Copyright 0 3997 by the Genetics Society of America

Alanine-Scanning Mutagenesisof Protein Phosphatase Type 1 in the Yeast Saccharomyces cerhsiae

Stefanie H. Baker,"" Debra L. Frederick,+Andrew Bloeched and Kelly Tatchellt *Department of Microbiology, North Carolina State University, Raleigh, North Carolina 27695 and tDepartment of Biochemistry and Molecular Biology, Louisiana State University Medical Center, Shreveport, Louisiana 71130 Manuscript received July 30, 1996 Accepted for publication November 18, 1996

ABSTRACT Protein phosphatase type 1, encoded by GLC7 in Saccharomyces cerwisiae, is an essential serine/threo- nine phosphatase implicated in the regulation of a diverse array of physiological functions. We con- structed and examined20 mutant alleles of GLC7 in which codons encoding clustersof charged residues were changed to alanine codons. Three of 20 mutant alleles alter residues in the active site of the phosphatase and are unable to rescue the lethalityof a glc7::LEU2 disruption. The17 alleles that support growth confer a range of mutant traits including cell cycle arrest, 2-deoxyglucose resistance, altered levels of glycogen, sensitivity to highsalt, and sporulation defects.For some traits, such as 2deoxyglucose resistance and cell cycle arrest, the mutated residues map to specific regions of the protein whereas the mutated residues in glycogen-deficient mutants and sporulation-defective mutantsare more widely distributed over the protein surface. Many mutants have complex phenotypes, each displayinga diverse range of defects. The wide range of phenotypes identified from the collection of mutant alleles is consistent with the hypothesis that Glc7p-binding proteins,which are thought to regulate the specificity of Glc7p, have overlapping binding sites on the surfaceof Glc7p. This could account for the high level of sequence conservation found among type 1 protein phosphatases from different species.

ROTEIN phosphatase type 1 (PPl) is an abundant glycogen synthase and phosphorylase kinase and re- P phosphoserine/threonine phosphatase that par- duced activity toward phosphorylase. Another example ticipates in physiological pathways ranging from glyco- is in the fission yeast S. pombe where the association of gen regulation and muscle contractility to ion channel the product of sds22+ with PP1 increases phosphatase regulation and cellcycle control (BOILEN and STAL activity toward Cdc2-phosphorylated histone H1 and re- MANS 1992; SHENOLIKAR 1994).The enzyme is highly duces activity toward glycogen phosphorylase (STONEet conserved, exhibiting over 80% amino acid identity be- al. 1993). tween yeast and mammals. Conservation extends to the The regulatory subunit paradigm extends to budding functional level where the enzyme has a role in glyco- yeastas well. Gaclp, a Glc7p-binding subunit, is re- gen biosynthesis in mammals and the budding yeast quired for glycogen biosynthesis (FRANGOISet al. 1992; Saccharomyces cermisiae and cell cycle control in mam- STUARTet al. 1994), while another Glc7pbinding pro- mals, Drosophila, Aspergillus, Schizosaccharomyces pombe tein, Reglp, is required for glucose repression (Tu and and S. cmeuisiae. Additional physiological roles for yeast CARLSON 1995). Theprotein products of alleles of glc7 PP1 in sporulation and glucose repression are implied exhibiting specific defects in glycogen accumulation from the phenotypes conferred by mutations in glc7, (glc7-1) and glucose repression (glc7-Tl52K) are un- the gene encoding PPI in budding yeast. able to efficiently bind the glycogen and glucose repres- PPI exhibits little substrate specificity in vitro. It has sion-specific subunits, respectively (STUARTet al. 1994; beenproposed that specificity is in partdictated by TU andCARLSON 1995). The correlationbetween allele- regulatory subunits that target the catalytic subunit to specific defects in GLC7 and the null phenotypes of its site of activityand/or regulate its substrate specificity mutants in the Glc7p regulatory subunit genes provides ( COHENand COHEN 1989). Theparadigm for this regu- strong evidence that regulatory subunits play a role in latory mechanism is the glycogen-binding subunit from regulating phosphatase specificity in vivo. In addition to skeletal muscle. Phosphorylation of this subunit in re- Gaclp and Reglp,a growing number of Glc7p-binding sponse to insulin induces its association with PP1 (DENT proteins have been identified in S. cereuisiae. These in- et al. 1990). Thecomplex has increased activity toward clude a homologue of S. pombe Sds22, called Egplp or Sds22p (HISAMOTOet al. 1995; ~~ACKELVIEet al. 1995); Corresponding author: Kelly Tatchell, Department of Biochemistry GlcBp, aprotein similar to mammalian inhibitor 2 and Molecular Biology, 1501 Kings Highway, I.SU Medical Center, Shreveport, LA 71 130. E-mail: ktatchamail-sh.lsumc.edu (CANNONet al. 1994; TUNGet al. 1995); Regzp, required 'Present address: Department of Biological Sciences, Clemson Uni- in combination with Reglp forgrowth (FREDERICK and versity, Clemson, SC 29634. TATCHELL1996); and Giplp, aprotein required for

Genrt~rs145: 615-626 (March, 199f) 616 S. H. Baker et al.

