DOCSLIB.ORG

And Interstrand Cross-Linked DNA Adducts by Uvrabc: a New Model

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
And Interstrand Cross-Linked DNA Adducts by Uvrabc: a New Model City University of New York (CUNY) CUNY Academic Works Publications and Research John Jay College of Criminal Justice 2010 Repair of mitomycin C mono- and interstrand cross-linked DNA adducts by UvrABC: a new model Mao-wen Weng New York University Yi Zheng New York University Vijay P. Jasti University of Connecticut Elise Champeil CUNY John Jay College Maria Tomasz CUNY Hunter College See next page for additional authors How does access to this work benefit ou?y Let us know! More information about this work at: https://academicworks.cuny.edu/jj_pubs/69 Discover additional works at: https://academicworks.cuny.edu This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] Authors Mao-wen Weng, Yi Zheng, Vijay P. Jasti, Elise Champeil, Maria Tomasz, Yinsheng Wang, Ashis K. Basu, and Moon-shong Tang This article is available at CUNY Academic Works: https://academicworks.cuny.edu/jj_pubs/69 6976–6984 Nucleic Acids Research, 2010, Vol. 38, No. 20 Published online 6 July 2010 doi:10.1093/nar/gkq576 Repair of mitomycin C mono- and interstrand cross-linked DNA adducts by UvrABC: a new model Mao-wen Weng1, Yi Zheng1, Vijay P. Jasti2, Elise Champeil3, Maria Tomasz4, Yinsheng Wang5, Ashis K. Basu2,* and Moon-shong Tang1,* 1Department of Environmental Medicine, Pathology, and Medicine, New York University School of Medicine, Tuxedo, New York 10987, 2Department of Chemistry, University of Connecticut, Storrs, Connecticut 06269, 3Department of Science, John Jay College, City University of New York, New York 10019, 4Department of Chemistry, Hunter College, City University of New York, New York, New York 10021 and 5Department of Chemistry, University of California, Riverside, CA 92521, USA Received March 17, 2010; Revised May 5, 2010; Accepted June 8, 2010 ABSTRACT INTRODUCTION Mitomycin C induces both MC-mono-dG and Mitomycin C (MC) is a potent antitumor drug. Although cross-linked dG-adducts in vivo. Interstrand this drug was discovered decades ago, it is still being cross-linked (ICL) dG-MC-dG-DNA adducts can actively used clinically, in combination with other prevent strand separation. In Escherichia coli cells, antitumor drugs, for the treatment of advanced cancers (1–4). Upon entering cells MC is chemically reduced to a UvrABC repairs ICL lesions that cause DNA bending. form that can react with deoxyguanosine (dG) residues The mechanisms and consequences of NER of ICL in DNA to form a MC-mono-dG adduct. Mitomycin C dG-MC-dG lesions that do not induce DNA bending can further form an intrastrand biadduct at –GG- sites remain unclear. Using DNA fragments containing a and an interstrand cross-linked (ICL) dG-MC-dG lesion MC-mono-dG or an ICL dG-MC-dG adduct, we at a –CG- site (5). If not repaired, these DNA adducts, found (i) UvrABC incises only at the strand contain- particularly ICL lesions, can block transcription and ing MC-mono-dG adducts; (ii) UvrABC makes three DNA replication and cause cell death (6). The antitumor types of incisions on an ICL dG-MC-dG adduct: type activity of MC is generally believed to be derived from 1, a single 50 incision on 1 strand and a 30 incision these interactions with DNA (7,8). on the other; type 2, dual incisions on 1 strand and Both eukaryotes and prokaryotes have the capacity to a single incision on the other; and type 3, dual repair MC-DNA adducts. The MC-mono-dG adducts are repaired by the nucleotide excision repair (NER) mecha- incisions on both strands; and (iii) the cutting nism, which is similar to what occurs with other bulky kinetics of type 3 is significantly faster than type 1 DNA adducts, such as benzo(a)pyrene diol epoxide-dG and type 2, and all of 3 types of cutting result in adducts and cyclobutane pyrimidine dimers (CPD) photo- producing DSB. We found that UvrA, UvrA+UvrB products (9,10). We previously have shown that UvrABC and UvrA+UvrB+UvrC bind to MC-modified DNA nuclease, the NER enzyme complex in Escherichia coli specifically, and we did not detect any UvrB- and cells, makes an incision 7–8 nt 50 to and 3–4 nt 30 to an UvrB+UvrC–DNA complexes. Our findings chal- MC-mono-dG adduct (10). It is likely that the intrastrand lenge the current UvrABC incision model. We biadduct at –GG- sites is repaired in the same fashion as propose that DSBs resulted from NER of ICL CPD and MC-mono-dG adducts, but the repair of ICL dG-MC-dG adducts contribute to MC antitumor dG-MC-dG lesion is less clear. The current understanding activity and mutations. of ICL lesions is derived primarily from results of studying *To whom correspondence should be addressed. Tel: +1 845 731 3585; Fax: +1 845 351 2385; Email: [email protected] Correspondence may also be addressed to Ashis K. Basu. Tel: +1 860 486 3965; Email: [email protected] ß The Author(s) 2010. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.5), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2010, Vol. 38, No. 20 6977 UvrABC nuclease incision on ICL thymidine-psoralen- oligonucleotide, [d(TTCTCCTATGGGAATTCTACGT thymidine (dT-psoralen-dT) lesions (11,12). However, ATAGAGAGGATATCCCC)]. The ligated 61-mer was results from studies on UvrABC recognition and repair isolated by gel electrophoresis and stored at À20C. of ICL dT-psoralen-dT lesions are inconsistent; while van Houten et al. (11,12) have shown that the UvrABC MC-cross-linked 61-mer duplex. The 61-bp fragments nuclease makes dual incisions only at the DNA strand containing a site-specific ICL dG-MC-dG adduct were with the furan side of ICL dT-psoralen-dT lesion, generated by hybridizing the MC-mono-adduct–con- Ramaswamy and Yeung (13) have demonstrated that taining 61-mer with its complementary 61-mer, and the the UvrABC nuclease can make incisions on both duplexes underwent further MC cross-linking using previ- 2 strands of this type of lesion. Sladek et al. (14,15) have ously described reaction conditions (18,19). The N - 2 demonstrated that the ICL dT-psoralen-dT adduct in a dG-MC-N -dG interstrand cross-link–containing 61-mer circular double-stranded DNA can be removed and duplex was purified by PAGE. repaired by the concerted actions of UvrABC incision, 32 recA-mediated DNA strand invasion and DNA polymer- Preparation of P-labeled DNA fragments ase I-mediated repair synthesis. The single-stranded (SS) 61-mer fragment containing an An ICL dG-MC-dG has two distinct structural differ- MC-mono-dG adduct or its complementary SS 61-mer ences from an ICL dT-psoralen-dT: 1, dG residues are was dissolved in 1 Â TE buffer (10 mM Tris–HCl, pH cross-linked instead of dT residues, and 2, the MC 8.0, 1 mM EDTA), 50-end labeled with g-32P-ATP by T4 moiety sticks out of the minor groove and does not polynucleotide kinase (New England, BioLab), hybridized induce DNA bending (16), while the psoralen moiety is to each other, and then separated in a nondenaturing 8% hidden within the base stacks and induces a 46.5o kink in polyacrylamide gel. The DS 61-bp fragments containing a the DNA helix (17). Similar to the ICL dG-MC-dG site-specific ICL dG-MC-dG were 50-end-labeled with adduct, it has been shown that an MC-mono-dG adduct g-32P-ATP