US007582457B2

(12) United States Patent (10) Patent No.: US 7,582.457 B2 Dunn-Coleman et al. (45) Date of Patent: Sep. 1, 2009

(54) METHOD FOR THE PRODUCTION OF Blanche et al., Purification and Characterization of S-Adenosyl-L- 1,3-PROPANEDIOL BY RECOMBINANT Methionine: Uroporphyrinogen III Methyltransferase From ORGANISMS COMPRISING GENES FOR Pseudomonas Dennitrificans, Journal of Bacteriology, Aug. 1989, COENZYME B12 SYNTHESIS vol. 171, No. 8, p. 4222-4231. Brey et al., Cloning of Multiple Genes Involved With Cobalamin (Vitamin B12) Biosynthesis in Bacillus megaterium, Journal of Bac (75) Inventors: Nigel S. Dunn-Coleman, Los Gatos, CA teriology, Aug. 1986, vol. 167. No. 2, p. 623-630. (US); Anthony Gatenby, Wilmington, Jeter et al., Cobalamin (Vitamin B12) Biosynthetic Genes of Salmo DE (US); Fernando Valle, Burlingame, nella typhimurium, Journal of Bacteriology., Jul. 1987, vol. 169, No. CA (US) 7, p. 3189-3 198. Crouzetet al., Nucleotide Sequence of a Pseudomonas Denitrificans (73) Assignees: E.I. du Pont de Nemours and 5.4-Kilobase DNA Fragment Containing Five COB Genes and Iden Company, Wilmington, DE (US); tification of Structural Genes Encoding S-Adenosyl-L-Methionine: Genencor International, Palo Alto, CA Journal of Bacteriology, Oct. 1990, vol. 172, No. 10 P5968-5979. Crouzet et al., Genetic and Sequence Analysis of an 8.7 Kilobase (US) Pseudomonas Denitrificans Fragment Carrying Eight Genes Involved in Transformation of Precorrin-2 to Cobyrinic Acid, Journal (*) Notice: Subject to any disclaimer, the term of this of Bacteriology, Oct. 1990, vol. 172, No. 19, p. 5980-5990. patent is extended or adjusted under 35 Crouzet et al., Nucleotide Sequence and Genetic Analysis of a 13.1- U.S.C. 154(b) by 0 days. Kilobase-Pair. ... Journal of Bacteriology, Oct. 1991, vol. 173, No. 19, p. 6074-6087. (21) Appl. No.: 11/479,194 Daniel et al., Purification of 1.3-Propanediol Dehydrogenase From Citrobacter. ... Journal of Bacteriology, Apr. 1995, vol. 177, No. 8, (22) Filed: Jun. 29, 2006 p.2151-2156. Debussche et al., Purification and Partial Characterization of (65) Prior Publication Data COB(I)Alamin Adenosyltransferase From Pseudomonas Denitrificans, Journal of Bacteriology, Oct. 1991, vol. 173, No. 19, p. US 2006/O246562 A1 Nov. 2, 2006 6300-6302. Luers et al., Glycerol Conversion to 1.3-Propanediol by Clostridium Related U.S. Application Data pasteurianum . . . . Fems Microbiology Letters, vol. 154, 1997, p. 337-345. (62) Division of application No. 09/310,001, filed on May Lundrigan et al. Altered Cobalamin Metabolism in Escherichia coli 11, 1999, now Pat. No. 7,074,608. Coli BTUR Mutants Affects BTUB Gene Regulation, Journal of (60) Provisional application No. 60/085,214, filed on May Bacteriology, Jan. 1989, vol. 171, No. 1, p. 154-161. Macis et al., Properties and Sequence of the Coenzyme B12-Depen 12, 1998. dent Glycerol Dehydratase of Clostridium pasteurianum, FEMS Microbiology Letters, vol. 164, 1998, p. 21-28. (51) Int. Cl. Seyfried et al., Cloning, Sequencing, and Overexpression of the CI2P 7/18 (2006.01) Genes Encoding Coenzyme B-12-Dependent Glycerol Dehydratase (52) U.S. Cl...... 435/158; 435/252.33: 435/254.2: of Citrobacter freundii, Journal of Bacteriology, Oct. 1996, vol. 178, 435/325; 435/189: 435/193; 435/419,536/23.2 No. 19, p. 5793-5796. (58) Field of Classification Search ...... 435/158, Bobik et al., Propanediol Utilization Genes (PDU) of Salmonella 435/252.33, 254.2, 325, 189, 193, 419, 536/23.2 typhimurium: Three Genes for the Propanediol Dehydratase, Journal See application file for complete search history. of Bacteriology, Nov. 1997, vol. 179, No. 21, p. 6633-6639. Suh et al., Purification and Initial Characterization of the ATP:Cor (56) References Cited rinoid Adenosyltransferase Encoded by the Coba Gene of Salmonella typhimurium, Journal of Bacteriology, Feb. 1995, vol. 177, No. 4, p. U.S. PATENT DOCUMENTS 921-92.5 Tobimatsu et al., Molecular Cloning, Sequencing and Characteriza 5,599,689 A 2/1997 Haynie et al. tion of the Genes for Adenosylcobalamin-Dependent Diol 5,633,362 A 5/1997 Nagarajan et al. Dehydratase of Klebsiella pneumoniae, Bioscience Biotechnology 5,686,279 A 11/1997 Finer et al. Biochemistry, Feb. 1998, vol. 62, No. 9, p. 1774-1777. 6,013,494. A 1/2000 Nakamura et al...... 435,158 Tobimatsu et al., Molecular Cloning, Sequencing, and Expression of the Genes Encloding Adenosylcobalamin-Dependent Diol Dehydrase FOREIGN PATENT DOCUMENTS of Klebsiella oxytoca, the Journal of Biological Chemistry, Mar. 1995, vol. 270, No. 13, p. 7142-7148. EP O516647 B1 12/1998 WO WO 87/O1391 3, 1987 (Continued) WO WO96,35796 11, 1996 WO WO98,21339 5, 1998 Primary Examiner Tekchand Saidha WO WO98,21340 5, 1998 WO WO98,21341 5, 1998 (57) ABSTRACT Recombinant organisms are provided comprising genes OTHER PUBLICATIONS encoding cob(II)alamin reductase, cob(I)alamin adenosyl transferase, glycerol dehydratase and 1,3-propanediol oxi Suh et al. Gene (1993) 129: 93-97.* Bobiket al. J. Bacteriology (1997) 179(21): 6633-6639.* doreductase activities useful for the production of 1,3-pro Cameron et al., Cloning and Analysis of Genes Involved in Coen panediol from a variety of carbon substrates. Zyme B12 Biosynthesis in Pseudomonas Denitrificans, Journal of Bacteriology, Jan. 1989 p. 547-557. 9 Claims, No Drawings US 7,582.457 B2 Page 2

