OGS Thesisvfinal

UNIVERSITY OF CALIFORNIA, SAN DIEGO

The Role of Alpha4 Containing Nicotinic Acetylcholine

Receptors in Dopamine Neurons

A dissertation submitted in partial satisfaction of the

requirements for the degree Doctor of Philosophy

Neurosciences

Tresa Michelle McGranahan

Committee in charge:

Professor Stephen Heinemann, Chair Professor Darwin Berg, Co-Chair Professor Stephan Anagnostaras Professor Athina Markou Professor Martin Paulus

2011

Tresa Michelle McGranahan, 2011

The Dissertation of Tresa Michelle McGranahan is approved, and it is acceptable in quality and form for publication on microfilm:

Co-Chair

Chair

University of California, San Diego

2011

iii

DEDICATION

I would like to dedicate this thesis to my family and my friend family. Without your

love and support, I would not have the strength to reach for my dreams.

TABLE OF CONTENTS

Signature Page ...... iii

Dedication ...... iv

Table of Contents ...... v

List of Figures ...... vii

List of Abbreviations ...... viii

Acknowledgements ...... ix

Vita, Publications, and Fields of Study ...... xii

Abstract ...... xii

Chapter I Introduction ...... 1

Introduction ...... 2

Chapter II Generating the Mouse Model ...... 14

Introduction ...... 15

Deletion of α4 Subunit from Dopaminergic Neurons ...... 16

Functional Deletion of α4*-nAChRs from Dopaminergic Neurons and

Preservation of α6(non-α4)-nAChRs ...... 17

Quantification of α4β2*-nAChRs and α6β2*-nAChRs ...... 19

Conclusions ...... 20

Methods...... 21

Chapter III General Characterization and Acute Nicotine Behaviors ...... 34

Introduction ...... 35

Learning and Memory ...... 35

Locomotor Activity ...... 38

Sensitivity to Nicotine-Mediated Behaviors ...... 40

Nicotine Induced Locomotor Changes...... 41

Nicotine Induced Changes in Body Temperature ...... 43

Methods...... 45

Chapter IV The Role of α4*-nAChRs in Reward ...... 53

Introduction ...... 54

Nicotine Reward...... 60

Cocaine Reward ...... 61

Discussion ...... 63

Methods...... 66

Chapter V The Role of α4*-nAChRs in Anxiety ...... 70

Introduction ...... 71

Basal Anxiety ...... 75

Anxiolytic Effects of Nicotine ...... 76

Discussion ...... 77

Methods...... 78

Chapter V Conclusions and Future Directions ...... 81

Conclusions ...... 82

Future Directions...... 90

References ...... 91

LIST OF FIGURES

Chapter II

Figure 1.1 Generation of α4 lox-only mouse...... 30

Figure 1.2 Deletion of α4 in dopaminergic regions in α4-DA mice ...... 31

Figure 1.3 Selective deletion of α4 in dopaminergic neurons ...... 32

Figure 1.4 Functional confirmation of deletion of α4 from dopaminergic neurons 33

Chapter III

Figure 2.1 Mutations do not alter bodyweight ...... 47

Figure 2.2 Fear conditioning ...... 48

Figure 2.3 Locomotor activity ...... 49

Figure 2.4 Locomotor habituation (30 minutes) ...... 50

Figure 2.5 Locomotor habituation (2 hours)...... 50

Figure 2.6 Locomotor suppression effects of nicotine...... 51

Figure 2.7 Thermoregulatory effects of nicotine...... 52

Chapter IV

Figure 3.1 Conditioned place preference methods ...... 67

Figure 3.2 α4-containing nAChRs mediate nicotine reward ...... 68

Figure 3.3 α4-containing nAChRs do not mediate cocaine reward...... 69

Chapter V

Figure 4.1 Basal anxiety ...... 79

Figure 4.2 α4-containing nAChRs mediate the anxiolytic effects of nicotine...... 80

vii

LIST OF ABBREVIATIONS

Abbreviation Definition α alpha β beta μ micro Ach acetylcholine VTA ventral tegmental area bp base pairs CPP conditioned place preference Cre P1 gene causes recombination CS conditioned stimulus CX cortex DAT dopamine transporter EC50 half maximal effective concentration EPM elevated plus maze ES embryonic stem cells fMRI functional magnetic resonance imaging g gram GABA gamma-aminobutyric acid GAD67 glutamate decarboxylase Hz Hertz i.p. intraperitoneal Kb kilo base pairs LTP long term potentiation M molar ml milliliter mM milimolar mPFC medial prefrontal cortex NAc nucleus accumbens nAChRs nicotinic acetylcholine receptors NMDA N-methyl-D-aspartate neor neomysin resistance gene OT olfactory tubercle PCR polymerase chain reaction pM picomolar SN substantia nigra ST striatum TH tyrosine hydroxlase WT wild type

viii

ACKNOWLEDGEMENTS

I would like to thank Dr. Stephen Heinemann for providing me with the extraordinary opportunity to work in his prestigious laboratory. His direction and advice has allowed me to focus not only on science, but also my future as a scientist.

His mentorship has personalized many of the critical findings that first attracted me to science. In addition to serving as a scientific mentor, Dr. Heinemann has been an extraordinary role model for how to live life fully.

I would also like to thank my committee members. Dr. Stephan Anagnostaras, his patience with me in discussing reward paradigms and interpretations of my findings were instrumental in my success. Dr. Darwin Berg, your suggestions to further examine various parts of the literature greatly improved my understanding and this thesis. I also greatly appreciate your advice on the limits to study one graduate student can undertake. I would like to thank Dr. Athina Markou, for encouraging me to think about and organize projects in relation to publications, although things did not always work out as planned, it is advise I will carry with me for all of my future studies. Dr. Martin Paulus, you are truly a role model for translational science and your synthesis of basic science findings with knowledge of psychiatry has served, and continues to serve, as an extraordinary example to me.

I also owe a huge debt of gratitude to all of my great colleagues in the

Heinemann lab both past and present. Their experience, encouragement and support have made for a wonderful work environment. Dr. TK Booker, thank you for all of

your advice, suggestions and thoughtful questions, and thank you for making time for me even when I know you did not have any to give. Dr. Gustavo Dziewczapolski, thank you for your willingness to help with everything from animal handling to experimental design. Dr. Hosuk Lee, thank you for listening to endless stories about my mice. I would also like to give my appreciation to Conny Maron, Carol Borges-

Merjane, Kacce Jones, Jian Xu and Juan Pina-Crespo for their support and guidance throughout this work.

Many thanks to Dr. Henry Lester from California Institute of Technology for the use of the conditioned place preference apparatus; without your generosity, the cornerstone of this work would not be possible. To Sharon Grady and Natalie Patzlaff from the University of Colorado at Boulder, your patience and expertise has been helpful beyond words. I am also grateful to Dr. Al Collins for his discussions and revisions of the manuscript.

I would also be remiss if I did not thank my funding sources; grants to Stephen

Heinemann funded most of my studies, along with the UCSD Medical Scientist

Training Grant.

Chapter Two, Three, Four and Five include portions submitted for publication in the Journal of Neuroscience, modified from the following publication.

McGranahan, T.M., Patzlaff, N.E., Grady, S.R., Heinemann, S.F., & Booker, T.K. alpha4beta2 nicotinic acetylcholine receptors on dopaminergic neurons mediate nicotine reward and anxiety relief. Journal of Neuroscience (submitted for publication).

I was the primary researcher of these studies and Stephen Heinemann directed and supervised the research. Natalie E. Patzlaff and Sharon R. Grady conducted the functional neurotransmitter assays at the University of Colorado, Boulder.

VITA

EDUCATION 2011 Doctor of Philosophy, University of California, San Diego

2004 Bachelor of Arts, University of California, Berkeley

PUBLICATIONS

Dayas, C.V., McGranahan, T.M., Martin-Fardon, R. & Weiss, F. Stimuli Linked to Ethanol Availability Activate Hypothalamic CART and Orexin Neurons in a Reinstatement Model of Relapse. Biol Psychiatry (2007)

TEACHING

SOMC 227 Mind, Brain and Behavior, Teaching Assistant Professor Mark Kritchevsky. University of California, San Diego Winter 2011

SOMC 205 Basic Neurology, Teaching Assistant Professor Mark Kritchevsky, University of California, San Diego, Spring 2009

FIELDS OF STUDY

Major Field: Neuroscience

Studies in Molecular Neurobiology Professor Stephen Heinemann The Salk Institute for Biological Studies

Studies in Molecular Biology Professor David Schaffer University of California, Berkeley

Studies in Neuroengineering Professor Marie-Françoise Chesselet Brain Research Institute, University of California, Los Angeles

xii

ABSTRACT OF THE DISSERTATION

The Role of Alpha4 Containing Nicotinic Acetylcholine

Receptors in Dopamine Neurons

Tresa Michelle McGranahan

Doctor of Philosophy in Neurosciences

University of California, San Diego, 2011

Professor Stephen Heinemann, Chair

Professor Darwin Berg, Co-Chair

Nicotine is the primary psychoactive substance in tobacco and it exerts its effects by interaction with various subtypes of nicotinic acetylcholine receptors

(nAChRs) in the brain. One of the major subtypes expressed in brain, the alpha4beta2- nAChR, endogenously modulates neuronal excitability and, thereby, modifies certain normal, as well as nicotine-induced, behaviors. Although alpha4-containing nAChRs are widely expressed across the brain, a major focus has been on their roles within midbrain dopaminergic regions involved in drug addition, mental illness and movement control in humans. This work generated a unique model system to examine the role of alpha4-nAChRs within dopaminergic neurons by a targeted genetic deletion

xiii

of the alpha4 subunit from dopaminergic neurons in mice. Selective deletion was confirmed by loss of alpha4 mRNA and alpha4beta2-nAChRs from dopaminergic neurons, as well as selective loss of alpha4beta2-nAChR function from dopaminergic but not GABAergic neurons. Mice without alpha4-containing nAChRs had no gross impairments in learning or locomotor activity and were examined in two behaviors central to nicotine dependence, reward and anxiety relief. alpha4-nAChRs on dopaminergic neurons were found to be necessary for nicotine reward as measured by nicotine place preference, but not for reward from another drug of abuse, cocaine.

Studies using the elevated plus maze as a measure of anxiety indicated that alpha4beta2-nAChRs are necessary for the anxiolytic effects of nicotine and that elimination of alpha4beta2-nAChRs specifically from dopaminergic neurons decreased the sensitivity to the anxiolytic effects of nicotine. In further characterizing the role of alpha4-nAChRs on dopaminergic neurons in nicotine behaviors, studies showed that deletion of these receptors also increased sensitivity to nicotine-induced locomotor depression, however these receptors were not involved in nicotine induced hypothermia. This was the first work to develop a dopaminergic specific deletion of a nAChR subunit and examine resulting changes in nicotine behaviors.

xiv

CHAPTER I

Introduction

1 2

INTRODUCTION

There are currently one billion cigarette smokers worldwide and estimates are that half of them will die prematurely due to a smoking related diseases (WHO, 2010).

Smoking remains the leading cause of preventable morbidity and mortality in the

United States as well as around the world annually resulting in 5.4 million deaths worldwide and 435,000 deaths in the United States (CDC, 2008; Benowitz, 2010;

WHO, 2010). Costs to the United States’ health care system are estimated around

$150 billion dollars a year in addition to the estimate $97.6 billion per year associated with lost productivity (CDC, 2008). Of the current 45 million American’s who smoke,

70% say they would like to quit and 40% do quit for at least a day, however 80% return to smoking within a month and only 3% successfully quit (Benowitz, 2010).

While there were decades of debate about the causality between smoking and a variety of diseases, there is now a recognized class of tobacco related diseases. Tobacco related deaths are most commonly due to cancer, cardiovascular disease and pulmonary disease. Cigarettes are also related to respiratory tract and other infections, osteoporosis, reproductive disorders, delayed wound healing, duodenal and gastric ulcers, diabetes, fire related and other trauma related injuries (Benowitz, 2010). While the pathophysiology behind these diseases is not the same, nicotine is clearly central as it sustains tobacco addiction. The work contained in this thesis focuses on further understanding of the circuitry and biochemistry that lead to nicotine induced behaviors.

Tobacco products consist of a wide variety of chemicals, however the absorption of the tertiary amine alkaloid, nicotine into the cardiovascular systems (via pulmonary, sublingual or cutaneous) and subsequent transport to the brain within eight to ten seconds is an essential step in nicotine dependence (Stein et al., 1998). The average cigarette delivers 10-30ug/kg nicotine resulting in peak plasma levels of nicotine ranging from 10-50ng/ml and usual blood levels of nicotine ranging between

125-275nM (Henningfield et al., 1993). These levels are approximated to be three times higher in the brain and redistribute around the body with high levels in the liver, kidney, spleen and lungs with lowest levels in fat (Nicod et al., 1984). The resulting arterio-venous difference can result in arterial levels being ten times venous

(Henningfield et al., 1993). Nicotine is metabolized in the liver primarily (80%) to cotinine using CYP2A6 resulting in a short half-life of approximately two hours in humans (Henningfield et al., 1993; Benowitz, 1996a).

Epidemiological studies have identified many genetic components to smoking.

For instance, twin studies have found that there is a high degree of heritability (greater than 50%) in regards to level of dependence and even the number of cigarettes smoked

(Lessov-Schlaggar et al., 2008). Additionally, several candidate genes have been identified including neurotransmitter receptors for acetylcholine (Ach), dopamine, γ- aminobutyric acid (GABA), opiate, canabanoid and others (Ho and Tyndale, 2007).

These genetic clues help to explain why, of all the people who try smoking, or other forms of tobacco use, only 20-25% become dependent daily smokers (Benowitz,

2010). Epidemiological evidence has also suggested the self-medication hypothesis

4 based on increased rates of smoking among individuals with certain mental health disorders. Individuals with anxiety disorders (particularly panic disorders) and schizophrenia smoke at higher rates than general population while other psychiatric disorders such as obsessive compulsive disorder, smoke at lower frequency than the general population (Ziedonis et al., 2008). This theory suggest that smoking represents self-medication to alleviate negative symptoms of the disease such as anhedoia or anxiety and may suggest a component of the pathology is related to the endogenous system with which nicotine interacts. Tremendous epidemiological work suggests that nicotine dependence involves several receptor systems and suggests multiple brain regions.

All drugs of dependence are commonly recognized to elicit a feeling of wellbeing or pleasure, however nicotine is attributed to several other of behaviors.

Smokers report that they smoke to modulate arousal and control mood (reviewed in

(Ziedonis et al., 2008)). Testing has shown that smoking improves smokers’ concentration, reaction time and performance on certain tests. Additionally, nicotine administration in human, as well as animal models, results in changes in heart rate, respiration, locomotor activity, body temperature, anxiety, pain (anti-nociception), learning and memory. These behaviors align with the main molecular target of nicotine in the brain, nicotinic acetylcholine receptors (nAChRs). Within the brain, these receptors are involved in modulating behavioral states such as emotional tone, motivation, arousal, as well as complex cognitive processes such as attention, learning

5 and memory. The correlation between nicotine binding sites, nAChRs and nicotine behavioral responses directed focus to nAChRs.

nAChRs are a class of cation-selective ligand-gated ion channels whose endogenous ligand is acetylcholine. Within the brain, 9 alpha (α2, α3, α4, α5, α6, α7,

α8, α9, α10) and 3 beta (β2, β3, β4) subunits have been identified. Eight subunits contribute to acetylcholine binding site (α2-α4, α6-α10) four of which also have structural function (α5, β2-β4)(Hogg et al., 2003). These receptors are formed by the heteromeric or homomeric combinations of five subunits to form a functional receptor

(reviewed in (Drago et al., 2003)). Most nAChRs are composed of both α and β subunits while α7 can form homo- or hetero-pentamers (α9 and α10 thought to assemble in alpha only hetero-pentamers but are mainly expressed in sensory and immune cells). Subunit expression varies across the brain with some receptors being highly localized and others being diffusely spread throughout the brain (Drago et al.,

2003). The combination of the subunits results in receptor subtypes with varying pharmacological and biophysical properties (reviewed in (Hogg et al., 2003; Fucile,

2004)). An additional level of complexity results from variations in cellular localization of nAChRs; they are expressed pre and post synaptically as well as extra- synaptically. Functionally, nAChRs produce local depolarization and are mainly thought to modulate neurotransmission across the brain. nAChRs’ function both directly by exciting neurons and indirectly by activation that leads to high Ca++ conductance, activating Ca++ cascades, inducing release of Ca++ from internal stores and exocytosis (Fucile, 2004). As most brain nAChRs are on presynaptic terminals,

6 they are often thought to stimulate neurotransmitter release (Albuquerque et al., 2009).

Work focusing on the role of presynaptic nAChRs indicated they influence synaptic efficacy and plasticity as well as frequency dependent filtering, spike-timing- dependent plasticity and overall signal–to-noise ratio in the cortex (Mansvelder and

McGehee, 2000; Disney et al., 2007; Zhang et al., 2009). Somatodendritic nAChRs however are thought to function more in volume transmission than the classically defined synapses responding to spread of neurotransmitter from distant sites

(Descarries et al., 1997). In addition to location based functional differences, nAChRs have posttranslational mechanisms that modify response properties; most notably upregulation and desensitization, which vary greatly based on subunit composition. nAChRs, as a family of receptors, have extraordinary diversity and complexity.

While there is wide variation in expression pattern of the various subunits across the brain, the midbrain dopaminergic system expresses mRNA for all brain nAChRs except α2 (Klink et al., 2001). This area is also activated upon intravenous nicotine administration in human smokers using fMRI (Stein et al., 1998). This activation correlates with a self-reported sensation of a “high or rush” (Due et al.,

2002; Barrett et al., 2004). The midbrain dopaminergic region consists of two main pathways: the mesolimbic pathway and the nigrostriatal pathway. The mesolimbic dopamine system, consisting of the ventral tegmental area (VTA) and its projections to several other areas including the nucleus accumbens (NAc), medial prefrontal cortex

(mPFC) and amygdala and has been described as a final common pathway for mediating the rewarding properties of drugs of abuse (Pierce and Kumaresan, 2006).

All drugs of abuse, including nicotine, either directly or indirectly activate dopaminergic neurons in the VTA to release dopamine into the NAc (Leshner and

Koob, 1999). The nigrostriatal pathway consists of dopaminergic neurons that originate in the substantia nigra (SN) pars compacta and project to the striatum. This pathway is involved in motor control and degenerates in Parkinson’s disease. Within this pathway, nicotine may be neuroprotective as there is an inverse correlation between smoking and Parkinson’s disease (Ritz et al., 2007). Based on the human pathology, these two systems have been considered separately, one a cognitive and the other a motor control area however recent work suggests that the two areas overlap in function as well as projections more than previously thought (review in (Wise, 2009)).

Extensive work on substances of abuse has focused on the mesolimbic pathway as essential for reward. We are defining reward as something that produces emotions and positive feelings and induce approach and learning behaviors. The VTA consists primarily of dopamine and GABA neurons and receives multiple projections from various neurotransmitter systems. Both GABA and dopamine projection neurons originate in the VTA and project to various areas including the NAc and mPFC.

Processing within the VTA involves local GABA interneurons as well as somatic and dendritic dopamine release. The primary glutamatergic excitatory inputs to the VTA are from the PFC as well as excitatory inputs from the amygdala, in addition to other neurotransmitter inputs from the laterodorstal tegmental nucleus, the bed nucleus of the stria terminalis and other areas (Johnson and North, 1992). Elegant work has indicated that dopamine neurons projecting to the PFC receive reciprocal input from

8 the PFC, while NAc projecting neurons do not indicating additional complexity of this circuitry (Carr and Sesack, 2000). This anatomical work characterizing the neuronal populations and projections has been followed by electrophysiological examination.

VTA dopamine neuron firing rate is increased by primary rewards, reward- predicting appetitive stimuli and novel, behavior orienting stimuli (Schultz, 2007).

Current interpretations of this work suggest that dopamine neurons adjust firing rate as an error signal for the quality of environmental events relative to prediction.

Endogenously, increased dopamine release can result from an increase in sustained firing activity of dopaminergic neurons, or as a result of burst firing which is twice as efficient at increasing dopamine release (Suaud-Chagny, 2004). While burst firing releases large amounts of dopamine, it is rapidly removed by reuptake and believed to function primarily in a synaptic function compared to increases in population activity that follow tonic increases in dopamine levels (Floresco et al., 2003). Work also suggests that burst firing is a key component of the reward circuitry as it is sufficient to elicit CPP (Tsai et al., 2009). Additionally, drugs of abuse increase dopamine by a various mechanisms. Nicotine alters dopamine transmission in several ways including directly stimulating dopamine release from synaptic terminals, activating somatic and dendritic nAChRs resulting in local depolarization as well as increasing glutamatergic and GABAergic transmission onto dopaminergic neurons through activation of presynaptic nAChRs (Mansvelder et al., 2009). In general, nicotine increases tonic firing rate of dopamine neurons (Lichtensteiger et al., 1982; Pidoplichko et al., 1997) although depressant effects may occur (Bonci and Malenka, 1999). These

9 electrophysiological findings in dopamine neurons have provided further support for their role in nicotine reward.

