DOCSLIB.ORG

Spades: a New Genome Assembler for Single-Cell Sequencing

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Spades: a New Genome Assembler for Single-Cell Sequencing Problem setting and preparing data The SPAdes approach SPAdes: a New Genome Assembler for Single-Cell Sequencing Algorithmic Biology Lab St. Petersburg Academic University A. Bankevich, S. Nurk, D. Antipov, A.A. Gurevich, M. Dvorkin, A. Korobeynikov, A.S. Kulikov, V.M. Lesin, S.I. Nikolenko, S. Pham, A.D. Prjibelski, A.V. Pyshkin, A.V. Sirotkin, N. Vyahhi, G. Tesler, M.A. Alekseyev, P.A. Pevzner August 27, 2012 Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Outline 1 Problem setting and preparing data Assembly: problem and pipeline Error correction: BayesHammer 2 The SPAdes approach De Bruijn graphs, mate-pairs, and simplification Paired de Bruijn graphs and repeats Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Single-cell sequencing Recent years have seen the advent of single-cell sequencing as a way to sequence genomes that we previously couldn’t. It turns out that many bacteria (“dark matter of life”) cannot be sequenced by standard techniques, most often because they cannot be cloned millions of times to get large DNA samples needed for regular sequencing. This is usually due to the fact that these bacteria come in metagenomic samples (ocean samples, microbiomes of larger organisms etc.) and cannot be cultivated alone. For now, metagenomic analysis can yield more or less only individual genes. Single-cell sequencing can get reasonable sequencing coverage by amplifying a single cell (more on that later). Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Single-cell sequencing Important examples: [Woyke et al., 2009, 2010]: marine cells sequencing from metagenomic ocean samples; [Dalerba et al., 2011]: studying tumor heterogeneity; [Islam et al., 2011]: characterizing single cell transcriptome; [Xu et al., 2012; Hou et al., 2012]: single-cell sequencing of tumor cells; [Yoon et al., 2011]: sequencing bacteria from the human microbiome; [Chitsaz et al., 2011]: assembling single-cell sequencing data from marine samples. So how does single-cell sequencing work and why do we need new assemblers for it? Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer The assembly problem First, let us go back to the general assembly problem. We have a long DNA sequence but cannot read it directly. Instead, we can perform sequencing, getting many random small pieces of the DNA (reads). For popular sequencing technologies, reads are usually L ≈ 35-400bp long. The assembly problem is to reconstruct the original sequence from the set of reads. Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer The assembly problem In many sequencing methods, we read ≈ L nucleotides from both ends of a longer DNA fragment. This leads to paired-end reads (read pairs): two reads for which we know the distance between them [Chaisson et al., 2009]. left read genome right read read length read length gap distance insert size Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer MDA technology Recent single-cell sequencing projects use the MDA technology [Dean et al., 2001; 2002]: Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer MDA technology However, MDA has a number of problems that seriously complicate assembly. First and foremost, non-uniform coverage: Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer MDA technology This means that a coverage threshold (often used in conventional assemblers) would throw a lot of the genome away: Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer MDA technology The insert size distribution is also not nearly as nice: Finally, there are simply more errors, including lots of chimeric connections. Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer MDA technology Computational problems of MDA: 1 highly non-uniform coverage; 2 noisier, more complicated insert size distribution; 3 more chimeric connections (sometimes with large coverage); 4 more frequent errors. First single-cell assembler: E+V-SC (Euler+Velvet-Single-Cell assembler) [Chitsaz et al., 2011]; captured 25% more genes than “regular” assemblers on single-cell data. Meet SPAdes – a new assembler specifically designed for the single-cell case. Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Assembly pipeline Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer BayesHammer Basic idea: break reads into k-mers and study the set of k-mers. ACGTGTGATGCATGATCG ACGTGTGATGC CGTGTGATGCA GTGTGATGCAT TGTGATGCATG GTGATGCATGA TGATGCATGAT GATGCATGATC ATGCATGATCG k-mers are the basic building block in modern assemblers (de Bruijn graph). However, de Bruijn graphs are not directly applicable because of errors in reads. Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer BayesHammer The first step in assembly is to fix as many errors as we can. If we know what k-mers are correct and how to correct others, it’s easy to correct reads. original read ACGTGTGATGCATGATCG ACGTGTGATGCATGATCG ACGTGTGATGC ACGTGTGATGC CGTGTGATGCA correction CGTGAGATGCA GTGTGATGCAT correction GTGAGATGCAT TGTGATGCATG TGTGATGCATG solid k-mers GTGATGCATGA GTGATGCATGA TGATGCATGAT correction AGATGCATGAT GATGCATGATC GATGCATGATC ATGCATGATCG ATGCATGATCG ACGTGAGATGCATGATCG corrected read Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer BayesHammer In regular (multi-cell) error correction, we can look at how many copies of a k-mer there are and assume that rare k-mers represent errors. In single-cell datasets, this idea fails due to non-uniform coverage. 104 102 100 0 1;000 2;000 3;000 4;000 KBases Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer BayesHammer Basic idea: a k-mer is covered many times (even if non-uniformly). Thus, if we look at the set of similar k-mers we can find out what to do because nucleotides of the central k-mer will be better covered than others. Problem: there may be several centers in such a cluster. ATGTGTGATGC ATGTGGGATGC ACGTGGGATGC ACGTGGGATGC ACGTGTGATGC ACGTGGGATGC ACGTGTGATGC ACGTGTGATGC ATGTGTGATGC ATGTGTGATGC ACGTGAGATGC ACGTGTGATAC ACGTGTGATGC ACGTGTGATGC ACGTGGGATGC Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer BayesHammer In Hammer, Medvedev et al. (2011) constructed and roughly clustered the Hamming graph of k-mers; BayesHammer uses probabilistic subclustering to get multiple centers in a cluster. Reads k-mers Hamming graph ACGTGTG ACGTG ACATG CGTGT GTGTG ACCTG ACATGTG ACATG ACGTG CGTGT CATGT CATGT ATGTG ATGTG CCTGT ACCTGTC ACCTG CCTGT GTGTG CTGTC CTGTC As a result, BayesHammer corrects single-cell datasets much better than other tools. Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data De Bruijn graphs, mate-pairs, and simplification The SPAdes approach Paired de Bruijn graphs and repeats Outline 1 Problem setting and preparing data Assembly: problem and pipeline Error correction: BayesHammer 2 The SPAdes approach De Bruijn graphs, mate-pairs, and simplification Paired de Bruijn graphs and repeats Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data De Bruijn graphs, mate-pairs, and simplification The SPAdes approach Paired de Bruijn graphs and repeats De Bruijn graphs When there are relatively few k-mers left, we can begin global processing (the actual assembly). Basic idea: de Bruijn graph [Idury & Waterman, 1995; Pevzner et al., 2001]. Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data De Bruijn graphs, mate-pairs, and simplification The SPAdes approach Paired de Bruijn graphs and repeats De Bruijn graphs Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data De Bruijn graphs, mate-pairs, and simplification The SPAdes approach Paired de Bruijn graphs and repeats De Bruijn graphs Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data De Bruijn graphs, mate-pairs, and simplification The SPAdes approach Paired de Bruijn graphs and repeats De Bruijn graphs Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data De Bruijn graphs, mate-pairs, and simplification The SPAdes approach Paired de Bruijn graphs and repeats De Bruijn graphs Algorithmic Biology
Load more

Recommended publications
  • Methods for De-Novo Genome Assembly
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 28 June 2020 doi:10.20944/preprints202006.0324.v1 Methods for De-novo Genome Assembly Arash Bayat∗1,3, Hasindu Gamaarachchi1, Nandan P Deshpande2, Marc R Wilkins2, and Sri Parameswaran1 1School of Computer Science and Engineering, UNSW, Australia 2Systems Biology Initiative, School of Biotechnology and Biomolecular Sciences, UNSW, Australia 3Health and Biosecurity, CSIRO, Australia June 25, 2020 Abstract Despite advances in algorithms and computational platforms, de-novo genome assembly remains a chal- lenging process. Due to the constant innovation in sequencing technologies (Sanger, SOLiD, Illumina, 454 , PacBio and Oxford Nanopore), genome assembly has evolved to respond to the changes in input data type. This paper includes a broad and comparative review of the most recent short-read, long-read and hybrid assembly techniques. In this review, we provide (1) an algorithmic description of the important processes in the workflow that introduces fundamental concepts and improvements; (2) a review of existing software that explains possible options for genome assembly; and (3) a comparison of the accuracy and the performance of existing methods executed on the same computer using the same processing capabilities and using the same set of real and synthetic datasets. Such evaluation allows a fair and precise comparison of accuracy in all aspects. As a result, this paper identifies both the strengths and weaknesses of each method. This com- parative review is unique in providing a detailed comparison of a broad spectrum of cutting-edge algorithms and methods. Availability: https://arashbayat.github.io/asm ∗To whom correspondence should be addressed. Email: [email protected] 1 © 2020 by the author(s).
