DOCSLIB.ORG

Étude Des Fonctions Développementales Et Métaboliques Du Récepteur Nucléaire Fetoprotein Transcription Factor (Ftf)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Étude Des Fonctions Développementales Et Métaboliques Du Récepteur Nucléaire Fetoprotein Transcription Factor (Ftf) DANIEL MALENFANT ÉTUDE DES FONCTIONS DÉVELOPPEMENTALES ET MÉTABOLIQUES DU RÉCEPTEUR NUCLÉAIRE FETOPROTEIN TRANSCRIPTION FACTOR (FTF) Thèse présentée à la Faculté des études supérieures et postdoctorales de l’Université Laval dans le cadre du programme de doctorat en Biologie cellulaire et moléculaire pour l’obtention du grade de Philosophiae Doctor (Ph.D.) FACULTÉ DE MÉDECINE UNIVERSITÉ LAVAL QUÉBEC 2012 © Daniel Malenfant, 2012 Résumé Le récepteur nucléaire Fetoprotein Transcription Factor (FTF) identifié par notre laboratoire et exprimé principalement dans le système digestif est un régulateur important du métabolisme des lipides et des stéroïdes, de la prolifération cellulaire et du développement embryonnaire. Plusieurs groupes ont constaté que l’influence du récepteur FTF sur la synthèse de stéroïdes et la régulation du cycle cellulaire stimule la prolifération tumorale de cellules d’origine tissulaire diverse. Mes études de doctorat ont porté sur l’expression tissulaire de FTF, sur la caractérisation d’un nouvel élément régulateur de son promoteur et sur l’identification par immunoprécipitation de chromatine (ChIP-chip) des cibles transcriptionnelles de FTF dans le foie de souris fœtale et adulte et dans les cellules d’hépatome humain. Ces études ont permis de mieux définir le rôle métabolique de FTF ainsi que son rôle développemental et son implication potentielle dans la carcinogenèse hépatique. L’expression de FTF par les organes du système digestif et par certaines structures nerveuses, sa régulation par des récepteurs nucléaires métaboliques et sa liaison aux promoteurs de multiples enzymes et transporteurs impliqués dans le métabolisme énergétique placent FTF dans une position clé dans l’homéostasie métabolique et énergétique de l’organisme. Le facteur de transcription C/EBPpartenaire de FTF au promoteur de l’AFP et impliqué lui aussi dans le développement hépatique et le métabolisme énergétique, est lié au promoteur de 20% des cibles transcriptionnelles de FTF. De plus, C/EBP lie le promoteur de FTF formant ainsi une autre boucle activatrice s’ajoutant au réseau transcriptionnel hépatique. Dans les cellules d’hépatome, FTF lie les promoteurs de plusieurs gènes impliqués dans la prolifération et le maintien des cellules tumorales, soit des régulateurs de la réplication, de la croissance et de l’apoptose cellulaire. FTF fait donc partie intégrante du réseau transcriptionnel hépatique régissant le développement et la différenciation hépatique et le maintien du métabolisme énergétique chez l’adulte et est vraisemblablement impliqué dans la promotion de la cancérogenèse hépatique. ii Abstract FTF is a nuclear receptor principally expressed in adult digestive organs that has been shown to act as a major regulator of lipids and steroids metabolism, cellular proliferation and embryonic development. FTF involvement in steroid synthesis and cell cycle regulation tends toward the stimulation of tumor proliferation in neoplasic tissues in which FTF is expressed. However, more studies of FTF function in normal and disease states and on its regulation are needed to draw a complete picture of FTF activity in cell physiology. Within the context of my studies, I delineated the FTF adult and fetal tissular expression, characterized a novel Ftf promoter element and identified FTF direct hepatic transcriptional targets in fetal, adult and tumor cell lines by using chromatin immunoprecipitation (ChIP- on-chip). These studies defined new FTF functions in metabolism, fetal development and hepatic carcinogenesis. FTF expression in digestive system and in neural structures controlling eating behavior, its transcriptional regulation by metabolic nuclear receptors and its binding to enzyme and transporter gene promoters driving energy metabolism, puts FTF in a key location for governing cellular and organismal energy metabolism. C/EBP, a transcriptional FTF partner on the Afp gene promoter and also involved in energy metabolism, is bound to 20% of the FTF targets including FTF itself thus adding branches to the complex hepatic transcriptional network. In hepatoma cells, FTF binds to proliferation and tumor cell maintenance genes like replication, growth and apoptosis regulators. Therefore, FTF belongs to the hepatic transcription network that governs hepatic development, differentiation and adult energy metabolism and is likely to be involved in promoting hepatic tumorogenesis. Avant-Propos Je remercie le Dr. Luc Bélanger pour m’avoir permis d’effectuer mes travaux de recherche dans son laboratoire ainsi que pour son support financier tout au cours de mes études graduées. Je remercie aussi le Dr. Jacques