sporulation (Tu et al. 1996). A number of genes have or synthetic media and stained with iodine vapor. Quantitative also been identifiedwhose products interactwith Glc7p glycogen assays were performed as described by FRANCOISst in the two hybrid system (Tu et al. 1996): X35, involved al. (1987). Glucose repression was assayed by growth on su- crose in the presence of 2-deoxyglucose, which prevents wild- invesicle trafficking (NELSONet al. 1996); REDI, re- type yeast strains from fermenting sucrose. Yeast strains were quired for synaptonemal complex formation (ROCK- streaked on 2-deoxyglucose plates [2% peptone, 1 % yeast MI1L and ROEDER 1988, 1990); GIP2, exhibiting se- extract, 2% sucrose, and 200 bg/ml of 2-deoxyglucose quence similarity to Gaclp; SUI, required for cortical (Sigma)] andgrown at 30" under anaerobic conditions rlsing cytoskeleton formation (HOLTZMANet al. 1993); and GasPaks (BBL) (Tu and CARLSON 1994). Molecular techniques and oligonucleotide-directed muta- several other genes of unknown function. Although an genesis: Escherichia coli strain DH5aF' was used for recombi- in vivo association betweenmany of these potential nant DNA manipulations except where stated. To construct binding proteins and Glc7p has not been proven, the recombinant plasmids, DNA restriction fragments were puri- possibility provides a mechanism to control the activity fied from agarose gels using the Geneclean I1 Kit (Bio 101) of Glc7p toward substrates involved in a wide range of following the manufacturer's instructions. The boiling lysis miniprepprocedure from MANIA-rIS (MANIATIS el nl. 1989) cellular processes. was used for isolating plasmid DNA from E. coli. Large scale If Glc7p has numerous roles in vivo, it should be preparations were done using the Qiagen Maxi Prep Kit (Qia- possible to identify glc7mutant alleles with a wide range gen). DNA sequence analysis was carried out using the manu- of phenotypes. To identify additional glc7 alleles, we facturer'sinstructions with the Sequenase 2.0kit (United created and analyzed 20 "charged to alanine" alleles States Biochemical). Immunoblot analysis of Haepitope- tagged Glc'7p was performed as described elsewhere (SILTART that result in changes of clusters of charged residues to PL (zl. 1994) using the ECL detection system (Amersharn). alanines. In addition, three nonsense mutations were Oligonucleotide-directed mutagenesis on pBSSK+PPl was created that result in Glc7 proteins with COOH-termi- performed using the Muta-Gene Phagemid in vilro Mutagene- nal deletions. The crystal structure of mammalian pP1 sis Kit Version 2 (BioRad). pBSSK+PPl contains the NidIII- (EGLOFFet al. 1995; GOLDBERGet al. 1995) has allowed XhoI fragment of GLC7in the HindIII-XhoIsites of pBIuescript SK+. The oligonucleotides listed in Table 2 were used to cow us to determine the location of each mutation in the struct the alanine-scanning mutant alleles. The preliminary three-dimensional structure of PP1. This information identification of the mutant alleles was made by the loss or allows us to identify sites on the surface of Glc7p that addition of a restriction endonuclease site or by sequence could lie at the interface between Glc7p and specific analysis. The sequenceof the entire GLC7 gene from each of regulatory proteins. the mutant alleles was subsequently determined. With the exception of gk7-13?, the only nucleotide differences were introduced by the mutagenesis. glc7-133 also included a muta- MATEWS AND METHODS tion resultingin the substitution of alanine forglutamine Strains and genetic techniques: The glc7 mutant strains 298. Each alanine-scanning mutant allele was transferred into (Table 1) are congenic to strain JC482 (MATa ura?-52 leu2 pNC160-PP1, a TRPI-CEN shuttle vector containing the XhoI hid) (CANNONand TAI'CHEIL198'7). Those haploid strains fragment of GLC7 cloned into the SnlI site of pNC160, by listed in Table 1 are MATa except for 71-11, which is MATa. replacing restriction fragments of pNCl6O-PP1with frag- Diploid strain SB78 (MATa/MATa uru3-52/ura3-52 trpl-l/ ments of pBSSK+PPl plasmids containing the mutations. trpl-1 lsu2/leu2 GLC7/glc7::IEU2) was used as the recipient In some mutants (glr7-101, glr7-102, gk7-108, glc7-109,$7- for transformation. The glc7::LEU2 and trpl-1 markers from 111, gk7-126, glc7-128, $7-133, glc729Y, gk7-295") a hemag- strain CY969 (a gift from KIM ARNDT) were introduced into glutinin epitope (Ha-rag) recognized by the nwnoclonal anti- the JC482 background by seven serial backcrosses. Rich media body 12CA5 (WII.SON et ccl. 1984) was introducedinto the YPD, YPA, and YPEG contained 1% yeast extract, 2% peptone GLC7coding sequence at thesecond amino acid residue. The and 2% glucose, 2% potassium acetate or 2% ethanol 3% introduction of the Ha-tag at this position of Glc7p does not glycerol, respectively. Synthetic media contained 0.67% yeast appear to affect the hnction oftheresulting protein (SL~TTOK nitrogen base and 2% glucose supplemented with amino el al. 1991; SI'CIART st nl. 1994; HIsAMcYrO st d. 1995). To acids. Plate media contained 2% agar. Yeast cultures were construct the Ha-tagged mutant alleles, the Ha epitope-tagged grown at 30" in YPD unless otherwise stated. Tetrad analysis gene was introduced into pNC16Oby cloning the HindIII- was performed as described (ROSE et ul. 1990). Cell densities Snll fragment ofYCp50-Ha-GLC7 (SUTTONet al. 1991) into were determined with a hemacytometer. Yeast cells were trans- pNC1GO and restriction fragmentsfrom pNC160-Ha-GI,C7 formed by the method of Gwrz and ScHIEs'rl. (GIETLet al. were recombined with restriction fragments from each of' the 1992). Sporulation efficiency wasassayed on plates and in mutant alleles. liquid culture. To determine thesporulation efficiency in liq- To assay the phenotype of strains carrying each alanine- uid culture, 5 ml cultures were grown overnight in YF'D at scanning allele, pNC160-GLC7 plasmids were transformed 30°, the cells were pelleted and washed once with water and into a GZ,C7/gk7::LE;U2 heterozygous diploid (strain SB78). then resuspended in 5 ml ofWA. The cultures were incubated The dominance of each mutant allele was determined by ex- at 30" for 3-5 days and the number of asci containing three amining Trp+ transformants for growth rate, glycogen accu- or four spores in each culture was counted using a hemocy- mulation, 2-deoxyglucose resistance and resistance to 1 M tometer. Thepercentage sporulation was reported as the ratio NaCI. Mutant traits were recessive except for a partial gly?O- of asci containing three or four spores to the total number gen deficiency observed in transformants carrying gk7-126, of cells (>300 cells per assay). Assay of sporulation efficiency glc7-128 or glc7-2W. To examine haploid phenotypes, Trp' was also tested by growing strains on solid media containing transformants were sporulated and subjected to tetrad analy- 1% potassium acetate. The percentage sporulation efficiency sis. Trp' Leu' meiotic progeny identify haploid strains car- was determined after incubation for 4 and 6 days at 24". rying the glr7::UU2 gene disruption and the alanine-scan- Glycogen and glucose repression assays: To qualitatively nillg allele. Tetrad analysis was performed on at least two determine glycogen accumulation, cells were grown on WD transformant.? from every transformation. The haploid strains Protein Phosphatase Type 1 in Yeast 61 7

TABLE 1 Phenotypes of gZc7 mutants

Identical in Haploid Diploid Allele Amino acid replacement mammals"Phenotypeh strain strain GLC7 SB90 SB238 D 7A, D9Aglc7-121 D7A, GLC SB231No SB207 D 13A, R14A, E17A glc7-122 R14A, D13A, No SB233 SB211 glc7-123K22A R19A, NoSB234 SB255' -glc K 40A, R42A Yes glc7-125R42A K40A, SBl45 SB236 t glc E 53A, E55A Yes gk7-101E55A E53A, Cglc SB229 SB83 E 76A Yes SB88 SB230 SB88 Yes glc7-102 E76A tglc D 94A, R95A, K97A Yes K97A R95A, glc7-126 D94A, Lethal K112A Yes SB214 SB245 gk7-127 SB214 YesKllOA, K112A spo, kglc, 2-DG' glc7-128 R121A, E125A Yes Lethal glc7-129 D137A, E138A SB177 Yes SB246 ts, cs, -glc glc7-131 K149A, D153A 71-11 Yes SB251' SPO, CS, 2-DG', tglc glc7-132 D165A, E166A, K167A SB216 Yes SB240 - glc glc7-133 R186A, R187A, R190A, Q298K No SB2592-DG' SB106 glc7-134 D193A, D196A SB219 Yes SB262 glc7-135 D207A, D209A, K21OA, D211A Yes Dominant lethal? glc7-106 E217A, D219A SB186 Yes SB244 glc7-136 D229A, R233A No SB195 SB247 +glc, spo glc 7-108 E255A SB189 Yes SB254 fglc K 259A , R260A Yes SB94 Yes glc7-109 R260A K259A, GLC NaCI", SB253 glc7-111E286A D285A, Yes SB237 SB113 t glc glc7-295" A295-312 Lethal glc7-299" A299-3 12 SB248 SB258 t glc A305-312 SB118 SB250 SB118 glc7-305" A305-312 R 73C Yes SB112 SB239 SB112 glcYes 7-1 R73C - glc No, residues altered in the allele are not identical to those in mammalian PPI; yes, residues are identical. "GLC, hyperaccumulation of glycogen; -glc, very low glycogen; tglc, reduced glycogen; spo, sporulation deficient; NaCI", unable to grow on 0.9 M NaCl; 2-DG', resistant to Zdeoxyglucose; ts, reduced growth rate at 37"; cs, reduced growth at 11". The glc7 allele in these strains was tagged with the Ha epitope. with each of the glc7 mutant alleles are listed in Table 1. in phosphate-buffered saline at a cell density of 1 X 106/ml, Diploid strains containing a particular glc7 allele were con- and propidiumiodide (Sigma)was added to a final concentra- structed by mating MATa and MATa haploids and isolating tion of40 pg/ml. Flow cytometry was performedat the zygotes. LSUMC Flow Cytometry Facility using a FACSvantage (Bec- Microscopy and flow cytometxy Immunofluorescence mi- ton-Dickinson, Mountain View, CA) with an excitation wave- croscopy was performed as described (MCMILLANand TAT- length of 488 nm and monitoringemission in the f12 channel. CHELL 1994). Cells were viewed and images acquired using Data were collected in the four-parameter list mode at20,000 an Olympus AX70 microscope (Olympus, Lake Success, Ny) cells/run. Channels were calibrated with haploid and diploid equipped with epifluorescent and Nomarski optics. Images cells both in log phase and arrested in G1 by nutrient starva- were acquired with a I/IElOOO SIT camera (DAGE-MTI Inc., tion. Michigan City, IN), digitized with a DSP2000 (DAGE-MIT Inc.) digital signal processor and transferred to the computer RESULTS using a Quick Capture (Data Translation Inc. Marlboro MA) frame grabber board and NIH Zmuge, version 1.60 software. Mutant alleles of GLC7 have proven valuable in iden- Image analysis was performed on a Macintosh Centris 650 tifylng physiological pathways that require Glc7p and computer using the public domain NIH Image program (writ- ten byWAYNE RASBAND atthe U.S. NationalInstitutes of the requisite regulatory subunits. For example, glc7-1 Health and available from the Internet by anonymous FTP and glc7-Tl52K have specificdefects in glycogen synthe- from zippy.nimh.nih.gov or on floppy disk from NTIS, 5285 sis (FENGet al. 1991; FRANCOISet al. 1992; CANNON et al. Port Royal Rd., Springfield, VA 22161, part number PB93- 1994) and glucose repression (Tu and CARLSON 1994), 504868). Composite figures were assembled with Adobe Pho- respectively. The product ofglc7-1 is defective in its toshop v 2.5 (Mountain View, CA). For flow cytometry cells were grown to 10' cells per ml in association with Gaclp (STUARTet al. 1994) while the liquid YPD medium, harvested by centrifugation, and resus- product of glc7-Tl52Kis defective in its interaction with pended in 0.5X volume of H20. Cells were sonicated for 20 Reglp but not with Gaclp (TU andCARLSON 1995). The sec to disruptcell aggregates, ethanol was added to 70% (vol/ correspondence between phenotype and biochemical vol) and cells were stored overnight at 4". Cells were harvested activity provides strong evidence that the binding pro- by centrifugation, washed once in10 mM Tris pH 7.4, 15 mM NaCl, resuspended in 1/10 volume of the same buffer teins have a physiological role in regulating the speci- containing RNAase A at 0.1 mg/mL, and incubatedat 37" for ficity of Glc7p. To identify additional alleles of Glc7p 1.5 hr. Cells were harvested by centrifugation, resuspended that affect its specificity,we constructed 23 glc7mutant 618 S. H. Baker et ul.

