Developing Receptor-Directed Synthetic Antagonists Against the IL-23 Signal Transduction Pathway

Developing Receptor-Directed Synthetic Antagonists against the IL-23 Signal Transduction Pathway

Deelaka Wellappili

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto

Developing Receptor-Directed Synthetic Antagonists against the IL-23 Signal Transduction Pathway

Deelaka Wellappili

Master of Science

Department of Molecular Genetics University of Toronto

2019 Abstract

IL-23 is a pro-inflammatory cytokine that initiates and stabilizes the TH17 lineage of T helper cells, often associated with autoimmune inflammatory conditions such as inflammatory bowel disease (IBD), psoriasis, and arthritis. Several antibodies targeting IL-23 have been developed but only one monoclonal antibody has been developed to target IL-23 signaling at the level of the receptor. Using in vitro selections against recombinant IL-23R, we have isolated one antibody from a phage-displayed synthetic antibody library which bound the receptor with high affinity, and interacts with ectopically-expressed cell surface receptors. This antibody was also shown to block the in vitro ligand-receptor interaction and antagonize IL-23-induced STAT3 signalling in cells. These results represent the first report of a recombinant antibody against IL-23R that antagonizes downstream cytokine-induced signalling. Further development and characterization of such antibodies would be beneficial since antibodies that block IL-23 signals at the level of the receptor may possess therapeutic value.

Acknowledgments

First and most importantly, I would like to thank my parents for their continued support and understanding over the course of my project. I would like to thank my mother for introducing me to the world of science, and thanks to my father for driving me to be my best and always showing interest in my graduate work. A heartfelt thank you to both of them for immigrating to a new and foreign country to make sure that I had the best possible opportunities to succeed, leaving behind their friends and family. A special thanks to my father for taking me wherever I needed for school or extracurricular activities all throughout my school years, an opportunity that allowed me to focus on learning and bettering myself. I would also like to acknowledge all my friends, who kept me sane and optimistic during the hard times while also celebrating my successes.

I want to sincerely thank my supervisor, Dr. Sachdev Sidhu, who showed me the importance of always moving forward with my research, and not getting stuck on any pitfalls. He was available via emails at all times, sometimes even at 3 am, and gave valuable thoughts and feedback about my work. Thanks to my graduate committee – Drs. Eleanor Fish, Michael Moran and Jason Moffatt, whose insight and often challenging questions gave me focus and improved my presentation skills immensely. A very special thanks to Dr. Shane Miersch, who while not being an official committee member, was instrumental in accelerating my project forwards. He worked one-on-one with me, planning all experiments as well as improving my presentations and reports, making sure I was accurate and concise with my work.

Finally, I would also like to thank all the members of the Sidhu Lab who were enthusiastic in helping me overcome the hurdles of my project and graduate school, and for all the laughs and stories throughout my time there. I particularly want to thank Hamed Shaykhalishahi, Paknoosh Pakarian, Gino Gallo, Bradley Yates, Levi Blazer, Gianluca Veggiani, Mart Ustav, and Greg Martyn for their invaluable help and for an unforgettable experience.

iii

Table of Contents

Acknowledgments ...... iii

Table of Contents ...... iv

List of Tables ...... vi

List of Figures ...... vii

List of Abbreviations ...... viii

Introduction ...... 1

1.1 Immune system and cytokines ...... 1

1.1.1 T cells, differentiation and immunity ...... 1

1.1.2 Interleukin 23 ...... 2

1.1.3 Pathology associated with IL-23 ...... 5

1.2 Antibodies ...... 6

1.2.1 Antibody structure and function ...... 6

1.2.2 Current therapeutic antibodies targeting the IL-23 signaling pathway ...... 7

1.3 Phage Display ...... 8

1.4 Thesis Overview ...... 8

Developing receptor-directed synthetic antagonists against the IL-23 signal transduction pathway ...... 10

2.1 Statement of Contribution ...... 10

2.2 Materials and Methods ...... 10

2.2.1 Plasmid constructs ...... 10

2.2.2 Antibodies and other proteins ...... 10

2.2.3 Protein production and purification ...... 11

2.2.4 Enzyme Linked Immunosorbent Assays (ELISAs) ...... 12

2.2.5 Analysis of binding kinetics by biolayer interferometry ...... 14

2.2.6 STAT3 signaling assay by western immunoblotting ...... 14

2.2.7 Flow cytometry detection of cell surface IL-23R expression ...... 16

2.2.8 RT-qPCR validation of cell lines ...... 17

2.3 Results ...... 17

2.3.1 ELISAs ...... 17

2.3.2 BLI Kinetic Analysis ...... 20

2.3.3 Flow cytometry detection of cell surface IL-23R binding ...... 21

2.3.4 Development of HeLa cells for the assay ...... 22

2.3.5 The effect of antibodies on IL-23 induced p-STAT3 signals ...... 23

2.4 Discussion ...... 25

Conclusion and Future Perspectives ...... 30

3.1 Development of antibodies targeting cytokine receptors ...... 30

3.2 Conclusion ...... 31

References ...... 32

List of Tables

Table 1: Primers for qPCR ...... 17

Table 2: Estimate of binding kinetics for antibody:IL-23R interactions ...... 20

List of Figures

Figure 1: IL-23 binds to IL-23R and IL-12Rb1 ...... 3

Figure 2: IL-23 signal transduction pathway ...... 5

Figure 3: Structure of an IgG ...... 6

Figure 4: Sequences of the CDR regions of each antibody clone ...... 18

Figure 5: Multipoint ELISA of antibody binding to IL-23R ...... 18

Figure 6: Fab 11189 blocks IL-23:IL-23R interaction ...... 19

Figure 7: 11188 and 11189 bind overlapping epitopes on IL-23R ...... 19

Figure 8: Both Fab and IgG 11189 block IL-23:IL-23R interaction ...... 21

Figure 9: 11189 Fab and IgG binds specifically to cells expressing IL-23R ...... 22

Figure 10: IL-23 induces phosphorylation of STAT3 in transfected HeLa cells ...... 23

Figure 11: Fab 11189 inhibits IL-23-induced phosphorylation of STAT3 in HeLa cells ...... 24

Figure 12: IgG 11189 partially inhibits IL-23-induced phosphorylation of STAT3 in HeLa cells ...... 24

Figure 13: IgG 11189 acts as an agonist ...... 25

vii

List of Abbreviations

7AAD – 7-aminoactinomycin D BLI – Bio-layer interferometry BSA – bovine serum albumin CBM – cytokine binding module CCR – chemokine receptor CD – classification determinant CDR – complementarity determining region DMEM – Dulbecco’s Modified Eagle’s medium DNA – deoxyribonucleic acid EAE – experimental autoimmune encephalomyelitis EC50 – half-maximal effective concentration ECD – extracellular domain EDTA – ethylenediaminetetraacetic acid ELISA – enzyme linked immunosorbent assay EPO – erythropoietin EPOR – EPO receptor Fab – antigen binding fragment FACS – fluorescence-activated cell sorting FBS – fetal bovine serum Fc – crystallisable fragment FcgR – Fc receptor gamma g – gram G-CSF – granulocyte-colony stimulating factor HRP – horseradish peroxidase IBD – inflammatory bowel disease IFN – interferon IgG – immunoglobulin IL – interleukin IPTG – isopropyl b-D-1-thiogalactopyranoside JAK – Janus kinase KD – dissociation constant kDa – kilodalton koff – dissociation rate kon – association rate L – litre M – molar MFI – mean fluorescent intensity mg – milligram mL – millilitre nM – nanomolar PBS – phosphate-buffered saline PVDF – polyvinylidene fluoride RA – rheumatoid arthritis s - seconds STAT – signal transducer of activation

viii

TH – helper T cell TMB - 3,3',5,5'-tetramethylbenzidine Tyk – tyrosine kinase x g - multiple of the acceleration of gravity α - alpha β - beta µg - microgram µL - microlitre µM - micromolar

Introduction 1.1 Immune system and cytokines

1.1.1 T cells, differentiation and immunity

The immune system is a vast network of different tissues, cells and molecules whose overarching goal is host defense. It works to protect the body against both external pathogens, as well as problems native to the body, like tumour cells. This massive system is divided into two sections based on the type of response required. Immediate and non-specific reactions to threats are controlled by the innate immune response, whereas long-term, specific responses are controlled by the adaptive immune response. The innate immune response includes phagocytic cells like macrophages, which engulf pathogens, and natural killer (NK) cells, which destroy infected host cells. Dendritic cells are a subset of the innate immune system, called antigen presenting cells (APC), which act as a connector between the innate and adaptive systems (Charles A Janeway et al., 2001). The adaptive response encompasses a group of cells called lymphocytes, specifically T and B cells (Parkin and Cohen, 2001). While B cells exhibited an antigen-specific response using antibodies, T cells respond in a cell-mediated fashion. T cells are made up of two main groups – cytotoxic T cells that directly kill infected cells, and helper T cells (TH) that stimulate responses in other cells (Alberts et al., 2002a).

Helper T cells are characterized by the presence of CD4 on the cell surface, while cytotoxic T cells have CD8 on the membrane. T cells functions are mediated, in part, by cytokines, which are small proteins produced by T cells that stimulate signaling in other immune cells, rendering a specific response. CD4+ T cells can be further differentiated into several different lineages of effector helper T cells. All helper T cells must first be activated through T cell receptor (TCR) activation (Alberts et al., 2002b). Subsequently, different cytokine combinations polarize the cells to specific lineages based on the required function. TH1 cells are produced by stimulation with IL-12 and IFN- g and initiate an immune response against intracellular pathogens. In response to extracellular parasites, IL-4 stimulates lineage commitment to TH2 cells. The lineages are also characterized by the cytokines they produce. TH1 cells release IFN-g (Schoenborn and Wilson, 2007), while TH2 cells produce IL-4, IL-5 and IL-13 (Paul, 1997). As such, a newly discovered subset of helper T cells have been characterized by their ability to produce IL-17, and as such have been labelled

1 2

TH17 cells (Abbas et al., 1996; Luckheeram et al., 2012). In mice, these cells are stimulated by IL- 6, TGF-b, IL-1b and IL-23, while in humans, they arise due to IL-1b and IL-23 stimulation

(Wilson et al., 2007). TH17 cells provide defence against extracellular bacteria and fungi, and stimulate an inflammatory environment (Ye et al., 2001).

