ESTROGEN AND GLUCOCORTICOID RECEPTOR INTERACTIONS ON ASPECTS OF
EARLY DEVELOPMENT OF RAINBOW TROUT
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
by
JACQUELINE FERRIS
In partial fulfillment of requirements
for the degree of
Master of Science
June, 2011 Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington OttawaONK1A0N4 OttawaONK1A0N4 Canada Canada
Your file Votre reference ISBN: 978-0-494-82806-9 Our file Notre reference ISBN: 978-0-494-82806-9
NOTICE: AVIS:
The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Nnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantias de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.
1*1 Canada © Jacqueline Ferris, 2011
ABSTRACT
ESTROGEN AND GLUCOCORTICOID RECEPTOR INTERACTIONS ON ASPECTS OF EARLY DEVELOPMENT OF RAINBOW TROUT
Jacqueline Ferris Advisor: University of Guelph, 2011 Dr. J. F. Leatherland
This thesis is an investigation of the interactions between the estrogen (ER) and glucocorticoid (GR) receptors. The study examined the effects of in ovo exposure of rainbow trout to GR and ER agonists (Cortisol and Bisphenol A [BPA], respectively) and antagonists (RU-486 and ICI 182,780, respectively) in various chemical combinations on mRNA transcription of ERa, ERfi, GR1 and GR2. BPA did not affect mRNA transcription of ERa or ERfi, and exhibited differential effects on GR1 and GR2, depending on the time point at which gene transcription was analyzed. The antiestrogen ICI 182,780 did not act as a pure antiestrogen, but acted differentially on ERa and ERfi. Histological analysis revealed co-administration of
Cortisol and BPA in ovo caused marked effects on notochord development indicated by an absence of the chordoblast layer. In ovo exposure to toxicants can affect early epigenetic mechanisms, possibly leading to deformity and/or death of a developing rainbow trout embryo. ACKNOWLEDGEMENTS
This thesis would not have been possible without the support I received from all those involved in this process. I would like to show my gratitude to my supervisor Dr. John Leatherland whose insights and expertise has helped me greatly in forming and strengthening this thesis. I am honoured to have been able to learn from him and truly acknowledge the valuable experience I have gained through this opportunity. I am grateful to my advisory committee, Dr. Allan King, Richard Moccia, and Dr. Jim Petrik, who have provided support and guidance throughout my graduate work. I owe my sincere gratitude to Mao Li, who has aided me in all aspects of my research. He has made his support available in a number of ways including experimental design, technical processes, and the many questions he helped me address through all phases of my work. I would like to thank Lucy Lin, Helen Coates, Jing Zhang, and Jeff Gross for their technical assistance and without whom my work would not have been possible. I gratefully acknowledge the staff at the Alma Aquaculture Research Station, Michael Burke and his team who were of great assistance in the preparation, sampling, and care of embryos. I would like to also acknowledge Michael Burke for the work he has done with data collection and fertility and mortality rate calculations. Our lab funding was provided by NSERC (Natural Sciences and Engineering Research Council) and Alma Aquaculture Research Station is funded by OMAF (Ontario Ministry of Agriculture and Food). TABLE OF CONTENTS
ACKNOWLEDGEMENTS i
LIST OF TABLES v
LIST OF FIGURES vi
LIST OF ABBREVIATIONS vii
INTRODUCTION AND REVIEW OF THE LITERATURE 1
1. ER and GR Interactions 3
1.1 Estrogen Receptors 4