Several studies have identified dopamine as essential not only for reward from drugs of abuse, but also for natural rewards. In fact animals that have deficits or lack endogenous dopamine function fail to survive or die from starvation (Cannon and

Bseikri, 2004). More limited dopaminergic lesions have been found to block reward in several paradigms. Dopamine lesions in the adult using 6-hydroxydopamine or dopamine antagonism impair nicotine reward in several paradigms including self administration (Corrigall and Coen, 1991), place preference (Acquas et al., 1989), and have been implicated in impaired facilitation of intracranial self-stimulation (Bauco and Wise, 1994). Additionally, antagonists to dopamine receptors D1 and D3 have been studied to block nicotine reward in animal as well as human studies (Bauco and

Wise, 1994). This work helped establish the dopamine hypothesis of reward, which this work expanded to examine the influence of dopaminergic nAChRs on nicotine behaviors.

Dopaminergic neurons compose the majority of the neurons within the VTA.

These neurons express several subtypes of nAChR, three of which contain the α4 subunit (α4β2, α4α6β2β3, and α4α5β2). One of these (α4α6β2β3) has the highest sensitivity to nicotine of any native nAChRs that have been studied to date (reviewed

in (Grady et al., 2007)). Two stoichiometries exist of α4β2-nAChRs (α42β23 has 10- fold-higher sensitivity than α43β22 (Nelson et al., 2003)) both of which are expressed more on GABAergic neurons in the midbrain than on dopaminergic neurons

(Salminen et al., 2004; Gotti et al., 2007; Carbone et al., 2009). Several studies have implicated the high-affinity α4β2*-nAChRs within mesolimbic areas in nicotine reward. Postmortem brains of human smokers have an upregulation of α4β2*- nAChRs and chronic nicotine results in upregulation in many dopaminergic projection regions including the medial perforant path, anterior cingulated cortex and striatum

(Breese et al., 1997). Within midbrain dopaminergic regions, chronic nicotine leads to an upregulation of α4*-nAChRs on GABAergic neurons of the SN and VTA but minimal change in dopaminergic neurons (Nashmi et al., 2007). Mice lacking the β2 subunit fail to display any nAChR upregulation (Picciotto et al., 2001), (Schwartz and

Kellar, 1983; Marks et al., 1985). This work suggests involvement of α4β2*-nAChRs in response to chronic nicotine.

Examining reward specifically, administration of acetylcholine directly into the

VTA has been found to be rewarding (Redgrave and Horrell, 1976; Ikemoto and Wise,

2002; Ikemoto and Wise, 2004). The endogenous cholinergic innervation to the VTA is primarily from the lateraodorsal temental nucleus and lesions of this nucleus also impair nicotine reward (Blaha et al., 1996). Mice lacking the β2 or α4 subunit lack nicotine reward in a variety of paradigms including conditioned place preference

(Walters et al., 2006) and nicotine self-administration (Picciotto et al., 1998a). Some addiction-related behaviors can be rescued by reintroduction of α4, α6 or β2 subunit into the VTA using viral expression (Pons et al., 2008) however other methods of low level re-expression of β2 were unsuccessful at restoring nicotine reward (Mineur et al.,

2008). In addition, data obtained from a mouse line carrying a mutation in the α4

11 subunit that renders the nAChR hypersensitive to nicotine suggests that activation of the α4 subunit is sufficient for nicotine-induced reward (Tapper et al., 2004).

Together, this collection of evidence suggests α4β2*-nAChRs within the VTA are critical for nicotine reward and subsequent addiction behaviors.

Pharmacological studies as well as studies in genetically mutated mice have identified that α4 containing nAChRs are involved in many behaviors in addition to reward. The α4 subunit, found on chromosome 20, is a 17kb gene consisting of 6 exons resulting in a 627 amino acid protein consisting of a ligand binding domain (37-

243) and 2 membrane spanning domains (250-427 and 566-618) with a phosphorylation (protein kinase C) site in between (s366) (Elliott et al., 1996). Mice lacking α4 have increased basal anxiety, exploratory behavior and sniffing with a decrease in grooming (Ross et al., 2000). They are also resistant to nicotine-induced anti-nociception on a hot plate (Marubio et al., 1999; Pons et al., 2008). Elimination of α4 containing receptors also alters sensitivity to nicotine induced locomotor depression (Tritto et al., 2004). Deletion of α4 also eliminates nicotine stimulated dopamine release (Exley et al., 2011). Additional work has been done to generate hypersensitive nicotinic receptors. This mutation results in embryonic lethality due to dopaminergic excitotoxicity (Orb et al., 2004). Inducing expression of this hypersensitive mutation at an adult time point is also excitotoxic and results in dramatic dopaminergic neuron loss (Labarca et al., 2001; Orb et al., 2004). Mice with a low level of expression of a less sensitive mutation were viable and enable examination of the sufficiency of α4 receptors. Studies in these mice have shown that

12 activation of α4 is sufficient for nicotine reward and nicotine induced hypothermia

(Tapper et al., 2004). Activation of only these hypersensitive α4 receptors were also sufficient to elicit tolerance to nicotine induced hypothermia. This behavioral work suggests α4*-nAChRs mediate at least sensitivity to nicotine and may be essential for many of the behavioral response to nicotine. Genetic analysis has also suggested a role for α4 in nicotine dependence (Ho and Tyndale, 2007; Lessov-Schlaggar et al., 2008)

While tremendous work using elegant genetic and pharmacological approaches has demonstrated the involvement of α4β2*-nAChRs in many behaviors, the brain regions that mediate these changes have yet to be identified. A vast literature supports the role of the mesolimbic dopaminergic pathway in mediating the rewarding properties of drugs of abuse (Pierce and Kumaresan, 2006), including nicotine

(Maskos et al., 2005), make α4β2*-nAChRs in mesolimbic dopaminergic regions likely candidates for mediating nicotine addiction-related behaviors. Additionally, previous work implicating midbrain dopaminergic neurons in other behaviors including anxiety and locomotion, make understanding the role of α4*-nAChRs within dopaminergic neurons intriguing. This work developed a mouse model in which α4 subunits were selectively deleted from dopaminergic neurons, in order to test the hypothesis that α4*-nAChRs on dopaminergic neurons mediate responses to acute nicotine including reward, locomotion, thermoregulation and anxiety. While there are many behavioral and pharmacological interventions aimed at smoking cessation, the majority of people who try to quit smoking relapse (Benowitz, 2010).

Better understanding of the molecular and genetic mechanisms that influence nicotine

13 dependence could aid in the development of more successful methods of nicotine cessation.

CHAPTER II

Generating the Mouse Model

14 15

INTRODUCTION

Nicotine-related diseases remain at epidemic proportions around the world and are responsible for nearly 6 million deaths a year (Mathers and Loncar, 2006).

Understanding the molecular mechanisms behind nicotine-related behaviors may provide insight into novel therapies and molecular targets for treating nicotine dependence. α4β2*-nAChRs were identified as a major target of nicotine binding in the brain and previous work has implicated these nAChRs in mediating multiple behavioral responses to nicotine (reviewed in (Drago et al., 2003).

Midbrain dopaminergic neurons are generally divided into two circuits, the mesolimbic dopaminergic pathway, implicated in reward and stress responses

(Roberts and Koob, 1982; Stewart, 1984), and nigrostriatal dopaminergic pathways necessary for the initiation of movement (Lima et al., 2009). α4β2*-nAChRs are highly expressed in these brain regions which are predominantly dopaminergic, but that also contain GABAergic and other cell types. α4β2*-nAChRs have been implicated in behaviors mediated by midbrain nuclei, however, it has not previously been possible to elucidate if the α4β2*-nAChRs involved in those behaviors are on dopaminergic or other types of neurons. This work generated a mouse with a specific deletion of α4 from dopamine neurons.

To specifically remove α4 from dopaminergic neurons, we first generated a line of α4 conditional (lox-only) mice in which loxP recognition sequences were inserted on either side of exonV of the α4 gene (which codes for the channel of the

16 receptor). The bacteriophage enzyme Cre recombinase recognizes loxP sites and facilitates recombination between them resulting in a deletion of the intervening DNA

(Figure 1.1). Previous groups have shown that deletion of exonV disrupt transcription of α4 and eliminate expression of the α4 protein (Marubio et al., 1999; Ross et al.,

2000). To selectively eliminate α4 expression from dopaminergic neurons, lox-only control mice (α4 lox/lox DAT-Cre -/-) were bred with knock-in mice expressing Cre under the control of the promoter for the dopamine transporter (DAT) gene

(Slc6a3)(α4 wt/wt DAT-Cre +/-) (Zhuang et al., 2005). The mating of these animals resulted in the dopaminergic α4 knockout mice (α4-DA [α4 lox/lox DAT-Cre+/-]) which expressed Cre only within dopaminergic neurons which, because of the loxP sites, deleted exonV of the α4 gene specifically within dopamine neurons.

Additionally, the following littermate control mice were tested in the subsequent experiments: cre-only controls (α4 wt/wt DAT-Cre +/-), lox-only controls (α4 lox/lox

DAT-Cre -/-) and wild type (α4 wt/wt DAT-Cre -/-), as well as mice with global deletion of α4 (α4-null [α4-/- DAT-Cre-/-]). Deletion was confirmed to be specific by examining α4 mRNA, nAChR binding and with functional assays.

DELETION OF α4 SUBUNIT FROM DOPAMINERGIC NEURONS

α4-DA mice exhibited a loss of α4 mRNA from dopaminergic midbrain regions (VTA and substantia nigra [SN]) as shown by in situ hybridization, while α4 expression was intact in remaining regions (Figure 1.2 row A). Cre expression was restricted to the same dopaminergic midbrain regions (Figure 1.2 row B). A coincident

17 decrease in high affinity 125I-epibatidine binding in dopaminergic midbrain regions

(VTA, SN) and terminal regions (ST [and OT not shown]) was observed (Figure 1.2 rows C and D), indicating a loss of α4*-nAChR. α4 mRNA expression was completely eliminated in α4-null mice.

To confirm that the regional deletion was specific to dopaminergic neurons, sections were triple labeled for α4 mRNA, the dopaminergic marker tyrosine hydroxylase (TH), and the GABAergic marker, GAD67 (Figure 1.3). In control animals (only wild type controls are shown in Figure 1.3), α4 mRNA expression was seen within both TH (arrow) and GAD67 positive cells (underlined arrow). In α4-DA mice, as expected, α4 mRNA was not detected within TH positive cells (Figure 1.3E).

α4 mRNA within GAD67 positive neurons remained intact, demonstrating that α4 expression was selectively eliminated in dopaminergic (arrow) but not GABAergic neurons (underlined arrow). We did observe three TH positive cells with expression of

α4 mRNA in α4-DA mutant out of the 150 TH positive neurons we examined. This indicates that the α4 gene was mutated with high efficiency by Cre recombinase

(sample image not shown).

FUNCTIONAL DELETION OF α4*-nAChRs FROM DOPAMINERGIC

NEURONS AND PRESERVATION OF α6(non-α4)-nAChRs

To verify the functional deletion of α4*-nAChR specifically from dopaminergic neurons, we examined nicotine-stimulated dopamine and GABA release. Nicotine-stimulated dopamine release is mediated by several subtypes of

18 nAChRs in two brain regions (ST and olfactory tubercle [OT]) that receive dopaminergic projections from the SN and VTA. These nAChRs fall into two main categories, an α-CtxMII-resistant component (α4β2 and α4α5β2-nAChRs) and an α-

CtxMII-sensitive component (α4α6β2β3, α6β2β3 and α6β2-nAChRs) (Salminen et al., 2007). Consistent with the presence of α4 subunit in all receptors mediating α-

CtxMII-resistant dopamine-release (Figure 1.4A), this release was abolished in the α4- null and α4-DA mice at both low (0.1μM) and moderate (10μM) concentrations of nicotine (0.01μM: ST:F(4,17)= 10.18, p<0.001; OT:F(4,16)=9.001, p=0.001) (1.0μM:

ST:F(4,17)=32.39 p<0.001; OT:F(4,16)=29.874, p<0.0010). The α-CtxMII-sensitive dopamine release (Figure 1.4B) was reduced at 0.1 μM nicotine (ST:F(4,17)=2.963, p=0.05; OT:F(4,16)=3.262, p=0.039) but remained at control levels at 1.0 μM nicotine for both α4-null and α4-DA mice (ST:F(4,17)=0.193, p=0.938; OT:F(4,15)=.439, p=0.779). This rightward shift may be explained by the loss of α4α6β2β3*-nAChR

(the receptor with the lowest EC50) leaving the α6β2 and α6β2β3-nAChRs intact

(Salminen et al., 2007). These findings are consistent with the loss of α4*-nAChRs in dopaminergic pathways that originate in midbrain dopaminergic regions. Nicotine- stimulated GABA release (Figure 1.4C) from ST and CX, a control region not receiving dopaminergic input from the VTA and SN, was eliminated in the α4-null mice, as expected (1uM(ST:F(4,14)=14.721, P<0.001; CX:F(4,14)=6.948, p=0.003)

10μM(ST:F(4,14)=21.687 p=0.001; CX:F(4,14)=8.994, p=0.001). The α4-DA mice retain control level of nicotine-stimulated GABA release activity in CX, showing no loss of the α4 subunit in GABA neurons. Although the α4-DA mice showed

19 significantly lowered nicotine-stimulated GABA release activity in ST, the level was comparable to the lox-only control, indicating an effect of the lox sites on expression in this region. This decrease in lox-only control mice was not detected by ligand binding (see below), indicating an alteration in expression below the level of detection using ligand binding. This supports the need to study all mutations independently, in addition to the desired mutation (Schmidt-Supprian and Rajewsky, 2007). These biochemical studies confirm that deletion of the α4 subunit in the α4-DA is restricted to dopaminergic neurons.

Interestingly, both the lox-only control and the α4-DA mice had a decrease in nicotine-stimulated GABA release in striatum but not in cortex. While insertion of loxP sites around exonV had no other detectable phenotypic or expression changes, this decrease may indicate that interruption of an intron by insertion of a loxP site may alter gene expression in specific neuronal populations. This illustrates the necessity of examining mice of all possible genotypes (wild type, cre-only control, lox-only control) in addition to the desired mutation (Schmidt-Supprian and Rajewsky, 2007), here the α4-DA mutant. In this case, the partial decrease in nicotine-stimulated GABA release did not alter any behavioral measurements or ligand binding, as the lox-only control behavioral responses and ligand binding were comparable to wild type and cre-only control mice.

QUANTIFICATION OF α4β2*-nAChRs AND α6β2*-nAChRs

The functional changes were supported by membrane binding experiments

20 conducted with 125I-epibatidine in samples of the same tissue used for the neurotransmitter release assays. Consistent with autoradiography results presented in

Figure 1.2, α4-null mice showed a decrease in total 125I-epibatidine binding in dopaminergic regions (OT: F(4,19)=183.095, p<0.001; ST: F(4,18)=96.559, p<0.001)

(Figure 1.4F). This decrease results from an almost complete loss of the cytisine- sensitive component (analogous to the α-CtxMII-resistant component of dopamine release, i.e., α4β2*-nAChR subtypes) (OT: F(4,19)=112.128, p<0.001; ST:

F(4,18)=65.489, p<0.001) (Figure 1.4D) and a partial loss of the α-CtxMII-sensitive component (i.e. a loss of the α4α6β3β2-nAChR subtype) (OT: F(4,19)=9.593, p<0.001; ST: F(4,18)=2.488, p=0.08)(Figure 4E). In CX, all 125I-epibatidine binding was absent in the α4-null (F(4,19)=59.475, p<0.001); however, in the α4-DA mutants,

125I-epibatidine binding in CX remained at control levels. In ST and OT from α4-DA mice, 125I-epibatidine binding (cytisine-sensitive, α-CtxMII-sensitive and total) was reduced but not abolished, consistent with deletion of α4 in dopaminergic neurons with continued expression in GABAergic neurons (Figure 1.4D-F). The decrease in nicotine-stimulated GABA release seen in the lox-only control was not detectable in these binding experiments.

CONCLUSIONS

Mice engineered with a deletion of the α4*-nAChRs subunit only in dopaminergic neurons (α4-DA) were extensively characterized. In the α4-DA mice, expression of α4 mRNA and protein was eliminated selectively in dopaminergic

21 neurons, as measured by in situ hybridization, high-affinity 125I-epibatidine binding, and co-localization of mRNA with TH and GAD67. A specific loss of all function of

α4*-nAChRs at dopaminergic terminals, but not GABAergic terminals, confirmed the localized deletion.

METHODS

Generation of Targeted Deletion of α4-nAChR Subunit: α4 lox-only mice:

Using established homologous recombination techniques, α4 lox-only mice were generated with loxP sequences (34 bp) (Sauer and Henderson, 1988; Kilby et al.,

1993) inserted into intronic regions on either side of exonV of the α4 gene as seen in

Figure 1.1. Previous work has demonstrated that deletion of exonV disrupts expression of the α4 protein (Marubio et al., 1999; Ross et al., 2000). The neomysin resistance gene (neor) was included in the targeting construct to facilitate selection of embryonic stem (ES) cells that had undergone homologous recombination. Diphtheria toxin fragment A gene, inserted beyond the region of homologous DNA as a negative selection marker, causes lethality in cells in which the construct has been aberrantly inserted without undergoing homologous recombination. The targeting construct was transfected into CCE ES cells (derived from 129SvEv mice) by electroporation and grown in the presence of G418 (Roche Diagnostics, Indianapolis, IN) to select for neomycin resistance. Correct insertion of the targeted gene was confirmed by PCR and

Southern blot analysis. In ES cells in which the targeting construct had been properly inserted, the neomycin resistance cassette was removed by Cre-mediated

22 recombination using a Cre expressing plasmid, pturbo-Cre (a generous gift from the

Embryonic Stem Cell Core, Washington University, St. Louis). As recombination can occur between any two of the three loxP sites, several recombination products were obtained. ES cells containing Product I with the ‘floxed’ exonV but no neomycin resistance gene were injected into C57Bl/6 mouse blastocysts and implanted into pseudopregnant females. Three chimeric mice were obtained, which on the basis of coat color (agouti), contained a substantial amount (70-100%) of tissue derived from the ES cells, indicating a high probability that the mutant DNA from the ES cell was contributing to the germ line. Germ line transmission of the loxP-flanked exon was confirmed by PCR, Southern blot and sequence analysis of tail DNA amplified by

PCR. α4 lox-only mice are viable with phenotype indistinguishable from wild type littermates. Mice were backcrossed over 15 generations to C57BL/6 and will be referred to as lox-only control mice.

α4-DA mice: α4-DA mice were generated by breeding the lox-only control mice with knock-in mice expressing Cre recombinase under the dopamine transporter

(DAT) gene (also known as slc6a3-Cre mice) (Zhuang et al., 2005). α4-DA mice were maintained primarily by heterozygous breeding of α4 wt/lox DAT-Cre -/- females with α4 wt/lox DAT-Cre +/- males. This breeding strategy produced the following desired genotypes: α4-DA (α4 lox/lox DAT-Cre+/-), cre-only control (α4 wt/wt DAT-

Cre +/-), lox-only control (α4 lox/lox DAT-Cre -/-), and wild type (α4 wt/wt DAT-

Cre -/-) littermates. Occasionally, lox-only control females were mated for a single generation with α4-DA males to increase the number of α4-DA mice.

α4-null mice: Using Cre positive females in breeding, we were able to obtain the global deletion of α4 presumably due to expression of Cre in the egg, which resulted in recombination prior to fertilization. α4 heterozygous Cre positive females

(α4 lox/wt DAT-Cre +/-) were used for breeding with wild type males (α4 wt/wt

DAT-Cre -/-). This breeding resulted in the targeted genotype, α4 wt/- DAT-Cre -/-

(other genotypes produced by this breeding are Cre-only control (α4 wt/wt DAT-Cre

+/-), wild type (α4 wt/wt DAT-Cre -/-), and null-heterozygous Cre positive mice

(α4wt/- DAT-Cre +/-)). The target heterozygous mice (α4 wt/- DAT-Cre -/-) were then used in heterozygous mating to produce α4-null mice (α4-/- DAT-Cre -/-) and wild type controls (α4 wt/wt DAT-Cre -/-).

Genotyping: Genotype was determined by PCR of tail DNA (primers: α4: 5’

CAGTGGGTTTGCTATGGTC 3’, 5’ ATACACCACACCCACGAAC 3’, 5’

GCAGGTGTTAGAATCATAGG 3’; CRE 5’ ACGCTGTTTTGCACGTTCACC 3’,

5’ GGTTTCCCGCAGAACCTGAA 3’). DNA ampliﬁcation was achieved through the following protocol: 95°, 2 min; 29 cycles: 95°- 25 seconds; 58°- 30seconds, 72°- 45 seconds; 72° 10 minutes. On a 1.5% agarose gel, the approximate band sizes were:

516 base pairs (bp)-wild type α4, 548 bp- loxP flanked α4, 478 bp - recombined α4 allele (α4-null), 210 bp - Cre.