TABLE 2 In vitro mutagenesis

Amino acid Annealing glc7 allele replacement Oligo sequence site" Detection" glc 7-101 E53A, E55A TACTTTAATTGGGGCGGCTAAGGCTAGTAAAATGGGTTG 236198 DdeI (- ) glc7-102 E76A CGGGAATCCACCGTAGGCAAATAGACGTAGTAA 824792 RsuI (-) glc 7-106 E217A, D219A GAAAGAAACACCTCTTGCATTGGCACTCCAACCTACGAT 1253-1215 Sequence glc 7-108 E255A TCTTTTACTAAAGAAGGCATAACCATCTTCCAC 1361-1329 Sequence glc7-109 K259A, R260A AAGTGTCACCAATTGTGCTGCACTAAAGAATTCATA 13761341 Sequence gk7-111 D285A, E286A AGAACATAATAAACTTGCAGCAACACTCATCATTGC 14541419 Sequence glc7-121 D7A, D9A TCTATCGATGATATTAGCAACGGCAACTGGTTGTGAGTC 97-60 Sequence glc7-122 D13A, R14A, E17ATTTAGATCCTCTTACTGCCAATAATGCAGCGATGATATTATCAAC 122-78 ClUI ( - ) glc 7-123 R19A, K22A AACTTGTTGACCAGGTGCAGATCCTGCTTACTTCCAATAATCT 1 3 7-96 Sequence glc 7-125 K40A, R42A CTTTATGAATATAGATGCGGCTGCCGAACATAAGTATCT 197-159 BgflI (-1 glc7-126 D94A, R95A, K97A AGTCTCTAAGGATTGTGCACCAGCGGCGACATAATCACCCAA 887-846 SUlI (-) glc7-127 KllOA, K112A AAAGTTTTCTGGATACGCAATTGCGTAAGCCAGTAATAG 932-894 Sequence glc7-128 R121A, E125A ATTAATGGAAGCACATGCATGGTTCCCTGCTAAAATGAAAAAGTT 971-937 Sequence glc7-129 D137A, E138A ATAACGTCTCTTACATGCAGCATAAAACCCGTAAAT 1010-975 BsoFI ( + ) glc7-131 K149A, D153A TAAACAATTGAAACAAGCCGTGAAAGTTGCCCAAAGTTTGATATT 1055-1011 XmnI (-) glc7-I32 D165A, E166A, K167AATGCATACAGAAGATTGCCGCAGCAATAATTGCAGCAAT 1097-1059 Sequence glc 7-133 R186A, R187A, R190AGGGAATATCTGTTGGCGCCATCACCGCTGCGATCTGTTCCATACT 1166-1122 BsoFI ( + ) glc7-I34 D193A, D196A ACATAATAAGCCAACGGCGGGAATAGCTGTTGGCCTCATCAC 11841143 Sequence GLC7-135 D207A, D209A, ACTCCAACCTACGATAGCTGCAGCTGGAGCTGACCACAATAAGTC 1229-1 184BsoFI ( + ) KZIOA, D211A gk7-136 D229A, R233A TTGTTTCTGTAAAAATCGGTTCACTACAGCAGGACCAAAAGTGAA 1295-1251 Sequence glc7-305" A305-312 CTTTCTACCCCCAGCTTACCTTGGTAGACT 1483-1511 Sequence &7-299" A299-312 CCTTGGTAGACTTTTTAGGCTGGCTTTAAAAT 1461-1493 Sequence ~1~7-295"- A295-312 TTTTTGGGCTGGCTTTAAATTTGAAAAGAACA 1449-1481 Sequence * Sequence corresponds to published sequence of GLC7/disZSl (OHKURAet al. 1989), accession number M27070. In some cases a mutation was detected by the elimination (-) or creation (+) of a restriction enzyme site. In other cases the only detection method was DNA sequence analysis. alleles using site-specific mutagenesis. Twenty of the by the crystal structure determination of human (Ec mutant alleles were clustered charged-to-alanine mu- LOFF et al. 1995) and rabbit (GOLDBERGet al. 1995) PP1, tants in which clusters of charged residues were which appeared after our collection of mutant alleles changed to alanine residues. The hypothesis behind was constructed. Given the high level of sequence iden- this approach, first outlined by CUNNINGHAMand tity between yeast Glc7pand mammalian PP1, it is possi- WELLS(1989), is that groups of charged residues are ble to directly model Glc7p using the coordinates of likely to lie on thesurface of the protein. The alteration the mammalian homologues. Thecoordinates for of the residues may change interactionswith other mac- amino acid residues 7-300 were determined from the romolecules but will not likely disrupt the tertiary struc- X-ray diffraction data for therabbit enzyme. Within this ture of the protein. This approach has been used suc- region the yeast and rabbit enzymes are 87% identical. cessfully to study cAMP-dependent protein kinase Among the 20 alaninescanning mutant alleles, 44 (GIBBSand ZOLLER 1991), actin (WERTMANet al. 1992), charged amino acid residues were changed to alanine. and @tubulin (REIJO et al. 1994). We also constructed Only six of these residues are notidentical to the corre- three nonsense alleles in which stop codons were placed sponding residues in the rabbit enzyme. This high level near the COOH terminus, resulting in proteins with of identity provides strongjustification for directly mod- small COOH-terminal deletions. The location of each eling Glc7p with the rabbit enzyme. mutation in the primary sequence of Glc7p is presented COOH-terminal truncations: The greatest diver- in Table 1 and Figure 1. Each mutant allele on a low gence between type 1 protein phosphatases is in their copyCEN-based plasmid (pNC16O) was transformed COOH-termini (BARTONet al. 1994). The major PPI into a diploid strain heterozygous forlethala isoform in rabbit is 17 amino acid residues longer than glc7::LEU2 gene disruption. Tetrad dissection of these Glc7p. Many isoforms of PP1 contain a cdc2 kinase transformants was used to isolate haploid strains con- consensus sequence, TPPR, near the COOH terminus. taining pNCl60-GLC7 plasmids as the sole functional The threonine in this sequence is phosphorylated in copyof GLC7. These strains were characterized for vivo in S. pombe (YAMANO et al. 1994) and mammals changes in growth rate and for other traits observed in (DOHADWALAet al. 1994) and is implicated as a site of glc7 mutants. negative regulation by cyclin-dependent protein kinase Our analysis of glc7 mutant alleles has been assisted (YAMANO et al. 1994). This sequence is not conserved Protein PhosphataseProtein Type 1 in Yeast 619