1.2 Glucocorticoid Receptors 5
1.3 Links between the ERand GR 7
2. Cortisol and the Stress Axis 10
2.1 HPA/HPI Interaction with the HPG axis 15
2.1.1 Cortisol Interaction with HPG Hormones 16
2.1.2 HPI and Ovarian Disease 18
2.1.3 The Role of Cortisol Secretagogues 20
2.2 Cortisol and the Somatotropic Axis 20
3. Bisphenol A 21
3.1 BPA and Early Development 23
3.2 BPA as an ER agonist 24
4. The Notochord 25
ii 4.1 Dual-segmentation Model 26
4.2 Chordoblasts 27
4.3 Notochord Secretions 28
4.4 Notochord Development 29
5. Cortisol and Vertebral Development 30
5.1 Cortisol and Thyroid Hormone Interactions on Development 31
RATIONALE 31
CHAPTER 1 - EFFECTS OF IN OVO EXPOSURE OF GLUCOCORTICOID (GR) AND ESTROGEN RECEPTOR (ER) AGONISTS AND ANTAGONISTS ON ER and GR GENE EXPRESSION, OOCYTE FERTILIZATION AND EMBRYO MORTALITY 32
Introduction 32
Materials and Methods 33
Animals 33
Basic Experimental Design 33
Treatment Groups 34
Chemicals 36
Mortality and Fertility Rates 36
Quantitative real time RT-PCR 36
Statistical Analysis 39
Results 39
Fertility Rates 39
Mortality Rates 40
BPA does not affect ER gene expression 43 iii BPA exerts differential effects on GR gene expression 43
BPA alters expression pattern of ERs and GRs during embryonic development 43
ICI exerts differential effects on £7? gene expression 44
ICI alters expression pattern of ERs during embryonic development 48
Discussion 48
CHAPTER 2 - EFFECTS OF IN OVO EXPOSURE TO CORTISOL, BISPHENOL A AND THE ANTIESTROGEN ICI 182,780 ON VERTEBRAL MORPHOLOGY 56
Introduction 56
Materials and Methods 57
Animals 57
Basic Experimental Design 57
Treatment Groups 57
Chemicals 57
Histological Methods 57
Results 59
Discussion 63
GENERAL DISCUSSION, CONCLUSIONS AND FUTURE DIRECTIONS FOR STUDY 65
REFERENCES 69
IV LIST OF TABLES
Chapter 1
Table 1.1: Treatment groups and concentrations used in genetic analysis 34
Table 1.2: Treatment groups co-administered with ethanol control (A) or Cortisol (B) and the concentrations used. The values shown are concentrations of the reagents in the ovarian fluid; CL content of the oocytes, as measured by radioimmunoassay were ~3, ~5, and ~7 ng/oocyte for the CC, CI and C2 treatment groups, respectively 35
Table 1.3: Oligonucleotide primers of genes used in qPCR. Included are the annealing temperature (Tm) and amplicon size in base pairs (bp) 39
Table 1.4: Percentage of embryos fertilized for each treatment group co-administered with ethanol control (A) or Cortisol (B) 40
Table 1.5: Cumulative mortality rates of embryos for each treatment group co-administered with ethanol control (A) or Cortisol (B). Mortality rates were calculated prior to eyed stage, prior to hatch, and prior to placement in swim-up tanks (44dpf) 41
Table 1.6: Mortality rates of hatched embryos in swim-up tanks (44-68dpf) for each treatment group co-administered with ethanol control (A) or Cortisol (B) 42
Chapter 2
Table 2.1: Treatment groups used for the study of the vertebral morphology of rainbow trout embryos and early juveniles reared from oocytes that had been subjected to these treatments for 3 h prior to fertilization 58
v LIST OF FIGURES
Introduction and Review of the Literature
Figure 1: The 11 (3-HSD enzymes regulate Cortisol activity by the interconversion of Cortisol and its inactive form, cortisone (recreated from Andersen, 2002) 10
Figure 2: A schematic representation of the stress response pathways involving the central and peripheral nervous systems (CNS and PNS, respectively) 13
Figure 3: A simplified depiction of the signalling cascade of the HPI axis in zebrafish (Alsop &
Vijayan, 2009) 14
