Inhibition of HBV Replication by N-Hydroxyisoquinolinedione and N- Hydroxypyridinedione Ribonuclease H Inhibitors T

Antiviral Research 164 (2019) 70–80

Contents lists available at ScienceDirect

Antiviral Research

journal homepage: www.elsevier.com/locate/antiviral

Inhibition of HBV replication by N-hydroxyisoquinolinedione and N- hydroxypyridinedione ribonuclease H inhibitors T

Tiﬀany C. Edwardsa,b, Nagraj Manic, Bruce Dorseyc, Ramesh Kakarlac, Rene Rijnbrandc, ∗ Michael J. Soﬁac, John E. Tavisa,b, a Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO, USA b Saint Louis University Liver Center, Saint Louis University School of Medicine, St. Louis, MO, USA c Arbutus Biopharma Incorporated, Warminster, PA, USA

ARTICLE INFO ABSTRACT

Keywords: We recently developed a screening system capable of identifying and evaluating inhibitors of the Hepatitis B HBV virus (HBV) ribonuclease H (RNaseH), which is the only HBV enzyme not targeted by current anti-HBV thera- Ribonuclease H pies. Inhibiting the HBV RNaseH blocks synthesis of the positive-polarity DNA strand, causing early termination N-hydroxyisoquinolinediones of negative-polarity DNA synthesis and accumulation of RNA:DNA heteroduplexes. We previously reported in- N-hydroxypyridinediones hibition of HBV replication by N-hydroxyisoquinolinediones (HID) and N-hydroxypyridinediones (HPD) in Antiviral human hepatoma cells. Here, we report results from our ongoing eﬀorts to develop more potent anti-HBV Structure-activity relationship RNaseH inhibitors in the HID/HPD compound classes. We synthesized and screened additional HIDs and HPDs for preferential suppression of positive-polarity DNA in cells replicating HBV. Three of seven new HIDs inhibited

HBV replication, however, the therapeutic indexes (TI = CC50/EC50) did not improve over what we previously

reported. All nine of the HPDs inhibited HBV replication with EC50s ranging from 110 nM to 4 μM. Cellular

cytotoxicity was evaluated by four assays and CC50s ranged from 15 to > 100 μM. The best compounds have a calculated TI of > 300, which is a 16-fold improvement over the primary HPD hit. These studies indicate that the HPD compound class holds potential for antiviral discovery.

1. Introduction anti-HBV treatments, be well tolerated during prolonged use, and have a high genetic barrier to resistance. Hepatitis B virus (HBV) is a major global health problem. An esti- We are exploring the HBV ribonuclease H (RNaseH) as an antiviral mated 257 million people are chronically infected worldwide, resulting drug target. The RNaseH is one of two enzymatically active domains on in > 880,000 deaths annually from HBV-associated liver diseases, in- the HBV polymerase that synthesizes the partially double-stranded DNA cluding cirrhosis, hepatocellular carcinoma, and liver failure (WHO, genome via reverse transcription. The reverse transcriptase (RT) do- 2017). HBV-associated health care costs are up to $39,898 per quality- main of the polymerase protein copies the pregenomic RNA (pgRNA) adjusted life year (Xie et al., 2018). Available anti-HBV therapies are template to form the minus-polarity DNA strand. The RNaseH re- limited to two forms of the innate immunity cytokine interferon-α and cognizes RNA:DNA heteroduplexes that are formed during minus-po- six nucleoside/nucleotide analogs (NA) which block DNA chain elon- larity DNA synthesis and degrades the RNA strand (Seeger et al., 2013; gation by the viral polymerase. These therapies significantly improve Tavis and Badtke, 2009). The polymerase then synthesizes the positive- patient outcomes, and NA can suppress viremia by more than 4–5 log10 polarity DNA strand, but it typically arrests after making only ∼50% of in the majority of patients (Cox and Tillmann, 2011; Kwon and Lok, the plus-polarity DNA strand. Both enzymatic activities of the poly- 2011). However, HBV replication still persists in most patients, there- merase are required for synthesis of the HBV genome, yet the RNaseH is fore these therapies must be continued indefinitely (Coffin et al., 2011; an unexploited drug target (Tavis and Lomonosova, 2015). Zoulim, 2004). It is widely accepted that curing HBV will require new Blocking the HBV RNaseH activity prevents removal of the RNA drugs against new targets capable of further suppressing HBV (Petersen strand from the minus–polarity DNA strand, resulting in an accumula- et al., 2016). These new therapies will need to work together with other tion of RNA:DNA heteroduplexes (Hu et al., 2013). Failure to remove

∗ Corresponding author. Doisy Research Center, 1100 South Grand Blvd., Saint Louis, MO 63104 USA. E-mail addresses: Tiff[email protected] (T.C. Edwards), [email protected] (N. Mani), [email protected] (B. Dorsey), [email protected] (R. Kakarla), [email protected] (R. Rijnbrand), msofi[email protected] (M.J. Sofia), [email protected] (J.E. Tavis). https://doi.org/10.1016/j.antiviral.2019.02.005 Received 19 October 2018; Received in revised form 20 December 2018; Accepted 5 February 2019 Available online 12 February 2019 0166-3542/ © 2019 Elsevier B.V. All rights reserved. T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80 the pgRNA blocks synthesis of positive-polarity DNAs and causes pre- 2.4. HBV q-PCR replication inhibition assay mature arrest of minus-polarity DNA synthesis (Edwards et al., 2017; Gerelsaikhan et al., 1996; Hu et al., 2013; Tavis et al., 2013), with HepDES19 or HepDE19 cells were seeded in 96-well plates at truncation of the minus-polarity DNAs possibly stemming from con- 4×104 cells per well in the absence of tetracycline. Test compounds in formational constraints imposed on the viral DNA within capsids due to a final DMSO concentration of 1% were applied to cells 48 h after in- accumulation of the heteroduplexes. This prevents the formation of a duction of HBV replication and cells were incubated with compounds complete viral genome, thus stopping both transmission of infectious for 72 h. Cells were washed in 200 μL of phosphate buffered saline viral particles and the intracellular “recycling” mechanism that re- (PBS) and lysed in 150 μL of core lysis buffer (10 mM Tris pH 7.4, 1% plenishes the pool of covalently closed circular DNA (cccDNA), the Tween20, 150 mM NaCl). Cells were incubated at room temperate on template for all HBV RNAs. an orbital shaker at 350 rpm for 40 min. Cell lysate was transferred to a We recently developed an HBV RNaseH screening pipeline (Cai 96 well polymerase chain reaction (PCR) plate, and centrifuged at et al., 2014; Edwards et al., 2017; Hu et al., 2013; Lomonosova et al., 3300 × g for 5 min. The supernatant (50 μL) from the cell lysate was 2017a, 2017b; Lu et al., 2015, 2016; Tavis et al., 2013; Tavis and transferred to a 96-well PCR plate and mixed with 20 units of micro-

