Cleavage of Fyn and Lyn in Their N-Terminal Unique Regions During Induction of Apoptosis: a New Mechanism for Src Kinase Regulation

Cleavage of Fyn and Lyn in their N-terminal unique regions during induction of apoptosis: a new mechanism for Src kinase regulation

Frederic Luciano1, Jean-Ehrland Ricci1 and Patrick Auberger*,1

1INSERM U526: Activation des Cellules Hematopoietiques / Physiopathologie de la Survie et de la Mort Cellulaires et Infections Virales. Equipe LabelliseÂe par la Ligue Nationale contre le Cancer. IFR50, FaculteÂ de MeÂdecine, Avenue de Valombrose, 06107 Nice-CeÂdex 2, France

The members of the Src kinase family are expressed in a 2000). While most Src kinases are widely expressed (i.e wide variety of tissues, but some of them such as Blk, Src, Fyn and Yes) (Golden et al., 1986; Kawakami et Hck, Fgr, Lck and Lyn are found primarily in al., 1989; Krueger et al., 1991; Zhao et al., 1991) hematopoietic cells. In the present study, we have certain members of this family such as Hck, Blk, Lck undertaken experiments to test whether Src kinase or Lyn exhibit a restricted tissue expression (Dymecki cleavage and relocation is a general mechanism during et al., 1990; Sudol et al., 1993; Veillette et al., 1989; induction of apoptosis. Our results indicate that Fyn and Willman et al., 1991; Yamanashi et al., 1989). Src Lyn are eciently cleaved in their unique region in family kinases share a common structural organization hematopoietic cells undergoing apoptosis. Fyn cleavage (Schwartzberg, 1998). They all have a N-terminal occurred in Fas-stimulated Jurkat T cells but Fyn and myristylation sequence, a unique domain, Src homol- Lyn were also processed in the SKW6.4 B cell line. ogy 2 (SH2) and Src homology 3 (SH3) domains, a Inhibition of caspases by Z-VAD-fmk or Ac-DEVD- catalytic domain and ®nally a C-terminal regulatory CHO totally prevented Fyn and Lyn cleavage in both domain. The N-amino termini of all family members, intact cells and in vitro. Fyn and Lyn but not Lck, Src also called the SH4 domain, are myristylated, a fatty and Hck were processed in vitro by human recombinant acid modi®cation that is determined by the ®rst seven caspase 3 and by cellular extracts prepared from Fas- amino-acids of the molecule and responsible for the stimulated cells. Single mutation of Asp 19 or Asp 18 in association of the protein with the plasma membrane. the unique N-terminal domains of Fyn and Lyn A short region of approximatively 80 amino acids respectively abolished their cleavage and relocation into called the unique region followed the myristylation the cytoplasm of apoptotic cells. When immunoprecipi- sequence. Downstream of this unique region lies a SH3 tated from COS cells N-terminal deleted Src kinases and a SH2 domain which are involved in protein ± exhibited increased enzymatic kinase activity toward protein interactions (Pleiman et al., 1993). The second enolase. Thus, cleavage of Fyn and Lyn during induction half of the molecule consists of the kinase or SH1 of apoptosis represents a new mechanism for the domain. Finally, an important feature of Src kinase is regulation of Src kinases that may have important the presence at the C-terminal end of the molecule of a functional and physiological consequences. Oncogene tyrosine residue in a highly conserved sequence that is (2001) 20, 4935 ± 4941. critical for the regulation of all Src kinase members (Xu et al., 1999). Keywords: apoptosis; Src kinases; caspases; T and B Apoptotic execution is orchestrated by caspases that lymphocytes function to cleave speci®cally after aspartic residues a limited number of substrates that eect the modi®cation associated with the ®nal steps of apoptosis (Hengartner, 2000; Nicholson and Thornberry, 1997; Nunez et al., 1998; Slee et al., 1999; Thornberry and Introduction Lazebnik, 1998; Widmann et al., 1998; Wolf and Green, 1999). We have previously reported that the The Src family of non receptor protein tyrosine kinases tyrosine kinase Fyn is cleaved in its unique region by consists of nine members (Src, Lyn, Fyn, Lck, Hck, caspases in T-cell undergoing apoptosis and is Fgr, Blk, Yes and Yrk) that are believed to play consequently relocated from the membrane to the important roles in a variety of cellular functions such cytosol of apoptotic cells (Ricci et al., 1999). The as growth, proliferation and dierentiation of many unique domain of Src kinases may contribute sig- cell types (Corey and Anderson, 1999; Schlessinger, ni®cantly to the dierences in the regulatory properties of this family of enzymes. Interestingly, this domain contains the lowest degree of homology among the dierent Src family members. Moreover, the unique *Correspondence: P Auberger; E-mail: [email protected] Received 3 March 2001; revised 4 May 2001; accepted 23 May domain of Lck and Fyn, for example, mediate their 2001 interaction with CD4 and CD8 (Rudd et al., 1991) and N-terminal cleavage of Src kinases in apoptosis F Luciano et al 4936 the antigen-receptor in T-lymphocytes but also with dierent signaling molecules (Sarosi et al., 1992). Phosphorylation at speci®c sites in the unique domains of Src kinases may also regulate their activity, as is the case for Hck (Johnson et al., 2000). In addition, several lines of evidences indicate that in certain circumstances Src kinases such as Lck, Fyn and Lyn may control apoptosis of T- and B-lymphocytes and granulocytes (Atkinson et al., 1996; Maruo et al., 1999; Qin et al., 1997; Simon et al., 1998; Wang et al., 1996). We show here that particular Src kinases are cleaved in a caspase-dependent fashion both in intact hematopoietic cells and in a cell free system. Of note, the cleavage occurs in the N-terminal unique region of Fyn and Lyn after an aspartic residue located in position 19 and 18 respectively, that is also conserved in Lck and Src but not in Hck, Yes, Blk and Yrk. This cleavage has important implications for the cellular localization and the activity of the kinases.