Figure 4: Molecular structure of BPA 21
Chapter 1
Figure 1.1: Effect of BPA on ERa (A) and ERfi (B) mRNA transcription 45
Figure 1.2: Effect of in ovo BPA treatment on GR1 (A) and GR2 (B) mRNA transcription 46
Figure 1.3: Effect of in ovo ICI treatment on ERa (A) and ERp (B) mRNA transcription 47
Chapter 2
Figure 2.1: Light micrograph depicting a transverse section through the notochord of an animal of the Cortisol treatment group 60
Figure 2.2: Light micrograph depicting a transverse section through the notochord of animals of the cortisol+BPA (A), and cortisol+BPA+ICI (B) treatment groups 61
Figure 2.3: Light micrograph depicting a transverse section through the notochord of a animals of the control (CC) (A), BPA, (B), BPAml (C), BPAm2 (D), and BPAh (E) treatment groups 62
VI LIST OF ABBREVIATIONS
11P-HSD: 11 P-hydroxysteroid dehydrogenase
ACTH: adrenocorticotropic hormone
AF1/AF2: activation functions 1 and 2
ALP: alkaline phosphatase
AP-1: activator protein-1
AVP: arginine vasopressin bp: base pairs
BPA: the ER agonist, bisphenol A
Ca2+: calcium
CBP: Cortisol binding protein
CC: no reagents in the oocyte incubation medium except for the ethanol solvent (0.1 ug/mL)
C/EBP(3 : CCAAT-enhancer binding protein beta
CL: Cortisol
CNS: central nervous system
COD: cystic ovary disease
CoUal: gene encoding for collagen, type II, alpha 1
CRH: corticotrophin-releasing hormone
Dex: the synthetic glucocorticoid, dexamethasone dpf: days post-fertilization
E2:17P-estradiol
EDC: endocrine disrupting chemical
EE2: 17a-ethinylestradiol
Ehh: echidna hedgehog gene
vii eNOS: endothelial nitrous oxide synthase
ER: estrogen receptor protein
ER: gene coding for the estrogen receptor
ERE: estrogen response element
ERK1/2: extracellular signal-regulated kinase gene
FF: follicular fluid
GH: growth hormone
GH: gene encoding for growth hormone
GHR: growth hormone receptor
GHR: gene encoding for growth hormone receptor
GI: gastrointestinal
GnRH: gonadotropin-releasing hormone
GPCR: G-protein-coupled receptor
GPER/GPR30: G protein-coupled estrogen receptor
GR: glucocorticoid receptor
GR: gene coding for the glucocorticoid receptor
GRE: glucocorticoid response element
GtH: gonadotropin hCG: human chorionic gonadotropin
HP A: hypothalamus-pituitary gland-adrenal cortex
Hpf: hours post fertilization
HPG: hypothalamus-pituitary gland-gonad
HPI: hypothalamus-pituitary gland-interrenal tissue
ICI: the ER antagonist, ICI-182,780
IGF: insulin-like growth factor viii IGF: gene encoding for insulin-like growth factor
IGFIR: insulin-like growth factor type 1 receptor
IL1: interleukin-1
IL6: interleukin-6
LH: luteinizing hormone
LUC: luciferase
MC2R: melanocortin 2 receptor
MCF7: breast cancer cell line
MAPK: mitogen-activated protein kinase mER: membrane bound ER
MetS: metabolic syndrome
MR: mineralocorticoid receptor mGR: membrane-bound GR
MMTV: mouse mammary tumour virus
NH3: ammonia
NOS: nitrous oxide synthase
NF-KB: nuclear factor -KB
PCOS: polycystic ovarian syndrome
PI3-k: PI3-kinase ppt: parts per trillion ptf: prior to fertilization
PVN: paraventricular nucleus
RA: retinoid acid
RNA: ribonucleic acid
RU: the GR antagonist RU 486. ix S-ANS: sympathetic division of the autonomic nervous system
Shh: sonic hedgehog gene
ST: somatotropic axis
T3: triiodothyronine
T4: thyroxine
TH: thyroid hormone
TR: thyroid receptor
77?: gene encoding for the thyroid receptor
x INTRODUCTION AND REVIEW OF THE LITERATURE
Embryonic development of rainbow trout (Oncorynchus mykiss) is a highly complex process that is sensitive to exposure to stressors particularly during early development.