Radioactive In situ hybridization: Coronal sections (15 μm) (n = 2-3 mice/genotype for α4 probe, n = 1-2 mice/genotype for Cre probe) were used for in situ hybridization with a protocol similar to that previously described (Marks et al.,

1992). A 600bp riboprobe complementary to mRNA encoding the intracellular loop of the α4 subunit was synthesized by in vitro transcription using T7 RNA polymerase

(Ambion, Austin, TX). 35S-UTP was used as the sole source of UTP. The same method was used to produce a riboprobe complementary to the coding sequence of Cre. α4 and Cre probes were hybridized to sequential serial sections.

[125I]Epibatidine Binding to Sections: Coronal sections (15 μm) (n=2-3 mice/genotype) were used for autoradiography using [125I]epibatidine following a protocol nearly identical to that described previously (Whiteaker et al., 2002). Total binding was determined using 10 pM [125I]epibatidine + 90 pM unlabeled epibatidine

(Sigma, St. Louis); nonspecific binding was determine by inclusion of 1 mM unlabeled L-nicotine (Sigma, St. Louis)

Co-localization of α4 with TH and GAD67: Mice (n=2/genotype) were anesthetized with Nembutal (50mg/kg) intraperitoneal injection (i.p.) and subjected to cardiac perfusion with 20mls RNAse free PBS followed by 50mls 4% paraformaldyde

(PFA). Brains were dissected, cut into 2 mm sections and incubated in 4% PFA for 2 hours at room temperature then in 30% sucrose at 4°C for 20 hours. Each section was then imbedded in Tissue Freezing Medium (Triangle Biomedical Sciences, Durhamn,

NC) and rapidly frozen using isopentane on dry ice prior to storage at -80°C. The

2mm section containing the midbrain was sliced at 15μm and mounted on to

Superfrost Plus slides (VWR, Denver, CO). Sections were hybridized with 600bp digoxigenin-labeled riboprobe complementary to α4 mRNA and a 900bp fluorescein-

25 labeled riboprobe complementary to the 3’ end of glutamate decarboxylase 67

(GAD67) mRNA at 67°C for 16 hours in a buffer containing 50% deionized formamide (Ambion, Austin, TX), 0.1mg/ml tRNA (Ambion, Austin, TX), 10% dextran (Chemicon, Temecula, CA), and 1X Denhardt’s solution (Sigma, St. Louis).

The slides underwent 1 hour of stringency washes at 63°C in a saline-sodium citrate buffer containing 50% formamide. Slides were then blocked for 1 hour in a MABT

(100mM maleic acid, 150mM NaCl, 0.1% Tween-20 [Roche Diagnostics,

Indianapolis, IN], pH 7.5) containing 2% Blocking Reagent (Roche diagnostics,

Indianapolis, IN) and 10% sheep serum (Jackson ImmunoResearch, West Grove, PA) and then incubated overnight at 4°C with 1:500 anti-digoxigenin-peroxidase antibody

(Roche). Following 50 minutes of washes in MABT, peroxidase was developed using the Tyramine Signal Amplification (TSA) cyanine3 kit (PerkinElmer Life Sciences,

Boston, MA). The reaction was stopped by three 10 minute washes in phosphate buffered saline solution (PBS; 100mM NaCl, 10mM sodium phosphate buffer, pH 7.5) then any remaining peroxidase was quenched using 3%H2O2 in PBS for 30 minutes at room temperature. This protocol was then repeated to stain the fluorescein-labeled probe with overnight antibody incubation using 1:500 anti-fluorescein-peroxidase antibody (Roche, Indianapolis, IN) and development using the TSA-Cyanine2 kit.

Following development of the GAD67 probe, sections were blocked for 2 hours and then incubated overnight with rabbit anti-tyrosine hydroxylase (ab112; AbCam,

Cambridge, MA) in a PBS based blocking solution containing 0.5% donkey serum,

0.25% Triton X-100 and 0.05% cold water fish skin gelatin. The following day after 1

26 hour of washes in 10% blocking solution, the sections were incubated for 4 hours at room temperature with 1:250 Alexaflour488 goat anti-rabbit (Invitrogen, Carlsbad,

CA). Slides were then rinsed for 20 minutes with PBS, dehydrated, cleared with

Xylene and cover-slipped. Slides were examined using a Leica TCS SP2 AOBS laser scanning confocal microscope with a 63x oil immersion lens (Mannheim, Germany).

The Alexa488 was excited using the 488 nm line of an argon laser, Cy5 using the 633 nm line of a HeNe laser, and Cy3 was excited by a 561nm DPSS laser. The images presented are a projection of 10 sections collected ~0.5um apart using Leica Confocal

Software (Germany).

Synaptosome Preparation for Release Experiments: After a mouse was sacrificed by cervical dislocation, the brain was removed and placed immediately on an ice-cold platform and regions dissected. Tissues from each mouse (n = 3-

6/genotype) were homogenized in 0.5 ml of ice-cold 0.32 M sucrose buffered with 5 mM HEPES, pH 7.5 and the homogenizer rinsed and combined for final volumes of 2-

3 ml. For each experiment, tissues from each mouse were divided as follows: Striatum

(ST) into 4 equal aliquots; olfactory tubercle (OT) into two aliquots of 25% of suspension and one of 50%; and cortex (CX) into one aliquot each of 8% and 92% of suspension. A crude synaptosomal pellet was prepared by centrifugation of these aliquots at 12,000g for 20 minutes. One pellet of ST and the larger pellets of OT and

CX were frozen for future binding experiments. The remaining pellets were used for neurotransmitter release.

Release of [3H]Dopamine: All experiments were conducted at room temperature using methods described previously (Grady et al., 1997, 2001) with modifications for collection into 96-well plates. In brief, pellets of 25% of ST or OT synaptosomes were resuspended in uptake buffer (128mM NaCl, 2.4mM KCl, 3.2 mM

CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 25 mM HEPES, pH 7.5, 10 mM glucose,

1 mM ascorbic acid, and 0.01 mM pargyline) and incubated at 37° C for 10 minutes.

[3H]Dopamine (100 nM, 4 µCi into 0.8 ml of synaptosomes) was then added, and the suspension was incubated for an additional 5 minutes. Aliquots (80 ml) were pipetted onto filters and perfused at 0.8 ml/minute with perfusion buffer (uptake buffer with

0.1% bovine serum albumin [BSA], 1 µM nomifensine and 1mM atropine) for 10 minutes, or buffer for 5 minutes followed by buffer with 50nM α-conotoxin MII (a-

CtxMII) for 5 minutes. Nicotine or high potassium (20mM) in perfusion buffer for 20 seconds were used to stimulate the release of [3H]dopamine. Starting from 1 minute before stimulation, fractions (~0.1 ml) were collected every 10 seconds for 4 minutes into 96-well plates, using a Gilson FC204 fraction collector (Gilson, Inc., Middleton,

WI). Radioactivity was determined by scintillation counting using a 1450 MicroBeta

Trilux scintillation counter (Perkin Elmer Life Sciences, Wallac Oy, Turku, Finland) after addition of 0.15 ml Optiphase ‘SuperMix’ scintillation cocktail. Instrument efficiency was 40%.

Release of [3H]GABA: Methods described for dopamine release were used with the following modifications: Ascorbate and pargyline were omitted from the uptake buffer and 1.25 mM aminooxyacetic acid added. Synaptosomes were incubated

28 at 37°C for 10 minutes, [3H]GABA (8 mCi into 0.8 ml) added, and the incubation continued for another 10 minutes. Perfusion buffer without nomifensine and with NO-

711 (100 nM) was used.

[125I]-Epibatidine Binding to Membrane Preparations: The methods of

Whiteaker et al, (2000a; 2000b) were followed to determine [125I]-epibatidine binding to membrane preparations. Briefly, tissue from 3-6 mice/genotype treated with phenylmethylsulfonyl fluoride (PMSF, 1 mM) were incubated with [125I]-epibatidine

(200 pM; Kd ~ 70 pM) in binding buffer (30 ml volume including in mM: NaCl, 144;

KCl, 1.5; CaCl2, 2; MgSO4, 1; HEPES, 20; pH=7.5 with BSA (0.1% wt/ vo1), 5 mM

EDTA, 5 mM EGTA, 10 mg/ml each aprotinin, leupeptin trifluoroacetate and pepstatin A). To some samples, 50 nM cytisine was added to selectively block α4β2*- nAChR, to allow determination of cytosine-resistant epibatidine binding (the α4β2*- nAChR population) (Grady et al, 2007). To other samples, 100nM α-CtxMII, was added to measure α-CtxMII-sensitive epibatidine binding (the α6β2*-nAChR population) (Grady et al, 2007). Nicotine (1 mM) was used for blank determination.

Incubation was for 2 hr at room temperature. Using an Inotech Cell Harvester

(Inotech, Rockville, MD, U.S.A.), reactions were terminated by filtration of samples at

4°C onto a two-layer filter consisting of one sheet of GFA/E glass fiber filter (Gelman

Sciences, Ann Arbor, MI, U.S.A.) and one sheet of GF/B glass fiber filter (Micro

Filtration Systems, Dublin, CA), both treated with 0.5% polyethylenimine. Samples were subsequently washed six times with ice-cold binding buffer. Radioactivity was measured using a Wallac 1450 Microbeta scintillation counter (PerkinElmer Life and

Analytical Sciences) after addition of 150 ml of Optiphase Supermix scintillation cocktail (PerkinElmer Life Sciences) to each well of a 96-well counting plate.

Data Analysis: All values are presented as mean ± SEM. Perfusion data were plotted as counts per minute versus fraction number. Fractions collected before and after the peak were used to calculate baseline as a single exponential decay. The calculated baseline was subtracted from the experimental data. Fractions that exceeded baseline by 10% or more were summed to give total released cpm and then normalized to baseline to give units of release [(cpm-baseline)/baseline] (Grady et al., 1997,

2001). One-way ANOVA with Duncan’s post-hoc analysis was used to determine statistical significance (SPSS software).

Chapter Two, Three, Four and Five include portions submitted for publication in the Journal of Neuroscience are modified from the following publication.

Figure 1.1 Generation of α4 lox-only mouse In the targeting construct used to generate α4 lox-only mice, 34 bp loxP sites (black triangles) were inserted into the intronic regions on either side of exonV of the α4 gene. The neomysin resistance gene (neor) was included in the targeting construct to facilitate selection of embryonic stem (ES) cells that had undergone homologous recombination. Diphtheria toxin fragment A (DT-A) gene, inserted beyond the region of homologous DNA as a negative selection marker. In ES cells the neomycin resistance cassette was removed by Cre- mediated recombination. As recombination can occur between any two of the three loxP sites, several recombination products were obtained. ES cells containing Product I with the ‘floxed’ exonV but no neomycin resistance gene were injected into C57Bl/6 mouse blastocysts and implanted into pseudopregnant females.

Figure 1.2. Deletion of α4 in dopaminergic regions in α4-DA mice. Expression of α4 mRNA (A.), Cre recombinase mRNA (B.), and high-affinity 125I-epibatidine binding sites (C.) at the level of the dopaminergic cell bodies (VTA/SN) are shown in adjacent brain slices for wildtype, cre-only control, lox-only control, α4-DA, and α4- null mice. 125I-Epibatidine binding is also shown at the level of the striatum (ST) that contains the terminal ends of mesolimbic dopaminergic neurons (D.). n=2-3 mice/genotype for α4 insitu and epibatidine; n=1-2/ Cre insitu

Figure 1.3. Selective deletion of α4 in dopaminergic neurons. Wildtype controls (A-D) and α4-DA (E-H) mice were labeled for α4 mRNA (red, B, F), tyrosine hydroxylase (TH) a marker for dopaminergic neurons (green, C, G), and a marker of GABAergic neurons (GAD67 blue, D, H). Dopamine neurons are indicated by arrows; GABA neurons by underlined arrows. Scale bar indicates 15μm. n=2 mice/genotype

Figure 1.4. Functional confirmation of deletion of α4 from dopaminergic neurons. (A.) α4β2*-nAChR (a-CtxMII-resistant) and (B.) α6β2*-nAChR (a-CtxMII- sensitive) mediated dopamine release from two dopaminergic projection regions, olfactory tubercle (OT) and striatum (ST). (C.) α4β2*-nAChR-mediated GABA release from ST and cortex (CX). For both dopamine and GABA release, full dose response curves were measured; representative concentrations are reported here (units normalized to baseline). K+-stimulated neurotransmitter release for all genotypes did not differ (data not shown). (D-F) 125I-epibatidine binding (fmol/mg protein) in OT, ST and CX. (D.) cytistine-sensitive component (representing α4β2*-nAChRs), (E.) α- CtxMII-sensitive component (α6β2*-nAChR) and (F.) total (representing all high- affinity heteromeric nAChRs). * p<0.05. n=3-6 mice/genotype

CHAPTER III

General Characterization and Acute Nicotine Behaviors

34 35

INTRODUCTION

While the mouse generated in the previous chapter was designed to ask specific questions about nicotine behaviors, it was also important to examine naïve animals. As noted in the previous chapter, modification of the animal’s genome due to insertion of genes, such as Cre, or smaller nucleotide pieces, such as the loxP sites, can result in unintended alterations of expression in addition to targeted deletion. Grossly, all animals were indistinguishable by genotype. All mice were black, of comparable weight (Figure 2.1), were capable of breeding and had no other notable phenotypes.

Having confirmed that dopaminergic neurons lack α4 mRNA, α4β2*-nAChRs and

α4β2*-nAChR mediated dopamine release, we proceeded to examine the memory and locomotor activity of all genotypes.

LEARNING AND MEMORY

Significant work ranging from clinical observations to controlled studies have found that nicotine has cognitive-enhancing properties (reviewed in (Herman and

Sofuoglu, 2010)). Several studies have shown that nicotine can improve performance in both smokers and non-smokers. Additionally, mice lacking β2*-nAChRs have deficits in executive function and behavioral flexibility (Granon et al., 2003). While

β2-null mice do not show memory improvement in response to nicotine like wild type mice, they already have improved basal associative memory compared to wildtype animals (Picciotto et al., 1995).

Impairment in learning or memory in our mutant mice may influence our ability to evaluate nicotine reward behaviors so we examined emotional memory using

36 delay fear conditioning. This test involves pairing a neutral context and cue (tone) with an aversive stimulus (foot shock). Previous work has shown that the contextual memory requires the dorsal hippocampus, lateral entorhinal cortex, nAC and fornix while the cued memory also requires a functional amygdala (Robinson et al., 2011).

Correlation between α4β2*-nAChR binding and the amount of contextual freezing suggest involvement of the cholinergic system in fear conditioning (Sienkiewicz-

Jarosz et al., 2003). Additionally, nicotine enhances fear conditioning (Gould, 2003) an effect mediated by α4β2*-nAChRs (Davis and Gould, 2006). While associative memory studies found improved memory in mice lacking β2*-nAChRs, old male β2- null mice (although not female or young animals) were found to have impaired contextual and cue memory (Caldarone et al., 2000). In addition to nAChRs, previous work has also strongly implicated muscarinic ACh receptors in mediating fear conditioning (Anagnostaras et al., 1999). While previous studies have found important roles for ACh receptors in learning and memory, alterations in contextual or cue learning in α4*-nAChR null mice have not been reported.

As α4*-nAChRs are expressed in brain regions essential for fear conditioning and dopamine neurons project to many of these regions, we wanted to examine if either our α4-null or α4-DA mice had any gross deficits in learning. Fear conditioning consists of three phases. During the initial training phase, the animal is introduced to a novel environment and allowed to explore for three minutes. During the next three minutes, three 20 second tones are presented that co-terminate with a one second foot shock. All control mice and α4-DA mice preformed equivalently and while α4-null

37 mice trended to freeze less during training, there was no statistically significant difference (F(4,42)=0.5387, P=0.7081) as all mice did increase freezing following shocks (F(5,210)=48.10, p<0.0001). A day later, the animals were reintroduced to the same chamber where they previously received the shock and the percent of time spent freezing was recorded as a measure of contextual learning. While all three control lines and α4-DA mice spent a significant amount of time freezing, indicating a contextual memory, α4-null mice again tended to spend less time freezing although not significantly (F(4,42)=0.6127, p=0.2411). The following day, the animals were introduced to a novel environment and again allowed to explore for three minutes.

During the following three minutes the same three 20 second tones were presented as on the training day except they were not paired with a foot shock. All mice showed little to no freezing during the first 3 minutes in the novel environment and increased freezing in response to the cue (tones) indicating cue learning (F(5,210)=24.17, p<0.001). While α4-DA mice tended to freeze less following the cue presentation, this also was not statistically significant (F(4.42)=0.6127 p=0.6558). All data are presented as percent of time spent freezing during each minute (Figure 2.2 A,C,E) and a total over all 3 minutes for context or the last 3 minutes for cue and training, (Figure 2.2

B,D,F). While statistical analysis did not reveal any significant differences in genotypes in percentage of time spent freezing suggesting that removal of α4*- nAChRs globally or regionally deleting α4*-nAChRs from dopamine neurons does not dramatically impair learning and memory, further studies may be justified to examine difference.

LOCOMOTOR ACTIVITY

As was previously mentioned, dopaminergic neurons are also critically involved in motor control. As such our deletion of α4 from dopaminergic neurons may alter the locomotor activity of our mutant mice. Previous studies have shown that β2- null mice are hyperactive and viral reintroduction of β2 subunit into dopamine regions can normalize locomotor activity (Avale et al., 2008). Additionally, previous studies have found that decreases in dopamine transporter (DAT) function alter locomotor activity (reviewed in (Uhl, 2003)). The Cre mouse used was knocked into the DAT locus and may subtly interrupt expression of the DAT and result in a hyperactive phenotype as well. As locomotor function is the basis of output for all of our intended behavioral measures, characterization of each genotype’s locomotor function is essential for adequate interpretation of any of our findings. In addition to this initial evaluation, for each subsequent behavioral test we included a measure of locomotor activity to evaluate any possible contribution from locomotor differences. We also examined locomotor effects of a wide range of nicotine doses (see nicotine induced locomotor changes below). Each finding will be identified as it is reported, but in advance we did not have any locomotor findings that would impair our ability to interpret data in any of the behavioral test examined.

In order to evaluate basal locomotor activity in drug naïve mice, we used a commercially produced activity monitor chambers (Med Associates, Vermont). We initially examined activity over 30 minutes of time in the 17”x 17” square apparatus.

We found no difference in distance traveled, time ambulatory, average velocity, or

39 time spent performing stereotypic movements (Figure 2.3). However on secondary analysis of five minute blocks of time, it appeared that the α4-DA mutant mice tended to be more active in later time points than the other mice (Figure 2.4) although this was not statistically significant. We decided to further examine a new group of mice for initial locomotor activity as well as in session habituation.

Previous work has found that mutations in dopaminergic signaling can result in mice with a hyperlocomotor phenotype (Zhuang et al., 2001). Similarly, other groups found that silencing β2 in the SN produced hyperactivity in mice (Avale et al., 2008).

As our initial 30-minute assay suggested that our α4-DA mutant might have a mild form of this hyperlocomotor phenotype, we decided to extend our study and examine all groups over the course of two hours. Previous work has indicated that rodents habituate to environments over time and decrease their locomotors activity (Leussis and Bolivar, 2006). We examined ambulatory counts during 10-minute blocks of activity and found that all mice had an equivalent level of locomotor activity during the first 10-minute block (Figure 2.5). Additionally, all control mice decreased their locomotor activity over time, however α4-DA mice did not decrease their activity compared to wild type mice and were hyperactive from 20-minutes through the rest of the study (Genotype F(3,23)=7.02 p=0.0016; Time F(10,230)=78.24, p<0.0001;

Interaction F(30,230)==1.49, p=0.0551). Additionally the α4-DA mice were hyperactive compared to α4-null mice statistically after 50 minutes.

This work suggests that elimination of α4 from dopamine neurons did not alter the mouse’s ability to move, however may alter habituation to a novel environment.

Additionally, it does appear that the addition of Cre to the DAT locus may be contributing to this finding as cre-only control mice differed from wild type mice during three of the 12 time bins. This suggests that the insertion of Cre into the DAT locus may alter DAT expression. A previous study also found that α4 null mutant mice had impaired DAT function suggesting the deletion of α4*-nAChRs, in addition to the possible decrease in DAT, may be the mechanism for this failure to habituate

(Parish et al., 2005). Interestingly knockdowns of DAT have previously been used as a model of bipolar disease (Young et al., 2010). Further work is needed to evaluate the possibility that α4*-nAChRs on dopaminergic neurons may be involved in this pathology.

