S. A. 1997. Revised dominance hierarchy for S-alleles in Corylus avellana L. Theor. Appl. Genet. 94:360-366.

Mehlenbacher, S. A. and D. C. Smith. 1991. Partial self-compatibility in 'Tombul' and 'Montebello' hazelnuts. Euphytica 56: 231-236.

Mehlenbacher, S. A. and M. M. Thompson. 1988. Dominance relationships among S-alleles in Corylus avellana L. Theor. Appl. Genet. 76: 669-672.

Nasrallah, J. B. 1997. Signal perception and response in the interactions of self- incompatibility in Brassica. Essays in Biochemistry 32: 143-159.

Nasrallah, M. E. and J. B. Nasrallah. 1986. Molecular biology of self- incompatibility in plants. Trend. Genet. 2: 239-244.

Nasrallah, M. E. and J. B. Nasrallah. 1993. Pollen-stigma signaling in the sporophytic self-incompatibility response. Plant Cell 5: 1325-1335.

Nettancourt, D. De. 1977. Incompatibility in Angiosperms. Monographs on Theor. Appl. Genet. 3. Springer-Verlag 230 p. Berlin and New York.

Nettancourt, D. De, M. Devreux, U. Laneri, M. Cresti, E. Pacini, and G. Sarfatti. 1974. Genetical and ultrastructrual aspects of self and cross incompatibility in interspecific hybrids between self-compatible Lycopersicum esculentum and self-incompatible L. peruvianum. Theor. Appl. Genet. 44: 278-288.

Newbigin, E., M. A. Anderson, and A. E. Clarke. 1993. Gametophytic self- incompatibility systems. Plant Cell 5: 1315-1324.

Rougier, M., N. Jnoud, C. Said, S. Russel, and C. Dumas. 1992. Interspecific incompatibility in Populus: inhibition of tube growth and behaviour of the male germ unit in P. deltoides x P. alba. Protoplasma 168: 107-112. 85

Sampson, D. R. 1962. Intergeneric pollen-stigma incompatibility in Cruciferae. Can. J. Genet. Cytol. 4: 38-49.

Schuster, C. E. 1924. Filberts: 2. Experimental data on filbert pollination. Oregon Agric. Expt. Sta. Bull. No. 208.

Smith, D. C. and S. A. Mehlenbacher. 1994. Use of Tyek housewrap for pollination bags in breeding hazelnut. (Corylus avellana L.) HortScience 29:918.

Thompson, M. M. 1979a. Genetics of incompatibility in Corylus avellana L. Theor. Appl. Genet. 54: 113-116.

Thompson, M. M. 1979b. Incompatibility alleles in Corylus avellana L. cultivars. Theor. Appl. Genet. 55: 29-33.

Thompson, M. M., H. B. Lagerstedt, and S. A. Mehlenbacher. 1996. Hazelnuts, p. 125-184. In: J. Janick and J. N. Moore (eds.). Fruit Breeding Vol: III, Nuts. John Wiley and Sons Inc., New York.

Volker, H., J. E. Gray, B. A. McClure, M. A. Anderson, and A. E. Clarke. 1990. Self-incompatibility: A self-recognition system in plants. Science 250: 937- 941. 86

CHAPTER 4

CHARACTERIZATION OF Corylm SPECIES BASED ON MORPHOLOGY AND PHENOLOGY

4.1 ABSTRACT

Twenty three morphological and five phenological characters were studied in 33 taxa representing nine Corylus species to reveal genetic relationships. Characters were very variable for most of the genotypes within the species. A phylogenetic analysis based on parsimony was performed. Twenty seven characters were parsimony informative. Three groups appeared in the tree. The six shrub species were placed in the first and second group while three tree species were placed in the last group. The first group included all representatives of C. avellana, C. americana, and C. heterophylla. Many of the C. avellana accessions failed to cluster together within the group due to the great diversity for morphological and phenological traits present in this species. The second group included all representatives of C. cornuta, C. californica, and C. sieboldiana. Our data suggest that C. californica may not be a botanical variety of C. cornuta. The third group included all representatives of the tree species C. colurna, C. chinensis, and C. jacquemontii. The clustering pattern was congruent with classification based on interspecific hybridization (Chapter 2).

4.2 INTRODUCTION

Corylus belongs to the birch family Betulaceae of the order Fagales (Furlow, 1997; Kubitzki, 1993; Woodland, 1991). The genus is included in one of two clades (Bousquet et al., 1992) or subfamilies, Coryloideae (Furlow, 1997; Kubitzki, 1993). Corylus species are monoecious, anemophilous, decidious shrubs 87

and trees. Corylus is native to the northern hemisphere, where its habitat ranges from Japan, China and Manchurica through Tibet, Caucasia, Turkey, Europe and North America (Ayfer et al., 1986; Drumke, 1964; Kasapligil, 1972). All Corylus species appear to be diploid, 2n = 2x = 22, (Botta et al., 1986; Kasapligil, 1968; Salesses, 1973; Wetzel, 1929), although 2n = 28 was reported (Woodworth, 1929). The chromosomes are extremely small. The number of Corylus species has been controversial. Ten to 25 species have been reported (Bailey, 1914; Everett, 1981; Huxley et al., 1992; Kasapligil, 1963, 1972; Krussmann, 1976; Rehder, 1940). The most widely accepted include five shrub species, C. avellana L., C. americana Marshall, C. cornuta Marshall, C. californica Marshall, C. heterophylla Fischer and C. sieboldiana Blume; and the four tree species C. colurna L., C. jacquemontii Decaisne, C. chinensis Franchet and C. ferox Wallich (Thompson et al., 1996). Drumke (1964) recognized C. californica as a botanical variety of C. cornuta rather than a distinct species. The systematics of Corylus has not been given much attention by taxonomists. Most of the studies that included Corylus were at the genus or higher level (Bousquet et al., 1992; Brunner and Fairbrothers, 1979; Savard et al., 1993). Corylus systematics has been mainly based on descriptions and largely restricted to morphology, especially of the husk or involucre (Figures 4.1 - 4.7) (Bailey, 1914; Drumke, 1964; Everett, 1981; Huxley et al., 1992; Kasapligil, 1964; Krussmann, 1976; Rehder, 1940). Furlow (1997) suggested a reevaluation of the genus Corylus. A variety of morphological, chemical and molecular markers have been used in crop species for determination of genetic variability (Avise, 1994). Observation of morphological characters may take time and these traits can be influenced by environmental factors. However there is a need for a better understanding of species relationships in Corylus and very little information exists about the use of morphological Fig 4.1 Husk variation in C. avellan; (A) Italian geotypes (B) Turkish genotypes. 89

Fig 4.2 Husk variation in (A) C. maxima and (B) a typical husk of C. americana. 90

Fig 4.3 A typical husk of (A) C. heterophylla and (B) C. cornuta. •Duvippqdis j (g) pire oomuo/tjDO j (v)j0 y.sm\ IBOidXi y f'p '%\i

16 92

Fig 4.5 Husk variation in (A) C. colurna and (B) C. jacquemontii. 93

Fig 4.6 A typical husk of (A) C. chinensis and (B) C.ferox var. thibetica. 94

g

u S s" S

< n

Ml i u o w If § 8 1^ a o > w

* si— fa 95

characters in this regard. The objective of this study was to analyze genetic relationships among Corylus species based on morphological and phenological characters.

4.3 MATERIALS AND METHODS

A total of 33 authentic (true-to-name) genotypes representing 9 Corylus species located at the Smith Research Farm of Oregon State University and at the National Clonal Germplasm Repository of the United States Department of Agriculture at Corvallis, OR were used (Table 4.1). For the five shrub species, clonally propagated trees as well as genotypes selected from seedling populations were used to represent the diversity and geographic range within the species. For C. colurna, C. jacquemontii and C. chinensis, only a few accessions were available at the time of study. Botanical characters used included phenological characters, husk and nut characters, growth habit, and seed germination characters (Table 4.2).

4.3.1 Phenological data Phenological observations were recorded at weekly intervals. Evaluations were made based on thorough observations of characters on each genotype. Time of budbreak. catkin elongation, female flowering, nut maturity and leaf fall: Budbreak date was recorded as the time when the first leaves emerged and extended from about 70% of the buds of a whole plant. Catkin elongation was recorded as the time when 70% of catkins had elongated. The first day when 70% of pistillate flower stigmas exerted was recorded as female flowering. Nut maturity was recorded as the date when 95% of the nuts on the tree turned freely in the husk or the basal scar of the nut had turned from green to white-gray or brown in color. Leaf fall date was the day 70% of leaves had fallen from the plant. 96

4.3.2 Husk characters The husk or involucre covers the nut. Husk characters were evaluated on 10 randomly chosen clusters from different locations within the tree (Thompson et al., 1978). In order to prevent subjectivity, characters were expressed with measurements whenever possible. The range of values for each character was divided into subgroups with equal-sized increments to obtain character states. Husk length: Length in cm from the base to the end of the husk Relative husk length: Ratio of length (cm) between nut end and husk end to the length (cm) between husk base and nut end. Husk constriction: Ratio of width (cm) at the nut end to width (cm) at the husk base. Constriction is not desired because constricted husks retain the nuts even after maturity. Husk shape: Ratio of width (cm) at the husk tip to the width (cm) of the husk base. Presence of deep incisions: Husk is divided into very long, narrow, finger- like divisions. Presence of slit: Husk is slit (open) on one or both sides usually from the tip to the base of the husk. When the nuts are mature, the husks dry. The presence of slits lets the drying husk fold back, allowing the nuts to be released from the husk. Husk fleshiness: Refers to thickness and juiciness of the husk. Husk hair type: Refers to the presence of either glandular or bristle type hairs. Bristle type hairs are very loosely attached to the husk. They become embedded in the hand and irritate the skin when touched.

4.3.3 Leaf characters Ten fully developed leaves were randomly taken from each genotype from many positions in the canopy and photocopied. Measurements of the length and width were made on the photocopies. 97

Table 4.1 Cultivated and wild Corylus accessions used in evaluation of botanical characters.

Species Code Genotype Origin

aveliana L. avel-1 B4 Macedonia avel-2 Butler OR, USA avel-3 Casina Spain avel-4 Du Chilly (syn. Kentish Cob) England avel-5 San Giovanni Italy aveI-6 Sivri Ghiaghli Turkey avel-7 Tombul Ghiaghli Turkey avel-8 Tonda Gentile Romana Italy

americana Marsh. amer-1 Seedling #400.042 (seed lot 88324) WI.USA amer-2 Seedling #531.013 (seed lot 88317) MI, USA amer-3 Seedling #532.061 (seed lot 88312) NJ, USA amer-4 Seedling #536.020 (seed lot 89332) IL, USA

heterophylla Fisch. heter-1 R27 (Het. 005) grafted tree China heter-2 Seedling #404.038 (seed lot 86025) Korea heter-3 Seedling #530.013 (seed lot 88452) China heter-4 heterophylla var. mandchurica China

cornuta Marsh. com-1 Seedling #CC2.057 (seed lot 87166) MN.USA com-2 Seedling #CC2.079 (seed lot 88402) QU, Canada com-3 Seedling #CC3.012 (seed lot 89404) NY, USA com-4 Seedling #CC3.049 (seed lot 89402) WI,USA

californica Marsh. calif-1 Grafted tree #X34 (B0089) OR, USA calif-2 Grafted tree #Y 18 (B0070) OR, USA calif-3 Grafted tree #Y32 (B0509) OR, USA calif-4 Seedling #CC2.094 (seed lot 88410) BC, Canada

sieboldiana Blume. sieb-1 Seedling #CC1.012 (seed lot 86028) Korea sieb-2 Seedling #CC 1.031 (seed lot 86029) Korea sieb-3 Seedling #CC 1.094 (seed lot 86032) Korea sieb-4 Grafted tree #CC5-396 Korea

colurna L. colur-1 Seedling tree #X 11 Europe colur-2 Seedling tree #X 13 Europe

jacquemontii Decne. jacq-1 Grafted tree (via Cecil Farris, Unknown Michigan) jacq-2 Seedling #397.002 (seed lot 88501) India

chinensis Franch. chinen-1 Seedling #W5 China 98

Table 4.2 Character states for the 28 botanical characters investigated.

Code/Character Character states and definitions

1-Budbreak 0 = 27 February (very early); 1=6-13 March (early); 2 = 20-27 March (medium); 3 = 3-10 April (late)

2-Catkin elongation 0 = 30 December (very early); 1 = 6-20 January (early); 2 = 27 January- 10 February (medium); 3 = 17 February - 3 march (late)

3-Female anthesis 0 = 30 December (very early); 1 = 6 - 20 January (early); 2 = 27 January - 10 February (medium); 3 = 17 February - 3 March (late); 4=10 March (very late)

4-Nut maturity 0 = 26 July (very early); 1 =2-16 August (early); 2 = 23 August- 6 September (medium); 3 = 13 - 27 September (late); 4 = 4-11 October (very late)

5-Leaffall 0 = 27 September - 4 October (very early); 1 = 11-18 October (early); 2 = 25 October - 1 November (medium); 3 = 8-15 November (late); 4 = 22 - 29 November (very late); 5 = leaves do not fall

6-Husk length 0 = <2.0 cm (small); 1 = 2.1 -3.0 cm (medium); 2 = 3.1 - 4.0 cm (long); 3 = 4.1 - 5.0 cm (very long); 4 = 5.1cm< (extremely long)

7-Relative husk length 0 = <0.13 (short); 1 = 0.14 - 0.63 (medium); 2 = 0.64 - 1.13 (long); 3 = 1.14 - 1.63 (very long); 4 = 1.64< (extremely long)

8-Husk constriction 0 = <0.75 (severe); 1 = 0.76 - 0.95 (slight); 2 = 0.96< (none)

9-Husk shape 0 = <0.70 (closed tube); 1 = 0.71 - 1.30 (tubular); 2 = 1.31 - 1.70 (flared); 3 = 1.7K (very flared)

10-Presence of deep 0 = no; l=yes incisions

11-Presence of slit 0 = no; 1 = yes

12-Husk flesh 0 = leafy; 1 = fleshy (juicy)

13-Huskhair 0 = glandular; 1 = bristles

14-Petiole length 0 = <1.0cm (short); 1 = 1.1 - 2.0 cm (medium); 2 = 2.lcm< (long)

15-Leafsize 0 = <8.0 (small); 1 = 8.1 - 10.0 (medium); 2 = 10.1 - 12.0 (large); 3 = 12.1<(very large) 99

Table 4.2 (Continued) Character states for the 28 botanical characters investigated.

Code/Character Character states

16-Leaf shape 0 = 0.9 - 1.10 (ratio 1:1); 1 = 1.11 - 1.35 (ratio 6:5); 2 =1.36-1.65 (ratio 3:2)

17-Leafbase 0 = variable forms of cordate; 1= oblique

18-Nuts/cluster 0 = 1.0-2.0; 1 =2.1-3.0; 2 = 3.1-4.0; 3 =4.1-5.0; 4 = 5.1-6.0; 5 = 6.1<

19-Nut size 0 = <13.0mm (very small); 1 = 13.1 - 15.5 mm(small); 2 = 15.6 - 18.0 mm (medium); 3 = 18.1 - 20.5 mm (large); 4 = 20.6mm< (very large)

20-Nut shape index 0 = <0.90 (oblate); 1 = 0.91 - 1.10 (round); 2 = 1.11-1.30 (long) 3 = 1.31< (very long)

21 -Nut compression 0 = 0.90 - 1.10 (no); 1 = 1.11 - 1.30 (compressed); index 3 = 1.31< (very compressed)

22-Shell scar size 0 = <10.0% (very shallow); 1 = 11.0 - 20.0% (shallow); 2 = 21.0 - 30.0% (medium); 3 = 31.0 - 40.0% (large); 4 = 41.0%< (very large)

23-Shell color 0 = Tawny olive/Deep olive buff; 1 = Sayal brown/Sudan brown 2 = Brussel brown/ Cinnamon brown; 3 = Hazel/Amber brown 4 = Auburn/ Argus brown; 5 = Chestnut brown/Carob brown

24-Nut weight ? = missing data; 0 = <0.50g (very small); 1 = 0.51 - 1.00g (small); 2 = 1.01 - 1.50g (medium); 3 = 1.51 - 2.00g (large); 4 = 2.0 lg< (very large)

25-% Kernel ? = missing data; 0 = <25% (very low); 1 = 25.1 - 35.0% (low); 2 = 35.1 - 45.0% (medium); 3 = 45.1 - 55.0% (high); 4 = 55.1%<(veryhigh)

26-Seed germination 0 = hypogeal; 1 = epigeal

27-Growth habit 0 = multiple stems; 1 = single stem

28-Sucker formation 0 = no; 1 = yes 100

Petiole length: Length of petiole in cm. Leaf shape: Ratio of leaf length (cm) to leaf width (cm). Leaf size: Leaf length (cm) + leaf width (cm) divided by 2. Leaf base: Shape of the leaf base.

4.3.4 Nut characters Nut characters were also expressed as measurements whenever possible. Samples of 10 randomly chosen nuts were evaluated for each genotype (Thompson et al., 1978). A digital caliper was used to measure the given dimensions on the nuts (Mitutoyo Mfg. Co. Ltd., Tokyo, Japan). Nuts / cluster: Average number of nuts per cluster based on counts of ten clusters. Nut size: [Nut length (mm) + nut width (mm)] divided by two. Nut shape index: Ratio of nut length (mm) to nut width (mm). Compression Index: Ratio of nut width (mm) to nut depth (mm). Shell scar size: Ratio of scar length (mm) on the shell surface (not at the base) to the total nut length (mm) multiplied by 100. Shell color: Determined by the comparison of shell color to a standard color reference ( Ridgway, 1912). Nut weight: Whole weight of the nut (shell + kernel) in grams. Percent Kernel: Ratio of kernel weight (g) to whole nut weight (g) multiplied by 100.

4.3.5 Other characters Seed germination type: Cotyledons either stay in the soil (hypogeal) or separate and are raised into the air (epigeal, like beans). This difference is a species characteristic, and used for all representatives of that species. Data was obtained 101

mostly from Chapter two, and from some additional germination tests of some individual genotypes. Growth habit: Formation of multiple stems or single stem (trunk) on the plants. Sucker formation: Production of suckers at the soil level or under the soil is a species characteristic. Some genotypes were represented by grafted trees. Sucker formation could not be noted on these trees but the presence or absence of suckers on other representatives was noted and the data used for the grafted trees.

4.3.6 Data analysis Maximum parsimony analyses of the morphological and the phenological characters were performed using PAUP* 4.0d65 (Swofford, 1999) on a Macintosh PowerPC 7600. Ten replicates of the following heuristic search options were performed: maximum parsimony, random sequence addition and tree bisection- reconnection branch swapping. Bootstrap support (Felstein, 1985) was determined using the above settings with 500 replications.

4.4 RESULTS

Thirty three accessions representing Corylus species were evaluated for 28 phenological and morphological characters (Table 4.3). Character states ranged from 0 to 5. The data for two characters, nut weight (#24) and % kernel (#25) in C. jacquemontii-l and C. heterophylla-4 accessions could not be obtained because all of the nuts sampled were blanks. They were treated as missing (?) values in PAUP. Many characters were very variable among accessions of each Corylus species. This was especially true for C. avellana, which made it difficult to see a unique character shared by all accessions of this cultivated species. For example, nut weight ranged from very small (0.92g)) to very large (4.3 Ig). However, the 102

Table 4.3 Coding of the character states for Corylus accessions.

Character Code Accession Code 1 2 3 4 5 6 7 8 9 10 11 12 13 14

avel-1 2 1 1 2 3 3 2 0 0 0 0 0 0 avel-2 2 1 2 2 3 1 0 2 1 0 0 0 avel-3 2 2 2 2 3 1 1 2 1 0 0 0 0 avel-4 2 1 2 3 3 2 1 2 1 0 0 0 avel-5 1 0 0 2 4 1 0 2 2 0 0 0 avel-6 0 1 2 1 3 2 2 0 2 0 0 0 0 avel-7 1 1 2 1 3 1 1 1 1 0 0 0 avel-8 1 0 1 1 3 2 1 2 2 0 0 0

amer-1 2 3 2 1 2 1 3 2 3 0 0 0 amer-2 2 2 2 2 1 2 3 2 3 0 0 0 amer-3 2 2 2 4 2 2 3 2 2 0 0 0 amer-4 2 3 3 2 1 2 3 2 2 0 0 0

heter-1 3 3 3 2 5 2 3 2 3 0 0 0 heter-2 2 2 2 2 5 0 1 2 2 0 0 0 heter-3 2 1 2 1 5 1 2 2 2 0 0 0 heter-4 2 2 2 2 5 1 2 2 3 0 0 0

com-1 2 3 3 1 0 4 4 0 0 0 0 0 com-2 3 3 4 1 0 4 4 0 0 0 0 0 com-3 3 3 3 2 2 4 4 0 0 0 0 0 com-4 3 3 3 1 0 4 4 0 0 0 0 0

calif-1 2 3 3 1 1 3 3 0 0 0 0 0 calif-2 2 3 3 0 1 2 2 0 0 0 0 0 calif-3 3 3 3 0 0 2 2 0 0 0 0 0 0 calif-4 3 3 3 1 0 2 2 0 0 0 0 0

sieb-1 3 3 4 4 2 3 4 0 0 0 0 0 sieb-2 2 3 3 4 2 3 4 0 0 0 0 0 sieb-3 3 3 3 4 2 2 4 0 0 0 0 0 sieb-4 2 3 3 4 4 3 4 0 0 0 0 0

colur-1 2 2 2 2 3 3 4 1 2 1 1 1 0 2 colur-2 2 0 2 3 2 3 3 1 3 1 1 1 0 2

jacq-1 2 2 2 3 3 2 4 1 2 1 1 1 0 2 jacq-2 3 1 2 3 1 2 3 1 1 1 1 1 0 2

chinen-1 2 2 2 4 3 2 3 0 0 0 0 1 0 2 103

Table 4.3 (Continued) Coding of the character states for Corylus accessions.