by T4 polynucleotide kinase at both ends; the does not induce DNA bending (16). If an ICL dG-MC-dG DNA fragments were then digested with SmaI to generate adduct does not cause DNA bending then what are the single 50-end 32P-labeled fragments. signals for UvrABC to recognize this adduct as a DNA lesion? Since the 2 dGs in both DNA strands in this lesion UvrABC nuclease reactions are covalently bonded with the same MC molecule, how The UvrA, UvrB and UvrC proteins were purified as pre- does UvrABC incise an ICL dG-MC-dG adduct? viously described (9). An aliquot of the 32P-labeled 61-bp To address these questions, we determined the recogni- DNA fragments (0.6–2.0 nM) was reacted with the UvrA, tion and incision of two types of MC–DNA lesions by UvrB and UvrC proteins (15 nM each) in UvrABC UvrABC nuclease, using substrates of 61-bp DNA frag- reaction buffer (50 mM Tris–HCI, pH 7.5, 10 mM ments containing either a site-specific ICL dG-MC-dG or MgC12, 100 mM KC1, 1 mM ATP and 1 mM DTT) at MC-mono-dG adduct at the same site. 37C for different time periods. Kinetics of UvrABC incision MATERIALS AND METHODS The 32P-labeled DS DNA fragments containing a site- Materials specific MC adduct were pre-incubated with 15 nM The restriction enzymes SmaI and SnaBI were obtained UvrA and 15 nM UvrB at 37C in UvrABC reaction from Roche. T4 polynucleotide kinase was obtained buffer and the reaction was then started with the from DuPont New England Biolabs. Acrylamide, bis- addition of UvrC (15 nM). The UvrABC reaction acrylamide, APS and yeast tRNA were purchased from mixtures were sampled at different time intervals and the the Sigma Chemical Company. The g-32P-ATP was resultant DNAs were purified and separated in a 12% purchased from Perkin Elmer. polyacrylamide denaturing or non-denaturing gel.
Load more

Recommended publications
  • Loss of DNA Mismatch Repair Facilitates Reactivation of a Reporter
    British Journal of Cancer (1999) 80(5/6), 699–704 © 1999 Cancer Research Campaign Article no. bjoc.1998.0412 Loss of DNA mismatch repair facilitates reactivation of a reporter plasmid damaged by cisplatin B Cenni1,†, H-K Kim1, GJ Bubley2, S Aebi1, D Fink1, BA Teicher3,*, SB Howell1 and RD Christen1 1Department of Medicine 0058, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0058, USA; 2Beth Israel Deaconess Hospital, Harvard Medical School, Boston, MA 02115, USA; 3Division of Cancer Pharmacology, Dana Farber Cancer Institute, Harvard Medical School, Boston, MA 02115, USA Summary In addition to recognizing and repairing mismatched bases in DNA, the mismatch repair (MMR) system also detects cisplatin DNA adducts and loss of MMR results in resistance to cisplatin. A comparison was made of the ability of MMR-proficient and -deficient cells to remove cisplatin adducts from their genome and to reactivate a transiently transfected plasmid that had previously been inactivated by cisplatin to express the firefly luciferase enzyme. MMR deficiency due to loss of hMLH1 function did not change the extent of platinum (Pt) accumulation or kinetics of removal from total cellular DNA. However, MMR-deficient cells, lacking either hMLH1 or hMSH2, generated twofold more luciferase activity from a cisplatin-damaged reporter plasmid than their MMR-proficient counterparts. Thus, detection of the cisplatin adducts by the MMR system reduced the efficiency of reactivation of the damaged luciferase gene compared to cells lacking this detector. The twofold reduction in reactivation efficiency was of the same order of magnitude as the difference in cisplatin sensitivity between the MMR-proficient and -deficient cells.