This locomotor data suggests that removal of all α4*-nAChRs or α4*-nAChRs from dopamine neurons does not impair locomotor activity, however, removal of α4*- nAChRs from dopamine neurons may result in increased response to novelty. As will be discussed later, this increase was not detected in any other paradigm.

SENSITIVITY TO NICOTINE-MEDIATED BEHAVIORS

Nicotine administration produces a wide variety of physiological as well as behavioral changes. Physiological effects of nicotine include increased heart rate and blood pressure and dose dependent increase in secretion of prolactin and

Adrenocorticotrophic hormone resulting in increase in corticosterone (Newhouse et al., 1990; Benowitz, 1996b). Behaviorally, nicotine increases arousal, visual attention and perception (Jones et al., 1992) and improves speed and accuracy of motor function

(West and Jarvis, 1986; Hindmarch et al., 1990) as well as performance on complex

41 psychomotor activities like driving. Nicotine also decreases reaction time and improves ability to withhold inappropriate responses (Wesnes and Warburton, 1983;

Jones et al., 1992). People report that nicotine produces feelings of relaxation, decreased stress, increased vigilance and improved cognition (Herman and Sofuoglu,

2010). Clearly nicotine has a wide variety of effects on physiological and behavioral states. Several groups have examined nicotine response and designed tests to examine them. A group at the University of Colorado at Boulder took great effort to generate dose response curves in 19 strains of mice for several responses to nicotine including respiratory rate, heart rate, locomotor activity and body temperature (Marks et al.,

1989). We chose to examine the role of α4 in dopaminergic neurons in two of these responses, locomotor activity and body temperature.

NICOTINE INDUCED LOCOMOTOR CHANGES

Psychostimulants are generally examined for their locomotor enhancing capabilities, however nicotine elicits a biphasic inhibitory-stimulatory effects on locomotion in a baseline-dependent fashion (Picciotto et al., 2001). While in rats an inverted U-shaped dose response curve can be generated in an acute setting, in most inbreed mouse strains, this is not the case. For mice nicotine generally functions as a locomotor depressant during acute administration in novel environments, although some strains such as CH3 produce a mild locomotor activation at low doses and depression at higher doses similar to findings in rats (Marks et al., 1989). Nicotine is capable of producing locomotor activation in a familiar environment, however with most inbred mice this generally is only accomplished with chronic nicotine exposure.

While previous work in rats, suggests that dopaminergic neurons mediate the locomotor enhancing effects of nicotine (Clarke et al., 1988; Clarke, 1990), these studies have not been conducted with locomotor depression.

Studies have shown that α4-null mice have decreased sensitivity to the locomotor depressing effects of nicotine (Ross et al., 2000). We replicated these findings using a different paradigm, Y-maze, which minimizes anxiogenic stimuli. For the Y-maze test, all animals were injected intraperitoneally (i.p.) with the selected nicotine dose and the number of crosses and rears were recorded (Figure 2.6). We found that nicotine produced a significant dose-dependent decrease in the number of crosses and rears for all genotypes tested. A significant dose-dependent depression of locomotor activity occurred at 1.0 mg/kg nicotine in all three control lines (wild type, cre-only control and lox-only control) for both measures of locomotor activity

(Crosses, F(5,168)=129.85 p<0.0001) and exploratory activity (Rears, F(5,168)=62.19 p<0.0001). Similar to previously published work (Ross et al., 2000), α4-null mice showed decreased sensitivity to nicotine, with minimal depression of locomotor activity at 1.0 mg/kg nicotine (Crosses: F(4,168) = 6.61 p= 0.0001, Bonferroni p<0.001; Rears: F(4,168)=3.38 p=0.0109) but full suppression of at 2.0 mg/kg nicotine. α4-DA mice, however, showed increased sensitivity to nicotine-induced locomotor depression, with a significant decrease in locomotor activity at 0.5mg/kg nicotine (Crosses: Bonferroni p<0.001; Rears: Bonferroni p<0.05). There was a significant interaction between genotype and nicotine in crosses (F(20,168)=3.04, p<0.0001).

Of note, the range of nicotine doses that depresses locomotor activity is considerably higher than those that elicit changes in reward or anxiety and no effect on locomotion was detected in the range used for reward or anxiety studies reported in

Chapters 4 and 5. Additionally, with this minimal anxiogenic method of locomotor testing, we did not detect the increased locomotor activity in the cre-only control line that was seen in the anxiety experiments (see Chapter 5).

Other groups have previously identified that α4-null mice have decreased sensitivity to the locomotor depressing effects of nicotine (Ross et al., 2000; Marubio et al., 2003), which we confirmed with our α4-null mice. Interestingly, elimination of

α4*-nAChRs only from dopaminergic neurons increased the sensitivity to nicotine for locomotor behavior. Possibly an alteration in the balance between nicotine stimulation of α4*-nAChRs on dopaminergic neurons versus GABAergic neurons, leads to an inhibition of dopamine neurons and thus an increased sensitivity to the locomotor depressing effects of nicotine. The doses at which this altered sensitivity to nicotine is detected are an order of magnitude larger than those that elicit conditioned place preference or changes in anxiety.

NICOTINE INDUCED CHANGES IN BODY TEMPERATURE

In addition to studying behaviors that we expected to be altered in a dopamine specific deletion of α4*-nAChRs, we wanted to confirm our model in a behavior that we did not expect to be altered. We chose to examine nicotine-induced hypothermia.

Nicotine has previously been shown to decrease body temperature in a dose dependent

44 manner. Chronic nicotine can induce tolerance to this response. Additionally, previous work has suggested that α4β2*-nAChRs mediate nicotine-induced hypothermia

(Tapper et al., 2004; Tritto et al., 2004). While it is possible that dopaminergic α4*- nAChRs mediate this response, we did not expect this neuronal population to be critical for nicotine induced hypothermia. We examined if mice lacking α4 subunit globally or only within dopaminergic neurons have altered responses to nicotine in regards to change in body temperature (Figure 2.7). While all mice had a decrease in body temperature in response to increasing doses of nicotine, α4-null mice did not show decreases in body temperature at 1.0 mg/kg nicotine that all three control lines did (genotype effect: F(4,158)=12.37 p<0.0001; dose effect F(5,158)=145.54 p<0.0001) consistent with reports for β2-null mice (Tritto et al., 2004). We found that the α4-DA mice responded just as control mice, indicating that dopaminergic α4*- nAChRs are not involved in nicotine-induced hypothermia. A significant interaction of dose and genotype was seen (F(20,158)=3.15, p<0.0001).

While studies examining hypersensitive α4*-nAChRs, found activation of these receptors was sufficient to produce tolerance to nicotine induced hypothermia

(Tapper et al., 2004), this is the first work to identify that α4*-nAChRs are necessary for normal sensitivity to acute nicotine induced hypothermia. Additionally, we demonstrated that dopaminergic α4*-nAChRs are not necessary and do not alter the sensitivity to nicotine induced hypothermia. This work served as additional support that we are not disturbing α4*-nAChRs in non-dopaminergic areas.

METHODS

Open Field Locomotor Activity: Locomotor activity was measured in 17 x 17 inch chambers lined with three 16-beam infrared arrays. A 50 millisecond-scanning rate was used for measuring beams broken. Distance traveled and stereotypic counts were measured using Open Field Activity software (MED Associates, Inc., St. Albans,

VT). Distance traveled was analyzed for estimates of locomotion based on the movement of a given distance and resting delay (movement in a given period).

Stereotypy was measured as consecutive breaking of the same photobeam that indiscriminately includes scratching, grooming, sniffing and head bobbing.

Habituation data was analyzed y repeated measures ANOVA. Other parameters were analyzed by one-way ANOVAs.

Y-Maze Locomotor Activity: A symmetrical Y-maze was constructed of red acrylic plastic and consisted of three enclosed arms that were 26 cm long, 6.1 cm wide, and 10.2 cm high. Crossing and rearing activities were monitored as breaks of infrared beams. The beams for monitoring Y-maze crosses were located in the middle of each arm and at the exit from each arm to the center of the maze. The beams for monitoring rears (when a mouse stands up on its hind legs) passed through the long axis of each arm 6.4 cm above the ﬂoor. Animals (n=4-10/genotype/dose) were injected with nicotine (0, 0.01, 0.25, 0.5, 1, 2 mg/kg i.p) and first placed in a holding cage for 5 minutes, then placed in the center of the maze and allowed to explore for

3 minutes. The total number of crosses between the arms and rears were recorded for the 3-minute test.

Fear Conditioning: Pavlovian associative learning was evaluated as freezing response to a context or a cue (tone) associated to an aversive stimulus (electric shock). We used test chambers (MED Associates, Vermont), which have a cubic shape with 2 metal walls, one back white synthetic leather wall, and one clear Plexiglas front gate wall, with a clear Plexiglas ceiling and a metal grid floor that will be used to deliver an electric shock. The chambers were cleaned between subjects with 85% ethanol. The test chamber was placed inside a sound-attenuated cubicle containing a small CCD camera and white light to enable behavioral observation. Experiments were controlled by commercial software (MED-PC IV) and interfaces from Med

Associates. A mouse was placed in the test chamber and allowed to explore freely for

3 minutes. In the next 3 minutes, three 20-second tones (80 dB, 2800 Hz; conditioned stimulus) were presented at one-minute intervals, which co-terminated (“delay conditioning”) with a 1 second foot shock (0.75 milliamp; unconditioned stimulus).

The mice were removed from the chamber 40 second after the last conditioned stimulus-unconditioned stimulus pairing for delay conditioning. Freezing behavior was recorded as percent of total time. One day later, the mouse was placed back into the test chamber for 6 minutes and the presence of freezing behavior was recorded

(contextual memory test). Twenty four hours later, the mouse was tested for its freezing to the auditory conditioned stimulus (cued memory test). For this last test the chamber was modified to provide a totally different context. A plastic floor and a semi circular plastic wall will be inserted. The lighting was changed to yellow and a container with 1 ml vanilla extract was placed in the sound-attenuated chamber. The

47 chambers were cleaned between subjects with Windex. There were two 3-minute phases during the cued memory test. In the first phase (pre-conditioned stimulus), freezing was recorded without the auditory cue. In the second phase, the conditioned stimulus was presented three times (20 seconds each) at one-minute intervals and freezing will be recorded again as percent of time in second phase. Data analyzed by repeated measures ANOVA. n=6-14/ genotype.

Body Temperature: Initial body temperature was recorded using a rectal thermometer lubricated with mineral oil and inserted 2.5 cm into the mouse’s rectum.

Following temperature recording, animals (n = 4-10/genotype/dose) were injected with the appropriate does of nicotine (0, 0.01, 0.25, 0.5, 1, 2 mg/kg i.p) and singly housed in a new cage for 15 minutes until the final body temperature recording was taken.

This chapter includes portions submitted for publication in the Journal of

Neuroscience from the following publication. McGranahan, T.M., Patzlaff, N.E.,

Grady, S.R., Heinemann, S.F., & Booker, T.K. alpha4beta2 nicotinic acetylcholine receptors on dopaminergic neurons mediate nicotine reward and anxiety relief.

Figure 2.1 Mutations do not alter bodyweight These are the body weights of the mice used in the later Y-Maze study (n=31-54mice/genotype)

Figure 2.2 Fear conditioning Fear conditioning data presented as percent of time spent freezing per minute (A,C,E) or during the last 3 minutes (B,F) or total time (D) during training (A,B), contextual testing (C,D) and Cue testing (E,F) n=6-14/genotype

Figure 2.3 Locomotor activity A. Distance traveled B. Time Ambulatory C. Average Velocity D. Time spent doing stereotypic movements n=7-13mice/genotype

Figure 2.4 Locomotor habituation (30 minutes). Locomotor activity was further divided into 5 minutes buns during the 30 minutes of open field activity. n=7- 13mice/genotype

Figure 2.5 Locomotor habituation (2 hours). Animals explored a novel arena for 2 hours and activity counts were recorded. Wild type, Lox-only and α4-null mice habituated to the environment at the same rate. Cre-only mice differed from wild type at 3 time points (#=p<0.05). α4-DA mice did not habituate to the environment and differed from wild type (*=p<0.05, **=p<0.01, ***=p<0.001) and from α4-null mice (p=p<0.05) n=6-8mice/genotype

Figure 2.6. α4-containing nAChRs on dopaminergic neurons are involved in locomotor suppression effects of nicotine. Activity (crosses (A.) and rears (B.)) were recorded over 3 minutes in the Y maze. All groups of mice showed locomotor suppression, however α4-null mice showed decreased sensitivity (*** p<0.001 wildtype X α4-null) while α4-DA mice showed increased sensitivity as measured by crosses (** p<0.05 for wildtype X α4-DA) (A.) α4-null mice also showed decrease sensitivity to nicotine as measure by rears (*p<0.05 wt X α4-null). While α4-DA mice did not show increased sensitivity relative to control mice in rears, they did show a significant difference from α4-null mice (# p<0.05 α4-DA X α4-null). n=4- 10mice/genotype.

Figure 2.7. α4-containing nAChRs on dopaminergic neurons are not involved in thermoregulatory effects of nicotine. All mice showed decrease in body temperature in response to increasing doses of nicotine. α4-null mice showed decreased sensitivity (***p<0.0001 wildtype X α4-null) while α4-DA mice did not differ from control groups. Data scaled as square root of dose. n=4-10mice/genotype

CHAPTER IV

The Role of α4*-nAChRs

In Reward

53 54

INTRODUCTION

The most commonly recognized behavioral response to nicotine is a sense of well being that it can elicit, what is commonly referred to as reward. For this work we define reward as something sufficient to induce learning, positive feelings and emotions. Nicotine reward has been examined in humans primarily using imaging and psychological evaluation with and without pharmacological manipulations (Rose and

Corrigall, 1997; Barr et al., 2008; Brody et al., 2009). Animal studies have proven more challenging to recognize emotional and positive feeling components of reward and instead measure the ability to induce learning and approach primarily as an increase in preference using a variety of paradigms. Extensive work in rats has used operant self-administration behaviors. This is most often a two choice paradigm where an operant response is required for an intravenous infusion of drug, while a similar operant response lacks a reward. Despite extensive work with all drugs of abuse in rats and several in mice, this method has been difficult to master for nicotine in mice. For mice, other methods of determining preference have been optimized including oral administration, intracranial self-administration, and conditioned place preference

(CPP).

CPP is a method of conditioning where an animal is trained to associate one area with drug and later given a choice between the area trained with drug and other areas that are novel or trained with vehicle (Fudala et al., 1985). Using this method in combination with pharmacological agents has provided information on several receptor systems that may be necessary elements for nicotine preference; in this work

55 we focused on acetylcholine (ACh) and dopamine. Rats will self-administer cholinergic agonists carboachol and acetylcholinesterase inhibitor neostigmine into the ventral tegmental area (VTA) (Ikemoto and Wise, 2002). Additionally, lesions of the tegmental pedunculopontine nucleus, the main source of endogenous Ach to the VTA, also block nicotine CPP (Lanca et al., 2000). Dihydro-β-erythroidine hydrobromide

(DHβE) a nicotinic acetylcholine receptor (nAChR) competitive antagonist, has been found to block nicotine CPP, however methyllycaconitine citrate (MLA), an α7*- nAChR antagonist does not (Walters et al., 2006). This work provides strong evidence for ACh receptors in nicotine CPP. Additional work has strongly implicated dopamine transmission as systemic administration of dopamine receptor D3 antagonists blocks nicotine reward (Le Foll et al., 2005a; Le Foll et al., 2005b). Additionally, dopamine receptor D1-like antagonists block nicotine CPP however reports suggest that D1- like receptors have regional variability (Singer et al., 1982; Acquas et al., 1989; Spina et al., 2010). In addition to ACh and dopamine systems, other pharmacological agents have been found to block nicotine CPP including canabinoid receptor CB1 (Merritt et al., 2008), and μ-opioid receptor antagonists (Walters et al., 2005). This work suggests that several neurotransmitter systems may be involved in nicotine reward, and that regional differences may exist as both ACh and dopamine projections and receptors are widely spread across several brain regions.

Pharmacological studies are limited because pharmacological agents often bind multiple sites in addition to the receptor with the highest affinity. Additionally, the heteromeric structure of nAChRs requires using genetically altered mice to identify

56 individual subunit involvement. Fortunately, many null mutant mice have been generated and examined for nicotine reward. Mice lacking α4, β2, or α6 have decreased nicotine reinforcement in various paradigms, while mice lacking α7 appear to have wild type levels of nicotine reinforcement (Picciotto et al., 1998b; Pons et al.,

2008). Recently, mice lacking α5*-nAChR were examined and found to have decreased sensitivity to the negative effects of nicotine resulting in self administration of more nicotine than wild type mice (Fowler et al., 2011). Additionally, mutant mice have implicated other receptor systems in nicotine reward such as adenosine receptor

A2A (Castane et al., 2006) and NMDA receptors (Wang et al., 2010). These studies in genetically altered mice have improved the understanding of specific receptors involved in nicotine reward.

In addition, tremendous work suggests positive reinforcement is mediated by the mesolimbic system for all drugs of abuse (Pierce and Kumaresan, 2006), including nicotine (Maskos et al., 2005). This brain circuitry has been the focus from the first intracranial self-stimulation studies (Olds and Milner, 1954; Olds, 1958) and more recent studies have supported focus on this area due to activation following intravenous nicotine administration in human smokers using fMRI (Stein et al., 1998) that correlates with a self-reported sensation of a “high or rush” (Due et al., 2002;

Barrett et al., 2004). The mesolimbic dopamine system, consisting of the VTA and its projections to several other areas including the NAc, medial prefrontal cortex (mPFC) and amygdala and has been described as a final common pathway for all drugs of abuse (Pierce and Kumaresan, 2006). All drugs of abuse, including nicotine, either

57 directly or indirectly activate dopaminergic neurons in the VTA resulting in the release of dopamine into the NAc (Leshner and Koob, 1999).

In addition to behavioral studies of nicotine reward, electrophysiological studies have lead to greater understanding of the effects of nicotine within mesolimbic dopamine regions and suggested the importance of glutamatergic (NMDA-dependent) plasticity in reward. Dopaminergic neuron firing has been well examined and is generally subdivided into 2 categories: tonic and phasic. Tonic firing is generally at a low frequency (approximately 4Hz) and phasic firing consists of high frequency bursts

(generally 20-40Hz of widely variable numbers of action potentials). Nicotine can both alter the tonic firing rate of dopamine neurons as well as frequency and duration of burst firing (Zhang et al., 2009), however burst firing is thought to differentiate behaviorally relevant information (Schultz, 2007).

In other systems, plasticity at excitatory glutamatergic synapses has been identified to play a critical role in memory acquisition and consolidation. NMDA receptors have a unique dual requirement for activation of synaptic transmission and membrane depolarization in a specific temporal relationship. This coincidence detector mechanism allows the NMDA receptor to flux calcium into the post synaptic cell and ultimately leading to the phenomenon known as long term potentiation (LTP).

LTP is a long lasting strengthening of communication between two neurons when the neurons are depolarized simultaneously. Induction of LTP involves brief repetitive stimulation of excitatory glutamate pathways that leads to an increase in the strength of the glutamate synapses for hours in brain slices and weeks in vivo. LTP is a main

58 candidate for mediating neuronal plasticity mechanisms of associative learning throughout the brain. Both neuronal plasticity and associative learning are components of addiction, which have made LTP an interesting area of study in addiction research.

As nicotine has been shown to activate both the pre and post-synaptic sides of the glutamate- dopamine synapse in the midbrain, this maybe sufficient to generate

Hebbian synaptic plasticity and thus LTP seen with systemic nicotine (Saal et al.,

2003). Evidence supporting LTP in behavior comes from mice lacking NMDA receptors (due to a lack of critical subunit NR1) from dopaminergic neurons. These mice lack nicotine CPP indicating that NMDA receptors are necessary for nicotine reward and suggesting that NMDA-dependent LTP at glutamate-dopamine synapses maybe necessary (Wang et al., 2010).

All drugs of abuse, including nicotine, have been shown to increase dopamine release both in vivo and in vitro (Ikemoto and Wise, 2004; Nestler, 2005). Nicotine has been shown to have several effects on dopamine neurons including directly stimulating dopamine release from synaptic terminals, activating somatic and dendritic nAChRs resulting in local depolarizations as well as increasing glutamatergic transmission onto dopaminergic neurons through activation of presynaptic nAChRs

(Mansvelder et al., 2002). While drugs of abuse increase dopamine by a various mechanisms, work suggests that burst firing specifically requires activation of NMDA receptors on dopaminergic neurons (Zweifel et al., 2009). Additionally, α4*-nAChRs are necessary for nicotine induced burst firing (Exley et al., 2011). Previous work has show that burst firing of dopamine neurons is sufficient to elicit CPP (Tsai et al.,

2009) suggesting that similar to NMDA receptors, α4*nAChRs on dopamine neurons may be necessary for nicotine reward.