Results and Discussion Figure 1 Cleavage of Src kinases in intact T and B cells during Fas-mediated apoptosis. (a±e) Jurkat or SKW 6.4 cells (4.106) Cleavage of Fyn and Lyn in Fas-stimulated were incubated for dierent times at 378C in either the absence or T and B cell lines the presence of 100 ng/ml CH11. Cells were then lyzed and proteins separated by electrophoresis on 11% polyacrylamide We have previously shown that p59 Fyn is cleaved in gels. Proteins were then blotted to PVDF membranes which were Jurkat T-cells undergoing apoptosis (Ricci et al., 1999). incubated with either anti-procaspase 3, anti-Lyn, anti-Hck, anti- To determine whether other Src kinases present in Lck or anti-Fyn antibodies. (f)Asin(a±e) but a 7.5% polyacrylamide gel was used instead of a 11% gel. Note that a hematopoietic cell lines could be substrate for caspases, 54 KDa band corresponding to the cleavage of the 56 KDa we looked for Fyn, Lyn, Lck and Hck processing in isoform can be detected in these conditions two cellular models that expressed or not these dierent kinases. As expected, the T-lymphoblastic cell line Jurkat expressed p56 Lck and p59 Fyn but not p53/56 Lyn while the B lymphoblastic cell line SKW6.4 of 11%), two cleavage products of 54 and 51 kDa were expressed P53/56 Lyn and to a lesser extent p59Fyn detected indicating that the two Lyn isoforms are but not the T-cell speci®c kinase p56 Lck (Figure 1). equally cleaved following CH11 treatment of SKW6.4 Surprisingly, both cell lines were found to express p59 cells (Figure 1f). It should be pointed out that we failed Hck, a Src kinase whose distribution is supposed to be to detect p60 Src immunoreactivity in Jurkat and largely restricted to myelomonocytic cell lines (Willman SKW6.4 cells (not shown). Taken together our results et al., 1991). We and others have previously reported indicate that some Src kinases are cleaved during that both cell lines were sensitive to Fas-killing (Ricci et induction of apoptosis in T- and B-cell lines. To verify al., 1999; Scadi et al., 1998). Induction of apoptosis that the cleavage of Fyn and Lyn can be ascribed to the by the agonistic anti-Fas mAb (CH11) was monitored activation of caspases in Fas-stimulated cells, we next as a function of time by the cleavage of procaspase 3 looked for the eect of the large spectrum caspase (Figure 1a). When T- and B-cells were treated for inhibitor Z-VAD-fmk on CH11-induced Fyn and Lyn various times with CH11, Fyn, Hck and to a lesser cleavage. Z-VAD-fmk was found to abrogate Fyn and extent Lyn were cleaved as soon as 3 h after CH11 Lyn processing in SKW6.4 cells (Figure 2a,b). Cleavage addition. By contrast, Lck was not aected by CH11 of Fyn and Lyn correlated with the processing and treatment (Figure 1b). Cleavage of Fyn occurs in B- activation of initiatory procaspases 8 and 9 and and T-cell lines as well, and after 5 h most of p59 Fyn eectory procaspases 3, 6 and 7 (Figure 2c ± g). appeared as a 57 kDa band in both cell types. Cleavage of Lyn generated a 51 kDa band while Hck was Cleavage of Src kinases by caspase 3 in vitro processed to a 42 kDa product. As described above, in the SKW 6.4 B cell line Lyn processing generated a In view of the results described above, we next 51 kDa band corresponding to the cleavage of the p53 examined whether these dierent Src kinases may isoform (Figure 1b), but it is conceivable that the serve as substrates for recombinant caspase 3. In vitro cleavage product of the p56 isoform is masked by the transcribed and translated wild-type kinases were residual intact p53 isoform. Accordingly, when a less incubated with either puri®ed recombinant caspase 3 reticulated polyacrylamide gel was used (7.5% instead or cell extracts prepared from Fas-stimulated Jurkat or