OTHER PUBLICATIONS Suh et al., Cloning Sequencing and Overexpression of cobA Which Enclodes ATP: Corrinoid Adenosyltransferase in Salmonella Tobimatsu et al., Cloning, Sequencing, and High Level Expression of typhimurium, Gene, 1993, vol. 129, p. 6633-6639. the Genes Encoding Adenosylcobalamin-Dependent Glycerol GenBank Accession No. U18813 also GI: 1381127, Oct. 10, 2000. Dehydrase of Klebsiella pneumoniae, the Journal of Biological GenBank Accession No. Z38060 also GI:557796, Apr. 18, 2005. Chemistry, Sep. 1996, vol. 271, No. 37 p. 22352-22357. GenBank Accession No. M55989 also GI: 147837, Apr. 26, 1993. Genbank Accession No. AAL20944. Propanediuol Utilization GenBank Accession No. Z28059 also GI:557761, Apr. 18, 2005. Dehydratase, Large Subunit (Salmonella typhimurium LT2). GenBank Accession No. M20938 also GI: 146176. Dec. 20, 1995. Genbank Accession No. ECU17433. Escherichia coli, Putative GenBank Accession No. U32164 also GI:974331, Feb. 3, 1996. Dehydrogenase and Putative Oxidoreductase (ycik) Genes, Com GenBank Accession No. X91067 also GI:984 177, Jan. 16, 2006. plete CDS, and (btuR) and (sohB) Genes, 5+UTR: (1994). GenBank Accession No. Z35169 also GI:51 1134, Jun. 12, 2006. Skraly et al. Construction and Characterization of a 1.3-Propanediol GenBank Accession No. Z74071 also GI: 1430993, Apr. 18, 2005. Operon. Applied and Environ Mental Microbiology, Jan. 1998, vol. GenBank Accession No. D45071 also GI: 868005, Jan. 28, 2003. 64(1), p. 98-105. GenBank Accession No. U09771 also GI: 1229153, Apr. 6, 2001. Genbank Accession No. AE008776. Salmonella typhimurium LT2, Accession No. Z47047, Created Dec. 22, 1994. Section 84 of 224 of the Complete Genome. (2001). * cited by examiner US 7,582,457 B2 1. 2 METHOD FOR THE PRODUCTION OF droxyacetone phosphate (DHAP) by a DHAkinase (Equation 1,3-PROPANEDIOL BY RECOMBINANT 4), becomes available for biosynthesis and for Supporting ORGANISMS COMPRISING GENES FOR ATP generation via, for example, glycolysis. COENZYME B12 SYNTHESIS Glycerol+NAD"->DHA+NADH--H (Equation 3) 5 This application is a divisional of U.S. patent application Ser. No. 09/310,001 filed May 11, 1999, now U.S. Pat. No. DHA-ATP-DHAP-ADP (Equation 4) 7,074,608, which claims the benefit of U.S. Provisional In contrast to the 1,3-propanediol pathway, this pathway may Application No. 60/085,214 filed May 12, 1998, both of provide carbon and energy to the cell and produces rather than which are incorporated by reference herein in their entireties. 10 consumes NADH. FIELD OF INVENTION In Klebsiella pneumoniae and Citrobacter freundii, the genes encoding the functionally linked activities of glycerol The present invention relates to the field of molecular biol dehydratase (dhaB), 1,3-propanediol oxidoreductase (dhaT), ogy and the use of recombinant organisms for the production 15 glycerol dehydrogenase (dha)), and dihydroxyacetone of 1,3-propanediol. More specifically it describes the expres kinase (dhaK) are encompassed by the dha regulon. The dha sion of cloned genes that affect the transformation of coen regulons from Citrobacter and Klebsiella have been Zyme B precursors to coenzyme B in conjunction with expressed in Escherichia coli and have been shown to convert genes that effectively convert a carbon substrate to 1,3-pro glycerol to 1,3-propanediol. panediol. The biological production of 1,3-propanediol requires glycerol as a Substrate for a two-step sequential reaction in BACKGROUND which a dehydratase enzyme (typically a coenzyme B dependent dehydratase) converts glycerol to an intermediate, 1.3-Propanediol is a monomer useful in the production of 3-hydroxypropionaldehyde, which is then reduced to 1,3- polyester fibers and the manufacture of polyurethanes and 25 propanediol by a NADH- (or NADPH) dependent oxi cyclic compounds. doreductase. The complexity of the cofactor requirements A variety of chemical routes to 1,3-propanediol are known. necessitates that a whole cell catalyst be used for an industrial For example, 1,3-propanediol is prepared from 1) ethylene process incorporating this reaction sequence for the produc oxide over a catalyst in the presence of phosphine, water, tion of 1,3-propanediol. A process for the production of 1,3- carbon monoxide, hydrogen and an acid; 2) by the catalytic 30 propanediol from glycerol using an organism containing a solution phase hydration of acrolein followed by reduction; or coenzyme B12-dependent diol dehydratase is described in 3) from hydrocarbons such as glycerol, reacted in the pres U.S. Pat. No. 5,633,362 (Nagarajan et al.). However, the ence of carbon monoxide and hydrogen over catalysts having process is not limited to the use of glycerol as feedstock. atoms from Group VIII of the periodic table. Although it is Glucose and other carbohydrates are suitable substrates and, possible to generate 1,3-propanediol by these chemical meth 35 recently, these substrates have been shown to be substrates for ods, they are expensive and generate waste streams contain 1,3-propanediol production. Carbohydrates are converted to ing environmental pollutants. 1,3-propanediol using mixed microbial cultures where the It has been known for over a century that 1,3-propanediol carbohydrate is first fermented to glycerol by one microbial can be produced from the fermentation of glycerol. Bacterial species and then converted to 1,3-propanediol by a second strains able to produce 1,3-propane-diol have been found, for 40 microbial species U.S. Pat. No. 5,599,689 (Haynie et al.). example, in the groups Citrobacter; Clostridium, Entero However, a single organism able to convert carbohydrates to bacter, Ilyobacter, Klebsiella, Lactobacillus, and Pelobacter. 1,3-propanediol is preferred for reasons of simplicity and In each case studied, glycerol is converted to 1,3-propanediol economy. Such an organism is described in U.S. Pat. No. in a two-step, enzyme-catalyzed reaction sequence. In the 5,686,276 (Laffend et al.); and in U.S. Ser. No. 60/030,601 first step, a dehydratase catalyzes the conversion of glycerol 45 and U.S. Ser. No. 08/969,683. to 3-hydroxypropionaldehyde (3-HP) and water (Equation Glycerol dehydratase and diol dehydratase are coenzyme 1). In the second step, 3-HP is reduced to 1,3-propanediol by B-dependent enzymes which catalyze the conversion of a NAD"-linked oxidoreductase (Equation 2). glycerol to 3-HP (Toraya, T. In Metalloenzymes Involving Glycerol-3-HP+HO (Equation 1) Amino Acid-Residue and Related Radicals; Sigel, H. and 50 Sigel, A., Eds.; Metal Ions in Biological Systems; Marcel 3-HP+NADH--H"-> 1,3-Propanediol--NAD" (Equation 2) Dekker: New York, 1994; Vol. 30, pp 217-254). Coenzyme B may be provided by the whole cell catalyst through de The 1,3-propanediol is not metabolized further and, as a novo synthesis. However, if the coenzyme B requirement of result, accumulates in high concentration in the media. The the B-dependent dehydratases exceeds the de novo synthe overall reaction consumes a reducing equivalent in the form 55 sis capacity of the whole cell catalyst or if the whole cell of a cofactor, reduced B-nicotinamide adenine dinucleotide catalyst lacks the de novo synthesis capacity, then coenzyme (NADH), which is oxidized to nicotinamide adenine dinucle B or coenzyme B precursors may be provided in the reac otide (NAD). tion medium. Due to the cost and instability of coenzyme B12, The production of 1,3-propanediol from glycerol is gener medium Supplementation with coenzyme B precursors is ally performed under anaerobic conditions using glycerol as 60 preferred; and this then requires the conversion of these pre the sole carbon Source and in the absence of other exogenous cursors to coenzyme B. In addition, glycerol dehydratase reducing equivalent acceptors. For example, in strains of and diol dehydratase undergo inactivation which involves Citrobacter, Clostridium, and Klebsiella, a parallel pathway loss of the 5'-deoxyadenosyl moiety from coenzyme B and for glycerol operates under these conditions which first the formation of hydroxocobalamin and/or cob(II)alamin. involves oxidation of glycerol to dihydroxyacetone (DHA) 65 (Toraya, T., Supra.) Thus, readenosylation of hydroxocobal by a NAD"- (or NADP-) linked glycerol dehydrogenase amin and/or cob(II)alamin is required for the recycling of (Equation 3). The DHA, following phosphorylation to dihy coenzyme B12. US 7,582,457 B2 3 4 Vitamin B (cyanocobalamin) and hydroxocobalamin are a cob(I)alamin adenosyltransferase activity, wherein at least stable, commercially available coenzyme B precursors one of the genes of (i)(c), (i)(d), or (i)(e) is introduced into the which are readily taken up by microorganisms. Conversion of host cell. these precursors, both Co(III) species, to coenzyme B (5'- deoxyadenosylcobalamin) involves: 1.) reduction of Co(III) BRIEF DESCRIPTION OF SEQUENCE LISTING to Co(II) (i.e., formation of cob(II)alamin by a aquacobal amin reductase), 2.) reduction of Co(II) to Co(I) (i.e., forma Applicants have provided 25 sequences in conformity with tion of cob(I)alamin by a cob(II)alamin reductase), and 3.) Rules for the Standard Representation of Nucleotide and ATP-dependent adenosylation of cob(I)alamin by a cob(I) Amino Acid Sequences in Patent Applications (Annexes I and alamin adenosyltransferase to form coenzyme B. Enzymes 10 II to the Decision of the President of the EPO, published in associated with these functions have been described for Sal Supplement No. 2 to OJ EPO, 12/1992), with 37 C.F.R. monella typhimurium, Pseudomonas denitrificans, and 1.821-1.825 and Appendices A and B (Requirements for Clostridium tetanomorphun. Suh and Escalante-Semerena, Application Disclosures Containing Nucleotides and/or J. Bacteriol. 177,921–925 (1995) and references therein. Amino Acid Sequences) with World Intellectual Property Similar systems have been described for Euglena gracilis 15 Organization (WIPO) Standard ST.25 (1998) and the (Watanabe et al., Arch. Biochem. Biophys. 305, 421-427 sequence listing requirements of the EPO and PCT (Rules 5.2 (1993)), Chlamydomonas reinhardtii (Watanabe et al., Bio and 49.5(a-bis), and Section 208 and Annex C of the Admin chim. Biophys. Acta 1075, 36-41 (1991)), and mammalian istrative Instructions). The Sequence Descriptions contain the cells (Pezacka, E. H., Biochim. Biophys. Acta 1157, 167-177 one letter code for nucleotide sequence characters and the (1993)). three letter codes for amino acids as defined in conformity The problem to be solved is how to biologically produce with the IUPAC-IYUB standards described in Nucleic Acids 1,3-propanediol by a single recombinant organism contain Research 13:3021-3030 (1985) and in the Biochemical Jour ing genes facilitating the synthesis of B coenzyme in the nal 219 (No. 2):345-373 (1984) which are herein incorpo presence of a B-dependent dehydratase enzyme. rated by reference. 25 SEQID NO:1 is the nucleotide sequence for btuR, encod SUMMARY OF THE INVENTION ing the E. coli cob(I)alamin adenosyltransferase enzyme. SEQID NO:2 is the nucleotide sequence for cobA, encod Applicants have solved the stated problem. They provide a ing the Salmonella typhimurium cob(I)alaminadenosyltrans single organism capable of the dehydratase-mediated biocon ferase enzyme. version of a fermentable carbon source directly to 1,3-pro 30 SEQID NO:3 is the nucleotide sequence for cobO, encod panediol, where B coenzyme synthesis is effected by for ing the Pseudomonas denitrificans cob(I)alamin adenosyl eign genes encoding aquacobalamin reductase, cob(II)alamin transferase enzyme. reductase and cob(I)alamin adenosyltransferase activities. SEQID NO:4 is the nucleotide sequence for dhaE1, encod Glucose and glycerol are used as model Substrates and the ing the C. Subunit of the glycerol dehydratase enzyme. bioconversion is applicable to any existing microorganism. 35 SEQID NO:5 is the nucleotide sequence for dhaE2, encod The present invention provides a process for the production ing the B subunit of the glycerol dehydratase enzyme. of 1,3-propanediol from a transformed host cell comprising SEQID NO:6 is the nucleotide sequence for dhaE3, encod (i) contacting a transformed host cell with at least one fer ing the Y subunit of the glycerol dehydratase enzyme. mentable carbon Source and an effective amount of coenzyme SEQID NO:7 the nucleotide sequence for dhaT, encoding B precursor whereby 1,3-propanediol is produced; wherein 40 Klebsiella oxidoreductase enzyme. said host cell comprises: a) at least one copy of a gene encod SEQID NO:8 is a universal primer used in the isolation of ing a protein having a dehydratase activity; b) at least one the Cob(II)alamin reductase gene. copy of a gene encoding a protein having an oxidoreductase SEQID NO:9 is the nucleotide sequence for theyciK gene activity; c) at least one copy of a gene encoding a protein islolated from E. coli. having a aquacobalamin reductase activity; d) at least one 45 SEQID NO:10 is the nucleotide sequence for PHK28-26a copy of a gene encoding a protein having a cob(II)alamin 12.1 kb EcoRI-SalI fragment containing the dha operon. reductase activity; and e) at least one copy of a gene encoding SEQ ID NO:11 is the nucleotide sequence for a multiple a protein having a cob(I)alaminadenosyltransferase activity; cloning site and terminator sequence used in the construction wherein at least one of the genes of(c), (d) or (e) is introduced of the expression vector pTacIQ. into the host cell, and (ii) recovering the 1,3-propanediol 50 SEQID NO:12-19 are primers used in the construction of produced in (i). The dehydratase activity of (i)(a) may be from expression vectors of the present invention. either a glycerol dehydratase enzyme or a diol dehydratase SEQID NO:20 is the nucleotide sequence for an insert in enzyme. The process may be regulated by selectively inhib pCL1920, used in the construction of the expression cassette iting any one of the genes of (i)(c), (i)(d), or (i)(e) to alter the for dhaT and dhaB(1.2.3). metabolism of coenzyme B precursor. The effective amount 55 SEQID NO:21 is the nucleotide sequence for the glucose of coenzyme B precursor is at a 0.1- to 10.0-fold molar ratio isomerase promoter sequence from Streptomyces. to the amount of dehydratase present, the improved produc SEQID NO:22-25 are primers used in the construction of tion measured against a bioprocess where the genes are not expression vectors of the present invention. present in multicopy. The invention further provides a transformed host organ 60 DETAILED DESCRIPTION OF THE INVENTION ism containing (a) at least one copy of a gene encoding a protein having a dehydratase activity; (b) at least one gene The present invention provides a method for biologically encoding a protein having an oxidoreductase activity; (c) at producing 1,3-propanediol from a fermentable carbon Source least one copy of a gene encoding a protein having an aqua in a single recombinant organism. The method incorporates a cobalamin reductase activity; (d) at least one copy of a gene 65 microorganism containing genes encoding glycerol dehy encoding a protein having a cob(II)alamin reductase activity; dratase, 1,3-propanediol oxidoreductase, aquacobalamin (e) and at least one copy of a gene encoding a protein having reductase, cob(II)alamin reductase, and cob(I)alaminadeno US 7,582,457 B2 5 6 Syltransferase. The recombinant microorganism is contacted 3-hydroxypropionaldehyde to 1,3-propanediol. 