City University of New York (CUNY) CUNY Academic Works Publications and Research John Jay College of Criminal Justice 2010 Repair of mitomycin C mono- and interstrand cross-linked DNA adducts by UvrABC: a new model Mao-wen Weng New York University Yi Zheng New York University Vijay P. Jasti University of Connecticut Elise Champeil CUNY John Jay College Maria Tomasz CUNY Hunter College See next page for additional authors How does access to this work benefit ou?y Let us know! More information about this work at: https://academicworks.cuny.edu/jj_pubs/69 Discover additional works at: https://academicworks.cuny.edu This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] Authors Mao-wen Weng, Yi Zheng, Vijay P. Jasti, Elise Champeil, Maria Tomasz, Yinsheng Wang, Ashis K. Basu, and Moon-shong Tang This article is available at CUNY Academic Works: https://academicworks.cuny.edu/jj_pubs/69 6976–6984 Nucleic Acids Research, 2010, Vol. 38, No. 20 Published online 6 July 2010 doi:10.1093/nar/gkq576 Repair of mitomycin C mono- and interstrand cross-linked DNA adducts by UvrABC: a new model Mao-wen Weng1, Yi Zheng1, Vijay P. Jasti2, Elise Champeil3, Maria Tomasz4, Yinsheng Wang5, Ashis K. Basu2,* and Moon-shong Tang1,* 1Department of Environmental Medicine, Pathology, and Medicine, New York University School of Medicine, Tuxedo, New York 10987, 2Department of Chemistry, University of Connecticut, Storrs, Connecticut 06269, 3Department of Science, John Jay College, City University of New York, New York 10019, 4Department of Chemistry, Hunter College, City University of New York, New York, New York 10021 and 5Department of Chemistry, University of California, Riverside, CA 92521, USA Received March 17, 2010; Revised May 5, 2010; Accepted June 8, 2010 ABSTRACT INTRODUCTION Mitomycin C induces both MC-mono-dG and Mitomycin C (MC) is a potent antitumor drug. Although cross-linked dG-adducts in vivo. Interstrand this drug was discovered decades ago, it is still being cross-linked (ICL) dG-MC-dG-DNA adducts can actively used clinically, in combination with other prevent strand separation. In Escherichia coli cells, antitumor drugs, for the treatment of advanced cancers (1–4). Upon entering cells MC is chemically reduced to a UvrABC repairs ICL lesions that cause DNA bending. form that can react with deoxyguanosine (dG) residues The mechanisms and consequences of NER of ICL in DNA to form a MC-mono-dG adduct. Mitomycin C dG-MC-dG lesions that do not induce DNA bending can further form an intrastrand biadduct at –GG- sites remain unclear. Using DNA fragments containing a and an interstrand cross-linked (ICL) dG-MC-dG lesion MC-mono-dG or an ICL dG-MC-dG adduct, we at a –CG- site (5). If not repaired, these DNA adducts, found (i) UvrABC incises only at the strand contain- particularly ICL lesions, can block transcription and ing MC-mono-dG adducts; (ii) UvrABC makes three DNA replication and cause cell death (6). The antitumor types of incisions on an ICL dG-MC-dG adduct: type activity of MC is generally believed to be derived from 1, a single 50 incision on 1 strand and a 30 incision these interactions with DNA (7,8). on the other; type 2, dual incisions on 1 strand and Both eukaryotes and prokaryotes have the capacity to a single incision on the other; and type 3, dual repair MC-DNA adducts. The MC-mono-dG adducts are repaired by the nucleotide excision repair (NER) mecha- incisions on both strands; and (iii) the cutting nism, which is similar to what occurs with other bulky kinetics of type 3 is significantly faster than type 1 DNA adducts, such as benzo(a)pyrene diol epoxide-dG and type 2, and all of 3 types of cutting result in adducts and cyclobutane pyrimidine dimers (CPD) photo- producing DSB. We found that UvrA, UvrA+UvrB products (9,10). We previously have shown that UvrABC and UvrA+UvrB+UvrC bind to MC-modified DNA nuclease, the NER enzyme complex in Escherichia coli specifically, and we did not detect any UvrB- and cells, makes an incision 7–8 nt 50 to and 3–4 nt 30 to an UvrB+UvrC–DNA complexes. Our findings chal- MC-mono-dG adduct (10). It is likely that the intrastrand lenge the current UvrABC incision model. We biadduct at –GG- sites is repaired in the same fashion as propose that DSBs resulted from NER of ICL CPD and MC-mono-dG adducts, but the repair of ICL dG-MC-dG adducts contribute to MC antitumor dG-MC-dG lesion is less clear. The current understanding activity and mutations. of ICL lesions is derived primarily from results of studying *To whom correspondence should be addressed. Tel: +1 845 731 3585; Fax: +1 845 351 2385; Email: [email protected] Correspondence may also be addressed to Ashis K. Basu. Tel: +1 860 486 3965; Email: [email protected] ß The Author(s) 2010. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.5), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2010, Vol. 38, No. 20 6977 UvrABC nuclease incision on ICL thymidine-psoralen- oligonucleotide, [d(TTCTCCTATGGGAATTCTACGT thymidine (dT-psoralen-dT) lesions (11,12). However, ATAGAGAGGATATCCCC)]. The ligated 61-mer was results from studies on UvrABC recognition and repair isolated by gel electrophoresis and stored at À20C. of ICL dT-psoralen-dT lesions are inconsistent; while van Houten et al. (11,12) have shown that the UvrABC MC-cross-linked 61-mer duplex. The 61-bp fragments nuclease makes dual incisions only at the DNA strand containing a site-specific ICL dG-MC-dG adduct were with the furan side of ICL dT-psoralen-dT lesion, generated by hybridizing the MC-mono-adduct–con- Ramaswamy and Yeung (13) have demonstrated that taining 61-mer with its complementary 61-mer, and the the UvrABC nuclease can make incisions on both duplexes underwent further MC cross-linking using previ- 2 strands of this type of lesion. Sladek et al. (14,15) have ously described reaction conditions (18,19). The N - 2 demonstrated that the ICL dT-psoralen-dT adduct in a dG-MC-N -dG interstrand cross-link–containing 61-mer circular double-stranded DNA can be removed and duplex was purified by PAGE. repaired by the concerted actions of UvrABC incision, 32 recA-mediated DNA strand invasion and DNA polymer- Preparation of P-labeled DNA fragments ase I-mediated repair synthesis. The single-stranded (SS) 61-mer fragment containing an An ICL dG-MC-dG has two distinct structural differ- MC-mono-dG adduct or its complementary SS 61-mer ences from an ICL dT-psoralen-dT: 1, dG residues are was dissolved in 1 Â TE buffer (10 mM Tris–HCl, pH cross-linked instead of dT residues, and 2, the MC 8.0, 1 mM EDTA), 50-end labeled with g-32P-ATP by T4 moiety sticks out of the minor groove and does not polynucleotide kinase (New England, BioLab), hybridized induce DNA bending (16), while the psoralen moiety is to each other, and then separated in a nondenaturing 8% hidden within the base stacks and induces a 46.5o kink in polyacrylamide gel. The DS 61-bp fragments containing a the DNA helix (17). Similar to the ICL dG-MC-dG site-specific ICL dG-MC-dG were 50-end-labeled with adduct, it has been shown that an MC-mono-dG adduct g-32P-ATP by T4 polynucleotide kinase at both ends; the does not induce DNA bending (16). If an ICL dG-MC-dG DNA fragments were then digested with SmaI to generate adduct does not cause DNA bending then what are the single 50-end 32P-labeled fragments. signals for UvrABC to recognize this adduct as a DNA lesion? Since the 2 dGs in both DNA strands in this lesion UvrABC nuclease reactions are covalently bonded with the same MC molecule, how The UvrA, UvrB and UvrC proteins were purified as pre- does UvrABC incise an ICL dG-MC-dG adduct? viously described (9). An aliquot of the 32P-labeled 61-bp To address these questions, we determined the recogni- DNA fragments (0.6–2.0 nM) was reacted with the UvrA, tion and incision of two types of MC–DNA lesions by UvrB and UvrC proteins (15 nM each) in UvrABC UvrABC nuclease, using substrates of 61-bp DNA frag- reaction buffer (50 mM Tris–HCI, pH 7.5, 10 mM ments containing either a site-specific ICL dG-MC-dG or MgC12, 100 mM KC1, 1 mM ATP and 1 mM DTT) at MC-mono-dG adduct at the same site. 37C for different time periods. Kinetics of UvrABC incision MATERIALS AND METHODS The 32P-labeled DS DNA fragments containing a site- Materials specific MC adduct were pre-incubated with 15 nM The restriction enzymes SmaI and SnaBI were obtained UvrA and 15 nM UvrB at 37C in UvrABC reaction from Roche. T4 polynucleotide kinase was obtained buffer and the reaction was then started with the from DuPont New England Biolabs. Acrylamide, bis- addition of UvrC (15 nM). The UvrABC reaction acrylamide, APS and yeast tRNA were purchased from mixtures were sampled at different time intervals and the the Sigma Chemical Company. The g-32P-ATP was resultant DNAs were purified and separated in a 12% purchased from Perkin Elmer. polyacrylamide denaturing or non-denaturing gel.