An alternate theory has been suggested that nicotine reward requires the desensitization of nAChRs on GABAergic neurons in the VTA leading to disinhibition of dopaminergic neurons. Dopaminergic neurons are under tonic inhibitory control by endogenous activation of nAChRs on GABA neurons

(Mansvelder et al., 2002). Nicotine however, may desensitizes these nAChRs in seconds to minutes resulting in increased firing rate of dopaminergic neurons

(Mansvelder et al., 2002). These authors suggested that LTP may be induced by the increase in dopamine firing rate that results from decreased GABA inhibition and not dependent of nicotine stimulation of nAChRs on dopamine neurons themselves.

The understanding of nicotine reward has narrowed from an identification of neurotransmitter systems involved, to and identification of key brain regions to theories on specific synapses. Each step of understanding overcame technological challenges to more carefully dissect the molecular mechanisms involved. While earlier studies identified deficits in nicotine reward using systemic and local pharmacological manipulations of α4β2*-nAChRs, technology advanced to generate mice with global deletions of α4 or β2 nAChR subunits, and technology further advanced with more regional approaches using viral reintroduction or localized re-expression of nAChRs into mice with global deletions (Mineur et al., 2008; Pons et al., 2008). This great compilation of work has implicated α4*-nAChRs in nicotine reinforcement and our

60 work takes the next advance in technology to target deletion of a specific nAChR subunit, α4, from a specific neuron population, dopamine neurons.

NICOTINE REWARD

To examine the role of α4 in nicotine reinforcement, we used CPP. CPP consists of three phases, first a pre-training phase where the animals initial biases for the apparatus are evaluated, followed by a training phase where the animal has six training sessions, three in drug chamber and three in saline chamber and lastly the testing phase where the animal is evaluated for preference (Figure 3.1). On the training day, preference is measured by the time spent in the chamber associated with drug exposure, in this case, nicotine. Nicotine reinforcement was measured as an increase in time spent in the nicotine-paired chamber over the saline-paired chamber (positive preference score). This method produced an inverted U-shaped dose response curve

(Figure 3.2) in all control lines (wild type, cre-only control and lox-only control) with a significant increase in preference for the nicotine-paired chamber at 0.065mg/kg i.p. nicotine (F (3,169)=5.04 p=0.0023). This change in preference score was not seen in either α4-DA or α4-null mice at any dose tested, indicating that they did not develop preference (F (4,169)=2.55 p=0.0410). In the work presented here, selective deletion of α4 subunits from dopaminergic neurons abolished nicotine CPP.

Analysis of this new mutant mouse provides direct evidence that dopaminergic

α4*-nAChRs are necessary for nicotine reward. While previous work has suggested that α4*-nAChR-induced changes in GABAergic tone by desensitization were

61 essential for nicotine reward (Wooltorton et al., 2003), this current work clearly demonstrates the requirement for nAChRs on dopaminergic neurons as α4 subunit expression in GABAergic neurons remained intact. This does not, however, eliminate the possibility that α4*-nAChRs on other neuronal populations, or other receptors on dopaminergic neurons, may play a role in nicotine reward.

COCAINE REWARD

Several other commonalties exist between nicotine and another common drug of abuse, cocaine (Zweifel et al., 2008). Nicotine has been shown to potentiate cocaine cravings in human and blocking nAChRs can block cue induced craving for cocaine

(Horger et al., 1992; Reid et al., 1998; Reid et al., 1999; Zachariou et al., 2001).

Rodent studies have supported this work finding that nicotine increases the self- administration of cocaine as well as facilitates relapse (Horger et al., 1992; Bechtholt and Mark, 2002). This cross interaction may explaining why 75% of cocaine- dependent individuals are also nicotine dependent (Sees and Clark, 1993).

Additionally, blocking nAChRs and genetically deleting β2*-nAChRs has been shown to decrease cocaine CPP at low doses (5mg/kg) (Zachariou et al., 2001).

Mecamylamine, a nAChR antagonist, has also been shown to dose-dependently decrease cocaine self-administration (Levin et al., 2000). Also interesting, blocking of both α7*- and α4β2*-nAChRs can increase the cocaine stimulated dopamine release as well as cocaine sensitization while neither can alone (Zanetti et al., 2006). Further work found that blocking either α4β2*-nAChRs or α7*-nAChRs within the VTA

62 increases cocaine induce dopamine release however co-administration had no effect

(Zanetti et al., 2007). Cocaine has been shown to function as an allosteric inhibitor of

α4β2*-nAChRs which may be a component of cocaine actions in the brain (Francis et al., 2000). Additionally, elegant work has recently shown that blocking cholinergic interneurons within the NAc during cocaine CPP training decreases the preference, while inhibition of cholinergic neurons during saline training does not alter preference

(Witten et al., 2010). This previous work suggests an endogenous role for nAChRs in cocaine preference and indicates that this may be medicated within the nAC.

The commonality of dopaminergic circuitry mediating reward for all drugs of abuse including cocaine and nicotine (Di Chiara and Imperato, 1988; Dani and

Heinemann, 1996; Nestler, 2005) and our finding that α4*-nAChRs are necessary for nicotine CPP led us to examine the role of α4*-nAChRs in cocaine preference. The same method of CPP was used to investigate if α4*-nAChRs modulate reinforcement for cocaine. Again, mice did not develop a consistent preference for either side when saline was administered, however all control lines as well as α4-DA and α4-null developed cocaine place preference (Figure 3.3), indicated by a treatment effect

(F(2,116)= 22.01, p < 0.0001) but lack of a genotype effect (F(4,116) =0.26, p =

0.9043). Indicating that loss of the α4 subunit globally or selectivity in dopaminergic neurons did not prevent acquisition of cocaine preference.

Our data demonstrate that while α4*-nAChRs on dopaminergic neurons are necessary for nicotine reward; they are not required for cocaine CPP. This suggests

63 that while dopaminergic neurons are considered a final common pathway for all drugs of abuse, α4*-nAChRs on dopaminergic neurons are uniquely important for nicotine reward, rather than for the reward system in general. Since previous work has implicated nAChRs, in drug preference (Bechara and van der Kooy, 1989; Zachariou et al., 2001), this does not exclude that non-α4*-nAChRs may be involved in cocaine reward, but does confirm that at commonly examined doses for cocaine CPP, α4*- nAChRs are not necessary for cocaine preference.

DISCUSSION

While this work serves to advance our understanding of nicotine reward, there still remain several issues that we were not able to address. First, there are multiple populations of dopaminergic neurons and our mutant mouse has a deletion of the α4 subunit in all of them. Based on the previous pharmacological work, we suspect that the dopaminergic necessity of α4*-nAChRs is specific to the VTA, however the development of viruses with greater specificity, probably utilizing short cell specific promoters instead of the ubiquitous promoters used in previous studies are necessary to confirm this assumption. That said the evidence using these constitutively active promoters in global knockout mice have suggested the sufficiency of α4*-nAChRs within the VTA (Pons et al., 2008). Additionally, recent work found that mice lacking

α4*-nAChR lack nicotine self administration into the VTA (Exley et al., 2011) further supporting a necessary roll for α4*-nAChRs within the VTA. Secondly, α4*-nAChRs localize to several neuronal regions and have variable effects. As discussed in the

64 introduction, nAChRs produce local depolarization, which includes an increase in Ca++ into the neuron. Tremendous work has identified multiple cellular processes that are altered by fluctuations in neuronal Ca++ levels. As a specific example of the complexity resulting from nAChR expression, activation of presynaptic nAChRs can induce dopamine release, while activation of somatic nAChRs may not directly increase dopamine release and alternatively activate intracellular messaging systems.

In addition to confirming specific populations of dopaminergic neurons necessary for nicotine reward, further work should isolate the role of α4*-nAChRs within the VTA from their roles in various projection regions such as the NAc. While recent work has begun differentiating the role of terminal from somato-dendtic α4*-nAChRs using

α4α6 – null mice, this work also lacks cellular specificity (Exley et al., 2011).

Understanding that limitation, considering this work with the previous pharmacological work injecting α4β2*-nAChR antagonists into the VTA, suggests that the necessity for α4*-nAChR function is within the VTA and not in the projection regions.

Considering these limitations, we have developed a theory for the role of α4- nAChRs on dopaminergic neurons. We suspect that nicotine activation of α4*- nAChRs on dopaminergic neurons in concert with synaptic release of glutamate is necessary to induce NMDA dependent plasticity of glutamate-dopamine synapses.

The mechanism of activation of glutamate synapses does not require a specific nAChR subtype and may not involve direct nicotine activation of glutamatergic terminals. It is possible that endogenous activation of these glutamatergic terminals in concert with

65 nicotine activating α4*-nAChRs on dopaminergic neurons strengthens synapses related to contextual cues. This may be the mechanism by which nicotine use can increase incentive value of contextual cues. It is of note that the method we chose to use requires contextual association with nicotine. In human smokers, long after nicotine consumption has ended, people addicted to nicotine have recurrent urges to smoke typically in association with smoking-related cues, which can include specific moods, situations or environmental factors. Typically it is these cues that maintain the desire to smoke as well as trigger relapse. It is possible that this is the mechanism that leads to the strong cross association. It is also interesting that this mechanism specifically requires nicotine activation of α4*-nAChRs as in our studies α4*- nAChRs are not necessary for cocaine place preference. Previous work has been unclear about the role of NMDA receptors on dopamine neurons as one group found that cocaine place preference does not require NMDA receptors on dopamine neurons

(Engblom et al., 2008) although another group found it was necessary (Zweifel et al.,

2008) at the same dose of 10mg/kg cocaine. Additionally evidence supports a role for nAChRs within the NAc as involved in cocaine reward (Witten et al., 2010). We hypothesize that this mechanism of associating cue and drug is unique to nicotine and that cocaine functions by a different mechanism.

METHODS

Conditioned Place Preference: A three-chamber conditioning apparatus was used; two conditioning chambers (16.8 cm x 12.7cm) with different wall colors and flooring were separated by a smaller neutral chamber (7.2 cm x 12.7 cm) with retractable doors. An adaptation of previously published protocols was used (Grabus et al., 2006; Brunzell et al., 2009). For the pre-training day, animals received a saline injection (i.p.) and were placed in the center neutral chamber for a 5-minute habituation period. The doors to the conditioning chambers were then opened and the animal was allowed to freely explore all three chambers for 15 minutes. The animals

(n=8-13/genotype/dose) had 6 training sessions in which they were injected with drug

(nicotine: 0, 0.04, 0.065, 0.09 mg/kg; or cocaine: 0, 20 mg/kg [drugs dissolved in sterile isotonic saline, injection volume ~0.01 mL/g body weight]) or saline and introduced to one of the conditioning chambers. The same animal was later (5 hours for nicotine CPP; 24 hours for cocaine CPP) injected with the opposite treatment (drug or saline) and introduced to the other chamber. Drug- and saline-paired sides were randomly assigned before testing. Any animal that spent 70% or more time in one chamber or 20% more time in either drug-paired chamber on pretraining day was excluded from the study. The preference score was calculated by the difference in times spent in the drug and saline paired chambers on the testing day compared to the pre-training day.

This chapter includes portions submitted for publication in the Journal of

Neuroscience from the following publication. McGranahan, T.M., Patzlaff, N.E.,

Grady, S.R., Heinemann, S.F., & Booker, T.K. alpha4beta2 nicotinic acetylcholine receptors on dopaminergic neurons mediate nicotine reward and anxiety relief.

Figure 3.1 Conditioned place prefernce methods

Figure 3.2. α4-containing nAChRs on dopaminergic neurons mediate nicotine reward. Nicotine elicited significant place preference at 0.065 mg/kg, i.p. in all 3 control groups (wildtype, cre-only control and lox-only control). Neither the α4-null mice nor the α4-DA mice developed a preference for the nicotine-paired side over a wide range of doses (0.04, 0.065, 0.09 mg/kg). ** p = 0.01n=8-13 mice/dose/genotype

Figure 3.3. α4-containing nAChRs on dopaminergic neurons do not mediate cocaine reward. Cocaine elicited significant place preference at 20 mg/kg, i.p. in all 3 control groups (wildtype, cre-only control and lox-only control) and in α4-null mice and the α4-DA mice. n=6-13 mice/dose/genotype

CHAPTER V

The Role of α4*-nAChRs

in Anxiety

70 71

INTRODUCTION

Anxiety and nicotine consumption have been widely recognized to be interrelated. Smokers frequently report anxiety relief as a key reason for continued smoking and relapse from abstinence (Pomerleau, 1986; Gilbert et al., 1989). In addition to this self-reporting, epidemiological (McKee et al., 2003), animal (Baer and

Lichtenstein, 1988), human laboratory (Payne et al., 1991; McKee et al., 2011) and treatment studies (Baer et al., 1989; Buczek et al., 1999) have all found stress to be a primary mechanism involved in the maintenance of and relapse to smoking.

Additionally, people with panic disorders smoke more than the general population

(Ziedonis et al., 2008). Human and animal studies have identified that nicotine can both increase and decrease anxiety generating the typical inverted U-shaped dose response curve seen with other nicotine behaviors (Pomerleau, 1986; Brioni et al.,

1993). While, human smokers identify the decrease in anxiety as a reason for continued use, isolating the anxiolytic effects of nicotine experimentally has been challenging and indicate that the route of administration as well as behavioral state of experimental subject impact the ability of nicotine to be anxiolytic. Additionally, there are several tests to examine anxiety in rodents that are suggested to model different anxiety disorders and have been used to identify the anxiolytic and anxiogenic effects of nicotine. These studies have great variability in protocol such as different time courses, baseline anxiety state and strain difference. We chose to use the elevated plus maze however an introduction to the other tests and results, should expand understanding.

The three most common anxiety tests in rodents are social interaction, mirrored chamber and elevated plus maze. The social interaction test is thought to model generalized anxiety disorder. Using this test, a dose response curve was generated identifying both anxiolytic as well as anxiogenic effects of nicotine. Interestingly, at a single dose (0.01 mg/kg), the time course for this test also presented an inverted U- shaped dose response curve with five minute post injection and 60 minute post injection being anxiogenic, however 30 minutes post injection being anxiolytic (File et al., 1998; Irvine et al., 1999). Further work indicated that local infusions of nicotine into the dorsal hippocampus or lateral septum were anxiogenic suggesting that these brain regions are involved in the anxiogenic limb of this behavior (File et al., 1998;

Cheeta et al., 2000). Complicating understanding, other work found that infusions of nicotine into the dorsal rafe nucleus produced both anxiolytic and anxiogenic responses (Cheeta et al., 2001). A related anxiety test, mirrored chamber, also produced an inverted U-shaped does curve producing both anxiolytic and anxiogenic effects of nicotine (Cao et al., 1993). These studies have supported anxiolytic and anxiogenic effects of nicotine.

The anxiety test we chose to use, elevated plus maze (EPM), may model panic disorders as well as generalized anxiety disorders. EPM has been more challenging to produce anxiolytic responses to nicotine in acute settings in mice. Previous groups have examined a large range of doses on the elevated plus maze 30 minutes after injection and were only able to elicit anxiogenic effects at higher doses of nicotine

(Ouagazzal et al., 1999). Additionally this group locally infused nicotine into the

73 dorsal hippocampus and found no effects. O’Neill and colleagues were able to produce anxiolytic effects in mice that were reversible with benzodiazepines suggesting

GABAergic mechanisms (Brioni et al., 1993; O'Neill and Brioni, 1994). Previous work has implicated several regions in anxiety and confirmed what smokers have reported for years, that smoking and stress are closely related.

Pharmacological interventions have advanced this work to implicate various neurotransmitter systems in the anxiolytic and anxiogenic effects of nicotine. Agonists with high affinity for α4β2*-nAChRs have been shown to have similar anxiolytic effects to nicotine suggesting that the nicotine is mediating its anxiolytic effects through these high affinity receptors (Decker et al., 1994). Interestingly, the anxiolytic response to nicotine appears to be highly conserved as a group recently was able to examine anxiolytic effects in zebrafish that were reversible by nicotine antagonists

MLA and DHβE (Levin et al., 2007). The anxiogenic effects of nicotine in the dorsal

hippocampus were reverse by blocking 5HT1a receptors suggesting nicotine’s effects within the dorsal hippocampus are partially mediated by serotonin (File et al., 1998;

Olausson et al., 2001). Additionally, the anxiolytic effects of chronic nicotine in EPM were reverse by the serotonin reuptake inhibitor citalopram (Olausson et al., 1999;

Olausson et al., 2001). In addition to the serotonin system, the GABAergic system has been indicated both by clinical use of benzodiazepines to treat anxiety as well as animal studies with nicotine included changes in anxiety (O'Neill and Brioni, 1994;

Irvine et al., 2001). This work suggests that the anxiolytic effects are produced by

74 enhanced release of neurotransmitters serotonin and/or GABA. No previous work has looked at the effects of nicotine on dopamine release to our knowledge.

Although not studied pharmacologically, previous work has implicated dopaminergic neurons in stress behaviors (George et al., 2000a; 2000b). George and colleagues identified that acute and chronic stress in the form of a foot shock increased dopamine release preferentially in the medial prefrontal cortex (mPFC). While acute nicotine was unable to reverse this stress induced dopamine release, chronic nicotine could significantly reduce dopamine release. Interestingly, co-treatment with naloxone, a opiate receptor antagonist, while alone had no effect on the stress induce dopamine release, did attenuate the effects of chronic nicotine suggesting that nicotine’s effects were mediated by opioid receptors. Recently work has shown that stress, in the form of social defeat, increases the phasic firing of dopamine neurons for as long as 10 days (Razzoli et al., 2011). Additionally acute stress has been shown to induce synaptic plasticity in the VTA indicated by an increase in the AMPA/NMDA ratio just as seen with acute nicotine exposure (Saal et al., 2003). Having a strong relationship between nicotine consumption and stress, previous work sought to examine the role of nAChRs in anxiety. While many pharmacological studies have been conducted on nicotine’s effects on anxiety, they have not been conducted in mutant mice. Studies using mice with genetic mutations have found roles for several nAChRs in basal anxiety. Mice lacking α4*-nAChRs have increased basal anxiety as do mice with hypersensitive α4*-nAChRs (Ross et al., 2000; Labarca et al., 2001).

Alternatively mice lacking β4*-nAChRs and β3*-nAChRs have decreased anxiety on

75 the elevated plus maze (Salas et al., 2004; Booker et al., 2007). Both β4*-nAChRs and β3*-nAChRs are expressed in dopaminergic neurons and α4β4*-nAChRs have been characterized to have higher amplitude and slower desensitization than α4β2*- nAChRs (Wu et al., 2006). Unfortunately previous work has not examined the anxiolytic effects of nicotine on these mice, possibly due to the difficulty in identifying anxiolytic doses.

BASAL ANXIETY

The elevated plus maze was used to examine basal anxiety changes in response to acute injections of nicotine. In this paradigm, there are four equally sized arms; two are gray, enclosed arms, so less anxiogenic than the two open arms, which have no encasement and are brighter. The number of times the mouse is willing to enter the more anxiogenic open arms and the amount of time spent in the open arms are interpreted as decreased anxiety.

In examining basal anxiety, we found no statistically significant difference in number of entries (F(4,27) = 2,267, p=0.0893) or time spent (F(4,27)=2.638, p=0.0558) on the open arm between all five genotypes (Figure 4.1). Additionally, we found no difference in locomotor activity as measure by total entries into both open and closed arms (F(4,27)=0.6790, p=0.6125). While previous work found an increase in basal anxiety in α4-null mutant mice on elevated plus maze (Ross et al., 2000), this was not detected in our line of mice. As these mutations are very similar, we suspect that the different findings are due to the higher level of basal anxiety in our facility.

Previous studies have found that mice in our facility have lower numbers of entries and time of entries that the same strain tested elsewhere. Alternatively, this is may be a result the degree of back crossing or other unidentified cause. Our null finding however are interesting it relation to studies of hypersensitive α4*-nAChRs that find a higher level of basal anxiety (Labarca et al., 2001), and may suggest that increased

α4*-nAChR stimulation decreases anxiety in mice. This work does provide for us an expectation that there is not a significant basal anxiety difference among these mice that may influence other testing.

ANXIOLYTIC EFFECTS OF NICOTINE

Having examined basal anxiety in these animals, we again used the same measure of time and entries into open arm as measures of anxiety. We observed an inverted U-shaped does response curve in control animals (wild type, cre-only control and lox-only control) where low doses of nicotine elicited an anxiolytic response, demonstrated by increases in the time spent (Figure 4.2A) and the number of entries into the open arm (Figure 4.2B) of the elevated plus maze (Time: F(5,208)=5.75, p<0.0001; Entries F(5,208)=4.35 p=0.0009). We found that the α4-null mice, unlike control mice, were insensitive to the anxiolytic effects of nicotine over these doses and did not increase the amount of time or entries into the open arm (Time: F(4,208)=3.45, p=0.0093; Entries: F(4,208)=3.56, p=0.0078). The α4-DA mice were also insensitive to nicotine at 0.01mg/kg dose (Bonferroni p<0.05). Though α4-DA mice tended to increase the amount of time spent on the open arm at the 0.05mg/kg nicotine dose, this

77 point was not statistically different from α4-null mice or controls. As a measure of general activity, the total number of entries into closed and open arms was also evaluated. A genotype (strain) difference in activity was detected, with cre-only control mice showing increased activity as measured by more total entries than other groups of mice (F(4,208)= 7.89, p<0.0001), however this was not an effect of nicotine

(F(5,208) = 1.28, p = 0.2753).