1.3-Pro with a carbon Substrate (preferably glucose or glycerol) and panediol oxidoreductase includes, for example, the polypep 1,3-propanediol is isolated from the growth media. tide encoded by the dhaT gene (GenBank U09771, U30903) The present method provides a rapid, inexpensive and envi and is identified as SEQID NO:7. ronmentally responsible source of 1,3-propanediol monomer The terms “polypeptide' and “protein’ are used inter useful in the production of polyesters and other polymers. changeably. The following definitions are to be used to interpret the The terms "fermentable carbon substrate” and "ferment claims and specification. able carbon source' refer to a carbon source capable of being The term "aquacobalamin reductase' refers to an enzyme metabolized by host organisms of the present invention and responsible for the reduction of aquacobalamin to cob(II) 10 particularly carbon Sources selected from the group consist alamin which involves the reduction of Co(III) to Co(II). ing of monosaccharides, oligosaccharides, polysaccharides, Typical of aquacobalamin reductase is EC 1.6.99.8. glycerol, dihydroxyacetone and one-carbon Substrates or The term “cob(II)alamin reductase' refers to an enzyme mixtures thereof. responsible for the reduction of cob(II)alamin to cob(I) The terms “host cell' or “host organism” refer to a micro alamin which involves the reduction of Co(II) to Co(I). Typi 15 organism capable of receiving foreign or heterologous genes cal of cob(II)alamin reductase is EC 1.6.99.9. For purposes of and of expressing those genes to produce an active gene the present invention, the terms “aquacobalamin reductase' product. and “cob(II)alamin reductase' include those reductases “Gene' refers to a nucleic acid fragment that expresses a which catalyze the corresponding reactions starting from specific protein, including regulatory sequences preceding (5' Vitamin B. non-coding sequences) and following (3' non-coding The term “cob(I)alamin adenosyltransferase' refers to an sequences) the coding sequence. “Native gene' refers to a enzyme responsible for the transfer of a deoxyadenosyl moi gene as found in nature with its own regulatory sequences. ety from ATP to the reduced corrinoid. Typical of cob(I) "Chimeric gene' refers to any gene that is not a native gene, alamin adenosyltransferase is EC 2.5.1.17. Cob(I)alamin comprising regulatory and coding sequences that are not adenosyltransferase is encoded by the gene “btuR' (GenBank 25 found together in nature. Accordingly, a chimeric gene may M21528) (SEQID NO: 1) in Escherichia coli, “cobA' (Gen comprise regulatory sequences and coding sequences that are Bank L08890) (SEQ ID NO:2) in Salmonella typhimurium, derived from different sources, or regulatory sequences and and “cobO” (SEQ ID NO3) (GenBank M62866) in coding sequences derived from the same source, but arranged Pseudomonas denitrificans. in a manner different than that found in nature. "Endogenous The terms “coenzyme B and "adenosylcobalamin' are 30 gene' refers to a native gene in its natural location in the used interchangeably to mean 5'-deoxyadenosylcobalamin. genome of an organism. A “foreign' gene refers to a gene not Hydroxocobalamin is the derivative of coenzyme B where normally found in the host organism, but that is introduced the upper axial 5'-deoxyadenosyl ligand is replaced with a into the host organism by gene transfer. Foreign genes can hydroxy moiety. Aquacobalamin is the unprotonated form of comprise native genes inserted into a non-native organism, or hydroxocobalamin. The terms "vitamin B” and “cyanoco 35 chimeric genes. A “transgene' is a gene that has been intro balamin' are used interchangeably and refer to the derivative duced into the genome by a transformation procedure. of coenzyme B where the upper axial 5'-deoxy'5'-adenosyl The terms “encoding and “coding refer to the process by ligand is replaced with a cyano moiety. The term “coenzyme which a gene, through the mechanisms of transcription and B precursor refers to a derivation of coenzyme B where translation, produces an amino acid sequence. It is under the upper axial 5'-deoxyadenosyl ligand is replaced. An 40 stood that the process of encoding a specific amino acid “effective amount of coenzyme B precursor will mean that sequence includes DNA sequences that may involve base coenzyme B precursor is present in the system at approxi changes that do not cause a change in the encoded amino acid, mately a 0.1- to 10.0-fold molar ratio to the amount of dehy or which involve base changes which may alter one or more dratase enzyme present. amino acids, but do not affect the functional properties of the The terms “glycerol dehydratase' or “dehydratase 45 protein encoded by the DNA sequence. It is therefore under enzyme” refer to the polypeptide(s) responsible for a coen stood that the invention encompasses more than the specific Zyme B-dependent enzyme activity that is capable of exemplary sequences. Modifications to the sequence, such as isomerizing or converting a glycerol molecule to the product deletions, insertions, or Substitutions in the sequence which 3-hydroxypropionaldehyde. For the purposes of the present produce silent changes that do not substantially affect the invention the dehydratase enzymes include a glycerol dehy 50 functional properties of the resulting protein molecule are dratase (GenBank U09771, U30903) and a diol dehydratase also contemplated. For example, alterations in the gene (GenBank D45071) having preferred substrates of glycerol sequence which reflect the degeneracy of the genetic code, or and 1,2-propanediol, respectively. Glycerol dehydratase of K which result in the production of a chemically equivalent pneumoniae ATCC 25955 is encoded by the genes dhaE1, amino acidata given site, are contemplated. Thus, a codon for dhaB2, and dhaE3 identified as SEQ ID NOS:4, 5, and 6 55 the amino acid alanine, a hydrophobic amino acid, may be respectively. The dhaB1, dhaB2 and dhaB3 genes code for the Substituted by a codon encoding another less hydrophobic C, B, and Y subunits of the glycerol dehydratase enzyme, residue (such as glycine), or a more hydrophobic residue respectively. Glycerol dehydratase and diol dehydratase (such as Valine, leucine, or isoleucine). Similarly, changes enzymes are complexes (withan CBY Subunit composition) which result in Substitution of one negatively charged residue that bind coenzyme B with a 1:1 stoichiometry. 60 for another (Such as aspartic acid for glutamic acid), or one An "effective amount” of coenzyme B precursor (or vita positively charged residue for another (such as lysine for min B) will mean that coenzyme B precursor (or Vitamin arginine), can also be expected to produce a biologically B) is present in the system at a molar ratio of between 0.1 equivalent product. Nucleotide changes which result in alter and 10, relative to the dehydratase enzyme. ation of the N-terminal and C-terminal portions of the protein The terms “oxidoreductase' or “1,3-propanediol oxi 65 molecule would also not be expected to alter the activity of the doreductase' refer to the polypeptide(s) responsible for an protein. In some cases, it may in fact be desirable to make enzyme activity that is capable of catalyzing the reduction of mutants of the sequence in order to study the effect of alter US 7,582,457 B2 7 8 ation on the biological activity of the protein. Each of the sequences, gene specific oligonucleotide probes comprising proposed modifications is well within the routine skill in the 20-30 contiguous nucleotides may be used in sequence-de art, as is determination of retention of biological activity in pendent methods of gene identification (e.g., Southern the encoded products. Moreover, the skilled artisan recog hybridization) and isolation (e.g., in situ hybridization of nizes that sequences encompassed by this invention are also 5 bacterial colonies or bacteriophage plaques). In addition, defined by their ability to hybridize, under stringent condi short oligonucleotides of 12-15 bases may be used as ampli tions (0.1xSSC, 0.1% SDS, 65° C.), with the sequences fication primers in PCR in order to obtain a particular nucleic exemplified herein. acid fragment comprising the primers. Accordingly, a “sub The term “substantially similar refers to the relationship stantial portion' of a nucleotide sequence comprises enough between nucleic acid fragments wherein the second contains 10 of the sequence to specifically identify and/or isolate a changes in one or more nucleotide bases relative to the first nucleic acid fragment comprising the sequence. The instant resulting in Substitution of one or more amino acids, but with specification teaches partial or complete amino acid and no affect on the functional properties of the protein encoded nucleotide sequences encoding one or more particular reduc by the DNA sequence. “Substantially similar also refers to tase proteins. The skilled artisan, having the benefit of the the effect of modifications (such as deletion or insertion of 15 sequences as reported herein, may now use all or a substantial one or more nucleotide bases) to the nucleic acid fragment of portion of the disclosed sequences for purposes known to the instant invention that do not substantially affect the func those skilled in this art. Accordingly, the instant invention tional properties of the resulting transcript vis-a-vis the abil comprises the complete sequences as reported in the accom ity to mediate alteration of gene expression by antisense or panying Sequence Listing, as well as Substantial portions of co-Suppression technology or of alteration of the functional those sequences as defined above. properties of the resulting protein molecule. It is therefore The term “expression” refers to the transcription and trans understood that the invention encompasses more than the lation to gene product from a gene coding for the sequence of specific exemplary sequences. the gene product. For example, it is well-known that alterations in a gene The terms “plasmid, “vector', and “cassette' refer to an which result in the production of a chemically equivalent 25 extra chromosomal element often carrying genes which are amino acid at a given site may nevertheless not effect the not part of the central metabolism of the cell, and usually in functional properties of the encoded protein. Thus, a codon the form of circular double-stranded DNA molecules. Such for the amino acidalanine, a hydrophobic amino acid, may be elements may be autonomously replicating sequences, Substituted by a codon encoding another less hydrophobic genome integrating sequences, phage or nucleotide residue(such as glycine) or a more hydrophobic residue(such 30 sequences, linear or circular, of a single- or double-stranded as Valine, leucine, or isoleucine). Similarly, changes which DNA or RNA, derived from any source, in which a number of result in substitution of one negatively charged residue for nucleotide sequences have been joined or recombined into a another (such as aspartic acid for glutamic acid) or one posi unique construction which is capable of introducing a pro tively charged residue for another (Such as lysine for arginine) moter fragment and DNA sequence for a selected gene prod can also be expected to produce a functionally equivalent 35 uct along with appropriate 3' untranslated sequence into a product. Nucleotide changes which result in alteration of the cell. “Transformation cassette' refers to a specific vector N-terminal and C-terminal portions of the protein molecule containing a foreign gene and having elements in addition to would also not be expected to alter the activity of the protein. the foreign gene that facilitate transformation of a particular Each of the proposed modifications is well within the routine host cell. “Expression cassette' refers to a specific vector skill in the art, as is determination of retention of biological 40 containing a foreign gene and having elements in addition to activity of the encoded products. Moreover, the skilled artisan the foreign gene that allow for enhanced expression of that recognizes that Substantially similar sequences encompassed gene in a foreign host. by this invention are also defined by their ability to hybridize, The terms “transformation' and “transfection” refer to the under stringent conditions (0.1xSSC, 0.1% SDS, 65° C.), acquisition of new genes in a cell after the incorporation of with the sequences exemplified herein. Preferred substan 45 nucleic acid. The acquired genes may be integrated into chro tially similar nucleic acid fragments of the instant invention mosomal DNA or introduced as extrachromosomal replicat are those nucleic acid fragments whose DNA sequences are at ing sequences. The term “transformant” refers to the product least 80% identical to the DNA sequence of the nucleic acid of a transformation. fragments reported herein. More preferred nucleic acid frag The term “genetically altered’ refers to the process of ments are at least 90% identical to the identical to the DNA 50 changing hereditary material by transformation or mutation. sequence of the nucleic acid fragments reported herein. Most The term “regulate” refers to control of the production of preferred are nucleic acid fragments that are at least 95% 1,3-propanediol by selective inhibition of the genes encoding identical to the DNA sequence of the nucleic acid fragments a protein having an aquacobalamin reductase activity, of the reported herein. genes encoding a protein having a cob(II)alamin reductase A “substantial portion of an amino acid or nucleotide 55 activity, or of the genes encoding a protein having a cob(I) sequence comprises enough of the amino acid sequence of a alamin adenosyltransferase activity. polypeptide or the nucleotide sequence of a gene to putatively The present invention involves the construction of a pro identify that polypeptide or gene, either by manual evaluation duction organism that incorporates the genetic machinery of the sequence by one skilled in the art, or by computer necessary to convert a fermentable carbon substrate to 1,3- automated sequence comparison and identification using 60 propanediol, in conjunction with genes encoding enzymes algorithms such as BLAST (Basic Local Alignment Search needed for the biotransformation of coenzyme B precursor Tool; Altschul, S. F., et al., (1993).J. Mol. Biol. 215:403-410; to coenzyme B. The genes involved in 1,3-propanediol see also www.ncbi.nlm.nih.gov/BLAST/). In general, a production will include a dehydratase gene (typically a glyc sequence often or more contiguous amino acids or thirty or erol or diol dehydratase) and an oxidoreductase as well as more nucleotides is necessary in order to putatively identify a 65 other proteins expected to aid in the assembly or in maintain polypeptide or nucleic acid sequence as homologous to a ing the stability of the dehydratase enzyme. These genes may known protein or gene. Moreover, with respect to nucleotide be transgenes and introduced into the host cell, or may be US 7,582,457 B2 10 endogenous. Genes responsible for the conversion of coen dhal) encoding a glycerol dehydrogenase, dhaR encoding a Zyme B precursor to coenzyme B will include at least one regulatory protein, dhaT encoding a 1,3-propanediol oxi copy of a gene encoding a protein having a aquacobalamin doreductase as well as dhaE1, dhaB2, and dhaB3 encoding reductase activity; at least one copy of a gene encoding a the alpha, beta and gamma Subunits of a glycerol dehydratase, protein having a cob(II)alamin reductase activity, and at least 5 respectively. Additionally, gene products designated as pro one copy of a gene encoding a protein having a cob(I)alamin tein X, protein 1, protein 2, and protein 3 (corresponding to adenosyltransferase activity. At least one of these genes will dhaBX, orfY, orfy, and orfW, respectively) are encoded be a transgene and introduced into the production cell. The within the dha regulon. While the precise functions of these transformed production cell is then grown under appropriate gene products are not well characterized, the genes are linked conditions for the production of 1,3-propanediol. 