Molecular Medicine REPORTS 2: 1029-1035, 2009

Strong association between lung cancer and the AXIN2 polymorphism

Emine Gulsen Gunes1, Ergun Pinarbasi1, Hatice Pinarbasi2 and Yavuz Silig2

Departments of 1Medical Biology and Genetics, and 2Biochemistry, Faculty of Medicine, Cumhuriyet University, 58140 Sivas, Turkey

Received June 12, 2009; Accepted August 10, 2009

DOI: 10.3892/mmr_00000210

Abstract. Accumulated evidence suggests that alterations due studies show that approximately 80% of all lung cancer cases to mutations or genetic polymorphisms in the AXIN2 tumor are attributable to cigarette smoking (3), while the combined suppressor , a component of the , effect of environment and genetic factors is responsible for 20% contributes to carcinogenesis. The effect of the AXIN2 exon 1 of cases. Among genetic factors, molecular abnormalities such 148 C→T polymorphism was recently investigated in a Japanese as mutations and deletions have been identified in oncogenes population, but has not been investigated in other populations. and tumor suppressor , and loss of heterozygosity has Additionally, other common polymorphisms of this gene have been detected in a number of chromosomal regions (4-6). In not been studied. In the present study, 8 polymorphisms of the addition, single nucleotide polymorphism (SNP) studies have AXIN2 gene, including exon 1 148 C→T, were investigated in a been carried out in a large number of populations in order Turkish population of 100 lung cancer patients using PCR-RFLP to show the susceptibility of an individual to lung cancer. methods. For the exon 1 432 C→T, exon 5 1365 G→A, exon 5 These studies focused mainly on genes encoding xenobiotic 1386 C→T, intron 5 1712+19 G→T, exon 7 2062 C→T and intron metabolizing and DNA repair enzymes, including NAT1 and 7 2141+73 G→A single nucleotide polymorphisms of AXIN2, 2, cytochrome P450 dependent monooxygenases, glutathione no significant association was found between the controls and S transferases, XRCC1 and XPD (7-9). The association the lung cancer patients. For exon 1 148 C→T, a statistically between tumor suppressor gene SNPs and lung cancer risk significant association between the controls and lung cancer has also been studied (10-12). patients was found. For this region, lung cancer patients with the AXIN2, a negative regulator of Wnt/β- signaling, acts

TT genotype showed a decreased risk [odds ratio (ORTT) 0.33, as a tumor suppressor gene (13,14). The loss of heterozygosity 95% confidence interval (CI) 0.12-0.89; p=0.032 (adjusted for in the genomic locus containing AXIN2 (15-17) and mutations age, gender and smoking status)] as compared with the controls in the gene itself have been observed in certain types of cancer, with the CC genotype. Concerning histological tumor type, it including hepatocellular (18), ovarian (19) and colorectal has been found that exon 1 148 C→T SNP is associated with a carcinomas (20) and medullablastomas (21), suggesting that significant decreased risk in squamous cell carcinoma patients this gene plays a role in carcinogenesis. Polymorphisms in

(ORTT 0.16; 95% CI 0.03-0.79; p=0.014). Male (ORTT 0.19; the AXIN2 gene, including exon 1 P50S, have recently been 95% CI 0.04-0.77; p=0.015) and smoker (ORTT 0.11; 95% CI shown to be associated with lung (22) and breast (23) cancers, 0.01-0.71; p=0.019) lung cancer patients with the TT genotype suggesting they play a role in lung cancer susceptibility. showed a decreased risk for the same region. Our results To our knowledge, there have been no prior studies on the suggest that the risk of lung cancer in a Turkish population is association between AXIN2 SNPs and lung cancer susceptibility related to polymorphisms of the AXIN2 gene. in a Turkish population. We therefore genotyped 200 Turkish individuals (100 controls and 100 lung cancer patients) for 8 Introduction SNPs of AXIN2 in order to investigate their association with susceptibility to lung cancer. The SNPs included the exon 1 Lung cancer is one of the leading causes of cancer-related 148 C→T (Pro50Ser) variant, exon 1 432 T→C, intron 2 956+16 death in males and females worldwide (1,2). Epidemiologic A→G, exon 5 1365 G→A, exon 5 1386 C→T, intron 5 1712+19 G→T, exon 7 2062 C→T and intron 7 2141+73 G→A.