Oncogene N-terminal cleavage of Src kinases in apoptosis F Luciano et al 4937

Figure 3 Cleavage of Src kinases by caspase 3 and Fas-activated cell extracts in vitro. p59Fyn, p56Lyn, p59Hck, p56Lck and p60Src were transcribed and translated with 35S-Methionine and incubated with puri®ed recombinant caspase 3 (25 ng), or Fas- activated Jurkat T-cell extracts (100 mg) for 15 h at 378C in either the presence or the absence of 100 mM Ac-DEVD-CHO, a large spectrum caspase inhibitor. The reaction products were then analysed by SDS ± PAGE and autoradiography. The mature and cleaved forms of Src kinases are indicated by arrows

Figure 2 Eect of a caspase inhibitor on Fas-induced p56/53Lyn cleavage SKW 6.4 cells (46106) were preincubated for 24 h at 378C in the absence or presence of 50 mM Ac-ZVAD-fmk. CH11 substrate for puri®ed caspase 3 in vitro, indicates that was then added for 7 h at 378C. Cells were lysed and processed as described in Figure 1a the latter is not involved in Hck cleavage in intact cells. Finally, no calpain inhibitors or proteasome inhibitors blocked Hck cleavage in myelomonocytic cell lines (not shown). SKW6.4 cells. After 15 h at 378C, Fyn and Lyn were proteolytically processed by caspase 3 and by cellular Lyn is cleaved in its N-terminal unique region in cell extracts prepared from apoptotic cells, generating the undergoing apoptosis characteristic 57 kDa and 54 kDa forms for Fyn and and Lyn, respectively (Figure 3). It should be To identify the aspartic residue cleaved in Lyn in mentioned that cellular extracts from untreated cells response to CH11, Asp18 was mutated to an alanine failed to induce Fyn or Lyn cleavage (not shown). In (Figure 4a) and the wild-type or mutated p56 Lyn each case, cleavage was abolished by preincubation cDNA were transcribed and translated in vitro with 35S- with Ac-DEVD-CHO a potent and large spectrum methionine in either the presence or the absence of caspase inhibitor. Concerning Lyn, the cDNA used in puri®ed recombinant caspase 3 or cellular lysates this experiment corresponds to the 56 kDa isoform of prepared from Fas-stimulated SKW6.4 cells (Figure the kinase. Indeed, two isoforms of Lyn, p53 and p56 4b). Asp18 was chosen because cleavage of Lyn at this Lyn have been described that dier only in a short 21 site would generate a fragment compatible with that amino-acids sequence located in the unique N-terminal observed in Fas-stimulated SKW6.4 cells. After 15 h at region (Yi et al., 1991). Interestingly, cleavage of Lyn 378C, wild-type 35S-labeled Lyn was processed by by caspase 3 in vitro was almost complete, while Fyn puri®ed caspase 3 and cellular extract prepared from was only partially processed in identical conditions. By Fas-treated SKW 6.4 cells generating the characteristic contrast, we found a reciprocal regulation of Fyn and 54 kDa fragment (Figure 4a,b). Puri®ed caspase 3 or Lyn cleavage in Fas-stimulated cells (i.e. a complete extracts from Fas-stimulated SKW6.4 failed to cleave cleavage of Fyn and only a partial cleavage of Lyn) D18A Lyn in vitro indicating that replacement of (Figures 1 and 2). These results probably re¯ect Asp18 by an alanine totally prevented p56 Lyn dierences in Fyn and Lyn caspase cleavage sites. cleavage by caspase 3 or other caspases present in Finally, recombinant caspase 3 or Fas-stimulated SKW6.4 cellular extracts. Thus, two Src kinase family extracts did not induce p56 Lck, p59 Hck or p60 Src members, namely Fyn and Lyn, which are known to cleavage in identical conditions (Figure 3). The play important roles in T- and B-cell receptor signaling observation that Hck is eciently cleaved in cells are processed in a very similar manner in lymphocytes undergoing apoptosis, but does not serve as a undergoing apoptosis.