Character code Accession Code 15 16 17 18 19 20 21 22 23 24 25 26 27 28

avel-1 2 0 0 1 4 3 2 4 4 4 0 0 avel-2 2 1 0 0 3 1 0 3 4 4 0 0 avel-3 1 0 1 2 1 0 1 3 2 5 0 0 avel-4 2 0 0 2 4 3 1 3 4 2 0 0 avel-5 0 0 0 3 2 1 3 4 4 0 0 avel-6 2 0 0 4 2 3 0 2 5 3 5 0 0 avel-7 1 0 2 1 2 0 1 4 1 4 0 0 avel-8 0 0 1 2 1 2 4 3 3 0 0

amer-l 2 0 3 1 1 4 5 2 1 0 0 amer-2 1 0 3 1 2 3 5 2 1 0 0 amer-3 2 0 3 1 2 2 3 4 1 1 0 0 amer-4 2 0 0 1 1 4 5 2 3 0 0

heter-1 0 0 0 1 2 2 2 2 3 0 0 heter-2 0 0 0 1 1 0 1 2 2 3 0 0 heter-3 0 0 0 0 1 2 4 1 2 0 0 heter-4 0 0 0 1 1 1 2 ?* ?* 0 0

com-1 2 0 0 1 1 1 1 2 2 0 0 com-2 1 0 0 1 2 1 1 2 2 0 0 com-3 1 0 0 1 2 1 1 2 2 0 0 com-4 0 1 0 0 0 2 1 1 1 3 0 0

calif-1 1 0 0 2 1 0 2 4 2 0 0 calif-2 1 0 0 2 2 0 1 3 2 0 0 calif-3 0 0 0 0 1 1 0 0 1 3 2 0 0 calif-4 1 1 0 1 2 1 1 0 1 3 2 0 0

sieb-1 0 2 0 0 0 2 0 1 0 1 3 0 0 sieb-2 0 1 0 2 0 3 0 1 0 0 3 0 0 sieb-3 0 2 0 0 0 3 0 2 0 1 3 0 0 sieb-4 0 1 0 3 0 3 0 2 0 1 3 0 0

colur-1 2 0 0 4 2 1 2 4 1 2 2 1 1 0 colur-2 2 1 0 2 3 2 2 4 1 3 2 1 1 0

jacq-1 2 1 0 1 2 1 1 3 1 ?* ?* 1 1 0 jacq-2 2 1 0 1 1 2 2 2 1 1 2 1 1 0

chinen-1 3 2 1 5 2 0 1 4 1 4 0 1 1 0

♦Missing data for nut weight and %kemel characters because all of the nut samples were blank 104

largest nut weight and highest % kernel were obtained from most of the C. avellana accessions among the taxa. Some characters were unique to a single species. In C. heterophylla, leaves did not drop in the fall and stayed attached to the twigs for a long time. C. chinensis had the largest leaf size and oblique leaf bases, the largest number of nuts per cluster, oblate nut shape and the lowest % kernel. The longest husks were observed in C. cornuta. Percent basal scar area on the shells was the smallest in C. californica. The shell color of C. sieboldiana nuts was the lightest (light olive-green). Some of the characters were prominent in more than one species. Nuts of C. sieboldiana and C. chinensis were the latest to mature. C. colurna and C. jacquemontii had deep divisions on their husks. C. americana and C. heterophylla did not have constricted husks, and many genotypes of these species had very open (flared) husks. C. cornuta, C. californica and C. sieboldiana were distinct from other species in regard to late male and female flowering, severe husk constriction, absence of slit(s) on husk, tubular husk shape, loosely attached bristles (non-glandular) on the husk.. The tree species C. colurna, C. jacquemontii and C. chinensis could be easily identified based on their single stem growth habit. The other characters unique to these wild tree species are the lack of sucker formation, long petiole length on leaves, thick- fleshy Ouicy) husks and epigeal type of seed germination. Although it was possible to get some idea about the relatedness of species based solely on raw data it is very difficult to make inferences due to large intraspecific diversity. Phylogenetic analysis of phenological and morphological characters in Corylus was performed. Twenty seven characters were parsimony informative and one character (leaf base) was not informative. The strict consensus tree is shown (Fig 4.1). Heuristic searching of 27 characters with unweighted parsimony resulted in the 201 best trees, tree length = 62, CI = 0.3881, RI = 0.6339, RC = 0.2460. The strict consensus tree places the 33 taxa in 3 basic groups, the C. avellana group, the C. cornuta group and the C. colurna group. The first two groups consist of shrub species while the last one is of tree species. 105

avellana-l avellam-2 uvclluriu-J

uvclltuiu-X

uvelturiu-ij avellcinu-7 avellana-S wiUiiiuMicri 54 americana-2 1 americum-3

neieropnytta-i heterophylla-2 f f 11 A

i . in* S neitt ujjttyttu-j o

LUIIUUU-l «1 2 50 connuQ-**A 71 iieuuiuia/ia-i 93 70 sieboldiana-3 siebddianaA cmijormca-i

• • LUIUIIIU-l 59 columa-2 H 88 jacquemontii-l u

' dunenensis-1

Figure 4.8. Strict consensus tree of 33 taxa based on botanical characters. Total characters=28, parsimony informative= 27. Heuristic search with unweighted parsimony results in best shortest 201 trees. Tree length = 62, CI = 0.3881, RI = 0.6339, RC = 0.2460. Numbers indicate bootstrap values. Note that tree species and shrub species are grouped together. 106

4.5 DISCUSSION

Hazelnut species have traditionally been classified based on morphology (Bailey, 1914; Drumke, 1964; Everett, 1981; Huxley et al., 1992; Kasapligil, 1963; Krussmann, 1976; Rehder, 1940), histology (Kasapligil, 1964), and cytology (Kasapligil, 1968). Among the morphological characters, the husk or involucre plays an important role. Rehder (1940) recognized 9 species based on husks while Kasapligil (1972) reported as many as 25 species, which he classified into 7 groups, based on their morphology. Recent literature indicate a consensus on recognition of 9 species (Mehlenbacher, 1991; Thompson et al., 1996) but the status of the others is not clear. The ambiguity in classification of Corylus species is still problematic and Furlow (1997) suggested a taxonomic revision of the genus as a whole. Genetic relationships among Corylus species have not been very attractive to taxonomists. This was explained by insufficient variation among wood tissues of the species to be of morphological and statistical importance (Hall, 1952). Despite the abundance of descriptions of Corylus species based on morphology, little is known about their genetic relatedness. C avellana is the most important species in the genus due to its economic significance. This species is very polymorphic based on morphology and isozyme studies (Ahmad et al., 1987; Caliskan and Cetiner, 1997; Cheng, 1992; Lagerstedt 1975; Mehlenbacher, 1991; Rovira 1997). Our results also show this polymorphism and great variability among cultivars for all morphological characters (Table 4.3). We believe that this variability within C. avellana is the reason for its failure to form a single monophyletic group on the tree (Fig 4.1). C. avellana has been divided into subgroups which some authorities accepted as distinct species (C. maxima Mill., C pontica Koch., and C. colchica) closely related to C. avellana (Kasapligil, 1972). However, Mehlenbacher (1991), Thompson et al., (1996) and Rovira (1997) agree that these so-called species show continuous variation in morphology, easily hybridize with each other, and overlap 107

in geographic distribution and they all should be placed in one large species, C. avellana. Our results show that C. avellana, C. americana and C. heterophylla grouped together on the tree (Fig 4.1). This is not surprising because husk morphology and nut characteristics of C. americana and C. heterophylla are most similar to C. avellana among the wild species. However it is interesting that these three species are geographically isolated. Their natural habitat is Europe, North America and East Asia, respectively (Thompson et al., 1996). The possible relatedness of C. americana with C. heterophylla based on husk similarity was noted by Kasapligil (1972). Our data showed that husks of these two species are similar; husks are slit on one or two sides, they are not constricted, and the husk is flared at the tip. The hybridization data (Chapter 2) showed that these 3 species could be easily hybridized with each other, which also suggests a close affinity. Our data and evidence from Chapter 2 suggests that these species exhibit close relationships. In our analysis we found that 3 Asian species C. chinensis, C. heterophylla and C. sieboldiana were separated on the tree (Fig 4.1). These species are very distinct from each other in morphology. C. chinensis forms large trees with a single stem and clusters are fleshy and hold many nuts (about 10). C. heterophylla is probably one of the most variable species in the genus, especially for leaf morphology. Plants are shrubby and produce a lot of suckers. C. sieboldiana plants, however, are intermediate between the other two species. The husks are tubular, the bristles are very loosely attached to the husk and if touched become embedded in skin where they are quite irritating. C. sieboldiana nuts are the most pointed and sharp among the species. Field hybridizations (Chapter 2) showed that these three Asian species are not cross-compatible suggesting distant relationships. However, Malusa (1994) reported based on Restriction Fragment Length Polymorphism (RFLP) data that C. heterophylla and C. chinensis formed a monophyletic group. Our results contradict this finding. We do not know what caused this difference, but use of different genotypes is a possible explanation. 108

The North American species C. cornuta and C. californica, and the Asian species C. sieboldiana clustered together suggesting a close relationship. The characteristic of this group is their tubular and extremely constricted husks with very loosely attached bristles. However, C. cornuta and C. californica nuts mature early (end of July-August) while nuts of C. sieboldiana are one of the latest to mature in the genus (October) in Oregon. Ease of interspecific hybridization (from Chapter 2) also indicates a close relationship among these species. C. californica has been recognized as a distinct species by some authorities (Bailey, 1914; Krussmann 1976; Rehder 1940), but as a subspecies (Furlow, 1997) or a botanical variety of C. cornuta by others (Drumke, 1964; Everett, 1981; Huxley et al., 1992; Sharp, 1951; Thompson et al., 1996). In Fig. 4.1, C. californica is separated from C. cornuta. The ease with which C. cornuta and C. californica can be crossed supports the botanical variety designation (Chapter 2). However, parsimony analysis of morphological and phenological data separated them. It is quite possible that C. californica could be a subspecies as suggested by Furlow (1997) or a distinct species (Bailey, 1914; Krussmann 1976; Rehder 1940). This complex relationship needs further study. The tree species, C. colurna, C. jacquemontii and C. chinensis were clustered together in the tree (Fig 4.1). Their growth habits are similar in that they form large trees with single trunks. They do not produce suckers, except when trunks are damaged. The leaves have long petioles. Their husks are fleshy, and the nuts have large basal scars covering almost half of the shell. An interesting character is the epigeal seed germination that was only seen in these 3 species. All other species are of the hypogeal type. Crossing relationships (from Chapter 2) also confirm the close relationship of C. colurna and C. chinensis. One missing point in our study is that we were not able to include an outgroup. It would have been very helpful. However bootstrap analysis was congruent with the common classification based on morphology and crossing relationships. Perhaps DNA markers would better resolve the relationships in 109

Corylus. Additional specimens of Asian Corylus species should be made available to taxonomists to allow better classification. 110

4.6 REFERENCES

Ahmad, Z., L. S. Daley, R. A. Menendez, and H. L. Lagerstedt. 1987. Characterization of filbert (Corylus) species and cultivars using gradient polyacrylamide gel electrophoresis. J. Environ. Hort. 5: 11-16.

Avis, J. C. 1994. Molecular markers, natural history and evolution. Chapman & Hall, New York.

Ayfer, M., A. Uzun, and F. Bas. 1986. Turkish hazelnut cultivars. Black Sea Hazelnut Exporters Union. Giresun/Ankara.

Bailey, L. H. 1914. The standard cyclopedia of horticulture, Vol.2. McMillan Co. London, University of Tennessee.

Botta, R., E. Emanuel, G. Me, S. Sacerdote, and R. Vallania. 1986. Indagine cariologica in alcune specie del genere Corylus. Riv. Ortoflorofrutt. It. 70: 323-329.

Bousquet, J., S. H. Strauss, and P. Li. 1992. Complete congruence between morphological and rbc-L based molecular phylogenies in birches and related species (Betulaceae). Mol. Biol. Evol. 9: 1076-1088.

Brunner, F. and D. E. Fairbrothers. 1979. Serological investigation of the Corylaceae. Bull. Tony. Bot. Club. 106: 97-103.

Caliskan, T. and E. Cetiner. 1997. Characterization studies on some hazelnut cultivars and types. Acta Hort. 445: 1-19.

Cheng, S. 1992. Isozyme variation and inheritance in hazelnut. Ph.D. Thesis. Oregon State University, Corvallis OR.

Drumke, J. S. 1964. A systematic survey of Corylus in North America . Ph.D. Thesis, University of Tennessee.

Everett, T. H. 1981. The New York Botanical Garden illustrated encyclopedia of horticulture. Vol. 3,. p. 886-888. Garland Publishing, New York.

Felstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791.

Furlow, J. J. 1997. Betulaceae Gray, Birch family, p. 507-538. In: Anonymous (ed.). Flora of North America, north of Mexico. Vol: 3 Magnoliophyta: Magnoliidae and Hamamelidae. Oxford Univ. Press, New York. Ill

Hall, J. W. 1952. The comparative anatomy and phylogeny of the Betulaceae. Bot. Gazette 113: 235-270.

Huxley, A., M. Griffiths, and L. Margot. 1992. The new Royal Horticultural Society dictionary of gardening 1. McMillan Press Ltd., London.

Kasapligil, B. 1963. Corylus colurna and its varieties. Calif. Hort. Soc. J. 24: 95- 104.

Kasapligil, B. 1964. A contribution to the histotaxonomy of Corylus (Betulaceae). Adansonia. Tome IV, Fascicule 1, p. 43-90.

Kasapligil, B. 1968. Chromosome studies in the genus Corylus. Scientific Reports of the Faculty of Science, Ege University No. 59.

Kasapligil, B. 1972. A bibliography on Corylus (Betulaceae) with annotations. Ann. Rep. Northern Nut Growers Assoc. 63: 107-162.

Krussmann, G. 1976. Manual of cultivated broad-leaved trees and shrubs. Timber Press, Portland, OR.

Kubitzki, K. 1993. Betulaceae, p. 152-157. In: K. Kubitzki (ed.). The families and genera of vascular plants. Vol, II. Flowering plants, Dicotyledons. Springer- Verlag, Berlin.

Lagerstedt, H. B. 1975. Filberts, p. 456-489. In: J. Janick and J. N. Moore (eds.). Advances in fruit breeding. Purdue Univ. Press, West Lafayette, IN.

Malusa, E. 1994. Interspecific relations among Corylus species. Acta Hort. 351:335-340.

Mehlenbacher, S. A. 1991. Hazelnuts (Corylus). Genetic resources of temperate fruit and nut crops. Acta Hort. 290: 791-836.

Rehder, A. 1940. Manual of cultivated trees and shrubs hardy in North America, p. 143-146. 2nd edition. New York, Mcmillan Company.

Ridgway, R. 1912. Color standards and color nomenclature. Published by the author. Washington, D.C.

Rovira, M. 1997. Genetic variability among hazelnut (C. avellana L.) cultivars. Acta Hort. 445:45-50. 112

Salesses, G. 1973. Cytological study of genus Corylus. A heterozygotic translocation in some low male fertile varieties of hazelnut (C. avellana). Ann. Amelior. Plantes 23: 59-66.

Saward, L., M. Michaud, and J. Bousquet. 1993. Genetic diversity and phylogenetic relationships between birches and alders using ITS, 18S r RNA, and rbcl gene sequences. Mol. Phyl. Evol. 2: 112-118.

Sharp, A. J. 1951. Relationships between the floras of California and southern United States. Contrib. Dudley Herbarium 4: 59-61.

Swofford, D. L. 1999. PAUP: Phylogenetic analysis using parsimony (* and other methods), version 4.0. Sinauer Associates, Sunderland, MA.

Thompson, MM., P. Romisondo, E. Germain, R. Vidal-Barraquer, and J. Tasias- Valls. 1978. An evaluation systems for filberts. HortScience 13: 514-517.

Thompson, M. M., H. B Lagerstedt, and S. A. Mehlenbacher. 1996. Hazelnuts, p. 125-184. In: J. Janick and N. Moore (eds.) Fruit Breeding - Volume III. Nuts. John Wiley and Sons Inc., New York.

Wetzel, V. G. K. 1929. Chromosomen studien bei den Fagales. Botanisches Rachiv. 25: 257-283.

Woodland, D. W. 1991. Contemporary plant systematics. Prentice Hall, Englewood Cliffs, N.J.

Woodworth, R. H. 1929. Cytological studies in Betulaceae, II: Corylus and Alnus. Bot Gaz. 88: 383-399. 113

CHAPTER 5

MOLECULAR ANALYSIS OF Corylus SPECIES BASED ON NUCLEAR rDNA ITS AND CHLOROPLAST matK GENE SEQUENCES

5.1 ABSTRACT

The phylogenetic relationships of 29 genotypes representing 12 Corylus species were investigated using sequences of the internal transcribed spacer regions (ITS-1, 5.8S and ITS-2) of the nuclear ribosomal DNA and the chloroplast wmrtC gene. Carpinus betulus was used as an outgroup. The ITS region and matK. were 666 and 1231 bp long, respectively. Nuclear and chloroplast genes revealed different branching patterns on the tree. The relatively small variation in the ITS region sequences in Corylus made the sequences easy to align but resulted in less resolved tree topology due to a limited number, only 22, of informative characters. Nevertheless, there were several well-supported clades in Corylus. Three distinct groups were formed: the species C. avellana, C. maxima, C. americana and C. heterophylla formed the first group; the species C. cornuta, C. californica and C sieboldiana formed the second group. Both groups consist of shrub species. The last group included the tree species C. colurna, C. chinensis, C jacquemontii and the paper bark hazel. C. ferox was a sister taxon that appeared in a separate branch of the tree. The strict consensus tree topology was congruent with the results of interspecific hybridization relationships and morphological classification (Chapters 2 and 4, respectively). The matK sequences had extremely low divergence and resulted in ambiguity as the number of informative characters was only 10. Two clusters appeared on the strict consensus tree, one with Asian and European species, and the other with North American species. However, this classification was not in agreement with known taxonomic classification. 114

5.2 INTRODUCTION

Genetic relationships among Corylus species have largely not been explored and the ambiguity in classification of the genus still continues. Furlow (1997) suggested a taxonomic revision of the genus. The reluctance of taxonomists to approach Corylus may have been partly due to variation among wood tissues of the species insufficient to be of morphological and statistical importance (Hall, 1952). Most of the studies that included Corylus have been at the genus or higher level (Bousquet et al., 1992; Brunner and Fairbrothers, 1979; Savard et al., 1993). Corylus belongs to the birch family Betulaceae of the order Fagales (Furlow, 1997; Kubitzki, 1993; Woodland, 1991). The genus is included in one of two clades or subfamilies, Coryloideae (Bousquet et al., 1992; Furlow, 1997; Kubitzki, 1993). Hazelnuts are not native to the Southern Hemisphere and native fossil forms show no evidence of them in the past (Kasapligil, 1972). Corylus species are widely distributed throughout temperate regions of the Northern Hemisphere from Japan, China and Manchuria through Tibet, Caucasia, Turkey, Europe and North America (Ayfer et al., 1986; Kasapligil, 1972). They are deciduous trees and shrubs. All species are monoecious and wind-pollinated (Lagerstedt, 1975). The chromosome number of the genus is 2n = 2x = 22 (Botta et al., 1986; Kasapligil, 1968; Salesses, 1973; Wetzel, 1929; Woodworth, 1929). Classification in the genus has traditionally been based on morphology, especially of the husk or involucre (Bailey, 1914; Drumke, 1964; Everett, 1981; Huxley et al., 1992; Kasapligil, 1963; Krussmann, 1976; Rehder, 1940), histology (Kasapligil, 1964), and cytology (Kasapligil, 1968). The number of Corylus species has varied from ten to 25 depending on the authority (Bailey, 1914; Everett, 1981; Huxley et al., 1992; Kasapligil, 1963, 1972; Krussmann, 1976; Rehder, 1940). Recent literature indicates a consensus on the recognition of five shrub species (C avellana L., C. americana Marshall, C. cornuta Marshall, C. californica Marshall, C. heterophylla Fischer and C. sieboldiana Blume) and four tree species (C. colurna L., C. jacquemontii Decaisne, C. chinensis Franchet and C. ferox Wallich) 115

(Mehlenbacher, 1991; Thompson et al., 1996), but the status of the others needs to be clarified. A variety of morphological, chemical and molecular markers have been used in crop species for determination of genetic variability (Dunemann et al., 1994; Fang et al, 1998; Krahl et al., 1991; Levi and Rowland, 1997; Loukas and Pontikis, 1979; Wang et al., 1992). We reported the results of interspecific hybridization in Chapter 2. Phylogenetic analysis of morphological and phenological characters (Chapter 4) grouped hazelnut species into three main clades. The tree and shrub species were clearly separated. However, the great morphological variation among accessions within species, especially in C. avellana, prevented some genotypes from clustering monophyletic group. In addition, morphological characters can be influenced by environmental factors. Comparative sequencing of chloroplast and nuclear genes of related taxa has recently been routinely applied in plant systematics due to relative ease of generating sequences, especially after improvements in DNA sequencing methods, and due to unambiguity of the data. Use of the nuclear ribosomal DNA internal transcribed spacer (ITS) region, which is composed of ITS-1, 5.8S and ITS-2, has become popular due to relatively high rate of nucleotide substitution. This permits systematic comparisons of relatively recently diverged taxa (Listen et al., 1996). The 5.8S region is highly conserved, but the ITS-1 and ITS-2 regions are generally informative for comparisons of related species and genera (Baldwin et al., 1995). ITS can be readily PCR-amplified and sequenced, however, this locus provides relatively small amounts of sequence data in angiosperms. Recent studies have widely employed chloroplast rbch gene sequences in plant systematics especially for higher level taxa (family or above), comparisons (Ooi et al., 1995; Soltis and Soltis, 1995). However, the rbch gene is conservative and the resolution power of the rbch data is low especially when closely related species are compared. The mutation rate of the maturase-encoded chloroplast gene matK. is reportedly two to three times higher than the that of rbch (Oio et al., 1995). 116

The matK gene is approximately 1500 bp long (Liang and Hilu, 1996). matK sequences of only 750 bp provided resolution of relationships in Saxifragaceae sensu stricto (Johnson and Soltis, 1994). The objective of this study was to analyze the genetic relationships among Corylus species based on sequences of the nuclear ribosomal DNA internal transcribed spacer (ITS) region and the chloroplast encoded matK gene.

5.3 MATERIALS AND METHODS

5.3.1 Plant material A total of 29 authentic (true-to-name) genotypes representing 12 Corylus species located at the Smith Research Farm of Oregon State University and at the National Clonal Germplasm Repository of USDA in Corvallis, OR were used (Table 5.1). The genotypes were seedlings or clonally propagated trees selected to represent the diversity and geographic range of the species.

5.3.2 Genomic DNA extraction A modification of the DNA extraction method of Davis et al. (1998) was followed. One or two very young expanding leaves (~2 cm in size) and the apical meristem were collected in mid-April and brought to the lab on ice. A leaf juice press (MEKU, Wennigsen, Germany) was use to grind leaf samples with an extraction buffer consisting of 0.35 M sucrose, 100 mM Tris, 50 mM potassium chloride, 25 mM EDTA and 5% PVP (F.W. 40,000). Approximately 500 ^il grindate was collected in a 1.7 ml centrifuge tube on ice and centrifuged for 5 min at 13,000 rpm. The supernatant was discarded and the pellet was resuspended in 640 jal lysing buffer [78.3 mM EDTA pH: 8.0, 39.16 mM Tris-HCl at pH 8.0, 2.12% n- lauroylsarcosine, 2.65%Triton X-100, and \0J\igl\i\ Proteinase-K which was 117

Table 5.1 Cultivated and wild Corylus accessions used in DNA studies.

Species Code Genotype Origin C. avellana avellana-1 Casina Spain avellana-2 Barcelona Spain avellana-3 Tombul Ghiaghli Turkey

C. maxima maxima-1 San Benedetto Italy maxima-2 Pellicle Rouge France

C. americana americana-1 Seedling #366.065 (COR 059) MI, USA americana-2 Seedling #531.001 (seed lot 88315) MI, USA americana-3 Seedling #366.088 (COR 180) IW, USA

C. heterophylla heterophylla-1 var. sutchuensis (#566.044) China heterophylla-2 Seedling #404.042 (seed lot 86026) China heterophylla-3 var. yunannensis (2.001) China

C. cornuta cornuta-1 Seedling #373.020 WI,USA comuta-2 Seedling #CC2.047 (seed lot 87164) Canada comuta-3 Seedling #CC3.006 (seed lot 89404) NY, USA

C. californica californica-1 Grafted tree #Y 18 (B0070) OR, USA califomica-2 Grafted tree #Y30 (B0437) OR, USA califomica-3 Grafted tree #X34 (B0089) OR, USA

C. sieboldiana sieboldiana-1 Seedling #CC 1.021 (seed lot 86028) Korea sieboldiana-2 Seedling #CC2.075 (seed lot 87801) Korea sieboldiana-3 var. brevirostris Korea

C. colurna. columa-1 Seedling tree #X 11 Europe columa-2 Seedling tree #X 13 Europe

C. chinensis chinensis-1 Seedling tree (91502) China chinensis-2 Seedling #529.039 China chinensis-3 Seedling (89701) China chinensis-5 Seedling #W5 China

C. jacquemontii. jacquemontii-1 Seedling #397.036 (seed lot 88502) Pakistan

C. ferox ferox-1 var. thibetica Batal. Pakistan

Paperbark hazel paperbark-1 Seedling #640.091 China

Carpinus betulus outgroup-1 Fastigiata Europe 118

added just before the use (Fisher Scientific)]. Samples were incubated for Ih at 370C in a shaker at -200 rpm. After centrifugation for 5 min, 500 ^il of supernatant was transferred to a new tube. An equal volume of cold isopropanol was added, mixed, then tubes were stored in the freezer at -20oC for at least 30 min. Tubes were centrifuged for 5 min, the supernatant was discarded, and the remaining liquid was aspirated. The pellet was resuspended in 220 ^1 of IX TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) overnight at 40C. Samples were extracted with phenol: chloroform: isoamyl alcohol (25:24:1) by vortexing 10 sec and then centrifuging for 10 min. 150 ^1 of the aqueous phase was transferred to a new tube and precipitated with two volumes of 95% EtOH: 3 M sodium acetate, pH 5.5, at -20oC for at least for 30 min. The tubes were centrifuged, the supernatant was poured off, and the pellet was washed with 70% EtOH. The tubes were centrifuged for 5 min, and the supernatant was discarded. The pellet was air-dried for 2h and resuspended in 100 ^1 IX TE buffer. DNA samples of some genotypes were viscous in appearance due to a high content of polysaccharides. This hindered accurate pipetting and also interfered with the polymerase chain reaction (PCR) amplifications (data not shown). These samples were salt precipitated before phenol: chloroform: isoamyl alcohol extraction by suspending the DNA in 220 \il IX TE and an equal amount of 5M sodium chloride. 440 ^1 of 95% EtOH was added, mixed and kept at -20oC for at least 30 min. The tubes were then centrifuged for 10 min, the pellet was washed with 70% EtOH once, and centrifuged for 5 min. The supernatant was decanted and the pellet was air-dried. Extracted DNA was quantified using fluorometer (Hoefer, DyNA Quant 2000) and diluted to 25ng/^ with IX TE.