Materials and methods Correspondence to: Dr Ergun Pinarbasi, Department of Medical Biology and Genetics, Faculty of Medicine, Cumhuriyet University, Subjects. The study population consisted of 100 lung cancer 58140 Sivas, Turkey patients admitted to the Respiratory Disease Department at E-mail: [email protected] Cumhuriyet University Hospital in Sivas (Central Anatolia) in 2006. Only patients with newly diagnosed lung cancer and Key words: AXIN2, polymorphism, lung cancer, cancer predisposi- no previous diagnosis of cancer or previous radiotherapy or tion, Turkish population chemotherapy were included in the study. There were no gender, age, histologic type or stage restrictions. The diagnosis of 1030 gunes et al: AXIN2 polymorphism and lung cancer

Table I. Conditions for the identification ofAXIN2 polymorphisms.

Polymorphism Marker Location Primer sequence (5'-3') Product rFLP allele effect (forward and reverse) (bp) (bp)

148 C/T rs2240308 Pro50Ser exon 1 F: CCACGCCGATTGCTGAGAGG 242 Mph1103I c (218, 24) r: TTCCGCCTGGTGTTGGAAGAGACAT T (242) 432 T/C rs2240308 ile144Ile exon 1 F: CCTGGAGAGGGAGAAATGC 253 Esp3I T (253) r: CATCACCGACTGGATCTCG c (145, 108) 956+16 A/G - - intron 2 F: GGGTTTCTGGTGAGGGTCAGT 228 MlsI a (205, 23) r: CAAGCAAGCCCACGGAAGG g (228) 1365 G/A rs9915936 Pro455Pro exon 5 F: ACGTCTTCCCTTTCAGGATG 248 MspI g (100, 80, 36, 32) r: GGTACTGCGAATGGTGGTG a (116, 100, 32) 1386 C/T rs1133683 Pro462Pro exon 5 F: TGCGTAGGGAGCCGAATGTTG 294 TaqI c (294) r: GTGGTCCGGGGAGCGGGATc T (274, 20) 1712+19 G/T - - intron 5 F: CACCACCACTACATCCACCAC 249 CpoI g (184, 65) r: GCTCCCACCTCACACCTG T (249) 2062 C/T - leu688Leu exon 7 F: TCCTTCTGTTTTCTCTCTGCTCATTCC 209 TaqI c (209) r: AGCGTGTTGGGTGGGGTCG T (191, 18) 2141+73 G/A rs4072245 - intron 7 F: GTGTCGAAGCCCCCAAAG 370 BseRI g (370) r: CTTGATCCTCCATCTcacagc a (260, 110)

lung cancer was histologically confirmed. The control group Statistical analysis. Statistical analysis was performed using consisted of 100 healthy individuals. All cases and controls were the Statistical Package for Social Sciences Program (SPSS, born in Turkey of native Turkish parents, and were interviewed version 16). Statistically significant departures from Hardy- by means of a questionnaire including questions about family Weinberg equilibrium for controls were assessed using the χ2 history of cancer, smoking and other lifestyle habits, and test. For each polymorphism, unconditional logistic regression lifetime occupational history. The study was approved by the was used to calculate the odds ration (OR) and 95% confidence local university ethics committee on human research. interval (CI) for the lung cancer and tumor types, adjusted for the study matching factors of age, gender and smoking habits. Genotyping. Prior to the initiation of chemotherapy or The relationship between genotypes and clinopathological radiotherapy, 2 ml of blood was collected per sample. DNA charactersitics was examined by the χ2 test. A p-value <0.05 extraction was performed as soon as the blood samples was considered to be statistically significant. reached the laboratory using a genomic DNA isolation kit (MBI Fermentas, Lithuania) according to manufacturer’s Results instructions. The samples were assayed without knowledge of the case-control status. A total of 200 individuals (100 lung cancer patients and A total of 8 regions including 5 exons and 3 introns of the 100 healthy controls) were genotyped for 8 different SNPs, AXIN2 gene were amplified by PCR over 30 cycles (Table I) including exon 1 148 C→T of the AXIN2 gene. The results of using previously reported primers (24). PCR was performed in SNP analysis in the control population did not deviate from a reaction volume of 25 µl containing 100 ng of genomic DNA, Hardy-Weinberg equilibrium. The distribution of demographic 10 pmol of the appropriate amplification primers, 5 nmol each characteristics in the genotyped cancer cases as similar to of 4 deoxynucleotide triphosphates (Fermentas), 2.5 Units of the demographic distribution of the controls. The principal Taq DNA polymerase (Fermentas), 10 mmol/l Tris-HCl (pH characteristics of the study population are presented in Table