10 to glycerol dehydratase (dhaB) or 1,3-propanediol oxi Recombinant organisms containing the necessary genes doreductase (dhaT) and are known to be useful for the pro that will encode the enzymatic pathway for the conversion of duction of 1,3-propanediol. Coenzyme B that is bound to a carbon Substrate to 1,3-propanediol may be constructed glycerol dehydratase occasionally undergoes irreversible using techniques well known in the art. In the present inven cleavage to form an inactive modified coenzyme which is tion genes encoding glycerol dehydratase (dhaB) and 1.3- 15 tightly bound to the dehydratase. Reactivation of the enzyme propanediol oxidoreductase (dhaT) were isolated from a occurs by exchange of the bound, modified coenzyme with native host Such as Klebsiella and together with genes encod free, intact coenzyme B. Protein X and at least one other of ing aquacobalamin reductase, cob(II)alamin reductase and protein 1, protein 2, and protein 3 are involved in the exchange cob(I) alamin adenosyltransferase (btuR or cobA or cobO) process. (see U.S. Ser. No. 08/969,683). In the separate diol isolated from native hosts such as E. coli, S. typhimurium or P. dehydratase system, genes designated as ddrA and ddrB, denitrificans) are used to transform host strains such as E. coli corresponding to the genes encoding protein X and protein 2, strain DH5C. or FM5; Kpneumoniae strain ATCC 25955; K. respectively, are described to be involved in the exchange Oxytoca strain ATCC 8724 or M5a1, S. cerevisiae strain process (Mori et al., J. Biol. Chem. 272, 32034-32041 YPH499, P. pastoris strain GTS115, or A. niger strain FS1. (1997)). 25 Glycerol-3-phosphate dehydrogenase and glycerol-3- Rational for Using dhaEdhaT phosphatase may be particularly effective in the conversion of Producing 1,3-propanediol from glucose can be accom glucose to glycerol, required for the production of 1,3-pro plished by the following series of steps. This series is repre panediol (U.S. Ser. No. 60/030,602). The term “glycerol-3- sentative of a number of pathways known to those skilled in phosphate dehydrogenase' refers to a polypeptide respon the art. Glucose is converted in a series of steps by enzymes of 30 sible for an enzyme activity that catalyzes the conversion of the glycolytic pathway to dihydroxyacetone phosphate dihydroxyacetone phosphate (DHAP) to glycerol-3-phos (DHAP) and 3-phosphoglyceraldehyde (3-PG). Glycerol is phate (G3P). In vivo G3PDH may be NADH-, NADPH-, or then formed by either hydrolysis of DHAP to dihydroxyac FAD-dependent. The NADH-dependent enzyme (EC etone (DHA) followed by reduction, or by reduction of DHAP to glycerol 3-phosphate (G3P) followed by hydroly 1.1.1.8) is encoded, for example, by several genes including 35 GPD1 (GenBank Z74071 x2), or GPD2 (GenBank Z35169x sis. The hydrolysis step can be catalyzed by any number of 1), or GPD3 (GenBank G984.182), or DAR1 (GenBank cellular phosphatases which are known to be non-specific Z7407 1x2). The NADPH-dependent enzyme (EC 1.1.1.94) with respect to their substrates or the activity can be intro is encoded by gpsA (GenBank U321643, (cds 197911 duced into the host by recombination. The reduction step can 196892) G466746 and L45246). The FAD-dependent be catalyzed by a NAD" (or NADP") linked host enzyme or 40 enzyme (EC 1.1.99.5) is encoded by GUT2 (GenBank the activity can be introduced into the host by recombination. Z47047x23), or glpD (GenBank G147838), or glpABC It is notable that the dha regulon contains a glycerol dehydro (GenBank M20938). The term “glycerol-3-phosphatase' genase (E.C. 1.1.1.6) which catalyzes the reversible reaction refers to a polypeptide responsible for an enzyme activity that of Equation 7. catalyzes the conversion of glycerol-3-phosphate and water Glycerol-3-HP+HO (Equation 5) 45 to glycerol and inorganic phosphate. Glycerol-3-phosphatase is encoded, for example, by GPP1 (GenBank Z47047x125), 3-HP+NADH--H"-> 1,3-Propanediol--NAD (Equation 6) or GPP2 (GenBank U18813x11). Glycerol+NAD"->DHA+NADH--H (Equation 7) Gene Isolation 50 Methods of obtaining desired genes from a bacterial Glycerol is converted to 1,3-propanediol via the intermediate genome are common and well known in the art of molecular 3-hydroxy-propionaldehye (3-HP) as has been described in biology. For example, if the sequence of the gene is known, detail above. The intermediate 3-HP is produced from glyc Suitable genomic libraries may be created by restriction endo erol, Equation 5, by a dehydratase enzyme which can be nuclease digestion and may be screened with probes comple encoded by the host or can introduced into the host by recom 55 mentary to the desired gene sequence. Once the sequence is bination. This dehydratase can be glycerol dehydratase (E.C. isolated, the DNA may be amplified using standard primer 4.2.1.30), diol dehydratase (E.C. 4.2.1.28) or any other directed amplification methods such as polymerase chain enzyme able to catalyze this transformation. Glycerol dehy reaction (PCR) (U.S. Pat. No. 4,683.202) to obtain amounts dratase, but not diol dehydratase, is encoded by the dha regu of DNA suitable for transformation using appropriate vec lon. 1,3-Propanediol is produced from 3-HP. Equation 6, by a 60 tOrS. NAD"- (or NADP) linked host enzyme or the activity can Alternatively, cosmid libraries may be created where large introduced into the host by recombination. segments of genomic DNA (35-45 kb) may be packaged into This final reaction in the production of 1,3-propanediol can vectors and used to transform appropriate hosts. Cosmid vec be catalyzed by 1,3-propanediol dehydrogenase (E.C. tors are unique in being able to accommodate large quantities 1.1.1.202) or other alcohol dehydrogenases. 65 of DNA. Generally, cosmid vectors have at least one copy of The dha regulon is comprised of several functional ele the cos DNA sequence which is needed for packaging and ments including dhak encoding a dihydroxyacetone kinase, subsequent circularization of the foreign DNA. In addition to US 7,582,457 B2 11 12 the cos sequence these vectors will also contain an origin of adenosyltransferase genes have been cloned and sequenced. replication Such as ColE1 and drug resistance markers such as Cob(I)alamin adenosyltransferase activity has been detected a gene resistant to amplicillin or neomycin. Methods of using in human fibroblasts and in isolated rat mitochondria (Fenton cosmid vectors for the transformation of suitable bacterial et al., Biochem. Biophys. Res. Commun. 98, 283-9, (1981)). hosts are well described in Sambrook et al., Molecular Clon- 5 The two enzymes involved in cobalt reduction are poorly ing: A Laboratory Manual, Second Edition (1989) Cold characterized and gene sequences are not available. There are Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. reports of an aquacobalamin reductase from Euglena gracilis (1989). (Watanabe et al., Arch. Biochem. Biophys. 305, 421-7. Typically to clone cosmids, foreign DNA is isolated and (1993)) and a microsomal cob(III)alamin reductase is present ligated, using the appropriate restriction endonucleases, adja 10 in the microsomal and mitochondrial inner membrane frac cent to the cos region of the cosmid vector. Cosmid vectors tions from rat fibroblasts (Pezacka, Biochim. Biophys. Acta, containing the linearized foreign DNA are then reacted with 1157, 167-77, (1993)). a DNA packaging vehicle Such as bacteriophage W. During Supplementing culture media with vitamin B may satisfy the packaging process the cos sites are cleaved and the foreign the need to produce coenzyme B for glycerol dehydratase DNA are packaged into the head portion of the bacterial viral 15 activity in many microorganisms, but in Some cases addi particle. These particles are then used to transfect suitable tional catalytic activities may have to be added or increased in host cells such as E. coli. Once injected into the cell, the vivo particularly when high levels of 1,3-propanediol are foreign DNA circularizes under the influence of the cos sticky desired. Enhanced synthesis of coenzyme B in eukaryotes ends. In this manner large segments of foreign DNA can be may be particularly desirable. Given the published sequences introduced and expressed in recombinant host cells. for genes encoding cob(I)alamin adenosyltransferase, the Isolation and Cloning of Genes Encoding Glycerol Dehy cloning and expression of this gene could be accomplished by dratase (dhaB) and 1,3-propanediol Oxidoreductase (dhaT) one skilled in the art. For example, it is contemplated that Identification and isolation of dhaE and dhaT were done yeast, such as Saccharomyces, could be constructed so as to essentially as described in U.S. Pat. No. 5,686,276 and those contain genes encoding cob(I)alamin adenosyltransferase in methods are hereby incorporated by reference. Cosmid vec 25 addition to the genes necessary to effect conversion of a tors and cosmid transformation methods were used within the carbon Substrate Such as glucose to 1,3-propanediol. Cloning context of the present invention to clone large segments of and expression of the genes for cobalt reduction requires a genomic DNA from bacterial genera known to possess genes different approach. This could be based on a selection in E. capable of processing glycerol to 1,3-propanediol. Two 1,3- coli for growth on ethanolamine as Sole C or N. Source. In the propanediol positive transformants were analyzed and DNA 30 presence of coenzyme B, ethanolamine ammonia-lyase sequencing revealed extensive homology to the glycerol enables growth of cells in the absence of other C or N. dehydratase gene (dhaB) from C. freundii, demonstrating that sources. If E. coli cells contain a cloned gene for cob(I)alamin these transformants contained DNA encoding the glycerol adenosyltransferase and random cloned DNA from another dehydratase gene. dhaE and dhaT were isolated and cloned organism, growth on ethanolamine in the presence of aqua into appropriate expression cassettes for co-expression in 35 cobalamin should be enhanced and selected for if the random recombinant hosts with genes encoding B coenzyme syn cloned DNA encodes cobalt reduction properties to facilitate thesis. adenosylation of aquacobalamin. Although the instant invention uses the isolated genes from Another approach to identifying and cloning the gene(s) within a Klebsiella cosmid, alternate sources of dehydratase for cobalt reduction is based on coenzyme B2 repression of genes include, but are not limited to, Citrobacter, Clostridia, 40 btuB expression. When E. coli is grown in the presence of Enterobacter, and Salmonella. coenzyme B the expression of btuB is reduced, and if a btuB::lacz fusion is constructed this repression can be B Coenzyme Genes observed as a reduction in B-galactosidase activity. Vitamin Rational for B Coenzyme Genes B will also repress expression ofbtuB::lacZonce it has been Adenosylcobalamin (coenzyme B) is an essential cofac 45 adenosylated, but factors that prevent conversion to coen tor for glycerol dehydratase activity. The coenzyme is the Zyme B. Such as defects in cobalt reduction or adenosyla most complex non-polymeric natural product known, and its tion, lead to constitutive expression ofbtuB::lacZ. To identify synthesis in vivo is directed using the products of about 20-30 cobalt reduction genes requires the initial selection or identi genes. Synthesis of coenzyme B is found in prokaryotes, fication of Lac" cells from a btuB::lacZ strain that has been Some of which are able to synthesize the compound de novo, 50 Subjected to mutagenesis, followed by positive selection for while others can perform partial reactions. E. coli, for growth on lactose, or by identifying Lac" colonies on indica example, cannot fabricate the corrin ring structure, but is able tor plates. False positives due to btuR mutations could be to catalyze the conversion of cobinamide to corrinoid and can minimized by having btuR present on a plasmid. A strain introduce the 5'-deoxyadenosyl group. defective in cobalt reduction can be transformed with cloned Eukaryotes are unable to synthesize coenzyme B de novo 55 DNA from the same or another species, and cloned cobalt and instead transport vitamin B and other coenzyme B. reduction genes identified because of a Lac phenotype precursors from the extracellular milieu with Subsequent con resulting from coenzyme B repression of btuR::lac7. version of the compound to its functional form of the com expression. pound by cellular enzymes. Three enzyme activities have been described for this series of reactions: 1) aquacobalamin 60 Isolation of Genes Encoding Cob(I)alamin Adenosyltrans reductase (EC 1.6.99.8) reduces Co(III) to Co(II); 2) cob(II) ferase alamin reductase (EC 1.6.99.9) reduces Co(II) to Co(III); and The genes encoding cob(I)alamin adenosyltransferase 3) cob(I)alaminadenosyltransferase (EC 2.5.1.17) transfers a were cloned from two species of bacteria, btuR from E. coli 5'-deoxyadenosine moiety from ATP to the reduced cor strain DH5O.(deoR endA1 gyra 96 hsdR17(rk-mk+) recA1 rinoid. This last enzyme activity is the best characterized of 65 relA1 supE44 thi-1 A(laczYA-argFV169)) and cobA from S. the three and is encoded by cobA in S. typhimurium, btuR in typhimurium strain ATCC 23564. Primers were designed E. coli and cobO in P denitrificans. These three cob(I)alamin using the published sequence ofbtuR (Lundrigan and Kad US 7,582,457 B2 13 14 ner, J. Bact. 171, 154-161 (1989)) such that PCR-amplifica B. Therefore, to isolate btuR mutants requires selection or tion of the gene from E. coli could be achieved to give the identification of Lac" cells from a btuB::lacZ strain in the complete coding sequence flanked by HindIII and BamHI presence of vitamin B. Since the cob(II)alamin reductase, sites to the 5' end, and a Pst site to the 3' end. A ribosome like Btu R, functions during the conversion of vitamin B to binding site was present between the HindIII and BamHI sites coenzyme B, the same requirement for growth on media at the 5' end to ensure adequate translation. The PCR product containing lactose and vitamin B of a btuB::lacZ Strain was cloned into the SrfI site of pCR-Script to give plasmid enables a positive selection for mutations in cob(II)alamin pAH61. A correctly constructed clone was confirmed by reductase. Alternatively, such mutations are observed as Lac" DNA analysis and by functional expression to complement an colonies on indicator plates. False positives due tobtuR muta E. coli btuR mutant strain for 1,3-propanediol production. 