Oncogene N-terminal cleavage of Src kinases in apoptosis F Luciano et al 4938

Figure 4 Characterization of the P56/53Lyn cleavage site. (a) Structure of p56/53Lyn and mutation of Asp18. A single mutation was introduced in the unique domain of Lyn that replaces Asp18 by an alanine. (b) Treatment of p56Lyn and p56Lyn D18A with recombinant caspase 3 and Fas-activated cell extracts in vitro. p56Lyn and p56Lyn D18A were transcribed and translated in vitro with 35S-methionine and incubated with puri®ed recombinant caspase 3 (25 ng), or Fas-activated Jurkat T-cell extracts (100 mg) for 15 h at 378C. The reaction products were then analysed by SDS ± PAGE and autoradiography. The mature and cleaved forms of Lyn are indicated

Relocation of the cleaved form of Src kinases Cleavage of Fyn and Lyn by caspases released the N- Figure 5 (a) Relocalization of p56/53Lyn and p59Fyn during Fas-mediated apoptosis. T- and B-cells (46106) were incubated terminal domain which is critical for the association of for 6 h at 378C with 100 ng/ml CH11. Cell lysates were separated Src kinases with the plasma membrane (Gervais and in cytosolic and microsomal fractions and proteins contained in Veillette, 1995; Yurchak and Sefton, 1995). Subcellular each fraction were subjected to Western blotting with anti-p56/ fractionnements were therefore performed with Jurkat 53Lyn and anti-p59Fyn antibody. As a control, total cell extracts and SKW6.4 cells to determine precisely the cellular were also analysed for p56/53Lyn and p59Fyn immunoreactivity. TOT: Total cellular proteins, MIC: Microsomal proteins, CYT: distribution of Fyn and Lyn in control and Fas- Cytosolic proteins. (b) Confocal microscopy images of Lyn stimulated cells. The subcellular distribution of both relocalization in SKW 6.4 cells. SKW 6.4 cells (106/ml) were kinases in stimulated cells was found to be dierent. treated or not for 6 h with 100 ng/ml CH11. Cells were Indeed, Fyn was present only in the membrane fraction permeabilized and successively incubated with anti-Lyn antibody, SAR-Biotin and Texas red-streptavidin. They were then analysed of Jurkat T-cells, while Lyn was enriched in the by confocal microscopy. Note both the membrane and cytosolic fraction of SKW6.4 (Figure 5a). Upon Fas cytoplasmic localization of Lyn in untreated cells and its stimulation, cleavage of Fyn and Lyn was accompanied cytoplasmic localization in CH11 treated cells. The fragmentation by the relocation of p57Fyn and p51Lyn from the of nucleus is also visible in CH11 treated cells membrane to the cytoplasm of apoptotic cells. It is not clear at present why only a small proportion of Lyn compared to Fyn is cleaved in response to Fas but the identical levels in COS-7 cells. As expected KD-Lyn simplest explanation would be that only the mem- was totally devoided of enzymatic activity. Interest- brane-associated kinase can serve as a substrate for ingly, DN-18 Lyn was found to be signi®cantly more caspases. Relocation of Lyn and Fyn was also active than WT-Lyn as judged by the increase in its con®rmed by confocal microscopy experiments (Figure autophosphorylation and its ability to phosphorylate 5b and not shown). enolase as an exogenous substrate (Figure 6b). These results demonstrate that cleavage of Lyn during induction of apoptosis results in the generation of a Consequence of Lyn cleavage on kinase activity soluble protein with identical or even increased kinase We next sought to analyse the eect of Lyn cleavage activity. This was also the case for DN-19 Fyn (not on its kinase activity. Dierent Lyn constructs were shown). Thus, it is likely that the N-terminal domain transfected in COS-7 which expressed a very low of Src kinases may exert a negative constraint on amount of endogenous Lyn. Lyn constructs were then kinase enzymatic activity. immunoprecipitated from COS-7 extracts and analysed We bring here evidence that Fyn and Lyn, two for p56Lyn and enolase phosphorylation in vitro.As important Src kinases involved in T and B cell receptor shown in Figure 6a, wild-type, uncleavable, kinase signaling (Appleby et al., 1992; Chan et al., 1997; dead and deleted Lyn were expressed at approximately Denny et al., 2000; Katsuta et al., 1998; Sefton and