1.1.2 Interleukin 23

Comparing the structure and sequence homology between newly discovered proteins and existing cytokines may lead to the discovery of new cytokines. One example is the identification of hematopoietic cytokines through the presence of the four-a-helix topology (Rozwarski et al., 1994). A study done in the early 2000s used a computer-derived algorithm to search for proteins similar in structure to the IL-6 family of cytokines, leading to the discovery of one novel cytokine labelled p19. The human p19 protein was found to be 19 kDa in size with close evolutionary relationships to IL-12p35, IL-6 and G-CSF. Upon further study, it was discovered that the co- expression of IL-12p40 lead to more efficient secretion of the p19 cytokine from expressing cells. The formation of the heterodimeric complex (Figure 1) (Desmet et al., 2014), consisting of p19 and IL-12p40, was formed by a disulphide linkage and labeled as IL-23 (Oppmann et al., 2000).

As shown by the close evolutionary relationship between IL-23p19 and IL-12p35, as well sharing the IL-23p40 subunit, IL-23 and IL-12 are structurally very similar. Both cytokines also bind IL- 12Rb1 through interactions with IL-12p40. However, unlike IL-12, IL-23 does not bind IL-12Rb2 (Oppmann et al., 2000). Upon studying the IL-23-dependent proliferation of cell lines created with cDNA libraries from various T cell cultures, along with IL-12Rb1, researchers found a 629-residue transmembrane protein that was required for IL-23-dependent proliferation. This protein was designated IL-23R, and it was found to have a close evolutionary relationship to IL-12Rb2, as well as being found in close proximity to IL-12Rb2 on chromosome 1 (Parham et al., 2002). IL-23R was found to consist of an intracellular domain and three extracellular domains: an Ig-like domain at the N-terminus, followed by two fibronectin type III domains making up a cytokine binding module (CBM) (Zhao et al., 2010). IL-12Rb1 contains of an intracellular domain and an extracellular domain made up of a cytokine binding module (CBM), followed by three fibronectin type III-like domains (Chua et al., 1995).

IL-23 signaling is mediated by the assembly of the ternary complex formed when IL-23 binds to IL-23R and IL-12Rb1. As IL-23 belongs to the larger IL-6 superfamily of cytokines, the initiation of signaling was hypothesized to occur via the site I-II-III paradigm, where the p19 subunit interacts with p40, IL-12Rb1 and IL-23R at sites I, II and III, respectively (Jones et al., 2012; Lupardus and Garcia, 2008). It has been shown that IL-12p40, as a homodimer, can bind IL-12Rb1 and block binding of both IL-12 and IL-23 (Ling et al., 1995). Therefore, binding site II on IL-23 is present on IL-12p40. Initially, the formation of the IL-23 heterodimer of p19 and p40 at site I must occur for further binding to transpire. This interaction opens site III on IL-23p19 allowing it to bind to IL-23R at its Ig-like domain (Schröder et al., 2015). Crystal structure analysis of the IL- 23:IL-23R interaction has also shown that this initial interaction structurally primes the IL-12p40 subunit to interact with IL-12Rb1. Microcalorimetry experiments have quantified the IL-23:IL-

23R interaction with a KD of 44 nM, and the subsequent interaction of IL-12Rb1 with the IL-

23:IL-23R complex with a KD of 25 nM. (Bloch et al., 2018).

Figure 1: IL-23 binds to IL-23R and IL-12Rb1 IL-23 is shown as a heterodimeric cytokine, with the green depicting IL-12p40 and the red depicting IL- 23p19. In blue is IL-23R while IL-12Rb1 is shown in yellow. IL-23p19 binds to IL-23R, allowing IL-12p40 to bind to IL-12Rb1.

IL-23 is produced by both mouse and human dendritic cells (Oppmann et al., 2000; Wilson et al., 2007). The expression of the receptor is, however much more varied. Due to the close relationship between IL-23R and IL-12Rb2, it was thought that their expression patterns should be related. Research showed that these two receptors, and overall response to IL-23 or IL-12, are vastly different between cell types, and the expression of the two receptors are controlled by specific transcription factors, that may even act in a disjointed fashion (Chognard et al., 2014). IL-23R has been shown to be expressed mainly in CD4+ CD45RO+ T cells, which are memory T helper cells (Chognard et al., 2014). Chemokines are molecules capable of inducing and directing chemotaxis, i.e. the movement of cells based on external stimuli. Thus, chemokine receptors are also a means of classifying certain immune cell subsets. In terms of IL-23 signaling, CCR6 and CCR4 appear to be markers of cells producing mainly IL-17 (Acosta-Rodriguez et al., 2007), which is controlled through IL-23, among others. Therefore, CCR6+ CCR4+ cells might be markers of cells that also express IL-23R.

Downstream signaling of IL-23 occurs mainly through a JAK/STAT signaling cascade (Figure 2), with two members of the Janus kinase family of proteins initiating signaling once activated. JAK2 is found constitutively bound to the cytoplasmic domain of IL-23R (Acosta-Rodriguez et al., 2007), while Tyk2 is found on the cytoplasmic domain of IL-12Rb1 (Floss et al., 2016; Zou et al., 1997). Whereas IL-12 signaling occurs primarily through STAT4 (Thierfelder et al., 1996), IL-23 signaling is predominantly under STAT3 (Parham et al., 2002). The dimerization of IL-23R and IL-12Rb1 upon binding of IL-23, leads to the activation of JAK2 and TYK2. JAK2 phosphorylates residues on the C-terminus of IL-23R, forming binding sites for STAT3. JAK2 phosphorylates and activates STAT3 at the Tyr705 residue (Lochmatter et al., 2016). Similarly, Tyk2 phosphorylates and activates STAT4. As the main signal transducer, STAT3 is a transcription factor that upregulates the expression of several downstream genes including Rorc, IL-17A, IL-17F and IL- 22, along with upregulating IL-23R and IL-12Rb1 (Wilson et al., 2007).

Figure 2: IL-23 signal transduction pathway Binding of IL-23 to IL-23R and IL-12Rb1, causes heterodimerization of the two receptors. This activates JAK2, which is constitutively bound to the cytoplasmic domain of IL-23R. JAK2 phosphorylates the C- terminus of IL-23R, providing binding sites for STAT3, which too gets phosphorylated by JAK2. Phosphorylated STAT3 moves to the nucleus and activates transcription of several genes, including Rorc, IL-17A, IL-17F and IL-23R.

1.1.3 Pathology associated with IL-23

IL-23 is a proinflammatory cytokine and, as such, dysregulation of IL-23 and its associated pathways have been linked to various inflammatory, autoimmune conditions. It has been hypothesized that these diseases are the result of the failures of several ‘checkpoints’ along the

TH17 differentiation pathway (Wilson et al., 2007). Early studies of IL-23, specifically IL-23p19, in mice have shown that overexpression of this protein leads to systemic inflammation and death (Wiekowski et al., 2001). Genome wide association studies have linked the IL-23R gene with psoriasis (Cargill et al., 2007), an inflammatory condition of the skin. Further studies have shown that injection of IL-23 into the skin of mice leads to psoriasis-like symptoms (Schön and Boehncke, 2005). Subsequent genome-scale studies have also shown connections between IL-23R expression and inflammatory bowel diseases (IBD), such as Crohn’s disease or ulcerative colitis. These studies have also found several IL-23R variants, including one with a R381Q mutation (Duerr et

6 al., 2006), which confers decreased susceptibility to IBD through reduced cell surface expression of the receptor (Sivanesan et al., 2016). In addition to psoriasis and IBD, IL-23 also plays a role in diseases such as rheumatoid arthritis (RA) and the mouse model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE) (Iwakura and Ishigame, 2006).

1.2 Antibodies

1.2.1 Antibody structure and function

Figure 3: Structure of an IgG The structure of an IgG is shown here, with the heavy chain in dark green and the light chain in light green. The disulphide bonds connecting the light and heavy chains, and those connecting the two heavy chains, are shown as dotted lines.

Immunoglobulins are large proteins, with an approximate molecular weight of 150 kDa, the most common being immunoglobulin G (IgG) (Figure 3). They are made up of two heavy chains and two light chains, connected via disulphide bonds into a “Y” shape. Each chain consists of several constant regions with similar amino acid sequences, and a variable region on the N-terminus. The light chain has one constant region, labelled CL1, while the heavy chain has three: CH1, CH2 and

CH3. The variable region of both heavy and light chains, labelled VH and VL respectively, form the antigen binding pocket. These variable regions contain sequences called complementarity determining regions (CDRs) which undergo recombination and somatic mutations within the host to arrive at sequences that, via shape and charge complementarity, can bind antigens (Davies and Cohen, 1996). While the bi-dentate protein is labelled as an IgG, several smaller fragments can be made in vitro that retain the ability to bind to antigens, including single chain variable fragments (scFv) and, the most common, antigen binding fragments (Fab). A Fab, as shown in Figure 3,

7 consists of one arm of the IgG molecule, including the variable regions of both heavy and light chains, as wells as the constant region of the light chain and one of the constant regions of the heavy chain. The crystallisable fragment (Fc) is also shown in Figure 3, and consists of two constant regions from both heavy chains. Biologically, while the antibody binding pocket recognizes and binds the antigen, the Fc region binds to the Fc receptor gamma (FcgR) on immune cells and initiates an immune response (Zeidler et al., 2000). Another effect mediated by the Fc region of antibodies is antibody dependent cell-mediated cytotoxicity (ADCC) where cells expressing specific Fc receptors can recognize antibodies bound to antigens and lyse the cells expressing the antigen. Similarly, the complement dependent cytotoxicity (CDC) can also be activated upon recognition of antibodies bound to antigen, leading to lysis of the antigen- expressing cell (Kellner et al., 2014).

1.2.2 Current therapeutic antibodies targeting the IL-23 signaling pathway

Several antibodies have been developed to target IL-23, and are currently in clinical or pre-clinical trials. The first monoclonal antibodies developed against IL-23, Ustekinumab and Briakinumab, targeted the IL-12p40 subunit and inhibited the activity of both IL-12 and IL-23. Phase III clinical trials for Ustekinumab and phase II trials for Briakinumab in psoriasis patients have shown impressive efficacy, but in both cases, there have been increases in infections, such as respiratory tract and urinary tract infections (Gandhi et al., 2010). Since targeting IL-12p40 leads to inhibitory effects on both IL-12 and IL-23, researchers have developed antibodies specific for IL-23 by targeting IL-23p19. Tildrakizumab, Guselkumab, and Risankizumab are three monoclonal antibodies, targeting IL-23p19, currently in clinical trials to treat psoriasis and Crohn’s disease. All three have shown positive results, outperforming Ustekinumab in certain cases (Bangert and Kopp, 2018; Feagan et al., 2018; Gordon et al., 2018; Papp et al., 2015; Zhuang et al., 2016).