Côté et Génome Québec pour le financement d’une partie des mes recherches doctorales. Merci à Alain-Roger Bataille et Éric Paquet pour leur implication directe dans la l’acquisition et l’analyse des données présentées dans le chapitre 3 de cette thèse. Un gros merci à tous les gens ayant travaillé dans le laboratoire du Dr. Bélanger durant mes études graduées, tout particulièrement Sylvie Roy, Denis Allard, Frédéric St- Pierre, Alain Lamontagne, Julie Poulin, Chantal Courtemanche, Jean-François Paré et Mariève Jacob-Wagner. Ils m’ont apporté un support autant moral qu’immoral et ont égayé mes journées. Enfin, merci à tous ceux avec qui j’ai joué au soccer, fait de l’escalade, et surtout à mon équipe de bateau-dragon « les Barbares de Québec » pour des heures de divertissement et de dépassement de soi. J’ai vraiment beaucoup de plaisirs à vous cotôyer et à repousser les limites avec vous. "Patience et longueur de temps font plus que force ni que rage" -Jean De la Fontaine Table des matières Résumé ......................................................................................................................... i Abstract ....................................................................................................................... ii Avant-Propos ...................................................................................................................... iii Table des matières .................................................................................................................. v Liste des tableaux ................................................................................................................. vii Liste des figures .................................................................................................................. viii Liste des abréviations ............................................................................................................. ix Chapitre 1 Introduction ..................................................................................................... 1 1.1 Le foie ..................................................................................................................... 2 1.1.1 Architecture .................................................................................................... 2 1.1.2 Développement ............................................................................................... 6 1.1.3 Fonctions ......................................................................................................... 9 1.1.4 Maladies hépatiques et cancer ...................................................................... 15 1.2 Transcription ......................................................................................................... 18 1.2.1 Généralités .................................................................................................... 18 1.2.2 Les éléments régulateurs ............................................................................... 23 1.2.3 Facteurs de transcription ............................................................................... 27 1.3 Transcription hépatique ........................................................................................ 30 1.3.1 Hepatocyte Nuclear Factor (HNF) ................................................................ 31 1.3.2 CAAT/enhancer binding protein (C/EBP) .................................................... 34 1.3.3 Les récepteurs nucléaires .............................................................................. 37 1.3.4 Autres facteurs .............................................................................................. 43 1.4 FTF (Fetoprotein Transcription Factor) ................................................................ 44 1.4.1 Généralités .................................................................................................... 44 1.4.2 Structure et activité ....................................................................................... 46 1.4.3 Promoteurs .................................................................................................... 48 1.4.4 Expression tissulaire ..................................................................................... 50 1.4.5 Fonction ........................................................................................................ 51 1.5 But des travaux de doctorat .................................................................................. 54 Chapitre 2 The Fetoprotein Transcription Factor (FTF) gene is essential to embryogenesis and cholesterol homeostasis and is regulated by a DR4 element .... 56 2.1 Avant-propos ........................................................................................................ 57 2.2 Résumé .................................................................................................................