    [Show full text]
  • Incision by Uvrabc Excinuclease Is a Step in the Path to Mutagenesis By
    Proc. Nati. Acad. Sci. USA Vol. 86, pp. 3982-3986, June 1989 Biochemistry Incision by UvrABC excinuclease is a step in the path to mutagenesis by psoralen crosslinks in Escherichia coli (plasmid mutagenesis/pSV2-gpt/homologous recombination/angelicin/deletions) FRANCES M. SLADEK*t, AGUSTIN MELIANt, AND PAUL HOWARD-FLANDERS§ Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06511 Communicated by Fred Sherman, February 21, 1989 (receivedfor review June 10, 1988) ABSTRACT 4,5',8-Trimethylpsoralen (psoralen) plus yield of SOS-dependent mutations (15, 16), which tend to be near UV light produces interstrand crosslinks and monoad- base-pair substitutions (17-19). ducts in DNA, both ofwhich are mutagenic. InEscherichia coil, The repair of crosslinks appears to occur by a sequential crosslinks are incised by UvrABC excinuclease, an event that excision-recombination mechanism (20, 21). In vitro studies can lead to homologous recombination and repair. To deter- show that crosslinked DNA is incised by the UvrABC exci- mine whether UvrABC incision of crosslinks is a step in the nuclease (22, 23) so that an 11-base oligonucleotide containing path to mutagenesis as well as repair, the effect of DNA the crosslink is left attached to an intact DNA strand (24). They homologous to a target gene on a plasmid was determined. also show that RecA-mediated strand exchange can proceed pSV2-gpt DNA was treated with psoralen and transformed into past the crosslinked oligonucleotide (25) and that a second a pair of hosts: one was gpt', the other was A(gpt-ac)5. The round of incision by UvrABC can release the psoralen moeity DNA was extracted and transformed into a tester strain from the DNA (25, 26).
    [Show full text]
  • Dnase I Footprint of ABC Excinuclease”
    THE JOURNALOF BIOLOGICAL CHEMISTRY Vol. 262, No. 27, Issue of September 25, pp. 13180-13187,1987 0 1987 by The American Societyfor Biochemistry and Molecular Biology, Inc. Printed in U.S.A. DNase I Footprint of ABC Excinuclease” (Received for publication, April 3, 1987) Bennett Van HoutenSg,Howard Gamperll((**,Aziz SancarS, and JohnE. HearstllJJ$$ From the $Department of Biochemistry, University ofNorth Carolina at Chapel Hill School of Medicine, Chapel Hill, North Carolina 27514, the TDepartment of Chemistry, University of California, Berkeley, California 94720, and the ((Divisionof Chemical Biodynamics, Lawrence Berkeley Laboratory, Berkeley, California 94720 The incision and excision steps of nucleotide excision In Escherichia coli, the initial steps of nucleotide excision repair in Escherichia coli are mediated by ABC exci- repair are mediated by the enzyme ABC excision nuclease nuclease, a multisubunit enzyme composed of three (ABC excinuclease) which is composed of threeproteins, proteins, UvrA, UvrB, and UvrC. To determine the UvrA (Mr= 103,874), UvrB (M, = 76,118), and UvrC (M, = DNA contact sites and the binding affinity ofABC 66,038) (Husain et al., 1986; Arikan et al., 1986; Backendorf excinuclease for damaged DNA, it is necessary to en- et al., 1986; Sancar, G. et al., 1984). These subunits function gineer a DNA fragment uniquely modified at one nu- cleotide. We have recently reported the constructionof in a concerted manner to hydrolyze the 8th phosphodiester a 40 base pair (bp) DNA fragment containing a psora- bond 5’ and the 4th or 5th phosphodiester bond 3‘ to a len adduct at a central TpA sequence (Van Houten, B., modified nucleotide(s).
    [Show full text]
  • Lecture 9.Pdf
    Lecture-9 M.Sc 2nd Semester (Environmental Microbiology) Paper EM-202: Microbial physiology and adaptation Unit IV: SOS Inducible Repair Mechanism Against UV Induced Damage The SOS Response • The SOS response is the term used to describe changes in gene expression in E. coli in other bacteria in response to extensive DNA damage. The prokaryotic SOS system is regulated by two main protien i.e. Lex A and Rec A. •Despite having multiple repair system, sometimes the damage to an organism’s DNA is so great that the normal repair mechanisms just described cannot repair all the damage. As a result, DNA synthesis stops completely. In such situations, a global control network called the SOS response is activated. •The SOS response is known to be widespread in the Bacteria domain, but it is mostly absent in some bacterial phyla, like the Spirochetes. •The SOS response, like recombination repair, is dependent on the activity of the RecA and Lex A protein . •. The most common cellular signals activating the SOS response are regions of single-stranded DNA (ssDNA), arising from stalled replication fork or double-strand breaks, which are processed by DNA helicase to separate the two DNA strands. In the initiation step, RecA protein binds to ssDNA in an ATP hydrolysis driven reaction creating RecA–ssDNA filaments. •RecA binds to single or double stranded DNA breaks and gaps generated by cessation of DNA synthesis. RecA binding initiates recombination repair. •RecA–ssDNA filaments activate LexA auto protease activity, which ultimately leads to cleavage of LexA dimer and subsequent LexA degradation. •The loss of LexA repressor induces transcription of the SOS genes and allows for further signal induction, inhibition of cell division and an increase in levels of proteins responsible for damage processing.