DISCUSSION

In this study, we identified a range of nicotine doses that decrease anxiety on the elevated plus maze in control mice. After developing this method, we were able to demonstrate that α4*-nAChRs are necessary for this response, as mice lacking α4

(α4-null) did not increase the time spent on the open (stressful) arm of the maze when given nicotine. We found that mice specifically lacking α4*-nAChRs in dopaminergic neurons had decreased sensitivity to nicotine, suggesting that α4*-nAChRs are necessary for the anxiolytic effects of nicotine, and that dopaminergic neurons are a component of the circuitry needed for this response. The lack of difference in total entries confirmed that the decreased sensitivity to the anxiolytic effects of nicotine in the elevated plus maze could not be attributed to changes in locomotor activity.

Previous work has implicated many brain regions in the anxiolytic effects of nicotine, including the dorsal hippocampus and the septum (Cheeta et al., 2000); however, this is the first work to delete α4*-nAChRs only in dopaminergic neurons and identify that they are involved in the anxiolytic effects of nicotine.

METHODS

Elevated Plus Maze: The elevated plus maze consists of two open arms (30 ×

5 cm) and two closed arms (30 × 5 cm) constructed of gray Plexiglas that extend from a center platform. The closed arms have sides of gray Plexiglas (15 cm tall). The entire apparatus is mounted 33 cm above the surface of the floor.

For naïve testing, animals were never handled prior to testing other than standard weekly cage changes. The day prior to testing animal’s tails were marked to avoid scuffing of animals on test day. Testing began with the animal placed in a cylindrical tube (5 cm diameter, 15 cm tall) in the center of the maze for 2 minutes. At the conclusion of 2 minutes, the tube was lifted and the animal was allowed to explore the maze for 10 minutes. Noldus video tracking was used as described below.

To examine nicotine effects on anxiety a separate group of animals who had never been handled other than standard weekly cage changing were used. Each test began by injecting the animal (n = 7-12/genotype/dose) with the appropriate dose of nicotine (0, 0.0055, 0.01, 0.05, 0.1, 0.15 mg/kg/i.p) and placed in a holding cage for

10 minutes. After the 10 minute holding period, the animal was placed in a cylindrical starting tube (5 cm diameter, 15 cm tall) in the center of the maze for 2 minutes. The tube was removed and the subjects were observed on the maze for 10 minutes using the Noldus video tracking system, subjects were scored for the amount of time spent and the number of entries into the open and closed arms. Total number of entries into the closed and open arms was combined as an assessment of activity.

This chapter includes portions submitted for publication in the Journal of

Neuroscience from the following publication. McGranahan, T.M., Patzlaff, N.E.,

Grady, S.R., Heinemann, S.F., & Booker, T.K. alpha4beta2 nicotinic acetylcholine receptors on dopaminergic neurons mediate nicotine reward and anxiety relief.

Figure 4.1 Basal anxiety. Removal of α4 from dopaminergic neurons does not alter basal anxiety as there is no difference in time spent in open arm, entries into the open. n=4-10mice/genotype

A. 60 Control: Wildtype * Control: Cre only # Control: Lox only !4-null !4-DA 40

20 Time in open arm (seconds) 0 0.01 0.05 0.1 0.15 B. Nicotine (mg/kg, i.p) 20

15 *

5 Entries in open arm

0 0.01 0.05 0.1 0.15 Nicotine (mg/kg, i.p)

C. 80

60 **

40 Total entries 20

0 0.01 0.05 0.1 0.15 Nicotine (mg/kg, i.p)

Figure 4.2. α4-containing nAChRs on dopaminergic neurons partially mediate the anxiolytic effects of nicotine. 0.01 mg/kg nicotine significantly decreased the anxiety in all 3 control groups (wildtype, cre-only control, lox-only control) as measured by increased time (A) and entries (B) to the open arm. α4-null mice did not show a change in anxiety as measured by time in open arm (* p<0.05). α4-DA mice showed a decreased sensitivity to nicotine as they spent significantly less time in the open arm (#p<0.05) than control mice. There were no differences between wildtype control, lox-only control, α4-null and α4-DA mice in activity, however cre-only control mice showed increased activity (**p<0.01). Data scaled as square root of dose. n=7-12mice/dose/genotype.

CHAPTER V

Conclusions and Future Directions

81 82

CONCLUSIONS

Ralph Waldo Emerson once said, “the believing we do something when we do nothing is the first illusion of tobacco.” In reality tobacco, nicotine more specifically, does many things; it alters mood, sensory processing, heart rate, hormone levels and cognition. In 1851, Clause Bernard found that nicotine stimulated muscle fibers.

Subsequently nicotine was found to stimulate and bind in many tissues across the body, most notably the brain (O'Brien et al., 1979; Marks et al., 1983). Further genetic work identified a broad family of receptors as the primary binding site of nicotine, the nicotinic acetylcholine receptors (nAChRs) (Boulter et al., 1986; Miwa et al., 2011).

These receptors were found to be pentameric combinations of various subunits, and a major subtype in the brain, α4β2*nAChRs, were found to be widely expressed. The complex array of actions nicotine produces is presumably due to the diversity of nAChRs which may make nicotine dependence the most complex of all addictions.

Through this long history of study, knowledge of nAChRs has been advanced by many technological improvements. Great advances have been made in understanding nicotine binding, nAChR stoichiometry, nAChR signaling, nicotine behaviors and nicotine metabolism. Our work has aimed to make another leap forward to understand the impact of deletion of a particular nicotinic subunit, α4, from a particular neuronal population, dopamine neurons. Having produced this specific alteration in nAChR expression, we were able to examine sensitivity to many nicotine behaviors with hopes that understanding the biochemistry behind nicotine-related

83 behaviors may provide insight into novel therapies and molecular targets for treating nicotine dependence.

We engineered mice with a deletion of the α4*-nAChRs subunit only in dopaminergic neurons (α4-DA) and extensively characterized them to confirm the deletion was specific. We confirmed that in the α4-DA mice, expression of α4 mRNA and protein was eliminated selectively in dopaminergic neurons, as measured by in situ hybridization, high-affinity 125I-epibatidine binding, and co-localization of mRNA with TH and GAD67. We decided to collaborate with a group that has unique expertise in functionally examining nAChRs and they confirmed a specific loss of all function of α4*-nAChRs at dopaminergic terminals, and preservation at GABAergic terminals. Additionally, this group was able to examine non-α4*-nAChRs and found that while α4-DA mice lacked α4*-nAChR function, they had preserved non-α4*- nAChR function, including α6*-nAChR, which forms pentamers both with and without the α4 subunit.

Having confirmed visually as well as functionally that our α4-DA mouse specifically lacked α4*-nAChRs in dopamine neurons, we confirmed that there were no significant impairments in memory or locomotor function. We used standard delay fear conditioning to examine context and cue based learning and found no significant impairment in memory in α4-DA mice or α4-null mice. To examine locomotor activity, we introduced mice of all five genotypes into a novel environment and observed rate, distance and frequency of movement. We found no locomotor impairment in any of our five genotypes. Careful examination of this data revealed

α4-DA mice had a mild impairment in habituation to a novel environment. Previous work has found similar phenotypes in mice with impaired dopamine transporter function (Zhuang et al., 2001; Young et al., 2010). Our method to specifically deliver

Cre to dopamine neurons may alter dopamine transporter function as suggested by

(Backman et al., 2006). Additionally, deletion of α4*-nAChRs has also been found to impair dopamine transporter function (Parish et al., 2005). We suspect that a decreases in dopamine transporter function is responsible for the decreased habituation, however it is also possible that impaired α4*-nAChR signaling impairs habituation to a novel environment. As the α4-null mutant mice do not have this habituation impairment, this suggests either a compensation in the α4-null mutant mice or a specific interruption in circuitry by the deletion of α4*-nAChRs from dopaminergic neurons. While this finding is interesting, we do not expect this alteration in habituation to impact our studies because all of our behaviors are evaluated within a short time window where no difference was seen by genotype. Additionally, α4-DA did not differ from cre-only mice until after 120 minutes and α4-null and α4-DA mice were compared not just to wild type mice but also to cre-only control and lox-only control in all testing.

Examination of memory and locomotion function serves as a baseline to ensure that our subsequent studies of nicotine behaviors are not influenced by major deficits in these mice.

Prior to evaluating behaviors that have central functions in nicotine dependence, we evaluated full dose response curves in two easily quantifiable nicotine behaviors: locomotor depression and hypothermia. Other groups have previously

85 identified that α4-null mice have decreased sensitivity to the locomotor depressing effects of nicotine (Ross et al., 2000), which we confirmed with our α4-null mice.

Interestingly, elimination of α4*-nAChRs only from dopaminergic neurons increased the sensitivity to nicotine induced locomotor depression. We proposed that in wild type mice, nicotine functions equally on GABA and dopamine neurons within the

VTA and that at high concentrations, nicotine impairs locomotion partially through inhibition of dopamine neurons. With the removal of α4*-nAChRs specifically from dopaminergic neurons, at concentrations above 0.5 mg/kg nicotine, nicotine stimulates

GABA neurons to inhibit dopaminergic neurons and impair locomotor activity. This alteration in the balance between nicotine stimulation of α4*-nAChRs on dopaminergic neurons versus GABAergic neurons, leads to an increase in inhibitory tone and thus an increased sensitivity to the locomotor depressing effects of nicotine.

It is important to acknowledge that there is no altered locomotor activity at the doses used for reward or anxiety studies.

In addition to examining a behavior that we thought might be influenced by dopaminergic α4*-nAChRs, we also wanted to examine a behavior which was not expected to be altered by dopaminergic deletion of α4*-nAChRs, nicotine-induced hypothermia. Null mutant mice lacking β2*-nAChRs have decreased sensitivity to nicotine-induced hypothermia, suggesting that activation of α4β2*-nAChRs are central to this behavior (Tritto et al., 2004). We found that α4-null mice also have decreased sensitivity to nicotine-induced hypothermia, however dopaminergic α4*- nAChRs do not influence this behavior. This study served to confirm that α4β2*-

86 nAChRs are necessary for the initial sensitivity to nicotine induced hypothermia, however α4*-nAChRs on dopaminergic neurons are not necessary for this behavior.

Having evaluated basal conditions and constructed nicotine dose response curves in two different behavioral tests, we were prepared to test our hypothesis that

α4*-nAChRs on dopaminergic neurons are necessary for nicotine reward. Earlier studies examined self-administration behaviors in mice with global deletions of nAChR subunits, and more regional approaches using viral reintroduction of nAChRs into mice with global deletions implicated α4*-nAChRs in nicotine reinforcement

(Pons et al., 2008). In the work presented here, selective deletion of α4 subunits from dopaminergic neurons abolished nicotine CPP. This new mutant mouse provides direct evidence that dopaminergic α4*-nAChRs are necessary for nicotine reward.

Our finding is in opposition to previous theories in the field that suggested that

α4*-nAChR-induced changes in GABAergic tone by desensitization mediate nicotine reward (Wooltorton et al., 2003; Pidoplichko et al., 2004; Mansvelder et al., 2009).

Our work clearly demonstrates the necessity of nAChRs on dopaminergic neurons as

α4 subunit expression and function was confirmed in GABAergic neurons. This work does not eliminate the possibility that α4*-nAChRs on GABA or other neuronal populations have a role in nicotine reward and further work is needed to evaluate this possibility. This work in combination with the finding that deletion of NMDA receptors from dopaminergic neurons impairs nicotine reward (Wang et al., 2010), may support the hypothesis that glutamate-driven burst firing of dopamine neurons in concert with nicotine activation of dopamine neurons is necessary for nicotine reward

(Mansvelder et al., 2002; Mansvelder et al., 2009). Further work is required to identify if α4*-nAChRs on dopaminergic neurons are involved in this plasticity, or are essential for another mechanism involved in nicotine preference.

Having identified the necessity of α4*-nAChRs on dopamine neurons in nicotine reward, we wanted to examine if they were necessary for another common drug of abuse, cocaine. Previous groups have found that blocking nAChRs pharmacologically or using β2-null mice impairs cocaine CPP at low doses only

(Zachariou et al., 2001). This work suggests an endogenous role for nAChRs in cocaine preference and combined with the commonality of dopaminergic circuitry mediating reward for all drugs of abuse (Di Chiara and Imperato, 1988; Dani and

Heinemann, 1996; Nestler, 2005), we thought that α4*-nAChRs on dopaminergic neurons might be necessary for rewarding properties of low dose cocaine. Our data demonstrate that while α4*-nAChRs on dopaminergic neurons are necessary for nicotine reinforcement; they are not required for cocaine CPP. This suggests that while dopaminergic neurons are considered a final common pathway for all drugs of abuse,

α4*-nAChRs on dopaminergic neurons are uniquely important for nicotine reinforcement, rather than for the reward system in general. Additionally, as previous work has implicated nAChRs in drug preference (Bechara and van der Kooy, 1989;

Zachariou et al., 2001), this does not exclude that non-α4*-nAChRs may be involved in low dose cocaine reward, but does confirm that α4*-nAChRs are not necessary for cocaine CPP.

Having confirmed our hypothesis that α4*-nAChRs are uniquely necessary for nicotine reward, we also examined if α4*-nAChRs are involved in another key feature of nicotine dependence, anxiety changes. Smokers report anxiety relief as a key reason for continued smoking and relapse from abstinence (Pomerleau, 1986; Gilbert et al.,

1989). Additionally, people with panic disorders have higher rates of smoking than general population (Ziedonis et al., 2008). Previous pharmacological studies have implicated nAChRs in mediating the anxiolytic effects of nicotine (Brioni et al., 1993) and mutations in α4*-nAChRs result in alterations of basal anxiety in animals (Ross et al., 2000; Labarca et al., 2001). Additionally, previous work has implicated dopaminergic neurons in stress behaviors (George et al., 2000a; 2000b). In this study, we identified a range of nicotine doses that decrease anxiety on the elevated plus maze in control mice. After developing this method, we were able to demonstrate that α4*- nAChRs are necessary for this response, as mice lacking α4 (α4-null) did not increase the time spent on the open (stressful) arm of the maze when given nicotine. We found that mice specifically lacking α4*-nAChRs in dopaminergic neurons had decreased sensitivity to nicotine, suggesting that α4*-nAChRs are necessary for the anxiolytic effects of nicotine, and that dopaminergic neurons are a component of the circuitry needed for this response. The lack of difference in total entries confirmed that the decreased sensitivity to the anxiolytic effects of nicotine in the elevated plus maze could not be attributed to changes in locomotor activity. Previous work has implicated many brain regions in the anxiolytic effects of nicotine, including the dorsal hippocampus and the septum (Cheeta et al., 2000). This is the first work to examine

89 the anxiolytic effects of nicotine in a mouse lacking a nAChR subunit and demonstrates that α4*-nAChRs are necessary for this action, as previous pharmacological studies had suggested. Additionally, this is the first work to merge evidence indicating a critical role of dopamine in stress responses with the anxiolytic effects of nicotine. While observational studies have found a correlation between dopamine and stress, this work demonstrates that nAChRs specifically on dopaminergic neurons are involved in the sensitivity to the anxiolytic effects of nicotine. This combined with our findings on nicotine reward are the first to suggests a shared mechanism between nicotine reward and nicotine induced reduction in anxiety.

While clinically these features have been recognized as central to maintaining nicotine consumption, this is the first work to suggest that a single cell population is involved in both and with further study may elucidate a novel molecular target to treat nicotine dependence.

Here we report that dopaminergic α4*-nAChRs are involved in nicotine CPP, anxiety reduction, and locomotor suppression, however dopaminergic α4*-nAChRs are not involved in cocaine CPP or nicotine-induced hypothermia. To our knowledge, this is the first mouse with a deletion of a nAChR subunit within a single neuronal population that identifies the role of a specific nAChR subtype in nicotine behaviors.

Identification of the subunit composition of the nAChRs in the neuronal pathway uniquely necessary for two key features of nicotine dependence, reward and anxiety, may provide an extraordinary opportunity to understand the circuitry and biochemistry that lead to nicotine dependence. While further studies are needed to

90 examine the role of α4*-nAChRs in other nicotine dependence-related behaviors such as tolerance to and withdrawal from nicotine, this work implicates dopaminergic α4*- nAChRs in major acute nicotine behaviors. This work also begins to uniquely distinguish neuronal populations involved in α4*-nAChR-mediated nicotine behaviors.

FUTURE DIRECTIONS

We chose to focus on several key nicotine based behaviors, however we examined all of these in the acute or sub-acute settings. Further work to characterize the role of α4*-nAChRs in nicotine withdrawal and relapse will provide additional insight into the role of these receptors on dopamine neurons. In parallel with these studies, examination of the role of these receptors in tolerance to chronic nicotine as well as nicotine-induced upregulation would complete understanding of the role of these receptors in nicotine behaviors. Additionally, our theory suggests that removal of

α4*-nAChRs from dopamine neurons alters synaptic plasticity. While we were unable to confirm this theory, examination of nicotine and stress induced alterations in synaptic plasticity in addition to general characterization of electrophysiological changes resulting from the removal of α4*-nAChRs from dopaminergic neurons are necessary to fully evaluate these studies. Other studies have been suggested such as alterations in sleep wake cycle, the role of α4*-nAChRs in natural rewards and the role of α4*-nAChRs in the selective vulnerability of dopamine neurons. We hope that having made and characterized this mouse, other groups will choose to acquire it and further examine it.

REFERENCES

Acquas, E., Carboni, E., Leone, P. and Di Chiara, G. (1989) 'SCH 23390 blocks drug- conditioned place-preference and place-aversion: anhedonia (lack of reward) or apathy (lack of motivation) after dopamine-receptor blockade?', Psychopharmacology (Berl) 99(2): 151-5.

Albuquerque, E. X., Pereira, E. F., Alkondon, M. and Rogers, S. W. (2009) 'Mammalian nicotinic acetylcholine receptors: from structure to function', Physiol Rev 89(1): 73-120.

Anagnostaras, S. G., Maren, S., Sage, J. R., Goodrich, S. and Fanselow, M. S. (1999) 'Scopolamine and Pavlovian fear conditioning in rats: dose-effect analysis', Neuropsychopharmacology 21(6): 731-44.

Avale, M. E., Faure, P., Pons, S., Robledo, P., Deltheil, T., David, D. J., Gardier, A. M., Maldonado, R., Granon, S., Changeux, J. P. et al. (2008) 'Interplay of beta2* nicotinic receptors and dopamine pathways in the control of spontaneous locomotion', Proc Natl Acad Sci U S A 105(41): 15991-6.

Backman, C. M., Malik, N., Zhang, Y., Shan, L., Grinberg, A., Hoffer, B. J., Westphal, H. and Tomac, A. C. (2006) 'Characterization of a mouse strain expressing Cre recombinase from the 3' untranslated region of the dopamine transporter locus', Genesis 44(8): 383-90.

Baer, J. S., Kamarck, T., Lichtenstein, E. and Ransom, C. C., Jr. (1989) 'Prediction of smoking relapse: analyses of temptations and transgressions after initial cessation', J Consult Clin Psychol 57(5): 623-7.

Baer, J. S. and Lichtenstein, E. (1988) 'Classification and prediction of smoking relapse episodes: an exploration of individual differences', J Consult Clin Psychol 56(1): 104-10.

Barr, R. S., Pizzagalli, D. A., Culhane, M. A., Goff, D. C. and Evins, A. E. (2008) 'A single dose of nicotine enhances reward responsiveness in nonsmokers: implications for development of dependence', Biol Psychiatry 63(11): 1061-5.

91 92

Barrett, S. P., Boileau, I., Okker, J., Pihl, R. O. and Dagher, A. (2004) 'The hedonic response to cigarette smoking is proportional to dopamine release in the human striatum as measured by positron emission tomography and [11C]raclopride', Synapse 54(2): 65-71.

Bauco, P. and Wise, R. A. (1994) 'Potentiation of lateral hypothalamic and midline mesencephalic brain stimulation reinforcement by nicotine: examination of repeated treatment', J Pharmacol Exp Ther 271(1): 294-301.

Bechara, A. and van der Kooy, D. (1989) 'The tegmental pedunculopontine nucleus: a brain-stem output of the limbic system critical for the conditioned place preferences produced by morphine and amphetamine', J Neurosci 9(10): 3400-9.

Bechtholt, A. J. and Mark, G. P. (2002) 'Enhancement of cocaine-seeking behavior by repeated nicotine exposure in rats', Psychopharmacology (Berl) 162(2): 178-85.

Benowitz, N. L. (1996a) 'Cotinine as a biomarker of environmental tobacco smoke exposure', Epidemiol Rev 18(2): 188-204.