I- was performed to assess protein levels.Glc7-299"p was RABBIT 1 MSDSEKLNLD SILGRLLEVQ GSRPGKNVQL TENEIRGLCL KSREIFLSQP YEAST 1 MDSQPWS- NIIDRLLEVR GSKPGQQVDL EENEIRYLCS ESLFIKQP expressed at normal levels but its mobilitywas increased gIc7-121 glc7-122 gIc7.123 glc7- 125 relativeto the wild-type Ha-tagged Glc'ip, consistent rDllm m I with loss of 14 COOH-terminal residues (datanot RABBIT ILLELEAPLK51 ICGDINGQYY DLLRLFEYGG FPPESNYLFL GDYVDRGKQS YEAST 50 ILLESAPIK LCGDIHGQYY DLLRLFEYGG FPPESNYLFLGDYV-QS gk7-lo1 gfc7-I02gk7-lo1 glc7- i26 shown). Ha-Glc'7-295"p could not be detected by immu- noblot analysis, indicating that the amino acid COOH -m "= terminal deletion probably reducesthe stability of the RABELT 101 LETICLLLAY KIKYPENFFL LRGNHECASI NRIYGFYDEC KRRYNIKLWK YEAST 100 LETICLLLAY UYPENFFI L-CAS1 NRIYGFYDEC KRRYNLKLQ. ~$7.127 glc7-128 glc7- 129 protein. Lethal mutant alleles: In addition to gk7-295", three mm ma I alanine-scanning mutant alleles failed to complement RABBIT 151 -FNcLP IAAImEKIF CCHGGLSPDL QsMEQIRRIM RPTDVPDQGL YEAST 150 ,,T=DCFNCLP LAALIBIF CMHGGLSPDL NSMEQLRRVM RPTDIPDVGL gIc7-131 Qk7.132 glc7-133 glc7-134 the growth defect of a glc7::LBU2 disruption. For one of these, glc7-135, diploid transformantswere never re- Elm m m-m RABBIT 201 LCDLLWSDPD KDVQGWGEND RGVSFTFGAE WAKFLHKHD LDLLCRAHQV covered in SB78, a diploid strain heterogygous for a YEAST 200 LCDLLWS-IVGWS~RGVSFTFGPDFLQKQD MELICRAHQV gfc7-135 gIc7-106 glc7-136 glc7::IEU2 disruption, suggestingaminothe that acid lorllm mm substitutions in this mutant allele cause a dominant RABBIT 251 VEDGYEFFAK RQLVTLFSAP NYCGEFDNAG AMMSVDETLM CSFQILKPAD lethalphenotype. We were able to recover trans- YEAST250 VEDGYLFFSSQLVTLFSAP NYCVEFDNAG AMMSVLLSLL CSFQ KP glc7-106 gk7-109 glc7.11 I formants of gk7-135 in a haploid strain that had a nor- Pglc7-295"@7-299" mal dosage of GLC7, suggesting that g1c7-135 is sensitive RABBIT 301 KNKGKYGQLSGLNPGGRPIT PPRNSAKAKK 330 AA to gene dosage. The three lethal alanine-scanning mu- YEAST 300 KSLPAGGR KKK 312 AA Lgk7-305" tant alleles each alter at least one amino acid residue predicted to be part of the conserved catalytic core of FIGUFT 1."Alanine-scanning and nonsense alleles of GLC7. Yeast Glc7p and rabbit PPla are aligned. Thebars over the enzyme (EGLOFFet al. 1995; GOLDBERGet al. 1995). the alignment of yeast Glc7p and rabbit PPla correspond to D94 and D207, which are changed to alanine in glc7- the alpha helices and beta sheets present in the structure of 126 and $67-135, respectively, are buried in the core of PP1 (GOLDBERGrt al. 1995). The narrow bars below Glc7p PP1 and are thought to directly participate in catalysis. mark theregions of Glc7p in which charged aminoacids were R121 and E125, altered in gk7-128, are also buried in changed to alanine. Thelocation of each of the threeCOOH- terminal nonsense mutations is marked by the vertical line. the core of PP1 and directly flank other residues in- volved in catalysis (EGLOFFet al. 1995; GOLDBERGet al. 1995). Epitope-tagged versions of Glc7-126p and Gc17- in Glc7p. However, Glc7p does contain a tract of basic 128p were not detected by immunoblot analysis, indi- residues in the COOH terminus that is also found in cating that the mutations are likely to alter protein sta- many PP1 enzymes. The COOH termini of rabbit and bility in addition to predicted changes in catalytic activ- human PPI were not resolved in the crystal structure, ity (data not shown).Yeast strain SB78 transformed with implying that the COOH-terminus has a high level of gk7-126, gk7-128 or gk7-295" contains slightly reduced mobility. levelsof glycogen, asassayed by iodine staining but To investigate the role of the COOH terminus in shows no obvious growth defects. The reducedglycogen Glc7p, we constructed aseries of ochre nonsense alleles levels indicate that each of the lethal mutantalleles are that removed all or part of this region. The locations at least partially dominant. of these mutations are presented in Figure 1. The gk7- Conditional mutant alleles: Haploid strains con- 305" product is missing the seven COOH-terminal resi- taining each of the viable alanine-scanning alleles were dues, including the conserved basic amino acid tract; assayed for growth defects at ll", 15", 24", 30°, and 37" the gk7-299 product lacks the 14 COOH-terminal resi- on YPD, YPGE, synthetic medium and YPD containing dues, which includes a highly conserved lysine residue 0.9 M NaC1. Only three mutant alleles, glc7-129, glc7- (K300); and glc7-295" lacks the COOH-terminal 18 resi- 131, and glc7-109, caused growth defects. The locations dues. These mutant alleles were tested in yeast for their of residues altered in the products of these alleles in ability to complement a glc7::UU2 gene disruption as the crystal structure ofPP1 arepresented in Figure 2D. described in MATERIALS AND METHODS. glc7-305" appears gk7-129 confers slow growth at ll",15" and 37" on all to be fully functional by the criteria used to examine media tested, while glc7-131 confers slow growth only the other mutants. Thus, theconserved lysine tract does at 11" and 15" on all media tested. glc7-109 results in not have an essential function. glc7-299 confers a par- little or no growth on WD + 0.9 M NaCl at all tempera- tial glycogen deficiency (Figure 5A) but grows at wild- tures. Microscopic examination of the glc7-109 strains type rates. Haploid strains containing theglc7-295" dele- revealed that thesalt sensitivitywas accompanied by cell tion were not recovered, indicating that thelargest dele- lysis. tion is not functional. To assess the stability of COOH- To determine if the growth defects in the glc7-129 terminal deletions, an Ha epitope was transferred to and glc7-131 mutants were associated with cell-cycle-spe- the NH2-terminus of glc7-299 and glc7-295", plasmids cific defects, cultures of each strain were grown to log containing these epitope-tagged mutant alleles were phase at 30" and were shifted to either 37" or 11". After transformed into strain SB78, and imlnunoblot analysis incubationat the nonpermissive temperature, cells 620 S. H. Baker et al.

FIGURE2.-Locations of amino acid residues altered in gk7 mutants that affect glycogen, 2-DG resistance, and viability. The location of amino acid residues altered by the glc7 alanine-scanning alleles are presented in three views of the space filling model of rabbit PP1. The residues altered in mutants that fail to accumulate glycogen are yellow, residues altered in mutants that hyperaccumulate glycogen are orange, and residues changed in mutants that are 2-DG resistant are red. Residues altered in temperature- orcold-sensitive mutants are green, andresidues altered in the NaC1-sensitive mutant glc7-109are blue. Surface residues altered in lethal glc7 alleles are black. Metal ions associated with the active site are magenta. Altered residues in glc7 alanine-scanning alleles that do not affect these traits are gray. A and D are views from an arbitrary "front" of the protein showing the metal ions in the active site. B and C are 180degree Yaxis rotations and 90-degree Xaxis rotations of A, respectively. Most residues altered in the glc7 mutants are identical in the rabbit enzyme; those residues that are not identical in glc7-123 (R19) and glc7-I21 (D7) are boxed. Modelling was performed on a Apple Macintosh computer using RasMo12.6 software (ROGER SAYLE,Glaxo Wellcome Medicines Research Centre). were harvested, fixed and stained with propidium io- (HISAMOTOet al. 1994) and glc7-12 cells (MACKELVIE et dide for microscopic examination and flow cytometry. al. 1995), which arrest in mitosis at their nonpermissive These results are presented in Figure 3. At ll", both temperatures. glc7-129and glc7-131 mutants accumulate as large bud- The growth of glc7-129cells is also delayed at 37" and ded cells. After 24 hr, three-quarters of the cells have again cells accumulate with large buds (Figure 3). Flow large buds. In contrast, less than one-half of the cells cytometry revealed a slight increase in cells with a 2C in the wild-type culture have large buds. Surprisingly, DNA content, indicating a delay in G2 or M (Figure the nuclear morphology is different for gZc7-129 and 3B). In contrast to the arrest phenotype of gZc7-129 at glc7-131 cells grownat 11". The majority of large budded 1lo, large-budded cells are observed at 37" in which the cells in glc7-129 cultures contain a single nucleus at or nucleus is not at the bud neck. An example of this is in bud neck, while large budded glc7-131 mutant cells shown in Figure 3C. Although the nuclear position in have a single nucleus positioned further from the bud glc7-129mutants has not been quantitated,our prelimi- neck (Figure 3C). Flow cytometry (Figure 2B) revealed nary observations suggest that Glc7p may have an addi- that cells accumulate with a 2C DNA content. Thephe- tional role in nuclear migration. However, we have not notype of glc7-129 cells is similar to that of glc7-Yl70 observed any increase in binucleate cells, a phenotype Protein Phosphatase Type 1 in Yeast 62 1