    [Show full text]
  • Nucleotide Excision Repair of Melphalan Monoadducts1
    [CANCER RESEARCH 5«.5196-5200. November 15. 1998] Nucleotide Excision Repair of Melphalan Monoadducts1 David F. Grant,2 Tadayoshi Bessho, and Joyce T. Reardon Department iif Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Lillle Rack. Arkansas 72205-7199 ¡D.F, C.I. and Department <ijBiochemistry and Biophysics. University of North Carolina Sdirmi of Medicine. Chapel Hill. North Carolina 275W-7260 ¡T.R.. J. T. R.I ABSTRACT melphalan damage can be repaired by NER. Because melphalan forms both monoadducts as well as interstrand cross-links in target DNA The nucleotide-cxcision repair (NER) system removes bulky DNA ad- (12-14), it is not clear what role NER might play in the repair process. ducts and is thought to be involved in resistance to chemotherapeutic In this study, we have directly tested the ability of the NER system drugs, which act by damaging DNA. In this study, we have investigated the ability of the NER system to recognize and excise melphalan mono- to remove melphalan monoadducts from DNA using a well-estab adducts from a 140-mer DNA substrate. We show that rodent and human lished in vitro assay system (15-18). In this system, a 140-bp linear cell-free extracts (CFEs) excise 26-29-nt-long oligomers from a synthetic DNA construct containing a centrally located DNA lesion is used as 140-mer containing centrally located melphalan adducts. CFEs from cell a substrate for NER enzymes (Fig. 1). NER activity is demonstrated lines with mutations in xeroderma pigmentosum group / or G genes did by the release of the centrally located lesion in the form of 26-29- not excise these alkylated oligomers; however, mixing the two CFEs nt-long excision products (15, 16, 18-21).
    [Show full text]
  • Focus on UV-Induced DNA Damage and Repair—Disease Relevance and Protective Strategies
    International Journal of Molecular Sciences Review Focus on UV-Induced DNA Damage and Repair—Disease Relevance and Protective Strategies Mateusz Kciuk 1,2,* , Beata Marciniak 2 , Mariusz Mojzych 3 and Renata Kontek 2 1 Doctoral School of Exact and Natural Sciences, University of Lodz, Banacha Street 12/16, 90-237 Lodz, Poland 2 Department of Molecular Biotechnology and Genetics, Faculty of Biology and Environmental Protection, University of Lodz, 12/16 Banacha St., 90-237 Lodz, Poland; [email protected] (B.M.); [email protected] (R.K.) 3 Department of Chemistry, Siedlce University of Natural Sciences and Humanities, 3 Maja 54, 08-110 Siedlce, Poland; [email protected] * Correspondence: [email protected] Received: 24 August 2020; Accepted: 29 September 2020; Published: 1 October 2020 Abstract: The protective ozone layer is continually depleting due to the release of deteriorating environmental pollutants. The diminished ozone layer contributes to excessive exposure of cells to ultraviolet (UV) radiation. This leads to various cellular responses utilized to restore the homeostasis of exposed cells. DNA is the primary chromophore of the cells that absorbs sunlight energy. Exposure of genomic DNA to UV light leads to the formation of multitude of types of damage (depending on wavelength and exposure time) that are removed by effectively working repair pathways. The aim of this review is to summarize current knowledge considering cellular response to UV radiation with special focus on DNA damage and repair and to give a comprehensive insight for new researchers in this field. We also highlight most important future prospects considering application of the progressing knowledge of UV response for the clinical control of diverse pathologies.
