Inhibition of HBV Replication by N-Hydroxyisoquinolinedione and N- Hydroxypyridinedione Ribonuclease H Inhibitors T

Total Page:16

File Type:pdf, Size:1020Kb

Inhibition of HBV Replication by N-Hydroxyisoquinolinedione and N- Hydroxypyridinedione Ribonuclease H Inhibitors T Antiviral Research 164 (2019) 70–80 Contents lists available at ScienceDirect Antiviral Research journal homepage: www.elsevier.com/locate/antiviral Inhibition of HBV replication by N-hydroxyisoquinolinedione and N- hydroxypyridinedione ribonuclease H inhibitors T Tiffany C. Edwardsa,b, Nagraj Manic, Bruce Dorseyc, Ramesh Kakarlac, Rene Rijnbrandc, ∗ Michael J. Sofiac, John E. Tavisa,b, a Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO, USA b Saint Louis University Liver Center, Saint Louis University School of Medicine, St. Louis, MO, USA c Arbutus Biopharma Incorporated, Warminster, PA, USA ARTICLE INFO ABSTRACT Keywords: We recently developed a screening system capable of identifying and evaluating inhibitors of the Hepatitis B HBV virus (HBV) ribonuclease H (RNaseH), which is the only HBV enzyme not targeted by current anti-HBV thera- Ribonuclease H pies. Inhibiting the HBV RNaseH blocks synthesis of the positive-polarity DNA strand, causing early termination N-hydroxyisoquinolinediones of negative-polarity DNA synthesis and accumulation of RNA:DNA heteroduplexes. We previously reported in- N-hydroxypyridinediones hibition of HBV replication by N-hydroxyisoquinolinediones (HID) and N-hydroxypyridinediones (HPD) in Antiviral human hepatoma cells. Here, we report results from our ongoing efforts to develop more potent anti-HBV Structure-activity relationship RNaseH inhibitors in the HID/HPD compound classes. We synthesized and screened additional HIDs and HPDs for preferential suppression of positive-polarity DNA in cells replicating HBV. Three of seven new HIDs inhibited HBV replication, however, the therapeutic indexes (TI = CC50/EC50) did not improve over what we previously reported. All nine of the HPDs inhibited HBV replication with EC50s ranging from 110 nM to 4 μM. Cellular cytotoxicity was evaluated by four assays and CC50s ranged from 15 to > 100 μM. The best compounds have a calculated TI of > 300, which is a 16-fold improvement over the primary HPD hit. These studies indicate that the HPD compound class holds potential for antiviral discovery. 1. Introduction anti-HBV treatments, be well tolerated during prolonged use, and have a high genetic barrier to resistance. Hepatitis B virus (HBV) is a major global health problem. An esti- We are exploring the HBV ribonuclease H (RNaseH) as an antiviral mated 257 million people are chronically infected worldwide, resulting drug target. The RNaseH is one of two enzymatically active domains on in > 880,000 deaths annually from HBV-associated liver diseases, in- the HBV polymerase that synthesizes the partially double-stranded DNA cluding cirrhosis, hepatocellular carcinoma, and liver failure (WHO, genome via reverse transcription. The reverse transcriptase (RT) do- 2017). HBV-associated health care costs are up to $39,898 per quality- main of the polymerase protein copies the pregenomic RNA (pgRNA) adjusted life year (Xie et al., 2018). Available anti-HBV therapies are template to form the minus-polarity DNA strand. The RNaseH re- limited to two forms of the innate immunity cytokine interferon-α and cognizes RNA:DNA heteroduplexes that are formed during minus-po- six nucleoside/nucleotide analogs (NA) which block DNA chain elon- larity DNA synthesis and degrades the RNA strand (Seeger et al., 2013; gation by the viral polymerase. These therapies significantly improve Tavis and Badtke, 2009). The polymerase then synthesizes the positive- patient outcomes, and NA can suppress viremia by more than 4–5 log10 polarity DNA strand, but it typically arrests after making only ∼50% of in the majority of patients (Cox and Tillmann, 2011; Kwon and Lok, the plus-polarity DNA strand. Both enzymatic activities of the poly- 2011). However, HBV replication still persists in most patients, there- merase