8.3 at 25˚C), 50 mmol/l KCl and 1.5 mmol/l MgCl2. PCR con- II. The mean ages of patients and controls were 59.22±9.63 ditions consisted of an initial denaturation at 94˚C for 5 min and 57.01±7.89 years, respectively. Relative to the controls, followed by 30 cycles of 94˚C for 30 sec, 60˚C for 30 sec and there were proportionally more males among the lung cancer 72˚C for 60 sec, and lastly 1 cycle at 72˚C for 5 min. patients (56%). The proportion of smokers was higher among In order to detect the 8 AXIN2 gene SNPs, PCR products patients (40%) than among controls (30%). were digested with 5 Units of appropriate restriction endo- Table III summarizes the main effects of the 8 SNPs of nuclease enzymes (Fermentas) (Table I) in a total reaction AXIN2 that are involved in lung cancer. Genotype analysis volume of 10 µl containing 1X reaction buffer (supplied with carried out on exons and the exon-intron boundaries of AXIN2 the enzyme) for 4 h at optimum temperature according to the in lung cancer patients indicated that there was no significant manufacturer’s instructions. Amplified and digested DNA association between genotype and risk of lung cancer for the fragment sizes are shown in Table I. Following digestion, DNA following SNPs: exon 1 432 T→C, intron 2 956+16 A→G, exon 5 fragments were seperated on 2.5% agarose gels. 1365 G→A, exon 5 1386 C→T, intron 5 1712+19 G→T, exon 7 Molecular Medicine REPORTS 2: 1029-1035, 2009 1031

