Methods for De-Novo Genome Assembly

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 28 June 2020 doi:10.20944/preprints202006.0324.v1 Methods for De-novo Genome Assembly Arash Bayat∗1,3, Hasindu Gamaarachchi1, Nandan P Deshpande2, Marc R Wilkins2, and Sri Parameswaran1 1School of Computer Science and Engineering, UNSW, Australia 2Systems Biology Initiative, School of Biotechnology and Biomolecular Sciences, UNSW, Australia 3Health and Biosecurity, CSIRO, Australia June 25, 2020 Abstract Despite advances in algorithms and computational platforms, de-novo genome assembly remains a chal- lenging process. Due to the constant innovation in sequencing technologies (Sanger, SOLiD, Illumina, 454 , PacBio and Oxford Nanopore), genome assembly has evolved to respond to the changes in input data type. This paper includes a broad and comparative review of the most recent short-read, long-read and hybrid assembly techniques. In this review, we provide (1) an algorithmic description of the important processes in the workflow that introduces fundamental concepts and improvements; (2) a review of existing software that explains possible options for genome assembly; and (3) a comparison of the accuracy and the performance of existing methods executed on the same computer using the same processing capabilities and using the same set of real and synthetic datasets. Such evaluation allows a fair and precise comparison of accuracy in all aspects. As a result, this paper identifies both the strengths and weaknesses of each method. This com- parative review is unique in providing a detailed comparison of a broad spectrum of cutting-edge algorithms and methods. Availability: https://arashbayat.github.io/asm ∗To whom correspondence should be addressed. Email: [email protected] 1 © 2020 by the author(s). Distributed under a Creative Commons CC BY license. Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 28 June 2020 doi:10.20944/preprints202006.0324.v1 1 Introduction is usually obtained by applying approximations. This leads to a less accurate assembled genome, which might, DNA is a giant molecular strand that is a chain of four for example, consider only exact-match overlaps in- small molecules. Sequencing is the process of read- stead of all overlaps between reads [43]. Scalability ing DNA molecular chain into strings of A, C, Tand G is another expectation from an assembly pipeline [24]. where each letter (called a base) represents one of the Genome assembly requires a massive amount of pro- small molecules. Due to the available technology to- cessing, and a pipeline should be able to utilize all avail- day, the DNA strand is broken into small pieces and able hardware resources such as processors and mem- each fragment is then sequenced separately. However, ory with the highest efficiency. The program should the order of DNA fragments (reads) cannot be pre- also be able to deal with limitations. For instance, us- served. Therefore, a process called genome assembly is ing a large amount of memory is common in de-novo used. This is the process by which the entire genome assembly programs. A scalable program should be able of an individual or species is obtained. The word as- to deal with the limited amount of available memory, sembly indicates that the entire genome cannot be ob- with minimal impact on execution time [28]. tained at once; rather, it must be assembled from small In addition to the above expectations, the choice of DNA fragments. The process of de-novo assembly has an assembly pipeline should be based on the following to do with assembling a species' genome for the first 'data-specific’ parameters. time. The resulting genome can then be used to facili- tate genome assembly of other individuals of the same • The types of data that are available for assembly: species, in a process called the reference-guided assem- It is important to compare short-read and long- bly. (To understand this, one might think of solving read assembly approaches to each other and to a jigsaw puzzle by using its cover photo for reference.) hybrid assembly techniques. In contrast, de-novo assembly refers to assembling the genome without having a draft genome; this is a com- { Ultra-short read sequencing such as early plex and difficult problem to solve. SOLiD [38] sequencing is suitable for de- Based on the purpose of the assembly, there are sev- Bruijn graph assembly but not an Overlap- eral expectations about the accuracy of the assembled Layout-Consensus (OLC ) assembly approach. genome and the time it takes to be assembled. Fur- { Next-Generation Sequencing (NGS) [31] ma- thermore, the type and volume of sequenced data play chines such as Illumina [4] produce reads up important roles in the assembly process. It is critical to to hundreds of bases (short-reads) with high choose a pipeline that best fits the available data and accuracy. The error rate is less than 2%; fulfils