Lomonosova, 2015). We identiﬁed > 100 inhibitors primarily in three coccal nuclease and brought to 10mM CaCl2. The lysate was incubated compound classes, the α-hydroxytropolones (αHT), N-hydro- for 1 h at 37 °C, and then the nuclease was inactivated at 70 °C for xyisoquinolinediones (HID), and N-hydroxypyridinediones (HPD), that 10 min. Qiagen protease (0.005 Anson units) was added to the lysate suppress viral replication in cells by blocking the HBV RNaseH. These and the mixture was incubated overnight. Qiagen protease was then compounds preferentially suppress the plus-polarity DNA strands, in- inactivated at 95 °C for 10 min. duce truncation of the minus-polarity DNA strands, and cause accu- The crude lysate was used as the template for strand-preferential mulation of extensive RNA:DNA heteroduplexes in capsids as expected quantitative polymerase chain reaction (q-PCR) analysis. Quantitative from their inhibition of the RNaseH. The best compounds have ther- PCR was performed with 40 cycles of 95 °C for 15 s and 60 °C for 1 min apeutic indexes [cytotoxicity/eﬃcacy (TI)] > 200 (Lomonosova et al., employing the Kappa Probe Force universal PCR master mix. The pri- 2017a). Representative HBV RNaseH inhibitors can work synergisti- mers and probe (IDT Inc.) for the plus-polarity DNA strand were 5′ cally with approved and experimental therapies (Lomonosova et al., CATGAACAAGAGATGATTAGGCAGAG3′,5′GGAGGCTGTAGGCATAAA 2017b), inhibit multiple HBV isolates from genotypes B, C, and D TTGG3′, and 5’/56-FAM/CTGCGCACC/ZEN/AGCACCATGCA/ equivalently (Lu et al., 2016), and suppress viral replication in a chi- 3IABkFQ. The primers and probe for the minus-polarity DNA strand meric mouse model (Long et al., 2018). Therefore, the HBV RNaseH is a were 5′GCAGATGAGAAGGCACAGA3′,5′CTTCTCCGTCTGCCGTT3′, validated drug target. and 5’/56-FAM/AGTCCGCGT/ZEN/AAAGAGAGGTGCG/3IABkFQ.

We are pursuing a hit-to-lead medicinal chemistry campaign to EC50 values were calculated from the plus-polarity DNA data with optimize inhibitors of the HBV RNaseH. Here, we report the activity of GraphPad Prism using the three-parameter log(inhibitor)-versus-re- seven new HIDs and nine new HPDs, with significant improvements in sponse algorithm with the bottom value set to zero. in vitro potency and cytotoxicity profiles for the HPD compounds. 2.5. Cytotoxicity assays 2. Materials and methods The effects of compounds on cell viability in HepDES19 or ™ 2.1. Compound acquisition and synthesis HepDE19 cells was assessed using the CellTiter 96 AQueous Non- Radioactive Cell Proliferation Assay (Promega, Madison, WI) (MTS) as Compounds were synthesized by Arbutus Biopharma and all com- previously described (Edwards et al., 2017). Cells were seeded into a 96 4 pounds were ≥95% pure. Compounds were dissolved in 100% DMSO well plate at 1 × 10 cells per well. The compounds were applied to and stored in amber tubes to protect them from light. All compounds cells 48 h after the removal of tetracycline from the cell culture media were maintained in single-use aliquots and stored at −80 °C until use. and the HBV-expressing cells were incubated for 72 h in the presence of Compound structures and names are in Table 1. compound containing media. Fifty percent cytotoxic concentration (CC50) values were calculated with GraphPad Prism using the three- parameter variable-response log(inhibitor)-versus-response algorithm fi 2.2. Expression and puri cation of HBV RNaseH and huRNaseH1 with the bottom value set to zero. Active compounds were further evaluated in an expanded cyto- HBV RNaseH with an N-terminal SMT tag was expressed in toxicity panel. HepDES19 cells were seeded at 1 × 104 cells per well fi ffi Escherichia coli and puri ed by nickel a nity-chromatography as de- and HBV expression was synchronously induced. Cells were incubated scribed previously (Villa et al., 2016). The human ribonuclease H1 in the presence of compound for 72 h. Lysosomal function was tested fi (huRNaseH1) was expressed in Escherichia coli and puri ed by nickel using the neutral red (NR) uptake assay (Edwards et al., 2017; Repetto ffi a nity-chromatography as described previously (Villa et al., 2016). et al., 2008). Lactate dehydrogenase (LDH) release was measured using the LDH-cytotoxicity colorimetric assay kit (BioVision) as previously 2.3. Cells and cell culture reported (Edwards et al., 2017). Fifty percent cytotoxic concentration

(CC50) values were calculated with GraphPad Prism using the three- HepDES19 and HepDE19 cells are HepG2 (human hepatoblastoma) parameter variable-response log(inhibitor)-versus-response algorithm cell line derivatives stably transfected with an HBV genotype D genome with the bottom value set to zero. under the control of a tetracycline-repressible promoter (Guo et al., The eﬀect of select compounds on cell viability in HepDE19 cells 2007). The HepBHAe82 cell line is a HepG2 cell line derivative that has was assessed using replicate plates, with cells plated at a density of an in-frame HA epitope tag in the N-terminal coding sequence of HBV e 5,000 cells/well and incubated for 4 days, to determine the ATP content antigen (HBeAg) in a transgene that does not disrupt any cis-elements as a measure of cell viability using the CellTiter-Glo™ reagent (CTG; critical for HBV replication, cccDNA transcription, and HA-HBeAg se- Promega, Madison, WI) per manufacturer's instructions. The plates cretion (Cai et al., 2016). Cells were maintained in Dulbecco's modiﬁed were read using a Victor luminescence plate reader (PerkinElmer Model Eagle's medium (DMEM)/F12 media supplemented with 10% fetal bo- 1420 Multilabel counter) and the relative luminescence units (RLU) vine serum (FBS) and 1% penicillin/streptomycin (P/S) with 1 μg/mL data generated from each well was calculated as percent inhibition of tetracycline. Synchronized expression of HBV pgRNA was induced by the untreated control wells and analyzed using XL-Fit module in removing tetracycline from the culture medium. Microsoft Excel to determine the CC50 (CTG) values using a four-

71 ..Ewrs tal. et Edwards, T.C. Table 1 Activity proﬁle of HID and HPD compounds.

Compound # Compound structure Derivative Activity vs. HBV RNaseHb Activity vs. huRNaseH1b Solubility HBV replication HBV replication Cellular TI seriesa (μM) inhibition (+) DNA inhibition (−) DNA cytotoxicity c Molecular Oligonucleotide - Molecular Oligonucleotide - (EC50 , μM) (EC50 , μM) (CC50 , μM) beacon directed cleavage beacon directed cleavage

A10 HID –– –NDe > 200 ––> 100 N.A.f

A11 HID INDd – + ND > 200 3.3 ± 0.4 38 ± 9 > 100 > 30

A12 HID + + + ND > 200 ––40 ± 8 N.A.