characteristic of mutants defective in nuclear or spindle A migration (PALMERet nl. 1992; ESHELr/ 01. 1993; LI PI nl. 1993; CIARKand MEYER1994; MCMILLANand TAT- genotype temp ("C) CHELL 1994; MuHUA d cd. 1994). (3688 Glucosederepression: TU and CARLSON (1994) GLC7 11 46% 17%15% 22% identified an allele of glc7 (glc7-7'152K) that result. in gk7-I29 11 19% 9% 70% 3% failure to repress invertase expression in the presence 11 5%gk7-131 11 9% 02% 3% of glucose. This phenotype is similar to but milder than that of regI/l~~x2/snzImutants, which were originally GLC7 30 60% 20% 15% 5% identified by their constitutive glucose derepression gk7-129 30 44% 27%5% 24% phenotype (ENTIANand ZIMMERMANN1980; MATSU- 91~7-131 30 49% 24% 20% 6% MOT0 d 01. 1983; NEICERORNand CARLSON 1987). Reglp interacts with the wild-typeGlc7p but fails to GLC7 37 44% 29% 19% 9% interact with Glc7"'.'"~ (Tu andCARLSON 1995). These glc7-I29 37 35% 24% 37% 4% data are consistent with the hypothesis that Reglp is a gic7-131 37 35% 27% 32% 5% regulatory subunit of Glc7p that modulates its activity in glucose repression. To identify other glucosedere- B pressed alleles, we plated the glc7 mutants on media $lA,K containing 2deoxyglucose and sucrose. Glucosedere- pressed mutants will grow on this medium, overcoming ,~ the inhibitory effects of 2deoxyglucose (2-DG). Three alleles caused a 2-DGresistant phenotype: gk7-127, glc7- 131, and glc7-133 (Figure 4). Theglc7-131 allele (K149A, ?IJfJ~,o0, 1,112 Dl53 A) alters residues that flank the alteration in gk7- '1'152K. Inspection of the locations of changes encoded by the 2-DGresistant mutant alleles on the structure of PPI reveals clustering on one face of the protein. This 'IAIK,o0, liv"\ is most clearly observed in the view of PPI presented in Figure 2C. One interpretation of this result is that a IC x 1c x 1c 2c single protein, possibly Reglp, binds to the region of Glc7p identified by the 2-DGresistant gk7 alleles. Glycogen biosynthesis: GLC7 was first identified by the glycogendeficient phenotype conferred by glc7-I, which results in the substitution of a cysteine residue for arginine at amino acid residue 73 (CANNON et nl. 1994). glc7-1 mutants fail to accumulate glycogen, at least in part due to a defect in the dephosphorylation and activation of glycogen synthase (FENC et nl. 1991; FRANCOISet nl. 1992). Changes inglycogen synthase that prevent its phosphorylation suppress the glycogen defect of glc7-1 (HARDY and ROACH1993), suggesting that Glc7p acts on glycogen synthase in vivo. Glc7-lp fails to interact with Gaclp (STUARTet nl. 1994), a puta- tive glycogenspecific regulatory subunit of Glc7p, im- plying that the R73A mutation in glc7-I disrupt. the FIGUKE3.-Cxll cycle arrest of gki-129 and gk7-131. Cel morphology and nuclear distribution in gk-7-I29 and glr7-I3 interaction between Glc7p and Gaclp. Despite its se- mutantsare shown. GK7, dc7-129 and gk7-131 strains werc vere glycogen defect, the gk7-I mutant grows normally grown in WD to mid-log phase atSO", and aliquot5 were shiftec under most conditions. To identify other glc7 mutant to 11" or 37" for 24 or 6 hr, respectively. Cell were harvested alleles defective in glycogen accumulation, we stained fixed and stained with propidium iodide to visualize nuclea the collection of gk7mutants with iodine vapor (Figure DNA. (A) The percentage ofunbudded cells, small budded cell (bud is <'/2 the size of the mother cell), large budded cell 5A). Many of the mutants exhibited a partial defect in with one nucleus, and large budded cells with two propidiun glycogen accumulation: the glc7-125, glc7-101, glc7-102, iodidestaining regions are tabulated foreach strain and inculx glc7-127, glc7-131, glc7-136, glc7-108, and glc7-111 mu- tion temperature. N = 260-348 for each culture. (B) Flow q tants all accumulate less glycogen than wild type but tometly data for propidium iodidestained yeast cells analyec more than glc7-1. In contrast, three mutants, gk7-123, in A. The Y axis represents the number of cells with a give1 fluorescence. (C) Representative images of fixed cells stainec glc7-129 and glc7-132, accumulate very low levels of gly- with propidium iodide andvisualized with a combination a cogen while two other mutants, gl~7-I09and gk7-121, fluorescence and DIC optics. routinely accumulate higher levels of glycogenthan the 622 S. H. Baker e/ nl.

LUV ' 3U~IU~~ 3UbI U3G FIGURE4.-2deoxyglucose resistance of glc7 mutants. Yeast strains carrying selected gk7 alleles were plated on synthetic medium containing 100 p~ 2deoxyglucose and 2% sucrose (left) or synthetic medium containing onlv 2% sucrose (right) and incubated for 5 days at 30" under anaerobic conditions. The strains include the following: (A) Cf.C7, (B) glc7-fO6, (C)gk7-134, (D) gk7-133, (E) gk7-132, (F) glc7-131, (G) gk7-129, (H)glc7-127. We note that glc7-106 (B) has a partial growth defect on sucrose. A growth defect was not observed on other carbon sources.

I IIIIC \1113.]