Despite these positive effects, cytokines are pleiotropic in nature. Broadly acting cytokine therapies, that inhibit the activity of a cytokine, may have negative effects on the immune system and an inability to control infections (Rider et al., 2016). This was seen in the study of Ustekinumab and Briakinumab. A means of overcoming this problem is targeting the receptor, IL- 23R, which is expressed at a much lower level than the cytokine and in a much more tissue/cell restricted fashion (Parham et al., 2002). Targeting the receptor would require a lower concentration of antibody compared to general targeting of a cytokine, and as such reduce off-target effects

8 including systemic reduction of the immune response. One monoclonal antibody, AS2762900-00, has been developed recently to target IL-23R, and has shown some inhibitory effects on downstream signaling (Sasaki-Iwaoka et al., 2018). However, its effect in human clinical trials is yet to be seen.

1.3 Phage Display

Antibodies for research and therapeutics have been developed in the past using hybridoma technology (Köhler and Milstein, 1975). This process involves injecting an animal, like a mouse, with an antigen, protein or peptide, and allowing the animal’s immune system to produce antibodies against the antigen. However, this process is expensive and time consuming. Another method developed in 1985 is phage display antibody technology. First developed as a method to show that an antigen could be expressed on the surface of bacteriophage and still maintain the antigenic determinants (Smith, 1985), it developed into a means by which antibodies could be developed against a specific antigen. Antibody fragments, specifically the Fab arm of an antibody, are fused to the pIII coat protein of bacteriophage (McCafferty et al., 1990; Winter et al., 1994). Strategies allow for the randomization of the CDRs of the antibody fragments (Fellouse et al., 2004), leading to the development of antibody libraries up to 1011 in diversity (Sidhu et al., 2000). This library can then select an antibody for a specific antigen over several rounds, enriching for binders that have higher affinity for the antigen than others. Negative selections can also be carried out on proteins, such as bovine serum albumin (BSA) or IgG1 Fc regions, to remove non-specific binders from the pool. Once high affinity antibody fragments have been selected, these clones can be sequenced, decoding their CDR sequences. Fab and IgG versions of these antibodies can be developed from these clones for further characterization. Antibodies developed using this method can also be further refined to increase affinity or to target antigens from a different species through the process of affinity maturation. Directed evolution of the CDR regions can produce new libraries that can be used for further selections on the antigen of choice (Sidhu and Fellouse, 2006).

1.4 Thesis Overview

IL-23 is one of the cytokines responsible for the development of the IL-17 producing TH17 lineage of helper T cells (Wilson et al., 2007). However, dysregulation of the pathway polarizing helper T cells to this lineage can result in the development of several autoimmune disorders such as IBD and psoriasis. This pathway has been the target of several monoclonal antibodies, targeting IL-23,

9 as a means of inhibiting signaling. However, the field of study is lacking in antibodies that target the IL-23R, with only one such antibody recently being described. Since targeting the receptor may provide a more specific avenue by which to treat these inflammatory conditions, with minimal side effects (Rider et al., 2016), I hypothesize that antibodies that bind to IL-23R and interfere with the interaction between IL-23 and IL-23R would act as antagonists of the IL-23 signaling pathway, and reduce the pro-inflammatory response. I have undertaken a project to characterize antibodies to IL-23R that have been selected using phage-display technology, and aim to develop a cell-based functional assay to examine the antagonistic effect of the antibodies on IL-23 signaling.

Using in vitro biochemical analyses, two antibodies were shown to bind to IL-23R, as both Fab and IgG, with high affinity and specificity. Using HeLa cell lines engineered to express both IL- 23R and IL-12Rb1 ectopically, dose-dependent binding of Fab and IgG versions of one of the antibodies to the cell surface was observed, while no binding was observed to native HeLa cells that do not express IL-23R. Biolayer interferometry (BLI) analysis was used to show the blockade of ligand binding to IL-23R by that same antibody. Further inhibition of the pathway was observed using the transfected HeLa cells, where the effect of the antibody on IL-23 dependent p-STAT3 signal was measured. The Fab version of the antibody showed a dose-dependent reduction in p- STAT3 when IL-23 was added. However; the IgG version of the antibody showed IL-23- independent p-STAT3 signaling at certain concentrations, leading to the conclusion that monomeric Fab acted as an antagonist, while the bivalent IgG acted as a synthetic agonist.

Developing receptor-directed synthetic antagonists against the IL-23 signal transduction pathway 2.1 Statement of Contribution

All phage-displayed libraries were created at the Toronto Recombinant Antibody Centre (TRAC), and selections on IL-23R were carried out by Lynda Ploder, a technician in the laboratory of Dr. Sachdev Sidhu. The different clones from the selections were purified and developed as Fab or IgG at the TRAC by Kirsten Krastel and Leonie Enderle, respectively, both members of Dr. Sidhu’s lab. Finally, the experiments to measure antibody-antigen interactions using BLI were designed by Nick Jarvik and myself, and the experiments were performed by Nick Jarvik, another technician in Dr. Sidhu’s lab. All other experiments, figure preparation and data analyses were carried out by myself.

2.2 Materials and Methods

2.2.1 Plasmid constructs

Plasmids containing cDNA constructs of IL-23R and IL-12Rb1 were provided by Dr. Stephen Michnick’s laboratory. IL-23R was then cloned into the pSBbi-Hyg vector containing a gene conferring hygromycin resistance, while IL-12Rb1 was cloned into the pSBbi-Pur vector containing a puromycin resistance gene. A plasmid containing the SB100X transposase enzyme, pCMV(CAT)T7-SB100, was used for transfections as well.

2.2.2 Antibodies and other proteins

Protein assays were conducted unless otherwise noted using commercially obtained human (R&D, 1400-IR) and mouse (R&D, 1686-MR) IL-23R extracellular domain (ECD) fused to IgG1 Fc regions. IgG1 Fc (R&D, 110-HG) and BSA (Bioshop, ALB001) were used as negative controls. Recombinant IL-23 (R&D, 1290-IL) was used for ELISAs, BLI and cell signaling assays. Rabbit anti-human p-STAT3 Tyr705 (CST, 9145) and STAT3 (CST, 4904) antibodies were used for western blotting to observe activation of intracellular signal transduction. For ELISAs, horseradish peroxidase (HRP)-conjugates of anti-Fc, anti-Kappa light chain (Southern Biotech, 2060-05) and anti-FLAG (Sigma Aldrich, A8592) antibodies were used as secondary antibodies. Alexa488- conjugated goat anti-human IgG, F(ab’)2 fragment specific (Jackson ImmunoResearch, 109-545-

097), was used as a secondary antibody for flow cytometry, while HRP-conjugated goat anti-rabbit IgG (ThermoFisher, A16110) was used as secondary antibody for western blotting. 7- Aminoactinomycin D (7AAD) (Sigma, A9400) was used as a marker to stain dead cells during flow cytometry experiments.

2.2.3 Protein production and purification

2.2.3.1 Fab production and purification

Expression constructs were made at the TRAC consisting of the Fab portion of the binders that were selected. Escherichia coli BL21 cells were then transformed with each Fab-encoding plasmid, and allowed to grow overnight at 37°C on agar plates containing 100 µg/mL of carbenicillin. The next day, individual colonies were inoculated into 5 mL of 2YT medium with 100 µg/mL carbenicillin, and incubated at 37°C overnight with shaking at 200 rpm. Overnight cultures were used to inoculate 150 mL of 2YT medium supplemented with 100 µg/mL of carbenicillin. It was incubated at 37°C with shaking until an optical density (OD600) between 0.6- 0.8 was reached, after which isopropyl b-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM. The cells were cultured for a further 4 hours at 37°C with shaking. At the end of the incubation period, the whole culture was centrifuged in a 50 mL Falcon tube at 11000x g for 8 min, repeating as necessary to pellet the whole volume. The supernatant was discarded, and the pellet was frozen at -20°C overnight.

The pellet was thawed and resuspended homogenously in 10 mL of lysis buffer (2M MgCl2, 100mM PSF, 1 mg/mL lysozyme, in PBS). The cells were lysed at 4°C for 1 h, followed by centrifugation for 9 min at 15000 g at 4°C. The supernatant, containing protein, was decanted into a new 50 mL Falcon tube and 300 µL of Protein A beads (GE, GE17-1279-03), previously washed in lysis buffer, were added. The mixture was incubated with shaking at 4°C for 2 h, and then poured into a 10 mL Econo-Pac® Chromatography Column (BioRad, 7321010). The beads were washed 3-4 times with 10 mL of PBS (pH 7.2), allowing the liquid to completely flow through each time.

The Fab was eluted with 800 µL of elution buffer (50 mM NaH2PO4, 100 mM H3PO4, 140 mM NaCl, pH 2.8) into a 15 mL Falcon tube. The elution was repeated with another 500 µL of elution buffer. The elution was neutralized with 144 µL of 1M Tris-HCl (pH 11). Buffer exchange into PBS (pH 7.2) and concentrated using Amicon protein concentrating filter units with a 30 kDa cut-

12 off (Millipore, UFC803024). Fab concentration was estimated by measuring the absorbance at 280 nm

2.2.3.2 IgG production and purification

Expi293 mammalian cells were seeded in 200 mL of Expi293 expression medium, at a concentration of 1.3 x 106 cells/mL and cultured for 24 hours at 37°C. Once the concentration of the cells had doubled, plasmids containing IgG heavy chain and light chain DNA were mixed with 20 mL of OptiMEM media (ThermoFisher, 31985-062), and added into a tube containing 200 µL FectoPRO transfection reagent (Polyprus, 116-010). This mixture was incubated at room temperature for 10 min, followed by its slow addition, in a drop-wise manner, into the Expi293 cell culture. A 100 µL aliquot of FectoPRO booster was also added at this point. The transfected cells were incubated at 37°C for up to 5 days with shaking at 125 rpm.