Oncogene N-terminal cleavage of Src kinases in apoptosis F Luciano et al 4939

Figure 6 In vitro kinase assays. (a) Lyn WT, D18A, Kinase-dead and DN-18 Lyn cDNA were transiently transfected into Cos-7 cells. Cell lysates were immunoprecipitated with anti p56Lyn antibody preadsorbed on protein G-Sepharose. Immunoprecipi- tated proteins were subjected to SDS ± PAGE and transferred to immobilon membrane for Western blotting with anti-p53/56Lyn. (b) Cell lysates were immunoprecipitated with p53/56Lyn antibody preadsorbed on protein G-Sepharose. After extensive washing, p53/56Lyn activity was determined in a kinase assay containing enolase as exogenous substrate

Taddie, 1994; Wang et al., 1996) are cleaved in several hematopoietic cell lines following Fas triggering. Fyn and Lyn are also processed by recombinant caspase 3 in a cell free system. However, dierences in the rate of cleavage of both kinases in vitro by caspase 3 and in vivo by cellular caspases were evident, probably re¯ecting variations in the cleavage site of both kinases Figure 7 Sequences of the N-terminal unique domains of Src (Figure 7). Thus, only a small proportion of Lyn was kinases. Fyn and Lyn are eciently cleaved by caspases after cleaved in intact cells, while Fyn cleavage was found to Asp19 and Asp18 respectively. Other Src kinases such as Src, Fgr and Lck which share a putative caspase cleavage site are not be almost complete in identical conditions. By contrast, processed in identical conditions. Hck is also cleaved by caspases Lyn appeared to be a best caspase 3 substrate in vitro. but processing did not occur in its unique domain. Blk and Yrk These in vitro results are not surprising since Fyn have not been tested but none of these kinases have a consensus cleavage occurs between Asp19 and Gly20 in the caspase cleavage site in their unique domain sequence EERD/G which resembles the cleavage site EESD/A for the small subunit of caspase 2 whereas Lyn is cleaved after Asp18 in the sequence DGVD/L Several lines of recent evidence suggest that Lyn and which matched well with a caspase 3 consensus site Fyn are required for induction of apoptosis in B- and T- (Figure 7). These sequences were conserved in other lymphocytes (Atkinson et al., 1996; Wang et al., 1996) mammalian Fyn and Lyn cleavage sites (not shown). and activation of apoptosis by thrombospondin-1 in Among tyrosine kinases, Src, Lck, Syk and Zap 70 microvascular cells (Jimenez et al., 2000). It has also were not processed by caspases in vitro and in intact been recently reported that Fyn may mediate TCR- cells ((Ricci et al., 1999), Figures 1 and 3, and not signaling events leading to anergy especially under shown). Finally other Src kinases such as Fgr, Yes, Btk conditions in which the strength of the TCR signal is and Yrk did not share a caspase consensus sequence in reduced (Denny et al., 2000). Moreover, recent results their N-terminal unique domain (Figure 7). from our laboratory indicate that Fyn is absolutely Furthermore, the lower eciency of Lyn cleavage in required for T-cell receptor induced-caspase activation intact cells and in vitro experiment could be due to the and apoptosis in T lymphocytes. Interestingly, over- fact that (1) only a small proportion of Lyn is available expression in a T-cell hybridoma of a soluble form of for caspase cleavage due to a particular subcellular Fyn lacking the six N-terminal amino-acids thus distribution or (2) caspase 3 is not the main caspase resembling the cleaved form of Fyn produced in involved in Lyn cleavage in vivo. As the N-terminal apoptotic cells inhibited anti-CD3-induced caspase domain of Src kinases is critical for association of these activation and apoptosis (Ricci et al., 2001). Thus, molecules to the plasma membrane, cleavage should cleavage of Fyn and Lyn upon TCR, BCR or Fas lead to the relocation of the kinases from the triggering could play an important role to block the membrane to the cytoplasm. This was indeed the case apoptotic signal in a potential feedback mechanism by since subcellular fractionnements and confocal micro- relocalization of the soluble forms of these kinases. scopy experiments clearly show the redistribution of a These kinases could then bind and modulate by signi®cant amount of the processed forms of Fyn and phosphorylation molecules critically involved in the Lyn into the cytoplasm. activation and death programs of lymphocytes. This