A18 HID – + – ND 50 ––24 ± 20 N.A. 72

A19 HID + + + + > 200 3.8 ± 1.7 > 50 100 ± 0.2 26

A20 HID – + – ND > 200 2.4 ± 0.1 > 50 93 ± 9 39

A21 HID – + – ND 50 ––18 ± 10 N.A. Antivira l Research164(2019)70–80

(continued on next page) ..Ewrs tal. et Edwards, T.C. Table 1 (continued)

A13 HPD + + + ND > 200 0.54 ± 0.3 56 ± 8 85 ± 15 157

A14 HPD IND + IND + > 200 2.1 ± 0.4 57 ± 4 81 ± 13 39

A15 HPD + + IND – > 200 0.46 ± 0.1 9.8 ± 3 71 ± 17 154

A16 HPD + + + ND > 200 4.0 ± 1.9 > 50 62 ± 15 16

A17 HPD + + + ND > 200 0.95 ± 0.2 > 50 15 ± 7 16 73

A22 HPD IND + + ND > 200 0.32 ± 0.2 32 ± 17 90 ± 6 281

A23 HPD + + + ND > 200 0.11 ± 0.01 10 ± 2 33 ± 8 300

A24 HPD + + + ND > 200 0.29 ± 0.1 31 ± 16 102 ± 3 352

A25 HPD + + + ND > 200 0.5 ± 0.1 30 ± 12 91 ± 16 182 Antivira l Research164(2019)70–80

a N-hydroxyisoquinolinedione (HID) and N-hydroxypyridinediones (HPD). b (+) Detectable inhibition at or below 100 μM; (−) No inhibition detected at 100 μM. c CellTiter 96™ AQueous Non-Radioactive Cell Proliferation Assay (MTS). d Indeterminante, (IND). e Not determined (ND). f Not applicable, (N.A.). T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80 parameter curve fitting algorithm. 2.8. Turbidimetric solubility assay The effect of select compounds on cell viability and proliferation in HepBHAe82 cells was assessed using replicate plates seeded at 10–20% Compound solubility was assessed using a turbidimetric solubility cell density that, after 4 days, were assayed for intracellular ATP con- assay in unmodified, phenol red-free DMEM media at pH 7.3. tent using the Cell-Titer Glo reagent (Promega, Madison, WI) per Compounds were diluted into DMEM (200 μM to 1.5 μM) in 1% DMSO. manufacturer's instructions and plates were read using a Victor lumi- 100 μL of diluted compound was plated into a clear 96-well plate and nescence plate reader (Model 1420 Multilabel counter; PerkinElmer, the absorbance at 620 nm was read with a synergy HTX plate reader. Waltham, MA). Cell viability was calculated as a percentage of the The absorbance versus compound concentration was plotted and the untreated negative control wells. The relative luminescence units (RLU) inflection point was determined to be the point where the absorbance at data generated from each well was calculated as % inhibition of the 620 nm was more than 2-fold higher than background. Solubility limits untreated control wells and analyzed using XL-Fit module in Microsoft are reported as the lower bound of the inflection point (Hoelke et al.,

Excel to determine EC50 (HA-HBeAg AlphaLISA) and CC50 (CTG) values 2009; Kerns et al., 2008). using a 4-parameter curve fitting algorithm. 2.9. bDNA quantitation of HBV rcDNA 2.6. RNaseH assays HepDE19 (50,000 cells/well) were plated in 96 well collagen-coated tissue culture-treated microtiter plates in the presence of 1 μg/mL tet- Qualitative inhibition of the HBV RNaseH and huRNaseH1 in the racycline and incubated in a humidified incubator at 37 °C and 5% CO biochemical assays was assessed using a molecular beacon assay as 2 overnight. Next day, the cells were switched to fresh medium without described previously (Edwards et al., 2017). HBV RNaseH (2.1 μg) was tetracycline and incubated for 4 h at 37 °C and 5% CO . The cells were incubated with 25 nM of a RNA/DNA substrate, 50 mM HEPES pH 8.0, 2 treated with fresh Tet-free medium with compounds at concentrations 100 mM NaCl, 2 mM Tris(2-carboxyethyl)phosphine hydrochloride starting at 25 μM and a serial, half log, 8-point, titration series in du- (TCEP), 0.05% Tween20, 5 units of RNaseOut, test compounds plicate. The final DMSO concentration in the assay was 0.5%. The (0–500 μM), and 5% DMSO in a 100 μL reaction volume. The substrate plates were incubated for seven days in a humidified incubator at 37 °C was formed by annealing a complementary RNA oligonucleotide to a and 5% CO . Following a seven day-incubation, the level of rcDNA hairpin DNA oligonucleotide to hold the hairpin DNA oligonucleotide 2 present in the inhibitor-treated wells was measured using a Quantigene in an open conformation. The DNA oligonucleotide has a 5′ fluorescein 2.0 bDNA assay kit (Affymetrix, Santa Clara, CA) with HBV specific reporter and a 3′ black hole quencher. When the RNA is degraded from custom probe set and manufacturer's instructions. In order to differ- the substrate the DNA oligonucleotide closes to form a hairpin struc- entiate HBV RNaseH inhibitors from other classes of HBV inhibitors (eg: ture, decreasing in signal intensity. Reactions were initiated with 5 mM capsid inhibitors), the assay method was configured by incorporating MgCl and fluorescence was read using a Synergy HTS multi-mode plate 2 the quantitation of both the minus-strand and the plus-strand of HBV reader at 37 °C. All huRNaseH1 reactions were run with 0.3 μg huR- rcDNA levels using specifically designed HBV probe sets. This is based NaseH1 and 100 nM of RNA:DNA substrate. All other reaction condi- on the observation that inhibition of RNaseH enzyme activity blocks tions were identical. Qualitative inhibition was defined as a dose-de- synthesis of the positive-polarity strand synthesis by the viral poly- pendent reduction in the rate of substrate degradation over time merase that follows the synthesis of the minus-polarity strand of rcDNA. compared to the vehicle-treated control. In this system, an RNaseH inhibitor would therefore show prominent Compounds were also analyzed in the oligonucleotide-directed RNA inhibition of the plus-strand formation but minimal effect on the cleavage assay (Edwards et al., 2017; Hu et al., 2013; Tavis et al., synthesis of the minus-strand of rcDNA. In contrast, treatment with 2013). 100 ng RNA was combined with 200 ng DNA oligonucleotide HBV capsid inhibitors would reduce the production of both strands of and the RNA:DNA substrate was incubated in the presence of the HBV rcDNA in cells. Concurrently, the effect of compounds on RNaseH enzyme and test compounds in 50 mM Tris (pH 7.5), 100 mM HepDE19 cell viability was assessed as described in section 2.5. Data NaCl, 5 mM MgCl , 2 mM TCEP, 0.05% Tween20, and 1% DMSO at 2 was analyzed using XL-Fit module in Microsoft Excel to determine EC 37 °C for 60 min. The products were resolved by denaturing gel elec- 50 and EC (bDNA) values using a 4-parameter curve fitting algorithm. trophoresis and RNA substrate and cleavage products were detected by 90 ® staining with SYBR gold according to the manufacturer's instructions 2.10. HepBHAe82 assay with cccDNA-dependent HA-HBeAg (e antigen) (Life Technologies, Carslbad, CA). Bands were imaged using a Typhoon quantitation using AlphaLISA Trio Variable Mode Imager (GE Healthcare, Marlborough,MA). Inhibi- tion was defined as a dose-dependent reduction in the amount of sub- The HepBHAe82 cell line is a HBV cell culture system is similar to strate cleavage compared to the vehicle-treated control. the HepDES19 but it has an in-frame HA epitope tag in the N-terminal coding sequence of HBeAg in the HBV transgene, without disrupting 2.7. Synergy any cis-elements critical for HBV replication, cccDNA transcription, and HA-HBeAg secretion (Cai et al., 2016). In this cell culture system, the Synergy between compounds was assessed using the Chou-Talalay reporters are the precore RNA and its cognate protein product, the se- method for HBV replication inhibition. HepDES19 cells were plated in creted HA-tagged HBV ″e antigen” (HA-HBeAg) that is only formed 96 well plates at 4 × 104 cells per well and incubated in the absence of upon the generation of cccDNA. An AlphaLISA assay for the detection of tetracycline for 48 h prior to the addition of compound. Nine compound HA-tagged HBeAg with anti-HA antibody serving as a capture antibody concentrations from 16- to 0.625-fold the EC50 of each compound and anti-HBeAg serving as detection antibody, specifically detects the (Table 1 and (Edwards et al., 2017)) were tested. All experiments were cccDNA-dependent signal and eliminates the contaminating signal from done with constant ratios of both compounds in the presence of 2% HBV “core antigen” (HBcAg). The HepBHAe82 cell line exhibits high DMSO as described previously (Lomonosova et al., 2017b). Cell lysis levels of cccDNA synthesis and HA-HBeAg production and secretion and and plus-polarity DNA quantification were done as described in section provides a highly specific readout signal with low noise. To test the 2.4. The Chou-Talalay method was used to calculate the combination effect of compounds on cccDNA formation and expression, HepBHAe82 index (CI) to determine synergy (CI < 1), additive effects (CI = 1) or (50,000 cells/well) were plated in 96 well, tissue culture-treated, mi- antagonism (CI > 1) using CompuSyn software from ComboSyn, Inc. crotiter plates in DMEM/F12 medium supplemented with 10% FBS, 1% (Chou, 2010). The weighted CI was calculated using the formula: penicillin-streptomycin and tetracycline (1 μg/mL) and incubated in a