After the incubation period, the Expi293 cell culture was centrifuged at 2000 g for 15 min to pellet cells and cellular debris, and the supernatant containing IgG was diluted with 10x DPBS (pH 7) (ThermoFisher, 14200-166) to a final concentration of 1x. The supernatant was mixed with 2 mL of Protein A beads, previously washed with 1x DPBS, and incubated for 3 h at room temperature with shaking. The mixture was transferred to an Econo-Pac® Chromatography Column, the supernatant was eluted, and the resin was washed with 5 mL of 1x DPBS. Resin-bound IgG was then eluted and neutralized as described for Fab above, using the same buffers.

2.2.4 Enzyme Linked Immunosorbent Assays (ELISAs)

2.2.4.1 Multipoint ELISAs

The binding of Fab and IgG to human and mouse IL-23R was assessed by ELISA. A stock solution of antigen, human and mouse IL-23R-Fc, was diluted to 1 µg/mL in PBS, 30 µL of which was used to coat 384-well Nunc Maxisorp plates (Thermo Scientific, 464718) overnight at 4°C with shaking at 125 rpm. IgG1 Fc protein and BSA were used as control antigens at the same concentration. After coating the plates, 100 µL of a 0.5% BSA solution in PBS pH 7.4 was used to block the plates for 1 h at room temperature, while shaking. The plates were washed three times with an automated plate washer (Biotek) using PBS with 0.05% Tween-20 (PBT). For multipoint ELISAs, increasing concentrations of Fab and IgG were added diluted in PBT with 0.5% BSA, incubating while shaking for 30 min. Subsequently, the plates were washed six times using the

13 automated plate washer. 30 µL of secondary antibody, either HRP-conjugated goat anti-human kappa antibody for IgG or goat anti-FLAG antibody for Fab, was added to the plates at 1:5000 dilution, and incubated for 30 min with shaking, followed by a further six washes using the plate washer. 25 µL of peroxide substrate mixture (Mandel, KP-50-76-03) was added and blue colour was developed, followed by the addition of 25 µL of 1 M H3PO4 to stop the reaction. Absorbance at 450 nm was recorded to measure colour development as indicative of the amount of antibody bound to IL-23R.

All samples were analyzed in triplicate, and absorbance values were analyzed using Prism software

(Graphpad, Version 5). The values were plotted against the concentrations and EC50 values were estimated based on the fit of the curves.

2.2.4.2 Competitive ELISAs

To evaluate whether an antibody is capable of blocking the interaction of IL-23 and IL-23R ECD, a Fab competitive ELISA was used. Plates were first coated with 30 µL of IL-23 at 10 µg/mL in PBS overnight at 4°C, followed by blocking 0.5% BSA in PBS pH 7.4. In separate tubes, IL-23R was incubated with a saturating concentration of the Fab, as calculated from the multipoint ELISA, for 30 min. IL-23 was used as a negative control, while unbound IL-23R-Fc was used as a positive control. Subsequently, 30 µL of the Fab-IL-23R mixture was added to the IL-23-coated plates and incubated for 30 min. Binding of IL-23R to IL-23 was measured with an HRP-conjugated anti-Fc secondary antibody, with colour development being measured as above, indicative of the amount of IL-23R bound to IL-23.

A competitive IgG-Fab ELISA was used to evaluate the relative binding epitopes of the antibodies obtained from the selections. Plates were coated with IL-23R-Fc, as per above, and blocked with 0.5% BSA in PBS pH 7.4. 30 µL of a saturating concentration of each IgG was first added to the plate and incubated for 30 min. Then, 5 µL of a sub-saturating concentration of each Fab was added to the plate. Fab binding was measured with an HRP-conjugated anti-FLAG secondary antibody and quantified using the colorimetric assay described above.

2.2.5 Analysis of binding kinetics by biolayer interferometry

The binding kinetics of antibody-receptor interactions, relative epitope analysis and blocking assays were carried out by biolayer interferometry (BLI) analysis using an Octet HTX system (ForteBio). To measure binding kinetics, increasing concentrations of IL-23R were immobilized on the sensor and the sensor was then dipped into wells containing serial dilutions of Fab or IgG for 300 s. Sensors were then dipped into a control buffer for 300 s to measure dissociation of the antibodies from the antigen. A 1:1 Langmuir model was used to fit the association and dissociation of the antibodies at each concentration, which allowed for the estimation of the binding affinity,

KD.

For the competition assays, IL-23R was immobilized on the sensor surface as above. Sensors were then dipped into a saturating concentration of a primary analyte, such as an antibody or IL-23, for 300 s. Then the sensors were dipped into a competing or probing analyte for 300 s and association of the competing analyte was measured. If the saturating analyte bound the same epitope or nearby to the competing analyte, the competing analyte would be blocked from binding, and the assay would show no association of the competing analyte with the sensor-bound IL-23R.

2.2.6 STAT3 signaling assay by western immunoblotting

HeLa cells (available in the lab) were cultured in a complete growth medium consisting of DMEM media (ThermoFisher, 11995065) supplemented with 10% Fetal Bovine Serum (FBS) and a penicillin/streptomycin cocktail (ThermoFisher, 10378016), at 37°C and 5% CO2. The cells were transfected with the IL-23R-encoding plasmid along with the pSb1 vector containing the transposase enzyme, using Polyjet (Froggabio, SL100688). Approximately 24 h after transfection, the cells were washed and incubated in growth medium with 350 µg/mL of hygromycin (Bioshop, HYG002.1). Cells underwent selection in this medium for 2 weeks, after which the surviving cells were transfected with the IL-12Rb1 plasmid as well as the transposase-containing plasmid. 24 h after transfection, the cells were washed and recultured in growth medium containing 350 µg/mL of hygromycin, as well as 2 µg/mL of puromycin (Bioshop, PUR333.100). Cells that survived after 2 weeks of selection with puromycin and hygromycin were used for the subsequent assay. The concentrations of both hygromycin and puromycin used for selections was determined by performing a kill curve on wild type HeLa cells with different concentrations of each antibiotic.

For western blotting of phosphorylated signaling proteins, 5 X 105 HeLa cells per well, expressing both IL-23R and IL-12Rb1, were seeded into 24-well plates. After seeding for 12 h, cells were washed and re-cultured in DMEM containing no FBS, to serum starve for up to 16 h. The concentration of IL-23 required to stimulate STAT3 phosphorylation was determined by titrating IL-23 onto the transfected HeLa cells, and determining the lowest concentration at which p-STAT3 was observed. To evaluate antibody-mediated inhibition of STAT3 phosphorylation, serum- starved cells were incubated with increasing concentrations of antibody, as Fab or IgG, in serum- free DMEM and incubated with the cells for 15 min, after which IL-23 was added at the determined concentration. After 30 min of IL-23 stimulation (Lochmatter et al., 2016), cells were lysed in the wells on ice using 200 µL of RIPA buffer (ThermoFisher, 89901), and cell lysate was collected in Eppendorf tubes. Total protein in lysate was measured using the PierceTM BCA assay (ThermoFisher, 23227), and samples containing 5 µg of protein were mixed with Laemmli Sample buffer (BioRad, 1610747) supplemented with 50 nM dithiothreitol (DTT), before boiling at 95°C.

Protein samples were added to individual wells of 4-15% TGX precast protein gel (BioRad, 4561086) and resolved by electrophoresis at 170V for ~40 min in Tris/Glycine/SDS buffer (BioRad, 1610732), before transferring to a low fluorescence polyvinylidene difluoride (PVDF) membrane (BioRad, 1704275) using the Trans-Blot® TurboTM transfer system. The membrane was then blocked with a TBT solution (0.05% Tween-20, 5% BSA in TBS pH 7.5), for 1 h with shaking at room temperature. Next, the anti-p-STAT3 antibody was added at 1:5000 dilution in the blocking buffer, and the membrane was incubated overnight at 4°C. The next day, the membranes were washed three times with TBST buffer (0.05% Tween-20 in TBS pH 7.5), followed by the addition of HRP-conjugated anti-Rabbit IgG secondary antibody, diluted 1:10000 in blocking buffer, for 1 h at room temperature. Signal from bound antibody was developed using the Clarity Western ECL substrate system (BioRad, 1705060), and images were taken using the ChemiDoc MP Imaging System (BioRad). Analysis of the images, including densitometry of protein bands, was carried out using the Image Lab software (BioRad, Version 6).

After visualizing the p-STAT3 bands, the blots were stripped using the OneMinute® Advance Western Blot Stripping buffer (GM Biosciences, GM6031). The blots were first washed with TBST buffer, followed by incubation with the stripping buffer for up to 5 min at room temperature. Subsequently, the blots were washed three times with TBST buffer, and re-blocked with TBT

16 solution. STAT3 antibody was diluted 1:2000 in TBT solution, and added to the membrane, incubating for 1 h at room temperature with shaking. Visualization of total STAT3 was conducted as above. After densitometry analysis of the protein bands for p-STAT3 and STAT3, the signal for p-STAT3 levels was shown relative to the total STAT3 levels.

2.2.7 Flow cytometry detection of cell surface IL-23R expression

A CytoFlex flow cytometer equipped with a 488-nm excitation laser (Beckman Coulter) was used for all flow cytometry experiments. All assays were carried out in a wash/blocking buffer composed of PBS with 1% BSA and 0.1% sodium azide. The buffer (FACS buffer) and all antibody binding and wash steps were conducted on ice. The cells were fixed after antibody binding, before any analysis, using 4% para-formaldehyde (PFA). Finally, all data analysis was carried out using FlowJo software (version 10).

Wild-type and transfected HeLa cells were grown in complete growth medium as above. Cells were harvested using PBS pH 7.4 containing 10 mM EDTA and isolated by centrifugation at 300 g for 5 min, before resuspension in the FACs buffer on ice. Approximately 3 X 105 cells were added to each well of a 96-well 2.2 mL volume propylene block (VWR, 89091-856) and incubated with serial dilutions of Fab or IgG, for 30 min. The cells were then washed with 1 mL of FACS buffer, then the block was centrifuged at 300 g for 5 min. The buffer was gently decanted and the cells were resuspended in 100 µL of FACS buffer containing a 1:100 dilution of 7- aminoactinomycin D (7AAD) and a 1:500 dilution of Alexa488-conjugate anti-F(ab¢)2 secondary antibody. After 30 min of incubation, the cells were washed twice with 1 mL of FACs buffer and fixed in 4% PFA. After a final wash with FACS buffer, the cells were resuspended again in 150 µL of FACS buffer and transferred to a 96-well assay plate. Data were recorded on the Cytoflex program. First, the population was gated using forward and side size scatter (FSC, SSC), followed by gating based on the lack of 7AAD signal. The fluorescence from the Alexa488 fluorophore was recorded for this population of cells and the background signal from cells incubated with only the secondary antibody was subtracted. The mean fluorescence intensity (MFI) was compared between transfected and untransfected cells to observe antibody binding to cells.