10 tions are minimized by having btuR present on a multicopy Primers were also designed for the S. typhimurium cobA plasmid. Isolation of mutations in the gene for cob(II)alamin gene using published sequence (Suh and Escalante-Semer reductase is achieved by chemical mutagenesis, UV light or ena, Gene 129,93-97 (1993)) such that PCR-amplification of by the use of transposons such as Tn5 or Tn10. Strains with the gene could be achieved to give the complete coding mutations in cob(II)alamin reductase are complemented sequence flanked by HindIII and BamHI sites to the 5' end, 15 using a cloned genomic library to give a Lac phenotype on and a PstI site to the 3' end. A ribosome binding site was Lac indicator plates, leading to identification of the specific present between the HindIII and BamHI sites at the 5' end to gene. In addition to using a library of cloned DNA to identify ensure adequate translation. The PCR product was cloned a cob(U)alamin reductase through complementation, defined into the SrfI site of pCR-Script to give plasmid pAH63. A fragments of cloned DNA encoding reductases are used to correctly constructed clone was confirmed by DNA analysis assess complementation. A fragment of chromosomal DNA and by functional expression to complement an E. colibtuR from E. coli (bearing the yeiK gene (GenBank CO06550) mutant strain for 1,3-propanediol production. (SEQ ID NO:9) encoding a dehydrogenase/reductase or a related sequence from other prokaryotes) is tested in the Isolation of the Cob(II)Alamin Reductase Gene complementation assay for a Lac phenotype resulting from Cob(II)alamin reductase has been purified 6300-fold to 25 reduction and adenosylation of vitamin B to form coen homogeneity from P. denitrificans strain SC510 (Blanche et Zyme B, which in turn will repress expression of btuB:: al., J. Bact. 174, 7452-7454 (1992)). The N-terminal amino lacZ. yCiK, located immediately upstream of btuR, is tran acid sequence was determined to be Met Glu Lys Thr Arg scribed in the same direction, and the termination codon Leu, from which one skilled in the art can design a Suitable (UGA) of yeiK overlaps with the initiation codon (AUG) of population of primers that encompasses all possible nucle 30 btuR in the genomic sequence ATGA. This sequential otide variations that encode this peptide ATG GAR AAR arrangement of termination and initiation codons is a charac ACSCGICTI, where R=A+G:S-C+G: I=Inosine (SEQID teristic of genes that are translationally coupled and co-regu NO: 8). The pool of primers thus obtained is used for PCR lated (Gatenby et al., Proc. Natl. Acad. Sci. USA 86, 4066 amplification of the gene for cob(II)alamin reductase using 4070 (1989)). E. coli yoik is a particularly preferred gene to either of two techniques. In one approach, chromosomal 35 enable cobalt reduction during the synthesis of coenzyme DNA from P. denitrificans is subjected to PCR with the pool B12. of primers encoding Met Glu Lys Thr Arg Leu, together with The skilled artisan will appreciate that utility of the dehy random primers to effect second strand synthesis. PCR prod drogenase/reductase activity encoded by yeiK will not be ucts are cloned into a plasmid, Such as pCR-Script, and the limited to this specific gene or enzyme but will include homo cloned fragments screened by DNA sequence analysis. 40 logues of the gene or enzyme including genes and enzymes Another approach is to first clone DNA from P. denitrifi that are substantially similar to the gene or enzyme and those cans into a plasmid such as pCR-Script, followed by PCR genes having about 80% identity to the gene, where those amplification using the pool of primers encoding Met Glu Lys having 90% identity repreferred, and where that having about Thr Arg Leu for first strand synthesis. Second strand synthesis 95% identity are most preferred. is accomplished by using as a primera sequence derived from 45 In addition to selections based on a Lac phenotype, it is the known plasmid sequence. The isolated complete or partial possible to use E. coli strains which carry a defective metB. sequence for cob(II)alamin reductase from P. denitrificans is gene that encodes a cobalamin-independent methionine Syn used as a probe to identify and clone similar genes from other thase, but which retain a functional metH gene encoding a species that encode this enzyme. cobalamin-dependent methionine synthase. An example of Development of an appropriate selection strategy based on 50 such a strain is CAG 18491 (F, , rph-1, metB3079:Tn 10), complementation allows identification and isolation of the a methionine auxotroph unless vitamin or coenzyme B is gene for cob(II)alamin reductase. Lundrigan and Kadner (J. added to the media. Mutagenesis of CAG 18491 and growth Bact 171, 154-161 (1989)) describe how btuR (adenosyl on minimal media containing coenzyme B, followed by transferase) mutants influence btuB (outer-membrane B. colony testing on minimal media containing vitamin B, binding protein) gene regulation. The btuR mutants are iden 55 allows identification of cells that have lost the ability to con tified because they do not repress btuB expression. This is vert vitamin to coenzyme B, but which can still use coen done by first making a gene fusion between btuB and lacZ. Zyme B during the synthesis of methionine by the Meth Growth of these cells in the absence of vitamin B or coen methionine synthase. The cells identified in this screen are Zyme B leads to constitutive expression of btuB::lacZ (so defective in one of the two cobalt reduction steps, or inadeno that B receptors are present on the cell Surface) to give a 60 sylation of vitamin B. Introduction of a cloned btuR plas Lacphenotype. In wild type cells vitamin B undergoes mid into cells that are methionine auxotrophs on vitamin B cobalt reduction, and is then converted to coenzyme B by but are prototrophs on coenzyme B will identify cells that cob(I)alamin adenosyltransferase, and the resulting coen remain Met on vitamin B, even though btuR is present. Zyme B causes repression of btuB::lacZ to give a Lac Alternatively, a plasmid bearing btuR is added to the metB. phenotype. In btuR mutants the vitamin B is not converted 65 strain prior to mutagenesis and selection. Cells that are defec to coenzyme B, repression ofbtuB::lacZ does not occur and tive in one or both of the two cobalt reduction steps can be a Lacphenotype is observed on media containing vitamin used to Screen a genomic library for clones that restore pro US 7,582,457 B2 15 16 totrophic growth on minimal media with vitamin B. To indicator plates, leading to identification of the specific gene. preclude cloning of the metB gene in this selection it is impor In addition to such complementation using a library of cloned tant to prepare the genomic library from a strain that has a DNA to identify an aquacobalamin reductase, defined frag defective metB gene. Plasmids obtained from this selection ments of cloned DNA encoding a reductase are used to assess will encode an enzyme capable of reducing cobalt. Assaying 5 complementation for cob(II)alamine reductase confirms this property. In addition to selections based on a Lac phenotype, it is possible to use E. coli strains which carry a defective metB. Isolation of the Aquacobalamin Reductase Gene gene that encodes a cobalamin-independent methionine Syn Aquacobalamin reductase is purified from, but is not lim thase, but which retain a functional metH gene encoding a ited to, Pseudomonas, Escherichia, Salmonella, Klebsiella or 10 cobalamin-dependent methionine synthase. The procedure Citrobacter, as described by Watanabe and Nakono (Methods follows that described above for the isolation of Cob(II) Enzymol. 281,289-305 (1997)) or with variations thereof. An alamin reductase gene. Plasmids obtained from this selection enzyme assay is used that measures the decrease in absor will encode an enzyme capable of reducing cobalt. Assaying bance of aquacobalamin at 525 nm (Watanabe et al., J. Nutr. for aquacobalamin reductase confirms this property. 126, 2947-2951 (1996)). The N-terminal amino acid is sequence of the protein is determined, from which one skilled Host Cells in the art can design a collection of primers that includes all Suitable host cells for the recombinant production 1,3- possible nucleotide variations that encode the N-terminal propanediol by the coexpression of a gene encoding a dehy peptide. The pool of primers thus obtained is used for PCR dratase enzyme and the genes encoding cob(I)alamin adeno amplification of the gene for aquacobalamin reductase using 20 Syltransferase, aquacobalamin reductase and cob(II)alamin either of two techniques. In one approach, chromosomal reductase may be either prokaryotic or eukaryotic and will be DNA is subjected to PCR with the pool of primers encoding limited only by their ability to express active enzymes. Pre the N-terminal peptide, together with random primers to ferred hosts will be those typically useful for production of effect second strand synthesis. PCR products are cloned into 1,3-propanediol or glycerol Such as Citrobacter, Entero a plasmid, such as pCR-Script, and the cloned fragments 2s bacter; Clostridium, Klebsiella, Aerobacter, Lactobacillus, screened by DNA sequence analysis. Another approach is to Aspergillus, Saccharomyces, Schizosaccharomyces, first clone chromosomal DNA into a plasmid such as pCR Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Script, followed by PCR amplification using the pool of prim Hansenula, Debaryomyces, Mucor, Torulopsis, Methyllo ers encoding the N-terminal peptide for first strand synthesis. bacter; Escherichia, Salmonella, Bacillus, Streptomyces and Second strand synthesis is accomplished by using as a primer 30 Pseudomonas. Most preferred in the present invention are E. a sequence derived from the known plasmid sequence. The coli, Klebsiella species and Saccharomyces species. isolated complete or partial sequence for aquacobalamin E. coli and Klebsiella species are particularly preferred reductase is used as a probe to identify and clone similar hosts. Strains of Klebsiella pneumoniae are known to produce genes from other species that encode this enzyme. 1,3-propanediol when grown on glycerolas the sole carbon. It Identification and isolation of the gene for aquacobalamin 35 is contemplated that Klebsiella can be genetically altered to reductase arises from an appropriate selection strategy based produce 1,3-propanediol from monosaccharides, oligosac on complementation. Lundrigan and Kadner (J. Bact 171, charides, polysaccharides, or one-carbon Substrates. 154-161 (1989)) describe how btuR (adenosyltransferase) Vectors And Expression Cassettes mutants influence btuB (outer-membrane B binding pro The present invention provides a variety of vectors and tein) gene regulation. The btuR mutants are identified 40 transformation and expression cassettes Suitable for the clon because they do not repress btuB expression. This is done by ing, transformation and expression of genes encoding a Suit first making a gene fusion between btuB and lacz. Growth of able dehydratase and of genes effecting the conversion of these cells in the absence of vitamin B or coenzyme B. coenzyme B precursors to coenzyme Binto a suitable host leads to constitutive expression of btuB::lacz (so that B cell. Suitable vectors will be those which are compatible with receptors are present on the cell Surface) to give a Lac" phe- 45 the bacterium used as a host cell. Suitable vectors can be notype. In wild type cells vitamin B2 undergoes cobalt derived, for example, from a bacteria, a virus (such as bacte reduction, and is then converted to coenzyme B by cob(I) riophage T7 or a M-13 derived phage), a cosmid, a yeast or a alamin adenosyltransferase. The resulting coenzyme B. plant. Protocols for obtaining and using Such vectors are causes repression ofbtuB::lacZ to give a Lac phenotype. In known to those in the art. (Sambrook et al., Molecular Clon btuR mutants the vitamin B is not converted to coenzyme 50 ing: A Laboratory Manual volumes 1.2.3 (Cold Spring Har B. repression of btuB::lacz does not occur, and a Lac" bor Laboratory, Cold Spring Harbor, N.Y., (1989)). phenotype is observed on media containing vitamin B. Typically, the vector or cassette contains sequences direct Therefore, to isolatebtuR mutants requires selection or iden ing transcription and translation of the relevant gene, a select tification of Lac" cells from a btuB::lacz strain in the pres able marker, and sequences allowing autonomous replication ence of vitamin B. Since the aquacobalamin reductase, like 55 or chromosomal integration. Suitable vectors comprise a Btu R, functions during the conversion of vitamin B to coen region 5' of the gene which harbors transcriptional initiation Zyme B, the same requirement for growth on media con controls and a region 3' of the DNA fragment which controls taining lactose and vitamin B of a btuB::lacZ Strain enables transcriptional termination. It is most preferred when both a positive selection for mutations in aquacobalamin reduc control regions are derived from genes homologous to the tase. Alternatively, such mutations are observed as Lac" colo- 60 transformed host cell although it is to be understood that such nies on indicator plates. False positives due tobtuR mutations control regions need not be derived from the genes native to are minimized by having btuR present on a multicopy plas the specific species chosen as a production host. mid. Isolation of mutations in the gene for aquacobalamin Initiation control regions or promoters, useful to drive reductase is achieved by chemical mutagenesis, UV light or expression of the relevant genes of the present invention in the by the use of transposons such as Tn5 or Tn10. Strains with 65 desired host cell, are numerous and familiar to those skilled in mutations in aquacobalamin reductase are complemented the art. Virtually any promoter capable of driving these genes using a cloned genomic library to give Lac phenotype on Lac is suitable for the present invention including but not limited US 7,582,457 B2 17 18 to CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, ity. For example, methylotrophic yeast are known to utilize GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for the carbon from methylamine to form trehalose or glycerol expression in Saccharomyces); AOX1 (useful for expression (Bellion et al., Microb. Growth C1 Compa. Int. Symp., 7th in Pichia); and lac, trp, JP, JP, T7, tac, and trc (useful for (1993), 415-32. Editor(s): Murrell, J. Collin; Kelly, Don P. expression in E. coli). 