are required for synthesis of the HBV genome, yet the RNaseH is fore these therapies must be continued indefinitely (Coffin et al., 2011; an unexploited drug target (Tavis and Lomonosova, 2015). Zoulim, 2004). It is widely accepted that curing HBV will require new Blocking the HBV RNaseH activity prevents removal of the RNA drugs against new targets capable of further suppressing HBV (Petersen strand from the minus–polarity DNA strand, resulting in an accumula- et al., 2016). These new therapies will need to work together with other tion of RNA:DNA heteroduplexes (Hu et al., 2013). Failure to remove ∗ Corresponding author. Doisy Research Center, 1100 South Grand Blvd., Saint Louis, MO 63104 USA. E-mail addresses: Tiff[email protected] (T.C. Edwards), [email protected] (N. Mani), [email protected] (B. Dorsey), [email protected] (R. Kakarla), [email protected] (R. Rijnbrand), msofi[email protected] (M.J. Sofia), [email protected] (J.E. Tavis). https://doi.org/10.1016/j.antiviral.2019.02.005 Received 19 October 2018; Received in revised form 20 December 2018; Accepted 5 February 2019 Available online 12 February 2019 0166-3542/ © 2019 Elsevier B.V. All rights reserved. T.C. Edwards, et al. Antiviral Research 164 (2019) 70–80 the pgRNA blocks synthesis of positive-polarity DNAs and causes pre- 2.4. HBV q-PCR replication inhibition assay mature arrest of minus-polarity DNA synthesis (Edwards et al., 2017; Gerelsaikhan et al., 1996; Hu et al., 2013; Tavis et al., 2013), with HepDES19 or HepDE19 cells were seeded in 96-well plates at truncation of the minus-polarity DNAs possibly stemming from con- 4×104 cells per well in the absence of tetracycline. Test compounds in formational constraints imposed on the viral DNA within capsids due to a final DMSO concentration of 1% were applied to cells 48 h after in- accumulation of the heteroduplexes. This prevents the formation of a duction of HBV replication and cells were incubated with compounds complete viral genome, thus stopping both transmission of infectious for 72 h. Cells were washed in 200 μL of phosphate buffered saline viral particles and the intracellular “recycling” mechanism that re- (PBS) and lysed in 150 μL of core lysis buffer (10 mM Tris pH 7.4, 1% plenishes the pool of covalently closed circular DNA (cccDNA), the Tween20, 150 mM NaCl). Cells were incubated at room temperate on template for all HBV RNAs. an orbital shaker at 350 rpm for 40 min. Cell lysate was transferred to a We recently developed an HBV RNaseH screening pipeline (Cai 96 well polymerase chain reaction (PCR) plate, and centrifuged at et al., 2014; Edwards et al., 2017; Hu et al., 2013; Lomonosova et al., 3300 × g for 5 min. The supernatant (50 μL) from the cell lysate was 2017a, 2017b; Lu et al., 2015, 2016; Tavis et al., 2013; Tavis and transferred to a 96-well PCR plate and mixed with 20 units of micro- Lomonosova, 2015). We identified > 100 inhibitors primarily in three coccal nuclease and brought to 10mM CaCl2. The lysate was incubated compound classes, the α-hydroxytropolones (αHT), N-hydro- for 1 h at 37 °C, and then the nuclease was inactivated at 70 °C for xyisoquinolinediones (HID), and N-hydroxypyridinediones (HPD), that 10 min. Qiagen protease (0.005 Anson units) was added to the lysate suppress viral replication in cells by blocking the HBV RNaseH. These and the mixture was incubated overnight. Qiagen protease was then compounds preferentially suppress the plus-polarity DNA strands, in- inactivated at 95 °C for 10 min. duce truncation of the minus-polarity DNA strands, and cause accu- The crude lysate was used as the template for strand-preferential mulation of extensive RNA:DNA heteroduplexes in capsids as expected quantitative polymerase chain reaction (q-PCR) analysis. Quantitative from their inhibition of the RNaseH. The best compounds have ther- PCR was performed with 40 cycles of 95 °C for 15 s and 60 °C for 1 min apeutic indexes [cytotoxicity/efficacy (TI)] > 200 (Lomonosova et al., employing the Kappa Probe Force universal PCR master mix. The pri- 2017a). Representative