2.2.8 RT-qPCR validation of cell lines

RNA was isolated from 5 X 105 cells from wild type HeLa cells or cells stably transfected with IL-23R and IL-12Rb1 using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s instructions. The RNA load was normalized between the two samples and reverse transcribed into cDNA using the iScript Reverse Transcription Supermix (BioRad, 1708841). The resulting cDNA was then used for quantitative polymerase chain reaction (qPCR) assays using the iTaq Universal SYBR Green Supermix (BioRad, 1725120) and the primers listed in

Table 1.

Table 1: Primers for qPCR Target Amplicon Sequence T (°C) mRNA length (bp) m IL-23R FWD: GCCAAGCAGCAATTAAGAAC 248 63 REV: GACACAGGTTACTTCATCAGG IL-12Rb1 FWD: CACAGAGACCCAAGTTACC 156 63 REV: GAGGCGAAGAAGATGAGC GAPDH FWD: CTGTTCGACAGTCAGCCGCATC 202 72 REV: GCGCCCAATACGACCAAATCCG b-actin FWD: GGACTTCGAGCAAGAGATGG 234 68 REV: AGCACTGTGTTGGCGTACAG

2.3 Results

2.3.1 ELISAs

Repeated phage binding selections were conducted at the TRAC against IL-23R resulting in the isolation of 13 different Fab binding clones. Of the different Fab clones, only two clones (Figure 4) showed both highly specific and tight binding to recombinant human IL-23R by multipoint

ELISAs (Figure 5). Clone 11189, with an EC50 of 15.3 ± 1.1 nM for the Fab and 2.1 ± 1.1nM for IgG, was the strongest binder to IL-23R. The Fab version of 11189 did not exhibit cross reactivity to mouse IL-23R; however, the IgG version showed some cross-reactivity with the mouse receptor, likely attributed to the higher avidity of the bivalent format. Clone11189 also showed less non- specific binding in its Fab version than clone 11188, which exhibited some binding to human IgG1 Fc protein. Neither clone showed any non-specific binding in the IgG format.

Figure 4: Sequences of the CDR regions of each antibody clone The variable regions of each CDR are shown here for clones 11188 and 11189.

EC50 = 15 nM

EC50 = 610 nM

EC50 = 2.6 nM EC50 = 2.1 nM

Figure 5: Multipoint ELISA of antibody binding to IL-23R All the graphs show antibody binding to immobilized antigen. (a) and (b) show the Fab versions of clone 11188 and 11189 respectively, while (c) and (d) show the IgG versions of each clone. The black curves show binding signals to human IL-23R, the red curves to mouse IL-23R, the green curves to IgG1 Fc, and the yellow curves to BSA. The EC50 estimates for binding to human IL-23R are also shown for each antibody version and clone.

Competitive ELISAs measuring the ability of either antibody clone to block binding of IL-23 to IL-23R showed that Clone 11189 in its Fab format could completely block this interaction (Figure 6). Clone 11188 exhibited only partial blockade of IL-23 binding to IL-23R. Competitive ELISAs assessing the relative epitopes of these antibodies showed that both Clone 11188 and 11189 bind overlapping epitopes on IL-23R (Figure 7).

Figure 6: Fab 11189 blocks IL-23:IL-23R interaction A competitive ELISA showing the effect of Fabs 11188 and 11189 on the binding of IL-23R to immobilized IL-23. The black bars show the binding of each complex to IL-23, while the orange bars show binding to BSA. IL-23R alone, not bound by either IL-23 or Fab, was used as a positive control, while IL-23R bound to IL-23 was used as a negative control.

Fab 11188 1.40 Fab 11189

1.05

0.70

0.35

0.00 Relative Fab Binding to IL-23R to Binding Fab Relative

No IgG IgG 11188 IgG 11189 No IgG (BSA) Saturating IgG

Figure 7: 11188 and 11189 bind overlapping epitopes on IL-23R The black bars show binding of Fab 11188 to IL-23R saturated with IgG, while the orange bars show binding of Fab 11189. Fab incubated with BSA was used as a positive control with a non-binding negative control.

2.3.2 BLI Kinetic Analysis

BLI was used to estimate the binding affinities of clones 11188 and 11189 to both human and mouse IL-23R-Fc. Table 2 shows the summary of the analysis, showing the on and off rates of the antibodies, as well the dissociation constant (KD). Similar to observations by ELISA, clone 11189 had the highest affinity with dissociation constants of 10 ± 0.1 nM and 70 ± 0.1 pM for the Fab and IgG formats, respectively. Both clones also showed cross-reactivity with mouse IL-23R, with the affinities of both Fab and IgG versions dropping by approximately 5-fold to give KD value of 53 ± 2 nM and 540 ± 20 pM, respectively.

Table 2: Estimate of binding kinetics for antibody:IL-23R interactions

4 -1 -1 -4 -1 Ligand Analyte kon (10 M s ) koff (10 s ) KD (nM) hIL-23R 11188 (Fab) 2.3 ± 0.1 13 ± 0.3 56 ± 2 hIL-23R 11189 (Fab) 9.4 ± 0.1 9.4 ± 0.1 10 ± 0.1 hIL-23R 11188 (IgG) 74 ± 0.4 3.3 ± 0.1 0.45 ± 0.01 hIL-23R 11189 (IgG) 55 ± 0.6 0.4 ± 0.1 0.07 ± 0.02 mIL-23R 11188 (Fab) 3.2 ± 0.2 30 ± 0.9 93 ± 5 mIL-23R 11189 (Fab) 4.8 ± 0.1 25 ± 0.5 53 ± 2 mIL-23R 11188 (IgG) 83 ± 1 8.2 ± 0.1 0.99 ± 0.02 mIL-23R 11189 (IgG) 104 ± 2 5.7 ± 0.2 0.54 ± 0.02

Human antigen is labelled with an “h”, while mouse antigen is labelled with an “m”. kon is the association rate, koff is the dissociation rate, and KD is the dissociation constant calculated as the ratio of kon to koff.

Competition assays were also conducted by BLI, confirming results obtained by ELISA, that both clones 11188 and 11189, effectively blocked the interactions between IL-23 and IL-23R. It also showed that both clones bind the same epitope on IL-23R. While both clones 11188 and 11189 block binding of IL-23 to IL-23R, clone 11189 is the stronger candidate with both Fab and IgG versions of the antibody blocking the binding between cytokine and receptor. The level of blockade was shown to be at the same level as already bound IL-23 preventing more from binding (Figure 8).

Figure 8: Both Fab and IgG 11189 block IL-23:IL-23R interaction (a) shows a heat map of the relative epitope analysis obtained by BLI. All data is shown relative to the binding of each competing analyte to human IL-23R incubated with a non-binding control antibody. The strength of binding is shown from stronger to weaker binding through a range of colours from green to orange to red, stronger. (b) is a bar graph of human IL-23 binding to human IL-23R pre-saturated with each analyte. The data shown in (b) is taken from (a)

2.3.3 Flow cytometry detection of cell surface IL-23R binding

As the in vitro analysis already carried out on clones 11188 and 11189 shows, clone 11189 binds IL-23R with higher affinity and specificity than clone 11188 while also being able to more effectively block the interaction between IL-23 and IL-23R. As such, all subsequent analyses were conducted only on clone 11189.

Both Fab and IgG versions of clone 11189 were used to evaluate the expression of IL-23R on newly transfected HeLa cells, and both showed binding to HeLa cells expressing IL-23R. The Fab version exhibited no binding whatsoever to wild-type HeLa cells, while the IgG exhibited some binding to the untransfected cells. Both versions of clone 11189 bind specifically to IL-23R expressing cells, while both versions of clone 4275, a negative control, do not bind at all (Figure

9). However, at concentrations above 100 nM, fluorescence signal was reduced, even though all the steps were carried out on ice.

Figure 9: 11189 Fab and IgG binds specifically to cells expressing IL-23R Increasing concentrations of both (a) Fab and (b) IgG 11189 and control 4275 were incubated with HeLa cells transfected with IL-23R and IL-12Rb1, as well as wild-type (WT) HeLa cells. Binding was measured by the fluorescence emitted from a secondary antibody conjugated with A488 fluorophore. The concentrations of both Fab and IgG were transformed logarithmically and the results are shown as the mean fluorescence intensity (MFI) as calculated using FlowJo software.

2.3.4 Development of HeLa cells for the assay

Wild-type HeLa cells were transfected with plasmid constructs with genes encoding for IL-23R and IL-12Rb1. The expression of these two genes was measured after selections by RT-qPCR. Analysis of the mRNA expression showed that the transfected HeLa cells had very high expression of both IL-23R and IL-12Rb1, compared to no expression in the wild-type HeLa cells of either mRNA. Further evidence of the expression of both IL-23R and IL-12Rb1 as proteins was shown above in the flow cytometry assays with clone 11189.

To develop an assay to show IL-23-dependent p-STAT3 induction, recombinant IL-23 was titrated on to wild-type and transfected HeLa cells, and downstream p-STAT3 levels were observed using western blots. The transfected HeLa cells showed induction of p-STAT3 signal starting at 0.5 ng/mL, while there was no signal induced in wild-type cells. Densitometric analysis of the p- STAT3 signal from assays on both cell types showed that the signal saturates above 10 ng/mL (Figure 10). As such, for further assays with IL-23 stimulation, 5 ng/mL was used as it was a sub- saturating concentration.

Figure 10: IL-23 induces phosphorylation of STAT3 in transfected HeLa cells Increasing concentrations of IL-23, in ng/mL, was titrated onto wild-type HeLa cells or cells transfected with IL-23R and IL-12Rb1. (a) shows the western blot of the p-STAT3 signal and total STAT for both wild-type and transfected HeLa cells. (b) shows the densitometry of the p-STAT3 signal in both cell types relative to total STAT3.

2.3.5 The effect of antibodies on IL-23 induced p-STAT3 signals

Fab and IgG clones were evaluated for their ability to reduce the p-STAT3 signal seen after IL-23 stimulation of HeLa cells expressing IL-23R and IL-12Rb1. Fab 11189 reduced p-STAT3 signals to background levels at 1 µM (Figure 11). However, blocking with IgG 11189 at 1 µM exhibited higher levels of p-STAT3 than seen with the Fab (Figure 12), and as such the IgG version reduced p-STAT3 signals less than the Fab version. Both Fab and IgG versions of clone 4275, the control antibody, did not show any effect on the intensity of the p-STAT3 band seen on the western blot.