Oncogene N-terminal cleavage of Src kinases in apoptosis F Luciano et al 4940 hypothesis is also supported by the ®nding that caspases Transfection of COS-7 cells are indeed phosphoproteins (Cardone et al., 1998). In summary, we described here a new mechanism for Lyn WT, Lyn D18A, Lyn KD and Lyn DN-18 were transiently Fyn and Lyn regulation in cells undergoing apoptosis expressed in Cos-7 cells by using the DEAE-Dextran procedure that required a speci®c cleavage in the N-terminal (Imbert et al., 1996). After 48 h cells were lysed in buer B. One hundred and ®fty mg of proteins were electrophoresed on unique domain of these kinases. More fundamentally, a 11% polyacrylamide gel and blotted to a PVDF membrane. cleavage and relocation of active Fyn and Lyn kinases After blocking non-speci®c binding sites, the membrane was following T- and B-cell triggering or death receptor- incubated with anti-p53/56Lyn antibodies as described above. mediated apoptosis may have important physiological consequences, such as retention of signaling molecules In vitro transcription and translation of Src kinases and cleavage into the cytoplasm by the mean of their SH2 and SH3 in a cell free system domains. Wild-type or uncleavable Src kinases were transcribed and translated using the Promega TNT coupled reticulocyte lysate system in the presence of 35S-methionine as previously described (Bertolotto et al., 2000b). Brie¯y, 2.5 mlof Materials and methods reticulocyte lysates were incubated in 50 mlof25mM HEPES pH 7.5, 0.1% CHAPS, 5 m DTT with 25 ng recombinant Cells M caspase 3 or 100 mg of Fas-stimulated Jurkat cell extracts for Cell lines used in this study have been described elsewhere 15 h at 378C. In some experiments, the eect of caspase (Mari et al., 1992). They were cultured in RPMI 1640 medium inhibitors (Z-VAD-fmk or Ac-DEVD-CHO, 10 mM) were in 12 or 6 well sterile dishes with either 100 ng/ml of anti-Fas also monitored. Proteins contained in cell lysates were IgM (CH11, Euromedex) or 1 mM staurosporine for dierent electrophoresed on 11% polyacrylamide gels. Gels were times at 378C. Western blot analysis has been also described in stained with Coomassie blue, ampli®ed and autoradiographed detail (Bertolotto et al., 2000a; Imbert et al., 1996). Brie¯y, using Amersham hyper®lm. after treatment cells (4.106) were washed in phosphate buer saline (PBS), lysed in lysis buer B (50 m HEPES pH 7.4, M Subcellular fractionnements 150 mM NaCl, 20 mM EDTA, 100 mM NaF, 10 mM Na2VO4, 1mM PMSF, 20 mg/ml aprotinin, 1% NP40) incubated for After stimulation, Jurkat or SKW6.4 cells (4.106) were 30 min at 48C and ®nally centrifuged at 15 000 g for 15 min. resuspended in PBS and rapidly sonicated. Cell extracts were One hundred and ®fty mg of protein were separated on 7.5 or ®rst centrifuged at 1000 g for 5 min. Supernatants were then 11% polyacrylamide gel and blotted to PVDF membranes centrifuged at 20 000 g for 30 min. Soluble proteins (cytosol) (Immobilon, millipore). After blocking non-speci®c binding were recentrifuged at 100 000 g for 30 min and collected. sites, the membranes were incubated for 2 h at room Pellets (microsomal fraction) were lysed in buer B and temperature with anti-human procaspase 3 (Transduction sonicated. An equal amount of cells were directly lysed in laboratory), procaspase 6, procaspase 7, procaspase 8, buer B and served as an internal control. In each lane the p59Fyn, p53/56Lyn, p56Lck or p59Hck antibodies (Santa amount of total, cytosolic and microsomal proteins loaded on Cruz). The membranes were washed three times with TNA- the gel corresponds to 4.106 cells. 1% NP40 (Tris 50 mM, NaCl 150 mM, pH 7.5) incubated further with horseradish peroxidase conjugated rabbit-anti- In vitro kinase assays mouse antibody for 60 min at room temperature. Immuno- blots were revealed by autoradiography using the enhanced Cell lysates were prepared as described above. After chemiluminescence detection kit (Amersham). centrifugation, supernatant were incubated at 48C for 18 h with anti-p53/56Lyn antibodies preadsorbed to protein G- sepharose. Immune complex were washed four times with Fyn and Lyn mutations lysis buer, one time with PBS buer and once with kinase To obtain the uncleavable forms of Src kinases a single buer A (HEPES 30 mM pH 6,8, MnCl2 5mM, MgCl2 mutation was introduced in the N-terminal unique domain 5mM). Beads were ®nally resuspended in 50 ml kinase buer that replaces aspartate 19 of Fyn or aspartate 18 of Lyn by A containing 5 mg enolase and 2 mCi of [g-32P]-ATP. After an alanine (QuickchangeTM site directed mutagenesis kit, incubation at 258C for 20 min, assays were terminated by the stratagene). The primers (Genset) used for Fyn were: sens addition of 4 mlof106Laemmli sample buer. The samples GAGGAGAGGGCCGGCAGCCTG and anti-sens CAGG- were heated at 958C for 5 min and analysed by SDS/12% CTGCCGGCCCTCTCCTC and for Lyn: sens GATGAAG- polyacrylamide gel electrophoresis. The gels were dried and TAGCTTCGAAGACT and antisens AGTCTTCGAAGC- subjected to autoradiography. TACTTCATC. To obtain the kinase dead form of Lyn, the lysine residue at position 275 in the putative ATP-binding site was replaced with an arginine (QuickchangeTM site directed mutagenesis kit, stratagene). The primers (Genset) used were: sens Acknowledgments GTGGCTGTGAGGACCCTCAAG and anti-sens CTTGA- This work was supported by INSERM and the Ligue GGGTCCTCACAGCCAC. Nationale Contre le Cancer (Equipe labelliseÂ eLNC).The Lyn DN-18 kinase was obtained using the following authors thank Bernard Mari for critical reading of the primers sens GATCGCGTAGCGAGAAATATGTCGAA- manuscript. We are indebted to Dr Sarah Courtneidge for GACTCAACCAGTACG and anti-sens: CGTACTGGTG- providing p59Fyn and p60Src cDNAs, to Dr Victor AGTCTTCGACATATTTCTCGCTACGCGGATC. Single Tybulewicz for the kind gift of p56Lyn cDNA and to Dr mutations or deletions were veri®ed by sequencing. Yves Colette and Pr Daniel Olive for Hck cDNA.