5.3.3 Polymerase Chain Reaction (PCR) amplifications Amplicons (PCR-derived gene segments) of the Internal Transcribed Spacer (ITS) region including the ITS-1, 5.8S, and ITS-2 regions of the nuclear ribosomal DNA (rDNA) 119

and full-length amplicons of the chloroplast gene mat)L (Fig. 5.1) were produced by PCR. The forward primer ITS-5 (Liston et al., 1996), and the reverse primer 26S-25R (Nickrent et al., 1994) were used to amplify the rDNA amplicon. Two external primers, MatK-AF (forward) and MatK-8R (reverse) (Ooi et al., 1995) and two internal primers MatK-1412F (forward) and MatK-1470R (reverse) (Johnson and Soltis, 1995) were used to amplify the plastid gene (Table 5.2). The same primers were used in subsequent sequencing reactions. All of the primers were synthesized at the Central Services Laboratory of Oregon State University, Corvallis, OR. The PCR reaction mixture (100 ^1) contained 9.75 |j.l 10X reaction buffer (Promega, Madison, WI), 5.85 ^il 25mM MgCh (Promega), 5.85 ^1 dNTP mix (dATP, dTTP, dCTP, and dGTP, 2mM each, Promega), 0.78 jal each (50 pmole) primer, 69.89^1 ddtfeO, 3 units Taq DNA polymerase (Promega), and 4|xl genomic DNA. Reaction mixtures were covered with 2-3 drops of mineral oil (Sigma, St. Louis, MO) and placed in a Thermal cycler (Perkin Elmer, DNA Thermal Cycler) programmed for 35 cycles of: 940C for 1 min, 550C for 1 min, and 720C for 3 min with an additional 7 min extension step at 720C. For maiK. gene amplifications, the PCR program was modified by lowering the annealing temperature to 520C and extending the time for 2 min, and the final extension time was increased from 7 min to 15 min. Reactions were held at 50C on the thermocycler block until removed. PCR products were precipitated and washed as in the last step of DNA extraction. The pellet was air dried and resuspended in TE. Amplicons were separated by electrophoresis on 2% low melting agarose gel at 70V for 4h (Fig 5.2), stained with ethidium bromide, and visualized by UV light. Electrophoresis buffer (Tris: Borate: EDTA containing 1 mM Guanosine) was used to prevent DNA shearing by UV light, and DNA bands were excised as quickly as possible to minimize exposure to UV light. Satisfactory amplicons were purified with Qiaquick gel extraction kits according to the manufacturer's protocol (Qiagen, Valencia, CA). Purified amplicons were processed by ITS-5 Small subunit rDNA gene Large subunit rDNA gene

matK-AF matK-8R rsp\6 trnKS' trnKl'

Fig 5.1 Structure and relative position of the (A) Internal Transcribed Spacer (ITS) region of nuclear ribosomal DNA, and (B) Chloroplast matK gene, including relative positions of the PCR and sequencing primers used in the present study. Primers with the suffix '-F' and ITS-5 are forward primers, those with the suffix '-R' are reverse primers. oto 121

Table 5.2 Primer sequences used for PCR amplifications and sequencing. Arrows designate the direction of the primer.

Name Direction Sequence 5' - 3'

ITS-5 «^> GGAAGGAGAAGTCGTAACAAGG 26S-25R o TATGCTTAAACTCAGCGGGT

PLASTID MatK-AF CTATATCCACTTATCTTTCAGGAGT ^> MatK-8R o AAAGTTCTAGCACAAGAAAGTCGA MatK-1412F ATATAATTCTTATGTATGTG i^> MatK-1470R AAGATGTTGATTGTAAATGA <=■

cycle sequencing and dye terminator chemistry on an ABI model 377 automated fluorescent sequencer at the Oregon State University Central Services Laboratory. Sequence files were manipulated using GCG9 (Genetic Computer Group, 1996). An initial automated alignment was performed with the PILEUP program in GCG9 (Gap creation penalty = 5; gap extension penalty = 1 for ITS sequences, and 12 and 4 for matK sequences, respectively). These alignments were imported into the Genetic Data Environment (GDE) (Smith et al., 1994) for manual adjustment and for Nexus file formation. Maximum parsimony analyses of the nuclear rDNA ITS region and the chloroplast matK gene were performed using PAUP* 4.0d65 (Swofford, 1999) on a Macintosh PowerPC 7600. One hundred replicates of the following heuristic search options were performed: maximum parsimony, random sequence addition and tree bisection-reconnection branch swapping. Bootstrap support (Felstein, 1985) was determined using the above settings except that 122

—> 700 bp A secondary band

B

1018 bp Secondary bands

1600 bp

Figure 5.2. Electrophoretic separation of PCR amplified nuclear rDNA ITS and chloroplast matK gene bands. (A) Nuclear rDNA ITS band. L= 100 bp ladder, 1- 4= C. chinensis, 5, 7= C. columa. (B) Chloroplast matK gene band. L= 1Kb ladder, 1= C. americana, 2= paperbark hazelnut, 3= C. sieboldiana, 4= C. californica, 5= C. cornuta, 6= C. chinensis, 1, 8= C. columa, 9= C maxima, 10= C. avellana. Note that there were secondary bands in both of nuclear and chloroplast gene amplifications, but they did not pose a problem. 123

Mulpars was inactivated and 500 replications were performed. Combinability of both data sets was determined using the partition homogeniety test (Farris et al., 1994; Mickvich and Farris, 1981; Swofford, 1999) and topological constraint analyses via the maximum likelihood ratio test (Kishino and Hasegawa, 1989).

5.4 RESULTS

The modified method of Davis et al. (1998) yielded clean and repeatably amplifiable DNA. The amount of DNA extracted varied greatly from accession to accession. RNAse treatment of the DNA was not necessary, but inclusion of Proteinase-K in the extraction protocol significantly improved PCR amplifications. High salt precipitations were used as needed and were effective in removing polysaccharides. The primers ITS-5 and 26S-25R amplified a 666 bp long ITS fragment. These primers also amplified a secondary fragment (approximately 550bp long) in some genotypes. The ITS fragment was easily separated from the secondary band on the agarose gel but four hours were required. Sequencing some segments of the ITS-DNA was complicated, possibly due to G+C richness in some segments or formation of secondary structures due to intrastrand complementarity under some reaction conditions (Baldwin et al., 1995). High temperature (>940C) denaturations in PCR and addition of DMSO (5-10%) to the reaction mixture was helpful. Occasionally a secondary band was also observed in chloroplast DNA amplifications but they were easily separated from the 1231 bp matK. fragment. Sequences of matK in general were cleaner and easier to read than those of ITS DNA. Phylogenetic analyses of nuclear and chloroplast DNA sequences of Corylus species were performed and a strict consensus tree of 30 genotypes constructed based on the nuclear rDNA ITS region sequence (Fig. 5.3). 124

avellana-l avellana-2 85 avellana-3 maxima-l maxima-2 a.

54 americana-l americana-2 americana-3 95 heterophylla-l heterophylla-2 heterophylla-3 cornuta-l corimta-2 cornuta-3 a. 66 californica-l 3 californica-2 2 californica-3 a 58 3 sieboldiana-l sieboldiana-2 sieboldiana-3 100 colurna-l colurna-2 85 93 chinensis-\ chinensis-2 Q. chinensis-3 3 2 chinensis-4 n) paperbark-l jacquemontii-l ferox-l Carpinus betulus

Fig. 5.3 Strict consensus tree of 30 genotypes based on nuclear rDNA ITS region sequences. Total characters = 674, parsimony informative = 22. Heuristic search with unweighted parsimony results in best shortest 63 trees. Tree length = 63, CI = 0.9206, RI = 0.9390, RC = 0.8645. Numbers indicate bootstrap values. 125

The ITS region was 666 bp long in Corylus, however, only 22 characters were parsimony informative. The heuristic search with unweighted parsimony resulted in the 63 shortest trees. Tree length = 63, CI = 0.9206, RI = 0.9390, RC = 0.8645. The strict consensus tree placed the 29 Corylus genotypes in 3 clusters; the first group included the shrub species C. avellana, C maxima, C. americana, C heterophylla, and the second group included C. cornuta, C. californica and C sieboldiana. The last group consisted of the tree species C. colurna, C. chinensis, C. jacquemontii and the paper bark hazel. C. ferox was separated from these groups. The chloroplast-encoded MatK gene was 123 Ibp long. A strict consensus tree of 30 genotypes based on MatK DNA sequences is shown in Fig. 5.4. Only 10 characters were parsimony informative. A heuristic search with unweighted parsimony resulted in 24 shortest tree. Tree length = 24, CI = 1.000, RI = 1.000, RC = 1.000. Unlike ITS, matK placed 29 Corylus taxa in two clusters. The first cluster included Asian and European species; shrub and tree species were not separated within this group. The second cluster included the North American species in one clade. Phylogenetic analysis of combined nuclear rDNA ITS region and chloroplast matK gene sequences was performed. However, tree topology from combined data analysis was not in agreement with ITS phylogeny and morphological tree topology (Chapter 4). We performed combinability analysis for nuclear and plastid DNA sequences. Partition homoegeniety test showed that these two sequences can not be combinable indicated by very significant p value (0.001). In addition, topological constraint analysis via maximum likelihood ratio test (either matK sequences were forced into ITS sequences or vice versa) provided another line of evidence that ITS and matK sequences cannot be combined (p value = 0.0005). 126

avellana-\ avellana-2 avellana-3 67 maxima-1 maxima-2 paperbark-l ferox-\ sieboldiana-l 71 sieboldiana-2 sieboldiana-3 65 heterophylla-l heterophylla-2 heterophylla-3 69 colurna-l colurna-2 91 chinensis-l chinensis-2 chinensis-3 chinensis-4 jacquemontii-l cornuta-1 cornuta-2 cornuta-3 64 californica-3 americana-l 86 amencana-2 americana-3 II 65 californica-X californica-2 Carpinus betulus

Fig. 5.4 Strict consensus tree of 30 genotypes based on matK. DNA sequences. Total characters =1231, parsimony informative = 10. Heuristic search with unweighted parsimony results in best shortest 24 trees. Tree length = 24, CI = 1.000, RI = 1.000, RC = 1.000. Numbers indicate bootstrap values. Note that Asian and European species (I) and North American species (II) grouped separately. 127

5.5 DISCUSSION

We compared the sequences from the nuclear ribosomal internal transcribed spacer (ITS) region and the chloroplast matK gene. The entire ITS region of rDNA appears to be universally under 700 bp long in angiosperms (Baldwin et al., 1995) and the 666 bp sequence we found for hazelnuts is consistent with previous result. However the same region was found to be as large as 3000 bp as in genus Pinus, (Quijada et al., 1998). The ribosomal DNA ITS region shows more divergence than the chloroplast gene rbcl which has been widely used in phylogenetic analysis (Baldwin et al., 1995). However we found relatively small variation in the Corylus ITS region. Only 22 characters were informative compared to 118 in grass species (Hsiao, et al., 1993). This made the sequences easy to align but resulted in a less resolved tree topology. Extremely low variation in the ITS was also observed in Fucus (Phaeophyceae) (Leclerc et al., 1998). Nevertheless our strict consensus tree generated some well-supported clades in Corylus. The chloroplast gene matK. is approximately 1550 bp in length and shows more divergence than the chloroplast gene rbcL (Johnston and Soltis, 1995). Liang and Hilu (1996) sequenced only 583 bp of the matK gene in grasses of which 30% were variable and 14.9% were informative. However, we sequenced the full length of the matK gene in Corylus species, which was 1231 bp long. Interestingly, there was extremely low variation in the matK gene sequence. Out of 24 variable nucleotides, only 10 were informative. Our phylogenetic analysis of combined nuclear and plastid gene sequences was not in agreement with interspecific hybridization (Chapter 2) or morphology (Chapter 4) or ITS tree topology (Fig 5.3). Then the question was if we could combine these two sequences in phylogenetic analysis? In fact, the evidence from both partition homogeniety test and topological constraint analysis indicated that these nuclear and plastid gene sequences cannot be combined into a single analysis. 128

The strict consensus tree based on the rDNA ITS region (Fig 5.3) showed three distinct groups: C. avellana, C. maxima, C. americana and C. heterophylla formed the first group; C. cornuta, C. californica and C. sieboldiana formed the second group, and the tree species C. colurna, C. chinensis, C. jacquemontii and the paperbark hazel form the third group. C. ferox was separated from all groups as a single genotype. Strict consensus tree topology was congruent with interspecific hybridization relationships and morphological classification (Chapters 2 and 4, respectively). Two clusters appeared on the strict consensus tree from the /mtfK gene sequences (Fig 5.4), one with Asian and European species, and the other with North American species. However, this classification is not in agreement with interspecific hybridization (Chapter 2) or morphology (Chapter 4) or ITS tree topology (Fig 5.3). A similar discrepancy was reported between nuclear and chloroplast gene trees in Triticeae (Kellogg et al., 1996) and in the Boykinia group (Saxifragaceae) (Soltis et al., 1996). The phylogenetic trees produced based on sequences of different genes, one nuclear and the other chloroplast, could be samples of the same phylogeny but characters indicating a relationship ('signal') might be few and are obscured by other random changes ('noise' or homoplasy) (Kellogg et al., 1996). When closely related species are examined, discordance between nuclear and plastid genes may arise and this phenomenon could be explained by either lineage sorting or chloroplast capture (Dowling et al., 1990; Soltis et al., 1996). Lineage sorting assumes that there was notable ancestral polymorphism that was rapidly fixed, so little remains detectable today. Disagreement also could be the result of ancient hybridization and chloroplast capture between species resulting in chloroplast based topologies that do not accurately reflect organismal relationships (Soltis et al., 1996). The lack or limited variation within the sequences of both nuclear and chloroplast genes in our study suggests recent diversification of the genus Corylus, however, they tell different stories about the relationships among hazelnut species. 129

Nonetheless, the following discussion is largely based on the nuclear ribosomal ITS region sequence data since it is congruent with known genetic relationships among Corylus species. C. avellana is the most important species in the genus due to its economical significance. This species is very polymorphic based on morphology and isozyme studies (Ahmad et al., 1987; Caliskan and Cetiner, 1997; Cheng, 1992; Lagerstedt 1975; Mehlenbacher, 1991; Rovira 1997). In fact this variability prevented C. avellana genotypes from clustering a monophyletic group in a parsimony analysis based on morphological and phenological characters (Chapter 4). On the other hand, in this study all C. avellana genotypes were distinctly separated from other species in both nuclear ribosomal ITS region and chloroplast matK gene sequences. C. avellana has been divided into subgroups which some authorities accept as distinct species (C. maxima Mill., C. pontica Koch., and C. colchica Alb.) closely related to C. avellana (Kasapligil, 1972). For example 'Tombul Ghiaghli' could be considered a representative of C. pontica, and 'San Benedetto' and 'Pellicle Rouge' could be considered C. maxima in our study. Phylogenetic analysis of both nuclear ribosomal ITS region and matK. sequences showed that genotypes of the C. maxima and 'C. pontica' always clustered with those of C. avellana (Fig. 5.3 and 5.4). This finding is consistent with the hypothesis that C. maxima, C. avellana, and C. pontica show continuous variation in morphology, easily hybridize with each other, and overlap in geographic distribution and they should be considered a single large species, C. avellana (Mehlenbacher, 1991; Rovira, 1997; Thompson et al., 1996). This situation is likely the same for C. colchica although no genotypes of this species were available for this study. C. avellana, C. americana and C. heterophylla grouped together on the strict consensus tree of the rDNA ITS region sequences (Fig 5.3). This was expected because husk morphology and nut characteristics of C. americana and C. heterophylla are most similar to C. avellana among the wild species. They also grouped together on the strict consensus tree produced by morphological and phenological characters (Chapter 4) although these three species are geographically 130

isolated. Their natural habitats are North America, East Asia, and Europe, respectively (Thompson et al., 1996). The possible relatedness of C. americana with C. heterophylla based on husk similarity was suggested by Kasapligil (1972). The hybridization data (Chapter 2) showed that these two species and C. avellana could be easily hybridized with each other, which also suggests a close affinity. Data from interspecific hybridizations, morphology and nuclear and plastid gene sequences suggests that these species exhibit close relationships. We found that the three Asian species C. chinensis, C. heterophylla, and C. sieboldiana were separated into distinct clades based on nuclear DNA sequences (Fig 5.3). These species are very distinct from each other in morphology and phylogenetic analysis separated them into distinct clades (Chapter 4). C. chinensis forms a large tree with a single stem but no sucker formation. C. heterophylla is probably one of the most variable species in the genus, especially for leaf morphology. Plants are shrubby and produce many suckers. C. sieboldiana plants, however, are intermediate between the other two species in that they form tall shrubs. The husks are tubular, the bristles are very loosely attached to the husk and if touched become embedded in the skin where they are quite irritating. C. sieboldiana nuts are the most pointed and sharp among the species. Although all Asian species were grouped together based on the matK gene sequences, we believe that this grouping is not compatible with the other evidence. Field hybridizations (Chapter 2) showed that these three species are cross-incompatible as well as morphologically distinct (Chapter 4), suggesting a distant relationship. However, Malusa (1994) reported based on Restriction Fragment Length Polymorphism (RFLP) data that C. heterophylla and C. chinensis formed a monophyletic group. We do not know what caused this difference, but use of different or mislabeled genotypes which is common in Corylus germplasms are possible explanations. All of the tree species C. chinensis, C. jacquemontii, and C. colurna formed a distinct clade on the strict consensus tree based on ITS sequences (Fig 5.3). This was congruent with morphological and phenological data (Chapter 4). C. chinensis 131

and C. colurna also hybridize freely (Chapter 2). C. colurna and C. jacquemontii are very similar in husk morphology and clustered together based on morphology (Chapter 4), but C. chinensis and C. colurna were more closely related based on ITS sequences. The paperbark hazel is distinct from the other tree species in that its bark peels off like a paper birch (Betula papyriferd). We have a single specimen of this species (from Cecil Farris, Lansing, MI) but we have not been able to see its husks and nuts. It is largely unknown in the western world. Except a citation listed in Kasapligil's (1972) bibliography, this species has not been included in taxonomic literature regarding Corylus. C.ferox was represented by its botanical variety thibetica in our study. It is very distinct from other Corylus species and in its ITS sequences separated it from the other taxa (Fig 5.3). The interesting character of this species is its bur-like spiny husks which resembles those of chestnut. Our specimen of this species gave only one cluster after grafting on a rootstock but there was very little growth in subsequent years and no nut production. Our very limited observations on its husk and nuts suggest that the nuts are similar in shape (compressed) and color to those of C. colurna and C. jacquemontii. The North American species C. cornuta and C. californica, and the Asian species C. sieboldiana clustered together based on nuclear DNA sequences. A characteristic of this group is their tubular and extremely constricted husks with very loosely attached bristles. Ease of interspecific hybridization among these species (Chapter 2) and morphological similarities (Chapter 4) along with this molecular level data indicates a close relationship among these species. C californica has been recognized as a distinct species by some authorities (Bailey, 1914; Krussmann 1976; Rehder 1940), but as a subspecies (Furlow, 1997) or a botanical variety of C. cornuta by others (Drumke, 1964; Everett, 1981; Huxley et al., 1992; Sharp, 1951; Thompson et al., 1996). The ease with which C. cornuta and C. californica can be crossed supports the botanical variety designation (Chapter 2). However, parsimony analysis of morphological and phenological data suggested that C. californica could be a subspecies as suggested by Furlow (1997) 132

or a distinct species. (Bailey, 1914; Krussmann 1976; Rehder 1940). Our DNA sequence data of the nuclear ribosomal ITS region suggests refusal of botanical variety consideration. In general, interspecific hybridization, morphological and phenological similarities and nuclear ribosomal DNA-ITS region sequence data were congruent. Tree species were clearly separated from shrub species. However within each clade some unresolved groups remained. Perhaps a different type of molecular data or comparison of sequences at more divergent genes would be helpful in exploring these unresolved groups. 133

5.6 REFERENCES

Ahmad, Z., L. S. Daley, R. A. Menendez, and H. L. Lagerstedt. 1987. Characterization of filbert (Corylus) species and cultivars using gradient polyacrylamide gel electrophoresis. J. Environ. Hort. 5:11-16.

Ayfer, M., A. Uzun, and F. Bas. 1986. Turkish hazelnut cultivars. Black Sea Hazelnut Exporters Union. Giresun/Ankara.

Bailey, L. H. 1914. The standard cyclopedia of horticulture, Vol.2. McMillan Co. London, University of Tennessee.

Baldwin, B. G., M. J. Sanderson, J. M. Porter, M. F. Wojciechowski, C. S. Campbell, and M. J. Donoghue. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann. Missouri Bot. Gard. 82: 247-277.

Botta, R., E. Emanuel, G. Me, S. Sacerdote, and R. Vallania. 1986. Indagine cariologica in alcune specie del genere Corylus. Riv. Ortoflorofrutt. It. 70: 323-329.

Bousquet, J., S. H. Strauss, and P. Li. 1992. Complete congruence between morphological and rbc-L based molecular phylogenies in birches and related species (Betulaceae). Mol. Biol. Evol. 9: 1076-1088.

Brunner, F. and D. E. Fairbrothers. 1979. Serological investigation of the Corylaceae. Bull. Torry. Bot. Club. 106: 97-103.

Caliskan, T. and E. Cetiner. 1997. Characterization studies on some hazelnut cultivars and types. Acta Hort. 445: 1-19.

Cheng, S. 1992. Isozyme variation and inheritance in hazelnut. Ph.D. Thesis. Oregon State University, Corvallis OR.

Davis, J., D. Henderson, M. Kobayashi, M. T. Clegg, and M. T. Clegg. 1998. Genealogical relationships among cultivated avocados as revealed through RFLP analyses. J. Heredity 89: 319-323.

Dowling, T. E., C. Moritz, and J. D. Palmer. 1990. Nucleic acids II: restriction site analysis, p. 250-317. In: D. M. Hillis and C. Moritz (eds.). Molecular systematics. Sinauer Associats, Inc. Sunderland, MA. 134

Drumke, J. S. 1964. A systematic survey ofCorylus in North America. Ph.D. Thesis, University of Tennessee.

Dunemann, F., R. Kahnau, and H. Schmidt. 1994. Genetic relationships in Malus evaluated by RAPD 'fingerprinting' of cultivars and wild species. Plant. Breed. 113: 150-159.

Everett, T. H. 1981. The New York Botanical Garden illustrated encyclopedia of horticulture. Vol. 3, p. 886-888. Garland Publishing, New York.

Fang, D., R. R. Krueger, and M. L. Roose. 1998. Phylogenetic relationships among selected Citrus germplasm accessions revealed by inter-simple sequence repeat (ISSR) markers. J. Amer. Soc. Hort. Sci. 123: 612-617.

Farrris, J. S., M. Kallersjo, A. G. Kluge, and C. Bult. 1994. Testing significance of incongruence. Cladistics 10: 315-319.

Felstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791.

Furlow, J. J. 1997. Betulaceae Gray, Birch family, p. 507-538. In: Anonymous (ed.). Flora of North America, north of Mexico. Vol: 3 Magnoliophyta: Magnoliidae and Hamamelidae. Oxford Univ. Press, New York.

Genetics Computer Group. 1996. Program manual for the Wisconsin Package, Version 9, Madison, WI.

Hall, J. W. 1952. The comparative anatomy and phylogeny of the Betulaceae. Bot. Gazette 113: 235-270.

Hsiao, C, N. J. Chatterkon, K. H. Asay, and K. B. Jensen. 1993. Phylogenetic relationships of 10 grass species: an assessment of phylogenetic utility of the internal transcribed spacer region in nuclear ribosomal DNA in monocots. Genome 37: 112-120.

Huxley, A., M. Griffiths, and L. Margot. 1992. The new Royal Horticultural Society dictionary of gardening 1. McMillan Press Ltd., London.