    [Show full text]
  • A Galaxy-Based Virus Genome Assembly Pipeline A
    The Pennsylvania State University The Graduate School VIRAMP: A GALAXY-BASED VIRUS GENOME ASSEMBLY PIPELINE A Thesis in Integrative Biosciences by Yinan Wan © 2014 Yinan Wan Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science December 2014 The thesis of Yinan Wan was reviewed and approved* by the following: Istvan Albert Associate Professor, Bioinformatics, Biochemistry and Molecular Biology Thesis Advisor Moriah L. Szpara Assistant Professor of Biochemistry & Molecular Biology Cooduvalli S. Shashikant Associate Professor of Molecular and Development Biology Co-Director, IBIOS Graduate Program Option in Bioinformatics and Genomics Peter Hudson Willaman Professor of Biology Director, Huck Institutes of the Life Sciences *Signatures are on file in the Graduate School iii ABSTRACT Background Advances in next generation sequencing make it possible to obtain high-coverage sequence data for large numbers of viral strains in a short time. However, since most bioinformatics tools are developed for command line use, the selection and accessibility of computational tools for genome assembly and variation analysis limits the ability of individual scientist to perform further bioinformatics analysis. Findings We have developed a multi-step viral genome assembly pipeline named VirAmp that combines existing tools and techniques and presents them to end users via a web-enabled Galaxy interface. Our pipeline allows users to assemble, analyze and interpret high coverage viral sequencing data with an ease and efficiency that previously was not feasible. Our software makes a large number of genome assembly and related tools available to life scientists and automates the currently recommended best practices into a single, easy to use interface.
    [Show full text]
  • Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates
    microorganisms Article Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates Pamela Afouda 1,2, Grégory Dubourg 1,2, Anthony Levasseur 1,2, Pierre-Edouard Fournier 2,3 , Jeremy Delerce 1, Oleg Mediannikov 1 , Seydina M. Diene 1,2 , Daniel Nahon 4, Didier Bourlès 4, Jean-Marc Rolain 1,2 and Didier Raoult 1,2,* 1 Aix Marseille Université, IRD, AP-HM, MEPHI, 13005 Marseille, France; [email protected] (P.A.); [email protected] (G.D.); [email protected] (A.L.); [email protected] (J.D.); [email protected] (O.M.); [email protected] (S.M.D.); [email protected] (J.-M.R.) 2 IHU Méditerranée Infection, 13005 Marseille, France; [email protected] 3 UMR VITROME, SSA, Aix-Marseille Université, IRD, AP-HM, IHU-Méditerranée-Infection, 13005 Marseille, France 4 Aix-Marseille University, CNRS, IRD, INRAE, Coll France, UM 34 CEREGE, Technopôle de l’Environnement Arbois-Méditerranée, BP80, 13545 Aix-en-Provence, France; [email protected] (D.N.); [email protected] (D.B.) * Correspondence: [email protected]; Tel.: +33-413-732-401; Fax: +33-413-732-402 Received: 29 March 2020; Accepted: 1 October 2020; Published: 3 October 2020 Abstract: Long considered to be a consequence of human antibiotics use by deduction, antibiotic resistance mechanisms appear to be in fact a much older phenomenon as antibiotic resistance genes have previously been detected from millions of year-old permafrost samples. As these specimens guarantee the viability of archaic bacteria, we herein propose to apply the culturomics approach to recover the bacterial content of a Siberian permafrost sample dated, using the in situ-produced cosmogenic nuclide chlorine36 (36Cl), at 2.7 million years to study the dynamics of bacterial evolution in an evolutionary perspective.