HBV RNaseH inhibitors can work synergisti- mers and probe (IDT Inc.) for the plus-polarity DNA strand were 5′ cally with approved and experimental therapies (Lomonosova et al., CATGAACAAGAGATGATTAGGCAGAG3′,5′GGAGGCTGTAGGCATAAA 2017b), inhibit multiple HBV isolates from genotypes B, C, and D TTGG3′, and 5’/56-FAM/CTGCGCACC/ZEN/AGCACCATGCA/ equivalently (Lu et al., 2016), and suppress viral replication in a chi- 3IABkFQ. The primers and probe for the minus-polarity DNA strand meric mouse model (Long et al., 2018). Therefore, the HBV RNaseH is a were 5′GCAGATGAGAAGGCACAGA3′,5′CTTCTCCGTCTGCCGTT3′, validated drug target. and 5’/56-FAM/AGTCCGCGT/ZEN/AAAGAGAGGTGCG/3IABkFQ. We are pursuing a hit-to-lead medicinal chemistry campaign to EC50 values were calculated from the plus-polarity DNA data with optimize inhibitors of the HBV RNaseH. Here, we report the activity of GraphPad Prism using the three-parameter log(inhibitor)-versus-re- seven new HIDs and nine new HPDs, with significant improvements in sponse algorithm with the bottom value set to zero. in vitro potency and cytotoxicity profiles for the HPD compounds. 2.5. Cytotoxicity assays 2. Materials and methods The effects of compounds on cell viability in HepDES19 or ™ 2.1. Compound acquisition and synthesis HepDE19 cells was assessed using the CellTiter 96 AQueous Non- Radioactive Cell Proliferation Assay (Promega, Madison, WI) (MTS) as Compounds were synthesized by Arbutus Biopharma and all com- previously described (Edwards et al., 2017). Cells were seeded into a 96 4 pounds were ≥95% pure. Compounds were dissolved in 100% DMSO well plate at 1 × 10 cells per well. The compounds were applied to and stored in amber tubes to protect them from light. All compounds cells 48 h after the removal of tetracycline from the cell culture media were maintained in single-use aliquots and stored at −80 °C until use. and the HBV-expressing cells were incubated for 72 h in the presence of Compound structures and names are in Table 1. compound containing media. Fifty percent cytotoxic concentration (CC50) values were calculated with GraphPad Prism using the three- parameter variable-response log(inhibitor)-versus-response algorithm fi 2.2.
Recommended publications
  • Mutations That Separate the Functions of the Proofreading Subunit of the Escherichia Coli Replicase
    G3: Genes|Genomes|Genetics Early Online, published on April 15, 2015 as doi:10.1534/g3.115.017285 Mutations that separate the functions of the proofreading subunit of the Escherichia coli replicase Zakiya Whatley*,1 and Kenneth N Kreuzer*§ *University Program in Genetics & Genomics, Duke University, Durham, NC 27705 §Department of Biochemistry, Duke University Medical Center, Durham, NC 27710 1 © The Author(s) 2013. Published by the Genetics Society of America. Running title: E. coli dnaQ separation of function mutants Keywords: DNA polymerase, epsilon subunit, linker‐scanning mutagenesis, mutation rate, SOS response Corresponding author: Kenneth N Kreuzer, Department of Biochemistry, Box 3711, Nanaline Duke Building, Research Drive, Duke University Medical Center, Durham, NC 27710 Phone: 919 684 6466 FAX: 919 684 6525 Email: [email protected] 1 Present address: Department of Biology, 300 N Washington Street, McCreary Hall, Campus Box 392, Gettysburg College, Gettysburg, PA 17325 Phone: 717 337 6160 Fax: 7171 337 6157 Email: [email protected] 2 ABSTRACT The dnaQ gene of Escherichia coli encodes the ε subunit of DNA polymerase III, which provides the 3’ 5’ exonuclease proofreading activity of the replicative polymerase. Prior studies have shown that loss of ε leads to high mutation frequency, partially constitutive SOS, and poor growth. In addition, a previous study from our lab identified dnaQ knockout mutants in a screen for mutants specifically defective in the SOS response following quinolone (nalidixic acid) treatment. To explain these results, we propose a model whereby in addition to proofreading, ε plays a distinct role in replisome disassembly and/or processing of stalled replication forks.