FIGURE5.--Glycogen accumulation in glc7 mutants. (A) Qualitative iodine staining of the indicated mutants on YPD. Strains were replica-plated to YPD and incubated for 24 hr at 30" before staining with iodine vapor. (B) Quantitative glycogen assays of the indicated mutants grown in YPD. Protein Phosphatase Type 1 in Yeast fi23 wild type. Glycogen levelsin these mutantswere directly assayed in batch culture. As shown in Figure 5B, the glc7-109 strain accumulates twice the level of glycogen found in the wild-type strain. Although not apparentin the iodine-stained colonies presented in Figure 5A, glc7- 121 also accumulates more glycogen than the wild type (Figure 5B). Diploid strains heterozygous for glr7-109 and gk7-121 do nothyperaccumulate glycogen, indicat- ing thatthese two alleles are recessive. The low glycogen levels in glr7-129 and glc7-132 are comparable to that found in glc7-I (Figure 5B). The locations of residues altered in the glycogen- defective mutants are presented in Figure 2. Residues that are altered in glycogendeficientmutants are marked in yellow while residues that are altered in gly- cogen-hyperaccumulating mutants are marked in or- ange. In contrast to the clustering of mutant alleles exhibiting defects in glucose repression, the glycogen- defective mutants arc scattered over the surface of Glc7p. The residues altered by glc7-123 (R19A,K22A) are located near R73, the residue altered by glc7-I. glc7- 129(D137A, E138A) alters residues located on thesame face as the active site (Figure 2A) and glc7-132 alters residues (D165A, E166A, K167A) located on the “back side” of Glc7p. Furthermore, the two hyperaccumula- tion mutant alleles, glc7-109 (K259A R260A) and glc7- 121 (D7A and D9A), are located on opposite sides of Glc7p. The dispersion of glycogendeficient mutant al- FIGURE6.”Spon1lation defects in glc7mutants. (A) Sponl- leles across the surface of Glc7p suggests that glycogen lation efficiency of homozygous g/cT mutant strains was as- defects may not reflect simply the inability to interact sayed in liquid YPA medium after 3 days (black bars) or on with the glycogen-specific regulatory subunit. solid SPO medium after 6 days incubation (gray bars). nd, not determined. (B) Space filling model of rabbit PPI (view Sporulation: glr7-1 (CANNONet al. 1994) and glc7- similar to that displayed in Figure 2C). Residues altered by T152K (TUand CARISON1994) mutants have a sporula- the sporulation-deficient glc7-I31 (K149A, D153A), gk7-127 tion defect. To assay this collection of gk7 alleles for (KllOA, K112A),and gk7-136 (D229A, R233A) alleles are sporulationcompetence, diploid strains homozygous marked in black. The residues in rabbit PPI corresponding for viable glc7 alleles were assayed for sporulation effi- to D229 and R233 are E230 and K234, respectively. Resiclucs ciency on solid and in liquid media. Sporulation effi- altered in alanine scanning alleles that do not confer a sporu- lation defect are colored gray. ciency, expressed as the percentage of three- to four- spored asci, ranged from that found for the wild-type meiotic regulator Imelp andis essential for sporulation strain to a near total lack of spores. Sporulation effi- (TUet nl. 1996). Giplp fails to interact with the product ciency is presented in Figure 6A and the location of of glc7-T152K, which is also sporulation deficient (TUPt each mutant alteration is shown on thecrystal structure nl. 1996). glc7-TI52K overlaps the sporulation-deficient in Figure 6B. Mutant alleles affecting sporulation are mutation glc7-131 (K149A, D153A). also distributed widely over the surface of PPI. These Redlp, which interacts with Glc7p in the two-hybrid alleles include the conditional cellcycle allele glc7-I31 assay (Tu d al. 1996), is requiredfor synaptonemal (K149A, D15SA), gk7-136 (D229A, R233A), for which complex formation and spore viability (Rocrcl\.!ll.r. and the only other defect is a partial reduction in glycogen ROEDER 1988, 1990). red1 mutantssporulate but the accumulation, and gk7-I27 (KllOA, K112A),which meiotic progeny are inviable. To determine if any gic7 confers 2-DG resistance and a partial glycogen defi- mutants have a related phenotype, we dissected tetrads ciency. As in the case of alleles that affect glycogen from each of the homozygous glc7 diploids and assaved accumulation, the dispersion of sporulation-deficient the percentage spore viability. Although the gk7 allele mutant alleles over the surface of PPI suggests that in each of our strains is present on a meiotically unsta- Glc7p may have more than a single role in meiosis or ble plasmid, which could complicate the interpretation sporulation or that separate characteristics of the pro- of spore inviability, allstrains that sporulatedefficiently tein can influence sporulation.In this regard it is worth gave rise to a high frequency of viable spores. notingthat two Glc7pbindingproteins, Giplpand Redlp,are requiredfor meiosis and sporulation. DISCUSSION Giplp, shown to bind Glc7p by co-immunoprecipita- The goal of our alanine-scanning mutagenesis was to tion and in the two-hybrid system, is regulated by the alter surface residues on Glc7p, resulting in a collection 624 S. H. Baker et al. of mutant alleles whose products are stable but are un- which overlaps the residues altered in glc7-131. We pre- able to perform specific functions. CUNNINGHAM and dict that the products of the other 2-DGresistant mu- WELLS(1989) proposed that clusters of charged resi- tants are also defective in their interaction with Reglp. dues are likely to lie on the surface of a protein and The two conditional mutant alleles, glc7-129and glc7- that changing these residues to alanine should give rise 131, alter residues on the “front” face of PPI (Figure to mutant proteins that retain the normal structure of 2D). glc7-129 causes a phenotype similar to that con- the protein but may be defective in protein-protein in- ferred by glc7-Yl70 (HISAMOTOet al. 1994) and glc7-12 teractions. This approach has been used with success (MACKELVIEet al. 1995). All three mutants accumulate to analyze the structure of actin (WERTMANet al. 1992), as large-budded cells with a single nucleus located at cAMPdependentprotein kinase (GIBBSand ZOLLEK or in the bud neck,indicating an arrest in the cell cycle 1991) and @tubulin (REIJO et al. 1994). In the case of between G2 and M phases. In contrast, gk7-131 cells Glc7p, the original assumption has largely proven to be arrest with large buds but predominantly with nuclei true. Of the 44 amino acid residues that have been away from the bud neck. The difference in phenotype altered among the 20 mutant alleles, only five are bur- between glc7-131 and glc7-129 mutants could reflect ied in the PPI structure and four of these are active- multiple roles for Glc7p in mitosis. If the paradigm site residues in glc7-126, glc7-128 and glc7-135. The only provided by the glucose repression-defective alleles buried, nonactive site residue we have mutated is holds true for mitotic cell cycle control, one would pre- LysllO in gk7-127. dict that other Glc7p-binding proteins or regulatory Most of the defects conferred by our collection of subunits bind to the regions defined by glc7-129 and glc7 mutant alleles have been observed previously for glc7-131. The binding protein encoded by EGPl/SDS22 other glc7 alleles. One exception is the NaCl sensitivity is a possible candidate. The EGPl/SDS22 gene is essen- of the glc7-109mutant. These cells grownormally under tial (HISAMOTOet al. 1995; MACISELVIEet al. 1995) and most conditions butlyse in 0.9 M NaC1. Osmoregulation depletion of its activity causes cell cycle arrest in G2 or is a complex response, and salt-sensitive phenotypes mitosis (HISAMOTOet al. 1995). It will be of interest to have been observed for a broad range of mutants, in- assay the interaction of Glc7-129p and Glc7-131p with cluding actin mutants (NOVICKand BOTSTEIN1985), Egplp. The amino acid residues altered in glc7-Yl70 mutants in the major plasma membrane ATPase and $67-12 are not located near those altered in glc7- (MCCUSKERet al. 1987), nonsense suppressors (SINGH 129 even though all three mutants have similar pheno- 1977), andmutants in the Hoglp MAP kinase pathway types.However amino acid residues C170 and G227, (SCHUL~LEKet al. 1994).Although the reason for thesalt sites of amino acid substitutions in glr7-Yl70 and glc7- sensitivity of glc7-109is not known, it may be of interest 12, respectively, are partially buried in the crystal struc- that null mutations in PP2B/calcineurin, another ser- ture of PP1. Alterations at these residues might globally ine/threonine phosphatase, causesensitivity to NaCl alter the structure of Glc7p rather than simply alter (NAKAMUFUet al. 1993; BRFLJDEKet al. 1994; MENDOZA surface binding interactions. et al. 1994) while null mutations in PPZl, which encodes Our results together with published data support the a PP1-related phosphatase,confer resistance to high hypothesis that the only essential function of GLC7 is a salt (POSASet al. 1995).It is not known if the high cell cycle role in mitosis or GI. All conditional alleles level of glycogen that accumulates in glc7-109 mutants of glr.7 cause arrest in G2/M and depletion of Glc7p by is related to the NaCl sensitivity. The glc7-121 mutant, repression of an inducible promoter leads to mitotic which also hyperaccumulates glycogen, is not salt