expectations. Only a fair comparison of assem- most errors are of the substitution type and bly pipelines can be informative as it would truly reveal are less frequently short Indels. the strengths and weaknesses of various methods. { paired-end [23] and mate-pair [50] reads are The assembled genome is expected to be accurate; sequenced from two ends of a long DNA various metrics can be used to measure the accuracy of fragment where the distance between them an assembled genome [16]. The most important met- is approximately known. Such information rics include genome coverage and contiguity as well can be used to improve the quality of the as base calling error rate. It is not possible to find a assembled genome. pipeline that maximizes the accuracy of all aspects [9]. The pipeline should be chosen based on the application { PacBio [14] and Oxford Nanopore [20] are for which the genome is assembled. Single-Molecule Real-Time (SMRT ) technolo- If the assembled genome is going to be used as a gies that can sequence reads up to many reference-genome in a reference-guided assembly, high thousands of bases long. However, they suf- genome coverage is prioritized. If part of the genome fer from a high base calling error rate (up to is missed in the reference-genome, all subsequent as- 30%) and can include long Indels. sembled genomes will lack the information on that re- • Sequencing remains an expensive process: It is gion. However, if a slight base calling error exists in the important to understand how different software reference-genome, a variant-calling process shows the programs respond to low and high read coverage same variation in all individuals; this variation pro- depth when assembling a genome. vides evidence of the error in the reference-genome. This can be fixed by updating the reference-genome { If only short-read or long-read are provided, for further analysis. On the other hand, if the genome the coverage depth should be considered in is assembled for functional genomic studies, high base configuring the assembly pipeline. For high calling accuracy in gene areas is critical since an in- coverage data, more filtering can be applied correct base calling could change the predicted protein to collect high-confidence data for more ac- structure. High genome coverage and contiguity in all curate assembly. On the other hand, when regions may not be a benefit in this scenario. the coverage is low, fewer heuristics should There are expectations from the assembly pipeline be applied to utilise all the information in as well. The program should trade-off between speed the data. For example, one should consider and accuracy. Despite algorithmic enhancements, speed a more exhaustive search to find all overlaps 2 Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 28 June 2020 doi:10.20944/preprints202006.0324.v1 between reads, not just those that are easy 2 MATERIALS AND METHODS to capture. { For hybrid assembly where short and long 2.1 Algorithms and Methods reads are used together in an assembly, cov- The input to the assembly process is a set of reads that erage depth has a stronger effect on the choice are passed through all data preprocessing steps. There of assembly pipeline. For example, if high is a graph data structure in the heart of each assembly coverage long-reads are provided, it is possi- pipeline called the assembly graph. The goal of the as- ble to do a long-read-only assembly [24] and sembly graph is to link small DNA fragments to one an- use short-read for genome polishing [51]. For other to build the genome. The output of the assembly lower long-read coverage, long-read should graph is a set of sequences called contigs which are usu- be corrected with short-read [17] prior to ally large pieces of the genome without any information the long-read assembly. If long-read cover- about their order in the genome. In the best scenario, age is not sufficient for assembly, it is pos- there would be one contig per chromosome covering the sible to use long-read to improve contiguity entire chromosome. However, this is an idealistic goal of a short-read assembly [2]. for current assembly pipelines, especially when dealing { For all assemblies, it should be noted that with large genomes. Finally, the post-processing steps sequencing coverage depth is not fixed across would improve the assembly by ordering these contigs, the genome. Variation in coverage results in filling the gaps and fixing errors. Scaffolding is the some regions having low (or no) read cover- process in which the order of the contig in the genome age that leads to a discontiguity in the re- and the distance between them is predicted. Gap fill- sulting assembly. In this case, one should ing is the process of identifying the sequence between consider a pipeline that includes a scaffold- the scaffolds.
Recommended publications
  • A Galaxy-Based Virus Genome Assembly Pipeline A