    [Show full text]
  • DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment
    Cancers 2014, 6, 1597-1614; doi:10.3390/cancers6031597 OPEN ACCESS cancers ISSN 2072-6694 www.mdpi.com/journal/cancers Review DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment Gemma Bridge †, Sukaina Rashid † and Sarah A. Martin * Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK; E-Mails: [email protected] (G.B.); [email protected] (S.R.) † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +44-20-7882-3599; Fax: +44-20-7882-3884. Received: 14 May 2014; in revised form: 2 July 2014 / Accepted: 18 July 2014 / Published: 5 August 2014 Abstract: Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting.
    [Show full text]
  • Cho Endonuclease Functions During DNA Interstrand Cross-Link Repair in Escherichia Coli
    crossmark Cho Endonuclease Functions during DNA Interstrand Cross-Link Repair in Escherichia coli Anthonige Vidya Perera, James Brian Mendenhall, Charmain Tan Courcelle, Justin Courcelle Department of Biology, Portland State University, Portland, Oregon, USA ABSTRACT DNA interstrand cross-links are complex lesions that covalently link both strands of the duplex DNA. Lesion removal is pro- posed to be initiated via the UvrABC nucleotide excision repair complex; however, less is known about the subsequent steps of Downloaded from this complex repair pathway. In this study, we characterized the contribution of nucleotide excision repair mutants to survival in the presence of psoralen-induced damage. Unexpectedly, we observed that the nucleotide excision repair mutants exhibit differ- ential sensitivity to psoralen-induced damage, with uvrC mutants being less sensitive than either uvrA or uvrB. We show that Cho, an alternative endonuclease, acts with UvrAB and is responsible for the reduced hypersensitivity of uvrC mutants. We find that Cho’s contribution to survival correlates with the presence of DNA interstrand cross-links, rather than monoadducts, and operates at a step after, or independently from, the initial incision during the global repair of psoralen DNA adducts from the genome. http://jb.asm.org/ IMPORTANCE DNA interstrand cross-links are complex lesions that covalently bind to both strands of the duplex DNA and whose mechanism of repair remains poorly understood. In this study, we show that Cho, an alternative endonuclease, acts with UvrAB and partici- pates in the repair of DNA interstrand cross-links formed in the presence of photoactivated psoralens. Cho’s contribution to survival correlates with the presence of DNA interstrand cross-links and operates at a step after, or independently from, the ini- tial incision during the repair process.
    [Show full text]
  • The Roles of Transcription Factors in Nucleotide Excision Repair in Yeast
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2010 The olesr of transcription factors in Nucleotide excision repair in yeast Baojin Ding Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Part of the Medicine and Health Sciences Commons Recommended Citation Ding, Baojin, "The or les of transcription factors in Nucleotide excision repair in yeast" (2010). LSU Doctoral Dissertations. 3791. https://digitalcommons.lsu.edu/gradschool_dissertations/3791 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. THE ROLES OF TRANSCRIPTION FACTORS IN NUCLEOTIDE EXCISION REPAIR IN YEAST A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Veterinary Medical Sciences through the Department of Comparative Biomedical Sciences by Baojin Ding B.S., Medical College of Qingdao Univerisity, 2001 M.S., Wenzhou Medical College, 2004 May 2010 ACKNOWLEDGEMENTS First of all, I would like to show my appreciation to my major professor, Dr. Shisheng Li, for his patient training and financial support, which have allowed me to complete all of the work presented in this dissertation. Thanks for the suggestions on my project, the opportunities to attend international academic conferences, and the help, encouragement and support during my studies.