Figure 11: Fab 11189 inhibits IL-23-induced phosphorylation of STAT3 in HeLa cells HeLa cells transfected with IL-23R and IL-12Rb1were stimulated with IL-23 with or without the Fab version of clone 11189. (a) Shows the western blot of the p-STAT3 and total STAT3 signal after stimulation with IL-23. The first column is the negative control of serum-starved HeLa cells without stimulation, while column two is the positive control with IL-23 signal without antibody present. (b) Shows the densitometry data for p-STAT3 from the western blot in (a) normalized to the level of total STAT3 and relative to the positive control. The Fab version of clone 4275 is a negative control antibody.

Figure 12: IgG 11189 partially inhibits IL-23-induced phosphorylation of STAT3 in HeLa cells (a) Shows the western blot presenting the effects of IgG on inhibiting IL-23-dependent p-STAT3 signals and (b) shows the densitometric representation of that data as in Figure 11. The IgG version of clone 4275 was used as a negative control

Further analysis was carried out to see whether antibody alone, in either the Fab or IgG format, could induce IL-23-independent p-STAT3 signals. Fab 11189 did not show any induction of IL- 23-independent signaling; however, IgG 11189, at 100 nM, showed p-STAT3 signal, though not as intense as the signal induced with IL-23. Further analysis of this IL-23-independent signal showed that IgG 11189 between 10 and 100 nM shows a dose-dependent IL-23-independent p- STAT3 signal (Figure 13). At all concentrations, Fab and IgG versions of the clone 4275, the control antibody, did not show any activation of p-STAT3 signal.

Figure 13: IgG 11189 acts as an agonist (a) Shows the Fab versions of the antibodies and their effect on p-STAT3 activation, while (b) and (c) show the effect of the IgG versions. The negative controls consist of unstimulated cells, denoted with a -, and clone 4275. The positive control, denoted with +, consists of cells stimulated with IL-23 without antibody present.

2.4 Discussion

IL-23, signaling through the IL-23R and IL-12Rb1 receptors, is partially responsible for the development and maintenance of IL-17-producing TH17 cells, cells that are essential for the host defense against extracellular bacterial and fungal pathogens. However, dysregulation of IL-23 signaling has been shown to be one of the factors responsible for the development of autoimmune inflammatory conditions such as IBD or psoriasis. Even though several antibodies targeting and

26 inhibiting the function of IL-23 are in clinical trials to study their effectiveness against these conditions, there has only been one antibody described to date that targets the IL-23R, and none that have progressed towards studying their effectiveness in patients. This project aimed to characterize novel antibodies, synthetically produced using phage-display technology, which act in a receptor-directed mechanism to inhibit IL-23 signaling. This report describes one such antibody, clone 11189, which was determined to bind human IL-23R with high affinity and specificity in both Fab and IgG formats. Clone 11189 was also shown to bind to cells ectopically expressing IL-23R while neither Fab nor IgG protein showed appreciable interaction with wild- type cells for both Fab and IgG constructs. Finally, both Fab and IgG versions of clone 11189 were shown to hinder the interactions between IL-23 and IL-23R, while the Fab version was also observed to reduce intracellular signal transduction through reduced phosphorylation-activation of the STAT3 transcription factor.

Though the phage selections were conducted prior to this study, repeated selection efforts did provide 13 unique clones for study. However, of the 13 clones, only four showed strong, specific binding to the IL-23R during ELISA and BLI assays, and only two were able to block IL-23:IL- 23R interactions. All selections were carried out with recombinant antigen, as described in 2.2, which was produced by a mouse myeloma cell line before purification. This antigen comprised a homodimer of the ECD of IL-23R fused to an IgG1 Fc region, which provided stability and increased yield. As such, the recombinant protein is not necessarily present in the same form, or same conformation(s), as IL-23R would be on the cell surface. Insofar as folding is required for function, selection on protein that is functionally folded may yield binders that may be more effective in a cellular setting. Cell-based methods of selection, like Cellect-Seq, could be a better alternative to obtain antibody clones that may prove to be functional binders on cells. Cellect-Seq uses phage display technology, while carrying out the selection on cells expressing the antigen of interest. Negative selections can be carried out on the same cell type but without the antigen being expressed (Sidhu and Geyer, 2015).

While the Fab version of clone 11189 acted as an antagonist, the IgG version acted as an agonist at lower concentrations, activating STAT3 signaling in an IL-23-independent manner. Antibodies are becoming more commonplace as therapeutics due to their high specificity to target antigens, and have been used for many years as therapeutics by employing effector mechanisms of the immune system to kill target cells. However, antibodies are also able to act as ligands, to mimic

27 or block biological molecules to either activate or inhibit signaling pathways (Vitetta and Uhr, 1994). Receptor agonists are molecules that mimic a biological ligand to activate the same biological effects within the cell, whereas receptor antagonists block the biological signal. Synthekines are synthetic cytokines that may activate receptor signaling, but unlike most agonists, they cause receptor activation through non-natural receptor pairings. These receptor combinations do not normally occur upon binding of a cytokine. Synthekines are a combination of two different cytokines, and this mutant form is capable of binding to two separate receptors which are part of two separate pathways (Moraga et al., 2017; Villarino and O’Shea, 2017). Together, all these molecules have use as potential therapeutics, as well as for research purposes, and the data presented in this study suggest that clone 11189 fits both roles based on the structure of the protein.

Format-dependent functions for antibodies are not without precedent. An antibody, Mab6H8, was raised against the b2-adrenoceptor (b2-AR), a receptor controlling the contraction of cardiomyocytes. As an IgG, this antibody showed agonistic activity, hypothesized to act by stabilizing the dimeric conformation of the activated b2-ARs. However, in the Fab form, Mab6H8 inhibited receptor activation possibly through allosteric mechanisms changing the ligand binding site of b2-AR (Mijares et al., 2000). In addition, monoclonal antibodies have been developed against the erythropoietin receptor (EPOR), that are capable of homodimerizing two EPORs on the cell surface and thereby initiating activation of the consequent signaling pathways. Canonical signaling of erythropoietin (EPO) occurs through the homodimerization of EPOR, and the developed antibodies are receptor agonists, capable of activating signaling in an EPO-independent manner (Elliott et al., 1996; Watowich et al., 1994).

Though no investigation of conformational changes occurring upon Fab 11189 binding to IL-23R was conducted, evidence did show blockade of IL-23:IL-23R interactions that were further reflected as reductions in downstream signaling. IgG 11189 showed similar ability to block ligand- receptor interactions (Figure 8), but also exhibited agonist-like activity on the cell surface receptor, presumably by crosslinking the receptor, thus activating downstream signaling in an IL-23 independent manner (Figure 13). Previous studies have shown that high concentrations of an IL- 23-like recombinant protein, p40_D2D3-p19-Fp, which cannot bind IL-12Rb1, activated STAT3, similar to IL-23. The mutated protein contains the p19 subunit necessary to bind IL-23R, but is lacking the domain on p40 required to bind IL-12Rb1. This suggested that IL-23R could form

28 homodimers and activate signaling (Schröder et al., 2015). Further research also showed that deletions of the stalk region of IL-23R ECD was capable of activating IL-23-independent signaling through the formation of IL-23R homodimers (Hummel et al., 2017). In addition, Ba/F3 cells expressing full length IL-23R and IL-12Rb1 proliferated in an IL-23-dependent manner, but were capable of proliferating independently of IL-23 when expressing the mutated form of IL-23R (Hummel et al., 2017). Therefore, this non-canonical activation of IL-23R can lead to intracellular signaling through the activation of STAT3, though other components of the pathway remain unknown.

The structure of an IgG (Figure 3) consists of two arms containing identical antigen binding pockets, making an IgG a bivalent molecule. Conversely, Fabs are monovalent, possessing only one binding site. Due to the nature of an IgG, it can bind to two antigens, separately. Presumably, the IgG version of clone 11189 is capable of binding to two different IL-23R ECDs on the cell surface, and bring the two receptors into close contact. The data presented in this study allows one to infer that the bidentate nature of IgG binding forces the two IL-23Rs to homodimerize, thereby activating downstream signaling through a potentially non-canonical pathway. IgG 11189 thus acts as a synthekine. No study to date has shown any form of non-natural IL-23R interactions and additional study of this mechanism, including reporter assays studying receptor dimerization, would provide further evidence on this non-canonical activation method. Several assays, such as a protein complementation assay developed by Michnick et al. (2016), or the mammalian- membrane two hybrid assay (MaMTH) (Petschnigg et al., 2014), might be possible methods by which the mechanism of receptor dimerization can be examined. These assays would tag IL-23R with a bait protein and identify other proteins, tagged with a prey protein, that are brought into close enough proximity as to allow phosphorylation events and activation of signaling. It would be possible to observe whether IL-23R is forming homodimers as hypothesized, or whether another mechanism is responsible for signal transduction. More study also needs to be done to identify the specific transcriptional signature of this non-canonical signaling profile since the observed activation of STAT3 is only one window to the entire signaling pathway. It is still to be seen whether the phosphorylation of STAT3, through the hypothesized IL-23R homodimers, leads to the same transcriptional activation of genes, such as Rorc and IL-23R, seen upon IL-23- dependent signaling through the IL-23R/IL-12Rb1 complex.

All observations of the effects of antibodies on intracellular IL-23 signaling, specifically activation of STAT3, were carried out on HeLa cells, ectopically expressing IL-23R and IL-12Rb1.As shown in the results above, wild-type HeLa cells did not express any mRNA for either receptor and thus, all cell signaling that is seen in this study mediated by treatment with IL-23 is artificial. In order to maintain consistency among experiments, selection with puromycin and hygromycin was carried out on the cell lines after transfection with the receptor constructs. This provided a more stable expression of IL-23R and IL-12Rb1 over many experiments, compared to transient transfection which may cause variations in the amount of receptor expressed among different cells (Kim and Eberwine, 2010). However, gene-modified HeLa cell lines may also alter or disrupt signaling cascades. Overexpression of receptors not normally expressed in a cell type could lead to signaling artifacts and may also activate or use signaling components that would be otherwise involved in separate pathways (Watson et al., 2011). Using primary cell lines may provide a further avenue of study, by testing the antibody on the cells it would target as a potential therapeutic. IL-

17 producing TH17 cells can be produced in vitro with isolated peripheral blood mononuclear cells (PBMCs), which have been stimulated with antibodies targeting CD3 and CD28 receptors, as well as cytokines such as IL-23 and IL-1b (Wilson et al., 2007). The effect of the antibodies on the release of IL-17A/F cytokines upon stimulation with IL-23 can be measured by ELISA.