    A Galaxy-Based Virus Genome Assembly Pipeline A

    The Pennsylvania State University The Graduate School VIRAMP: A GALAXY-BASED VIRUS GENOME ASSEMBLY PIPELINE A Thesis in Integrative Biosciences by Yinan Wan © 2014 Yinan Wan Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science December 2014 The thesis of Yinan Wan was reviewed and approved* by the following: Istvan Albert Associate Professor, Bioinformatics, Biochemistry and Molecular Biology Thesis Advisor Moriah L. Szpara Assistant Professor of Biochemistry & Molecular Biology Cooduvalli S. Shashikant Associate Professor of Molecular and Development Biology Co-Director, IBIOS Graduate Program Option in Bioinformatics and Genomics Peter Hudson Willaman Professor of Biology Director, Huck Institutes of the Life Sciences *Signatures are on file in the Graduate School iii ABSTRACT Background Advances in next generation sequencing make it possible to obtain high-coverage sequence data for large numbers of viral strains in a short time. However, since most bioinformatics tools are developed for command line use, the selection and accessibility of computational tools for genome assembly and variation analysis limits the ability of individual scientist to perform further bioinformatics analysis. Findings We have developed a multi-step viral genome assembly pipeline named VirAmp that combines existing tools and techniques and presents them to end users via a web-enabled Galaxy interface. Our pipeline allows users to assemble, analyze and interpret high coverage viral sequencing data with an ease and efficiency that previously was not feasible. Our software makes a large number of genome assembly and related tools available to life scientists and automates the currently recommended best practices into a single, easy to use interface.
  • Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates

    Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates

    microorganisms Article Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates Pamela Afouda 1,2, Grégory Dubourg 1,2, Anthony Levasseur 1,2, Pierre-Edouard Fournier 2,3 , Jeremy Delerce 1, Oleg Mediannikov 1 , Seydina M. Diene 1,2 , Daniel Nahon 4, Didier Bourlès 4, Jean-Marc Rolain 1,2 and Didier Raoult 1,2,* 1 Aix Marseille Université, IRD, AP-HM, MEPHI, 13005 Marseille, France; [email protected] (P.A.); [email protected] (G.D.); [email protected] (A.L.); [email protected] (J.D.); [email protected] (O.M.); [email protected] (S.M.D.); [email protected] (J.-M.R.) 2 IHU Méditerranée Infection, 13005 Marseille, France; [email protected] 3 UMR VITROME, SSA, Aix-Marseille Université, IRD, AP-HM, IHU-Méditerranée-Infection, 13005 Marseille, France 4 Aix-Marseille University, CNRS, IRD, INRAE, Coll France, UM 34 CEREGE, Technopôle de l’Environnement Arbois-Méditerranée, BP80, 13545 Aix-en-Provence, France; [email protected] (D.N.); [email protected] (D.B.) * Correspondence: [email protected]; Tel.: +33-413-732-401; Fax: +33-413-732-402 Received: 29 March 2020; Accepted: 1 October 2020; Published: 3 October 2020 Abstract: Long considered to be a consequence of human antibiotics use by deduction, antibiotic resistance mechanisms appear to be in fact a much older phenomenon as antibiotic resistance genes have previously been detected from millions of year-old permafrost samples. As these specimens guarantee the viability of archaic bacteria, we herein propose to apply the culturomics approach to recover the bacterial content of a Siberian permafrost sample dated, using the in situ-produced cosmogenic nuclide chlorine36 (36Cl), at 2.7 million years to study the dynamics of bacterial evolution in an evolutionary perspective.
  • A New Versatile Metagenomic Assembler (Supplementary Material)