Table II. Characteristics of lung cancer patients and healthy play an important role in Wnt/β-catenin signaling and function controls. as a scaffolding protein for a protein complex including AXIN2, adenomatous polyposis coli (APC), glycogen synthase kinase 3 a Patients (n=100) controls (n=100) p-value (GSK3) and β-catenin. This complex is required for the phos- n (%) n (%) phorylation of β-catenin (32,33). In this complex is localized human 17q21-25, a region highly susceptible to Gender 0.157 allelic losses and chromosomal re-arrangements involved in Male 56 (56) 46 (46) several types of cancer (24,34,35). A recent study by Kanzaki Female 44 (44) 54 (54) et al in a Japanese population showed that the AXIN2 SNP at Age 59.22±9.63 57.01±7.89 codon 50 is associated with lung cancer (22). In another study, (years ± SD) 5 AXIN SNPs were investigated in breast cancer patients and Smoking habit 0.138 found to be associated with the disease (23). In this study, the Non-smoker 60 (60) 70 (70) effect of the AXIN2 SNP at codon 50 as well as 7 other significant Smoker 40 (40) 30 (30) SNPs of AXIN2 were investigated in a Turkish population in order to further analyse their role in lung cancer susceptibility. aP-values were calculated using the χ2 test. The study comprised 100 lung cancer patients and 100 hospital-based controls. Although the frequency of males and smokers was higher among the lung cancer patients, there was no significant relationship between lung cancer and these factors. 2062 C→T and intron 7 2141+73 G→A. However, individuals No association was observed between lung cancer and the 7 carrying the 148 TT (Ser/Ser) genotype were found to have following SNPs of AXIN2: exon 1 432 T→C, intron 2 956+16 a decreased risk of lung cancer (p<0.05). For this region of A→G, exon 5 1365 G→A, exon 5 1386 C→T, intron 5 1712+19 AXIN2, the frequencies of the Pro50Pro (CC), Pro50Ser G→T, exon 7 2062 C→T and intron 7 2141+73 G→A. (C→T) and Ser50Ser (TT) genotypes were 32, 52 and 16% In the study by Kanzaki et al, the SNP at codon 50 of the in the controls, respectively, and 45, 47 and 8% in the lung AXIN2 gene encoding either proline (CCT) or serine (TCT) cancer patients, respectively. The calculated values for the 148 was found to be associated with lung cancer, but not with col- → C T polymorphism were ORTT 0.35, 95% CI 0.13-0.93 and orectal and head and neck cancers (22). The authors found that p=0.032. When age, gender and smoking status were included patients with the TT genotype showed a reduced risk of cancer in the analysis, the estimated OR was found to be 0.33 and the (ORTT 0.31, 95% CI 0.12-0.79). The results of the present study 95% CI was 0.12-0.89. also indicate a decreased risk for lung cancer patients with 2 The the χ test was used to evaluate the association between the TT genotype (ORTT 0.35, 95% CI 0.13-0.93). The CC, CT the AXIN2 polymorphisms and smoking habit, gender and and TT allele frequencies were 45, 47 and 8% in lung cancer histopatholgic type of lung cancer (Table IV). The most prevalent patients and 32, 52 and 16% in controls, respectively. These type of tumors were squamous cell carcinoma (46%) and small results are similar to those of Kanzaki et al, who found a CC, cell carcinoma (27%). Others included lung adenocarcinoma, CT and TT genotype distribution of 50, 44 and 8% in lung and large cell and adenosquamous carcinoma. With the cancer patients and 42, 52 and 15% in controls, respectively. exception of the exon 1 148 C→T SNP, none of the remaining The 17q21-25 region of AXIN2 is very close to the functional 7 AXIN2 SNPs exhibited statistically significant results. For motif where APC binds. AXIN2 binding site disruption or → the 148 C T SNP, squamous cell carcinoma patients (ORTT mutations in APC result in human cancer (36). It is possible 0.16, 95% CI 0.03-0.79; p=0.014), males (ORTT 0.19, 95% CI that this SNP of AXIN2 changes the binding efficiency of 0.04-0.077; p=0.015) and smokers (ORTT 0.11, 95% CI 0.01- APC, though this requires further investigation. 0.71; p=0.019) with the TT genotype were fiound to exhibit a No prior study has examined lung cancer risk associated statistically significant decreased risk of lung cancer. with 7 of the AXIN2 polymorphic sites investigated in the For the intron 2 956+16 A→G SNP, the p-value was found present study; however, the intron 2 956+16 A→G and exon 7 → to be 0.044 for small cell carcinoma (ORAG 0.28, 95% CI 0.80- 2062 C T polymorphisms were found to be associated with 1.02). However, as it was close to 0.05 it did not reach statistical tooth agenesis (24). It has been proposed that this variant of significance, since the OR value was in the range of 95% CI. AXIN2 may exert a weak effect on splicing, since it creates an additional donor splicing site within the sequence of exon 2. Discussion This was not observed in the present study. Additionally, the SNP at exon 5 1365 G→A of the AXIN2 gene has been reported Molecular epidemiology studies indicate that genetic polymor- to be A→G (dbSNP ID: rs9915936), but we did not identify any phisms and mutations of xenobiotic metabolizing enzymes and AA genotypes in our control and study groups (24). The GG DNA repair genes as well as tumor suppressor genes and onco- genotype was therefore selected as the wild-type genotype for genes are among the risk factors for lung cancer (25). statistical testing. Polymorphisms of xenobiotic enzymes have been demonstrated This is the first study carried out in a Turkish population to be a major risk factor for lung cancer by several case-control investigating the AXIN2 polymorphism and its association studies; however, the results of these studies are inconsistent with lung cancer. The data indicate that there is a significant (25). Several lines of evidence indicate that events that alter the association between AXIN2 SNPs and lung cancer in this tumor suppressor pathways affect lung and other types of cancer population. Further investigation in different populations with (26-31). These events include polymorphisms of AXIN2, which large case numbers is needed to support these results. 1032 gunes et al: AXIN2 polymorphism and lung cancer

Table III. AXIN2 genotypes in healthy controls and lung cancer patients.