Oncogene N-terminal cleavage of Src kinases in apoptosis F Luciano et al 4941 References

Appleby MW, Gross JA, Cooke MP, Levin SD, Qian X and Ricci JE, Maulon L, Luciano F, Guerin S, Livolsi A, Mari B, Perlmutter RM. (1992). Cell, 70, 751 ± 763. Breittmayer JP, Peyron JF and Auberger P. (1999). Atkinson EA, Ostergaard H, Kane K, Pinkoski MJ, Caputo Oncogene, 18, 3963 ± 3969. A, Olszowy MW and Bleackley RC. (1996). J. Biol. Chem., Ricci JE, Lang V, Luciano F, Belhacene N, Giordanengo V, 271, 5968 ± 5971. Michel F, Bismuth G and Auberger P. (2001). FASEB J., Bertolotto C, Maulon L, Filippa N, Baier G and Auberger P. (in press). (2000a). J. Biol. Chem., 275, 37246 ± 37250. Rudd CE, Barber EK, Burgess KE, Hahn JY, Odysseos AD, BertolottoC,RicciJE,LucianoF,MariB,ChambardJC Sy MS and Schlossman SF. (1991). Adv. Exp. Med. Biol., and Auberger P. (2000b). J. Biol. Chem., 275, 12941 ± 292, 85 ± 96. 12947. Sarosi GA, Thomas PM, Egerton M, Phillips AF, Kim KW, Cardone MH, Roy N, Stennicke HR, Salvesen GS, Franke Bonvini E and Samelson LE. (1992). Int. Immunol., 4, TF, Stanbridge E, Frisch S and Reed JC. (1998). Science, 1211 ± 1217. 282, 1318 ± 1321. Scadi C, Fulda S, Srinivasan A, Friescu C, Li F, Tomaselli ChanVW,MengF,SorianoP,DeFrancoALandLowell KJ, Debatin KM, Krammer PH and Peter ME. (1998). CA. (1997). Immunity, 7, 69 ± 81. EMBO J., 17, 1675 ± 1687. Corey SJ and Anderson SM. (1999). Blood, 93, 1 ± 14. Schlessinger J. (2000). Cell, 100, 293 ± 296. Denny MF, Patai B and Straus DB. (2000). Mol. Cell. Biol., Schwartzberg PL. (1998). Oncogene, 17, 1463 ± 1468. 20, 1426 ± 1435. Sefton BM and Taddie JA. (1994). Curr. Opin. Immunol., 6, Dymecki SM, Niederhuber JE and Desiderio SV. (1990). 372 ± 379. Science, 247, 332 ± 336. Simon HU, Youse® S, Dibbert B, Hebestreit H, Weber M, Gervais FG and Veillette A. (1995). Mol. Cell. Biol., 15, Branch DR, Blaser K, Levi-Schaer F and Anderson GP. 2393 ± 2401. (1998). Blood, 92, 547 ± 557. Golden A, Nemeth SP and Brugge JS. (1986). Proc. Natl. Slee EA, Harte MT, Kluck RM, Wolf BB, Casiano CA, Acad. Sci. USA, 83, 852 ± 856. Newmeyer DD, Wang HG, Reed JC, Nicholson DW, Hengartner MO. (2000). Nature, 407, 770 ± 776. Alnemri ES, Green DR and Martin SJ. (1999). J. Cell. Imbert V, Rupec RA, Livolsi