sensi- and GI arrest (HISAMOTOet al. 1994; BLACKet al. 1995; tive. MACKELVIE et al. 1995). The only other conditional al- Our analysis of the alanine-scanning alleles has pro- lele of glc7, dis2sl-49, a glycine to serine substitution at vided several insights into the activity of type 1 protein amino acid residue 62, confers a weak temperature- phosphatase. First, residues that affect some traits are sensitive phenotype (PVII\TSUURA and hRAKU 1994). localized to a specific surface of the Glc7p. This is true However, the possibility of other essential functions for for glucose derepression and for mitotic cell cycle con- PP1 should not be discounted. The set of mutants we trol. Mutational changes that cause resistance to 2-DG have generated may not eliminate some specific activi- localize to one face of Glc7p, most strikingly illustrated ties of Glc7p. For example, REG1 and REG2, which en- on the view of PP1 presented in Figure 2C. The 2-DG code two Glc7p binding proteins, are together nearly resistant allele glc7-127 (K112A, K11OA) does not alter essential for growth but deletion of both genes does residues that are close to those altered in the other 2- not result in a cell cycle defect. The growth defect of DGresistant alleles (glc7-131 and glc7-133). However, regl reg2 strains is totally suppressed by mutations in the one of the residues altered in gk7-127, K110, is partially SNF1-encoded protein kinase (FREDERICKand TAT- buried in the protein. Itis possible that the substitution CHELL 1996). None of our glc7 mutants are phenotypi- of alanine at this position could have longer range in- cally similar to regl reg2 cells, suggesting the possibility fluences on proteinstructure. Reglp, which is required that none of our alleles eliminate the binding of both for glucose repression, fails to interact productively with Reglp and Reg2p to Glc7p. G1~7~’“’73(Tu and CARLSON 1995),the location of In contrast to the location of glucose-repressed and P rotein PhosphataseProtein Type 1 in Yeast 625 conditional glc7 alleles, those alleles that impact glyco- myces cerevisiaegenes encoding subunits of cyclic AMPdependent protein kinase. Mol. Cell. Biol. 7: 2653-2663. gen metabolism and sporulation are not confined to a CLARK,S. W., and D. I. MEYER, 1994 ACT3: a putative centractin single region of Glc7p. The residues altered by these homologue in S. cerevisiae is required for proper orientation of mutations are scattered widely over the surface of the the mitotic spindle. J. Cell. Biol. 127: 129-138. COHEN,P., and P. T. W. COHEN,1989 Protein phosphatases come protein. This has several possible implications. First, it of age. J. Biol. Chem. 264 21435-21438. is consistent with the idea thatseveral different binding CUNNINGHAM,B. C., and J. A. WELLS,1989 High-resolution epitope proteins may associate with Glc7p, each required for mapping of hGH-receptor interactions by alaninescanning mu- tagenesis. Science 244: 1081-1085. sporulation or glycogen biosynthesis. Another possibil- DENT,P., A. LAVOINNE,S. NAKIELNY,F. B. CAUDWELL,P. WATTet al., ity is that asingle regulatory subunit may contact Glc7p 1990 The molecularmechanism by which insulinstimulates at distant sites. The molecular weight of Gaclp, a Glc7p- glycogen synthesis in mammalian skeletal muscle. Nature 348: 302-308. binding protein necessary for theactivation of glycogen DOHADWALA,M., E. F. DA CRUZE SILVA,F. L. HALL, R. T. WILLIAMS, synthase, is 88.6 kDa (FRANCOISet al. 1992). At over D. A. CARBONARO-HALL et al., 1994 Phosphorylation and inacti- twice the molecular weight of Glc7p, it could easily con- vation of protein phosphatase 1 by cyclindependent kinases. Proc. Natl. Acad. Sci. USA 91: 6408-6412. tact distant sites on Glc7p. It is also possible that the EGLOFF,M. P., P. T. COHEN,P. REINEMERand D. BARFORD, 1995 CryS- changes caused to some alleles may directly alter the tal structure of the catalytic subunit of human protein phospha- enzymatic activity toward specific substrates without al- tase 1 and its complex with tungstate. J. Mol.Biol. 254: 942- 959. tering the affinity of Glc7p with regulatory subunits. ENTIAN,K. D., and F. K. ZIMMERMANN,1980 Glycolytic enzymes and A final observation concerningthe phenotypes intermediates in carboncatabolite repression mutantsof Sacchar- caused by the alanine-scanning gZc7 mutant alleles is omyces cerevisiae. Mol. Gen. Genet. 177: 345-350. ESHEL,D., L. A. URRESTARAZU,S. VISSERS, J.-C. JAUNIAUX,J. C. VAN their combinatorial phenotypes, as illustrated by the VLIET-REEDIJKet al., 1993 Cytoplasmic dynein is requiredfor two conditional alleles glc7-129 and glc7-131. Both mu- normal nuclear segregation in yeast. Proc. Natl. Acad. Sci. USA tants arrest at the nonpermissive temperature at G2/M 90: 11172-11176. FENG,Z., S. E. WILSON,Z.-Y. PENG,K. K. SCHLENDER,E. M. REIMANN and both are sporulation-deficient. However, glc7-129 et al., 1991 The yeast GLC7gene required for glycogen accumu- results in a strongglycogen deficiency, whereas glc7-131 lation encodes a type 1 protein phosphatase. J. Biol. Chem. 266: does not. glc7-131 confers a 2-DGresistant phenotype 23796-23801. FRANCOIS,J., P. ERASOand C. GANCEDO,1987 Changes in the con- that is not observed for glc7-129. In contrast, glc7-127 centration of CAMP,fructose 2, 6bisphosphate and related me- confers 2-DGresistance and a sporulation-deficiency tabolites and enzymes in Saccharomyces cerevisiae during growth but no cell cyclearrest phenotype.If most of the defects on glucose. Eur. J. Biochem. 164: 369-373. FRANCOIS,J. M., S. THOMPSON~AEGER,J. SKROCH, U. ZELLENKA,W. caused by the alanine-scanning alleles result from im- SPEVAKet al., 1992 GACl may encode a regulatory subunit for paired interactions between the mutant products and protein phosphatase type 1 in Saccharomycescerevisiae. EMBO J. Glc7p binding proteins, then thefact that complex phe- 11: 87-96. FREDERICK,D. L., and K. TATCHELI.,1996 The REG2 gene of Sac- notypes are found for the different mutants implies charomyces cereuisiaeencodes a type 1 protein phosphatase-binding that the bindingsites for these different Glc7p binding protein that functions with Reglp and the Snflp proteinkinase proteins must overlap. Overlapping binding sites cou- to regulate growth. Mol. Cell. Biol. 16 2922-2931. pled with a large number of Glc7p-binding proteins GIBBS,C. S., and M. J. ZOLLER,1991 Rational scanning mutagenesis of a protein kinase identifies functional regionsinvolved in catal- could provide an explanation for the high level of se- ysis and substrate interactions. J. Biol. Chem. 266: 892343931, quence conservation found amongtype 1 protein phos- GIETZ,D., A. ST. JEAN,R. A. WOODS and R. H. SCHIESTL,1992 Im- phatases of different species (BARTONet al. 1994). proved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20: 1425. We thank JOHN KUIUYANfor providing us with the coordinates for GOLDBERG,J., H. B. HUANG,Y. G. KWON,P. GREENGARD,A. C. NAIRN the crystal structure of PP1 and DAVIDIRLBECK for technical assis- et al., 1995 Three-dimensional structure of the catalytic subunit of protein serine/threonine phosphatase-1. Nature 745- tance. We also thank ERIC FIRSTand LUCYROBINSON for critically 376: 753. reading the manuscript. This work supported by National Insti- was HARDY,T., and P. ROACH,1993 Control of yeast glycogen synthase-:! tutes of Health grant GM-477899. by COOH-terminal phosphorylation. J. Biol. Chem. 268: 23799- 23805. LITERATURE CITED HISAMOTO,N., D. L. FREDERICK,K. SUGIMOTO,K TATCHELLand K. MATSUMOTO, 1995 The EGPl gene may be a positive regulator BARTON,G. J., P. T. W. COHENand D. BARFORD,1994 Conservation of protein phosphatase type 1 in the growth control of Saccharo- analysis and structureprediction of the protein serine/threonine mycescereuisiae. Mol. Cell. Biol. 15: 3767-3776. phosphatases. Eur. J. Biochem. 220: 225-237. HISAMOTO,N., K. SUGIMOTOand K. MATSUMOTO, 1994 The Glc7 BLACK,s., P. D. ANDREWS,A. A. SNEDDONand M. J. R. STARK,1995 type 1 protein phosphatase of Saccharomyces cerevisiaeis required A regulated MET3-GLC7 gene fusion provides evidence of a mi- for cell cycle progression in G2/M. Mol. Cell. Biol. 14: 3158- totic role for Saccharomyces cereuisiae. Yeast ll: 747-759. 3165. BOLLEN,M., and W. STALMANS, 1992 The structure, role, andregula- HOLTZMAN,D. A., S. YANG and D. G. DRUBIN,1993 Synthetic-lethal tion of type 1 protein phosphatases. Crit. Rev. Biochem. Mol. interactions identify two novel genes, SLAl and SLA2, that con- Biol. 27: 227-281. trol membrane cytoskeleton assembly in Saccharomyces cerevi- BREUDER,T., C. S. HEMENWAY,N. R. MOWA, M. E. CARDENAS and J. siae. J. Cell Biol. 122: 635-644. HEITMAN,1994 Calcineurin is essential in cyclosporin A-and LI, Y.-Y., E. YEH, T. HAYSand K. BLOOM,1993 Disruption of mitotic FK5Ohensitive yeast strains. Proc. Natl. Acad. Sci. USA 91: 5372- spindle orientation in a yeast dynein mutant. Proc. Natl. Acad. 5376. Sci. USA 90: 10096-10100. CANNON,J.F.J. R. PRINGLE,A.FIECHTERandM. KHALIL, 1994 Charac- MACKELVIE,S. H., P. D. ANDREwS and M. J. R. STARK, 1995 The Sac- terization of glycogendeficient glc mutants of Saccharomyces cere- charomyces cereuisiae gene SDS22 encodes a potential regulator of visiae. Genetics 136 485-503. the mitotic function of yeast type 1 protein phospha&e. Mol. CANNON,F., J. and K. TATCHELL,1987 Characterization of .Saccharo- Cell. Biol. 15: 3777-3785. 626 S. H. Baker et al.