AXIN2 genotype Patients Controls p-valuea OR (95% CI) n (%) n (%) ------Crude Adjustedb

Exon 1 148 C/T CC 45 (45.0) 32 (32.0) 1 1 (Reference) 1 (Reference) CT 47 (47.0) 52 (52.0) 0.148 0.64 (0.35-1.17) 0.62 (0.33-1.16) TT 8 (8.0) 16 (16.0) 0.032 0.35 (0.13-0.93) 0.33 (0.12-0.89) Allele frequencies C 137 (61.5) 116 (58.0) T 63 (38.5) 84 (42.0) Exon 1 432 T/C TT 96 (96.0) 95 (95.0) 1 1 (Reference) 1 (Reference) TC 4 (4.0) 5 (5.0) 1.0 1.0 (0.24-4.11) 1.2 (0.28-5.12) CC 0 0 Allele frequencies T 196 (98.0) 195 (97.5) C 4 (2.0) 5 (2.5) Intron 2 956+16 A/G AA 77 (77.0) 64 (64.0) 1 1 (Reference) 1 (Reference) AG 20 (20.0) 28 (28.0) 0.121 0.59 (0.30-1.15) 0.57 (0.29-1.13) GG 3 (3.0) 8 (8.0) 0.08 0.31 (0.07-1.22) 0.30 (0.07-1.22) Allele frequencies A 174 (87.0) 156 (78.0) G 26 (13.0) 44 (22.0) Exon 5 1365 G/A GG 91 (91.0) 88 (88.0) 1 1 (Reference) 1 (Reference) GA 9 (9.0) 12 (12.0) 0.489 0.72 (0.29-1.80) 0.73 (0.29-1.86) AA 0 0 Allele frequencies G 191 (95.5) 188 (94.0) A 9 (4.5) 12 (6.0) Exon 5 1386 C/T CC 52 (52.0) 42 (42.0) 1 1 (Reference) 1 (Reference) CT 38 (38.0) 50 (50.0) 0.102 0.61 (0.34-1.10) 0.57 (0.31-1.05) TT 10 (10.0) 8 (8.0) 0.985 1.01 (0.36-2.78) 0.80 (0.27-2.30) Allele frequencies C 142 (71.0) 134 (67.0) T 58 (29.0) 66 (33.0) Intron 5 1712+19 G/T TT 97 (97.0) 96 (96.0) 1 1 (Reference) 1 (Reference) GT 3 (3.0) 4 (4.0) 0.352 1.80 (0.51-6.37) 1.98 (0.55-7.12) GG 0 0 Allele frequencies T 193 (96.5) 196 (98.0) G 7 (3.5) 4 (2.0)

Exon 7 2062 C/T CC 91 (91.0) 86 (86.0) 1 1 (Reference) 1 (Reference) CT 9 (9.0) 14 (14.0) 0.268 0.60 (0.25-1.47) 0.61 (0.24-1.52) TT 0 0 Allele frequencies C 191 (95.5) 186 (93.0) T 9 (4.5) 14 (7.0) Intron 7 2141+73 G/A GG 73 (73.0) 80 (80.0) 1 1 (Reference) 1 (Reference) GA 27 (27.0) 20 (20.0) 0.243 1.47 (0.76-2.86) 1.63 (0.82-3.21) AA 0 0 Allele frequencies G 173 (86.5) 180 (90.0) A 27 (13.5) 20 (10.0) ap-values were calculated using the χ2 test. bAdjusted for age, gender and smoking status. Molecular Medicine REPORTS 2: 1029-1035, 2009 1033

Table IV. Association between the AXIN2 genotype and the clinicopathological characteristics of the lung cancer patiens.

Region Genotype p-value Odds ratio P-value odds ratio (95% CI) (95% CI)