Load more

Recommended publications
  • The Transcription Factor Pou3f1 Promotes Neural Fate Commitment
    RESEARCH ARTICLE elifesciences.org The transcription factor Pou3f1 promotes neural fate commitment via activation of neural lineage genes and inhibition of external signaling pathways Qingqing Zhu1,2†, Lu Song1†, Guangdun Peng1, Na Sun3, Jun Chen1, Ting Zhang1, Nengyin Sheng1, Wei Tang1, Cheng Qian1, Yunbo Qiao1, Ke Tang4, Jing-Dong Jackie Han3, Jinsong Li1, Naihe Jing1* 1State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 2Department of Neurosurgery, West China Hospital, Sichuan University, Sichuan, China; 3Key Laboratory of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 4Institute of Life Science, Nanchang University, Nanchang, Jiangxi, China Abstract The neural fate commitment of pluripotent stem cells requires the repression of extrinsic inhibitory signals and the activation of intrinsic positive transcription factors. However, how these two events are integrated to ensure appropriate neural conversion remains unclear. In this study, we showed that Pou3f1 is essential for the neural differentiation of mouse embryonic stem cells (ESCs), specifically during the transition from epiblast stem cells (EpiSCs) to neural progenitor cells (NPCs). Chimeric analysis showed that Pou3f1 knockdown leads to a markedly decreased *For correspondence: njing@ incorporation of ESCs in the neuroectoderm. By contrast, Pou3f1-overexpressing ESC derivatives sibcb.ac.cn preferentially contribute to the neuroectoderm. Genome-wide ChIP-seq and RNA-seq analyses †These authors contributed indicated that Pou3f1 is an upstream activator of neural lineage genes, and also is a repressor of equally to this work BMP and Wnt signaling.
    [Show full text]
  • SPACE Exploration of Chromatin Proteome to Reveal Associated RNA- Binding Proteins
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.200212; this version posted July 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SPACE exploration of chromatin proteome to reveal associated RNA- binding proteins Mahmoud-Reza Rafiee1*, Julian A Zagalak1,2, Giulia Tyzack1,3,4, Rickie Patani1,3,4, Jernej Ule1,2, Nicholas M Luscombe1,5,6* 1The Francis Crick Institute, 1 Midland Road, London NW1 1AT, UK. 2 Department of Molecular Neuroscience, UCL Institute of Neurology, Queen Square, London WC1N 3BG, UK. 3 Sobell Department of Motor Neuroscience and Movement Disorders, UCL Institute of Neurology, Queen Square, London WC1N 3BG, UK. 4 Department of Neuroinflammation, UCL Institute of Neurology, Queen Square, London WC1N 1PJ, UK. 5 UCL Genetics Institute, University College London, Gower Street, London WC1E 6BT, UK. 6 Okinawa Institute of Science & Technology Graduate University, Okinawa 904-0495, Japan * corresponding authors Abstract Chromatin is composed of many proteins that mediate intermolecular transactions with the genome. Comprehensive knowledge of these components and their interactions is necessary for insights into gene regulation and other activities; however, reliable identification of chromatin-associated proteins remains technically challenging. Here, we present SPACE (Silica Particle Assisted Chromatin Enrichment), a stringent and straightforward chromatin- purification method that helps identify direct DNA-binders separately from chromatin- associated proteins. We demonstrate SPACE’s unique strengths in three experimental set- ups: the sensitivity to detect novel chromatin-associated proteins, the quantitative nature to measure dynamic protein use across distinct cellular conditions, and the ability to handle 10- 25 times less starting material than competing methods.