    [Show full text]
  • DNA POLYMERASE III HOLOENZYME: Structure and Function of a Chromosomal Replicating Machine
    Annu. Rev. Biochem. 1995.64:171-200 Copyright Ii) 1995 byAnnual Reviews Inc. All rights reserved DNA POLYMERASE III HOLOENZYME: Structure and Function of a Chromosomal Replicating Machine Zvi Kelman and Mike O'Donnell} Microbiology Department and Hearst Research Foundation. Cornell University Medical College. 1300York Avenue. New York. NY }0021 KEY WORDS: DNA replication. multis ubuni t complexes. protein-DNA interaction. DNA-de penden t ATPase . DNA sliding clamps CONTENTS INTRODUCTION........................................................ 172 THE HOLO EN ZYM E PARTICL E. .......................................... 173 THE CORE POLYMERASE ............................................... 175 THE � DNA SLIDING CLAM P............... ... ......... .................. 176 THE yC OMPLEX MATCHMAKER......................................... 179 Role of ATP . .... .............. ...... ......... ..... ............ ... 179 Interaction of y Complex with SSB Protein .................. ............... 181 Meclwnism of the yComplex Clamp Loader ................................ 181 Access provided by Rockefeller University on 08/07/15. For personal use only. THE 't SUBUNIT . .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 182 Annu. Rev. Biochem. 1995.64:171-200. Downloaded from www.annualreviews.org AS YMMETRIC STRUC TURE OF HOLO EN ZYM E . 182 DNA PO LYM ER AS E III HOLO ENZ YME AS A REPLIC ATING MACHINE ....... 186 Exclwnge of � from yComplex to Core .................................... 186 Cycling of Holoenzyme on the LaggingStrand
    [Show full text]
  • Restoration of Mir-193A Expression Is Tumor-Suppressive in MYC
    Bharambe et al. Acta Neuropathologica Communications (2020) 8:70 https://doi.org/10.1186/s40478-020-00942-5 RESEARCH Open Access Restoration of miR-193a expression is tumor-suppressive in MYC amplified Group 3 medulloblastoma Harish Shrikrishna Bharambe1,2, Annada Joshi1, Kedar Yogi1,2, Sadaf Kazi1 and Neelam Vishwanath Shirsat1,2* Abstract Medulloblastoma, a highly malignant pediatric brain tumor, consists of four molecular subgroups, namely WNT, SHH, Group 3, and Group 4. The expression of miR-193a, a WNT subgroup-specific microRNA, was found to be induced by MYC, an oncogenic target of the canonical WNT signaling. MiR-193a is not expressed in Group 3 medulloblastomas, despite MYC expression, as a result of promoter hypermethylation. Restoration of miR-193a expression in the MYC amplified Group 3 medulloblastoma cells resulted in inhibition of growth, tumorigenicity, and an increase in radiation sensitivity. MAX,STMN1, and DCAF7 were identified as novel targets of miR-193a. MiR- 193a mediated downregulation of MAX could suppress MYC activity since it is an obligate hetero-dimerization partner of MYC. MYC induced expression of miR-193a, therefore, seems to act as a feedback inhibitor of MYC signaling. The expression of miR-193a resulted in widespread repression of gene expression that included not only several cell cycle regulators, WNT, NOTCH signaling genes, and those encoding DNA replication machinery, but also several chromatin modifiers like SWI/SNF family genes and histone-encoding genes. MiR-193a expression brought about a reduction in the global levels of H3K4me3, H3K27ac, the histone marks of active chromatin, and an increase in the levels of H3K27me3, a repressive chromatin mark.