    [Show full text]
  • A New Versatile Metagenomic Assembler (Supplementary Material)
    metaSPAdes: a new versatile metagenomic assembler (Supplementary Material) Sergey Nurk1,*,**, Dmitry Meleshko1,*, Anton Korobeynikov1,2 and Pavel A Pevzner1,3 1Center for Algorithmic Biotechnology, Institute for Translational Biomedicine, St. Petersburg State University, St. Petersburg, Russia 2Department of Statistical Modelling, St. Petersburg State University, St. Petersburg, Russia 3Department of Computer Science and Engineering, University of California, San Diego, USA *These authors contributed equally to this work **corresponding author, [email protected] Data preprocessing 2 Modifying the decision rule in exSPAnder for metagenomic data 3 Reducing running time and memory footprint of metaSPAdes 4 Bulge projection approach 6 Nx statistics 7 Analysis of the SYNTH dataset 8 CAMI datasets 10 Analysis of the CAMI datasets 14 BenchmarKing SPAdes against metaSPAdes 17 Effect of novel algorithmic approaches in metaSPAdes on assembly quality 21 Analysis of the HMP dataset 25 References 27 1 Supplemental Material: Data preprocessing The SYNTH, HMP, MARINE, and SOIL datasets were pre-processed to remove adaptors and trim low- quality segments of the reads. We used cutadapt software v 1.9.1 (Martin 2011), trimming bases with PHRED quality < 20 from 3’ end (parameter -q 20). Adaptor sequences were identified for each dataset individually, using FastQC v0.11.3 and manual reads inspection: SYNTH: -q 20 -a GAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT HMP: -q 20 -a AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
    [Show full text]
  • Computational Protocol for Assembly and Analysis of SARS-Ncov-2 Genomes
    PROTOCOL Computational Protocol for Assembly and Analysis of SARS-nCoV-2 Genomes Mukta Poojary1,2, Anantharaman Shantaraman1, Bani Jolly1,2 and Vinod Scaria1,2 1CSIR Institute of Genomics and Integrative Biology, Mathura Road, Delhi 2Academy of Scientific and Innovative Research (AcSIR) *Corresponding email: MP [email protected]; AS [email protected]; BJ [email protected]; VS [email protected] ABSTRACT SARS-CoV-2, the pathogen responsible for the ongoing Coronavirus Disease 2019 pandemic is a novel human-infecting strain of Betacoronavirus. The outbreak that initially emerged in Wuhan, China, rapidly spread to several countries at an alarming rate leading to severe global socio-economic disruption and thus overloading the healthcare systems. Owing to the high rate of infection of the virus, as well as the absence of vaccines or antivirals, there is a lack of robust mechanisms to control the outbreak and contain its transmission. Rapid advancement and plummeting costs of high throughput sequencing technologies has enabled sequencing of the virus in several affected individuals globally. Deciphering the viral genome has the potential to help understand the epidemiology of the disease as well as aid in the development of robust diagnostics, novel treatments and prevention strategies. Towards this effort, we have compiled a comprehensive protocol for analysis and interpretation of the sequencing data of SARS-CoV-2 using easy-to-use open source utilities. In this protocol, we have incorporated strategies to assemble the genome of SARS-CoV-2 using two approaches: reference-guided and de novo. Strategies to understand the diversity of the local strain as compared to other global strains have also been described in this protocol.