    [Show full text]
  • Chapter 1 - Introduction
    Chapter 1 - Introduction 1 1.1 Epigenetic modifications and gene silencing The fact that a multicellular organism is able to undergo cellular differentiation, even though every cell contains the same genetic material, indicates the existence of an extra layer of phenotype-determining factors. Cellular differentiation is associated with the development of different patterns of gene expression in individual cells or groups of cells, and the way in which these patterns are established involves epigenetics. Epigenetics refers to the process by which transcriptional states are changed in a relatively permanent way in the absence of DNA mutation. Epigenetic gene silencing or activation results from modifications to the gene in question either by changing the methylation state of the DNA or by modifying the proteins that package the DNA. There is increasing evidence that in some cases RNA molecules are also involved. Epigenetic modifications are generally erased and reset between generations in order to provide the necessary pluripotent starting state from which to begin development in the next generation. 1.1.1 DNA methylation DNA methylation is the best studied epigenetic modification. In mammals DNA methylation is always associated with cytosine residues, generally occurring at CpG dinucleotides in a symmetrical fashion, where the cytosines on both strands are methylated. Methylation of cytosine involves the transfer of a methyl group from an S-adenosyl-L-methionine to the 5-position of cytosine, resulting in the modified base 5-methylcytosine (Jeltsch, 2002) (Figure 1.1). Estimates of methylation levels at CpGs in mammals range from 50-90% (Gruenbaum et al., 1981; Jeltsch, 2002). DNA 2 hypermethylation at promoters usually correlates with transcriptional repression and gene silencing.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • WO 2015/130968 A2 3 September 2015 (03.09.2015) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2015/130968 A2 3 September 2015 (03.09.2015) P O P C T (51) International Patent Classification: Inc., 75 Francis Street, Boston, MA 021 15 (US). YOSEF, C12Q 1/68 (2006.01) Nir; 1520 Laurel Ave., Richmond, CA 94805 (US). (21) International Application Number: (74) Agents: KOWALSKI, Thomas J. et al; Vedder Price PCT/US20 15/0 17826 P.C., 1633 Broadway, New York, NY 1001 9 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 26 February 2015 (26.02.2015) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (25) Filing Language: English BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (26) Publication Language: English DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, 61/945,641 27 February 2014 (27.02.2014) US MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (71) Applicants: THE BROAD INSTITUTE INC. [US/US]; PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, 415 Main Street, Cambridge, MA 02142 (US). THE SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, BRIGHAM AND WOMEN'S HOSPITAL, INC.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Sexual Dimorphism in Brain Transcriptomes of Amami Spiny Rats (Tokudaia Osimensis): a Rodent Species Where Males Lack the Y Chromosome Madison T
    Ortega et al. BMC Genomics (2019) 20:87 https://doi.org/10.1186/s12864-019-5426-6 RESEARCHARTICLE Open Access Sexual dimorphism in brain transcriptomes of Amami spiny rats (Tokudaia osimensis): a rodent species where males lack the Y chromosome Madison T. Ortega1,2, Nathan J. Bivens3, Takamichi Jogahara4, Asato Kuroiwa5, Scott A. Givan1,6,7,8 and Cheryl S. Rosenfeld1,2,8,9* Abstract Background: Brain sexual differentiation is sculpted by precise coordination of steroid hormones during development. Programming of several brain regions in males depends upon aromatase conversion of testosterone to estrogen. However, it is not clear the direct contribution that Y chromosome associated genes, especially sex- determining region Y (Sry), might exert on brain sexual differentiation in therian mammals. Two species of spiny rats: Amami spiny rat (Tokudaia osimensis) and Tokunoshima spiny rat (T. tokunoshimensis) lack a Y chromosome/Sry, and these individuals possess an XO chromosome system in both sexes. Both Tokudaia species are highly endangered. To assess the neural transcriptome profile in male and female Amami spiny rats, RNA was isolated from brain samples of adult male and female spiny rats that had died accidentally and used for RNAseq analyses. Results: RNAseq analyses confirmed that several genes and individual transcripts were differentially expressed between males and females. In males, seminal vesicle secretory protein 5 (Svs5) and cytochrome P450 1B1 (Cyp1b1) genes were significantly elevated compared to females, whereas serine (or cysteine) peptidase inhibitor, clade A, member 3 N (Serpina3n) was upregulated in females. Many individual transcripts elevated in males included those encoding for zinc finger proteins, e.g.