Johnson, L. A. and D. E. Soltis. 1994. matK DNA sequences and phylogenetic reconstruction in Saxifragaceae s. s. Syst. Bot. 19: 143-156.

Johnson, L. A. and D. E. Soltis. 1995. Phylogenetic inference in Saxifragaceae sensu stricto and Gillia (Polemoniaceae) using matK sequences. Arm. Missouri Bot. Gard. 82: 149-175. 135

Kasapligil, B. 1963. Corylus colurna and its varieties. Calif. Hort. Soc. J. 24: 95- 104.

Kasapligil, B. 1964. A contribution to the histotaxonomy of Corylus (Betulaceae). Adansonia. Tome IV, Fascicule 1, p. 43-90.

Kasapligil, B. 1968. Chromosome studies in the genus Corylus. Scientific Reports of the Faculty of Science, Ege University No. 59.

Kasapligil, B. 1972. A bibliography on Corylus (Betulaceae) with annotations. Ann. Rep. Northern Nut Growers Assoc. 63: 107-162.

Kellogg, E. A., R. Appels, and R. J. Mason-Gamer. 1996. When genes tell different stories: the diploid genera of Triticeae (Gramineae). Syst. Bot. 21: 321-347.

Kishino, H. and M. Hasegawa. 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominiodea. J. Mol. Evol. 29: 170-179.

Krahl, K. H., A. Lansari, and A. F. Lezzoni. 1991. Morphological variation within a sour cherry collection. Euphytica 52: 47-55.

Krussmann, G. 1976. Manual of cultivated broad-leaved trees and shrubs. Timber Press, Portland, OR.

Kubitzki, K. 1993. Betulaceae, p. 152-157. In: K. Kubitzki (ed.). The families and genera of vascular plants. Vol, II. Flowering plants, Dicotyledons. Springer- Verlag, Berlin.

Lagerstedt, H. B. 1975. Filberts, p. 456-489. In: J. Janick and J. N. Moore (eds.). Advances in fruit breeding. Purdue Univ. Press, West Lafayette, IN.

Leclerc, M. C, V. Barriel, G. Lecointre, and B. de Reviers. 1998. Low divergence in rDNA ITS sequences among five species of Fucus (Phaeophyceae) suggests a very recent radiation. J. Mol. Evol. 46: 115-120.

Levi, A. and K. J. Rowland. 1997. Identifying blueberry cultivars and evaluating their genetic relationships using randomly amplified polymorphic DNA (RAPD) and simple sequence repeat (SSR) anchored primers. J. Amer. Soc. Hort. Sci. 122: 74-78.

Liang, H. and K. W. Hilu. 1996. Aplication of the matK. gene sequences to grass systematics. Can. J. Bot. 74: 125-134. 136

Listen, A., W. A. Robinson, J. M. Oliphant, and E. R. Alvarez-Buylla. 1996. Length variation in the nuclear ribosomal DNA internal transcribed spacer region of non-flowering seed plants. Syst. Bot. 21: 109-120.

Loukas, M. and C. A. Pontikis. 1979. Pollen isozyme polymorphisim in types of Pistacia vera and related species as an aid in taxonomy. J. Hort. Sci. 54: 95- 102.

Malusa, E. 1994. Interspecific relations among Corylus species. Acta Hort. 351:335-340.

Mehlenbacher, S. A. 1991. Hazelnuts (Corylus). Genetic resources of temperate fruit and nut crops. Acta Hort. 290: 791-836.

Mickevich, M. F. and J. S. Farris. 1981. The implications of congruence in Menidia. Syst. Zool. 30: 351-370.

Nickrent, D. L., K. P. Schuette, and E. M. Starr. 1994. A molecular phylogeny of Arceuthbium (Viscaceae) based on nuclear ribosomal DNA internal transcribed spacer sequences. Amer. J. Bot. 81:1149-1160.

Ooi, K., Y. Endo, J. Yokoyama, and N. Murakami. 1995. Useful primer designs to amplify DNA fragments of the plastid gene matK. from angiosperm plants. J. Japanese Bot. 70: 328-331.

Quijada, A., A. Liston, P. Delgado, A. Vasquez-Lobo and, E. R. Alvarez-Buylla. 1998. Variation in the nuclear ribosomal DNA internal transcribed spacer (ITS) region of Pinus rzedowskii revealed by PCR-RFLP. Theor. Appl. Genet. 96: 539-544.

Rehder, A. 1940. Manual of cultivated trees and shrubs hardy in North America, p. 143-146. 2nd edition. McMillan Company, New York.

Rovira, M. 1997. Genetic variability among hazelnut (C. avellana L.) cultivars. Acta Hort. 445: 45-50.

Salesses, G. 1973. Cytological study of genus Corylus. A heterozygotic translocation in some low male fertile varieties of hazelnut (C avellana). Ann. Amelior. Plantes 23: 59-66.

Saward, L., M. Michaud, and J. Bousquet. 1993. Genetic diversity and phylogenetic relationships between birches and alders using ITS, 18S rRNA, and rbel gene sequences. Mol. Phyl. Evol. 2: 112-118. 137

Sharp, A. J. 1951. Relationships between the floras of California and southern United States. Contrib. Dudley Herbarium 4:59-61.

Smith, S. W., R. Overbeek, C. R. Woese, W. Gilbert, and P. M. Gillevet. 1994. The genetic data environment: an expandable GUI for multiple sequence analysis. Cabios 10: 670-671.

Soltis, P. S. and D. E. Soltis. 1995. Alternative genes for phylogenetic reconstruction in plants: introduction. Ann. Miss. Bot. Gard. 82: 147-148.

Soltis, D. E., L. A. Johnson, and C. Looney. 1996. Discordance between ITS and chloroplast topologies in the Boykinia group (Saxifragaceae). Syst. Bot. 21: 169-185.

Swofford, D. L. 1999. PAUP: Phylogenetic analysis using parsimony (* and other methods), version 4.0. Sinauer Associates, Sunderland, MA.

Thompson, M. M., H. B Lagerstedt, and S. A. Mehlenbacher. 1996. Hazelnuts, p. 125-184. In: J. Janick and N. Moore (eds.) Fruit Breeding - Volume III. Nuts. John Wiley and Sons Inc., New York.

Wang, Z. Y., G. Second, and S. D. Tanksley. 1992. Polymorphism and phylogenetic relationships among species in the genus Oryza as determined by analysis of nuclear RFLPs. Theor. Appl. Genet. 83:565-581.

Wetzel, V. G. K. 1929. Chromosomen studien bei den Fagales. Botanisches Rachiv. 25: 257-283.

Woodland, D. W. 1991. Contemporary plant systematics. Prentice Hall, Englewood Cliffs, N.J.

Woodworth, R. H. 1929. Cytological studies in Betulaceae, II: Corylus andAlnus. Bot Gaz. 88: 383-399. 138

CHAPTER 6

CONCLUSIONS

True-to-name representatives of all hazelnut species at Oregon State University and at the U.S. Department of Agriculture National Clonal Germplasm Repository in Corvallis, Oregon had reached maturity and were available for use in this study of genetic relationships among Corylus species. Interspecific hybridization, pollen-stigma incompatibility, morphological and phenological characterization, and DNA sequence analysis were studied. Cluster set in interspecific crosses ranged from 0% to 77.8%. Reciprocal differences were common. The cultivated European hazelnut, C. avellana could be crossed with most of the wild species either freely or with some degree of difficulty. In general, C. avellana was more successful as a pollen parent. Neither C. cornuta nor C. sieboldiana was cross-compatible with C. avellana in either direction, but C. americana and C. avellana were cross-compatible reciprocally. C. cornuta, C. californica and C. sieboldiana were cross-compatible reciprocally. The cross between C. colurna and C. avellana is difficult but possible. Unilateral incompatibility was observed. The crosses C. californica x C. avellana, C. chinensis x C. avellana, C americana x C. heterophylla, C. cornuta x C heterophylla, C. californica x C. colurna, and C. americana x C. sieboldiana were successfiil, but the reciprocals were not. However, the Asian species C. heterophylla x C. chinensis and C. chinensis x C. sieboldiana were reciprocally incompatible. Fluorescence microscopy showed that pollen-stigma incompatibility exists within and among wild hazelnut species as well as the cultivated European hazelnut C. avellana. Clearly incompatible reactions were observed following all self- pollinations, indicated by reduced pollen germination and pollen tubes that were short, usually 'comma' shaped, often terminated in pronounced bulbs, and failed to 139

penetrate the stigma. Both compatible and incompatible reactions were observed in intra- and interspecific pollinations with some reciprocal differences. Unilateral incompatibility is also a barrier in interspecific crosses. Pollen-stigma interactions suggest that sphorophytic self-incompatibility exists in wild Corylus species and that a large number of S-alleles is involved. Pollen-stigma incompatibility and embryo abortion (blank nuts) appear to be major blocks to interspecific gene flow. A phylogenetic analysis based on twenty three morphological and five phenological characters placed hazelnut species in three groups. The six shrub species were placed in the first and second groups while three tree species were placed in the last group. The first group included all representatives of C. avellana, C. americana, and C. heterophylla. The C. avellana accessions failed to form a monophyletic group due to the great diversity for morphological and phenological traits in this species. The second group included all representatives of C cornuta, C. californica, and C. sieboldiana. Our data suggest that C. californica may not be a botanical variety of C. cornuta. The third group included all representatives of the tree species C. colurna, C. chinensis, and C. jacquemontii. Bootstrap analysis was congruent with the common classification based on morphology and crossing relationships. In addition, the chloroplast matK. gene and the Internal Transcribed Spacer (ITS) region of the nuclear ribosomal DNA (rDNA) were amplified and sequenced. Carpinus betulus was used as an outgroup. The ITS region and matK. were 666 and 1231 bp long, respectively. Nuclear and chloroplast genes revealed different branching patterns on the tree. The relatively small variation in the ITS region sequences in Corylus made the sequences easy to align but resulted in less resolved tree topology due to a limited number, only 22, of informative characters. The matK sequences had extremely low divergence and resulted in ambiguity as the number of informative characters was only 10. Three distinct groups were formed based on nuclear DNA sequences: the species C. avellana, C. maxima, C. americana and C. heterophylla formed the first group; the species C. cornuta, C. californica and C. sieboldiana formed the second group. The last group included 140

the tree species C. colurna, C. chinensis, C. jacquemontii and the paperbark hazel. The strict consensus tree topology was congruent with the results of interspecific hybridization relationships and morphological classification. In plastid DNA analysis, two clusters appeared on the strict consensus tree, one with Asian and European species, and the other with North American species. However, this classification was not in agreement with known taxonomic classification. The ITS and maiK. sequences could not be combined. The very low variation in both gene sequences suggested recent divergence of the genus. Based on the results of our studies, Corylus species were placed into four groups: 1- C. avellana, C. maxima, C. americana and C. heterophylla 2- C. colurna, C. chinensis, paperbark hazelnut and C. jacquemontii 3- C. cornuta, C. californica and C. sieboldiana and 4- C. ferox. Crossability relationships will enable hazelnut breeders to select parents efficiently. For example, transfer of eastern filbert blight resistance from C. cornuta to C. avellana would not be possible through traditional hybridization and backcrossing. Knowledge of pollen-stigma incompatibility also will be useful in selection of parents within and among species. Additional specimens of Asian Corylus species should be made available to taxonomists to allow better classification in genus Corylus. 141

BIBLIOGRAPHY

Ahmad, M., D. L. McNeil, and J. R. Sedcole. 1997. Phylogenetic relationships in Lens species and their interspecific hybrids as measured by morphological characters. Euphytica 94: 101-111.

Ahmad, Z., L. S. Daley, R. A. Menendez, and H. L. Lagerstedt. 1987. Characterization of filbert (Corylus) species and cultivars using gradient polyacrylamide gel electrophoresis. J. Environ. Hort. 5: 11-16.

Al-Zahim, M., H. J. Newbury, and B. V. Ford-Lloyd. 1997. Classification of genetic variation in garlic (Allium sativum L.) revealed by RAPD. Hortscience 32: 1102-1104.

Anhert, D., M. Lee, D. F. Austin, C. Livini, W. L. Woodman, S. J. Openshaw, J. S. C. Smith, K, Porter, and G. Dalton. 1996. Genetic diversity among elite sorghum inbred lines assessed with DNA markers and pedigree information. Crop Sci. 36: 1385-1392.

Avis, J. C. 1994. Molecular markers, natural history and evolution. Chapman & Hall, pp 511, New York.

Ayfer, M., A. Uzun, and F. Bas. 1986. Turkish hazelnut cultivars. Black Sea Hazelnut Exporters Union. Giresun/Ankara.

Bailey, L. H. 1914. The standard cyclopedia of horticulture, Vol.2. McMillan Co. London, University of Tennessee.

Baldwin, B. G., M. J. Sanderson, J. M. Porter, M. F. Wojciechowski, C. S. Campbell, and M. J. Donoghue. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann. Missouri Bot. Gard. 82: 247-277.

Ballington, J. R. and G. J. Galletta. 1978. Comparative crossability of 4 diploid Vaccinium species. J. Amer. Soc. Hort. Sci. 103(4): 554-560.

Bartolozzi, F, M. L. Warburton, S. Arulsekar, and T. M. Gradziel. 1998. Genetic characterization and relatedness among California almond cultivars and breeding lines detected by randomly amplified polymorphic DNA (RAPD) analysis. J. Amer. Soc. Hort. Sci. 123: 381-387.

Bell, P. 1995. Incompatibility in flowering plants: Adaptation of an ancient response. Plant Cell 7: 5-16. 142

Bell, R. L. and L. F. Hough. 1986. Interspecific and intergeneric hybridization of Pyrus. HortScience 21:62-64.

Bohs, L. 1991. Crossing studies in Cyphomandra (Solanaceae) and their systematic and evolutionary significance. Amer. J. Bot. 78: 1683-1693.

Botta, R., E. Emanuel, G. Me, S. Sacerdote, and R. Vallania. 1986. Indagine cariologica in alcune specie del genere Corylus. Riv. Ortoflorofrutt. It. 70: 323-329.

Bourquin, J. C, A. Sonko, L. Otten, and B. Walter. 1993. Restriction fragment length polymorphism and molecular taxonomy in Vitis vinifera L. Theor. Appl. Genet. 87:431-438.

Bousquet, J., S. H. Strauss, and P. Li. 1992. Complete congruence between morphological and rbc-L based molecular phylogenies in birches and related species (Betulaceae). Mol. Biol. Evol. 9: 1076-1088.

Brummer, E. C, J. H. Bouton, and G. Kochert. 1995. Analysis of annual Medicago species using RAPD markers. Genome 38: 362-367.

Brunner, F. and D. E. Fairbrothers. 1979. Serological investigation of the Corylaceae. Bull. Torry. Bot. Club. 106: 97-103.

Caliskan, T. and E. Cetiner. 1997. Characterization studies on some hazelnut cultivars and types. Acta Hort. 445: 1-19.

Castiglione, S., G. Wang, G. Damiani, C. Bandi, S. Bisoffi, and F. Sala. 1993. RAPD fingerprints for identification and taxonomic studies of elite poplar (Populus spp.) clones. Theor. Appl. Genet. 87: 54-59.

Challice, J. S. and M. N. Westwood. 1973. Numerical taxonomic studies of the genus Pyrus using both chemical and botanical characters. Bot. J. Linn. Soc. 67: 121-148.

Chawla, B., R. Bematzky, W. Liang, and M. Marcotrigiano. 1997. Breakdown of self incompatibility in tetraploid Lycopersicon peruvianum: inheritance and expression of S-related proteins. Theor. Appl. Genet. 95: 992-996.

Cheng, S. 1992. Isozyme variation and inheritance in hazelnut. Ph.D. Thesis. Oregon State University, Corvallis OR. 143

Chetelat, R.T. and J.W. DeVama. 1991. Expression of unilateral incompatibility in pollen of Lycopersicon pennelli is determined by major loci on chromosomes 1, 6, and 10. Theor. Appl. Genet. 82: 704-712.

Cooper, D. C. and R. A. Brink. 1940. Somatoplastic sterility as a cause of seed failure after interspecific hybridization. Genetics 25:593-617.

Crawford, D. J. 1990. Plant molecular systematics. John Wiley and Sons, New York.

Davis, J., D. Henderson, M. Kobayashi, M. T. Clegg, and M. T. Clegg. 1998. Genealogical relationships among cultivated avocados as revealed through RFLP analyses. J. Heredity 89: 319-323.

Decker, D. S. 1985. Numerical analysis of allozyme variation in Cucurbitapepo. Econ. Bot. 39: 300-309.

Deng, Z. N., A. Genetile, E. Nicolosi, F. Domina, A. Vardi, and E. Tnbulato. 1995. Identification of in vivo and in vitro lemon mutants by RAPD markers. J. Hort. Sci. 70:117-125.

Dhaliwal, H.S. 1992. Unilateral Incompatibility, p. 32-46. In: Kallo, G. and J.B. Chowdhury (Eds.). Distant hybridization of crop plants. Monographs on Theoretical and Applied Genetics 16: 32-46. Springer Verlag, Berlin.

Dickinson, H. G. 1990. Self-incompatibility in flowering plants. BioEssays 12: 155-161.

Dowling, T. E., C. Moritz, and J. D. Palmer. 1990. Nucleic acids II: restriction site analysis, p.250-317. In: D. M. Hillis and C. Moritz (eds.). Molecular systematics. Sinauer Associats, Inc. Sunderland, MA.

Drumke, J. S. 1964. A systematic survey of Corylus in North America . Ph.D. Thesis, University of Tennessee.

Dudley, J. W. 1994. Comparison of genetic distance estimators using molecular marker data. Proc. of Symp. Analysis of molecular data. p. 3-7. Joint Plant Breeding Symposia series ASHS, CSSA. 1994.

Dunemann, F., R. Kahnau, and H. Schmidt. 1994. Genetic relationships in Malus evaluated by RAPD fingerprinting of cultivars and wild species. Plant Breeding 113: 150-159. 144

Ebert, P. R., M. A. Anderson, R. Bematzky, M. Altschuler, and A. E. Clarke. 1989. Genetic polymorphism of self-incompatibility in flowering plants. Cell 56: 255-262.

Egea, J. and L. Burgos. 1996. Detecting cross-incompatibility of three North American apricot cultivars and establishing the first incompatibility group in apricot. J. Amer. Soc. Hort. Sci. 121: 1002-1005.

Erdogan, V. and S. A. Mehlenbacher. 1997. Preliminary results on interspecific hybridization in Corylus. Acta Hort. 445: 65-71.

Everett, T. H. 1981. The New York Botanical Garden illustrated encyclopedia of horticulture. Vol. 3, p. 886-888. Garland Publishing, New York.

Fabri, A., Hormoza, J. I, and V. S. Polito. 1995. Random amplified polymorphic DNA analysis of olive (Olea europaea L.) cultivars. J. Amer. Soc. Hort. Sci. 120: 538-542.

Fang, D., R. R. Krueger, and M. L. Roose. 1998. Phylogenetic relationships among selected Citrus germplasm accessions revealed by inter-simple sequence repeat (ISSR) markers. J. Amer. Soc. Hort. Sci. 123: 612-617.

Farris, C. W. 1970. Inheritance of parental characteristcis in filbert hybrids. Ann. Rep. Northern Nut Growers Assoc. 61: 54-58.

Farris, C. W. 1976. An introduction to the stars: A new family of filbert hybrids. Ann. Rep. Northern Nut Growers Assoc. 67: 80-82.

Farris, C. W. 1982. A progress report on the development of F2 hybrids of Corylus colurna x C. avellana. Ann. Rep. Northern Nut Growers Assoc. 73: 15-16.

Farris, C. W. 1989. Two new introduction; 'Grand Traverse' hazelnut and 'Spartan' seedless grape. Ann. Rep. Northern Nut Growers Assoc. 80: 102-103.

Farrris, J. S., M. Kallersjo, A. G. Kluge, and C. Bult. 1994. Testing significance of incongruence. Cladistics 10: 315-319.

Felstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791.

Fjellstrom, R. G., D. E. Parfitt, and G. H. McGranahan. 1994. Genetic relationships and characterization of Persian walnut (J. regia L.) cultivars using restriction fragment length polymorphisims (RFLPs). J. Amer. Soc. Hort. Sci. 119:833-839. 145

Furlow, J. J. 1997. Betulaceae Gray, Birch family, p. 507-538. In: Anonymous (ed.). Flora of North America, north of Mexico. Vol: 3 Magnoliophyta: Magnoliidae and Hamamelidae. Oxford Univ. Press, New York.

Gardiner, S. E., H. C. M. Basset, C. Madie, and D. A. M. Noiton. 1996. Isozyme, randomly amplified polymorphic DNA (RAPD), and restriction fragment- length polymorphism (RFLP) markers used to deduce a putative parent for the 'Braebum' apple. J. Amer. Soc. Hort. Sci. 121: 996-1001.

Gaude, T. and C. Dumas. 1987. Molecular and cellular events of self- incompatibility. Intern. Rev. Cytol. 107: 333-366.

Gawel, N. J., R. L. Jarret, and A. P. Whittemore. 1992. Restriction fragment length polymorphisim (RFLP)-based phylogenetic analysis of Musa. Theor. Appl. Genet. 84: 286-290.

Gellatly, J. U. 1950. Description of filazel varieties. Ann. Rep. Northern Nut Growers Assoc. 41: 116-117.

Gellatly, J. U. 1956. Filazels. Ann. Rep. Northern Nut Growers Assoc. 47: 112- 114.

Gellatly, J. U. 1964. Filazels. Ann. Rep. Northern Nut Growers Assoc. 55: 153- 155.

Gellatly, J. U. 1966. Tree hazels and their improved hybrids. Ann. Rep. Northern Nut Growers Assoc. 57: 98-101.

Genetics Computer Group. 1996. Program manual for the Wisconsin Package, Version 9, Madison, WI.

Hadley, H. H. and S. J. Openshaw. 1980. Interspecific and intergeneric Hybridization, p. 133-159. In: W. R. Fehr and H. H. Hadley (eds.). Hybridization in crop plants. Amer. Soc. Agr., CSSA, Madison, WI.

Hall, J. W. 1952. The comparative anatomy and phylogeny of the Betulaceae. Bot. Gazette 113: 235-270.

Hampson, C. R., A. N. Azarenko, and A. Soeldner. 1993. Pollen-stigma interactions following compatible and incompatible pollinations in hazelnut. J. Amer. Soc. Hort. Sci. 118: 814-819. 146

Harrison, R. E., J. J. Luby, and G. R. Fumier. 1997. Chloroplast DNA restriction fragment variation among strawberry (Fragaria spp.) taxa. J. Amer. Soc. Hort. Sci. 122: 63-68.

Hawkes, J.G. 1977. The importance of wild germplasm in plant breeding. Euphytica26: 615-621.

Hellman, E. W., R. M. Skirvin, and A.G. Otterbacher. 1982. Unilateral incompatibility between red and black raspberries. J. Amer. Soc. Hort. Sci. 107: 781-784.

Heslop-Harrison J., Y. Heslop-Harrison, R. B. Knox, and B. Howlet. 1973. Pollen-wall proteins: gametophytic and sporophytic fractions in the pollen walls of the Malvaceae. Ann. Bot. 37: 403-412.

Heslop-Harrison J., R. B. Knox, and Y. Heslop-Harrison. 1974. Pollen wall proteins: exine-held fractions associated with the incompatibility response in Cruciferae. Theor. Appl. Genet. 44: 133-137.

Heslop-Harrison Y., J. S. Heslop-Harrison and J. Heslop-Harrison. 1986. Germination of Corylus avellana L. (hazel) pollen: hydration and the function of the oncus. Acta Bot. Neerl. 35: 265-284.

Hiscock, S. J. and H. G. Dickinson. 1993. Unilateral incompatibility within the Brassicaceae: further evidence for the involvement of the self- incompatibility (S)-locus. Theor. Appl. Genet. 86: 744-753.

Hogenboom, N. G. 1973. A model for incongruity in intimate partner relationships. Euphytica 22: 219-233.

Hormoza, J. I., L. Dollo, and V. S. Polito. 1994. Determination of relatedness and geographical movements of Pistacia vera (Pistachio; Anacardiaceae) germplasm by RAPD analysis. Econ. Bot. 48: 349-358.