Exon 1 148 C/T cc cT TT CT TT Controls 32 52 16 Patients 45 47 8 0.148 0.64 (0.35-1.17) 0.032 0.35 (0.13-0.93) Male 25 27 4 0.082 0.45 (0.18-1.11) 0.015 0.19 (0.04-0.77) Female 20 20 4 0.620 0.80 (0.34-1.88) 0.463 0.60 (0.15-2.36) Non-smoker 28 26 6 0.243 0.64 (0.30-1.34) 0.380 0.59 (0.18-1.90) Smoker 17 21 2 0.268 0.54 (0.18-1.61) 0.019 0.11 (0.01-0.71) SQC 24 20 2 0.075 0.51 (0.24-1.07) 0.014 0.16 (0.03-0.79) SCC 10 13 4 0.639 0.80 (0.31-2.03) 1.000 0.80 (0.21-2.95) Other 11 14 2 0.596 0.78 (0.31-1.93) 0.310 0.36 (0.07-1.84) Exon 1 432 T/C TT TC TC Controls 96 4 Patients 96 4 0.640 1.00 (0.24-4.11) Male 55 1 1.000 0.81 (0.05-13.4) Female 41 3 1.000 1.20 (0.23-6.49) Non-smoker 56 4 0.703 1.59 (0.34-7.42) Smoker 40 0 0.429 0.96 (0.90-1.03) SQC 44 2 1.000 1.09 (0.20-6.18) SCC 26 1 1.000 0.92 (0.10-8.61) Other 26 1 1.000 0.92 (0.09-8.61) Intron 2 956+16 A/G AA AG GG AG GG gg Controls 64 28 8 Patients 77 20 3 0.121 0.59 (0.30-1.15) 0.080 0.31 (0.79-1.22) Male 43 11 2 0.196 0.54 (0.21-1.37) 1.000 0.69 (0.10-5.23) Female 34 9 1 0.367 0.64 (0.24-1.68) 0.113 0.16 (0.02-1.45) Non-smoker 47 12 1 0.055 0.45 (0.20-1.02) 0.059 0.14 (0.01-1.25) Smoker 30 8 2 0.747 1.20 (0.35-4.24) 1.000 0.76 (0.10-5.86) SQC 31 13 2 0.916 0.95 (0.43-2.10) 0.500 0.51 (0.10-2.57) SCC 24 3 0 0.044 0.28 (0.80-1.02) 0.195 0.88 (0.82-0.96) Other 22 4 1 0.127 0.41 (0.13-1.31) 0.447 0.36 (0.04-3.07) Exon 5 1365 G/A gg ga GA Controls 88 12 Patients 91 9 0.489 0.72 (0.29-1.80) Male 52 4 0.216 0.42 (0.11-1.56) Female 39 5 0.750 1.20 (0.33-4.65) Non-smoker 53 7 0.837 0.89 (0.31-2.56) Smoker 38 2 0.645 0.47 (0.07-3.03) SQC 43 3 0.390 0.51 (0.13-1.90) SCC 22 5 0.357 1.66 (0.53-5.22) Other 26 1 0.297 0.28 (0.03-2.27) Exon 5 1386 C/T cc cT TT CT TT Controls 42 50 8 Patients 52 38 10 0.102 0.61 (0.34-1.10) 0.985 1.01 (0.36-2.78) Male 31 22 3 0.201 0.59 (0.26-1.32) 1.000 0.96 (0.14-6.31) Female 21 16 7 0.318 0.64 (0.27-1.52) 0.752 1.22 (0.35-4.23) Non-smoker 28 23 9 0.491 0.77 (0.36-1.61) 0.386 1.66 (0.52-5.25) Smoker 24 15 1 0.072 0.40 (0.14-1.09) 0.265 0.22 (0.02-2.80) SQC 27 18 1 0.115 0.56 (0.27-1.15) 0.146 0.19 (0.02-1.64) SCC 12 11 4 0.575 0.77 (0.38-1.92) 0.417 1.75 (0.45-6.82) Other 13 9 5 0.257 0.58 (0.22-1.49) 0.306 2.01 (0.56-7.24) Intron 5 1712+19 G/T gg gT GT Controls 96 4 Patients 93 7 0.352 1.80 (0.51-6.37) Male 52 4 0.688 1.69 (0.29-9.68) Female 41 3 0.654 1.90 (0.30-11.9) Non-smoker 53 7 0.080 4.50 (0.90-22.5) Smoker 40 0 0.180 0.93 (0.84-1.02) SQC 42 4 0.261 2.28 (0.54-9.5) SCC 27 0 0.578 0.96 (0.92-1.00) Other 24 3 0.165 3.00 (0.62-14.3) 1034 gunes et al: AXIN2 polymorphism and lung cancer

Table IV. Continued.