Benowitz, N. L. (1996b) 'Pharmacology of nicotine: addiction and therapeutics', Annu Rev Pharmacol Toxicol 36: 597-613.

Benowitz, N. L. (2010) 'Nicotine addiction', N Engl J Med 362(24): 2295-303.

Benowitz, N. L., Jacob, P., 3rd and Perez-Stable, E. (1996) 'CYP2D6 phenotype and the metabolism of nicotine and cotinine', Pharmacogenetics 6(3): 239-42.

Blaha, C. D., Allen, L. F., Das, S., Inglis, W. L., Latimer, M. P., Vincent, S. R. and Winn, P. (1996) 'Modulation of dopamine efflux in the nucleus accumbens after cholinergic stimulation of the ventral tegmental area in intact, pedunculopontine tegmental nucleus-lesioned, and laterodorsal tegmental nucleus-lesioned rats', J Neurosci 16(2): 714-22.

Bonci, A. and Malenka, R. C. (1999) 'Properties and plasticity of excitatory synapses on dopaminergic and GABAergic cells in the ventral tegmental area', J Neurosci 19(10): 3723-30.

Booker, T. K., Butt, C. M., Wehner, J. M., Heinemann, S. F. and Collins, A. C. (2007) 'Decreased anxiety-like behavior in beta3 nicotinic receptor subunit knockout mice', Pharmacol Biochem Behav 87(1): 146-57.

Boulter, J., Evans, K., Goldman, D., Martin, G., Treco, D., Heinemann, S. and Patrick, J. (1986) 'Isolation of a cDNA clone coding for a possible neural nicotinic acetylcholine receptor alpha-subunit', Nature 319(6052): 368-74.

Breese, C. R., Marks, M. J., Logel, J., Adams, C. E., Sullivan, B., Collins, A. C. and Leonard, S. (1997) 'Effect of smoking history on [3H]nicotine binding in human postmortem brain', J Pharmacol Exp Ther 282(1): 7-13.

Brioni, J. D., O'Neill, A. B., Kim, D. J. and Decker, M. W. (1993) 'Nicotinic receptor agonists exhibit anxiolytic-like effects on the elevated plus-maze test', Eur J Pharmacol 238(1): 1-8.

Brody, A. L., Mandelkern, M. A., Olmstead, R. E., Allen-Martinez, Z., Scheibal, D., Abrams, A. L., Costello, M. R., Farahi, J., Saxena, S., Monterosso, J. et al. (2009) 'Ventral striatal dopamine release in response to smoking a regular vs a denicotinized cigarette', Neuropsychopharmacology 34(2): 282-9.

Brunzell, D. H., Mineur, Y. S., Neve, R. L. and Picciotto, M. R. (2009) 'Nucleus Accumbens CREB Activity is Necessary for Nicotine Conditioned Place Preference', Neuropsychopharmacology 11: 8.

Buczek, Y., Le, A. D., Wang, A., Stewart, J. and Shaham, Y. (1999) 'Stress reinstates nicotine seeking but not sucrose solution seeking in rats', Psychopharmacology (Berl) 144(2): 183-8.

Caldarone, B. J., Duman, C. H. and Picciotto, M. R. (2000) 'Fear conditioning and latent inhibition in mice lacking the high affinity subclass of nicotinic acetylcholine receptors in the brain', Neuropharmacology 39(13): 2779-84.

Cannon, C. M. and Bseikri, M. R. (2004) 'Is dopamine required for natural reward?', Physiol Behav 81(5): 741-8.

Cao, W., Burkholder, T., Wilkins, L. and Collins, A. C. (1993) 'A genetic comparison of behavioral actions of ethanol and nicotine in the mirrored chamber', Pharmacol Biochem Behav 45(4): 803-9.

Carbone, A. L., Moroni, M., Groot-Kormelink, P. J. and Bermudez, I. (2009) 'Pentameric concatenated (alpha4)(2)(beta2)(3) and (alpha4)(3)(beta2)(2) nicotinic acetylcholine receptors: subunit arrangement determines functional expression', Br J Pharmacol 156(6): 970-81.

Carr, D. B. and Sesack, S. R. (2000) 'Projections from the rat prefrontal cortex to the ventral tegmental area: target specificity in the synaptic associations with mesoaccumbens and mesocortical neurons', J Neurosci 20(10): 3864-73.

Castane, A., Soria, G., Ledent, C., Maldonado, R. and Valverde, O. (2006) 'Attenuation of nicotine-induced rewarding effects in A2A knockout mice', Neuropharmacology 51(3): 631-40.

CDC (2008) Smoking-Attributable Mortality, Years of Potential Life Lost, and Productivity Losses—United States, 2000–2004. Morbidity and Mortality Weekly Report [serial online]. vol. 57.

Cheeta, S., Irvine, E. E., Kenny, P. J. and File, S. E. (2001) 'The dorsal raphe nucleus is a crucial structure mediating nicotine's anxiolytic effects and the development of tolerance and withdrawal responses', Psychopharmacology (Berl) 155(1): 78-85.

Cheeta, S., Kenny, P. J. and File, S. E. (2000) 'Hippocampal and septal injections of nicotine and 8-OH-DPAT distinguish among different animal tests of anxiety', Prog Neuropsychopharmacol Biol Psychiatry 24(7): 1053-67.

Clarke, P. B. (1990) 'Dopaminergic mechanisms in the locomotor stimulant effects of nicotine', Biochem Pharmacol 40(7): 1427-32.

Clarke, P. B., Fu, D. S., Jakubovic, A. and Fibiger, H. C. (1988) 'Evidence that mesolimbic dopaminergic activation underlies the locomotor stimulant action of nicotine in rats', J Pharmacol Exp Ther 246(2): 701-8.

Corrigall, W. A. and Coen, K. M. (1991) 'Selective dopamine antagonists reduce nicotine self-administration', Psychopharmacology (Berl) 104(2): 171-6.

Dani, J. A. and Heinemann, S. (1996) 'Molecular and cellular aspects of nicotine abuse', Neuron 16(5): 905-8.

Davis, J. A. and Gould, T. J. (2006) 'The effects of DHBE and MLA on nicotine- induced enhancement of contextual fear conditioning in C57BL/6 mice', Psychopharmacology (Berl) 184(3-4): 345-52.

Decker, M. W., Brioni, J. D., Sullivan, J. P., Buckley, M. J., Radek, R. J., Raszkiewicz, J. L., Kang, C. H., Kim, D. J., Giardina, W. J., Wasicak, J. T. et al. (1994) '(S)-3-methyl-5-(1-methyl-2-pyrrolidinyl)isoxazole (ABT 418): a novel cholinergic ligand with cognition-enhancing and anxiolytic activities: II. In vivo characterization', J Pharmacol Exp Ther 270(1): 319-28.

Descarries, L., Gisiger, V. and Steriade, M. (1997) 'Diffuse transmission by acetylcholine in the CNS', Prog Neurobiol 53(5): 603-25.

Di Chiara, G. and Imperato, A. (1988) 'Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats', Proc Natl Acad Sci U S A 85(14): 5274-8.

Disney, A. A., Aoki, C. and Hawken, M. J. (2007) 'Gain modulation by nicotine in macaque v1', Neuron 56(4): 701-13.

Drago, J., McColl, C. D., Horne, M. K., Finkelstein, D. I. and Ross, S. A. (2003) 'Neuronal nicotinic receptors: insights gained from gene knockout and knockin mutant mice', Cell Mol Life Sci 60(7): 1267-80.

Due, D. L., Huettel, S. A., Hall, W. G. and Rubin, D. C. (2002) 'Activation in mesolimbic and visuospatial neural circuits elicited by smoking cues: evidence from functional magnetic resonance imaging', Am J Psychiatry 159(6): 954-60.

Elliott, K. J., Ellis, S. B., Berckhan, K. J., Urrutia, A., Chavez-Noriega, L. E., Johnson, E. C., Velicelebi, G. and Harpold, M. M. (1996) 'Comparative structure of human neuronal alpha 2-alpha 7 and beta 2-beta 4 nicotinic acetylcholine receptor subunits

96 and functional expression of the alpha 2, alpha 3, alpha 4, alpha 7, beta 2, and beta 4 subunits', J Mol Neurosci 7(3): 217-28.

Engblom, D., Bilbao, A., Sanchis-Segura, C., Dahan, L., Perreau-Lenz, S., Balland, B., Parkitna, J. R., Lujan, R., Halbout, B., Mameli, M. et al. (2008) 'Glutamate receptors on dopamine neurons control the persistence of cocaine seeking', Neuron 59(3): 497-508.

Exley, R., Maubourguet, N., David, V., Eddine, R., Evrard, A., Pons, S., Marti, F., Threlfell, S., Cazala, P., McIntosh, J. M. et al. (2011) 'Distinct contributions of nicotinic acetylcholine receptor subunit {alpha}4 and subunit {alpha}6 to the reinforcing effects of nicotine', Proc Natl Acad Sci U S A(108): 5.

File, S. E., Kenny, P. J. and Ouagazzal, A. M. (1998) 'Bimodal modulation by nicotine of anxiety in the social interaction test: role of the dorsal hippocampus', Behav Neurosci 112(6): 1423-9.

Floresco, S. B., West, A. R., Ash, B., Moore, H. and Grace, A. A. (2003) 'Afferent modulation of dopamine neuron firing differentially regulates tonic and phasic dopamine transmission', Nat Neurosci 6(9): 968-73.

Fowler, C. D., Lu, Q., Johnson, P. M., Marks, M. J. and Kenny, P. J. (2011) 'Habenular alpha5 nicotinic receptor subunit signalling controls nicotine intake', Nature.

Francis, M. M., Vazquez, R. W., Papke, R. L. and Oswald, R. E. (2000) 'Subtype- selective inhibition of neuronal nicotinic acetylcholine receptors by cocaine is determined by the alpha4 and beta4 subunits', Mol Pharmacol 58(1): 109-19.

Fucile, S. (2004) 'Ca2+ permeability of nicotinic acetylcholine receptors', Cell Calcium 35(1): 1-8.

Fudala, P. J., Teoh, K. W. and Iwamoto, E. T. (1985) 'Pharmacologic characterization of nicotine-induced conditioned place preference', Pharmacol Biochem Behav 22(2): 237-41.

George, T. P., Verrico, C. D., Picciotto, M. R. and Roth, R. H. (2000a) 'Nicotinic modulation of mesoprefrontal dopamine neurons: pharmacologic and neuroanatomic characterization', J Pharmacol Exp Ther 295(1): 58-66.

George, T. P., Verrico, C. D., Xu, L. and Roth, R. H. (2000b) 'Effects of repeated nicotine administration and footshock stress on rat mesoprefrontal dopamine systems: Evidence for opioid mechanisms', Neuropsychopharmacology 23(1): 79-88.

Gilbert, D. G., Robinson, J. H., Chamberlin, C. L. and Spielberger, C. D. (1989) 'Effects of smoking/nicotine on anxiety, heart rate, and lateralization of EEG during a stressful movie', Psychophysiology 26(3): 311-20.

Gotti, C., Moretti, M., Gaimarri, A., Zanardi, A., Clementi, F. and Zoli, M. (2007) 'Heterogeneity and complexity of native brain nicotinic receptors', Biochem Pharmacol 74(8): 1102-11.

Gould, T. J. (2003) 'Nicotine produces a within-subject enhancement of contextual fear conditioning in C57BL/6 mice independent of sex', Integr Physiol Behav Sci 38(2): 124-32.

Grabus, S. D., Martin, B. R., Brown, S. E. and Damaj, M. I. (2006) 'Nicotine place preference in the mouse: influences of prior handling, dose and strain and attenuation by nicotinic receptor antagonists', Psychopharmacology (Berl) 184(3-4): 456-63.

Grady, S. R., Grun, E. U., Marks, M. J. and Collins, A. C. (1997) 'Pharmacological comparison of transient and persistent [3H]dopamine release from mouse striatal synaptosomes and response to chronic L-nicotine treatment', J Pharmacol Exp Ther 282(1): 32-43.

Grady, S. R., Meinerz, N. M., Cao, J., Reynolds, A. M., Picciotto, M. R., Changeux, J. P., McIntosh, J. M., Marks, M. J. and Collins, A. C. (2001) 'Nicotinic agonists stimulate acetylcholine release from mouse interpeduncular nucleus: a function mediated by a different nAChR than dopamine release from striatum', J Neurochem 76(1): 258-68.

Grady, S. R., Salminen, O., Laverty, D. C., Whiteaker, P., McIntosh, J. M., Collins, A. C. and Marks, M. J. (2007) 'The subtypes of nicotinic acetylcholine receptors on dopaminergic terminals of mouse striatum', Biochem Pharmacol 74(8): 1235-46.

Granon, S., Faure, P. and Changeux, J. P. (2003) 'Executive and social behaviors under nicotinic receptor regulation', Proc Natl Acad Sci U S A 100(16): 9596-601.

Henningfield, J. E., Stapleton, J. M., Benowitz, N. L., Grayson, R. F. and London, E. D. (1993) 'Higher levels of nicotine in arterial than in venous blood after cigarette smoking', Drug Alcohol Depend 33(1): 23-9.

Herman, A. I. and Sofuoglu, M. (2010) 'Cognitive effects of nicotine: genetic moderators', Addict Biol 15(3): 250-65.

Hindmarch, I., Kerr, J. S. and Sherwood, N. (1990) 'Effects of nicotine gum on psychomotor performance in smokers and non-smokers', Psychopharmacology (Berl) 100(4): 535-41.

Ho, M. K. and Tyndale, R. F. (2007) 'Overview of the pharmacogenomics of cigarette smoking', Pharmacogenomics J 7(2): 81-98.

Hogg, R. C., Raggenbass, M. and Bertrand, D. (2003) 'Nicotinic acetylcholine receptors: from structure to brain function', Rev Physiol Biochem Pharmacol 147: 1- 46.

Horger, B. A., Giles, M. K. and Schenk, S. (1992) 'Preexposure to amphetamine and nicotine predisposes rats to self-administer a low dose of cocaine', Psychopharmacology (Berl) 107(2-3): 271-6.

Ikemoto, S. and Wise, R. A. (2002) 'Rewarding effects of the cholinergic agents carbachol and neostigmine in the posterior ventral tegmental area', J Neurosci 22(22): 9895-904.

Ikemoto, S. and Wise, R. A. (2004) 'Mapping of chemical trigger zones for reward', Neuropharmacology 47 Suppl 1: 190-201.

Irvine, E. E., Cheeta, S. and File, S. E. (1999) 'Time-course of changes in the social interaction test of anxiety following acute and chronic administration of nicotine', Behav Pharmacol 10(6-7): 691-7.

Irvine, E. E., Cheeta, S., Lovelock, C. and File, S. E. (2001) 'Tolerance to midazolam's anxiolytic effects after short-term nicotine treatment', Neuropharmacology 40(5): 710- 6.

Johnson, S. W. and North, R. A. (1992) 'Two types of neurone in the rat ventral tegmental area and their synaptic inputs', J Physiol 450: 455-68.

Jones, G. M., Sahakian, B. J., Levy, R., Warburton, D. M. and Gray, J. A. (1992) 'Effects of acute subcutaneous nicotine on attention, information processing and short- term memory in Alzheimer's disease', Psychopharmacology (Berl) 108(4): 485-94.

Kilby, N. J., Snaith, M. R. and Murray, J. A. (1993) 'Site-specific recombinases: tools for genome engineering', Trends Genet 9(12): 413-21.

Klink, R., de Kerchove d'Exaerde, A., Zoli, M. and Changeux, J. P. (2001) 'Molecular and physiological diversity of nicotinic acetylcholine receptors in the midbrain dopaminergic nuclei', J Neurosci 21(5): 1452-63.

Labarca, C., Schwarz, J., Deshpande, P., Schwarz, S., Nowak, M. W., Fonck, C., Nashmi, R., Kofuji, P., Dang, H., Shi, W. et al. (2001) 'Point mutant mice with hypersensitive alpha 4 nicotinic receptors show dopaminergic deficits and increased anxiety', Proc Natl Acad Sci U S A 98(5): 2786-91.

Lanca, A. J., Adamson, K. L., Coen, K. M., Chow, B. L. and Corrigall, W. A. (2000) 'The pedunculopontine tegmental nucleus and the role of cholinergic neurons in nicotine self-administration in the rat: a correlative neuroanatomical and behavioral study', Neuroscience 96(4): 735-42.

Le Foll, B., Goldberg, S. R. and Sokoloff, P. (2005a) 'The dopamine D3 receptor and drug dependence: effects on reward or beyond?', Neuropharmacology 49(4): 525-41.

Le Foll, B., Sokoloff, P., Stark, H. and Goldberg, S. R. (2005b) 'Dopamine D3 receptor ligands block nicotine-induced conditioned place preferences through a mechanism that does not involve discriminative-stimulus or antidepressant-like effects', Neuropsychopharmacology 30(4): 720-30.

100

Leshner, A. I. and Koob, G. F. (1999) 'Drugs of abuse and the brain', Proc Assoc Am Physicians 111(2): 99-108.

Lessov-Schlaggar, C. N., Pergadia, M. L., Khroyan, T. V. and Swan, G. E. (2008) 'Genetics of nicotine dependence and pharmacotherapy', Biochem Pharmacol 75(1): 178-95.

Leussis, M. P. and Bolivar, V. J. (2006) 'Habituation in rodents: a review of behavior, neurobiology, and genetics', Neurosci Biobehav Rev 30(7): 1045-64.

Levin, E. D., Bencan, Z. and Cerutti, D. T. (2007) 'Anxiolytic effects of nicotine in zebrafish', Physiol Behav 90(1): 54-8.

Levin, E. D., Mead, T., Rezvani, A. H., Rose, J. E., Gallivan, C. and Gross, R. (2000) 'The nicotinic antagonist mecamylamine preferentially inhibits cocaine vs. food self- administration in rats', Physiol Behav 71(5): 565-70.

Lichtensteiger, W., Hefti, F., Felix, D., Huwyler, T., Melamed, E. and Schlumpf, M. (1982) 'Stimulation of nigrostriatal dopamine neurones by nicotine', Neuropharmacology 21(10): 963-8.

Lima, M. M., Reksidler, A. B. and Vital, M. A. (2009) 'The neurobiology of the substantia nigra pars compacta: from motor to sleep regulation', J Neural Transm Suppl(73): 135-45.

Mansvelder, H. D., Keath, J. R. and McGehee, D. S. (2002) 'Synaptic mechanisms underlie nicotine-induced excitability of brain reward areas', Neuron 33(6): 905-19.

Mansvelder, H. D. and McGehee, D. S. (2000) 'Long-term potentiation of excitatory inputs to brain reward areas by nicotine', Neuron 27(2): 349-57.

Mansvelder, H. D., Mertz, M. and Role, L. W. (2009) 'Nicotinic modulation of synaptic transmission and plasticity in cortico-limbic circuits', Semin Cell Dev Biol 20(4): 432-40.

Marks, M. J., Burch, J. B. and Collins, A. C. (1983) 'Genetics of nicotine response in four inbred strains of mice', J Pharmacol Exp Ther 226(1): 291-302.

101

Marks, M. J., Pauly, J. R., Gross, S. D., Deneris, E. S., Hermans-Borgmeyer, I., Heinemann, S. F. and Collins, A. C. (1992) 'Nicotine binding and nicotinic receptor subunit RNA after chronic nicotine treatment', J Neurosci 12(7): 2765-84.

Marks, M. J., Stitzel, J. A. and Collins, A. C. (1985) 'Time course study of the effects of chronic nicotine infusion on drug response and brain receptors', J Pharmacol Exp Ther 235(3): 619-28.

Marks, M. J., Stitzel, J. A. and Collins, A. C. (1989) 'Genetic influences on nicotine responses', Pharmacol Biochem Behav 33(3): 667-78.

Marubio, L. M., del Mar Arroyo-Jimenez, M., Cordero-Erausquin, M., Lena, C., Le Novere, N., de Kerchove d'Exaerde, A., Huchet, M., Damaj, M. I. and Changeux, J. P. (1999) 'Reduced antinociception in mice lacking neuronal nicotinic receptor subunits', Nature 398(6730): 805-10.

Marubio, L. M., Gardier, A. M., Durier, S., David, D., Klink, R., Arroyo-Jimenez, M. M., McIntosh, J. M., Rossi, F., Champtiaux, N., Zoli, M. et al. (2003) 'Effects of nicotine in the dopaminergic system of mice lacking the alpha4 subunit of neuronal nicotinic acetylcholine receptors', Eur J Neurosci 17(7): 1329-37.

Maskos, U., Molles, B. E., Pons, S., Besson, M., Guiard, B. P., Guilloux, J. P., Evrard, A., Cazala, P., Cormier, A., Mameli-Engvall, M. et al. (2005) 'Nicotine reinforcement and cognition restored by targeted expression of nicotinic receptors', Nature 436(7047): 103-7.