(CI50 + 2CI75 + 3CI90 + 4CI95)/10 = CIwt (Lomonosova et al., 2017b). humidiﬁed incubator at 37 °C and 5% CO2 overnight. Next day, the cells

74 T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80 were switched to fresh medium without tetracycline and treated with the rate of substrate degradation. Of the seven HIDs evaluated, two compounds at concentrations starting at 25 μM and a serial, ½ log, 8- inhibited the HBV RNaseH, four did not inhibit the enzyme, and one point, titration series in duplicate. The final DMSO concentration in the gave inconclusive results (Table 1, Fig. 2). Of the nine HPDs, seven assay was 0.5%. The plates were incubated for 9 days in a humidified inhibited the HBV RNaseH and two gave inconclusive results (Table 1, incubator at 37 °C and 5% CO2. On day 9, media was harvested and Fig. 2). Inconclusive results stemmed from interference with the removed to a fresh plate, and level of HA-HBeAg was determined by fluorescence signal by the compounds or inhibition that lacked dose- AlphaLISA. Concurrently, the effect of inhibitor concentrations on cell responsiveness. Therefore, we evaluated inhibition by the HID/HPD viability and proliferation was assessed using the Cell-Titer Glo reagent compounds using a gel-based oligonucleotide-directed RNA cleavage (Promega, Madison, WI) as described in section 2.5. assay that is specific for RNaseH activity compared to other RNase activities that could also be detected by the molecular beacon assay 2.11. Selectivity assays (Edwards et al., 2017). Compounds were incubated with the HBV RNaseH and an RNA:DNA heteroduplex substrate. The reaction pro- The selectivity assays for human immunodeficiency virus (HIV), ducts were resolved on a denaturing acrylamide gel and the amount of human cytomegalovirus (HCMV), herpes simplex virus (HSV) and cleaved substrate was measured by imaging the resolved products using Eschericia coli tolC mutant were performed by Imquest Biosciences Inc. a Typhoon phosphorimager. Five of the HIDs inhibited the HBV RNaseH (Frederick, MD) using their standardized protocols under a service and all nine HPDs inhibited the HBV RNaseH in the oligonucleotide- contract. directed RNA cleavage assay (Table 1, Fig. 2b). Inhibition of the HBV RNaseH endonuclease activity in the oligonucleotide-directed RNaseH 3. Results assay is best measured by observing the amount of substrate RNA re- maining intact after the reaction relative to the uninhibited control 3.1. HBV replication inhibition and cytotoxicity (Fig. 2b). This is because the HBV RNaseH has a 3′-5′ exonuclease activity that is stimulated by the endonuclease activity, and the RNaseH To evaluate the ability of compounds to inhibit HBV replication, remains attached to the P1 product fragment and processively degrades HepDES19 cells, a human hepablastoma cell line (Guo et al., 2007), that it. (Villa et al., 2016). Both the endo- and exo-nuclease activities are carries a tetracycline-repressible HBV genomic expression vector were inhibited by RNaseH inhibitors, resulting in stabilization of both the seeded onto a 96 well plate, HBV replication was synchronously in- substrate and P1 products rather than just the substrate as would be the duced by withdrawal of tetracycline, and compounds were incubated case if there were no exonucleolytic degradation (Fig. 2b). In total, 14 with the HBV-expressing cells for 72 h. HBV nucleic acids were har- of the 16 compounds inhibited the HBV RNaseH in one or both bio- vested and a strand-preferential q-PCR assay was done to quantify the chemical assays. amount of positive- and negative-polarity DNA strands because inhibiting the HBV RNaseH preferentially blocks synthesis of positive- 3.3. huRNaseH1 inhibition polarity DNA. Three of the seven HIDs inhibited HBV replication, with effective concentration fifty percent (EC50) values from 2.4 to 3.8 μM All compounds were counter-screened using the molecular beacon (Table 1). All HPDs inhibited HBV replication, with EC50s from 0.11 to assay for activity against the human ribonuclease H1 (huRNaseH1), 4.0 μM(Table 1). The most effective compound was A23, an HPD, which is a potential off-target cellular enzyme. Three of seven HIDs and which has an EC50 of 0.11 ± 0.01 μM. All active compounds pre- seven of nine HPDs inhibited the huRNaseH1 in the molecular beacon ferentially inhibited the HBV positive-polarity DNA strand (Fig. 1). assay. Two compounds were inconclusive and were therefore evaluated To determine if efficacy of the compounds resulted from adverse using the oligonucleotide-directed RNA cleavage assay, where one fo effects on cellular health, we measured the 50 percent cytotoxicity the compounds inhibited the huRNaseH1 (Table 1). concentration (CC50) values for the compounds in HepDES19 cells using an MTS assay that measures mitochondrial function over three days of 3.4. bDNA quantitation of HBV rcDNA compound exposure; cells were plated at a low enough density that they divided at least twice while in the presence of the compounds. CC50s Based on the results obtained in the strand-preferential q-PCR assay ranged from 15 to > 100 μM(Table 1, Fig. 1). Eleven of the 16 com- for the HPD compounds, one HID (A19) and six HPDs (A13, A15, A22, pounds had CC50s over 50 μM(Table 1). Therapeutic index values A23, A24, A25) compounds were further evaluated for inhibition of (CC50MTS/EC50 = TI) ranged from 16 to 352 for the active compounds. HBV replication in HepDE19 cells using a branched chain DNA (bDNA) To expand assessment of cytotoxicity in HepDES19 cells, we eval- hybridization assay. HepDE19 cells were plated in tetracycline con- uated all active compounds using a neutral red (NR) assay, which taining DMEM on 96 well collagen-coated plates. 24 h later, HBV re- measures lysosomal function, and a lactate dehydrogenase (LDH) assay, plication was synchronously induced by the removal of tetracycline. which assesses cell membrane permeability. CC50 values for the NR Four hours after induction of HBV replication, test compounds were assay ranged from 17 to > 100 μM(Table 2), while for the LDH assay applied and incubated in the presence of HBV replicating cells for seven we observed values of 19 to > 100 μM(Table 2). Select compounds days. A bDNA assay kit with specific HBV primers and probes was used were also evaluated for cytotoxicity in HepDE19 cells and to quantify HBV rcDNA levels. All compounds tested inhibited HBV