In conclusion, these data describe one antibody clone, 11189, which is capable of binding to IL- 23R and disrupting IL-23- induced phosphorylation of STAT3 in its monovalent Fab form, while the bivalent IgG form is capable of activating IL-23-independent signaling. Both versions of the antibody showed high affinity and specific binding to recombinant IL-23R, as well as to engineered cell lines expressing IL-23R. Due to the lack of antibodies that target IL-23R, this new antibody provides a powerful new tool to further develop as a single-armed antagonist of the IL- 23 signaling pathway, and as a potential therapeutic in the treatment of inflammatory, autoimmune diseases. In addition, the bivalent IgG provides a means to study the activity and physiological effects of non-natural receptor homodimerization.

Conclusion and Future Perspectives

IL-23 is a critical cytokine for the maintenance of TH17 cells, a subset of T helper cells responsible for defense against extracellular pathogens but are also implicated in autoimmune diseases due to aberrant IL-23 signaling. Chapter 2 describes the development of one novel antibody targeted to the IL-23R, which is capable of inhibiting IL-23-dependent signaling in its Fab format. The current landscape of IL-23R antibodies is incomplete, with only one other IL-23R antibody described (Sasaki-Iwaoka et al., 2018). This study provides the groundwork for the development of a potential IL-23R targeting therapeutic, which may be used for patients suffering with IBD or psoriasis, diseases showing strong correlations with abnormal IL-23 signaling.

3.1 Development of antibodies targeting cytokine receptors

With the increase in the development of biologics to treat disease, the production of antibodies to target cytokines is an expanding field. Aberrant cytokine signaling has been implicated in many diseases and the inhibition of specific cytokines are attractive therapeutic strategies. Targeting a specific cytokine involved in a signaling pathway can lead to the arrest of that pathway, hypothetically providing a direct target for a therapeutic. However, cytokines are pleiotropic, the inhibition of one cytokine may treat a specific disease while also causing a negative effect on another pathway (Rider et al., 2016). Redundancies present in pathways may also play a role, where blocking of one cytokine might be counteracted by another cytokine which plays a redundant role in the pathway (Rider et al., 2016). Broad cytokine therapies might yield unwanted effects such as loss of defense against infections and, as described in Chapter 1, targeting cytokine receptors provides a more specific and targeted therapeutic approach.

The structural considerations of an IgG allow for one antibody to target two antigens: one arm targets a tissue-specific antigen, while the other arm binds to the target antigen (Kontermann and Brinkmann, 2015). One example of such a system is a bispecific T cell engager (BiTE). These bispecific antibodies target the CD3 receptor on T cells while also targeting a specific cancer cell receptor such as the EGFR or the VEGFR, allowing the T cell to specifically target the cancer cell (Ross et al., 2017). Another example is a bispecific antibody that targets IL-6R and IL-17A. This antibody was described as a potential therapeutic against rheumatoid arthritis by inhibiting both IL-6 and IL-17A pathways, both of which have non-overlapping effects on inflammation (Lyman et al., 2018). Clone 11189 is an ideal candidate of a bispecific antibody that targets both IL-23R

and another antigen, IL-17A/F. This would target two components of TH17 cells, possibly providing an additive therapeutic effect.

3.2 Conclusion

This study describes the development and characterization of an antibody that binds to human IL- 23R and is capable of inhibiting downstream signaling through the blockade of IL-23:IL-23R interactions. This antibody, in the monovalent Fab format, acts as an antagonist of IL-23 signaling by targeting the receptor and blocking the ligand binding site. It also expands on a non-canonical IL-23 signaling pathway, where the bivalent IgG molecule is capable of activating IL-23- independent activation of downstream signaling, possibly through homodimerization of IL-23R. The experimental process of this study, with characterizing of the in vitro binding of the antibodies and moving towards measuring their effects on intracellular signaling, can be extrapolated for further analysis of novel antibodies targeting a host of cytokine receptors. The constructed cell line, ectopically expressing IL-23R and IL-12Rb1, was an effective model system to study the influence of the antibodies on intracellular signals, and further analysis of the antibodies can be conducted using primary cell assays. These assays would be the ideal measurement of the efficacy of the antibody as an antagonist of IL-23 signaling, and would pave the way for studies on animal models or clinical trials.

References

Abbas, A.K., Murphy, K.M., and Sher, A. (1996). Functional diversity of helper T lymphocytes. Nature 383, 787–793.

Acosta-Rodriguez, E.V., Rivino, L., Geginat, J., Jarrossay, D., Gattorno, M., Lanzavecchia, A., Sallusto, F., and Napolitani, G. (2007). Surface phenotype and antigenic specificity of human interleukin 17–producing T helper memory cells. Nat. Immunol. 8, 639.

Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002a). Molecular Biology of the Cell.

Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002b). Helper T Cells and Lymphocyte Activation. Mol. Biol. Cell 4th Ed.

Bangert, C., and Kopp, T. (2018). Tildrakizumab for the treatment of psoriasis. Immunotherapy 10, 1105–1122.

Bloch, Y., Bouchareychas, L., Merceron, R., Składanowska, K., Van den Bossche, L., Detry, S., Govindarajan, S., Elewaut, D., Haerynck, F., Dullaers, M., et al. (2018). Structural Activation of Pro-inflammatory Human Cytokine IL-23 by Cognate IL-23 Receptor Enables Recruitment of the Shared Receptor IL-12Rβ1. Immunity 48, 45-58.e6.

Cargill, M., Schrodi, S.J., Chang, M., Garcia, V.E., Brandon, R., Callis, K.P., Matsunami, N., Ardlie, K.G., Civello, D., Catanese, J.J., et al. (2007). A Large-Scale Genetic Association Study Confirms IL12B and Leads to the Identification of IL23R as Psoriasis-Risk Genes. Am. J. Hum. Genet. 80, 273–390.

Charles A Janeway, J., Travers, P., Walport, M., and Shlomchik, M.J. (2001). Principles of innate and adaptive immunity. Immunobiol. Immune Syst. Health Dis. 5th Ed.

Chognard, G., Bellemare, L., Pelletier, A.-N., Dominguez-Punaro, M.C., Beauchamp, C., Guyon, M.-J., Charron, G., Morin, N., Sivanesan, D., Kuchroo, V., et al. (2014). The dichotomous pattern of IL-12r and IL-23R expression elucidates the role of IL-12 and IL-23 in inflammation. PloS One 9, e89092.

Chua, A.O., Wilkinson, V.L., Presky, D.H., and Gubler, U. (1995). Cloning and characterization of a mouse IL-12 receptor-beta component. J. Immunol. 155, 4286–4294.

Davies, D.R., and Cohen, G.H. (1996). Interactions of protein antigens with antibodies. Proc. Natl. Acad. Sci. 93, 7–12.

Desmet, J., Verstraete, K., Bloch, Y., Lorent, E., Wen, Y., Devreese, B., Vandenbroucke, K., Loverix, S., Hettmann, T., Deroo, S., et al. (2014). Structural basis of IL-23 antagonism by an Alphabody protein scaffold. Nat. Commun. 5, 5237.

32 33

Duerr, R.H., Taylor, K.D., Brant, S.R., Rioux, J.D., Silverberg, M.S., Daly, M.J., Steinhart, A.H., Abraham, C., Regueiro, M., Griffiths, A., et al. (2006). A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 314, 1461–1463.

Elliott, S., Lorenzini, T., Yanagihara, D., Chang, D., and Elliott, G. (1996). Activation of the Erythropoietin (EPO) Receptor by Bivalent Anti-EPO Receptor Antibodies. J. Biol. Chem. 271, 24691–24697.

Feagan, B.G., Panés, J., Ferrante, M., Kaser, A., D’Haens, G.R., Sandborn, W.J., Louis, E., Neurath, M.F., Franchimont, D., Dewit, O., et al. (2018). Risankizumab in patients with moderate to severe Crohn’s disease: an open-label extension study. Lancet Gastroenterol. Hepatol. 3, 671–680.

Fellouse, F.A., Wiesmann, C., and Sidhu, S.S. (2004). Synthetic antibodies from a four-amino- acid code: a dominant role for tyrosine in antigen recognition. Proc. Natl. Acad. Sci. U. S. A. 101, 12467–12472.

Floss, D.M., Klöcker, T., Schröder, J., Lamertz, L., Mrotzek, S., Strobl, B., Hermanns, H., and Scheller, J. (2016). Defining the functional binding sites of interleukin 12 receptor β1 and interleukin 23 receptor to Janus kinases. Mol. Biol. Cell 27, 2301–2316.

Gandhi, M., Alwawi, E., and Gordon, K.B. (2010). Anti-p40 antibodies ustekinumab and briakinumab: blockade of interleukin-12 and interleukin-23 in the treatment of psoriasis. Semin. Cutan. Med. Surg. 29, 48–52.

Gordon, K.B., Strober, B., Lebwohl, M., Augustin, M., Blauvelt, A., Poulin, Y., Papp, K.A., Sofen, H., Puig, L., Foley, P., et al. (2018). Efficacy and safety of risankizumab in moderate-to- severe plaque psoriasis (UltIMMa-1 and UltIMMa-2): results from two double-blind, randomised, placebo-controlled and ustekinumab-controlled phase 3 trials. The Lancet 392, 650– 661.

Hummel, T.M., Ackfeld, T., Schönberg, M., Ciupka, G., Schulz, F., Oberdoerster, A., Grötzinger, J., Scheller, J., and Floss, D.M. (2017). Synthetic Deletion of the Interleukin 23 Receptor (IL-23R) Stalk Region Led to Autonomous IL-23R Homodimerization and Activation. Mol. Cell. Biol. 37.

Iwakura, Y., and Ishigame, H. (2006). The IL-23/IL-17 axis in inflammation. J. Clin. Invest. 116, 1218–1222.

Jones, L.L., Chaturvedi, V., Uyttenhove, C., Van Snick, J., and Vignali, D.A.A. (2012). Distinct subunit pairing criteria within the heterodimeric IL-12 cytokine family. Mol. Immunol. 51, 234– 244.