    [Show full text]
  • Sequencing and Comparative Analysis of <I>De Novo</I> Genome
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Dissertations and Theses in Biological Sciences Biological Sciences, School of 7-2016 Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762 Julien S. Gradnigo University of Nebraska - Lincoln, [email protected] Follow this and additional works at: http://digitalcommons.unl.edu/bioscidiss Part of the Bacteriology Commons, Bioinformatics Commons, and the Genomics Commons Gradnigo, Julien S., "Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762" (2016). Dissertations and Theses in Biological Sciences. 88. http://digitalcommons.unl.edu/bioscidiss/88 This Article is brought to you for free and open access by the Biological Sciences, School of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Dissertations and Theses in Biological Sciences by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 by Julien S. Gradnigo A THESIS Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Master of Science Major: Biological Sciences Under the Supervision of Professor Etsuko Moriyama Lincoln, Nebraska July, 2016 SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 Julien S. Gradnigo, M.S. University of Nebraska, 2016 Advisor: Etsuko Moriyama Streptomyces aureofaciens is a Gram-positive Actinomycete used for commercial antibiotic production. Although it has been the subject of many biochemical studies, no public genome resource was available prior to this project.
    [Show full text]
  • De Novo Assembly
    de novo assembly Rayan Chikhi CNRS Workshop on Genomics - Cesky Krumlov January 2016 1 YOUR INSTRUCTOR IS.. - Junior CNRS researcher in Lille, France - Postdoc at Penn State, PhD at ENS Rennes, France - CompSci background Research: - Software and methods for de novo assembly: I Minia I KmerGenie I Falcon2Fastg - Collab. on large-genomes assembly projects @RayanChikhi on Twitter http://rayan.chikhi.name 2 QUESTIONS TO THE AUDIENCE - Already have data to assemble? - Plans to sequence de novo? - RNA-Seq? - PacBio? 3 COURSE STRUCTURE - Short intro - Basic definitions - Fundamentals: why assemblies are as they are - Metrics: methods for evaluation - RNA-Seq: how Trinity works - In practice: best practices ; multi-k ; visualization 4 5 What’s an assembly and how to generate one ... 6 Source: 8 Ted Talks That Teach Public Speaking (SNI) 7 THE "WHY" - Create reference genome / transcriptome - Gene content - Novel insertions - Un-mapped reads - SNPs in non-model organisms - Find SV’s (Evan’s talk) - Specific regions of interest - Metagenomics - .. 8 "WHAT" AND "HOW" BASED ON "WHY" Scenario 1: What the best possible assembly of bacteria X How high-coverage PacBio data Why Obtain a reference geome Scenario 2: What a meh-looking draft assembly of organism X How couple of Illumina lanes Why Gene content and possible viral insertions 9 ASSEMBLY: A SOLVED PROBLEM? Still a difficult problem in 2016. 1. PacBio methods are still preliminary 2. Hard to obtain good assemblies from Illumina data Conclusions of the GAGE benchmark : in terms of assembly quality, there is no single best assembler 3. High computational requirements State of the research 1.