Hsiao, C, N. J. Chatterkon, K. H. Asay, and K. B. Jensen. 1993. Phylogenetic relationships of 10 grass species: an assessment of phlogenetic utility of the internal transcribed spacer region in nuclear ribosomal DNA in monocots. Genome 37: 112-120.

Hu, H. H. 1948. The silva of China: a description of the trees which grow naturally in China. Vol 2, Betulaceae-Corylaceae. Fan Memorial Institue of Biology and National Forest Res. Bureau. Ministry of Agricultura and Forestry. 147

Huxley, A., M. Griffiths, and L. Margot. 1992. The new Royal Horticultural Society dictionary of gardening 1. McMillan Press Ltd., London.

Ikeda, S., J. B. Nasrallah, R. Dixit,. S. Preiss, and M. E. Nasrallah. 1997. An aquaporin-like gene required for the Brassica self-incompatibility response. Science 276: 1564-1566.

Janssens, G. A., I. J. Goderis, W. F. Broekaert, and W. Broothaerts. 1995. A molecular method for S- allele identification in apple based on allele- specific PCR. Theor. Appl. Genet. 91: 691-698.

Johnson, L. A. and D. E. Soltis. 1994. wa/K DNA sequences and phylogenetic reconstruction in Saxifragaceae s. s. Syst. Bot. 19: 143-156.

Johnson, L. A. and D. E. Soltis. 1995. Phylogenetic inference in Saxifragaceae sensu stricto and Gillia (Polemoniaceae) using matK sequences. Ann. Missouri Bot. Gard. 82: 149-175.

Johansson, E. 1927. Floral biology trials with hazel at Alnarp 1924-1926 (in Swedish). Sveriges Pom. Foren. Arsskrift 1927. p. 3-20.

Johnston, S. A. and R. E. Hanneman. 1982. Manipulations of endosperm balance number overcome crossing barriers between diploid Solarium species. Science. 217:446-448.

Kallo, G. 1992. Utilization of wild species, p. 149-167. In: Kallo, G. and J.B. Chowdhury (Eds.). Distant hybridization of crop plants. Monographs on Theoretical and Applied Genetics 16:. Springer Verlag, Berlin, Germany

Kasapligil, B. 1963. Corylus colurna and its varieties. Calif. Hort. Soc. J. 24: 95- 104.

Kasapligil, B. 1964. A contribution to the histotaxonomy of Corylus (Betulaceae). Adansonia. Tome IV, Fascicule 1, p. 43-90.

Kasapligil, B. 1968. Chromosome studies in the genus Corylus. Scientific Reports of the Faculty of Science, Ege University No. 59.

Kasapligil, B. 1972. A bibliography on Corylus (Betulaceae) with annotations. Ann. Rep. Northern Nut Growers Assoc. 63: 107-162.

Kellogg, E. A., R. Appels, and R. J. Mason-Gamer. 1996. When genes tell different stories: the diploid genera of Triticeae (Gramineae). Syst. Bot. 21: 321-347. 148

Kesseli, R. V. and R. W. Michelmore. 1986. Genetic variation and phylogenies detected from isozyme markers in species of Lactuca. J. Heredity 77: 324- 331.

Kester, D. E., W. C. Micke, and M. Viveros. 1994. A mutation in 'Nonpareil' almond conferring unilateral incompatibility. J. Amer. Soc. Hort. Sci. 119: 1289-1292.

Khus, G. S. and D. S. Brar. 1992. Overcoming the barriers in hybridization, p. 47- 61. In: G. Kallo and J. B. Chowdhury (eds.). Distant hybridization of crop plants. Springer-Verlag, New York.

Kim, J. H. 1985. Horticultural crops research highlights 1984-85. Horticultural Experiment Station. Rural Development Administration. Suweon, Korea, p. 24.

Kishino, H. and M. Hasegawa. 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominiodea. J. Mol. Evol. 29: 170-179.

Knox, R. B., R. R. Willing, and A. E. Ashford. 1972. Role of pollen-wall proteins as recognition substances in interspecific incompatibility in poplars. Nature. 237: 381-383.

Krahl, K. H., A. Lansari, and A. F. Lezzoni. 1991. Morphological variation within a sour cherry collection. Euphytica 52: 47-55.

Krussmann, G. 1976. Manual of cultivated broad-leaved trees and shrubs. Timber Press, Portland, OR.

Kubitzki, K. 1993. Betulaceae, p. 152-157. In: K. Kubitzki (ed.). The families and genera of vascular plants. Vol, II. Flowering plants, Dicotyledons. Springer- Verlag, Berlin.

Ladizinsky, G. 1992. Crossability relations, p. 15-31. In: Kallo, G. and J.B. Chowdhury (Eds.). Distant hybridization of crop plants. Monographs on Theoretical and Applied Genetics 16:. Springer Verlag, Berlin.

Lagerstedt, H. B. 1975. Filberts, p. 456-489. In: J. Janick and J. N. Moore (eds.). Advances in fruit breeding. Purdue Univ. Press, West Lafayette, IN. 149

Lamboy, W. F., J. Yu, P. L. Forsline, and N. F. Weeden.1996. Partitioning of allozyme diversity in wild populations of Malus sieversii L. and implications for germplasm collection. J. Amer. Soc. Hort. Sci. 121: 982- 987.

Larsen, K. 1977. Self-incompatibility in Beta vulgaris L. I. Four gametophytic, complementary S-loci in sugar beet. Hereditas 85: 227-248.

Layne, R. E. C. and W. B. Sherman. 1986. Interspecific hybridization ofPrunus. Hortscience 21: 48-51.

Leclerc, M. C, V. Barriel, G. Lecointre, and B. de Reviers. 1998. Low divergence in rDNA ITS sequences among five species of Fucus (Phaeophyceae) suggests a very recent radiation. J. Mol. Evol. 46: 115-120.

Levi, A. and L. J. Rowland. 1997. Identifying blueberry cultivars and evaluating their genetic relationships using randomly amplified polymorphic DNA (RAPD) and simple sequence repeat- (SSR) anchored primers. J. Amer. Soc. Hort. Sci. 122: 74-78.

Lewis D. and L. K. Crowe. 1958. Unilateral interspecific incompatibility in flowering plants. Heredity 12: 233-256.

Li, X., N. Paech, J. Nield, D. Hayman, and P. Langridge. 1997. Self -incompatibiltyin the grasses: evolutionary relationship of the S gene from Phalaris coerulescens to homologous sequences in other grasses. Plant Mol. Biol. 34: 223-232.

Liang, H. and K. W. Hilu. 1996. Aplication of the maiK. gene sequences to grass systematics. Can. J. Bot. 74: 125-134.

Liang, W. J. and Y. M. Zhang. 1988. Investigation and study of filbert resources in China. Proc. Int. Symp. on Hort. Germplasm, Cultivated and Wild, Beijing, Sept. 1988.

Liang, W., X. Ming, and X. Wanying. 1994. Studies on hazelnut breeding in northern China. Acta Hort. 351: 59-66.

Lield, B. E. and N. O. Anderson. 1993. Reproductive barriers: identification, uses and circumvention. Plant Breed. Rev. 11: 11-154. 150

Lield, B. E., S. McCormick, and M. A. Mutschler. 1996. Unilateral incongruity in crosses involving Lycopersicon pennelli and L. esculentum is distinct from self-incompatibility in expression, timing and location. Sex. Plant Reprod. 9: 299-308.

Listen, A. and J. A. Wheeler. 1994. The phylogenetic position of the genus Astragalus (Fabaceae): evidence from the chloroplast genes rpoCl and rpoCl. Bio. Syst. Ecol. 22: 377-388.

Liston, A., W. A. Robinson, J. M. Oliphant, and E. R. Alvarez-Buylla. 1996. Length variation in the nuclear ribosomal DNA internal transcribed spacer region of non-flowering seed plants. Syst. Bot. 21: 109-120.

Loukas, M. and C. A. Pontikis. 1979. Pollen isozyme polymorphisim in types of Pistacia vera and related species as an aid in taxonomy. J. Hort. Sci. 54: 95- 102.

Lu, J. and Lamikanra, O. 1996. Barriers to intersubgeneric crosses between Muscadinia and Euvitis. HortScience 31: 269-271.

Magdalita, P. M., R. A. Drew, S. W. Adkins, and I. D. Godwin. 1997. Morphological, molecular and cytological analyses of Carica papaya x C. cauliflora interspecific hybrids. Theor. Appl. Genet. 95: 224-229.

Malusa, E. 1994. Interspecific relations among Corylus species. Acta Hort. 351:335-340.

Masuelli, R. W. and El L. Camadro. 1997. Crossability relationships among wild potato species with different ploidies and endosperm balance numbers (ENB). Euphytica 94: 227-235.

Matton, D.P., O. Maes, G. Laublin, Q. Xike, C. Bertrand, D.Morse, and M. Cappadocia. 1997. Hypervariable domains of self-incompatibility RNases mediate allele-specific pollen recognition. Plant Cell 9: 1757-1766.

Mau, S. L., J. Raff, and A. E. Clarke. 1982. Isolation and partial characterization of components of Prunus avium L. styles, including an antigenic glycoprotein associated with a self-incompatibility genotype. Planta 156: 505-516.

McKay, J. W. 1966. Sterility in filbert (Corylus). Proc. Amer. Soc. Hort. Sci. 88:319-324.

Mehlenbacher, S. A. 1991. Hazelnuts (Corylus). Genetic resources of temperate fruit and nut crops. Acta Hort. 290: 791-836. 151

Mehlenbacher, S. A. 1994. Genetic improvement of the hazelnut. Acta Hort. 351: 23-38.

Mehlenbacher, S. A. 1997. Revised dominance hierarchy for S-alleles in Corylus avellana L. Theor. Appl. Genet. 94: 360-366.

Mehlenbacher, S. A. and D. C. Smith. 1991. Partial self-compatibility in 'Tombul' and 'Montebello' hazelnuts. Euphytica 56: 231-236.

Mehlenbacher, S. A. and M. M. Thompson. 1988. Dominance relationships among S-alleles in Corylus avellana L. Theor. Appl. Genet. 76: 669-672.

Mehlenbacher, S. A., A. N. Miller, M. M. Thompson, H. B. Lagerstedt, and D. C. Smith. 1991. 'Willamette' hazelnut. HortScience 26:1341-1342.

Mhameed, S., D. Sharon, D. Kaufinan, E. Lahav, H. Hillel, C. Degani, and U. Lavi. 1997. Genetic relationships within avocado (Persea americana Mill) cultivars and between Persea species. Theor. Appl. Genet. 94: 279-286.

Mickevich, M. F. and J. S. Farris. 1981. The implications of congruence in Menidia. Syst. Zool. 30: 351-370.

Morgan, D. R., D. E. Soltis, and K. R. Roberstson. 1994. Systematic and evolutionary implications of rbcL sequence variation in Rosaceae. Amer. J. Bot. 81:890-903.

Narasimha Rao, N. 1979. The barriers to hybridization between Solarium melongena and some other species of Solarium, p.605-614. In: Hawkes, J. G., R. N. Lester and A. D. Skelding (eds.). The biology and taxonomy of the Solanacea. Linn. Soc. Sym. Series 7, Academic Press, London.

Nasrallah, J. B. 1997. Signal perception and response in the interactions of self- incompatibility in Brassica. Essays in Biochemistry 32: 143-159.

Nasrallah, M. E. and J. B. Nasrallah. 1985. A cDNA clone encoding an S-locus glycoprotein from Brassica olearaceae. Nature 318: 263-267.

Nasrallah, M. E. and J. B. Nasrallah. 1986. Molecular biology of self incompatibility in plants. Trends Genet. 2: 239-244.

Nasrallah, M. E. and J. B. Nasrallah. 1993. Pollen-stigma signaling in the sporophytic self-incompatibility response. Plant Cell 5: 1325-1335. 152

Nettancourt, D. De. 1977. Incompatibility in Angiosperms. Monographs on Theor. Appl. Genet. 3. Springer-Verlag 230 p. Berlin and New York.

Nettancourt, D. De, M. Devreux, U. Laneri, M. Cresti, E. Pacini, and G. Sarfatti. 1974. Genetical and ultrastructrual aspects of self and cross incompatibility in interspecific hybrids between self-compatible Lycopersicum esculentum and self-incompatible L. peruvianum. Theor. Appl. Genet. 44: 278-288.

Newbigin, E., M. A. Anderson, and A. E. Clarke. 1993. Gametophytic self- incompatibility systems. Plant Cell 5: 1315-1324.

Nickrent, D. L., K. P. Schuette, and E. M. Starr. 1994. A molecular phylogeny of Arceuthbium (Viscaceae) based on nuclear ribosomal DNA internal transcribed spacer sequences. Amer. J. Bot. 81:1149-1160.

Nienhuis, J., J. Tivang, and P. Skroch. 1994. Analysis of genetic relationships among genotypes based on molecular marker data. Proc. of Symp. Analysis of molecular data. p. 8-14. Joint Plant Breeding Symposia series ASHS, CSS A. 1994.

Ooi, K., Y. Endo, J. Yokoyama, and N. Murakami. 1995. Useful primer designs to amplify DNA fragments of the plastid gene matK from angiosperm plants. J. Japanese Bot. 70: 328-331.

Perez, S., S. Montez, and C. Mejia. 1993. Analysis of peach germplasm in Mexico. J. Amer. Soc. Hort. Sci. 118: 519-524.

Qu, X., J. Lu, and O. Lamikanra. 1996. Genetic diversity in Muscadine and American bunch grapes based on randomly amplified polymorphic DNA (RAPD) analysis. J. Amer. Soc. Hort. Sci. 121: 1020-1023.

Quijada, A., A. Liston, P. Delgado, A. Vasquez-Lobo and, E. R. Alvarez-Buylla. 1998. Variation in the nuclear ribosomal DNA internal transcribed spacer (ITS) region of Pinus rzedowskii revealed by PCR-RFLP. Theor. Appl. Genet. 96: 539-544.

Rabakoarihanta, A., D. W. S. Mok, and M. C. Mok. 1979. Fertilization and early embryo development in reciprocal interspecific crosses ofPhaseolus. Theor. Appl. Genet. 54: 55-59.

Reed, C. A. 1936. New filbert hybrids. J. Heredity 27: 427-431.

Rehder, A. 1940. Manual of cultivated trees and shrubs hardy in North America, p. 143-146. 2nd edition, McMillan Company, New York. 153

Ren, J., J. R. McFerson, R. Li, S. Kresovich, and W. F. Lamboy. 1995. Identities and relationships among Chinese vegetable Brassicas as determined by random amplified polymorphic DNA markers. J. Amer. Soc. Hort. Sci. 120: 548-555.

Rhodes, A. M, S: E. Malo, C. W. Campbell, and S. G. Carmer. 1971. A numerical taxonomic study of avocado (Persea americana Mill). J. Amer. Soc. Hort. Sci. 96: 391-395.

Ridgway, R. 1912. Color standards and color nomenclature. Published by the author. Washington, D.C.

Rougier, M., N. Jnoud, C. Said, S. Russel, and C. Dumas. 1992. Interspecific incompatibility in Populus: inhibition of tube growth and behaviour of the male germ unit in P. deltoides x P. alba. Protoplasma 168: 107-112.

Rovira, M. 1997. Genetic variability among hazelnut (C. avellana L.) cultivars. Acta Hort. 445: 45-50.

Rudd, J., F Christopher H. Franklin, and V. E. Franklin-Tong. 1997. CA2 independent phosphorylation of a 68 kDa pollen protein is stimulated by the self-incompatibiliy response in Papaer rhoeas. Plant J. 12: 507-514.

Sakurai, K., S. K. Brown, andN. F. Weeden. 1997. Determining the self- incompatibility allales of Japanese apple cultivars. Hortscience. 32: 1258- 1259.

Salesses, G. 1973. Cytological study of genus Corylus. A heterozygotic translocation in some low male fertile varieties of hazelnut (C avellana). Ann. Amelior. Plantes 23: 59-66.

Sampson, D. R. 1962. Intergeneric pollen-stigma incompatibility in Cruciferae. Can. J. Genet. Cytol. 4: 38-49.

Saward, L., M. Michaud, and J. Bousquet. 1993. Genetic diversity and phylogenetic relationships between birches and alders using ITS, 18S rRNA, and rbcl gene sequences. Mol. Phyl. Evol. 2: 112-118.

Schuster, C. E. 1924. Filberts: 2. Experimental data on filbert pollination. Oregon Agric. Expt. Sta. Bull. No. 208548-555.

Scorza, R. 1984. Introduction to the workshop. Overcoming the barriers to interspecific hybridization of perennial fruit crops. Held at 81st ASHS annual meeting, Vancover, B.C. 6 August, 1984. ( HortScience 21:41). 154

Sharp, A. J. 1951. Relationships between the floras of California and southern United States. Contrib. Dudley Herbarium 4: 59-61.

Shii, C. T., M. C. Mok, S. R. Temple, and D. W. S. Mok. 1980. Expression of developmental abnormalities in hybrids of Phaseolus vulgaris. J. Heredity. 71:218-222.

Simmonds, N. W. and S. T. C. Weatherup. 1990. Numerical taxonomy of the cultivated bananas. Trop. Agric. (Trinidad) 67: 90-92.

Singh, R. J. 1993. Plant cytogenetics. CRC press.

Slate, G. L. 1961. The present status of filbert breeding. Ann. Rep. Northern Nut Growers Assoc. 52: 24-26.

Smith, D. C. and S. A. Mehlenbacher. 1994. Use of Tyvek housewrap for pollination bags in breeding hazelnut {Corylus avellana L.). Hortscience. 29:918.

Smith, S. W., R. Overbeek, C. R. Woese, W. Gilbert, and P. M. Gillevet. 1994. The genetic data environment: an expandable GUI for multiple sequence analysis. Cabios 10: 670-671.

Sneath, P. H. A. and R. R. Sokal. 1973. Numerical taxonomy: the principles and practice of numerical classification. Freeman Press, San Francisco.

Soltis, P. S. and D. E. Soltis. 1995. Alternative genes for phylogenetic reconstruction in plants: introduction. Ann. Miss. Bot. Gard. 82: 147-148.

Soltis, D. E., L. A. Johnson, and C. Looney. 1996. Discordance between ITS and chloroplast topologies in the Boykinia group (Saxifragaceae). Syst. Bot. 21: 169-185.

Stammers, M., J. Harris, G. M. Evans, M. D. Hayward, and J. W. Forster. 1995. Use of random PCR (RAPD) technology to analyse phylogenetic relationships in the LoliumlFestuca complex. Heredity 74: 19-27.

Stein, J. C, B. Howlett, D. C. Boyes, M. E. Nasrallah,and J. B. Nasrallah. 1991. Molecular cloning of a putative receptor protein kinase gene encoded at the self incompatibility locus of Brassica oleraceae. Proc. Natl. Acad. Sci. USA. 88: 8816-8820. 155

Stein, J. C, R. Dixit, M. E. Nasrallah, and J. B. Nasrallah. 1996. SRK, the stigma- specific S locus receptor kinase of Brassica, is targeted to the plasma membrane in transgenic tobacco. Plant Cell. 8: 429-445.

Stiles, J. I., C. Lemme, S. Sondur, M. B. Morshidi, and R. Manshardt. 1993. Using randomly amplified polymorphic DNA for evaluating genetic relationships among papaya cultivars. Theor. Appl. Genet. 85: 697-701.

Stuessy, T. F. 1990. Plant taxonomy. Columbia Univ. Press, pp 514, New York.

Swofford, D. L. 1999. PAUP*: Phylogenetic analysis using parsimony (* and other methods), version 4.0. Sinauer Associates, Sunderland, MA.

Thompson, M. M. 1979a. Genetics of incompatibility in Corylus avellana L. Theor. Appl. Genet. 54: 113-116.

Thompson, M. M. 1979b. Incompatibility alleles in Corylus avellana L. cultivars. Theor. Appl. Genet. 55: 29-33.

Thompson, M.M., P. Romisondo, E. Germain, R. Vidal-Barraquer, and J. Tasias- Valls. 1978. An evaluation systems for filberts. HortScience 13: 514-517.

Thompson, M. M., H. B. Lagerstedt and S. A. Mehlenbacher. 1996. Hazelnuts, p. 125-184. In J. Janick, J. N. Moore (eds.). Fruit Breeding Vol: III, Nuts. John Wiley and Sons Inc., New York.

Thormann, C. E., and T. C. Osbom. 1992. Use of RAPD and RFLP markers for germplasm evaluation, p. 9-11. In: Applications of RAPD technology to plant breeding (Joint plant breeding symposia series). ASS A, ASHS, AGA, Minneapolis, Minn.

Tingey, S. V. and J. P. del Tufo. 1993. Genetic analysis with random amplified polymorphic DNA markers. Plant. Physiol 101: 349-352.

Varghese, Y. A., C. Knaak, M. R. Sethuraj, and W. Ecke. 1997. Evaluation of random amplified polymorphic DNA (RAPD) markers in Hevea brasiliensis. Plant Breeding 116: 47-52.

Vivek, B. S. and P. W. Simon. 1998. Genetic relationships and diversity in carrot and other Daucus taxa based on nuclear restriction fragment length polymorphisims. J. Amer. Soc. Hort. Sci. 123: 1053-1057. 156

Volker, H., J. E. Gray, B. A. McClure, M. A. Anderson, and A. E. Clarke. 1990. Self-incompatibility: A self-recognition system in plants. Science 250: 937- 941.

Wang, Z. Y., G. Second, and S. D. Tanksley. 1992. Polymorphisim and phylogenetic relationships among species in the genus Oryza as determined by analysis of nuclear RFLPs. Theor. Appl. Genet. 83: 565-581.

Warburton, M. L. and F. A Bliss. 1996. Genetic diversity in peach (Prunuspersica L. Batch) revealed by randomly amplified polymorphic DNA (RAPD) markers and compared to inbreeding coefficients. J. Amer. Soc. Hort. Sci. 121: 1012-1019.

Weschcke, C. 1970. A little nut history. Ann. Rep. Northern Nut Growers Assoc. 61:113-116.

Wetzel, V. G. K. 1929. Chromosomen studien bei den Fagales. Botanisches Rachiv. 25: 257-283.

Wilde, H. R. Waugh, and W. Powell. 1992. Genetic fingerprinting ofTheobroma clones using randomly amplified polymorphic DNA markers. Theor. Appl. Genet. 83: 871-877.

Wilkie, S. E., P. G. Isaac, and R. J. Slater. 1993. Random amplified polymorphic DNA (RAPD) markers for genetic analysis in Allium. Theor. Appl. Genet. 86: 497-504.

Williams, C. E. and D. A. St. Clair. 1993. Phenetic relationships and levels of variability detected by restriction fragment length polymorphism and random amplified polmorphic DNA analysis of cultivated and wild accessions of Lycopersicon esculentum. Genome 36: 619-630.

Woodland, D. W. 1991. Contemporary plant systematics. Prentice Hall, Englewood Cliffs, pp. 582, N. J.

Woodworth, R. H. 1929. Cytological studies in Betulaceae, II: Corylus anAAlnus. Bot Gaz. 88: 383-399.

Wu, L., and H. Lin. 1994. Identifying buffalograss [Buchloe dactyloides (Nutt.) Engelm.] cultivar breeding lines using randomly amplified polymorphic DNA (RAPD) markers. J. Amer. Soc. Hort. Sci. 119: 126-130.

Zheng, W. J. 1985. Taxonomy of Chinese forest trees (in Chinese). Forest Publishing House of China, Beijing. 157

APPENDIX Table Al Intra- and interspecific crossing, seed germination and seedling performance results of C. avellana (as female) in 1995.