Region Genotype p-value Odds ratio P-value odds ratio (95% CI) (95% CI)

Exon 7 2062 C/T cc cT CT Controls 86 14 Patients 91 9 0.268 0.60 (0.25-1.47) Male 51 5 1.000 1.02 (0.26-4.07) Female 40 4 0.250 0.44 (0.12-1.51) Non-smoker 56 4 0.350 0.55 (0.15-1.93) Smoker 35 5 0.511 0.57 (0.15-2.08) SQC 42 4 0.365 0.58 (0.18-1.88) SCC 24 3 1.000 0.76 (0.20-2.89) Other 25 2 0.520 0.49 (0.10-2.30) Intron 7 2141+73 G/a gg ga GA Controls 80 20 Patients 73 27 0.243 1.47 (0.76-2.86) Male 43 13 0.469 1.40 (0.53-3.87) Female 30 14 0.285 1.60 (0.66-4.02) Non-smoker 40 20 0.183 1.68 (0.77-3.66) Smoker 33 7 0.747 1.37 (0.36-5.22) SQC 31 15 0.097 1.93 (0.88-4.25) SCC 22 5 0.864 0.90 (0.30-2.69) Other 20 7 0.504 1.40 (0.52-3.76)

SQC, squamous cell carcinoma; SCC, small cell carcinoma.

Acknowledgements 11. ohta M, Inoue H, Cotticelli MG, et al: The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint is abnormal in digestive tract cancers. Cell 84: This study was supported by Grant no. T-299 from Cumhuriyet 587-597, 1996. University CUBAP, Sivas, Turkey. The technical assistance of 12. Sard L, Accornero P, Tornielli S, et al: The tumor-suppressor gene Ms. Meral Yilmaz is gratefully acknowledged. FHIT is involved in the regulation of apoptosis and in cell cycle control. Proc Natl Acad Sci USA 96: 8489-8492, 1999. 13. Kikuchi A: Modulation of Wnt signaling by axin and axil. References Cytokine Growth Factor Rev 10: 255-265, 1999. 14. Hughes TA and Brady HJM: Cross-talk between pRb/E2F and 1. Ginsberg RJ, Vokes EE and Raben A: Cancer of the lung. In: Wnt/b-catenin pathways: E2F1 induces AXIN2 leading to repres- Cancer: Principles and Practice of Oncology. DeVita VT Jr, sion of Wnt signalling and to increased cell death. Exp Cell Res Hellman S and Rosenberg SA (eds). 5th edition. Lippincott- Raven, Philadelphia, pp858-865, 1997. 303: 32-46, 2005. 2. Marby M, Nelkin BD and Baylin SB: Lung cancer. In: The 15. Phelan CM, Borg A, Cuny M, et al: Consortium study on 1280 Genetic Basis of Human Cancer. Vogelstein B and Kinzler KW breast carcinomas: allelic loss on targets sub- (eds). 2nd edition. McGraw-Hill, New York, pp671-679, 1998. regions associated with family history and clinical parameters. 3. Khuder SA: Effect of cigarette smoking on major histological Cancer Res 58: 1004-1012, 1998. types of lung cancer: a meta-analysis. Lung Cancer 31: 139-148, 16. Plummer SJ, Paris MJ, Myles J, Tubbs R, Crowe J and Casey G: 2001. Four regions of allelic imbalance on 17q12-qter associated with 4. Sekido Y, Fong KM and Minna JD: Progress in understanding the high-grade breast tumors. Genes Cancer 20: molecular pathogenesis of human lung cancer. Biochim Biophys 354-362, 1997. Acta 1378: 21-59, 1998. 17. Barlund M, Tirkkonen M, Forozan F, Tanner MM, Kallioniemi O 5. Salgia R and Skarin AT: Molecular abnormalities in lung cancer. and Kallioniemi A: Increased copy number at 17q22-q24 by J Clin Oncol 16: 1207-1217, 1998. CGH in breast cancer is due to high-level amplification of two 6. Reissmann PT, Koga H, Figlin RA, Holmes EC and Slamon DJ: separate regions. Genes Chromosomes Cancer 20: 372-376, Amplification and overexpression of the cyclin D1 and epidermal 1997. growth factor receptor genes in non-small cell lung cancer. Lung 18. Taniguchi K, Roberts LR, Aderca IN, et al: Mutational spectrum Cancer Study Group. J Cancer Res Clin Oncol 125: 61-70, of beta-catenin, AXIN1 and AXIN2 in hepatocellular carcinomas 1999. and hepatoblastomas. Oncogene 21: 4863-4871, 2002. 7. Pinarbasi H, Silig Y, Cetinkaya O, Seyfikli Z and Pinarbasi E: 19. Wu R, Zhai Y, Fearon ER and Cho KR: Diverse mechanisms of Strong association between the GSTM1-null genotype and lung beta-catenin deregulation in ovarian endometrioid adenocarci- cancer in a Turkish population. Cancer Genet Cytogenet 146: nomas. Cancer Res 61: 8247-8255, 2001. 125-129, 2003. 20. Liu W, Dong X, Mai M, et al: Mutations in AXIN2 cause 8. Bartsch H, Nair U, Risch A, Rojas M, Wikman H and with defective mismatch repair by activating Alexandrov k: Genetic polymorphism of CYP genes, alone or beta-catenin/TCF signalling. Nat Genet 26: 146-147, 2000. in combination, as a risk modifier of tobacco-related cancers. 21. Yokota N, Mainprize TG, Taylor MD, et al: Identification of Cancer Epidemiol Biomarkers Prev 9: 3-28, 2000. differentially expressed and developmentally regulated genes in 9. Schwartz AG, Prysak GM, Bock CH and Cote ML: The medulloblastoma using suppression subtraction hybridization. molecular epidemiology of lung cancer. Carcinogenesis 28: Oncogene 23: 3444-3453, 2004. 507-518, 2007. 22. Kanzaki H, Ouchida M, Hanafusa H, et al: Single nucleotide 10. Kohno T and Yokota J: How many tumor suppressor genes are polymorphism of the AXIN2 gene is preferentially associated involved in human lung carcinogenesis? Carcinogenesis 20: with human lung cancer risk in a Japanese population. Int J Mol 1403-1410, 1999. Med 18: 279-284, 2006. Molecular Medicine REPORTS 2: 1029-1035, 2009 1035