HepBHAe82 cells using the CellTiter-Glo™ assay (CTG). CC50s in both replication with EC50s from 3.4 to 10.7 μM(Table 3). cell lines ranged from 25 to > 50 μM(Table 2), and there was a general concordance among all cytotoxicity assays. 3.5. HepBHAe82 assay with cccDNA-dependent HA-HBeAg (e antigen) quantitation using AlphaLISA 3.2. Biochemical screening against the HBV RNaseH Select compounds were further evaluated for the ability to inhibit We evaluated all compounds for inhibition of the HBV RNaseH cccDNA formation and expression. HepBHAe82 cells were seeded into using a molecular beacon assay in which RNaseH activity causes a 96 well plates and 24 h later tetracycline was removed to synchronously decline in ﬂuorescence (Edwards et al., 2017); this assay is suitable for induce HBV replication. Test compounds were applied and incubated in qualitative but not quantitative assessment of inhibition. Compounds the presence of HBV replicating cells for nine days. Media was har- were incubated with the HBV RNaseH plus a RNA:DNA heteroduplex vested on day nine and transferred to a fresh plate. substrate and the rate of substrate degradation was monitored, with In this cell culture system the levels of cccDNA are detected by inhibition being reported qualitatively as a dose-dependent reduction in measuring the secreted HA-HBeAg that is only formed upon generation

75 T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80

Fig. 1. Representative replication inhibition eﬃcacy and cytotoxicity assays. Replication inhibition by representative HIDs and HPDs was measured against an

HBV genotype D isolate in HepDES19 cells using a strand preferential q-PCR assay. EC50 values were calculated based on the decline of the positive-polarity DNA strand relative to the DMSO vehicle treated controls. Positive-polarity DNAs are in black; negative-polarity DNAs are in grey. EC50 values are the average of three experiments ± one standard deviation. Cytotoxicity was measured by MTS assay and CC50 values are the averages of three experiments ± one standard deviation. of cccDNA. An AlphaLISA assay for the detection of HA-tagged HBeAg 3.6. Synergy with anti-HA antibody serving as a capture antibody and anti-HBeAg serving as detection antibody was used. All seven compounds inhibited New anti-HBV drugs are likely to be used in combination with other cccDNA formation and expression with EC50s ranging from 0.43 to drugs. Therefore, we determined if an HPD (A23) and the approved 1.5 μM(Table 4). nucleoside analog Lamivudine act synergistically in inhibiting HBV replication. Three independent synergy experiments were performed in which the amount of DNA accumulation was measured using our strand preferential q-PCR assay. The Chou-Talalay method was used to

76 T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80

Table 2 Cytotoxicity analysis of selected compounds.

Compound # HepDES19 HepDE19 HepBHAe82

MTSa (μM) NRb (μM) LDHc (μM) MTSa (μM) CTGd (μM) CTGd (μM)

A11 > 100 > 100 > 100 NDe ND ND A13 85 ± 15 56 ± 11 90 ± 11 ND > 25 > 25 A14 81 ± 13 53 ± 8 77 ± 27 ND ND ND A15 71 ± 17 35 ± 15 96 ± 8 ND ∼25 > 25 A16 62 ± 15 52 ± 9 60 ± 12 ND ND ND A17 15 ± 7 17 ± 9 19 ± 13 ND ND ND A19 100 ± 0.2 > 100 > 100 ND > 25 > 25 A20 93 ± 9 42 ± 0.1 22 ± 8 ND ND ND A22 90 ± 6 63 ± 26 75 ± 13 71 ± 17 ∼25 > 25 A23 33 ± 8 37 ± 15 62 ± 15 48 ± 20 > 25 > 25 A24 102 ± 3 83 ± 30 > 100 97 ± 3 > 25 > 25 A25 91 ± 16 90 ± 15 90 ± 1 ND ∼25 > 25

a CellTiter 96™ AQueous Non-Radioactive Cell Proliferation Assay (MTS) was used to measure mitochondrial function. b Neutral red retention assay (NR) was used as a measure of lysosome function. c Lactate dehydrogenase release assay (LDH) was used as a measure of plasma membrane permeability. d CellTiter-Glo™ assay (CTG) was used as a measure of plasma membrane permeability. e Not determined (ND).

Fig. 2. Effects of the compounds on purified HBV RNaseH. (Panel A) HBV RNaseH inhibition was determined using a molecular beacon RNaseH assay in which quenching of fluorescence from the RNaseH substrate is measured following removal of the RNA strand by the RNaseH, causing the folding of the DNA strand into a hairpin. (Panel B) HBV RNaseH inhibition was determined using an oligonucleotide-directed RNA cleavage assay in which the cleavage of an RNA:DNA heteroduplex substrate was monitored by resolving the products on a gel and visualizing the stained gel using a Typhoon phosphorimager. Values are in μM. Neg. control, reactions in which the DNA oligonucleotide was not homologous to the RNA; EDTA control, reactions containing 10 mM EDTA to prevent catalysis.

77 T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80

Table 3 Expanded activity proﬁle of selected RNaseH inhibitors.

Compound EC50 CC50 q-PCR TI q-PCR TI bDNA TI HepDES19 HepDE19 HepDE19 q-PCR HepDES19 (μM) q-PCR HepDE19 (μM) bDNA_rcDNA HepDE19 MTS MTS CTG (μM) HepDES19 HepDE19 HepDE19 (μM) (μM) (μM) (+) strand (−) strand (+) strand (−) strand (+) strand (−) strand

HID A19 3.8 ± 1.7 NDa ND 7.6 ± 4.7 > 25 100 ± 0.2 ND > 25 26 NA > 3.2 HPD A13 0.54 ± 0.3 56 ± 8 ND ND 10.7 ± 2.2 > 25 85 ± 15 ND > 25 157 NA > 2.3 A15 0.46 ± 0.1 9.8 ± 3 ND ND 4.4 ± 2.7 ∼25 71 ± 17 ND ∼25 154 NA ∼5.7 A22 0.32 ± 0.2 32 ± 17 0.33 ± 0.2 11 ± 7 3.4 ± 2.5 > 25 90 ± 6 71 ± 17 > 25 281 215 > 7.3 A23 0.11 ± 0.01 10 ± 2 0.1 ± 0.03 6.7 ± 4 5.2 ± 1.6 > 25 33 ± 8 48 ± 20 ∼25 300 480 ∼4.8 A24 0.29 ± 0.1 31 ± 16 0.4 ± 0.01 32 ± 10 7.1 > 25 102 ± 3 97 ± 3 > 25 352 243 > 3.5 A25 0.5 ± 0.1 30 ± 12 ND ND 3.7 ± 2.3 > 25 91 ± 16 ND ∼25 182 NA ∼6.7

a Not determined (ND).