    [Show full text]
  • Methylome and Transcriptome Maps of Human Visceral and Subcutaneous
    www.nature.com/scientificreports OPEN Methylome and transcriptome maps of human visceral and subcutaneous adipocytes reveal Received: 9 April 2019 Accepted: 11 June 2019 key epigenetic diferences at Published: xx xx xxxx developmental genes Stephen T. Bradford1,2,3, Shalima S. Nair1,3, Aaron L. Statham1, Susan J. van Dijk2, Timothy J. Peters 1,3,4, Firoz Anwar 2, Hugh J. French 1, Julius Z. H. von Martels1, Brodie Sutclife2, Madhavi P. Maddugoda1, Michelle Peranec1, Hilal Varinli1,2,5, Rosanna Arnoldy1, Michael Buckley1,4, Jason P. Ross2, Elena Zotenko1,3, Jenny Z. Song1, Clare Stirzaker1,3, Denis C. Bauer2, Wenjia Qu1, Michael M. Swarbrick6, Helen L. Lutgers1,7, Reginald V. Lord8, Katherine Samaras9,10, Peter L. Molloy 2 & Susan J. Clark 1,3 Adipocytes support key metabolic and endocrine functions of adipose tissue. Lipid is stored in two major classes of depots, namely visceral adipose (VA) and subcutaneous adipose (SA) depots. Increased visceral adiposity is associated with adverse health outcomes, whereas the impact of SA tissue is relatively metabolically benign. The precise molecular features associated with the functional diferences between the adipose depots are still not well understood. Here, we characterised transcriptomes and methylomes of isolated adipocytes from matched SA and VA tissues of individuals with normal BMI to identify epigenetic diferences and their contribution to cell type and depot-specifc function. We found that DNA methylomes were notably distinct between diferent adipocyte depots and were associated with diferential gene expression within pathways fundamental to adipocyte function. Most striking diferential methylation was found at transcription factor and developmental genes. Our fndings highlight the importance of developmental origins in the function of diferent fat depots.
    [Show full text]
  • Whole-Exome Sequencing of Metastatic Cancer and Biomarkers of Treatment Response
    Supplementary Online Content Beltran H, Eng K, Mosquera JM, et al. Whole-exome sequencing of metastatic cancer and biomarkers of treatment response. JAMA Oncol. Published online May 28, 2015. doi:10.1001/jamaoncol.2015.1313 eMethods eFigure 1. A schematic of the IPM Computational Pipeline eFigure 2. Tumor purity analysis eFigure 3. Tumor purity estimates from Pathology team versus computationally (CLONET) estimated tumor purities values for frozen tumor specimens (Spearman correlation 0.2765327, p- value = 0.03561) eFigure 4. Sequencing metrics Fresh/frozen vs. FFPE tissue eFigure 5. Somatic copy number alteration profiles by tumor type at cytogenetic map location resolution; for each cytogenetic map location the mean genes aberration frequency is reported eFigure 6. The 20 most frequently aberrant genes with respect to copy number gains/losses detected per tumor type eFigure 7. Top 50 genes with focal and large scale copy number gains (A) and losses (B) across the cohort eFigure 8. Summary of total number of copy number alterations across PM tumors eFigure 9. An example of tumor evolution looking at serial biopsies from PM222, a patient with metastatic bladder carcinoma eFigure 10. PM12 somatic mutations by coverage and allele frequency (A) and (B) mutation correlation between primary (y- axis) and brain metastasis (x-axis) eFigure 11. Point mutations across 5 metastatic sites of a 55 year old patient with metastatic prostate cancer at time of rapid autopsy eFigure 12. CT scans from patient PM137, a patient with recurrent platinum refractory metastatic urothelial carcinoma eFigure 13. Tracking tumor genomics between primary and metastatic samples from patient PM12 eFigure 14.
    [Show full text]