    [Show full text]
  • Metaspades: a New Versatile Metagenomics Assembler
    metaSPAdes: a new versatile metagenomics assembler Sergey Nurk1,*,**, Dmitry Meleshko1,*, Anton Korobeynikov1,2 and Pavel A Pevzner1,3 1Center for Algorithmic Biotechnology, Institute for Translational Biomedicine, St. Petersburg State University, St. Petersburg, Russia 2Department of Statistical Modelling, St. Petersburg State University, St. Petersburg, Russia 3Department of Computer Science and Engineering, University of California, San Diego, USA *These authors contributed equally to this work **corresponding author, [email protected] Abstract While metagenomics has emerged as a technology of choice for analyzing bacterial populations, as- sembly of metagenomic data remains challenging thus stifling biological discoveries. Moreover, re- cent studies revealed that complex bacterial populations may be composed from dozens of related strains thus further amplifying the challenge metagenomics assembly. metaSPAdes addresses various challenges of metagenomics assembly by capitalizing on computational ideas that proved to be useful in assemblies of single cells and highly polymorphic diploid genomes. We benchmark metaSPAdes against other state-of-the-art metagenome assemblers and demonstrate that it results in high-quality assemblies across diverse datasets. Introduction Metagenome sequencing has emerged as a technology of choice for analyzing bacterial popula- tions and discovery of novel organisms and genes (Venter et al. 2004; Tyson et al. 2004; Yooseph et al. 2007; Arumugam et al. 2011). In one of the early metagenomics studies, Venter et al. (2004) at- tempted to assemble the complex Sargasso Sea microbial community but, as the paper stated, failed. On the other side of the spectrum of metagenomics studies, Tyson et al. (2004) succeeded in assem- bling a simple metagenomic community from a biofilm consisting of a few species.
    [Show full text]
  • Evaluation of Genome Assembly Software Based on Long Reads
    Evaluation of genome assembly software based on long reads Laurent Bouri1,*, Dominique Lavenier2, Jean-Franc¸ois Gibrat3, and Victoria Dominguez del Angel4 1CNRS Engineer/ IFB 2CNRS Research Director, GenScale team leader 3INRA Research Director/ IFB 4ELIXIR Training Coordinator (FRANCE)/ IFB ABSTRACT During the last 30 years, Genomics has been revolutionized by the development of first- and second-generation sequencing (SGS) technologies, enabling the completion of many remarkable projects as the Human Genome Project1,2 , the 1000 Genomes Project3 and the Human Microbiome Project4. In the last decade, SGS technologies based on massive parallel sequencing have dominated the market, thanks to their ability to produce enormous volumes of data cheaply. However, often genes and regions of interest are not completely or accurately assembled, complicating analyses or requiring additional cloning efforts for obtaining the correct sequences5. The fundamental obstacle in SGS technologies for obtaining high quality genome assembly is the existence of repetitions in the sequences. A promising solution to this issue is the advent of Third-generation sequencing (TGS) technologies based on long read sequencing6. TGS technologies have been used to produce highly accurate de novo assemblies of hundreds of microbial genomes7,8, and highly contiguous reconstructions of many dozens of plant and animal genomes, enabling new insights into evolution and sequence diversity9,10. They have also been applied to resequencing analyses, to create detailed maps of structural variations in many species11. Also, these new technologies have been used to fill in many of the gaps in the human reference genome12. In this report, we compare and evaluate several genome assembly software based on TSG technology.
    [Show full text]
  • A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing
    JOURNAL OF COMPUTATIONAL BIOLOGY Volume 19, Number 5, 2012 Original Articles # Mary Ann Liebert, Inc. Pp. 455–477 DOI: 10.1089/cmb.2012.0021 SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing ANTON BANKEVICH,1,2 SERGEY NURK,1,2 DMITRY ANTIPOV,1 ALEXEY A. GUREVICH,1 MIKHAIL DVORKIN,1 ALEXANDER S. KULIKOV,1,3 VALERY M. LESIN,1 SERGEY I. NIKOLENKO,1,3 SON PHAM,4 ANDREY D. PRJIBELSKI,1 ALEXEY V. PYSHKIN,1 ALEXANDER V. SIROTKIN,1 NIKOLAY VYAHHI,1 GLENN TESLER,5 MAX A. ALEKSEYEV,1,6 and PAVEL A. PEVZNER1,4 ABSTRACT The lion’s share of bacteria in various environments cannot be cloned in the laboratory and thus cannot be sequenced using existing technologies. A major goal of single-cell genomics is to complement gene-centric metagenomic data with whole-genome assemblies of unculti- vated organisms. Assembly of single-cell data is challenging because of highly non-uniform read coverage as well as elevated levels of sequencing errors and chimeric reads. We de- scribe SPAdes, a new assembler for both single-cell and standard (multicell) assembly, and demonstrate that it improves on the recently released E + V - SC assembler (specialized for single-cell data) and on popular assemblers Velvet and SoapDeNovo (for multicell data). SPAdes generates single-cell assemblies, providing information about genomes of un- cultivatable bacteria that vastly exceeds what may be obtained via traditional metagenomics studies. SPAdes is available online (http://bioinf.spbau.ru/spades). It is distributed as open source software. Key words: assembly, de Bruijn graph, single cell, sequencing, bacteria 1.