A, Pahl HL, Traenckner EB, Biol., 144, 281 ± 292. Mueller-Dieckmann C, Farahifar D, Rossi B, Auberger P, SudolM,GreulichH,NewmanL,SarkarA,SukegawaJand Baeuerle PA and Peyron JF. (1996). Cell, 86, 787 ± 798. Yamamoto T. (1993). Oncogene, 8, 823 ± 831. Jimenez B, Volpert OV, Crawford SE, Febbraio M, Thornberry NA and Lazebnik Y. (1998). Science, 281, Silverstein RL and Bouck N. (2000). Nat. Med., 6, 41 ± 48. 1312 ± 1316. Johnson TM, Williamson NA, Scholz G, Jaworowski A, Veillette A, Bookman MA, Horak EM, Samelson LE and Wettenhall RE, Dunn AR and Cheng HC. (2000). J. Biol. Bolen JB. (1989). Nature, 338, 257 ± 259. Chem., 275, 33353 ± 33364. Wang J, Koizumi T and Watanabe T. (1996). J. Exp. Med., Katsuta H, Tsuji S, Niho Y, Kurosaki T and Kitamura D. 184, 831 ± 838. (1998). J. Immunol., 160, 1547 ± 1551. Widmann C, Gibson S and Johnson GL. (1998). J. Biol. Kawakami Y, Furue M and Kawakami T. (1989). Oncogene, Chem., 273, 7141 ± 7147. 4, 389 ± 391. Willman CL, Stewart CC, Longacre TL, Head DR, Krueger J, Zhao YH, Murphy D and Sudol M. (1991). Habbersett R, Ziegler SF and Perlmutter RM. (1991). Oncogene, 6, 933 ± 940. Blood, 77, 726 ± 734. MariB,CheclerF,PonzioG,PeyronJF,ManieS,Farahifar Wolf BB and Green DR. (1999). J. Biol. Chem., 274, 20049 ± D, Rossi B and Auberger P. (1992). EMBO J., 11, 3875 ± 20052. 3885. Xu W, Doshi A, Lei M, Eck MJ and Harrison SC. (1999). Maruo A, Oishi I, Sada K, Nomi M, Kurosaki T, Minami Y Mol. Cell., 3, 629 ± 638. and Yamamura H. (1999). Int. Immunol., 11, 1371 ± 1380. Yamanashi Y, Mori S, Yoshida M, Kishimoto T, Inoue K, Nicholson DW and Thornberry NA. (1997). Trends Yamamoto T and Toyoshima K. (1989). Proc. Natl. Acad. Biochem. Sci., 22, 299 ± 306. Sci. USA, 86, 6538 ± 6542. Nunez G, Benedict MA, Hu Y and Inohara N. (1998). Yi TL, Bolen JB and Ihle JN. (1991). Mol. Cell. Biol., 11, Oncogene, 17, 3237 ± 3245. 2391 ± 2398. PleimanCM,ClarkMR,GauenLK,WinitzS,Coggeshall Yurchak LK and Sefton BM. (1995). Mol. Cell. Biol., 15, KM, Johnson GL, Shaw AS and Cambier JC. (1993). Mol. 6914 ± 6922. Cell. Biol., 13, 5877 ± 5887. Zhao YH, Baker H, Walaas SI and Sudol M. (1991). Qin S, Minami Y, Kurosaki T and Yamamura H. (1997). J. Oncogene, 6, 1725 ± 1733. Biol. Chem., 272, 17994 ± 17999.

Oncogene