    [Show full text]
  • Rnase-H-Based Assays Utilizing Modified Rna
    (19) TZZ ¥_T (11) EP 2 279 263 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12Q 1/68 (2006.01) 04.09.2013 Bulletin 2013/36 (86) International application number: (21) Application number: 09739895.2 PCT/US2009/042454 (22) Date of filing: 30.04.2009 (87) International publication number: WO 2009/135093 (05.11.2009 Gazette 2009/45) (54) RNASE-H-BASED ASSAYS UTILIZING MODIFIED RNA MONOMERS TESTS AUF RNASE-H-BASIS MIT MODIFIZIERTEN RNA-MONOMEREN DOSAGES À BASE DE RNASE-H UTILISANT DES MONOMÈRES D’ARN MODIFIÉS (84) Designated Contracting States: • ROSE, Scott AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Coralville, IA 52241 (US) HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL • DOBOSY, Joseph PT RO SE SI SK TR Coralville, IA 52241 (US) (30) Priority: 30.04.2008 US 49204 P (74) Representative: Grünecker, Kinkeldey, Stockmair & Schwanhäusser (43) Date of publication of application: Leopoldstrasse 4 02.02.2011 Bulletin 2011/05 80802 München (DE) (60) Divisional application: (56) References cited: 13173388.3 EP-A- 1 367 136 WO-A-01/21813 13173389.1 WO-A-03/074724 WO-A-2004/059012 13173390.9 WO-A-2007/062495 WO-A2-2005/021776 13173391.7 WO-A2-2007/141580 US-A- 5 744 308 US-A- 5 830 664 (73) Proprietor: Integrated Dna Technologies, Inc. Coralville, IA 52241 (US) • ITAYA M ET AL: "Molecular cloning of a ribonuclease H (RNase HI) gene from an extreme (72) Inventors: thermophile Thermus thermophilus HB8: a • WALDER, Joseph, Alan thermostable RNase H can functionally replace Chicago, IL 60645 (US) the Escherichia coli enzyme in vivo." NUCLEIC • BEHLKE, Mark, Aaron ACIDS RESEARCH 25 AUG 1991, vol.
    [Show full text]
  • Telomerase Reverse Transcriptase Expression Elevated by Avian Leukosis Virus Integration in B Cell Lymphomas
    Telomerase reverse transcriptase expression elevated by avian leukosis virus integration in B cell lymphomas Feng Yang, Rena R. Xian*, Yingying Li, Tatjana S. Polony, and Karen L. Beemon† Department of Biology, The Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 Communicated by Saul Roseman, The Johns Hopkins University, Baltimore, MD, September 26, 2007 (received for review May 11, 2007) Simple retroviruses induce tumors by integrating into the host integration sites are believed to result from strong biological genome, activating cellular oncogenes and microRNAs, or inacti- selection (7). vating tumor suppressor genes. The identification of these genes Avian leukosis virus (ALV) is a simple retrovirus that does not elucidates molecular mechanisms of tumorigenesis. In this study, encode an oncogene but that can induce tumors by integrating we identified avian leukosis virus (ALV) proviral integration sites in near oncogenes, introducing a strong promoter or enhancer rapid-onset B cell lymphomas arising <12 weeks after infection of sequence (8–12). Typically, ALV induces B cell lymphomas to chicken embryos. By using inverse PCR, 28 unique viral integration develop in Ϸ6 months and frequently involves proviral integra- sites were identified in rapid-onset tumors. Integrations in the tions, resulting in deregulation of the cellular transcription telomerase reverse transcriptase (TERT) promoter/enhancer region factor, myc, as well as bic (precursor to microRNA 155) (10–12). were observed in four different tumors, suggesting that this is a In addition, B cell lymphomas with a more rapid onset (lethal in common integration site. These provirus integrations ranged from Ͻ3 months) have been observed with clonal proviral insertions 217 to 2,584 bp upstream of the TERT transcription initiation site into the myb gene locus, resulting in overexpression of a trun- and were all in the opposite transcriptional orientation to TERT.