    A New Versatile Metagenomic Assembler (Supplementary Material)

    metaSPAdes: a new versatile metagenomic assembler (Supplementary Material) Sergey Nurk1,*,**, Dmitry Meleshko1,*, Anton Korobeynikov1,2 and Pavel A Pevzner1,3 1Center for Algorithmic Biotechnology, Institute for Translational Biomedicine, St. Petersburg State University, St. Petersburg, Russia 2Department of Statistical Modelling, St. Petersburg State University, St. Petersburg, Russia 3Department of Computer Science and Engineering, University of California, San Diego, USA *These authors contributed equally to this work **corresponding author, [email protected] Data preprocessing 2 Modifying the decision rule in exSPAnder for metagenomic data 3 Reducing running time and memory footprint of metaSPAdes 4 Bulge projection approach 6 Nx statistics 7 Analysis of the SYNTH dataset 8 CAMI datasets 10 Analysis of the CAMI datasets 14 BenchmarKing SPAdes against metaSPAdes 17 Effect of novel algorithmic approaches in metaSPAdes on assembly quality 21 Analysis of the HMP dataset 25 References 27 1 Supplemental Material: Data preprocessing The SYNTH, HMP, MARINE, and SOIL datasets were pre-processed to remove adaptors and trim low- quality segments of the reads. We used cutadapt software v 1.9.1 (Martin 2011), trimming bases with PHRED quality < 20 from 3’ end (parameter -q 20). Adaptor sequences were identified for each dataset individually, using FastQC v0.11.3 and manual reads inspection: SYNTH: -q 20 -a GAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT HMP: -q 20 -a AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
  • Spades: a New Genome Assembler for Single-Cell Sequencing

    Spades: a New Genome Assembler for Single-Cell Sequencing

    Problem setting and preparing data The SPAdes approach SPAdes: a New Genome Assembler for Single-Cell Sequencing Algorithmic Biology Lab St. Petersburg Academic University A. Bankevich, S. Nurk, D. Antipov, A.A. Gurevich, M. Dvorkin, A. Korobeynikov, A.S. Kulikov, V.M. Lesin, S.I. Nikolenko, S. Pham, A.D. Prjibelski, A.V. Pyshkin, A.V. Sirotkin, N. Vyahhi, G. Tesler, M.A. Alekseyev, P.A. Pevzner August 27, 2012 Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Outline 1 Problem setting and preparing data Assembly: problem and pipeline Error correction: BayesHammer 2 The SPAdes approach De Bruijn graphs, mate-pairs, and simplification Paired de Bruijn graphs and repeats Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Single-cell sequencing Recent years have seen the advent of single-cell sequencing as a way to sequence genomes that we previously couldn’t. It turns out that many bacteria (“dark matter of life”) cannot be sequenced by standard techniques, most often because they cannot be cloned millions of times to get large DNA samples needed for regular sequencing. This is usually due to the fact that these bacteria come in metagenomic samples (ocean samples, microbiomes of larger organisms etc.) and cannot be cultivated alone. For now, metagenomic analysis can yield more or less only individual genes. Single-cell sequencing can
  • Computational Protocol for Assembly and Analysis of SARS-Ncov-2 Genomes

    Computational Protocol for Assembly and Analysis of SARS-Ncov-2 Genomes

    PROTOCOL Computational Protocol for Assembly and Analysis of SARS-nCoV-2 Genomes Mukta Poojary1,2, Anantharaman Shantaraman1, Bani Jolly1,2 and Vinod Scaria1,2 1CSIR Institute of Genomics and Integrative Biology, Mathura Road, Delhi 2Academy of Scientific and Innovative Research (AcSIR) *Corresponding email: MP [email protected]; AS [email protected]; BJ [email protected]; VS [email protected] ABSTRACT SARS-CoV-2, the pathogen responsible for the ongoing Coronavirus Disease 2019 pandemic is a novel human-infecting strain of Betacoronavirus. The outbreak that initially emerged in Wuhan, China, rapidly spread to several countries at an alarming rate leading to severe global socio-economic disruption and thus overloading the healthcare systems. Owing to the high rate of infection of the virus, as well as the absence of vaccines or antivirals, there is a lack of robust mechanisms to control the outbreak and contain its transmission. Rapid advancement and plummeting costs of high throughput sequencing technologies has enabled sequencing of the virus in several affected individuals globally. Deciphering the viral genome has the potential to help understand the epidemiology of the disease as well as aid in the development of robust diagnostics, novel treatments and prevention strategies. Towards this effort, we have compiled a comprehensive protocol for analysis and interpretation of the sequencing data of SARS-CoV-2 using easy-to-use open source utilities. In this protocol, we have incorporated strategies to assemble the genome of SARS-CoV-2 using two approaches: reference-guided and de novo. Strategies to understand the diversity of the local strain as compared to other global strains have also been described in this protocol.
  • Sequencing and Comparative Analysis of &lt;I&gt;De Novo&lt;/I&gt; Genome