23. Wang X, Goode EL, Fredericksen ZS, et al: Association of genetic 30. Shinmura K, Suzuki M, Yamada H, et al: Characterization of variation in genes implicated in the beta-catenin destruction adenocarcinoma of the lung in a familial adenomatous polyposis complex with risk of breast cancer. Cancer Epidemiol Biomarkers patient. Pathol Int 58: 706-712, 2008. Prev 17: 2101-2108, 2008. 31. Mechanic LE, Marrogi AJ, Welsh JA, et al: Polymorphisms in XPD 24. Mostowska A, Biedziak B and Jagodzinski PP: Axis inhibition and TP53 and mutation in human lung cancer. Carcinogenesis 26: protein 2 (AXIN2) polymorphisms may be a risk factor for 597-604, 2005. selective tooth agenesis. J Hum Genet 51: 262-266, 2006. 32. Akiyama T: Wnt/beta-catenin signaling. Cytokine Growth Factor 25. Risch A and Plass C: Lung cancer epigenetics and genetics. Int J Rev 11: 273-282, 2000. Cancer 123: 1-7, 2008. 33. Bienz M and Clevers H: Linking colorectal cancer to Wnt 26. Yokobori T, Mimori K, Iwatsuki M, et al: p53-altered FBXW7 signaling. Cell 103: 311-320, 2000. expression determines poor prognosis in gastric cancer cases. 34. Salahshor S and Woodgett JR: The links between axin and Cancer Res 69: 3788-3794, 2009. carcinogenesis. J Clin Pathol 58: 225-236, 2005. 27. Miyaki M, Yamaguchi T, Iijima T, Takahashi K, Matsumoto H 35. Hart MJ, De los Santos R, Albert IN, Rubinfeld B and Polakis P: and Mori T: Somatic mutations of the CDC4 (FBXW7) gene in Down-regulation of beta-catenin by human Axin and its association hereditary colorectal tumors. Oncology 76: 430-434, 2009. with the APC tumor suppressor, beta-catenin and GSK3 beta. 28. Liu JN, Zhang XM, Guo YL, Sun T, Lin DX and Wen T: Genetic Curr Biol 8: 573-581, 1998. polymorphism in MDM2 is associated with susceptibility to 36. Rubinfeld B, Robbins P, El-Gamil M, Albert I, Porfiri E and colorectal cancer in a Chinese population. Zhonghua Zhong Liu Polakis P: Stabilization of beta-catenin by genetic defects in Za Zhi 30: 335-338, 2008. melanoma cell lines. Science 275: 1790-1792, 1997. 29. Ding L, Getz G, Wheeler DA, et al: Somatic mutations affect key pathways in lung adenocarcinoma. Nature 455: 1069-1075, 2008.