    [Show full text]
  • Hexameric Helicase G40P Unwinds DNA in Single Base Pair Steps Michael Schlierf1,2*, Ganggang Wang3, Xiaojiang S Chen3, Taekjip Ha1,4,5,6,7*
    RESEARCH ARTICLE Hexameric helicase G40P unwinds DNA in single base pair steps Michael Schlierf1,2*, Ganggang Wang3, Xiaojiang S Chen3, Taekjip Ha1,4,5,6,7* 1Physics Department and Center for the Physics of Living Cells, University of Illinois at Urbana-Champaign, Illinois, United States; 2B CUBE – Center for Molecular Bioengineering, Technische Universita¨ t Dresden, Dresden, Germany; 3Molecular and Computational Biology, Department of Biological Sciences, University of Southern California, Los Angeles, United States; 4Howard Hughes Medical Institute, Baltimore, United States; 5Department of Biophysics and Biophysical Chemistry, Johns Hopkins University, Baltimore, United States; 6Department of Biomedical Engineering, Johns Hopkins University, Baltimore, United States; 7Department of Biophysics, Johns Hopkins University, Baltimore, United States Abstract Most replicative helicases are hexameric, ring-shaped motor proteins that translocate on and unwind DNA. Despite extensive biochemical and structural investigations, how their translocation activity is utilized chemo-mechanically in DNA unwinding is poorly understood. We examined DNA unwinding by G40P, a DnaB-family helicase, using a single-molecule fluorescence assay with a single base pair resolution. The high-resolution assay revealed that G40P by itself is a very weak helicase that stalls at barriers as small as a single GC base pair and unwinds DNA with the step size of a single base pair. Binding of a single ATPgS could stall unwinding, demonstrating highly coordinated ATP hydrolysis between six identical subunits. We observed frequent slippage of the helicase, which is fully suppressed by the primase DnaG. We anticipate that these findings allow a better understanding on the fine balance of thermal fluctuation activation and energy derived from hydrolysis.
    [Show full text]
  • Potential of Naturally Derived Compounds in Telomerase and Telomere Modulation in Skin Senescence and Aging
    International Journal of Molecular Sciences Review Potential of Naturally Derived Compounds in Telomerase and Telomere Modulation in Skin Senescence and Aging Barbara Jacczak, Błazej˙ Rubi´s and Ewa Toto´n* Department of Clinical Chemistry and Molecular Diagnostics, Poznan University of Medical Sciences, 49 Przybyszewskiego St., 60-355 Pozna´n,Poland; [email protected] (B.J.); [email protected] (B.R.) * Correspondence: [email protected]; Tel.: +48-61-869-1427 Abstract: Proper functioning of cells—their ability to divide, differentiate, and regenerate—is dictated by genomic stability. The main factors contributing to this stability are the telomeric ends that cap chromosomes. Telomere biology and telomerase activity have been of interest to scientists in various medical science fields for years, including the study of both cancer and of senescence and aging. All these processes are accompanied by telomere-length modulation. Maintaining the key levels of telomerase component (hTERT) expression and telomerase activity that provide optimal telomere length as well as some nontelomeric functions represents a promising step in advanced anti-aging strategies, especially in dermocosmetics. Some known naturally derived compounds contribute significantly to telomere and telomerase metabolism. However, before they can be safely used, it is necessary to assess their mechanisms of action and potential side effects. This paper focuses on the metabolic potential of natural compounds to modulate telomerase and telomere biology and thus prevent senescence and skin aging. Keywords: telomerase; telomeres; natural compounds; senescence; skin aging; antioxidants Citation: Jacczak, B.; Rubi´s,B.; Toto´n,E. Potential of Naturally Derived Compounds in Telomerase and Telomere Modulation in Skin 1.