    Sequencing and Comparative Analysis of <I>De Novo</I> Genome

    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Dissertations and Theses in Biological Sciences Biological Sciences, School of 7-2016 Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762 Julien S. Gradnigo University of Nebraska - Lincoln, [email protected] Follow this and additional works at: http://digitalcommons.unl.edu/bioscidiss Part of the Bacteriology Commons, Bioinformatics Commons, and the Genomics Commons Gradnigo, Julien S., "Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762" (2016). Dissertations and Theses in Biological Sciences. 88. http://digitalcommons.unl.edu/bioscidiss/88 This Article is brought to you for free and open access by the Biological Sciences, School of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Dissertations and Theses in Biological Sciences by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 by Julien S. Gradnigo A THESIS Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Master of Science Major: Biological Sciences Under the Supervision of Professor Etsuko Moriyama Lincoln, Nebraska July, 2016 SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 Julien S. Gradnigo, M.S. University of Nebraska, 2016 Advisor: Etsuko Moriyama Streptomyces aureofaciens is a Gram-positive Actinomycete used for commercial antibiotic production. Although it has been the subject of many biochemical studies, no public genome resource was available prior to this project.
  • De Novo Assembly

    De Novo Assembly

    de novo assembly Rayan Chikhi CNRS Workshop on Genomics - Cesky Krumlov January 2016 1 YOUR INSTRUCTOR IS.. - Junior CNRS researcher in Lille, France - Postdoc at Penn State, PhD at ENS Rennes, France - CompSci background Research: - Software and methods for de novo assembly: I Minia I KmerGenie I Falcon2Fastg - Collab. on large-genomes assembly projects @RayanChikhi on Twitter http://rayan.chikhi.name 2 QUESTIONS TO THE AUDIENCE - Already have data to assemble? - Plans to sequence de novo? - RNA-Seq? - PacBio? 3 COURSE STRUCTURE - Short intro - Basic definitions - Fundamentals: why assemblies are as they are - Metrics: methods for evaluation - RNA-Seq: how Trinity works - In practice: best practices ; multi-k ; visualization 4 5 What’s an assembly and how to generate one ... 6 Source: 8 Ted Talks That Teach Public Speaking (SNI) 7 THE "WHY" - Create reference genome / transcriptome - Gene content - Novel insertions - Un-mapped reads - SNPs in non-model organisms - Find SV’s (Evan’s talk) - Specific regions of interest - Metagenomics - .. 8 "WHAT" AND "HOW" BASED ON "WHY" Scenario 1: What the best possible assembly of bacteria X How high-coverage PacBio data Why Obtain a reference geome Scenario 2: What a meh-looking draft assembly of organism X How couple of Illumina lanes Why Gene content and possible viral insertions 9 ASSEMBLY: A SOLVED PROBLEM? Still a difficult problem in 2016. 1. PacBio methods are still preliminary 2. Hard to obtain good assemblies from Illumina data Conclusions of the GAGE benchmark : in terms of assembly quality, there is no single best assembler 3. High computational requirements State of the research 1.
  • Metaspades: a New Versatile Metagenomics Assembler