Kellner, C., Derer, S., Valerius, T., and Peipp, M. (2014). Boosting ADCC and CDC activity by Fc engineering and evaluation of antibody effector functions. Methods San Diego Calif 65, 105– 113.

Kim, T.K., and Eberwine, J.H. (2010). Mammalian cell transfection: the present and the future. Anal. Bioanal. Chem. 397, 3173–3178.

Köhler, G., and Milstein, C. (1975). Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256, 495–497.

Kontermann, R.E., and Brinkmann, U. (2015). Bispecific antibodies. Drug Discov. Today 20, 838–847.

Ling, P., Gately, M.K., Gubler, U., Stern, A.S., Lin, P., Hollfelder, K., Su, C., Pan, Y.C., and Hakimi, J. (1995). Human IL-12 p40 homodimer binds to the IL-12 receptor but does not mediate biologic activity. J. Immunol. 154, 116–127.

Lochmatter, C., Fischer, R., Charles, P.D., Yu, Z., Powrie, F., and Kessler, B.M. (2016). Integrative Phosphoproteomics Links IL-23R Signaling with Metabolic Adaptation in Lymphocytes. Sci. Rep. 6, 24491.

Luckheeram, R.V., Zhou, R., Verma, A.D., and Xia, B. (2012). CD4+T cells: differentiation and functions. Clin. Dev. Immunol. 2012, 925135.

Lupardus, P.J., and Garcia, K.C. (2008). The structure of interleukin-23 reveals the molecular basis of p40 subunit sharing with interleukin-12. J. Mol. Biol. 382, 931–941.

Lyman, M., Lieuw, V., Richardson, R., Timmer, A., Stewart, C., Granger, S., Woods, R., Silacci, M., Grabulovski, D., and Newman, R. (2018). A bispecific antibody that targets IL-6 receptor and IL-17A for the potential therapy of patients with autoimmune and inflammatory diseases. J. Biol. Chem. jbc.M117.818559.

McCafferty, J., Griffiths, A.D., Winter, G., and Chiswell, D.J. (1990). Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348, 552–554.

Mijares, A., Lebesgue, D., Wallukat, G., and Hoebeke, J. (2000). From agonist to antagonist: Fab fragments of an agonist-like monoclonal anti-beta(2)-adrenoceptor antibody behave as antagonists. Mol. Pharmacol. 58, 373–379.

Moraga, I., Spangler, J.B., Mendoza, J.L., Gakovic, M., Wehrman, T.S., Krutzik, P., and Garcia, K.C. (2017). Synthekines are surrogate cytokine and growth factor agonists that compel signaling through non-natural receptor dimers. ELife 6, e22882.

Oppmann, B., Lesley, R., Blom, B., Timans, J.C., Xu, Y., Hunte, B., Vega, F., Yu, N., Wang, J., Singh, K., et al. (2000). Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13, 715–725.

Papp, K., Thaçi, D., Reich, K., Riedl, E., Langley, R.G., Krueger, J.G., Gottlieb, A.B., Nakagawa, H., Bowman, E.P., Mehta, A., et al. (2015). Tildrakizumab (MK-3222), an anti- interleukin-23p19 monoclonal antibody, improves psoriasis in a phase IIb randomized placebo- controlled trial. Br. J. Dermatol. 173, 930–939.

Parham, C., Chirica, M., Timans, J., Vaisberg, E., Travis, M., Cheung, J., Pflanz, S., Zhang, R., Singh, K.P., Vega, F., et al. (2002). A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J. Immunol. Baltim. Md 1950 168, 5699–5708.

Parkin, J., and Cohen, B. (2001). An overview of the immune system. Lancet Lond. Engl. 357, 1777–1789.

Paul, W.E. (1997). Interleukin 4: signalling mechanisms and control of T cell differentiation. Ciba Found. Symp. 204, 208–216; discussion 216-219.

Petschnigg, J., Groisman, B., Kotlyar, M., Taipale, M., Zheng, Y., Kurat, C.F., Sayad, A., Sierra, J.R., Usaj, M.M., Snider, J., et al. (2014). The mammalian-membrane two-hybrid assay (MaMTH) for probing membrane-protein interactions in human cells. Nat. Methods 11, 585– 592.

Rider, P., Carmi, Y., and Cohen, I. (2016). Biologics for Targeting Inflammatory Cytokines, Clinical Uses, and Limitations. Int. J. Cell Biol. 2016.

Ross, S.L., Sherman, M., McElroy, P.L., Lofgren, J.A., Moody, G., Baeuerle, P.A., Coxon, A., and Arvedson, T. (2017). Bispecific T cell engager (BiTE®) antibody constructs can mediate bystander tumor cell killing. PLOS ONE 12, e0183390.

Rozwarski, D.A., Gronenborn, A.M., Clore, G.M., Bazan, J.F., Bohm, A., Wlodawer, A., Hatada, M., and Karplus, P.A. (1994). Structural comparisons among the short-chain helical cytokines. Struct. Lond. Engl. 1993 2, 159–173.

Sasaki-Iwaoka, H., Ohori, M., Imasato, A., Taguchi, K., Minoura, K., Saito, T., Kushima, K., Imamura, E., Kubo, S., Furukawa, S., et al. (2018). Generation and characterization of a potent fully human monoclonal antibody against the interleukin-23 receptor. Eur. J. Pharmacol. 828, 89–96.

Schoenborn, J.R., and Wilson, C.B. (2007). Regulation of interferon-gamma during innate and adaptive immune responses. Adv. Immunol. 96, 41–101.

Schön, M.P., and Boehncke, W.-H. (2005). Psoriasis. N. Engl. J. Med. 352, 1899–1912.

Schröder, J., Moll, J.M., Baran, P., Grötzinger, J., Scheller, J., and Floss, D.M. (2015). Non- Canonical Interleukin 23 Receptor Complex Assembly P40 PROTEIN RECRUITS INTERLEUKIN 12 RECEPTOR β1 VIA SITE II AND INDUCES P19/INTERLEUKIN 23 RECEPTOR INTERACTION VIA SITE III. J. Biol. Chem. 290, 359–370.

Sidhu, S.S., and Fellouse, F.A. (2006). Synthetic therapeutic antibodies. Nat. Chem. Biol. 2, 682–688.

Sidhu, S.S., and Geyer, C.R. (2015). Phage Display In Biotechnology and Drug Discovery (CRC Press).

Sidhu, S.S., Lowman, H.B., Cunningham, B.C., and Wells, J.A. (2000). Phage display for selection of novel binding peptides. Methods Enzymol. 328, 333–363.

Sivanesan, D., Beauchamp, C., Quinou, C., Lee, J., Lesage, S., Chemtob, S., Rioux, J.D., and Michnick, S. (2016). IL23R variants protective against inflammatory bowel diseases (IBD)

36 display loss of function due to impaired protein stability and intracellular trafficking. J. Biol. Chem. jbc.M116.715870.

Smith, G.P. (1985). Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228, 1315–1317.

Thierfelder, W.E., van Deursen, J.M., Yamamoto, K., Tripp, R.A., Sarawar, S.R., Carson, R.T., Sangster, M.Y., Vignali, D.A., Doherty, P.C., Grosveld, G.C., et al. (1996). Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382, 171–174.

Villarino, A., and O’Shea, J.J. (2017). Extraordinary effects of unnatural pairings. ELife 6, e27198.

Vitetta, E.S., and Uhr, J.W. (1994). Monoclonal antibodies as agonists: an expanded role for their use in cancer therapy. Cancer Res. 54, 5301–5309.

Watowich, S.S., Hilton, D.J., and Lodish, H.F. (1994). Activation and inhibition of erythropoietin receptor function: role of receptor dimerization. Mol. Cell. Biol. 14, 3535–3549.

Watson, C.S., Jeng, Y.-J., and Guptarak, J. (2011). Endocrine disruption via estrogen receptors that participate in nongenomic signaling pathways. J. Steroid Biochem. Mol. Biol. 127, 44–50.

Wiekowski, M.T., Leach, M.W., Evans, E.W., Sullivan, L., Chen, S.C., Vassileva, G., Bazan, J.F., Gorman, D.M., Kastelein, R.A., Narula, S., et al. (2001). Ubiquitous transgenic expression of the IL-23 subunit p19 induces multiorgan inflammation, runting, infertility, and premature death. J. Immunol. Baltim. Md 1950 166, 7563–7570.

Wilson, N.J., Boniface, K., Chan, J.R., McKenzie, B.S., Blumenschein, W.M., Mattson, J.D., Basham, B., Smith, K., Chen, T., Morel, F., et al. (2007). Development, cytokine profile and function of human interleukin 17–producing helper T cells. Nat. Immunol. 8, 950.

Winter, G., Griffiths, A.D., Hawkins, R.E., and Hoogenboom, H.R. (1994). Making antibodies by phage display technology. Annu. Rev. Immunol. 12, 433–455.

Ye, P., Rodriguez, F.H., Kanaly, S., Stocking, K.L., Schurr, J., Schwarzenberger, P., Oliver, P., Huang, W., Zhang, P., Zhang, J., et al. (2001). Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J. Exp. Med. 194, 519–527.

Zeidler, R., Mysliwietz, J., Csánady, M., Walz, A., Ziegler, I., Schmitt, B., Wollenberg, B., and Lindhofer, H. (2000). The Fc-region of a new class of intact bispecific antibody mediates activation of accessory cells and NK cells and induces direct phagocytosis of tumour cells. Br. J. Cancer 83, 261–266.

Zhao, J., Liu, Y.-H., Reichert, P., Pflanz, S., and Pramanik, B. (2010). Glycosylation analysis of interleukin-23 receptor: elucidation of glycosylation sites and characterization of attached glycan structures. J. Mass Spectrom. 45, 1416–1425.

Zhuang, Y., Calderon, C., Marciniak, S.J., Bouman-Thio, E., Szapary, P., Yang, T.-Y., Schantz, A., Davis, H.M., Zhou, H., and Xu, Z. (2016). First-in-human study to assess guselkumab (anti- IL-23 mAb) pharmacokinetics/safety in healthy subjects and patients with moderate-to-severe psoriasis. Eur. J. Clin. Pharmacol. 72, 1303–1310.

Zou, J., Presky, D.H., Wu, C.Y., and Gubler, U. (1997). Differential associations between the cytoplasmic regions of the interleukin-12 receptor subunits beta1 and beta2 and JAK kinases. J. Biol. Chem. 272, 6073–6077.