    [Show full text]
  • The Home Owners' Loan Corporation (HOLC) Was Created in June 1933
    The Home Owners’ Loan Corporation (HOLC) was created in June 1933 by the US Congress. The purpose was to refinance mortgages in default to prevent foreclosures. In 1935 Federal Home Loan Bank Board asked HOLC to look at 239 cities and create "residential security maps" to indicate the level of security for real‐estate investments. On the maps, the newest areas — those considered desirable for lending purposes — were outlined in blue and known as "Type A". These were typically affluent suburbs on the outskirts of cities. "Type B" neighborhoods were considered "Still Desirable", whereas older "Type C" neighborhoods were labeled "Declining" and outlined in yellow. "Type D" neighborhoods were outlined in red and were considered the most risky for mortgage support. Fourteen of these cities were in Ohio. The maps were usually hand drawn and hand colored and not published. The area descriptions were typed or hand written on forms. The surviving maps and area descriptions are in the National Archives. Home Owners Loan Corporation (HOLC) Residential Security "Redlining" Map Area Descriptions Dayton, Ohio 1937 Area Descriptions for Dayton, Ohio, 1937. Home Owners' Loan Corporation, box 105, City Survey Files, Record Group 195: Records of the Federal Home Loan Bank Board, National Archives II, College Park, Maryland. City Survey Files, compiled 1935 - 1940 ARC Identifier 720357 I MLR Number A 1 39 Textual Records from the Federal Loan Agency. Federal Home Loan Bank Board. Home Owners' Loan Corporation. (07/01/1939- 02/24/1942) National Archives at
    [Show full text]
  • Non-Canonical Roles of Telomerase: Unraveling the Imbroglio Evelyne Ségal-Bendirdjian, Vincent Geli
    Non-canonical Roles of Telomerase: Unraveling the Imbroglio Evelyne Ségal-Bendirdjian, Vincent Geli To cite this version: Evelyne Ségal-Bendirdjian, Vincent Geli. Non-canonical Roles of Telomerase: Unraveling the Imbroglio. Frontiers in Cell and Developmental Biology, Frontiers media, 2019, 7, 10.3389/fcell.2019.00332. hal-03006249 HAL Id: hal-03006249 https://hal.archives-ouvertes.fr/hal-03006249 Submitted on 15 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. fcell-07-00332 December 9, 2019 Time: 15:2 # 1 REVIEW published: 10 December 2019 doi: 10.3389/fcell.2019.00332 Non-canonical Roles of Telomerase: Unraveling the Imbroglio Evelyne Ségal-Bendirdjian1*† and Vincent Geli2*† 1 INSERM UMR-S 1124, Team: Cellular Homeostasis, Cancer and Therapies, INSERM US36, CNRS UMS 2009, BioMedTech Facilities, Université de Paris, Paris, France, 2 Marseille Cancer Research Center, U1068 INSERM, UMR 7258 CNRS, Aix Marseille University, Institut Paoli-Calmettes, Equipe labellisée Ligue, Marseille, France Telomerase plays a critical role in stem cell function and tissue regeneration that depends on its ability to elongate telomeres. For nearly two decades, it turned out that TERT regulates a broad spectrum of functions including signal transduction, gene expression regulation, and protection against oxidative damage that are independent of its telomere elongation activity.
    [Show full text]
  • DNA Polymerase Delta P50 (POLD2) Rat Monoclonal Antibody [Clone ID: 7B4] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AM20280AF-N DNA polymerase delta p50 (POLD2) Rat Monoclonal Antibody [Clone ID: 7B4] Product data: Product Type: Primary Antibodies Clone Name: 7B4 Applications: WB Recommended Dilution: Western blotting: 1 µg/ml. Detailed procedure is provided in Protocols. Reactivity: Human, Mouse, Rat Host: Rat Isotype: IgG2a Clonality: Monoclonal Immunogen: Recombinant full length His-Human p50 Specificity: This antibody reacts with DNA polymerase delta p50 small subunit (50 kDa) by Western blotting. Formulation: PBS, pH 7.2 containing 50% Glycerol without preservatives. State: Azide Free State: Liquid purified IgG fraction. Concentration: lot specific Purification: Protein-G Agarose Chromatography of hybridoma supernatant. Conjugation: Unconjugated Storage: Store the antibody (in aliquots) at -20°C. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. Gene Name: Homo sapiens DNA polymerase delta 2, accessory subunit (POLD2), transcript variant 1 Database Link: Entrez Gene 18972 MouseEntrez Gene 289758 RatEntrez Gene 5425 Human P49005 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 DNA polymerase delta p50 (POLD2) Rat Monoclonal Antibody [Clone ID: 7B4] – AM20280AF-N Background: In eukaryotic cells, 3 types of DNA polymerases (pol), pol alpha, pol delta and pol epsilon function in accurate and efficient DNA replication. Pol delta is a heteromultimeric enzyme composed of a 125 kDa major catalytic subunit and three smaller accessory subunits.