MANIATIS, T., J. SAMBROOKand E. F. FRITSCH,1989 Molecular Clon- ROCKMILL,B., and G. S. ROEDER,1988 REDI: a yeast gene required ing: A Laboratory Manual. Cold Spring Harbor Laboratory Press, for the segregation of chromosomes during thereductional divi- Cold Spring Harbor, NY. sion of meiosis. Proc. Natl. Acad. Sci. USA 85 6057-6061. MATSUMOTO,K., T. YOSHIMATSUand Y. OSHIMA,1983 Recessive mu- ROCKMIIJ.,B., and G. S. ROEDER,1990 Meiosis in asynaptic yeast. tations conferring resistance to carbon catabolite repression of Genetics 126: 563-574. galactokinase synthesis in Saccharomyces cereuisiae. J. Bacteriol. ROSE, M. D., F. WINSTONand P. HIETER,1990 Methods in Yeast Genel- 153: 1405-1414. ics. A Laboraton, Course Manual. Cold Spring Harbor Laboratory MATSUURA,A., and Y. ANRAKU,1994 Geneticinteraction between Press, Plainview, NY. the Ras-cAMP pathway and theDis2sl/Glc7 protein phosphatase SCHULLER,C., J. L. BREWSTER,M. R. ALEXANDER, M. C. CUSTIN and in Saccharomyces cerevisiae. Mol. Gen. Genet. 242: 257-262. H. RUIS, 1994 The HOG pathway controls osmotic regulation MCCUSKER,J. H., D. S. PERLINand J. E. HABER,1987 Pleiotropic of transcription Fia the stress response element (STRE) of the plasma membrane ATPase mutations of Saccharomyces cerevisiae. Saccharomyces cerevisiae CTTl gene. EMBO J. 13: 4382-4389. Mol. Cell. Biol. 7: 4082-4088. SHENOLIKAR,S., 1994 Protein serine/threonine phosphatases- MCMILIAN,J. N., and K. TATCIIELL,1994 The JNMl gene in the new avenues for cell regulation. Annu. Rev. Cell Biol. 10: 5.5- yeast Saccharomyces cerevasae is required for nuclearmigration and 86. spindle orientation during themitotic cell cycle.J. Cell Biol. 125: SINGH,A,, 1977 Nonsense suppressors of yeast cause osmotic-sensi- 143-158. tive growth. Proc. Natl. Acad. Sci. USA 74 305-309. MENDOZA,I., F. RUBIO,A. RODRIGUEZ-NAVARROand J. M. PARDO, STONE, E. M., H. YAMANO,N. KINOSHITA and M. YANAGIUA,1993 Mi- 1994 The protein phosphatase calcineurin is essential for NaCl totic regulation of protein phosphatases by the fission yeastsds22 tolerance of Saccharomyces cerevisiae. J. Biol. Chem. 269: 8792- protein. Curr. Biol. 3 13-26. 8796. STUART,J. S., D. L. FREDERICK,C. M. VARNERand K. TATCHEIL,1994 MUHUA, L., T. S. -OVA and J. A. COOPER,1994 A yeast actin- The mutant type 1 protein phosphatase encoded by glc7-1 from related protein homologous to that foundin vertebrate dynactin Saccharomyce.y cereuisiae fails to interact productively with the complex is required for spindle orientation and nuclear migra- GACI-encoded regulatory subunit. Mol. Cell. Biol. 14 896-905. tion. Cell 78: 669-679. SUTTON, A,, F. LIN,M. J. F. SARABIAand K. T. ARNDT,1991 The SIT4 NAKAMURA,T., Y. LIU,D. HIRATA,H. NAMBA,S. HARADA et al., 1993 protein phosphatase is required in late G, for progression into Protein phosphatase type 2B (calcinewin)-mediated, FK506sen- S phase. Cold Spring Harbor Symp. Quant. Biol. 56: 75-81. sitive regulation of intracellular ions in yeast is an important Tu, J., and M. CARLSON,1994 The GLC7type 1 protein phosphatase determinant for adaptation tohigh salt stress conditions. EMBO is required for glucose repression in Saccharomyces cermisiae. Mol. J. 12: 4063-4071. Cell. Biol. 14: 6789-6796. NEIGEBORN,L., and M. CARLSON, 1987 Mutations causing constitu- TU,J., and M. CARLSON,1995 REG1 binds to protein phosphatase tive invertase synthesis in yeast: genetic interactions with snfmu- type 1 and regulates glucose repression in Saccharomyces cerevis- tations. Genetics 115: 247-253. iae. EMBO J. 14: 5939-5946. NELSON,K. K., M. HOL.MERand S. K. LEMMON,1996 SCD5, a sup- TU,J., W. SONCand M. CARLSON,1996 Protein phosphatase type 1 pressor of clathrin deficiency, encodes a novel protein with a interacts with proteins required for meiosis and other cellular late secretory function in yeast. Mol. Biol. Cell 7: 245-260. processes in Saccharomycer cereuzsiae. Mol. Cell. Biol. 16: 4199- NOVICK,P., and D. BOTSTEIN,1985 Phenotypic analysis of tempera- 4206. ture-sensitive yeast actin mutants. Cell 40: 405-416. TUNG, H.Y., W. WANC;and C. S. CHAN,1995 Regulation of chromc- some segregation by GlcSp, a structural homolog of mammalian OHKURA,H., N. KINOSHITA, S. MIYATANI,T. TODAand M. YANAGIDA, inhibitor 2 that functions as both an activator and an inhibitor 1989 The fission yeast dis2+ generequired for chromosome of yeast protein phosphatase 1. Mol. Cell. Biol. 15: 6064-6074. diioining encodes one of two putative type 1 protein phospha- WERTMAN, F., D. G. DRUBINand D. BOTSTEIN,1992 Systematic tases. Cell 57: 997-1007. K. mutational analysisi of the yeast ACT1 gene. Genetics 132: 337- PALMER,R. E., D. S. SULLIVAN,T. HUFFAKERand D. KOSHLAND,1992 350. Role of astral microtubules and actin in spindle orientation and WILSON,I. A,, H. L. NIMAPZ,R. A. HOUGHTEN,A. R. CHERENSON,M. 1,. migration in the budding yeast, Saccharomyces cereuisiae. J. Cell CONNOILYet al., 1984 The structure of an antigenic determi- Biol. 119: 583-593. nant in a protein. Cell 37: 767-778. POSAS, F.,M. CAMPSand J. &NO, 1995 The PPZ protein phospha- YAMANO, H., K. ISHIIand M. YANAGIDA,1994 Phosphorylation of tases are important determinants of salt tolerance in yeast cells. dis2 protein phosphatase at the Cterminal cdc2 consensus and J. Biol. Chem. 270: 13036-13041. its potential role in cell cycle regulation. EMBO J. 13: 5310- REIJO, R. A,, E. M. COOPER,G. J. BEAGLEand T. C. HUFFAKER,1994 5318. Systematic mutational analysis of the yeast beta-tubulin gene. Mol. Biol. Cell. 5: 29-43. Communicating editor: A. P. MITCHELI.