Table 4 3.8. Selectivity assays Inhibition of cccDNA by selected compounds. Selectivity assays evaluating inhibition of HIV, HCMV, HSV-1, and Compound HepBHAe82_ AlphaLISA_eAg HepBHAe82_ Cytotoxicity E. coli tolC mutant were performed by Imquest Biosciences Inc. μ μ EC50 ( M) CC50 ( M) (Frederick, MD) for three representative compounds. No substantial evidence of activity was observed against any of the pathogens tested HID (Table 6). A19 1.3 ± 0.39 > 25 HPD A13 1.5 ± 0.94 > 25 4. Discussion and summary A15 0.76 ± 0.71 > 25 A22 0.56 ± 0.34 > 25 A23 0.56 ± 0.2 > 25 We previously reported that 11 HIDs and a structurally related HPD A24 0.43 ± 0.11 > 25 inhibited HBV replication with low-to sub-micromolar efficacies, with A25 0.65 ± 0.51 > 25 TI values of 2.4–71 (Edwards et al., 2017). Therefore, we synthesized 16 new compounds, seven HIDs and nine HPDs, to examine the anti- HBV potential of these scaffolds. calculate the combination indexes (CI), and weighted CI (CIwt) values are reported in (Table 5). All CI values were well below 1, indicating that Lamivudine and A23 synergistically suppressed HBV replication 4.1. HIDs (Table 5). We also determined if two RNaseH inhibitors from HID (#86) and HPD (A23) compound classes can act synergistically with one an- We explored modifications to the HID scaffold, primarily at the R5 other in inhibiting HBV replication as was recently shown for an α- and R6 positions based on our preliminary SAR (Edwards et al., 2017), hydroxytropolone (αHT) and an HID (Lomonosova et al., 2017a,b). As to determine which modifications to the scaffold improved potency, expected, both compounds preferentially inhibited the positive-polarity specificity, and reduce cytotoxicity. Of the seven HIDs screened, only ff DNA strand and had little to no e ect on the minus-polarity DNA. The three were active against HBV replication, with EC50 values between CIwt values were below 1, indicating that #86 and A23 act synergisti- 2.4 and 3.8 μM(Table 1). CC50s for all HIDs evaluated ranged from 15 cally against HBV replication (Table 5). to > 100 μM, but the three active compounds were relatively nontoxic

with CC50s ≥100 μM(Table 1). Two of the previously reported HIDs have TI > 40, with the best inhibitor (#86) having a TI of 71 (Edwards 3.7. Compound solubility limits at pH 7.3 et al., 2017). None of the new HIDs had a TI > 40, indicating that modiﬁcations to the HIDs did not improve the in vitro potency or cy- Solubility of all compounds was evaluated using a turbidimetric totoxicity proﬁles of this class of compounds. solubility assay (Hoelke et al., 2009; Kerns et al., 2008). Compounds One HID (A19) was further evaluated for inhibition of HBV re- were diluted from 200 to 1.5 μM in DMEM in 1% DMSO to mimic the plication in HepDE19 cells using a bDNA hybridization assay. assay conditions of the HBV replication inhibition assay. Most com- Consistent with data from the strand-preferential q-PCR assay, com- μ pounds were soluble in DMEM up to 200 M, except two HIDs, A18 and pound A19 inhibited HBV replication with an EC50 of 7.6 μM. While the μ A21, which were soluble up to 50 M(Table 1). EC50 was approximately 2-fold higher in the bDNA hybridization assay compared to the q-PCR assay, both assays reported only modest inhibition of HBV replication by A19.

Table 5 (a) Combination index (CI).

Compound Combination CI values at various inhibition levels: (a) Weighted CI values (a)

50% 75% 90% 95%

A23 + Lam 0.21 ± 0.25 0.20 ± 0.11 0.22 ± 0.13 0.24 ± 0.14 0.21 A23 + #86 0.50 ± 0.33 0.46 ± 0.32 0.43 ± 0.31 0.41 ± 0.31 0.46

78 T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80

Table 6 Selectivity proﬁle of selected compounds.

Compound HIV HSV1 CMV E. coli tolC

EC50 (μM) CC50 (μM) EC50 (μM) CC50 (μM) EC50 (μM) CC50 (μM) MIC (μM)

A15 > 34.4 34.4 > 20.2 20.2 > 39 39 > 50 A22 > 50 > 50 > 40.9 40.9 > 50 > 50 > 50 A25 > 50 > 50 > 43.3 43.3 > 50 > 50 > 50

We previously reported our biochemical HBV RNaseH inhibition in the HepDES19 and HepDE19 cells (Table 3), precluding cell line assays consistently underreports RNaseH activity for a number of HID differences as the cause for the discrepancy. Other technical explana- inhibitors of HBV replication (Edwards et al., 2017). Therefore, bio- tions for the discrepancy would require either a selective under-detec- chemical analysis of the HIDs were limited to qualitative assessment. tion of the plus-polarity DNA strand relative to the minus-polarity Five of the seven HIDs inhibited HBV RNaseH in one or both bio- strand for those two compounds by the q-PCR assay, or over-detection chemical assays employed (Table 1). Coupled with the preferential of the plus-polarity strand by the bDNA hybridization assay, potentially suppression of the positive-polarity DNA strand synthesis in the re- due to hybridization with incompletely degraded HBV RNA and/or plication inhibition assays, this indicates that the HIDs inhibit HBV HBV DNA from the transcriptional template in the cells. We consider it replication by inhibiting HBV RNaseH in culture. unlikely that there was a selective under-detection of the positive po- Solubility issues were encountered with A18 and A21. Therefore, larity DNA in the q-PCR based assay because these compounds were the solubility profiles of all the HIDs were evaluated in unmodified tested more than a dozen times and results were consistent. As none of DMEM media under conditions that mimic our replication inhibition these technical explanations is probable and as HPD inhibitors such as assay. Compounds A18 and A21 were insoluble in DMEM media above A23 and A25 could inhibit cccDNA formation in the HepBHAe82 assay

50 μM(Table 1) which may help explain the large standard deviation in with EC50s ≈ 0.5 μM, we feel that the most plausible explanation is that assays with them. However, the other HIDs were soluble above 200 μM. compounds were less potent in the bDNA hybridization assay because Therefore, inactivity in the replication inhibition assay of the com- the cells were incubated with the compounds for seven days versus pounds A10 and A12 is not due to lack of solubility. three days for the q-PCR assay. Over this time some compound degradation may have occurred, resulting in resumption of reverse tran- 4.2. HPDs scription. Such resurgence of viral replication late in the 7-day assay would have had a lesser eﬀect on the cccDNA-dependent assay because In previous studies, the HPD compound #208 was active against cccDNA formation is slow and requires prior formation of capsid-as-