    [Show full text]
  • Fate of the Replisome Following Arrest by UV-Induced DNA Damage in Escherichia Coli
    Fate of the replisome following arrest by UV-induced DNA damage in Escherichia coli H. Arthur Jeiranian, Brandy J. Schalow, Charmain T. Courcelle, and Justin Courcelle1 Department of Biology, Portland State University, Portland, OR 97201 Edited by Mike E. O’Donnell, Howard Hughes Medical Institute, The Rockefeller University, New York, NY, and approved May 24, 2013 (received for review January 18, 2013) Accurate replication in the presence of DNA damage is essential to allowing the machinery to overcome specific challenges such as genome stability and viability in all cells. In Escherichia coli, DNA collisions with the transcription apparatus or DNA-bound pro- replication forks blocked by UV-induced damage undergo a partial teins (1, 12, 13). In this study, we used thermosensitive replication resection and RecF-catalyzed regression before synthesis resumes. mutants to characterize how the composition of the replisome These processing events generate distinct structural intermediates changes following encounters with UV-induced photoproducts, a on the DNA that can be visualized in vivo using 2D agarose gels. biologically relevant lesion that is known to block the progression However, the fate and behavior of the stalled replisome remains of the replisome when located in the leading strand template (6, a central uncharacterized question. Here, we use thermosensitive 14–16). The results demonstrate that the DNA polymerases can mutants to show that the replisome’s polymerases uncouple and dissociate from the replisome in a modular manner without transiently dissociate from the DNA in vivo. Inactivation of α, β,or compromising the integrity of the replication fork. Dissociation of τ subunits within the replisome is sufficient to signal and induce the DNA polymerase from the replisome is sufficient and can the RecF-mediated processing events observed following UV dam- serve to initiate the processing of the replication fork DNA via the age.
    [Show full text]
  • 31, 2009, Now Pat. No. 8,313,899, Which Is a Division E.E."
    USOO8795959B2 (12) United States Patent (10) Patent No.: US 8,795,959 B2 Ryan (45) Date of Patent: * Aug. 5, 2014 (54) ISOLATED GLUCOKINASE GENOMIC FOREIGN PATENT DOCUMENTS POLYNUCLEOTDE FRAGMENTS FROM WO 952O678 8, 1995 CHROMOSOME 7 WO OO58467 10, 2000 (71) Applicant: Ryogen LLC, Suffern, NY (US) OTHER PUBLICATIONS (72) Inventor: James Ryan, Augusta, GA (US) Sulston et al., Genome Research, vol. 8, pp. 1097-1108 (1998).* Stoffel et alProc. Natl. Acad. Sci., vol. 89, pp. 2698-2702 (1992).* (73) Assignee: Ryogen LLC, Suffern, NY (US) logy et al., Molecular Endocrinol. vol. 6, pp. 1070-1081 1992). (*) Notice: Subject to any disclaimer, the term of this Table 24 of U.S. Appl. No. 60/231.498. patent is extended or adjusted under 35 ablemed, ES Froc. Nall. r Acad. N.SEs Sc1. : 14800. 1999 U.S.C. 154(b) by 0 days. Altschul, Nucleic Acids Res. 25: 3389-3402. 1997. This patent is Subject to a terminal dis- Burge, J. Mol. Biol. 268: 78-94. 1997. claimer. EMBL database Accession No. Q9UES0 May 1, 2000 SNARE pro tein Ykt6 (Fragment) Homo sapiens. (21) Appl. No.: 13/680,178 International Search Report for PCT/2001/29454, filed Mar. 27. 2003. (22) Filed: Nov. 19, 2012 Layne, J. Biol. Chem. 273:15654-15660. 1998. 9 Maestrini, Hum. Mol. Gen. 2:761-766. 1993. O O McNew, J. Biol. Chem. 272: 17776-17783. 1997. (65) Prior Publication Data Muise, Biochem J. 343: 341-345. 1999. US 2013/O13O250 A1 May 23, 2013 Nuttal, Bone 27: 177-184. 2000. Ohno, Biochem Biophys Res Comm 228: 411-414, 1996.
    [Show full text]