Nut set and blank nut formation Seed germination Seedling survival and growth

# # % # % # # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty GA3 % Seedling Seedling diameter code pollinated harvested set harvested nuts treated Germination planted survival (cm)

avellana. X avellana 95142 532 82 15.4 137 16.8 112 41.1 46 91.3 1.16 95146 279 118 42.3 306 9.2 150 44.5 49 93.9 1.09 95150 957 362 37.8 677 25.4 150 15.3 23 69.6 0.95 95154 570 323 56.7 539 26.2 150 39.3 41 92.7 1.08

avellana x americana* 95143 588 15 2.6 17 23.5 95151 808 168 20.8 209 23.4 150 13.3 20 100.0 0.87

avellana x. heterophylla 95145 443 0 0.0 95153 587 1 0.2 1 0 1 100.0 1 100.0 1.16 avellana x cornuta 95149 902 2 0.2 3 66.7 1 100.0 1 100.0 1.20 95157 376 0 0.0 avellana x californica 95148 587 0 0.0 - - - - 95156 655 0 0.0 - - . avellana x sieboldiana 95147 748 4 0.5 4 50.0 2 50.0 1 100.0 0.67 95155 870 0 0.0 avellana x colurna 95144 465 0 0.0 - - - - 95152 663 0 0.0 - - Table A2 Intra- and interspecific crossing, seed germination and seedling performance results of C. americana (as female) in 1995.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty GA3 % Seedlings Seedling diameter code pollinated harvested set harvested nuts treated Germination planted survival (cm)

americana x americana 95105 118 55 46.6 189 80.4 31 61.3 19 68.4 0.47 95101 180 81 45.0 206 18.5 155 96.7 50 100.0 0.44

americana x avellana 95102 215 87 40.5 201 32.8 135 99.3 61 98.4 0.87

americana x heterophylla 95104 154 45 29.2 80 33.8 54 94.4 51 98.0 0.44

americana x cornuta 95107 190 0 0.0 ------

americana x californica 95106 84 2 2.4 2 50.0 1 100.0 1 100.0 1.0

americana x sieboldiana 95108 250 56 22.4 126 49.2 59 74.6 44 88.6 0.58

americana x colurna 95103 270 2 0.7 3 100.0 - - - - - Table A3 Intra- and interspecific crossing, seed germination and seedling performance results of C. heterophylla (as female) in 1995.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty % Seedlings Seedling diameter code pollinated harvested set harvested nuts treated Germination planted survival (cm) heterophylla x heterophylla 95172 620 32 5.2 45 55.6 20 50.0 10 80.0 0.27 95177 170 35 20.6 43 44.2 24 62.5 15 100.0 0.34 95181 960 88 9.2 123 26.8 84 73.8 49 67.4 0.22 95184 530 14 2.6 18 16.7 15 46.7 7 42.9 0.27 heterophylla x avellana 95178 290 4 1.4 4 25.0 3 33.3 1 0.0 - 95182 624 13 2.1 15 40.0 8 62.5 5 0.0 heterophylla x americana 95179 296 0 0.0 95183 924 4 0.4 4 0.0 4 75.0 3 100.0 0.28 heterophylla x cornuta 95175 367 0 0.0 - - - 95187 630 0 0.0 - - - - heterophylla x californica 95173 425 0 0.0 - - - - - 95185 560 0 0.0 - - heterophylla x sieboldiana 95174 590 0 0.0 ------95186 520 0 0.0 - heterophylla x colurna 95176 350 0 0.0 - - - - 95180 905 0 0.0 ; : ;

ON © Table A4 Intra- and interspecific crossing, seed germination and seedling performance results of C. cornuta (as female) in 1995.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty % Seedlings Seedling diameter code pollinated harvested set harvested nuts treated Germination planted survival (cm) cornuta x cornuta 95115 235 74 31.5 115 33.9 71 16.9 12 91.7 0.40 95109 37 14 37.8 18 55.6 8 50.0 4 50.0 0.27 95112 175 106 60.6 203 37.9 120 29.2 35 94.3 0.39 95122 75 24 32.0 30 33.3 20 80.0 16 75.0 0.43 95118 65 1 1.5 1 0.0 cornuta x californica 95117 290 103 35.5 160 38.8 97 71.1 40 97.5 0.42 95125 90 26 28.9 33 27.3 23 91.3 21 66.7 0.47 cornuta x sieboldiana 95116 280 126 45.0 226 29.6 158 84.2 42 64.3 0.36 95124 75 33 44.0 31 29.0 21 90.5 19 100.0 0.58 cornuta x americana 95113 130 11 8.5 20 80.0 4 75.0 3 100.0 0.39 95123 55 0 0.0 cornuta x heterophylla 95114 145 55 37.9 107 55.1 47 89.4 42 59.5 0.36 95121 60 0 0.0 cornuta x avellana 95110 56 0 0.0 ------95119 55 0 0.0 cornuta x colurna 95111 82 0 0.0 ------95120 70 0 0.0 : Table A5 Intra- and interspecific crossing, seed germination and seedling performance results of C. californica (as female) in 1995.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty GA3 % Seedlings Seedling diameter code pollinated harvested set harvested nuts treated Germination planted survival (cm)

californica x californica 95126 47 28 57.5 54 37.0 30 73.3 22 68.2 0.66 95130 139 59 42.5 128 21.1 83 78.3 49 89.8 0.58 95134 71 35 49.3 65 15.4 73 76.7 39 53.9 0.44 95138 38 12 31.6 19 26.3 14 100.0 14 78.6 0.47

californica x cornuta 95132 159 72 45.3 144 27.1 104 65.4 49 89.8 0.63 95141 36 13 36.1 20 40.0 10 60.0 6 66.7 0.57

californica x sieboldiana 95131 65 24 39.9 51 39.2 26 73.1 19 100.0 0.73 95139 43 21 48.8 40 35.0 27 70.4 19 100.0 0.64

californica x americana 95128 51 10 19.6 17 47.1 10 100.0 10 90.0 0.56 95136 61 1 1.6 1 100.0

californica x heterophylla 95129 69 8 8.7 12 83.3 2 100.0 2 100.0 0.63 95137 80 1 1.3 1 100.0

californica x avellana 95127 47 4 8.5 8 12.5 7 71.4 5 100.0 0.66 95135 73 7 9.6 24 91.7 2 0.0

californica x colurna 95133 49 15 24.5 24 33.3 14 85.7 12 83.3 0.42 95140 30 2 6.7 4 100.0 o\ to Table A6 Intra- and interspecific crossing, seed germination and seedling performance results of C. sieboldiana (as female) in 1995.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty % Seedlings Seedling diameter code pollinated harvested set harvested nuts treated Germination planted survival (cm) sieboldiana x sieboldiana 95193 214 38 17.8 90 25.3 67 94.0 63 85.7 0.32 95189 165 22 13.3 44 22.7 36 83.3 30 93.3 0.30 95200 66 44 66.7 165 16.4 136 95.6 48 85.4 0.38 sieboldiana x cornuta 95188 300 10 3.3 25 48.0 11 90.9 10 90.0 0.19 95203 68 23 33.8 78 47.4 41 100.0 41 95.1 0.29 sieboldiana x californica 95190 340 21 6.2 47 29.8 31 87.1 27 81.5 0.55 95201 79 47 59.5 175 28.6 119 93.3 49 98.0 0.52 sieboldiana x americana 95195 195 0 0.0 - - - 95199 78 0 0.0 - - - - sieboldiana x heterophylla 95191 264 0 0.0 - - - - 95202 93 0 0.0 - - - sieboldiana x avellana 95194 200 0 0.0 ------95197 74 0 0.0 - 95198 36 0 0.0 sieboldiana x colurna 95192 275 0 0.0 - - - - - 95196 53 0 0.0 - - ON Table A7 Intra- and interspecific crossing, seed germination and seedling performance results of C. colurna (as female) in 1995.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty % Seedlings Seedling diameter code pollinated harvested set harvested nuts treated Germination planted survival (cm)

colurna x colurna 95158 326 71 21.8 467 16.9 150 86.7 49 87.8 0.62 95165 178 40 22.5 243 14.8 150 86.7 36 75.0 0.65

colurna x avellana 95167 139 9 6.5 15 100.0 - - - - -

colurna x americana 95161 95 6 6.3 15 86.7 2 100.0 2 100.0 0.85 95168 300 0 0.0

colurna x heterophylla 95159 339 14 4.1 45 95.6 2 50.0 1 100.0 0.54 95166 198 0 0.0

colurna x cornuta 95164 170 0 0.0 - - - - 95171 95 0 0.0 - - -

colurna x californica 95163 285 0 0.0 - - - 95170 65 0 0.0 - - - -

colurna x sieboldiana 95162 150 0 0.0 ------95169 161 0 0.0 -

ON Table A8 Intra- and interspecific crossing, seed germination and seedling performance results of C. avellana (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm)

avellana x avellana 96163 82 60 73.2 125 12.8 78 66.7 50 94.0 1.00 96167 55 41 74.6 94 13.8 77 68.8 47 89.4 1.07

avellana x americana 96164 67 31 46.3 45 13.3 38 42.1 16 93.8 1.08

avellana x heterophylla 96170 51 24 47.1 57 56.1 24 37.5 9 100.0 0.92

avellana x cornuta 96165 57 0 0.0 ------

avellana x californica 96168 70 0 0.0 ------

avellana x sieboldiana 96166 46 0 0.0 ------

avellana x colurna 96169 61 13 21.3 16 18.8 10 10.0 1 100.0 1.20

0\ Table A9 Intra- and interspecific crossing, seed germination and seedling performance results of C. americana (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm)

americana x americana 96101 48 28 58.3 93 9.7 87 95.4 51 96.1 0.71 96105 130 108 83.1 310 5.2 98 69.4 50 94.0 0.76 96109 177 20 11.3 48 8.3 44 72.3 34 100.0 0.77 96113 85 38 44.7 100 6.0 91 83.5 53 92.5 0.62 96117 60 22 36.7 47 66.0 15 20.0 3 100.0 0.75 96121 270 83 30.7 355 3.9 94 70.2 51 90.2 0.85

americana x avellana 96102 48 20 41.7 70 15.7 55 87.3 48 95.8 0.92 96110 100 10 10.0 16 31.3 11 63.6 7 100.0 0.97 96118 158 14 8.9 45 82.2 7 42.9 3 100.0 0.67

americana x heterophylla 96104 50 32 64.0 112 18.8 78 73.1 50 98.0 0.71 96112 107 9 8.4 10 10.0 9 100.0 9 100.0 0.71 96119 115 15 13.0 23 87.0 3 0.0 - - -

americana x cornuta 96103 52 0 0.0 _ . _ _ » _ _ 96111 136 0 0.0 - - - - - . - 96123 200 0 0.0 ------

americana x californica 96106 87 11 12.6 13 0.0 13 53.9 7 100.0 0.90 96114 100 25 25.0 30 16.7 25 88.0 22 100.0 0.74 96122 340 3 0.9 3 0.0 3 100.0 3 100.0 1.13

OS ON Table A9 (continued) Intra- and interspecific crossing, seed germination and seedling performance results of C. americana (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm)

americana x sieboldiana 96108 120 79 65.8 271 21.0 76 43.4 33 66.7 0.75 96116 85 50 58.8 92 35.9 52 73.1 38 94.7 0.60 96120 73 5 6.9 5 100.0

americana x colurna 96107 ' 83 10 12.1 13 7.7 8 50.0 4 100.0 0.84 96115 114 17 14.9 23 17.4 18 33.3 6 83.3 0.60 96124 260 0 0.0

americana x chinensis* 96125 62 0 0.0 ------

A single genotype of C. chinensis was used as pollen parent

ON Table AlO Intra-and interspecific crossing, seed germination and seedling performance results of C. heterophylla (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm)

heterophylla x heterophylla 96190 50 18 36.0 48 18.8 16 43.8 7 100.0 0.54

heterophylla x avellana 96191 52 0 0.0 -

heterophylla x americana 96192 47 0 0.0 -

heterophylla x cornuta 96193 42 0 0.0 -

0\ 00 Table All Intra- and interspecific crossing, seed germination and seedling performance results of C. cornuta (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm)

cornuta x cornuta 96126 60 12 20.0 20 45.0 10 30.0 3 33.3 0.45 96130 50 22 44.0 34 47.1 14 0.0 96134 31 8 25.8 11 36.4 5 40.0 2 100.0 0.32 96138 25 6 24.0 9 33.3 5 40.0 2 50.0 0.31

cornuta x californica 96132 90 65 72.2 111 27.9 63 49.2 29 72.4 0.67 96140 12 6 50.0 8 25.0 5 80.0 4 50.0 0.85

cornuta x sieboldiana 96133 70 42 60.0 70 54.3 221 23.8 5 60.0 0.60 96141 15 3 20.0 4 75.0 1 0.0

cornuta x americana 96127 70 1 1.4 1 0.0 1 100 1 0.0 96135 35 0 0.0 -

cornuta x heterophylla 96129 63 3 4.8 3 100.0 8 25.0 2 100.0 0.47 96137 50 15 30.0 17 47.1

cornuta x avellana 96131 90 13 14.4 14 100.0 - - - - - 96139 19 0 0.0

cornuta x colurna 96128 75 0 0.0 - - - - - 96136 37 0 0.0 - -

Ov NO Table A12 Intra- and interspecific crossing, seed germination and seedling performance results of C. californica (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm)

californica x californica 96146 69 24 34.8 32 15.6 20 20.0 4 100.0 0.99 96150 100 36 36.0 62 16.1 63 25.4 16 93.8 0.97

californica x cornuta 96152 70 36 51.4 51 47.1 26 26.9 7 100.0 0.73

californica x sieboldiana 96153 65 10 15.4 11 45.5 5 60.0 3 100.0 0.89

californica x americana 96147 45 6 13.3 8 62.5 3 0.0 - - -

californica x heterophylla 96149 50 28 56.0 41 56.1 15 53.3 8 87.5 0.75

californica x avellana 96151 58 28 48.3 42 31.0 25 64.0 16 75.0 0.98

californica x colurna 96148 25 5 20.0 5 40.0 3 66.7 1 0.0 -

o~0 Table A13 Intra- and interspecific crossing, seed germination and seedling performance results of C. sieboldiana (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm) sieboldiana x sieboldiana 96201 227 138 60.8 389 19.0 75 90.7 49 89.8 0.58 96206 360 225 62.5 624 31.1 64 87.5 46 91.3 0.59 96210 260 88 33.9 267 41.2 51 49.0 25 80.0 0.49 sieboldiana x cornuta 96208 255 91 35.7 185 43.8 54 47.4 27 66.7 0.54 sieboldiana x californica 96203 295 39 13.2 62 17.7 47 85.1 40 85.0 0.71 96212 180 27 15.0 43 39.5 26 76.9 20 100.0 0.74 sieboldiana x americana 96207 340 2 0.6 2 0.0 1 100.0 1 0.0 - sieboldiana x heterophylla 96209 290 25 8.6 28 71.4 8 62.5 5 100.0 0.49 sieboldiana x avellana 96202 360 0 0.0 - - - - 96211 430 1 0.2 1 100.0 - sieboldiana x colurna 96204 228 0 0.0 - - - - - 96213 450 0 0.0 - - sieboldiana x chinensis * 96205 70 0 0.0 ------

A single genotype of C. chinensis was used as pollen parent. Table A14 Intra- and interspecific crossing, seed germination and seedling performance results of C. colurna (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm) colurna x colurna 96171 25 5 20.0 22 22.7 16 81.3 12 91.7 0.56 colurna x chinensis 96178 41 16 39.0 86 15.1 61 73.8 39 87.2 1.00 colurna x avellana 96173 23 7 30.4 31 80.7 6 83.3 5 100.0 0.96 colurna x americana 96172 9 1 11.1 3 100.0 - - - - colurna x heterophylla 96176 7 1 14.3 1 100.0 - - - - colurna x cornuta 96175 5 0 0.0 ------colurna x californica 96174 45 1 2.2 1 100.0 - - - - colurna x sieboldiana 96177 33 1 3.0 1 100.0 - - - -

to Table A15 Intra- and interspecific crossing, seed germination and seedling performance results of C. chinensis (as female) in 1996.

Nut set and blank nut formation Seed germination Seedling survival and vigor

# # % # % # % Trunk Crosses Progeny Flowers Clusters Cluster Seeds Empty # % Seedlings Seedling diameter code pollinated harvested set harvested nuts Stratified Germination planted survival (cm)

chinensis x chinensis * 96218 4 0 0.0 - - - .

chinensis x colurna 96223 7 3 42.9 25 24.0 18 94.4 17 94.1 1.03

chinensis x avellana 96220 14 5 35.7 28 35.7 17 88.2 15 86.7 1.26

chinensis x americana 96219 4 0 0.0 - - - .

chinensis x heterophylla 96225 1 0 0.0 - - - -

chinensis x cornuta 96222 7 0 0.0 - - - -

chinensis x californica 96221 2 0 0.0 - - - .

chinensis x sieboldiana 96224 6 0 0.0 - - - -

* In cross of chinensis x chinensis, the female and male parent is the same clone, and no set was obtained due to self incompatibility. Generally the flower number on this C. chinensis genotype was low because it had just started to flower after a long juvenility period. 174

Table A16 Intra- and interspecific crossing results of C. avellana (as female) in 1997.

Nut set and blank nut formation # # % # % Progeny Flowers Clusters Cluster Seeds Empty nuts Crosses code pollinated harvested set harvested

avellana x avellana 97167 125 80 64.0 179 7.3 97173 85 68 80.0 138 15.2 97178 170 92 54.1 131 32.1 97185 200 121 60.5 171 33.9

avellana x americana 97170 65 27 41.5 37 16.2 97180 130 71 54.6 112 8.0

avellana x heterophylla 97176 130 6 4.6 8 100.0 97188 150 98 65.3 148 24.3

avellana x heterophylla 97174 190 60 31.6 106 94.3 var. sutchuensis 97186 165 91 55.2 120 53.3

avellana x cornuta 97168 190 0 0.0 . . 97184 130 0 0.0 - -

avellana x californica 97169 170 0 0.0 _ _ 97181 170 0 0.0 - -

avellana x sieboldiana 97175 135 0 0.0 _ _ 97187 165 0 0.0 - -

avellana x colurna 97172 100 0 0.0 _ _ 97183 130 0 0.0 - - 97189 110 0 0.0 - -

avellana x chinensis* 97171 85 0 0.0 . _ 97179 100 0 0.0 - .

* A single genotype of C. chinensis and C. heterophylla var. sutchuensis was used as pollen parent. 175

Table A17 Intra- and interspecific crossing results of C. americana (as female) in 1997.

Nut set and blank nut formation # # % # % Progeny Flowers Clusters Cluster Seeds Empty Crosses code pollinated harvested set harvested nuts

americana x americana 97101 100 52 52.0 122 4.1 97107 34 12 35.5 32 6.3

americana x avellana 97102 63 38 60.3 114 4.4

americana x heterophylla 97103 60 38 63.3 117 16.2

americana x het. van.sutchuensis* 97105 60 39 65.0 112 15.2

americana x cornuta 97108 30 3 10.0 3 100.0 97113 80 5 6.3 5 60.0

americana x californica 97109 35 0 0.0 - -

americana x sieboldiana 97104 60 26 43.3 71 26.8

americana x colurna 97110 23 0 0.0 - -

americana x chinensis* 97106 60 2 3.3 2 0.0 97112 85 3 3.5 3 100.0

* A single genotype of C. chinensis and C. heterophylla var. sutchuensis was used as pollen parent. 176

Table A18 Intra- and interspecific crossing results of C. heterophylla (as female) in 1997.

Nut set and blank nut formation # # % # % Progeny Flowers Clusters Cluster Seeds Empty Crosses code pollinated harvested set harvested nuts

heterophylla x heterophylla 97201 260 0 0.0 - . 97211 270 0 0.0 - - 97217 30 17 56.7 22 77.3 97222 75 8 10.7 14 71.4 97228 155 0 0.0 - -

heterophylla x heterophylla 97205 100 0 0.0 _ . war .sutchuensis* 97218 35 11 31.4 18 88.9

heterophylla x avellana 97204 160 9 5.6 11 63.4 97214 235 6 2.6 7 42.9 97220 60 4 6.7 6 100.0 97229 200 18 9.0 22 9.1

heterophylla x americana 97206 180 1 0.6 1 0.0 97212 200 8 4.0 8 25.0 97227 45 0 0.0 - - 97230 140 3 2.1 3 0.0

heterophylla x cornuta 97202 50 0 0.0 . _ 97226 70 0 0.0 - - 97232 190 0 0.0 - -

heterophylla x californica 97203 94 0 0.0 . ■ 97223 45 0 0.0 - -

heterophylla x sieboldiana 97209 115 0 0.0 . _ 97216 60 0 0.0 - - 97224 70 1 1.4 1 100.0 97231 150 0 0.0 - -

heterophylla x colurna 97207 110 0 0.0 . . 97225 45 1 2.2 3 100.0

heterophylla x chinensis* 97208 75 0 0.0 _ _ 97213 205 0 0.0 - - 97221 40 4 10.0 7 100.0

* A single genotype of C. chinensis and C. heterophylla var. sutchuensis was used as pollen parent. 177

Table A19 Intra- and interspecific crossing results of C. cornuta (as female) in 1997.

Nut set and blank nut formation # # % # % Progeny Flowers Clusters Cluster Seeds Empty Crosses code pollinated harvested set harvested nuts

cornuta x cornuta 97122 45 18 40.0 26 11.5 97127 115 64 55.7 124 22.6 97133 185 40 21.6 64 0.0 97139 55 37 67.3 67 19.4

cornuta x californica 97131 90 29 32.2 38 13.2 97137 80 21 26.3 31 58.1

cornuta x sieboldiana 97129 90 56 62.2 98 13.3 97141 75 49 65.3 102 13.7

cornuta x americana 97126 80 1 1.3 3 100.0 97135 140 11 7.9 13 69.2

cornuta x heterophylla 97124 70 38 54.3 54 20.4 97143 50 32 64.0 58 50.0

cornuta x heterophylla 91132 95 0 0.0 var. sutchuensis* 97136 180 7 3.9 8 25.0

cornuta x avellana 97130 100 0 0.0 97138 135 15 11.1 20 100.0

cornuta x colurna 97123 80 19 23.8 21 28.6 97142 60 0 0.0

cornuta x chinensis* 97125 95 0 0.0 - - 97134 100 0 0.0

''A single genotype of C. chinensis and C. heterophylla var. sutchuensis was used as pollen parent 178

Table A20 Intra- and interspecific crossing results of C. californica (as female) in 1997.

Nut set and blank nut formation # # % # % Progeny Flowers Clusters Cluster Seeds Empty Crosses code pollinated harvested set harvested nuts

californica x californica 97144 90 40 44.4 40 7.5 97149 90 26 28.9 37 8.1 97155 no 79 71.8 125 12.0 97162 85 58 68.2 94 14.9

californica x cornuta 97145 85 19 22.4 19 42.1 97159 80 54 67.5 73 31.5

californica x sieboldiana 97147 70 28 40.0 29 24.1 97165 65 46 70.8 87 39.1

californica x americana 97153 90 31 34.4 32 0.0 97160 120 50 41.7 70 42.9 97166 75 35 46.7 49 36.7

californica x heterophylla 97152 100 21 21.0 21 14.3 97158 75 57 76.0 91 28.6

californica x heterophylla 97154 40 2 5.0 2 0.0 var. sutchuensis* 97163 65 34 52.3 49 55.1

californica x avellana 97146 80 26 32.5 28 14.3 97164 78 55 70.5 84 20.2

californica x colurna 97151 70 22 31.4 22 4.6 97157 115 69 60.0 100 30.0

californica x chinensis* 97150 30 0 0.0 . . 97156 70 14 20.0 17 64.7

^A single genotype of C. chinensis and C. heterophylla var. sutchuensis was used as pollen parent. 179

Table All Intra- and interspecific crossing results of C. sieboldiana (as female) in 1997.

Nut set and blank nut formation # # % # % Progeny Flowers Clusters Cluster Seeds Empty Crosses code pollinated harvested set harvested nuts sieboldiana x sieboldiana 97239 225 149 66.2 423 8.5 97245 230 81 35.2 162 30.3 97251 125 91 72.8 251 14.3 97258 205 123 60.0 229 13.5 sieboldiana x cornuta 97246 240 21 8.8 43 69.8 97253 120 40 33.3 115 32.2 sieboldiana x californica 97241 200 85 42.5 188 18.1 97256 100 35 35.0 102 34.3 97263 160 60 37.5 90 30.0 sieboldiana x americana 97250 300 16 5.3 39 97.4 97259 100 0 0.0 - - sieboldiana x heterophylla 97249 155 3 1.9 9 100.0 97254 180 6 3.3 13 84.6 97264 160 2 1.3 17 94.1 sieboldiana x heterophylla 97248 285 9 3.2 17 100.0 var. sutchuensis* 97255 120 0 0.0 - - sieboldiana x avellana 97242 235 0 0.0 . _ 97260 180 0 0.0 - - 97262 180 0 0.0 - - sieboldiana x colurna 97247 250 5 2.0 10 100.0 97252 185 3 1.6 3 0.0 sieboldiana x chinensis* 97244 200 0 0.0 _ _ 97257 80 0 0.0 ~ -

"'A single genotype of C. chinensis and C. heterophylla var. sutchuensis was used as pollen parent. 180

Table A22 Intra- and interspecific crossing results of C. colurna (as female) in 1997.