    [Show full text]
  • Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing
    G C A T T A C G G C A T genes Article Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing Hyun-Oh Lee 1,2,†, Ji-Weon Choi 3,†, Jeong-Ho Baek 4, Jae-Hyeon Oh 5 ID , Sang-Choon Lee 1 and Chang-Kug Kim 5,* ID 1 Phyzen Genomics Institute, Seongnam 13558, Korea; [email protected] (H.-O.L.); [email protected] (S.-C.L.) 2 Department of Plant Science, Seoul National University, Seoul 08826, Korea 3 Postharvest Technology Division, National Institute of Horticultural and Herbal Science, Wanju 55365, Korea; [email protected] 4 Gene Engineering Division, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Korea; fi[email protected] 5 Genomics Division, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-63-238-4555 † These authors contributed equally to this work. Received: 28 June 2018; Accepted: 25 July 2018; Published: 30 July 2018 Abstract: Platycodon grandiflorus (balloon flower) and Codonopsis lanceolata (bonnet bellflower) are important herbs used in Asian traditional medicine, and both belong to the botanical family Campanulaceae. In this study, we designed and implemented a de novo DNA sequencing and assembly strategy to map the complete mitochondrial genomes of the first two members of the Campanulaceae using low-coverage Illumina DNA sequencing data. We produced a total of 28.9 Gb of paired-end sequencing data from the genomic DNA of P. grandiflorus (20.9 Gb) and C. lanceolata (8.0 Gb). The assembled mitochondrial genome of P.
    [Show full text]
  • An Adjunctive Therapy Administered with an Antibiotic Prevents
    RESEARCH ARTICLE An adjunctive therapy administered with an antibiotic prevents enrichment of antibiotic-resistant clones of a colonizing opportunistic pathogen Valerie J Morley1*, Clare L Kinnear2, Derek G Sim1, Samantha N Olson1, Lindsey M Jackson1, Elsa Hansen1, Grace A Usher3, Scott A Showalter3,4, Manjunath P Pai5, Robert J Woods2, Andrew F Read1,6,7 1Center for Infectious Disease Dynamics, Department of Biology, The Pennsylvania State University, University Park, United States; 2Division of Infectious Diseases, Department of Internal Medicine, University of Michigan, Ann Arbor, United States; 3Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, United States; 4Department of Chemistry, The Pennsylvania State University, University Park, United States; 5Department of Clinical Pharmacy, College of Pharmacy, University of Michigan, Ann Arbor, United States; 6Huck Institutes for the Life Sciences, The Pennsylvania State University, University Park, United States; 7Department of Entomology, The Pennsylvania State University, University Park, United States Abstract A key challenge in antibiotic stewardship is figuring out how to use antibiotics therapeutically without promoting the evolution of antibiotic resistance. Here, we demonstrate proof of concept for an adjunctive therapy that allows intravenous antibiotic treatment without driving the evolution and onward transmission of resistance. We repurposed the FDA-approved bile acid sequestrant cholestyramine, which we show binds the antibiotic daptomycin, as an ‘anti- *For correspondence: antibiotic’ to disable systemically-administered daptomycin reaching the gut. We hypothesized that [email protected] adjunctive cholestyramine could enable therapeutic daptomycin treatment in the bloodstream, Competing interests: The while preventing transmissible resistance emergence in opportunistic pathogens colonizing the authors declare that no gastrointestinal tract.
    [Show full text]