5 Publisher: Intercept, Andover, UK). Similarly, various spe Termination control regions may also be derived from vari cies of Candida will metabolizealanine or oleic acid (Sulter ous genes native to the preferred hosts. Optionally, a termi et al., Arch. Microbiol., 153(5), 485-9 (1990)). Accordingly, nation site may be unnecessary; however, it is most preferred the source of carbon utilized in the present invention may if included. encompass a wide variety of carbon-containing Substrates For effective expression of the instant enzymes, DNA 10 and will only be limited by the requirements of the host encoding the enzymes are linked operably through initiation organism. codons to selected expression control regions such that All of the above mentioned carbon substrates and mixtures expression results in the formation of the appropriate mes thereof are expected to be suitable in the present invention. senger RNA. However, preferred carbon substrates are glycerol, dihy Transformation of Suitable Hosts and Expression of Genes 15 droxyacetone, monosaccharides, oligosaccharides, polysac for the Production of 1,3-propanediol charides, and one-carbon Substrates. More preferred are Sug Once Suitable cassettes are constructed they are used to arS Such as glucose, fructose. Sucrose and single carbon transform appropriate host cells. Introducing into the host cell Substrates Such as methanol and carbon dioxide. Most pre the cassette containing the genes encoding cob(I)alamin ferred is glucose. adenosyltransferase, aquacobalamin reductase, cob(II) In addition to an appropriate carbon Source, fermentation alamin reductase, glycerol dehydratase (dhaB), and 1,3-pro media must contain Suitable minerals, salts, cofactors, buffers panediol oxidoreductase (dhaT) (either separately or and other components, known to those skilled in the art, together) may be accomplished by known procedures includ suitable for the growth of the cultures and promotion of the ing transformation (e.g., using calcium-permeabilized cells, enzymatic pathway necessary for glycerol production. Par electroporation) or by transfection using a recombinant phage 25 ticular attention is given to Co(II) salts and/or vitamin B or virus. (Sambrook et al., Supra.) other alternate coenzyme B 12 precursors. For example, E. In the present invention, E. coli FM5 containing the genes coli and eukaryotes are unable to synthesize coenzyme B. de encoding glycerol dehydratase (dhaB), 1,3-propanediol oxi novo but are able to utilize coenzyme B precursors. Pre doreductase (dhaT), aquacobalamin reductase, cob(II)alamin ferred coenzyme B precursors are vitamin B and reductase, and cob(I)alamin adenosyltransferase is used to 30 hydroxocobalamin. It is desirable that the amount of coen convert vitamin B supplied in the media to coenzyme B to Zyme B inside the host cell be approximately equal in molar enable glycerol dehydratase to function. concentration to the amount of dehydratase enzyme. Culture Conditions Media and Carbon Substrates Typically, cells are grown at 30°C. in appropriate media. Fermentation media in the present invention must contain 35 Preferred growth media in the present invention are common suitable carbon substrates. Suitable substrates may include commercially prepared media Such as Luria Bertani (LB) but are not limited to glycerol, dihydroxyacetone, monosac broth, Sabouraud Dextrose (SD) broth or Yeast Malt Extract charides such as glucose and fructose, oligosaccharides Such (YM) broth. Other defined or synthetic growth media may as lactose or Sucrose, polysaccharides (such as starch or cel also be used and the appropriate medium for growth of the lulose), or mixtures thereof, and unpurified mixtures from 40 particular microorganism will be known by someone skilled renewable feedstocks (such as cheese whey permeate, corn in the art of microbiology or fermentation science. The use of steep liquor, Sugar beet molasses, and barley malt). Addition agents known to modulate catabolite repression directly or ally, the carbon Substrate may also be one-carbon Substrates indirectly, e.g., cyclic adenosine 3':5'-monophosphate, may (such as carbon dioxide or methanol) for which metabolic also be incorporated into the reaction media. Similarly, the conversion into key biochemical intermediates has been dem 45 use of agents known to modulate enzymatic activities (e.g., onstrated. Sulphites, bisulphites and alkalis) that lead to enhancement of Glycerol production from single carbon Sources (e.g., glycerol production may be used in conjunction with or as an methanol, formaldehyde, or formate) has been reported in alternative to genetic manipulations. methylotrophic yeasts (Yamada et al., Agric. Biol. Chem., Suitable pH ranges for the fermentation are between pH 5.0 53(2) 541-543, (1989)) and in bacteria (Hunter et al., Bio 50 to pH 9.0, where pH 6.0 to pH 8.0 is preferred as the range for chemistry, 24, 4148-4155, (1985)). These organisms can the initial condition. assimilate single carbon compounds, ranging in oxidation Reactions may be performed under aerobic or anaerobic state from methane to formate, and produce glycerol. The conditions where anaerobic or microaerobic conditions are pathway of carbon assimilation can be through ribulose preferred. monophosphate, through serine, or through Xylulose-mono 55 phosphate (Gottschalk, Bacterial Metabolism, Second Edi Fermentations tion, Springer-Verlag: New York (1986)). The ribulose mono The present invention may be practiced using either batch, phosphate pathway involves the condensation of formate fed-batch, or continuous processes and any known mode of with ribulose-5-phosphate to form a 6 carbon sugar that fermentation would be suitable. Additionally, cells may be becomes fructose and eventually the three carbon product 60 immobilized on a substrate as whole cell catalysts and sub glyceraldehyde-3-phosphate. Likewise, the serine pathway jected to fermentation conditions for 1,3-propanediol produc assimilates the one-carbon compound into the glycolytic tion. pathway via methylenetetrahydrofolate. The present process is exemplified herein as a batch In addition to one and two carbon Substrates, methy method of fermentation. A classical batch fermentation is a lotrophic organisms are also known to utilize a number of 65 closed system where the composition of the media is set at the other carbon-containing compounds such as methylamine, beginning of the fermentation and not artificially altered dur glucosamine and a variety of amino acids for metabolic activ ing the fermentation. Thus, at the beginning of the fermenta US 7,582,457 B2 19 20 tion the media is inoculated with the desired organism or given by way of illustration only. From the above discussion organisms and fermentation is permitted to occur adding and these Examples, one skilled in the art can ascertain the nothing to the system. Typically, however, a batch fermenta essential characteristics of this invention, and without depart tion is “batch” with respect to the addition of the carbon ing from the spirit and scope thereof, can make various Source and attempts are often made at controlling factors such 5 changes and modifications of the invention to adapt it to as pH and oxygen concentration. The metabolite and biomass various usages and conditions. compositions of the batch system change constantly up to the time the fermentation is stopped. Within batch cultures cells EXAMPLES moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is dimin 10 General Methods ished or halted. Ifuntreated, cells in the stationary phase will Procedures for phosphorylations, ligations and transfor eventually die. Cells in log phase generally are responsible for mations are well known in the art. Techniques suitable for use the bulk of production of end product or intermediate. in the following examples may be found in Sambrook, J. et al., A variation on the standard batch system is the Fed-Batch Molecular Cloning. A Laboratory Manual, Second Edition, fermentation system which is also suitable in the present 15 invention. In this variation of a typical batch system, the Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Substrate is added in increments as the fermentation N.Y. (1989). Materials and methods suitable for the maintenance and progresses. Fed-Batch systems are useful when catabolite growth of bacterial cultures are well known in the art. Tech repression is apt to inhibit the metabolism of the cells and niques suitable for use in the following examples may be where it is desirable to have limited amounts of substrate in found as set out in Manual of Methods for General Bacteri the media. Measuring the actual Substrate concentration in ology (Philipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Fed-Batch systems is difficult and is therefore estimated on Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. the basis of the changes of measurable factors such as pH, Briggs Phillips, eds), American Society for Microbiology, dissolved oxygen, and the partial pressure of waste gases Such Washington, D.C. (1994)) or by Thomas D. Brock in Biotech as CO. Batch and Fed-Batch fermentations are common and 25 well known in the art and examples may be found in Brock, nology: A Textbook of Industrial Microbiology, Second Edi infra. tion, Sinauer Associates, Inc., Sunderland, Mass. (1989). All The method also is expected to be adaptable to continuous reagents and materials used for the growth and maintenance fermentation methods. Continuous fermentation is an open ofbacterial cells were obtained from Aldrich Chemicals (Mil system where a defined fermentation media is added continu 30 waukee, Wis.), DIFCO Laboratories (Detroit, Mich.), ously to a bioreactor and an equal amount of conditioned GIBCO/BRL (Gaithersburg, Md.), or Sigma Chemical Com media is removed simultaneously for processing. Continuous pany (St. Louis, Mo.) unless otherwise specified. fermentation generally maintains the cultures at a constant The meaning of abbreviations is as follows: “h” means high density where cells are primarily in log phase growth. hour(s), “min' means minute(s), “sec’ means second(s), “d Continuous fermentation allows for the modulation of one 35 means day(s), “mL means milliliters, “L” means liters. factor or any number of factors that affect cell growth or end Cells product concentration. For example, one method will main E. coli strain DH5O. was purchased from Gibco/BRL, tain a limiting nutrient Such as the carbon Source or nitrogen Gaithersburg, Md. K. pneumoniae strain ATCC 25955, K. level at a fixed rate and allow all other parameters to moder Oxytoca strain ATCC 8724, and S. typhimurium strain ATCC ate. In other systems a number of factors affecting growth can 40 23564 were purchased from the American Type Culture Col be altered continuously while the cell concentration, mea lection (ATCC), Rockville, Md. E. coli strain FM5 (ATCC Sured by media turbidity, is kept constant. Continuous sys 53911), Amgen patent U.S. Pat. No. 5,494,816, is available tems strive to maintain steady state growth conditions and from ATCC E. coli strain RK6726 (Lundrigan et al., Mol. thus the cell loss due to media being drawn off must be Gen. Genet. 206,401–407 (1987)) was a gift from R. Kadner. balanced against the cell growth rate in the fermentation. 45 E. coli strain CAG 18491 was purchased from the E. coli Methods of modulating nutrients and growth factors for con Genetic Stock Center, Yale University, New Haven, Conn. K. tinuous fermentation processes as well as techniques for Oxytoca strain M5a1 was purchased from National Collec maximizing the rate of product formation are well known in tions of Industrial and Marine Bacteria, Ltd., Aberdeen, Scot the art of industrial microbiology. A variety of methods are land (NCIMB #12204). S. cerevisiae strainYPH499 (ura3-52 detailed by Brock, infra. 50 lys2-801 ade2-101 trp1-del63 his3-del.200 leu2-del 1) was Identification and Purification of 1.3-Propanediol: purchased from Stratagene, La Jolla, Calif. P. pastoris Strain GTS115 (his4) was obtained from Phillips Petroleum, Methods for the purification of 1,3-propanediol from fer Bartlesville, Okla. A. niger strain FS1 is a proprietary strain mentation media are known in the art. For example, pro from Genencor International, Inc. panediols can be obtained from cell media by Subjecting the 55 reaction mixture to extraction with an organic solvent, distil Isolation and Identification 1,3-propanediol lation, and column chromatography (U.S. Pat. No. 5,356, The conversion of glycerol to 1,3-propanediol was moni 812). A particularly good organic solvent for this process is tored by HPLC. Analyses were performed using standard cyclohexane (U.S. Pat. No. 5,008,473). techniques and materials available to one skilled in the art of 1.3-Propanediol may be identified directly by submitting 60 chromatography. One suitable method utilized a Waters the media to high pressure liquid chromatography (HPLC) Maxima 820 HPLC system using UV (210 nm) and RI detec analysis. The preferred method is analysis of the fermentation tion. Samples were injected onto a Shodex SH-1011 column media on an analytical ion exchange column using a mobile (8 mmx300 mm, purchased from Waters, Milford, Mass.) phase of 0.01 N sulfuric acid in an isocratic fashion. equipped with a Shodex SH-1011P precolumn (6 mmx50 The present invention is further defined in the following 65 mm), temperature controlled at 50°C., using 0.01 NHSO as Examples. It should be understood that these Examples, mobile phase at a flow rate of 0.5 mL/min. When quantitative while indicating preferred embodiments of the invention, are analysis was desired, samples were prepared with a known US 7,582,457 B2 21 22 amount of trimethylacetic acid as external standard. Typi A 12.1 kb EcoRI-SalI fragment from pKP1, subcloned into cally, the retention times of glycerol (RI detection), 1,3-pro pIB131 (IBI Biosystem, New Haven, Conn.), was sequenced panediol (RI detection), and trimethylacetic acid (UV and RI and termed pHK28-26 (SEQ ID NO:10). Sequencing detection) were 20.67 min, 26.08 min, and 35.03 min, respec revealed the loci of the relevant open reading frames of the tively. dha operon encoding glycerol dehydratase and genes neces Production of 1,3-propanediol was confirmed by GC/MS. sary for regulation. Referring to SEQID NO:10, a fragment Analyses were performed using standard techniques and of the open reading frame for dhak (encoding dihydroxyac materials available to one of skill in the art of GC/MS. One etone kinase) is found at bases 1-399; the open reading frame suitable method utilized a Hewlett Packard 5890Series II gas dhal) (encoding glycerol dehydrogenase) is found at bases chromatograph coupled to a Hewlett Packard 5971 Series 10 983-2107; the open reading frame dhaR (encoding the repres mass selective detector (EI) and a HP-INNOWax column (30 sor) is found at bases 2209-4134; the open reading frame m length, 0.25 mm i.d., 0.25 micron film thickness). The dhaT(encoding 1,3-propanediol oxidoreductase) is found at retention time and mass spectrum of 1,3-propanediol gener bases 5017-6180; the open reading frame dhaE1 (encoding ated were compared to that of authentic 1,3-propanediol (m/e: the alpha Subunit glycerol dehydratase) is found at bases 57,58). 