    [Show full text]
  • Supporting Information
    Supporting Information Traverse and Ochman 10.1073/pnas.1525329113 A→C A→C SI Methods where r is the error rate for A→C errors, radj is the base Transcription error rates were calculated by recovering all errors adjusted error rate, and fA is the adjustment coefficient for base in the output file processed by CircSeq_v2. This pipeline is composition, calculated as described in detail (22), but briefly, repeats within each read 0.25 were identified by CircSeq_v2, andalignedtoobtainaconsensus fA = , sequence if a read contained were at least three full repeats of A 100 bp or less. Any read that failed to meet this criterion was A discarded. Because each base within each repeat is assigned a where is the fraction of overall adenosine nucleotides se- quenced in the transcriptome. This calculation normalizes the error different quality score, a single quality score representative of → the consensus sequence at each base was calculated as the av- rate of A C errors by any base compositional biases in the tran- erage quality score from the three bases from each repeat at scriptome. This error rate is presented in the context of the entire each location. Reads are then mapped to their respective ref- transcriptome (i.e., not within the context of all sequenced adeno- erence genome using bowtie2, and errors were identified as sine locations). those bases within reads that did not match the reference To ensure that sequencing errors did not influence our results, we genome. Only bases that had an average quality score of 20 or analyzed the original sequence data to include all bases having an higher (Fig.
    [Show full text]
  • Excision Repair in Mammalian Cells *
    THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 270, No. 27, Issue of July 7, pp. 15915-15918, 1995 Minireview © 1995 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. damage in 12-13-nt-Iong oligomers and eucaryotes excise 27-29­ Excision Repair in nt-long fragments. This dual incision activity is referred to as Mammalian Cells* excision nuclease (excinuclease), The single-stranded gap gener­ ated by either type of excision is filled in by DNA polymerases and sealed by ligase. Aziz Saneart From the Department ofBiochemistry and Biophysics, Genetics ofExcision Repair University ofNorth Carolina School ofMedicine, The excision repair genes (uvrA, uvrB, and uvrC) of E. coli show Chapel Hill, North Carolina 27599 no homology to the human excision repair genes (1). In contrast, the sequences of excision repair genes in mammalian cells and There are two types of structural anomalies that lead to muta­ yeast are highly homologous, and the enzymology of excision repair tion, a permanent change in DNA sequence. The first class involves in these two systems is very similar (1, 3). Only mammalian exci­ normal bases in abnormal sequence context (mismatch, bulge, sion repair will be covered in this review. Three human diseases loop). The second class, which is referred to as DNA damage or are caused by a defect in excision repair (9): xeroderma pigmento­ DNA lesion, involves abnormal nucleotides (modified, fragmented, sum, Cockayne's syndrome, and trichothiodystrophy. cross-linked) in normal sequence context. DNA lesions, in addition Xeroderma pigmentosum patients suffer from photosensitivity, to causing mutations, also constitute replication and transcription photodermatoses including skin cancers, and in some cases from neurological abnormalities.
    [Show full text]
  • Molecular Mechanisms of Xeroderma Pigmentosum (XP) Proteins
    REVIEW Molecular mechanisms of xeroderma pigmentosum (XP) proteins Sandra C. Koch, Nina Simon, Charlotte Ebert and Thomas Carell* Center for Integrated Protein Science at the Department of Chemistry, Ludwig-Maximilians Universität München, Butenandtstr. 5-13, 81377 Munich, Germany Quarterly Reviews of Biophysics (2016), 49, e5, pages 1 of 32 doi:10.1017/S0033583515000268 Abstract. Nucleotide excision repair (NER) is a highly versatile and efficient DNA repair process, which is responsible for the removal of a large number of structurally diverse DNA lesions. Its extreme broad substrate specificity ranges from DNA damages formed upon exposure to ultraviolet radiation to numerous bulky DNA adducts induced by mutagenic environmental chemicals and cytotoxic drugs used in chemo- therapy. Defective NER leads to serious diseases, such as xeroderma pigmentosum (XP). Eight XP complementation groups are known of which seven (XPA–XPG) are caused by mutations in genes involved in the NER process. The eighth gene, XPV, codes for the DNA polymerase ɳ, which replicates through DNA lesions in a process called translesion synthesis (TLS). Over the past decade, detailed structural information of these DNA repair proteins involved in eukaryotic NER and TLS have emerged. These structures allow us now to understand the molecular mechanism of the NER and TLS processes in quite some detail and we have begun to understand the broad substrate specificity of NER. In this review, we aim to highlight recent advances in the process of damage recognition and repair as well as damage tolerance by the XP proteins. Key words: NER, xeroderma pigmentosum, crystal structures, DNA repair. 1. Introduction 2 1.1.
    [Show full text]