Nut set and blank nut formation # # % # % Crosses Progeny Flowers Clusters Cluster Seeds Empty code pollinated harvested set harvested nuts

colurna x colurna 97191 105 50 47.6 357 2.0

colurna x chinensis* 97199 30 12 40.0 78 10.3

colurna x avellana 97193 125 30 24.0 103 94.2

colurna x americana 97197 35 0 0.0 - -

colurna x heterophylla 97198 45 0 0.0 - -

colurnax heter. var. sutchuensis* 97192 75 0 0.0 - -

colurna x cornuta 97194 58 0 0.0 - -

colurna x californica 97195 65 0 0.0 - -

colurna x sieboldiana 97196 65 0 0.0 - -

''A single genotype of C. chinensis and C. heterophylla var. sutchuensis was used as pollen parent. 181

Table A23 Intra- and interspecific crossing results of C. chinensis (as female) in 1997.

Nut set and blank nut formation # # % # % Crosses Progeny Flowers Clusters Cluster Seeds Empty code pollinated harvested set harvested nuts

chinensis x chinensis* 97265 13 0 0.0 - -

chinensis x colurna 97272 9 7 77.8 36 22.2

chinensis x avellana 97269 21 10 47.6 44 15.9

chinensis x americana 97271 21 6 28.6 22 4.6

chinensis x heterophylla 97268 22 0 0.0 - -

chinensis x heter. var. sutchuensis** 97270 24 0 0.0 - -

chinensis x cornuta 97266 15 0 0.0 - -

chinensis x californica 97267 13 3 23.1 4 75.0

chinensis x sieboldiana 97273 17 0 0.0 - -

* In cross of chinensis x chinensis female parent and male parent was the same genotype that no seed formation occurred due to self incompatibility. ** A single genotype of C. heterophylla var. sutchuensis was used as pollen parent. 182

Table A24 Pollen-stigma interactions of self-pollinated genotypes ofCorylus species.

Species Reaction to self Species Reaction to self pollination* pollination

C. avellana C. cornuta HennemanM (SjSrf** I CC3.016 I Segorbe (SAJ** I Tombul Ext'ra Ghiaghli (S^)** C C. cornuta var. californica C. americana Y3 366.060 I Y18 366.088 I Y20 401.067 I Y28 530.039 I Y32 530.069 I Y34 532.039 I Y37 532.051 I C. sleboldlana C. heterophylla CC 1.023 366.060 I CC 1.043 404.042 I CC 1.054 530.013 I CC 1.074 530.018 I CC 1.061 530.021 I CC 1.093 T27 I CC2.070 T28 I CCS #396 CCS #347

* 1= Self-Incompatible, C= self-compatible. ** Self-incompatibility alleles of C. avellana cultivars are shown. All alleles in the pistil are codominant whereas underlined alleles are dominant in the pollen. Table A25 Cross-compatibilities of some genotypes within species in Corylus.

Female Genotype Male Genotype Reaction** Female Genotype Male Genotype Reaction

C. avellana C. avellana C. americana C. americana Mortarella (S2S17)* Badem (S2S5)* C 532.014 401.026 I Barcelona (S1S2)* C 403.046 C Henneman #3 (S^S^)* C Imperiale de Trebizonde (S2S10)* C C. heterophylla C. heterophylla Segorbe (S9S23)* C T28 T27 C Tombul Extra Ghiaghli (848,2)* C 402.013 I Tombul Ghiaghli (S4S8)* C 402.050 I Willamette(S,S3)* C 404.047 I Casina (S10S21)* Segorbe (S9S23)* C 559.055 c Mortarella (828,7)* C 559.059 c Tombul Extra Ghiaghli (848^2)* C 366.097 404.038 c 245.098 (SaSg)*** Tombul Extra Ghiaghli (848,2)* I 404.045 I 453.081 (SjS,)* Segorbe (89823)* I 404.061 I 530.018 I C. americana C. americana 530.030 I 401.067 400.008 I 530.031 I 401.023 c 559.059 I 530.039 I 531.013 c C. cornuta C. cornuta 532.039 c CC3.035 CC3.016 c 532.014 400.027 c CC3.049 c * Self incompatibility alleles of C. avellana cultivars. All alleles in the pistil are codominant whereas underlined alleles are dominant in the pollen ** 1= self-incompatible, C= self-compatible. *** The cross 245.098 x 'Tombul Extra Ghiaghli' should be compatible based on the S alleles they have. Incompatible reaction might be due to old flower action or mislabelled preparations. OO Table A25 (continued) Cross-compatibilites of some genotypes within species in Corylus.

Female Genotype Male Genotype Reaction* Female Genotype Male Genotype Reaction

C. cornuta var. californica C. cornuta var. C. cornuta C. cornuta californica CC3.035 CC3.059 C Y28 C CC4.002 I Y3 Y30 C CC4.004 I Y32 C CC4.007 I Y34 C CC4.012 I Y37 C CC4.021 C CC2.089 I CC4.032 C CC4.041 c C. sieboldiana C. sieboldiana CC4.042 c CC 1.054 CC2.070 C CC4.049 CC3.038 c CC2.096 I CC3.059 c CCS #396 C CC4.007 c CC 1.095 CC1.014 C CC4.016 I CC 1.054 C CC4.026 I CC 1.061 C CC4.034 c CC 1.074 C CC2.070 I C. cornuta var. C. cornuta var. CC2.073 c californica californica Y3 Y5 I CC2.096 I Y18 c CCS #396 c Y20 I

1= self-incompatible, C= self-compatible

00 Table A26 Cross-compatibilites of C. avellana with other wild Corylus species

Female Genotype Male Genotype Reaction* Female Genotype Male Genotype Reaction

C. avellana C. americana C. avellana C. cornuta var. californica Mortarella 401.026 C Mortarella CC2.088 I VR20-11 401.026 I Segorbe CC2.088 C VR20-11 532.051 I Segorbe 532.051 C C. avellana C. sieboldiana Tombul Extra Ghiaghli 532.061 C Casina CC2.070 C Tombul Extra Ghiaghli 403.064 I Mortarella CC2.070 I Casina 403.064 C 245.098 CC2.070 c Tombul Extra Ghiaghli CC1.061 I C. avellana C. heterophylla 276.076 CC 1.061 c Mortarella 402.050 C Cutleaf CC1.061 c Tombul Extra Ghiaghli 402.050 I Mortarella T29 C C. avellana C. columa Segorbe T29 C Casina Xll I VR20-11 T29 I Cutleaf Xll I 245.098 T29 I Tombul Extra Ghiaghli Xll I Segorbe Xll I C. avellana C. cornuta 276.076 Xll c Casina CC4.034 C Mortarella CC4.034 I C. avellana C. chinensis Segorbe CC4.034 c Casina W4 I Voile Zeller CC4.034 I VR20-11 W4 c VR20-11 CC4.034 c Casina CC3.059 c C. avellana C. jacquemontii Tombul Extra Ghiaghli CC3.059 I Henneman #3 88501-2 c VR20-11 CC3.059 c 532.100 88501-2 I * 1= Incompatible C= co mpatible 00 Table A27 Cross-compatibilites of C. americana with other Corylus species.

Female Genotype Male Genotype Reaction* Female Genotype Male Genotype Reaction

C. americana C. avellana C. americana C. sieboldiana 532.014 Mortarella I 401.067 CCS #397 C 533.069 Mortarella C 530.069 CCS #397 I 401.067 CC 1.043 C C. americana C. heterophylla 532.014 CC 1.043 C 532.014 402.013 C 532.061 402.013 C C. americana C. colurna 533.069 402.013 I 532.014 Xll 532.014 T29 C 533.069 Xll 533.069 T29 C 366.088 Xll 366.060 404.038 C 401.067 Xll 366.088 404.038 C 366.088 X13 401.067 X13 C. americana C. cornuta 532.014 CC4.034 I C. americana C. chinensis 533.069 CC4.034 C 366.060 W5 366.088 CC4.034 I 530.069 W5 530.039 CC4.034 I 532.014 W5 532.039 CC3.059 I 530.069 CC3.059 I C. americana C. jacquemontii 366.060 88501-2 C. americana C. cornuta var. 366.088 88501-2 califomica 532.061 Y37 401.067 88501-2 366.088 Y37 366.088 397.027 532.014 CC2.088 532.014 397.050 366.060 CC2.088 401.067 397.050 06 * 1= incompatible C= compatible 0\ Table A28 Cross-compatibilites of C. heterophylla with other Corylus species.

Female Genotype Male Genotype Reaction* Female Genotype Male Genotype Reaction

C. heterophylla C. avellana C. heterophylla C. cornuta van califomica T28 Tombul Extra Ghiaghli C T28 Y29 C 530.018 Tombul Extra Ghiaghli I 530.021 Y29 I 530.021 Tombul Extra Ghiaghli I T28 Y37 C 404.044 Tombul Extra Ghiaghli C R27 CC2.088 I 530.018 Segorbe C T28 CC2.088 C 530.021 Segorbe I 366.097 Segorbe c C. heterophylla C. sieboldiana R27 CC 1.061 I C. heterophylla C. americana 530.018 CC 1.061 I R27 400.008 I 366.097 CC 1.061 I 366.097 400.008 I 404.044 CC 1.044 C 530.018 400.008 c 530.021 400.008 c C. heterophylla C. colurna 366.097 531.013 I R27 Peavy I 530.018 531.013 I 404.044 Peavy c 530.021 531.013 c C. heterophylla C. chlnensls C. heterophylla C. cornuta T28 W4 c 404.044 CC3.059 I T28 W5 I 530.018 CC3.059 I 530.021 W5 I T28 CC4.007 I 530.021 CC4.007 I C. heterophylla C. jacquemontil R27 CC4.018 I 404.044 88501-2 c 404.044 CC4.018 I 530.013 88501-2 c 530.021 88501-2 I

* 1= incompatible C= compatible 00 ^1 Table A29 Cross-compatibilites of C. cornuta with other Corylus species.

Reaction* Female Genotype Male Genotype Reaction Female Genotype Male Genotype C. cornuta C. avellana C. comuta C. colurna CC3.035 Segorbe I CC2.057 XI1 I CC3.049 Segorbe C CC2.115 Xll I CC3.056 Tombul Extra Ghiaghli C CC3.035 Xll I CC3.056 Xll I C. cornuta C. americana CC3.049 Xll C CC3.035 400.008 I CC3.035 X13 I CC3.049 400.008 c CC3.049 X13 C CC2.057 401.023 c CC3.056 X13 c CC2.046 401.023 I CC2.057 531.013 I C. cornuta C. chinensis CC3.049 531.013 c CC2.057 W5 I CC3.056 531.013 I CC3.035 W5 I CC4.049 531.013 c C. cornuta C. jacquemontii C. cornuta C. heterophylla CC3.035 396.027 I CC2.057 404.038 c CC3.049 396.027 c CC3.035 404.038 I CC2.057 88501-2 I CC3.035 559.059 c CC3.035 88501-2 I CC3.049 559.059 I CC3.049 88501-2 I

C. comuta C. sieboldiana C. cornuta C. comuta var. californica CC2.057 CC 1.061 c CC3.035 Y3 I CC4.049 CC 1.061 I CC3.049 Y3 c CC3.049 CC1.014 I CC2.057 CC2.089 c CC3.056 CC1.014 c CC4.049 CC2.089 c * 1= incompatible C= compatible 00 00 Table A30 Cross-compatibilites of C. sieboldiana with other Corylus species.

Female Genotype Male Genotype Reaction* Female Genotype Male Genotype Reaction

C. sieboldiana C. avellana C. sieboldiana C. cornuta var californica CC 1.024 Tombul Extra Ghiaghli I CC 1.024 Y18 C CC 1.074 Tombul Extra Ghiaghli C CC 1.054 Y18 I CCS #347 Tombul Extra Ghiaghli I CC 1.024 CC2.088 C CCS #347 Segorbe c CC 1.054 CC2.088 I CC 1.074 Mortarella c C. sieboldiana C. colurna C. sieboldiana C. americana CC 1.024 XI1 I CC 1.024 400.008 I CC 1.074 Xll I CC 1.074 400.008 c CCS #347 X13 I CC 1.024 531.013 I CCS #396 X13 I CC 1.074 531.013 c CCS #350 Peavy I

C. sieboldiana C. heterophylla C. sieboldiana C. chinensis CC 1.024 404.038 c CCS #347 W5 C CC 1.028 404.038 I CCS #350 W5 C CC2.070 404.038 I CCS #396 W5 I CC 1.028 559.059 I CCS #350 W4 c CCS #396 559.059 I C. sieboldiana C. jacquemontii C. sieboldiana C cornuta CC 1.024 88501-2 I CC 1.054 CCS. 059 I CC 1.074 88501-2 I CC 1.074 CC3.059 c CCS #347 88501-2 I CC2.070 CC3.059 c CCS #347 397.027 I CC 1.074 CC4.018 c CCS #350 397.050 c CC2.070 CC4.018 I

* I=incompatible C= compatible 00 Table A31 Sequence alignment (674 bp) of nuclear ribosomal DNA internal transcribed spacer (ITS) region for Corylus species. R=A/G, S=C/G, W=A/T, Y=C/T.

11111111112222222222333333333344 44 444 444555555555566666666 Taxon/Node 1234567890123456789012345678901234567890123456789012345678901234567 avellana-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG avellana-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG avellana-3 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG maxima-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG maxima-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG cornuta-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG cornuta-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG cornuta-3 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG californica-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG californica-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG californica-3 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG sieboldiana-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG sieboldiana-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG sieboldiana-3 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG americana-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG americana-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG americana-3 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG heterophylla-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG heterophylla-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG heterophylla-3 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG colurna-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG colurna-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG chinensis-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG chinensis-2 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG chinensis-3 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG chinensis-4 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG paperbark-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG jacquemontii-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG ferox-1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTG Carpinus TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTGCCCAGCAGAACGACCCGCGAACTTG © Table A31 (Continued)

11111111111111111111111111111111111 6677777777778888888888999999999900000000001111111111222222222233333 Taxon/Node 8901234567890123456789012345678901234567890123456789012345678901234

avellana-1 TATAAACAACCGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG avellana-2 TATAAACAACCGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG avellana-3 TATAAACAACCGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG maxima-1 TATAAACAACCGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG maxima-2 TATAAACAACCGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG cornuta-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG cornuta-2 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG cornuta-3 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG californica-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG californica-2 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG californica-3 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG sieboldiana-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG sieboldiana-2 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG sieboldiana-3 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG americana-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG americana-2 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG ainericana-3 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG heterophylla-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—-CTCGTG heterophylla-2 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG heterophylla-3 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG colurna-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG colurna-2 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG chinensis-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACACTCTCGTG chinensis-2 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACACTCTCGTG chinensis-3 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG chinensis-4 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACACTCTCGTG paperbark-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA—CTCGTG jacquemontii-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCGGGGAGACA--CTCGTG ferox-1 TATAAACAACTGGGGGCGGGGGGCGTTCTCGCCCCGTGCCCCCGAACGGCAGGGAGGCA—CCCGTG Carpinus TATAAACAACCGGGGGC-AGGGGCGATCTCGCCCCGTGCCCTCGAACGGCAGGGAGACA—CTCGTG Table A31 (Continued)

1111H1111111111111111111111111H111111111111111111111H11111111122 33333444 4444 4 445555555555666666666677777777778888888888999999999900 Taxon/Node 5678 901234567890123456789012345678901234567890123456789012345678901 avellana-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC avellana-2 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC avellana-3 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC maxima-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC maxima-2 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC cornuta-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC cornuta-2 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC cornuta-3 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC californica-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC californica-2 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC californica-3 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC sieboldiana-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC sieboldiana-2 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC sieboldiana-3 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC americana-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC americana-2 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC americana-3 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC heterophylla-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC heterophylla-2 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC heterophylla-3 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC colurna-1 CCTTCTCGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTGAAGAGTGCCTCC colurna-2 CCTTCTCGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTGAAGAGTGCCTCC chinensis-1 CCTTCTCGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC chinensis-2 CCTTCTCGCCGAACAACG-AACCCCGGCGCGGTYTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC chinensis-3 CCTTCTCGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC chinensis-4 CCTTCTCGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC paperbark-1 CCTTCTTGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC jacquemontii-1 CCTTCTYGCCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAACTAAAGAGTGCCTCC ferox-1 CCTTCCTGCCGAACAACGAAACCCCGGCGCGGTCTGCGCCAAGGAACTTCAATTAAAGAGTGCCTCC Carpinus CCTTCTTGTCGAACAACG-AACCCCGGCGCGGTCTGCGCCAAGGAACTTCAATTAAAGAGTGCCTCC

to Table A31 (Continued)

2222222222222222222222222222222222222222222222222222222222222222222 000000001111111111222222222233333333334 444 44 44 44 5555555555666666666 Taxon/Node 23456789012345678 90123456789012345678901234567890123456789012345678 avellana-1 GGTCGCCTCGGAAACGGCGTGCGTGCCGGGGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA avellana-2 GGTCGCCTCGGAAACGGCGTGCGTGCCGGGGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA avellana-3 GGTCGCCTCGGAAACGGCGTGCGTGCCGGGGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA maxima-1 GGTCGCCTCGGAAACGGCGTGCGTGCCGGGGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA maxima-2 GGTCGCCTCGGAAACGGCGTGCGTGCCGGGGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA cornuta-1 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA cornuta-2 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA cornuta-3 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA californica-1 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA californica-2 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA californica-3 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA sieboldiana-1 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAASGACTCTCGGCAA sieboldiana-2 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAASSACTCTCGGCAA sieboldiana-3 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA americana-1 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA americana-2 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA americana-3 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCGAAACCATAACGACTCTCGGCAA heterophylla-1 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA heterophylla-2 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA heterophylla-3 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA colurna-1 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA colurna-2 GGTCGCCTCGGAAACGGCGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA chinensis-1 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA chinensis-2 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA chinensis-3 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA chinensis-4 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA paperbark-1 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA jacquemontii-1 GGTCGGCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTGCAAAACCATAACGACTCTCGGCAA ferox-1 GGTCGCCTCGGAAACGGTGTGCGTGCCGGAGGCGAATCTTGTMCMAAACCATAACGACTCTCGGCAA Carpinus GGTCGCCTCGGAAACGATGCGCGTGTCGGAGACGAATCTTGTACAAAACCATAACGACTCTCGGCAA so Table A31 (Continued)

2222222222222222222222222222222333333333333333333333333333333333333 6777777777788888888889999999999000000000011111111112222222222333333 Taxon/Node 901234567890123456789012345678901234 5678901234567890123456789012345 avellana-1 CGGATATCTCGGCTCTCGCATCGATGA^GAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA avellana-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA avellana-3 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA maxima-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA maxima-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA cornuta-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA cornuta-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA cornuta-3 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA californica-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA californica-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA californica-3 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA sieboldiana-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA sieboldiana-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA sieboldiana-3 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA americana-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA americana-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA americana-3 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA heterophylla-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA heterophylla-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA heterophylla-3 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA colurna-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA colurna-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA chinensis-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA chinensis-2 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA chinensis-3 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA chinensis-4 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA paperbark-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA jacquemontii-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA ferox-1 CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA Carpinus CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAA Table A31 (Continued)

3333333333333333333333333333333333333333333333333333333333333333444 33334 4444 4 444 4 55555555556666666666777777777788888888889999999999000 Taxon/Node 6789012345678901234567890123456789012345678901234567890123456789012 avellana-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC avellana-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC avellana-3 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC maxima-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC maxima-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC cornuta-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC cornuta-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC cornuta-3 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC californica-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC californica-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC californica-3 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC sieboldiana-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC sieboldiana-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC sieboldiana-3 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC americana-l TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC americana-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC americana-3 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC heterophylla-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC heterophylla-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC heterophylla-3 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC colurna-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC colurna-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC chinensis-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC chinensis-2 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC chinensis-3 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC chinensis-4 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC paperbark-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC jacquemontii-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC ferox-1 TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC Carpinus TCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTCGAGGGCACGTCTGC Table A31 (Continued)

4444444444444444444444444444444444444444444444444444444444444444444 0000000111111111122222222223333333333444 4 4 444 4455555555556666666666 Taxon/Node 34 56789012345678901234567890123456789012345678901234567890123456789 avellana-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG avellana-2 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG avellana-3 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG maxima-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG maxima-2 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG cornuta-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG cornuta-2 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG cornuta-3 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG californica-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG californica-2 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG californica-3 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG sieboldiana-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG sieboldiana-2 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG sieboldiana-3 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGGCGAGGGCGGTCTGCG americana-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG ainericana-2 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG americana-3 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAKGGCGGTCTGCG heterophylla-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-ATCATCGCCTCTCCAAGAGACGAGGGCGGTCTGCG heterophylla-2 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-ATCATCGCCTCTCCAAGAGACGAGGGCGGTCTGCG heterophylla-3 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-ATCATCGCCTCTCCAAGAGACGAGGGCGGTCTGCG colurna-1 CTGGGCGTCACGCATCGTTGCCCCCAACCCCCAT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG colurna-2 CTGGGCGTCACGCATCGTTGCCCCCAACCCCCAT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG chinensis-1 CTGGGCGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG chinensis-2 CTGGGCGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG chinensis-3 CTGGGCGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG chinensis-4 CTGGGCGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG paperbark-1 CTGGGTGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG jacquemontii-l CTGGGYGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG ferox-1 CTGGGYGTCACGCATCGTTGCCCCCAACCCC-AT CGCCTCTCCAAGAGACGAGGGCGGTCTGCG Carpinus CTGGGTGTCACGCATCGTCGCCCCCAACCCC-AT CGCCTCTCCAAGAGTCGAGGGCAGTCTGTG Table A31 (Continued)

44 44 4 44 4 444 444 444444444444 44445555555555555555555555555555555555555 7777777777888888888899999999990000000000111111111122222222223333333 Taxon/Node 0123456789012345678901234567890123456789012345678901234567890123456 avellana-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG avellana-2 GGGCGGACATTGGCCTCCCGTGAGCTRTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG avellana-3 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG maxima-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG maxima-2 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG cornuta-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG cornuta-2 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG cornuta-3 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG californica-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG californica-2 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG californica-3 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG sieboldiana-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG sieboldiana-2 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG sieboldiana-3 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG americana-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG americana-2 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG americana-3 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG heterophylla-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG heterophylla-2 GGGCGGACATTGGCCTCCCGTGAGCTYTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG heterophylla-3 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG colurna-1 GGGCGGACATTGGCCTCCCGTGAGCTTCCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG colurna-2 GGGCGGACATTGGCCTCCCGTGAGCTTCCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG chinensis-1 GGGCGGACATTGGCCTCCCGTGAGCTTCCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG chinensis-2 GGGCGGACATTGGCCTCCCGTGAGCTTCCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG chinensis-3 GGGCGGACATTGGCCTCCCGTGAGCTTYCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG chinensis-4 GGGCGGACATTGGCCTCCCGTGAGCTTCCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG paperbark-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG jacquemontii-1 GGGCGGACATTGGCCTCCCGTGAGCTTYCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG ferox-1 GGGCGGACATTGGCCTCCCGTGAGCTTTCGCTCGCGGCTGGCCTAAAAGCGAGTCCTCGGCGACGAG Carpinus GGGCGGACATTGGCCTCCCGTGCGCTTCCAATTGCGGTTGGCCTAAAAGCGAGTCCTAGGCGACGAG Table A31 (Continued)

5555555555555555555555555555555555555555555555555555555555555556666 3334444 444444555555555566666666667777777777888888888899999999990000 Taxon/Node 7890123456789012345678901234567890123456789012345678901234567890123 avellana-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG avellana-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG avellana-3 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG maxima-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG maxima-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG cornuta-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG cornuta-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG cornuta-3 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG californica-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG californica-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG californica-3 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG sieboldiana-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG sieboldiana-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG sieboldiana-3 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCATCTTGTG americana-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG americana-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG americana-3 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG heterophylla-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG heterophylla-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCATGTG heterophylla-3 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG colurna-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGCCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG colurna-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGCCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG chinensis-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGCCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG chinensis-2 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGCCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG chinensis-3 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGCCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG chinensis-4 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGCCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG paperbark-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGCCCCGTCGCGCGCGGCTCGTCGCTCGTCTTGTG jacquemontii-1 CGCCACGACAATCGGTGGTYGACAAACCCTCGTGYCCCGTCGTGCGCGGCTCGTCGCTCGWCTTGTG ferox-1 CGCCACGACAATCGGTGGTTGACAAACCCTCGTGTCCCGTCGTGCGCGGCTCGTCGCTCGTCTTGTG Carpinus CGCCACGACAATCGGTGGTTACCAAACCCTCGTGTCCCGTCGTGCGTGCCTCGTCGCTCATCTTGTG Table A31 (Continued)

666666666666666666666666666666666666666666666666666666666666666 000000111111111122222222223333333333444444444455555555556666666 Taxon/Node 4 56789012345678901234567890123456789012345678901234 567890123456 avellana-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT avellana-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT avellana-3 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT maxima-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT maxima-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT cornuta-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT cornuta-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT cornuta-3 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT californica-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT californica-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT californica-3 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT sieboldiana-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT sieboldiana-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT sieboldiana-3 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT americana-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT americana-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT americana-3 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT heterophylla-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT heterophylla-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT heterophylla-3 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT colurna-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCGACGCGACCCCAGGTCAGGCGGGACT colurna-2 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCGACGCGACCCCAGGTCAGGCGGGACT chinensis-1 CTCTGTGACCCCGTAGCGTCGCGCTCGCGACTCTTCCGACGCGACCCCAGGTCAGGCGGGACT chinensis-2 CTCTGTGACCCYGTAGCGTCGCGCTCGCGACTCTTCCGACGCGACCCCAGGTCAGGCGGGACT chinensis-3 CTCTGTGACCCYGTAGCGTCGCGCTCGCGACTCTTCCGACGCGACCCCAGGTCAGGCGGGACT chinensis-4 CTCTGTGACCCCGTAGCGTCGCGCTCGCGACTCTTCCGACGCGACCCCAGGTCAGGCGGGACT paperbark-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT jacquemontii-1 CTCTGTGACCCTGTAGCGTCGCGCTCGCGACTCTTCCAACGCGACCCCAGGTCAGGCGGGACT ferox-1 CTCTGTGACCCTGTAGCGTCGCGCTYGCGACTYCTYCGACGCGACCCCAGGTCAGGCGGGACT Carpinus CTCTGTGACCCTGTAGCGTCGCGATCGCGACTCTTCCAATGCGACCCCAGGTCAGGCGGGACT Table A32 Sequence alignment (1231 bp) of chloroplast matK. gene for Corylus species.