15 7044-8711; the open reading framedhaE2 (encoding the beta An alternative method for GC/MS involved derivatization subunit glycerol dehydratase) is found at bases 8724-9308; of the sample. To 1.0 mL of sample (e.g., culture Supernatant) the open reading frame dhaB3 (encoding the gamma Subunit was added 30 ul of concentrated (70% V/v) perchloric acid. glycerol dehydratase is found at bases 9311-9736; and the After mixing, the sample was frozen and lyophilized. A 1:1 open reading frame dhaBX (encoding a protein of unknown mixture of bis(trimethylsilyl)trifluoroacetamide:pyridine function) is found at bases 9749-11572. Additionally, the (300 uL) was added to the lyophilized material, mixed vigor open reading frame orfY (encoding a protein of unknown ously and placed at 65° C. for oneh. The sample was clarified function) is found at bases 6202-6630; the open reading of insoluble material by centrifugation. The resulting liquid frame orfx (encoding a protein of unknown function) is partitioned into two phases, the upper of which was used for found at bases 4643–49, and the open reading frame orfW analysis. The sample was chromatographed on a DB-5 col 25 (encoding a protein of unknown function) is found at bases umn (48 m, 0.25 mm I.D., 0.25um film thickness; from J&W 4112-4642. Scientific) and the retention time and mass spectrum of the Construction of General Purpose Expression Plasmids for 1,3-propanediol derivative obtained from culture superna Use in Transformation of Escherichia coli tants were compared to that obtained from authentic stan Construction of Expression Vector pTacIQ dards. The mass spectrum of TMS-derivatized 1,3-pro 30 The E. coli expression vector pTacIQ was prepared by panediol contains the characteristic ions of 205,177, 130 and inserting lacIq gene (Farabaugh, P. J., Nature 274 (5673) 115 AMU. 765-769, (1978)) and tac promoter (Amann et al., Gene 25, Assay for cob(I)alamin Adenosyltransferase and Cob(II) 167-178 (1983)) into the restriction endonuclease site EcoRI Alamin Reductase Activity. of pBR322 (Sutcliffe, Cold Spring Harb. Symp. Ouant. Biol. Cob(I)alamin adenosyltransferase may be assayed as 35 43, 77-90 (1979)). A multiple cloning site and terminator described by S.-J. Suh and J. C. Escalante-Semerena, J. Bac sequence (SEQ ID NO:11) replaces the pBR322 sequence teriol. 177,921–925 (1995) or L. Debussche et al., J. Bacte from EcoRI to Sphil. riol. 173, 6300-6302 (1991). Alternatively, cob(Dalamin Subcloning the Glycerol Dehydratase Genes (dhaB1.2.3, adenosyltransferase may be determine by an in vivo assay as 40 X) described in Example 1. The open reading frame for the dhaB3 gene was amplified Cob(II)alamin reductase may be assayed as described by L. from pHK 28-26 by PCR using primers (SEQID NO:12 and Debussche et al., J. Bacteriol. 174, 7452-7454 (1992). SEQID NO:13) incorporating an EcoRI site at the 5' end and Isolation and Cloning of Genes Encoding Glycerol Dehy a Xbal site at the 3' end. The product was subcloned into dratase (Dhab) and 1,3-propanediol Oxidoreductase (dhaT) 45 pI litmus29 (New England Biolab, Inc., Beverly, Mass.) to Identification and isolation of dhaE and dhaT were done generate the plasmid pHAB3 containing dhaB3. essentially as described in U.S. Pat. No. 5,686,276 and those The region containing the entire coding region for dhaB1, methods are hereby incorporated by reference. Cosmid vec dhaB2, dhaB3 and dhaBX of the dhaB operon from pHK28 tors and cosmid transformation methods were used to clone 26 was cloned into pBluescriptIKS+ (Stratagene, La Jolla, large segments of genomic DNA from bacterial genera 50 Calif.) using the restriction enzymes KipnI and EcoRI to cre known to possess genes capable of processing glycerol to ate the plasmid pM7. 1,3-propanediol. Specifically, genomic DNA from K. pneu The dhaRX gene was removed by digesting plasmid pM7 moniae ATCC 25955 was isolated by methods well known in with Apal and Xbal, purifying the 5.9 kb fragment and ligat the art and digested with the restriction enzyme Sau3A for ing it with the 325-bp Apal-Xbal fragment from plasmid insertion into a cosmid vector Supercos 1 and packaged using 55 pDHAB3 to create pM11 containing dhaE1, dhaB2 and GigapackII packaging extracts. Following construction of the dhaE33. vector E. coli XL 1-Blue MR cells were transformed with the The open reading frame for the dhaB1 gene was amplified cosmid DNA. Transformants were screened for the ability to from pHK28-26 by PCR using primers (SEQID NO:14 and convert glycerol to 1,3-propanediol by growing the cells in SEQID NO:15) incorporating a HindIII site and a consensus the presence of glycerol and analyzing the media for 1.3- 60 ribosome binding site at the 5' endanda Xbal site at the 3' end. propanediol formation. The product was subcloned into pI litmus28 (New England Two of the 1,3-propanediol positive transformants were Biolab, Inc.) to generate the plasmid plT1 containing dhaB1. analyzed and the cosmids were named pKP1 and pKP2. DNA A NotI-Xbal fragment from pM11 containing part of the sequencing revealed extensive homology to the glycerol dhaB1 gene, the dhaB2 gene and the dhaB3 gene was inserted dehydratase gene (dhaB) from C. freundii, demonstrating that 65 into pI T1 to create the dhaE expression plasmid, plT2. The these transformants contained DNA encoding the glycerol HindIII-Xbal fragment containing the dhaB(1,2,3) genes dehydratase gene. from plT2 was inserted into pTacIQ to create pCT3. US 7,582,457 B2 23 24 Subcloning the 1,3-propanediol Dehydrogenase Gene HCl, contained 0.2 M KHPO, 2.0 g/L citric acid, 2.0 g/L (dhaT) MgSO.7H2O, 1.2 mL 98% HSO, 0.30g/L ferric ammo The KpnI-SacI fragment of pHK28-26, containing the 1,3- nium citrate, 0.20 g/L CaCl2.H2O, 5 g/L yeast extract, 15 g/L propanediol dehydrogenase (dhaT) gene, was Subcloned into D-glucose, 60 g/L glycerol, 5 mL per liter of Modified Balch/ pBluescriptII KS+ creating plasmid paH1. The dhaT gene Es Trace-Element Solution (Cote, R. J., and Gherna, R. L. In was amplified by PCR from pAH1 as template DNA and Methods for General and Molecular Bacteriology; Gerhardt, synthetic primers (SEQ ID NO:16 with SEQ ID NO:17) P. et al., Eds: American Society for Microbiology: Washing incorporating an Xbal site at the 5' endanda BamHI site at the ton, D.C., 1994; p. 158), and 50 mg/L vitamin B. In addi 3' end. The product was subcloned into pCR-Script (Strat tion, 50 ug/mL spectinomycin and 100 ug/mL carbencillin agene) at the SrfI site to generate the plasmids pAH4 and 10 were used to maintain the plasmids plT24 and pAH61, pAH5 containing dhaT. The plasmid pAH4 contains the dhaT respectively. The shake flasks were incubated at 33°C. with gene in the right orientation for expression from the lac pro vigorous shaking. After 48 hours, RK6726/pLT24/pAH61 moter in pCR-Script and pAH5 contains dhaT gene in the (ODoo-9.8 AU) produced 4.0 g/L 1,3-propanediol. In the opposite orientation. The Xbal-BamHI fragment from paH4 control experiment with RK6726/pDT24 (OD-10.1 AU), containing the dhaT gene was inserted into pTacIQ to gener 15 1,3-propanediol was not detected. ate plasmid pAH8. The HindIII-BamHI fragment from paH8 The S. typhimurium strain (ATCC 23564) used for isolation containing the RBS and dhaT gene was inserted into pBlue of the cob(I)alamin adenosyltransferase (cobA) gene was scriptiIKS+ to create p AH11. purchased from the American Type Culture Collection (Rockville, Md.). cobA was amplified from chromosomal Construction of an Expression Cassette for dhaT and dhaE DNA by PCR using synthetic primers (SEQ ID NO:24 with (1,2,3) SEQ ID NO:25) incorporating a ribosome binding site An expression cassette for dhaT and dhaR(1.2.3) was flanked by HindIII and BamHI sites at the 5' end and a PstI site assembled from the individual dhaB(1.2.3) and dhaT sub at the 3' end. The product was subcloned into pCR-Script clones described previously using standard molecular biol (Stratagene, Madison, Wis.) at the SrfI site to generate the ogy methods. A Spel-SacI fragment containing the dhaB(1. 25 plasmidpAH63 containing cobA in the correctorientation for 2.3) genes from plT3 was inserted into pAH11 at the Spel expression from the lac promoter. The activity of p AH63 was SacI sites to create p AH24. A SalI-Xbal linker (SEQ ID NO:18 and SEQ ID NO:19) was inserted into paH5 which demonstrated as described for p AH61. was digested with the restriction enzymes SalI-Xbal to create Example 2 pDT16. The linker destroys the Xbal site. The 1kb Sall-Mlul 30 fragment from plT16 was then inserted into pAH24 replac ing the existing Sal-Mlul fragment to create pCT18, pl.)T21 Cob(II)alamin Reductase: Gene Isolation and Plasmid was constructed by inserting the SalI-NotI fragment from Construction Media pDT18 and the NotI-Xbal fragment from pM7 into pCL1920 Synthetic S12 medium is used in the screening of bacterial transformants for the ability to grow in the absence of (SEQID NO:20). The glucose isomerase promoter sequence 35 from Streptomyces (SEQID NO:21) was cloned by PCR and methionine in the presence of either vitamin B or coenzyme inserted into EcoRI-HinDIII sites of pitmus28 to construct B. S12 medium contains: 10 mM ammonium sulfate, 50 pDT5. pCL1925 was constructed by inserting EcoRI-PvulI mM potassium phosphate buffer, pH 7.0, 2 mM MgCl, 0.7 fragment of pDT5 into the EcoRI-Pvul site of pCL1920. mM CaCl, 50 uM MnCl, 1 uM FeCls, 1 uM ZnCl, 1.7 uM CuSO, 2.5uM CaCl2, 2.4 uMNaMoO, and 2 uMthiamine pDT24 was constructed by cloning the HinDIII-Mlull frag 40 hydrochloride. S12 medium is supplemented with 0.2% ment of pDT21 and the Mlul-Xbal fragment of pDT21 into D-glucose, 2 mg/L uracil, and 400 ug/L. Vitamin B or coen the HinlDIII-Xbal sites of pCL1925. Zyme B12. Example 1 Selection for a cob(II)alamin Reductase Defective Strain 45 E. coli strain CAG 18491 (F, , rph-1, metB3079:Tnl0) btuR and cobA: Gene Isolation Plasmid Construction and was purchased from the E. coli Genetic Stock Center, Yale Activity University (New Haven, Conn.). All incubations are at 37°C. The E. coli DH5C. (deoR endA1 gyrA96hsdR17(rk-mk+) CAG 18491 is grown in LB medium containing 10 mg/L recA1 relA11 supE44 thi-1 A(lacZYA-argEV169)) strain tetracycline to an Asoo 0.3-0.4AU, made competent by CaCl used for isolation of the cob(I)alamin adenosyltransferase 50 treatment, and transformed with the btuR plasmid pAH61. (btuR) gene was purchased from Gibco BRL (Gaithersburg, Transformants are selected following overnight growth on Md.). btuR was amplified from chromosomal DNA by PCR LB plates containing 10 mg/L tetracycline and 50 mg/Lampi using synthetic primers (SEQID NO:22 with SEQID NO:23) cillin. A single transformant is grown in LB containing 10 incorporating a ribosome binding site flanked by HindIII and mg/L tetracycline and 50 mg/L ampicillinto an A. O.5-0.6 BamHI sites at the 5' end and a Pst site at the 3' end. The 55 AU. 1 MMgSO is added to give a final concentration of 10 product was subcloned into pCR-Script (Stratagene, Madi mM, and bacteriophage w::Tn5 is added to give an m.o. i. of 1. son, Wis.) at the SrfI site to generate the plasmid paH61 After 10 minto allow phage infection the culture is allowed to containing btuR in the correctorientation for expression from grow for an additional 60 min. Serial dilutions are plated on the lac promoter. LB containing 10 mg/L tetracycline, 50 mg/L amplicillin and The activity of p AH61 was demonstrated by restoring 1,3- 60 25 mg/L. kanamycin. Following overnight growth, several propanediol production in an E. coli, btuR minus background thousand colonies are pooled by scraping plates bearing well (RK6726, Lundrigan et al., Mol. Gen. Genet. 206, 401–407 separated colonies. The pool of cells is washed extensively by (1987)). E. coli strains RK6726/pDT24 and RK6726/pDT24/ centrifugation and resuspension in S12 medium. Serial dilu pAH61 were grown in erlenmeyer flasks containing medium tions are plated on S12 plates containing coenzyme B and at one fifth the volume of flask capacity. The plasmid plT24 65 incubated in the dark for 2 days. Colonies are replica-plated contains the genes encoding glycerol dehydratase and 1.3- onto S12 plates containing vitamin B and 0.1 mM isopro propanediol oxidoreductase). Medium, titrated to pH 6.8 with pyl-f-D-galactopyranoside (IPTG) and incubated in the dark US 7,582,457 B2 25 26 for 2 days. Colonies that fail to grow on vitamin B but grow Example 4 on coenzyme B are enriched for mutations in the vitamin B to coenzyme B conversion, but will not be mutated in Enhanced 1,3-propanediol Production btuR because of the presence of the multicopy btuR plasmid pAH61, nor will they be defective in cobalamin transport or methionine synthesis because they grow on minimal media Growth of cells from Example 3 to give an improvement in containing coenzyme B. Putative cobalt reductase mutants 1,3-propanediol production is carried at 37°C. in shake-flask are assayed for the loss of cob(II)alamin reductase using the cultures (erlenmeyer flasks, liquid volume one tenth that of in vivo assay with cells treated with toluene and incubated total volume). with reduced hydroxycobalamin. 10 E. coli strain FM5/pLT24 cotransformed with pAH61 and A characterized cob(II)alamin reductase mutant is used to the cob(II)alamin reductase plasmid is grown in 250 mL select by complementation a gene that will restore growth on S12 plates containing vitamin B and IPTG. Chromosomal flasks containing 25 mL of medium at 30°C. with shaking at DNA is isolated from CAG 18491, or from other strains or 250 rpm. FM5/pLT24 (the parent strain) is grown in parallel species that are metB, and partially digested with the restric 15 as the control. Medium, titrated to pH 6.8 with NHOH, tion enzyme Sau3A. The Sau3A fragments are ligated into the contains 0.2 M KHPO, 2.0 g/L citric acid, 2.0 g/L BamHI site of plasmid paCYC184 and transformed into the MgSO4.7H2O, 1.2 mL 98% HSO, 0.30 g/L ferric ammo cob(II)alamin reductase minus strain. Plasmid paCYC184 nium citrate, 0.20 g/L CaCl2.H2O, 5 mL of trace metal mix, (ch1R) is compatible with p AH61 (ampR), and the presence 5 g/L yeast extract, 10 g/L D-glucose, 30 g/L glycerol and 5 of Tn5 (kanR) and Tn 10 (tetR) are confirmed by resistance to mg/L of either vitamin B or hydroxocobalamin. Trace metal the appropriate antibiotic. The transformed library-contain mix contains (g/L): NaSO (4.0), MnSO HO (0.80), ing cells are plated on S12 plates containing vitamin B and ZnSO 7HO (1.6), CoSO (0.52), CuSO 5HO (0.12), and 0.1 mMIPTG and incubated in the dark for 2 days. Plasmids FeSO 7H2O (4.0). In addition, the appropriate antibiotics are that restore growth of cells by complementation under these present in order to maintain plasmid stability. growth conditions are screened using the in vitro cob(II) 25 alamin reductase assay to confirm the presence of the cloned Flasks are inoculated to an initial OD600 of approximately gene. 0.01 AU. pH is maintained above pH 6.2 with the addition of Example 3 0.5 N KOH, and the glucose concentration is maintained above 2 g/L with the addition of a 50% (w/w) solution. pH is Host Construction 30 monitored using ColorpHast strips (EM Science, Gibbstown, N.J.). Glucose concentration is monitored using the Trinder E. coli strain FM5 is co-transformed with the dha plasmid enzymatic assay (Sigma, St. Louis, Mo.). At various times, pDT24 (specR), the btuR plasmid pAH61 (ampR), and the aliquots are removed in order to determine 1,3-propanediol cob(II)alamin reductase plasmid based on p ACYC184 concentration (by gc orhplc analysis as described above) and (ch1R). Selection is on LB plates containing 50 mg/L spec- cell density (ODoo). The strain FM5/pLT24 cotransformed tinomycin, 50 mg/L amplicillin and 100 mg/L chlorampheni- with pAH61 and the cob(II)alamin reductase plasmid shows col. Colonies resistant to all three antibiotics are used for increased 1,3-propanediol production compared to the parent 1.3-propanediol production. strain.