HBV replication with an EC50 of 0.69 μM, a CC50 of 15 μM, and a TI of sociated HBV DNA (Guo et al., 2007). 22 (Edwards et al., 2017). This compound showed the best combination All HPD compounds were active against the HBV RNaseH in the of potency and TI in the HID/HPD compound classes, and therefore it biochemical assays (Table 1, Fig. 2). However, only qualitative assess- was the starting point for exploring the anti-HBV potential of the HPDs. ment of the biochemical assays was possible. This is likely due to the

The EC50 values for the nine new HPD compounds by the three-day known insensitivity of the biochemical assay, possibly because the re- q-PCR replication inhibition assay ranged from 0.11 to 4 μM, and the combinant RNaseH is only a fragment of the full HBV polymerase (Villa

CC50s ranged from 15 to > 100 μM, resulting in TIs from 16 to 352 et al., 2016) and may not fully mimic the native enzyme. (Table 1). The best HPD compounds, A22, A23, and A24, were sig- Selectivity of the HPDs for the HBV RNaseH was evaluated by niﬁcantly more potent than the hit compound #208 (EC50 = 0.69 μM) counter-screening them against the huRNaseH1 because huRNaseH1 is and also less cytotoxic than #208 (CC50 =15μM), resulting in a 16-fold the cellular enzyme whose catalytic activity most nearly resembles that improvement of the calculated TI for A4. Similar to data for the HIDs of the HBV RNaseH. Although these enzymes have similar catalytic (Edwards et al., 2017), there was a general concordance among the function, they share only 19% amino acid identity in global alignments, various cytotoxicity assays employed. with only two of the DEDD residues aligning. Eight of the nine HPDs Inhibition of HBV cccDNA formation and expression is considered inhibited huRNaseH1, indicating that selectivity of the HPDs needs to essential for the elimination of HBV because the cccDNA is the persis- be improved. However, the qualitative nature of the assays precludes tent form of the viral genome. Therefore, we evaluated six HPDs with identifying moderate selectivity if it were present. Interestingly, A15

EC50s from 0.11 to 0.54 μM and TIs between 154 and 352 for inhibition inhibited the HBV RNaseH in both the biochemical and cell based as- of cccDNA formation and expression in the HepBHAe82 cell line that says but it did not inhibit the huRNaseH1. These data indicate that it expresses the HBV e antigen only from the cccDNA. EC50s in these as- may be possible to develop an HBV RNaseH inhibitor that minimizes says ranged from 1.5 to 0.43 μM. These results indicate that these undesired effects on huRNaseH1. compounds have a moderate effect on cccDNA formation and/or ex- Further selectivity studies were done against HIV, HSV-1, HCMV, pression, which would be the predicted result of blocking the recycling and E. coli tolC for three representative HPDs. No appreciable activity mechanism that replenishes the cccDNA pool in the nucleus by in- was observed against any of these pathogens. The failure to inhibit the hibiting genome maturation via RNaseH inhibition. Explicit evaluations HIV with these RNaseH inhibitors may stem from the large genetic of the effects of RNaseH inhibitors on cccDNA formation will be con- distance between the HIV and HBV RNaseHs, which share only 23% ducted during subsequent optimization of the HPDs. amino acid identity (Tavis et al., 2013), or possibly due to different Due to the results from the strand-preferential q-PCR assay, six interactions of the compounds with the lymphocytic cells in which HIV HPDs were tested for inhibition of HBV replication in HepDE19 cells is studied versus the hepatic cells used for HBV. Regardless, these data fi using a bDNA assay. The EC50s for the six compounds tested ranged indicate that it is possible to develop a highly speci c HBV RNaseH from 3.4 to 10.7 μM. It is unclear why the potencies in this assay were inhibitor. lower than the strand-preferential q-PCR assay. The possibility that the Curing HBV will require new drugs against new targets capable to discrepancy could have resulted from differences in the HepDES19 cells further suppressing HBV, and these drugs will likely be used in com- used for the q-PCR assay and HepDE19 cells used for the bDNA assay bination with other drugs. Therefore, we evaluated the effects on HBV was tested by screening A22, A23, and A24 for HBV replication in- replication of combining an HPD (A23) with Lamivudine, an approved hibition in HepDE19 cells using the q-PCR assay. EC50s were consistent NA drug that targets the HBV reverse transcriptase active site. A23 and