11111111112222222222333333333344 4444 444 4555555555566666666 Taxon/Node 123456789012345678901234 5678901234567890123456789012345678901234567 avellana-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG avellana-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG avellana-3 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG maxima-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG maxima-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG cornuta-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTCGTTGGAAAATGTAGCTTATG cornuta-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTCGTTGGAAAATGTAGCTTATG cornuta-3 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTCGTTGGAAAATGTAGCTTATG californica-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG californica-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG californica-3 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTCGTTGGAAAATGTAGCTTATG sieboldiana-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG sieboldiana-2 TATATTTATGCACTTGCTCATGATCATGATTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG sieboldiana-3 TATATTTATGCACTTGCTCATGATCATGATTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG americana-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTCGTTGGAAAATGTAGCTTATG americana-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTCGTTGGAAAATGTAGCTTATG americana-3 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTCGTTGGAAAATGTAGCTTATG heterophylla-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG heterophylla-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG heterophylla-3 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG colurna-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG colurna-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG chinensis-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG chinensis-2 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG chinensis-3 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG chinensis-4 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG paperbark-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG jacquemontii-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG ferox-1 TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATGTAGCTTATG Carpinus TATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAGTGATTTTGTTGGAAAATTTAGCTTATG

oO Table A32 (Continued)

11111111111111111111111111111111111 6677777777778888888888999999999900000000001111111111222222222233333 Taxon/Node 8901234567890123456789012345678901234567890123456789012345678901234

avellana-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT avellana-2 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT avellana-3 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT maxima-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT maxima-2 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT cornuta-1 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT cornuta-2 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT cornuta-3 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT californica-1 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT californica-2 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT californica-3 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT sieboldiana-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT sieboldiana-2 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT sieboldiana-3 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT americana-1 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT americana-2 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT americana-3 ATAAAAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT heterophylla-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT heterophylla-2 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT heterophylla-3 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT colurna-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT colurna-2 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT chinensis-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT chinensis-2 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT chinensis-3 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT chinensis-4 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT paperbark-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT jacquemontii-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT ferox-1 ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT Carpinus ATAATAAATCTAGTTTACTTATTGTAAAACGTTTAATTACGCGAATGTATCAACAGAATCATTTGAT O Table A32 (Continued)

1111111111111111111111111111111111111111111111111111111111H1111122 333334 44 4 4 44 4 445555555555666666666677777777778888888888999999999900 Taxon/Node 56789012345678901234 56789012345678901234 567890123456789012345678901 avellana-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG avellana-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG avellana-3 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG maxima-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG maxima-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG cornuta-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG cornuta-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG cornuta-3 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG californica-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG californica-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG californica-3 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG sieboldiana-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG sieboldiana-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG sieboldiana-3 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG americana-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG americana-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG americana-3 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG heterophylla-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG heterophylla-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG heterophylla-3 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG colurna-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG colurna-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG chinensis-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG chinensis-2 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG chinensis-3 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG chinensis-4 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG paperbark-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG jacquemontii-1 GATTTCCGCTAATGATTCTAACCAAAAGAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG ferox-1 GATTTCCGCTAATGATTCTAACCAAAATAAATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG Carpinus GATTTCCGCTAATGATTCTAACCAAAATAGATTTTTGGGATACAACAAGAATTTGTATTCTCAAATG o Table A32 (Continued)

2222222222222222222222222222222222222222222222222222222222222222222 00000000111111111122222222223333333333444 44 44 4445555555555666666666 Taxon/Node 23456789012345678901234 5678901234567890123456789012345678 9012345678

avellana-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG avellana-2 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG avellana-3 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG maxima-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG maxima-2 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG cornuta-1 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG cornuta-2 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG cornuta-3 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG californica-1 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG californica-2 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG californica-3 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG sieboldiana-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG sieboldiana-2 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG sieboldiana-3 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG americana-1 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG americana-2 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG americana-3 ATATCAGAAGGGTTTGCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG heterophylla-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG heterophylla-2 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG heterophylla-3 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG colurna-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG colurna-2 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG chinensis-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG chinensis-2 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG chinensis-3 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG chinensis-4 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG paperbark-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG jacquemontii-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG ferox-1 ATATCAGAAGGGTTTGCAATCGTTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG Carpinus ATATCAGAAGGATTTTCAATCATTGCGGAAATCCCATATTCTCTACGATTAATATCTTCTTTGGAAG O Table A32 (Continued)

2222222222222222222222222222222333333333333333333333333333333333333 6777777777788888888889999999999000000000011111111112222222222333333 Taxon/Node 9012345678901234567890123456789012345678901234567890123456789012345

avellana-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA avellana-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA avellana-3 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA maxima-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA maxima-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA cornuta-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA cornuta-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA cornuta-3 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA californica-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA californica-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA californica-3 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA sieboldiana-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA sieboldiana-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA sieboldiana-3 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA americana-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA americana-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA americana-3 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA heterophylla-1 GGGCACAAATCATAAGATCTTATAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA heterophylla-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA heterophylla-3 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA colurna-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA colurna-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA chinensis-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA chinensis-2 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA chinensis-3 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA chinensis-4 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA paperbark-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA jacquemontii-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA ferox-1 GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA Carpinus GGGCACAAATCATAAGATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAA o Table A32 (Continued)

3333333333333333333333333333333333333333333333333333333333333333444 33334 4 444 44 4 44 55555555556666666666777777777788888888889999999999000 Taxon/Node 678901234 5678901234 5678901234 56789012345678901234567890123456789012 avellana-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT avellana-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT avellana-3 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT maxima-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT maxima-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT cornuta-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT cornuta-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT cornuta-3 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT californica-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT californica-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT californica-3 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT sieboldiana-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT sieboldiana-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT sieboldiana-3 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT americana-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT americana-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT americana-3 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT heterophylla-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT heterophylla-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT heterophylla-3 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT colurna-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT colurna-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT chinensis-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT chinensis-2 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT chinensis-3 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT chinensis-4 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT paperbark-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT jacquemontii-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT ferox-1 ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT Carpinus ATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTT

O Table A32 (Continued)

4444444444444444444444444444444444444444444444444444444444444444444 0000000111111111122222222223333333333444 44 44 44 455555555556666666666 Taxon/Node 34 56789012345678901234 567890123456789012345678901234567890123456789

avellana-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT avellana-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT avellana-3 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT maxima-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT maxima-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT cornuta-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT cornuta-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT cornuta-3 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT californica-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT californica-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT californica-3 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT sieboldiana-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT sieboldiana-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT sieboldiana-3 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT americana-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT americana-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT americana-3 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT heterophylla-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT heterophylla-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT heterophylla-3 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT colurna-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT colurna-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT chinensis-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT chinensis-2 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT chinensis-3 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT chinensis-4 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT paperbark-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT jacquemontii-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT ferox-1 CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT Carpinus CAAACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTTACATTTATTGCGGTTCTTTCTTCATGAGT o 0\ Table A32 (Continued)

44444444444 44 444 4 444 444 4444444 5555555555555555555555555555555555555 7777777777888888888899999999990000000000111111111122222222223333333 Taxon/Node 01234 5678901234 5678901234567890123456789012345678901234567890123456 avellana-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG avellana-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG avellana-3 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG maxima-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG maxima-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG cornuta-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG cornuta-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG cornuta-3 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG californica-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCGAG californica-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCGAG californica-3 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG sieboldiana-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG sieboldiana-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG sieboldiana-3 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG americana-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG americana-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG americana-3 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG heterophylla-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG heterophylla-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG heterophylla-3 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG colurna-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG colurna-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG chinensis-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG chinensis-2 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG chinensis-3 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG chinensis-4 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG paperbark-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG jacquemontii-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG ferox-1 ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTTTTTTTTCAAAAAGTAATTCAAG Carpinus ATTCTAATGGTAATATTCTTTTTATTCTAAATAAATCTATTTCTATTTTTTCAAAAAGTAATTCAAG O ^1 Table A32 (Continued)

5555555555555555555555555555555555555555555555555555555555555556666 33344 44 444444555555555566666666667777777777888888888899999999990000 Taxon/Node 7890123456789012345678901234 567890123456789012345678901234567890123 avellana-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC avellana-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC avellana-3 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC maxima-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC maxima-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC cornuta-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC cornuta-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC cornuta-3 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC californica-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC californica-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC californica-3 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC sieboldiana-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC sieboldiana-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC sieboldiana-3 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC americana-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC americana-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC americana-3 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC heterophylla-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC heterophylla-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC heterophylla-3 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC colurna-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC colurna-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC chinensis-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC chinensis-2 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC chinensis-3 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC chinensis-4 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC paperbark-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC jacquemontii-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC ferox-1 ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC Carpinus ATTATTATTATTCTTATATAATTCTTATATATGTGAATACGAATCCCTTTTCCTTTTTCTCCGTAAC © 00 Table A32 (Continued)

6666666666666666666666666666666666666666666666666666666666666666666 0000001111111111222222222233333333334 4 44 4 444 44555555555566666666667 Taxon/Node 456789012345678 9012345678901234567890123456789012345678901234567890

avellana-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA avellana-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA avellana-3 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA maxima-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA maxima-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA cornuta-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA cornuta-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA cornuta-3 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA californica-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA californica-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA californica-3 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA sieboldiana-l CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA sieboldiana-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA sieboldiana-3 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA americana-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA americana-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA americana-3 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA heterophylla-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA heterophylla-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA heterophylla-3 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA colurna-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA colurna-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA chinensis-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA chinensis-2 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA chinensis-3 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA chinensis-4 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA paperbark-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA jacquemontii-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA ferox-1 CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA Carpinus CAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAGAAAAA oto Table A32 (Continued)

6666666666666666666666666666677777777777777777777777777777777777777 7777777778888888888999999999900000000001111111111222222222233333333 Taxon/Node 1234567890123456789012345678901234567890123456789012345678901234567

avellana-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT avellana-2 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT avellana-3 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT maxima-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT maxima-2 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT cornuta-1 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT cornuta-2 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT cornuta-3 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT californica-1 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT californica-2 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT californica-3 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT sieboldiana-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT sieboldiana-2 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT sieboldiana-3 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT americana-1 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT americana-2 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT americana-3 TGGAGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT heterophylla-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT heterophylla-2 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT heterophylla-3 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT colurna-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT colurna-2 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT chinensis-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT chinensis-2 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT chinensis-3 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT chinensis-4 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT paperbark-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT jacquemontii-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT ferox-1 TGGAGGATCTTGCCGAAGTTTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT Carpinus TGGGGGATCTTGCCGAAGTCTTTGTTAATGATTTTCGGGGCATCCTATGCTTCCTCAAGGATCCTTT to o Table A32 (Continued)

7777777777777777777777777777777777777777777777777777777777777788888 3344444 44 44 45555555555666666666677777777778888888888999999999900000 Taxon/Node 890123456789012345678901234 5678901234567890123456789012345678901234

avellana-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT avellana-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT avellana-3 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT maxima-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT maxima-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT cornuta-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT cornuta-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT cornuta-3 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT californica-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT californica-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT californica-3 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT sieboldiana-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT sieboldiana-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT sieboldiana-3 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT americana-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT americana-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT americana-3 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT heterophylla-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT heterophylla-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT heterophylla-3 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT colurna-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT colurna-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT chinensis-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT chinensis-2 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT chinensis-3 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT chinensis-4 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT paperbark-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT jacquemontii-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT ferox-1 CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT Carpinus CATTCATTATGTTAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGATACGCCTCTTCTGATGAAT Table A32 (Continued)

8888888888888888888888888888888888888888888888888888888888888888888 000001111111111222222222233333333334 4 4 44 4 444 45555555555666666666677 Taxon/Node 5678901234567890123456789012345678 901234567890123456789012345678901 avellana-1 AAATGGAAATATTGCCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA avellana-2 AAATGGAAATATTGCCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA avellana-3 AAATGGAAATATTGCCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA maxima-1 AAATGGAAATATTGCCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA maxima-2 AAATGGAAATATTGCCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA cornuta-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA cornuta-2 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA cornuta-3 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA californica-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA californica-2 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA californica-3 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA sieboldiana-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA sieboldiana-2 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA sieboldiana-3 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA americana-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA americana-2 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA americana-3 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA heterophylla-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA heterophylla-2 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA heterophylla-3 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA colurna-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTACGGTCTCACCCAGGAAGGA colurna-2 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTACGGTCTCACCCAGGAAGGA chinensis-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA chinensis-2 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA chinensis-3 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA chinensis-4 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA paperbark-1 AAATGGAAATATTGCCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA jacquemontii-1 AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA ferox-1 AAATGGAAATATTGCCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA Carpinus AAATGGAAATATTACCTTGTCAGTTTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGA Table A32 (Continued)

8888888888888888888888888888999999999999999999999999999999999999999 7777777788888888889999999999000000000011111111112222222222333333333 Taxon/Node 2345678901234567890123456789012345678901234567890123456789012345678 avellana-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA avellana-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA avellana-3 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA maxima-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA maxima-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA cornuta-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA cornuta-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA cornuta-3 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA californica-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA californica-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA californica-3 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA sieboldiana-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA sieboldiana-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA sieboldiana-3 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA americana-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA americana-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA americana-3 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA heterophylla-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA heterophylla-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA heterophylla-3 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA colurna-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA colurna-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA chinensis-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA chinensis-2 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA chinensis-3 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA chinensis-4 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA paperbark-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA jacquemontii-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTGTGCCACTAAA ferox-1 TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTGGGGTTATTTTTCAAGTGTGCCACTAAA Carpinus TCTATATAAACCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAATGTGCCACTAAA Table A32 (Continued)

111111 9999999999999999999999999999999999999999999999999999999999999000000 34 444 444 4 4455555555556666666666777777777788888888889999999999000000 Taxon/Node 901234 56789012345678 90123456789012345678901234567890123456789012345

avellana-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC avellana-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC avellana-3 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC maxima-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC maxima-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC cornuta-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC cornuta-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC cornuta-3 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC californica-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC californica-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC californica-3 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC sieboldiana-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC sieboldiana-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC sieboldiana-3 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC americana-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC americana-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC americana-3 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC heterophylla-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC heterophylla-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC heterophylla-3 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC colurna-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC colurna-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC chinensis-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC chinensis-2 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC chinensis-3 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC chinensis-4 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC paperbark-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC jacquemontii-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC ferox-1 TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAACTC Carpinus TCCTTCAATGGTGCCGAGTCAAATGCTAGAAAATTCATTTGTAATAAATAATGCTCCTAAGAAGCTC Table A32 (Continued)

1111111111111111111111111111111111111111111111111111111111111111111 0000000000000000000000000000000000000000000000000000000000000000000 000011111111112222222222333333333344 4 44 4 444455555555556666666666777 Taxon/Node 678901234 5678901234567890123456789012345678901234567890123456789012

avellana-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG avellana-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG avellana-3 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG maxima-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG maxima-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG cornuta-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG cornuta-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG cornuta-3 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG californica-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG californica-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG californica-3 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG sieboldiana-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG sieboldiana-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG sieboldiana-3 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG americana-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG americana-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG americana-3 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG heterophylla-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG heterophylla-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG heterophylla-3 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG colurna-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG colurna-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG chinensis-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG chinensis-2 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG chinensis-3 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG chinensis-4 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG paperbark-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG jacquemontii-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG ferox-1 GATACAATAGTTCCAATTATTCCTCTGATTGAATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG Carpinus GATACAATAGTTCCGATTATTCCTCTGATTGGATCATTGGCTAAAGCGAAATTTTGTAACGCATTAG Table A32 (Continued)

1111111111111111111111111111111111111111111111111111111111111111111 0000000000000000000000000001111111111111111111111111111111111111111 7777777888888888899999999990000000000111111111122222222223333333333 Taxon/Node 3456789012345678901234567890123456789012345678901234567890123456789

avellana-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG avellana-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG avellana-3 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG maxima-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG maxima-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG cornuta-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG cornuta-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG cornuta-3 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG californica-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG californica-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG californica-3 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG sieboldiana-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG sieboldiana-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG sieboldiana-3 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG americana-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG americana-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG americana-3 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCG heterophylla-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG heterophylla-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG heterophylla-3 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG colurna-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG colurna-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG chinensis-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG chinensis-2 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG chinensis-3 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG chinensis-4 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG paperbark-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG jacquemontii-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG ferox-1 GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG Carpinus GGCATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATAAATCGATTTGTGCG ho Table A32 (Continued)

1111111111111111111111111111111111111111111111111111111111111111111 1111111111111111111111111111111111111111111111111111111111112222222 444444 4444555555555566666666667777777777888888888899999999990000000 Taxon/Node 0123456789012345678901234567890123456789012345678901234567890123456

avellana-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA avellana-2 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA avellana-3 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA maxima-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA maxima-2 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA cornuta-1 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA cornuta-2 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA cornuta-3 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA californica-1 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA californica-2 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA californica-3 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA sieboldiana-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA sieboldiana-2 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA sieboldiana-3 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA americana-1 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA americana-2 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA americana-3 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA heterophylla-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA heterophylla-2 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA heterophylla-3 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA colurna-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA colurna-2 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA chinensis-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA chinensis-2 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA chinensis-3 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA chinensis-4 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA paperbark-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA jacquemontii-1 TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA ferox-1 TATATGCACAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA Carpinus TATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAA o t-h \—3. TD n r> o o n o 3" tr 3" (u(«0)M0)Mnnnooo33 01 0i 01 (U (D a> 0) s- 3- p- 3- o O (D (D (D 333i-''^J*t-,"ib(1,(1,oooo>OJ < <: < 01 H n 1-1 n •o H- H- H- H- i-- M rt rt rt (D(I)n>(0(1)(DI-,l-'l-,HHMXX (0 (0 rt) X T) O J3 (D 3 3 3 3 c C (D (D (D M i-l M C CT (T H- H- H- 3 3 3 H- H- o a" p- X c M (0 (0 rt) (I) I-I H H 1-1 H HPHOOOMii-hi-tiCCC33 3 3 1 (D tr 3 3 3 3 3 3 O O O OOOt-'H'l-'OOOrrrtrtniO) 01 01 01 \ C H1 3 ai u M CO M ID 0) "O 'O "O B)(UB)p.D-Q.'-(l-ll-lft>0)CUi-( I I 3 3 3 Z u o l-( H- H- H- H- 1 1 3" 3" 3- "3 3- 3.- 3 3 3 K) 01 01 0i o > 3 ?r u 0) M M M P-"< >< >< D) ID 0) &> 0) K- UJ hO h-» I I I 1 a rt 1 1 1 1 1 (-• h- (—• I 3 3 n o o ui ro H-* (D M Jk U) ISJ l-1 MUlIvJh-'OiOifliOiOiOl oi (» m I I I I I 1 i i i ui ho t- LJ ro i-* n Ul M h-» ©

-3 1-3 i-3 i-3 1-3 1-3 i-3 H H H i-3 H H -3 H ~~1 o B > > > > > > > > > 5» > > > > > oo o IS> H" s -3 >-3 i-3 i-3 HUH H H H i-3 H H H H U3 O M (-■ n > > > > > > > > > > > > > > > O H" to l-1 a -3 -3 •-3 H H i-3 H i-3 i-3 i-3 i-3 i-3 H •-3 H hO (-■ > > > > > > > > > > > > > > > (SO H-i 1>0 l-i o o O O O O O O O O O O O O O O O o o O O n o o o O O O O N> t-1 i-3 >-3 1>0 M i-3 >-3 i-3 i-3 ►-3 1-3 i-3 H H H i-3 H i-3 H H i-3 i-3 i-3 i-3 H H ■-3 i-3 H i-3 i-3 i-3 1 -3 H •-3 1-3 •-3 1-3 ■-3 H H i-3 H ■-3 i-3 H H H >-3 H H i-3 i-3 i-3 i-3 i-3 H i-3 i-3 •-3 H ho I- O O o n O O O O O O O O O O O O O O O O O O O O O O O O O O t\) t-' O O o o O O O O O O O O O O O O O O O O O O O O O O o o o o > > > > > > js > > > > > > > > > > > > > > > > > > > > > > > 00 hO (-■ o o o o O o o o o o o o o o O O n o o o o o O O o o o o ho M >-3 H >-3 1-3 -3 >-3 i-3 •-3 H i-3 1-3 i-3 H H i-3 H H 1-3 i-3 i-3 -3 i-3 i-3 H i-3 i-3 i-3 H o i-3 H i-3 i-3 1-3 1-3 i-3 i-3 i-3 H H H H H i-3 H H H ■-3 H -3 H i-3 H •-3 i-3 i-3 H (-' ho ho (-■ i-3 i-3 i-3 H >-3 i-3 H i-3 1-3 i-3 i-3 H H H H H H i-3 H i-3 i-3 H i-3 i-3 i-3 H H H ho ho O O O O O O O O O n O O O O O O o o o n O O O O O O O O O O U) hO i-3 i-3 "-3 i-3 >-3 i-3 1-3 H i-3 H i-3 H •-3 i-3 H H i-3 i-3 H H H H i-3 i-3 H H i-3 i-3 H H Js. ho •^ i^ i-3 i-3 •-3 i-3 H H i-3 H i-3 i-3 i-3 H H i-3 i-3 H i-3 i-3 H i-3 i-3 H i-3 i-3 i-3 H H H Cn ho o o O O O O O O O O O O O O O O O O O O O O O O O O O O O O cn ho i-3 -3 •-3 1-3 H >-3 i-3 >-3 i-3 >-3 H H H H H -3 H i-3 i-3 i-3 i-3 H i-3 H H -3 i-3 i-3 H H ~J ho o o O O O O O O O O O O O O O O O O O O O O O O O O O O O O 00 ho o o O O O O O O O o o o O O O O O O O O o n o n O O O O O O lO ho •-3 i-3 ►3 1-3 i-3 H i-3 i-3 1-3 i-3 i-3 H -3 H i-3 H H i-3 H -3 i-3 i-3 1-3 i-3 i-3 H H H i-3 H O CO > > > > > > > > > > > > > > > > > > > > > > > > > > h-i CO

812