SEQUENCE LISTING

<16 Oc NUMBER OF SEO ID NOS: 25

<210 SEQ ID NO 1 <211 LENGTH: 591 &212> TYPE: DNA <213> ORGANISM: Escherichia coli

<4 OO SEQUENCE: 1 atgagtgatgaacgctacca acagcgt cag cagcgagtga aagaaaaagt agatgctcgt. 60

gtggcc.cagg cc caggatga acgcgg tatt at catcgt.ct tt accggcaa tdgaaaaggc 12O aaaaccaccg cggcatttgg tacggcaa.ca cc.gcagttg gt cacggaala aaaagtaggc 18O

gtcgtgcagt tt attaaagg cacctggcct aatggcgaac gcaatctgct ggagccacat 24 O

ggcgttgagt tt caggtgat ggcaacgggc tittacctggg at acacaaaa cc.gc.gagt ct 3 OO gat accgc.cg cctgcc.gcga agtctggcaa catgcaaagc ggatgcttgc tigattic ct ca 360 Ctggatatgg ttittgcttga tigaactgacg tatatggtgg cqtatgact a tittgcc actg 42O

gaagaagtgg to aggcgtt aaatgaacgt ccacat Caac agacggtgat tat cacgggit 48O

cgtggttgtc atcgggatat tcttgaact g gCagatacgg taagtgaatt acgcc.ccgtc 54 O

US 7,582,457 B2 45 46

- Continued <210 SEQ ID NO 12 <211 LENGTH: 37 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer

<4 OO SEQUENCE: 12 ggaatt Caga t ct cagcaat gagcgagalaa accatgc 37

<210 SEQ ID NO 13 <211 LENGTH: 27 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer

<4 OO SEQUENCE: 13 gctictagatt agct tcctitt acgcago 27

<210 SEQ ID NO 14 <211 LENGTH: 33 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer

<4 OO SEQUENCE: 14 ggccaa.gctt aaggaggitta attaaatgala aag 33

<210 SEQ ID NO 15 <211 LENGTH: 26 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer <4 OO SEQUENCE: 15 gctictagatt attcaatggit gtcggg 26

<210 SEQ ID NO 16 <211 LENGTH: 42 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer <4 OO SEQUENCE: 16 gcqc cqtcta gaattatgag citatcg tatgtttgattatc td 42

<210 SEQ ID NO 17 <211 LENGTH: 36 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer <4 OO SEQUENCE: 17 tctgatacgg gatcct caga atgcctggcg gaaaat 36

<210 SEQ ID NO 18 <211 LENGTH: 18 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer

US 7,582,457 B2 51 52

- Continued aggaact citt tdatc.cggitt cotgaacagg atctatttga gcc.gctaaat gaaac cittaa 4 O2O cgctatggaa citcgcc.gc.cc gactgggctg gcgatgagcg aaatgtagtg Cttacgttgt 4 O8O cc.cgcatttg gtacagcgca gta accggca aaatcgc.gcc gaaggatgtc. gctgc.cgact 414 O gggcaatgga gcgc.ctgc.cg gcc cagtatic agc.ccgt cat acttgaagct agacaggctt 42OO atcttggaca agaagaagat cqcttggcct cqc.gc.gcaga t cagttggala gaatttgtc.c 426 O actacgtgaa aggcgagat.c accalaggtag ticggcaaata atgtc.t.a.aca atticgttcaa 432O gcc.gacgc.cg Ctt cqcggcg C9gcttaact Caagcgittag atgcact aag cacataattg 438 O ct cacago.ca aactat cagg toaagttctgc titt tattatt tittaa.gcgtg cataataagc 4 44 O cctacacaaa ttgggagata tat catgaaa gcc tiggcttt ttcttgttat cqcaatagitt 4500 ggcgaagitaa ticgcaa.catc. c9c attaaaa t ct agdgagg gctitt acta 4549

<210 SEQ ID NO 21 <211 LENGTH: 199 &212> TYPE: DNA <213> ORGANISM: Streptomyces sp.

<4 OO SEQUENCE: 21 gaattic act a gtcgatctgt gctgtttgcc acgg tatgca gcaccagcgc gagattatgg 6 O gct cqcacgc ticgactgtcg gacgggggca Ctggaacgag aagtcaggcg agc.cgtcacg 12 O c ccttgacaa togccacatco tdagcaaata attcaac cac taaacaaatc aaccocqttt 18O cc.cggaggta accaagctt 199

<210 SEQ ID NO 22 <211 LENGTH: 46 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer

<4 OO SEQUENCE: 22 taagct tagg agcatcc.cat gagtgatgaa cqctaccaac agcgt.c 46

<210 SEQ ID NO 23 <211 LENGTH: 37 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer

<4 OO SEQUENCE: 23 caattic ct gc agittaataat cqatic cctat citgcgct 37

<210 SEQ ID NO 24 <211 LENGTH: 46 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: primer

<4 OO SEQUENCE: 24 taagct tagg agcatcc.cat gagtgatgaa cittatcagc agcgc.c 46

<210 SEQ ID NO 25 <211 LENGTH: 37 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: US 7,582,457 B2 53 54

- Continued <223> OTHER INFORMATION: Description of Artificial Sequence: primer <4 OO SEQUENCE: 25 caattic ct gc agittaataat caatticccat citgcgct 37

We claim: 10 activity selected from the group consisting of Kleb 1. A process for the bio-production of 1,3-propanediol siella pneumoniae dhaE1-3 as shown in SEQ ID comprising: NO:4, SEQID NO:5, and SEQID NO:6; (i) contacting a transformed host cell with at least one (b) at least two copies of a gene encoding a protein fermentable carbon source and an effective amount of having a 1,3-propanediol oxidoreductase activity of coenzyme B precursor whereby 1,3-propanediol is 15 Klebsiella pneumoniae dhaT as shown in SEQ ID produced, the transformed host cell comprising: NO:7; and (a) at least one copy of genes encoding a protein having (c) at least one copy of a gene encoding a protein having a glycerol dehydratase activity or a diol dehydratase a cob(I)alamin adenosyltransferase activity selected activity selected from the group consisting of Kleb- from the group consisting of Escherichia coilbtuRas siella pneumoniae dhaE1-3 as shown in SEQ ID 20 shown in SEQ ID NO:1, Salmonella typhimurium NO:4, SEQID NO:5, and SEQID NO:6; cobA as shown in SEQID NO:2, and Pseudomonas (b) at least one copy of a gene encoding a protein having denitrificans cobO as shown in SEQID NO:3: a 1,3-propanediol oxidoreductase activity of Kleb- wherein the genes of (i)(a)-(i)(c) are heterologous and siella pneumoniae dhaT as shown in SEQ ID NO:7; express their respective gene products in active form; and 25 and (c) one copy of a gene encoding a protein having a (ii) recovering the 1,3-propanediol produced from step (i); cob(I)alamin adenosyltransferase activity selected the improvement comprising an increase in the produc from the group consisting of Escherichia coilbtuRas tion of 1,3-propanediol as compared with a bio-process shown in SEQ ID NO:1, Salmonella typhimurium wherein the gene of (i)(c) is not present in multicopy in cobA as shown in SEQID NO:2, and Pseudomonas 30 the transformed host cell. denitrificans cobO as shown in SEQID NO:3: 7. A process for regulating the bio-production of 1,3-pro wherein the genes of (i)(a)-(i)(c) are heterologous to the panediol comprising: host cell and express their respective gene products in (i) contacting a transformed host cell with (a) at least one active form, and carbon Source selected from the group consisting of (ii) recovering the 1,3-propanediol produced from step (i). 35 fermentable carbohydrates, single-carbon Substrates 2. The process according to claim 1 wherein the ferment- and mixtures thereof and (b) an effective amount of able carbon Source is selected from the group consisting of coenzyme B precursor whereby 1.3-propanediol is fermentable carbohydrates, single-carbon Substrates, and produced, the transformed host cell comprising: mixtures thereof. 3. The process according to claim 1 wherein the ferment- 40 (a)at least one copy of genes encoding a protein having a glycerol dehydratase activity or a diol dehydratase able carbon Source is selected from the group consisting of activity selected from the group consisting of Kleb monosaccharides, oligosaccharides, polysaccharides, single siella pneumoniae dhaE1-3 as shown in SEQ ID carbon Substrates, glycerol, dihydroxyacetone and carbon NO:4, SEQID NO:5, and SEQID NO:6; containing amines. (b) at least one copy of a gene encoding a protein having 4. The process according to claim 1 wherein the trans- 45 a 1,3-propanediol oxidoreductase activity of Kleb formed host cell is selected from the group consisting of siella pneumoniae dhaT as shown in SEQ ID NO:7; bacteria, yeast, and filamentous fungi. and 5. The process according to claim 4 wherein the trans (c) at least one copy of a gene encoding a protein having formed host cell is selected from the group consisting of a cob(I)alamin adenosyltransferase activity selected Citrobacter, Enterobacter, Clostridium, Klebsiella, Aero- 50 from the group consisting of Escherichia coilbtuRas Schizosaccharomyces,bacter, Lactobacillus, Zygosaccharomyces,Aspergillus, Saccharomyces, Pichia, y SE ASSI) SightF.C.his Kluyveromyces, Candida, Hansenula, Debaryomyces, cobA as shown in SEQ : Z, and FSeudomonas Mucor, Torulopsis, Methylobacter, Escherichia, Salmonella, denitrificans cobO as shown in SEQID NO:3: Bacillus, Streptomyces, and Pseudomonas. 55 wherein the gene of (i)(c) is selectively inhibited 6. An improved process for the bio-production of 1,3- whereby the metabolism of coenzyme B precursor propanediol comprising: is regulated. (i) contacting a transformed host cell with at least one 8. The process of any one of claims 1, 6 or 7 wherein the carbon Source selected from the group consisting of effective amount of coenzyme B precursor is produced de fermentable carbohydrates, single-carbon Substrates 60 novo by the transformed host cell. and mixtures thereof, and an effective amount of coen 9. The process of any one of claims 1, 6 or 7 wherein the Zyme B precursor, whereby 1,3-propanediol is pro effective amount of coenzyme B precursor is at a 0.1- to duced; the transformed host cell comprising: 10.0-fold molar ratio to the amount of dehydratase present. (a) at least one copy of genes encoding a protein having a glycerol dehydratase activity or a diol dehydratase k . . . .