79 T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80

Lamivudine were strongly synergistic, with a CIwt of 0.21 (Table 5). Financial support Therefore, blocking both enzymatic activities of the multifunctional HBV polymerase resulted in much stronger suppression of viral re- This research was funded by corporate funds from Arbutus plication than blocking either activity alone. Biopharma and NIH grant R21 AI124672 to JET. We also evaluated the effects of combining two RNaseH inhibitors with each other, the HID #86 and the HPD A23, on HBV replication. References The HID and HPD compound classes share a common pharmacophore, so we hypothesized that combing them would be antagonistic. Cai, C.W., Lomonosova, E., Moran, E.A., Cheng, X., Patel, K.B., Bailly, F., Cotelle, P., Surprisingly, we found that combing A23 and #86 synergistically Meyers, M.J., Tavis, J.E., 2014. Hepatitis B virus replication is blocked by a 2-hy- droxyisoquinoline-1,3(2H,4H)-dione (HID) inhibitor of the viral ribonuclease H ac- suppressed HBV replication, with a CIwt of 0.46 (Table 5). We pre- tivity. Antivir. Res. 108, 48–55. viously showed that combining an αHT and HID synergistically sup- Cai, D., Wang, X., Yan, R., Mao, R., Liu, Y., Ji, C., Cuconati, A., Guo, H., 2016. Establishment of an inducible HBV stable cell line that expresses cccDNA-dependent presses HBV replication (Lomonosova et al., 2017b). However, these epitope-tagged HBeAg for screening of cccDNA modulators. Antivir. Res. 132, 26–37. two compound classes share different core pharmacophores, which Chou, T.C., 2010. Drug combination studies and their synergy quantification using the suggests that these compound classes may not interact with RNaseH Chou-Talalay method. Cancer Res. 70, 440–446. Coffin, C.S., Mulrooney-Cousins, P.M., Peters, M.G., van, M.G., Roberts, J.P., Michalak, identically. Our data indicate that the HID and HPD compounds also T.I., Terrault, N.A., 2011. Molecular characterization of intrahepatic and extrahepatic likely do not inhibit the enzyme in identical manners despite the shared hepatitis B virus (HBV) reservoirs in patients on suppressive antiviral therapy. J. Viral – pharmacophore. We see three possibilities for how HIDs and HPDs can Hepat. 18, 415 423. Cox, N., Tillmann, H., 2011. Emerging pipeline drugs for hepatitis B infection. Expert synergize. First, both inhibitors could bind simultaneously in a co- Opin. Emerg. Drugs 16, 713–729. operative manner. Second, the compounds could bind to the RNaseH Edwards, T.C., Lomonosova, E., Patel, J.A., Li, Q., Villa, J.A., Gupta, A.K., Morrison, L.A., ff Bailly, F., Cotelle, P., Giannakopoulou, E., 2017. Inhibition of hepatitis B virus re- during di erent stages of the RNaseH catalytic cycle and therefore not plication by N-hydroxyisoquinolinediones and related polyoxygenated heterocycles. compete for the same protein conformation or complex. Third, the Antivir. Res. 143, 205–217. compounds may also contact the RNaseH substrate in the active site, Gerelsaikhan, T., Tavis, J.E., Bruss, V., 1996. Hepatitis B virus nucleocapsid envelopment does not occur without genomic DNA synthesis. J. Virol. 70, 4269–4274. and the local sequence of the substrate could modulate binding of the Guo, H., Jiang, D., Zhou, T., Cuconati, A., Block, T.M., Guo, J.T., 2007. Characterization HIDs and HPDs differently. Regardless, these data indicate that RNaseH of the intracellular deproteinized relaxed circular DNA of hepatitis B virus: an in- termediate of covalently closed circular DNA formation. J. Virol. 81, 12472–12484. inhibitors could be used in combination with other anti-HBV therapies Hoelke, B., Gieringer, S., Arlt, M., Saal, C., 2009. Comparison of nephelometric, UV- in the future. spectroscopic, and HPLC methods for high-throughput determination of aqueous This study indicates that the HPD compound class appears a better drug solubility in microtiter plates. Anal. Chem. 81, 3165–3172. Hu, Y., Cheng, X., Cao, F., Huang, A., Tavis, J.E., 2013. beta-Thujaplicinol inhibits he- candidate for anti-HBV RNaseH inhibitor optimization than the HIDs. patitis B virus replication by blocking the viral ribonuclease H activity. Antivir. Res. By synthesizing only nine new HPDs we achieved a 16-fold improve- 99, 221–229. ment over our initial hit compound, whereas no improvement was seen Kerns, E.H., Di, L., Carter, G.T., 2008. In vitro solubility assays in drug discovery. Curr. Drug Metabol. 9, 879–885. with seven new HIDs. Future efforts will explore additional modifica- Kwon, H., Lok, A.S., 2011. Hepatitis B therapy. Nat. Rev. Gastroenterol. Hepatol. 8, tions to the HPD scaffold in an effort to develop improved inhibitory 275–284. Lomonosova, E., Daw, J., Garimallaprabhakaran, A.K., Agyemang, N.B., Ashani, Y., compounds. Murelli, R.P., Tavis, J.E., 2017a. Efficacy and cytotoxicity in cell culture of novel α- hydroxytropolone inhibitors of hepatitis B virus ribonuclease H. Antivir. Res. 144, 5. Summary 164–172. Lomonosova, E., Zlotnick, A., Tavis, J.E., 2017b. Synergistic interactions between hepatitis B virus RNase H antagonists and other inhibitors. Antimicrob. Agents chemother. We evaluated 16 novel compounds, seven HIDs and nine HPD 61 e02441-02416. compounds for activity against HBV replication in culture. Only three of Long, K.R., Lomonosova, E., Li, Q., Ponzar, N.L., Villa, J.A., Touchette, E., Rapp, S., Liley, R.M., Murelli, R.P., Grigoryan, A., 2018. Efficacy of hepatitis B virus ribonuclease H the seven HIDs were active against HBV replication, and none of these inhibitors, a new class of replication antagonists, in FRG human liver chimeric mice. compounds had a TI better than the best prior HID (#86, TI = 71). In Antivir. Res. 149, 41–47. Lu, G., Lomonosova, E., Cheng, X., Moran, E.A., Meyers, M.J., Le Grice, S.F., Thomas, C.J., comparison, synthesis of only nine new HPDs resulted in a more than Jiang, J.K., Meck, C., Hirsch, D.R., D'Erasmo, M.P., Suyabatmaz, D.M., Murelli, R.P., 16-fold improvement in the TI over the best previous HPD (#208, Tavis, J.E., 2015. Hydroxylated tropolones inhibit hepatitis B virus replication by TI = 22) (Edwards et al., 2017). We were able to achieve greater gains blocking the viral ribonuclease H activity. Antimicrob. Agents Chemother. 59, 1070–1079. in potency and TI with the HPDs compared to the HIDs. Future efforts Lu, G., Villa, J.A., Donlin, M.J., Edwards, T.C., Cheng, X., Heier, R.F., Meyers, M.J., Tavis, will focus on further improving the HPD scaffold with better TIs and J.E., 2016. Hepatitis B virus genetic diversity has minimal impact on sensitivity of the viral ribonuclease H to inhibitors. Antivir. Res. 135, 24–30. improved selectivity over huRNaseH1, with the goal of developing a Petersen, J., Thompson, A.J., Levrero, M., 2016. Aiming for cure in HBV and HDV in- novel HBV RNaseH drug that can be used in combination with other fection. J. Hepatol. 65, 835–848. inhibitors to provide better treatment to the millions of chronically Repetto, G., del Peso, A., Zurita, J.L., 2008. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat. Protoc. 3, 1125–1131. infected patients. Seeger, C., Zoulim, F., Mason, W.S., 2013. Hepadnaviruses. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, 6 ed. Lippincott Williams & Wilkins, Philadelphia PA, pp. – Competing intrests 2185 2221. Tavis, J.E., Badtke, M.P., 2009. Hepadnaviral genomic replication. In: Cameron, C.E., G”tte, M., Raney, K.D. (Eds.), Viral Genome Replication. Springer Science+Business None. Media, LLC, New York, pp. 129–143. Tavis, J.E., Cheng, X., Hu, Y., Totten, M., Cao, F., Michailidis, E., Aurora, R., Meyers, M.J., Jacobsen, E.J., Parniak, M.A., Sarafianos, S.G., 2013. The hepatitis B virus ribonu- Acknowledgements clease h is sensitive to inhibitors of the human immunodeficiency virus ribonuclease h and integrase enzymes. PLoS Pathog. 9, e1003125. Tavis, J.E., Lomonosova, E., 2015. The hepatitis B virus ribonuclease H as a drug target. We thank Reese Foster for technical support and Maureen Donlin for Antivir. Res. 118, 132–138. assistance with the genetic alignments. We also thank Andrzej Villa, J.A., Pike, D.P., Patel, K.B., Lomonosova, E., Lu, G., Abdulqader, R., Tavis, J.E., fi Ardzinski and Kim Stever for help with the HepDE19 (bDNA) assays 2016. Puri cation and enzymatic characterization of the hepatitis B virus ribonuclease H, a new target for antiviral inhibitors. Antivir. Res. 132, 186–195. and Lucy Wang for help with the HepBHAe82 assay. WHO, 2017. Hepatitis B vaccines: WHO position paper – July 2017. Wkly. Epidemiol. Rec. 92, 369–392. Xie, L., Yin, J., Xia, R., Zhuang, G., 2018. Cost‐effectiveness of antiviral treatment after Appendix A. Supplementary data resection in hepatitis B virus–related hepatocellular carcinoma patients with com- pensated cirrhosis. Hepatology 68, 1476–1486. Supplementary data to this article can be found online at https:// Zoulim, F., 2004. Antiviral therapy of chronic hepatitis B: can we clear the virus and prevent drug resistance? Antivir. Chem. Chemother. 15, 299–305. doi.org/10.1016/j.antiviral.2019.02.005.