    Metaspades: a New Versatile Metagenomics Assembler

    metaSPAdes: a new versatile metagenomics assembler Sergey Nurk1,*,**, Dmitry Meleshko1,*, Anton Korobeynikov1,2 and Pavel A Pevzner1,3 1Center for Algorithmic Biotechnology, Institute for Translational Biomedicine, St. Petersburg State University, St. Petersburg, Russia 2Department of Statistical Modelling, St. Petersburg State University, St. Petersburg, Russia 3Department of Computer Science and Engineering, University of California, San Diego, USA *These authors contributed equally to this work **corresponding author, [email protected] Abstract While metagenomics has emerged as a technology of choice for analyzing bacterial populations, as- sembly of metagenomic data remains challenging thus stifling biological discoveries. Moreover, re- cent studies revealed that complex bacterial populations may be composed from dozens of related strains thus further amplifying the challenge metagenomics assembly. metaSPAdes addresses various challenges of metagenomics assembly by capitalizing on computational ideas that proved to be useful in assemblies of single cells and highly polymorphic diploid genomes. We benchmark metaSPAdes against other state-of-the-art metagenome assemblers and demonstrate that it results in high-quality assemblies across diverse datasets. Introduction Metagenome sequencing has emerged as a technology of choice for analyzing bacterial popula- tions and discovery of novel organisms and genes (Venter et al. 2004; Tyson et al. 2004; Yooseph et al. 2007; Arumugam et al. 2011). In one of the early metagenomics studies, Venter et al. (2004) at- tempted to assemble the complex Sargasso Sea microbial community but, as the paper stated, failed. On the other side of the spectrum of metagenomics studies, Tyson et al. (2004) succeeded in assem- bling a simple metagenomic community from a biofilm consisting of a few species.
  • Evaluation of Genome Assembly Software Based on Long Reads

    Evaluation of Genome Assembly Software Based on Long Reads

    Evaluation of genome assembly software based on long reads Laurent Bouri1,*, Dominique Lavenier2, Jean-Franc¸ois Gibrat3, and Victoria Dominguez del Angel4 1CNRS Engineer/ IFB 2CNRS Research Director, GenScale team leader 3INRA Research Director/ IFB 4ELIXIR Training Coordinator (FRANCE)/ IFB ABSTRACT During the last 30 years, Genomics has been revolutionized by the development of first- and second-generation sequencing (SGS) technologies, enabling the completion of many remarkable projects as the Human Genome Project1,2 , the 1000 Genomes Project3 and the Human Microbiome Project4. In the last decade, SGS technologies based on massive parallel sequencing have dominated the market, thanks to their ability to produce enormous volumes of data cheaply. However, often genes and regions of interest are not completely or accurately assembled, complicating analyses or requiring additional cloning efforts for obtaining the correct sequences5. The fundamental obstacle in SGS technologies for obtaining high quality genome assembly is the existence of repetitions in the sequences. A promising solution to this issue is the advent of Third-generation sequencing (TGS) technologies based on long read sequencing6. TGS technologies have been used to produce highly accurate de novo assemblies of hundreds of microbial genomes7,8, and highly contiguous reconstructions of many dozens of plant and animal genomes, enabling new insights into evolution and sequence diversity9,10. They have also been applied to resequencing analyses, to create detailed maps of structural variations in many species11. Also, these new technologies have been used to fill in many of the gaps in the human reference genome12. In this report, we compare and evaluate several genome assembly software based on TSG technology.
  • A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing

    A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing

    JOURNAL OF COMPUTATIONAL BIOLOGY Volume 19, Number 5, 2012 Original Articles # Mary Ann Liebert, Inc. Pp. 455–477 DOI: 10.1089/cmb.2012.0021 SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing ANTON BANKEVICH,1,2 SERGEY NURK,1,2 DMITRY ANTIPOV,1 ALEXEY A. GUREVICH,1 MIKHAIL DVORKIN,1 ALEXANDER S. KULIKOV,1,3 VALERY M. LESIN,1 SERGEY I. NIKOLENKO,1,3 SON PHAM,4 ANDREY D. PRJIBELSKI,1 ALEXEY V. PYSHKIN,1 ALEXANDER V. SIROTKIN,1 NIKOLAY VYAHHI,1 GLENN TESLER,5 MAX A. ALEKSEYEV,1,6 and PAVEL A. PEVZNER1,4 ABSTRACT The lion’s share of bacteria in various environments cannot be cloned in the laboratory and thus cannot be sequenced using existing technologies. A major goal of single-cell genomics is to complement gene-centric metagenomic data with whole-genome assemblies of unculti- vated organisms. Assembly of single-cell data is challenging because of highly non-uniform read coverage as well as elevated levels of sequencing errors and chimeric reads. We de- scribe SPAdes, a new assembler for both single-cell and standard (multicell) assembly, and demonstrate that it improves on the recently released E + V - SC assembler (specialized for single-cell data) and on popular assemblers Velvet and SoapDeNovo (for multicell data). SPAdes generates single-cell assemblies, providing information about genomes of un- cultivatable bacteria that vastly exceeds what may be obtained via traditional metagenomics studies. SPAdes is available online (http://bioinf.spbau.ru/spades). It is distributed as open source software. Key words: assembly, de Bruijn graph, single cell, sequencing, bacteria 1.
  • Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing

    Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing

    G C A T T A C G G C A T genes Article Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing Hyun-Oh Lee 1,2,†, Ji-Weon Choi 3,†, Jeong-Ho Baek 4, Jae-Hyeon Oh 5 ID , Sang-Choon Lee 1 and Chang-Kug Kim 5,* ID 1 Phyzen Genomics Institute, Seongnam 13558, Korea; [email protected] (H.-O.L.); [email protected] (S.-C.L.) 2 Department of Plant Science, Seoul National University, Seoul 08826, Korea 3 Postharvest Technology Division, National Institute of Horticultural and Herbal Science, Wanju 55365, Korea; [email protected] 4 Gene Engineering Division, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Korea; fi[email protected] 5 Genomics Division, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-63-238-4555 † These authors contributed equally to this work. Received: 28 June 2018; Accepted: 25 July 2018; Published: 30 July 2018 Abstract: Platycodon grandiflorus (balloon flower) and Codonopsis lanceolata (bonnet bellflower) are important herbs used in Asian traditional medicine, and both belong to the botanical family Campanulaceae. In this study, we designed and implemented a de novo DNA sequencing and assembly strategy to map the complete mitochondrial genomes of the first two members of the Campanulaceae using low-coverage Illumina DNA sequencing data. We produced a total of 28.9 Gb of paired-end sequencing data from the genomic DNA of P. grandiflorus (20.9 Gb) and C. lanceolata (8.0 Gb). The assembled mitochondrial genome of P.
  • An Adjunctive Therapy Administered with an Antibiotic Prevents

    An Adjunctive Therapy Administered with an Antibiotic Prevents

    RESEARCH ARTICLE An adjunctive therapy administered with an antibiotic prevents enrichment of antibiotic-resistant clones of a colonizing opportunistic pathogen Valerie J Morley1*, Clare L Kinnear2, Derek G Sim1, Samantha N Olson1, Lindsey M Jackson1, Elsa Hansen1, Grace A Usher3, Scott A Showalter3,4, Manjunath P Pai5, Robert J Woods2, Andrew F Read1,6,7 1Center for Infectious Disease Dynamics, Department of Biology, The Pennsylvania State University, University Park, United States; 2Division of Infectious Diseases, Department of Internal Medicine, University of Michigan, Ann Arbor, United States; 3Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, United States; 4Department of Chemistry, The Pennsylvania State University, University Park, United States; 5Department of Clinical Pharmacy, College of Pharmacy, University of Michigan, Ann Arbor, United States; 6Huck Institutes for the Life Sciences, The Pennsylvania State University, University Park, United States; 7Department of Entomology, The Pennsylvania State University, University Park, United States Abstract A key challenge in antibiotic stewardship is figuring out how to use antibiotics therapeutically without promoting the evolution of antibiotic resistance. Here, we demonstrate proof of concept for an adjunctive therapy that allows intravenous antibiotic treatment without driving the evolution and onward transmission of resistance. We repurposed the FDA-approved bile acid sequestrant cholestyramine, which we show binds the antibiotic daptomycin, as an ‘anti- *For correspondence: antibiotic’ to disable systemically-administered daptomycin reaching the gut. We hypothesized that [email protected] adjunctive cholestyramine could enable therapeutic daptomycin treatment in the bloodstream, Competing interests: The while preventing transmissible resistance emergence in opportunistic pathogens colonizing the authors declare that no gastrointestinal tract.