Mathers, C. D. and Loncar, D. (2006) 'Projections of global mortality and burden of disease from 2002 to 2030', PLoS Med 3(11): e442.

McKee, S. A., Maciejewski, P. K., Falba, T. and Mazure, C. M. (2003) 'Sex differences in the effects of stressful life events on changes in smoking status', Addiction 98(6): 847-55.

McKee, S. A., Sinha, R., Weinberger, A. H., Sofuoglu, M., Harrison, E. L., Lavery, M. and Wanzer, J. (2011) 'Stress decreases the ability to resist smoking and potentiates smoking intensity and reward', J Psychopharmacol 25(4): 490-502.

102

Merritt, L. L., Martin, B. R., Walters, C., Lichtman, A. H. and Damaj, M. I. (2008) 'The endogenous cannabinoid system modulates nicotine reward and dependence', J Pharmacol Exp Ther 326(2): 483-92.

Mineur, Y. S., Brunzell, D. H., Grady, S. R., Lindstrom, J. M., McIntosh, J. M., Marks, M. J., King, S. L. and Picciotto, M. R. (2008) 'Localized low level re- expression of high affinity mesolimbic nicotinic acetylcholine receptors restores nicotine-induced locomotion but not place conditioning', Genes Brain Behav 10: 10.

Miwa, J. M., Freedman, R. and Lester, H. A. (2011) 'Neural systems governed by nicotinic acetylcholine receptors: emerging hypotheses', Neuron 70(1): 20-33.

Nashmi, R., Xiao, C., Deshpande, P., McKinney, S., Grady, S. R., Whiteaker, P., Huang, Q., McClure-Begley, T., Lindstrom, J. M., Labarca, C. et al. (2007) 'Chronic nicotine cell specifically upregulates functional alpha 4* nicotinic receptors: basis for both tolerance in midbrain and enhanced long-term potentiation in perforant path', J Neurosci 27(31): 8202-18.

Nelson, M. E., Kuryatov, A., Choi, C. H., Zhou, Y. and Lindstrom, J. (2003) 'Alternate stoichiometries of alpha4beta2 nicotinic acetylcholine receptors', Mol Pharmacol 63(2): 332-41.

Nestler, E. J. (2005) 'Is there a common molecular pathway for addiction?', Nat Neurosci 8(11): 1445-9.

Newhouse, P. A., Sunderland, T., Narang, P. K., Mellow, A. M., Fertig, J. B., Lawlor, B. A. and Murphy, D. L. (1990) 'Neuroendocrine, physiologic, and behavioral responses following intravenous nicotine in nonsmoking healthy volunteers and in patients with Alzheimer's disease', Psychoneuroendocrinology 15(5-6): 471-84.

Nicod, P., Rehr, R., Winniford, M. D., Campbell, W. B., Firth, B. G. and Hillis, L. D. (1984) 'Acute systemic and coronary hemodynamic and serologic responses to cigarette smoking in long-term smokers with atherosclerotic coronary artery disease', J Am Coll Cardiol 4(5): 964-71.

O'Brien, R. D., Gibson, R. E. and Sumikawa, K. (1979) 'The nicotinic acetylcholine receptor from Torpedo electroplax', Prog Brain Res 49: 279-91.

103

O'Neill, A. B. and Brioni, J. D. (1994) 'Benzodiazepine receptor mediation of the anxiolytic-like effect of (-)-nicotine in mice', Pharmacol Biochem Behav 49(3): 755-7.

Olausson, P., Akesson, P., Engel, J. A. and Soderpalm, B. (2001) 'Effects of 5-HT1A and 5-HT2 receptor agonists on the behavioral and neurochemical consequences of repeated nicotine treatment', Eur J Pharmacol 420(1): 45-54.

Olausson, P., Engel, J. A. and Soderpalm, B. (1999) 'Behavioral sensitization to nicotine is associated with behavioral disinhibition; counteraction by citalopram', Psychopharmacology (Berl) 142(2): 111-9.

Olds, J. (1958) 'Self-stimulation of the brain; its use to study local effects of hunger, sex, and drugs', Science 127(3294): 315-24.

Olds, J. and Milner, P. (1954) 'Positive reinforcement produced by electrical stimulation of septal area and other regions of rat brain', J Comp Physiol Psychol 47(6): 419-27.

Orb, S., Wieacker, J., Labarca, C., Fonck, C., Lester, H. A. and Schwarz, J. (2004) 'Knockin mice with Leu9'Ser alpha4-nicotinic receptors: substantia nigra dopaminergic neurons are hypersensitive to agonist and lost postnatally', Physiol Genomics 18(3): 299-307.

Ouagazzal, A. M., Kenny, P. J. and File, S. E. (1999) 'Modulation of behaviour on trials 1 and 2 in the elevated plus-maze test of anxiety after systemic and hippocampal administration of nicotine', Psychopharmacology (Berl) 144(1): 54-60.

Parish, C. L., Nunan, J., Finkelstein, D. I., McNamara, F. N., Wong, J. Y., Waddington, J. L., Brown, R. M., Lawrence, A. J., Horne, M. K. and Drago, J. (2005) 'Mice lacking the alpha4 nicotinic receptor subunit fail to modulate dopaminergic neuronal arbors and possess impaired dopamine transporter function', Mol Pharmacol 68(5): 1376-86.

Payne, T. J., Schare, M. L., Levis, D. J. and Colletti, G. (1991) 'Exposure to smoking- relevant cues: effects on desire to smoke and topographical components of smoking behavior', Addict Behav 16(6): 467-79.

104

Picciotto, M. R., Caldarone, B. J., Brunzell, D. H., Zachariou, V., Stevens, T. R. and King, S. L. (2001) 'Neuronal nicotinic acetylcholine receptor subunit knockout mice: physiological and behavioral phenotypes and possible clinical implications', Pharmacol Ther 92(2-3): 89-108.

Picciotto, M. R., Zoli, M., Lena, C., Bessis, A., Lallemand, Y., Le Novere, N., Vincent, P., Pich, E. M., Brulet, P. and Changeux, J. P. (1995) 'Abnormal avoidance learning in mice lacking functional high-affinity nicotine receptor in the brain', Nature 374(6517): 65-7.

Picciotto, M. R., Zoli, M., Rimondini, R., Léna, C., Marubio, L. M., Pich, E. M., Fuxe, K. and Changeux, J.-P. (1998a) 'Acetylcholine receptors containing the β2 subunit are involved in the reinforcing properties of nicotine', Nature 391: 173-177.

Picciotto, M. R., Zoli, M., Rimondini, R., Lena, C., Marubio, L. M., Pich, E. M., Fuxe, K. and Changeux, J. P. (1998b) 'Acetylcholine receptors containing the beta2 subunit are involved in the reinforcing properties of nicotine', Nature 391(6663): 173-7.

Pidoplichko, V. I., DeBiasi, M., Williams, J. T. and Dani, J. A. (1997) 'Nicotine activates and desensitizes midbrain dopamine neurons', Nature 390(6658): 401-4.

Pidoplichko, V. I., Noguchi, J., Areola, O. O., Liang, Y., Peterson, J., Zhang, T. and Dani, J. A. (2004) 'Nicotinic cholinergic synaptic mechanisms in the ventral tegmental area contribute to nicotine addiction', Learn Mem 11(1): 60-9.

Pierce, R. C. and Kumaresan, V. (2006) 'The mesolimbic dopamine system: the final common pathway for the reinforcing effect of drugs of abuse?', Neurosci Biobehav Rev 30(2): 215-38.

Pomerleau, O. F. (1986) 'Nicotine as a psychoactive drug: anxiety and pain reduction', Psychopharmacol Bull 22(3): 865-9.

Pons, S., Fattore, L., Cossu, G., Tolu, S., Porcu, E., McIntosh, J. M., Changeux, J. P., Maskos, U. and Fratta, W. (2008) 'Crucial role of alpha4 and alpha6 nicotinic acetylcholine receptor subunits from ventral tegmental area in systemic nicotine self- administration', J Neurosci 28(47): 12318-27.

105

Razzoli, M., Andreoli, M., Michielin, F., Quarta, D. and Sokal, D. M. (2011) 'Increased phasic activity of VTA dopamine neurons in mice 3 weeks after repeated social defeat', Behav Brain Res 218(1): 253-7.

Redgrave, P. and Horrell, R. I. (1976) 'Potentiation of central reward by localised perfusion of acetylcholine and 5-hydroxytryptamine', Nature 262(5566): 305-7.

Reid, M. S., Mickalian, J. D., Delucchi, K. L. and Berger, S. P. (1999) 'A nicotine antagonist, mecamylamine, reduces cue-induced cocaine craving in cocaine-dependent subjects', Neuropsychopharmacology 20(3): 297-307.

Reid, M. S., Mickalian, J. D., Delucchi, K. L., Hall, S. M. and Berger, S. P. (1998) 'An acute dose of nicotine enhances cue-induced cocaine craving', Drug Alcohol Depend 49(2): 95-104.

Ritz, B., Ascherio, A., Checkoway, H., Marder, K. S., Nelson, L. M., Rocca, W. A., Ross, G. W., Strickland, D., Van Den Eeden, S. K. and Gorell, J. (2007) 'Pooled analysis of tobacco use and risk of Parkinson disease', Arch Neurol 64(7): 990-7.

Roberts, D. C. and Koob, G. F. (1982) 'Disruption of cocaine self-administration following 6-hydroxydopamine lesions of the ventral tegmental area in rats', Pharmacol Biochem Behav 17(5): 901-4.

Robinson, L., Platt, B. and Riedel, G. (2011) 'Involvement of the cholinergic system in conditioning and perceptual memory', Behav Brain Res.

Rose, J. E. and Corrigall, W. A. (1997) 'Nicotine self-administration in animals and humans: similarities and differences', Psychopharmacology (Berl) 130(1): 28-40.

Ross, S. A., Wong, J. Y., Clifford, J. J., Kinsella, A., Massalas, J. S., Horne, M. K., Scheffer, I. E., Kola, I., Waddington, J. L., Berkovic, S. F. et al. (2000) 'Phenotypic characterization of an alpha 4 neuronal nicotinic acetylcholine receptor subunit knockout mouse', J Neurosci 20(17): 6431-41.

Saal, D., Dong, Y., Bonci, A. and Malenka, R. C. (2003) 'Drugs of abuse and stress trigger a common synaptic adaptation in dopamine neurons', Neuron 37(4): 577-82.

106

Salas, R., Pieri, F. and De Biasi, M. (2004) 'Decreased signs of nicotine withdrawal in mice null for the beta4 nicotinic acetylcholine receptor subunit', J Neurosci 24(45): 10035-9.

Salminen, O., Drapeau, J. A., McIntosh, J. M., Collins, A. C., Marks, M. J. and Grady, S. R. (2007) 'Pharmacology of alpha-conotoxin MII-sensitive subtypes of nicotinic acetylcholine receptors isolated by breeding of null mutant mice', Mol Pharmacol 71(6): 1563-71.

Salminen, O., Murphy, K. L., McIntosh, J. M., Drago, J., Marks, M. J., Collins, A. C. and Grady, S. R. (2004) 'Subunit composition and pharmacology of two classes of striatal presynaptic nicotinic acetylcholine receptors mediating dopamine release in mice', Mol Pharmacol 65(6): 1526-35.

Sauer, B. and Henderson, N. (1988) 'Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1', Proc Natl Acad Sci U S A 85(14): 5166-70.

Schmidt-Supprian, M. and Rajewsky, K. (2007) 'Vagaries of conditional gene targeting', Nat Immunol 8(7): 665-8.

Schultz, W. (2007) 'Behavioral dopamine signals', Trends Neurosci 30(5): 203-10.

Schwartz, R. D. and Kellar, K. J. (1983) 'Nicotinic cholinergic receptor binding sites in the brain: regulation in vivo', Science 220(4593): 214-6.

Sees, K. L. and Clark, H. W. (1993) 'When to begin smoking cessation in substance abusers', J Subst Abuse Treat 10(2): 189-95.

Sienkiewicz-Jarosz, H., Maciejak, P., Bidzinski, A., Szyndler, J., Siemiatkowski, M., Czlonkowska, A., Lehner, M. and Plaznik, A. (2003) 'Exploratory activity and a conditioned fear response: correlation with cortical and subcortical binding of the alpha4beta2 nicotinic receptor agonist [3H]-epibatidine', Pol J Pharmacol 55(1): 17- 23.

107

Singer, G., Wallace, M. and Hall, R. (1982) 'Effects of dopaminergic nucleus accumbens lesions on the acquisition of schedule induced self injection of nicotine in the rat', Pharmacol Biochem Behav 17(3): 579-81.

Spina, L., Longoni, R., Vinci, S., Ibba, F., Peana, A. T., Muggironi, G., Spiga, S. and Acquas, E. (2010) 'Role of dopamine D1 receptors and extracellular signal regulated kinase in the motivational properties of acetaldehyde as assessed by place preference conditioning', Alcohol Clin Exp Res 34(4): 607-16.

Stein, E. A., Pankiewicz, J., Harsch, H. H., Cho, J. K., Fuller, S. A., Hoffmann, R. G., Hawkins, M., Rao, S. M., Bandettini, P. A. and Bloom, A. S. (1998) 'Nicotine-induced limbic cortical activation in the human brain: a functional MRI study', Am J Psychiatry 155(8): 1009-15.

Stewart, J. (1984) 'Reinstatement of heroin and cocaine self-administration behavior in the rat by intracerebral application of morphine in the ventral tegmental area', Pharmacol Biochem Behav 20(6): 917-23.

Suaud-Chagny, M. F. (2004) 'In vivo monitoring of dopamine overflow in the central nervous system by amperometric techniques combined with carbon fibre electrodes', Methods 33(4): 322-9.

Tapper, A. R., McKinney, S. L., Nashmi, R., Schwarz, J., Deshpande, P., Labarca, C., Whiteaker, P., Marks, M. J., Collins, A. C. and Lester, H. A. (2004) 'Nicotine activation of alpha4* receptors: sufficient for reward, tolerance, and sensitization', Science 306(5698): 1029-32.

Tritto, T., McCallum, S. E., Waddle, S. A., Hutton, S. R., Paylor, R., Collins, A. C. and Marks, M. J. (2004) 'Null mutant analysis of responses to nicotine: deletion of beta2 nicotinic acetylcholine receptor subunit but not alpha7 subunit reduces sensitivity to nicotine-induced locomotor depression and hypothermia', Nicotine Tob Res 6(1): 145-58.

Tsai, H. C., Zhang, F., Adamantidis, A., Stuber, G. D., Bonci, A., de Lecea, L. and Deisseroth, K. (2009) 'Phasic firing in dopaminergic neurons is sufficient for behavioral conditioning', Science 324(5930): 1080-4.

108

Uhl, G. R. (2003) 'Dopamine transporter: basic science and human variation of a key molecule for dopaminergic function, locomotion, and parkinsonism', Mov Disord 18 Suppl 7: S71-80.

Walters, C. L., Brown, S., Changeux, J. P., Martin, B. and Damaj, M. I. (2006) 'The beta2 but not alpha7 subunit of the nicotinic acetylcholine receptor is required for nicotine-conditioned place preference in mice', Psychopharmacology (Berl) 184(3-4): 339-44.

Walters, C. L., Cleck, J. N., Kuo, Y. C. and Blendy, J. A. (2005) 'Mu-opioid receptor and CREB activation are required for nicotine reward', Neuron 46(6): 933-43.

Wang, L. P., Li, F., Shen, X. and Tsien, J. Z. (2010) 'Conditional knockout of NMDA receptors in dopamine neurons prevents nicotine-conditioned place preference', PLoS One 5(1): e8616.

Wesnes, K. and Warburton, D. M. (1983) 'Effects of smoking on rapid information processing performance', Neuropsychobiology 9(4): 223-9.

West, R. J. and Jarvis, M. J. (1986) 'Effects of nicotine on finger tapping rate in non- smokers', Pharmacol Biochem Behav 25(4): 727-31.

Whiteaker, P., Jimenez, M., McIntosh, J. M., Collins, A. C. and Marks, M. J. (2000a) 'Identification of a novel nicotinic binding site in mouse brain using [(125)I]- epibatidine', Br J Pharmacol 131(4): 729-39.

Whiteaker, P., McIntosh, J. M., Luo, S., Collins, A. C. and Marks, M. J. (2000b) '125I-alpha-conotoxin MII identifies a novel nicotinic acetylcholine receptor population in mouse brain', Mol Pharmacol 57(5): 913-25.

Whiteaker, P., Peterson, C. G., Xu, W., McIntosh, J. M., Paylor, R., Beaudet, A. L., Collins, A. C. and Marks, M. J. (2002) 'Involvement of the alpha3 subunit in central nicotinic binding populations', J Neurosci 22(7): 2522-9.

WHO, W. H. O. (2010) Tobacco Free Initiative FIFTY-THIRD WORLD HEALTH ASSEMBLY: World Health Organization.

109

Wise, R. A. (2009) 'Roles for nigrostriatal--not just mesocorticolimbic--dopamine in reward and addiction', Trends Neurosci 32(10): 517-24.

Witten, I. B., Lin, S. C., Brodsky, M., Prakash, R., Diester, I., Anikeeva, P., Gradinaru, V., Ramakrishnan, C. and Deisseroth, K. (2010) 'Cholinergic interneurons control local circuit activity and cocaine conditioning', Science 330(6011): 1677-81.

Wooltorton, J. R., Pidoplichko, V. I., Broide, R. S. and Dani, J. A. (2003) 'Differential desensitization and distribution of nicotinic acetylcholine receptor subtypes in midbrain dopamine areas', J Neurosci 23(8): 3176-85.

Wu, J., Liu, Q., Yu, K., Hu, J., Kuo, Y. P., Segerberg, M., St John, P. A. and Lukas, R. J. (2006) 'Roles of nicotinic acetylcholine receptor beta subunits in function of human alpha4-containing nicotinic receptors', J Physiol 576(Pt 1): 103-18.

Young, J. W., Goey, A. K., Minassian, A., Perry, W., Paulus, M. P. and Geyer, M. A. (2010) 'The mania-like exploratory profile in genetic dopamine transporter mouse models is diminished in a familiar environment and reinstated by subthreshold psychostimulant administration', Pharmacol Biochem Behav 96(1): 7-15.

Zachariou, V., Caldarone, B. J., Weathers-Lowin, A., George, T. P., Elsworth, J. D., Roth, R. H., Changeux, J. P. and Picciotto, M. R. (2001) 'Nicotine receptor inactivation decreases sensitivity to cocaine', Neuropsychopharmacology 24(5): 576- 89.

Zanetti, L., de Kerchove D'Exaerde, A., Zanardi, A., Changeux, J. P., Picciotto, M. R. and Zoli, M. (2006) 'Inhibition of both alpha7* and beta2* nicotinic acetylcholine receptors is necessary to prevent development of sensitization to cocaine-elicited increases in extracellular dopamine levels in the ventral striatum', Psychopharmacology (Berl) 187(2): 181-8.

Zanetti, L., Picciotto, M. R. and Zoli, M. (2007) 'Differential effects of nicotinic antagonists perfused into the nucleus accumbens or the ventral tegmental area on cocaine-induced dopamine release in the nucleus accumbens of mice', Psychopharmacology (Berl) 190(2): 189-99.

110

Zhang, T., Zhang, L., Liang, Y., Siapas, A. G., Zhou, F. M. and Dani, J. A. (2009) 'Dopamine signaling differences in the nucleus accumbens and dorsal striatum exploited by nicotine', J Neurosci 29(13): 4035-43.

Zhuang, X., Masson, J., Gingrich, J. A., Rayport, S. and Hen, R. (2005) 'Targeted gene expression in dopamine and serotonin neurons of the mouse brain', J Neurosci Methods 143(1): 27-32.

Zhuang, X., Oosting, R. S., Jones, S. R., Gainetdinov, R. R., Miller, G. W., Caron, M. G. and Hen, R. (2001) 'Hyperactivity and impaired response habituation in hyperdopaminergic mice', Proc Natl Acad Sci U S A 98(4): 1982-7.

Ziedonis, D., Hitsman, B., Beckham, J. C., Zvolensky, M., Adler, L. E., Audrain- McGovern, J., Breslau, N., Brown, R. A., George, T. P., Williams, J. et al. (2008) 'Tobacco use and cessation in psychiatric disorders: National Institute of Mental Health report', Nicotine Tob Res 10(12): 1691-715.

Zweifel, L. S., Argilli, E., Bonci, A. and Palmiter, R. D. (2008) 'Role of NMDA receptors in dopamine neurons for plasticity and addictive behaviors', Neuron 59(3): 486-96.

Zweifel, L. S., Parker, J. G., Lobb, C. J., Rainwater, A., Wall, V. Z., Fadok, J. P., Darvas, M., Kim, M. J., Mizumori, S. J., Paladini, C. A. et al. (2009) 'Disruption of NMDAR-dependent burst firing by dopamine neurons provides selective assessment of phasic dopamine-dependent behavior', Proc Natl Acad Sci U S A 106(18): 7281-8.