Environmental pollutants such as bisphenol A (BPA) have the potential to cause long-lasting effects on a developing embryo. The mechanism of action in the embryo is currently not well understood; however, because BPA is a well-known xenoestrogen, it is plausible that the detrimental effects of environmental pollutants may be related to modifications to the regulation of the endocrine system.
Important components of the endocrine system include the glucocorticoid (GR) and estrogen receptors (ER), both of which are nuclear receptors and members of the steroid receptor superfamily (Dauvois et al, 1993, Teitsma et al 1998, Teyssier et al, 2001, Lethimonier et al,
2002, Iwamuro et al, 2003, Bilang-Bleuel et al, 2005, Quaedackers et al, 2007) and act as ligand-activated transcription factors (Teyssier et al, 2001, Lethimonier et al, 2002, Quaedackers et al, 2007, Schaaf et al, 2009). They are important mediators of the metabolic, immune and reproductive systems, and are key factors in cell growth and proliferation, as well as overall development (Kinyamu & Archer, 2003). Although the GRs and ERs are known to interact with one another (Kinyamu & Archer, 2003), relatively little is known of the signalling pathways that connect the two.
The hypothalamus-pituitary gland-interrenal tissue (HPI) axis, the homologue of the mammalian hypothalamus-pituitary gland-adrenal cortex (HPA) axis, is critical in the regulation and maintenance of glucocorticoid levels (Aluru & Vijayan, 2009). It is through HPA activation that Cortisol (CL) is released into the circulation in response to homeostasis-disrupting stressors
(Stolte et al, 2008). In teleost fishes, CL, along with various catecholamines, adrenocorticotropic hormone (ACTH), corticotropin-releasing hormone (CRH) and other peptides, is the primary interrenal steroid hormone secreted in response to stressors (Alsop & Vijayan, 2008). During
1 early zebrafish {Danio rerio) development, embryos rely on maternal CL transferred to the egg during gonadal development until around the time of hatch (Alsop & Vijayan, 2008).
Approximately 1 week post-hatch, zebrafish embryos are able to synthesize their own CL, however CL release due to stress via the HPI axis does not normally become activated until 2 weeks post hatch (Alsop & Vijayan, 2008). Rainbow trout (O. mykiss) begin to produce basal
Cortisol at the eyed stage (17dpf), however the functional HPI activity was not detected until 9 days post-hatch (41dpf) (Auperin & Geslin, 2008). Once it is established and functional, the HPI axis is sensitive to stressors during the later stages of embryonic development, and exposure to these stressors at this time may result in long-lasting effects that may permanently alter the normal stress response (Alsop & Vijayan, 2009).
Ovarian fluid is released from the ovary with the eggs and is important for storage of the eggs in the coelomic cavity prior to ejection as well as after ejection (Lahnsteiner et al., 1995).
Salmonid ovarian fluid has been found to contain both organic and inorganic components
(Lahnsteiner et al, 1995, Lahnsteiner, 2000, Finn, 2007). The organic components such as lipids, proteins, steroid hormones, carbohydrates and enzymes, variably contribute to components of yolk synthesis (Lahnsteiner et al, 1995, Bayunova et al, 2011). Inorganic, ionic components play a role in prolonging the fertilization period during spawning, activation and prolonged motility of spermatozoa (Lahnsteiner et al., 1995).
Bisphenol A, a potent endocrine disrupting chemical (EDC), can affect embryonic development, causing genetic and physical aberrations, sometimes resulting in deformity or death. BPA is a known estrogen agonist and has been documented to bind both the
ERa and ERp, though its effects on gene transcription and reproductive effects in the literature varies (Matthews et al. 2001, Kang et al, 2002, Takao et al, 2003, Levy et al, 2004, Lahnsteiner et al, 2005). Interactions are also known to exist between BPA and the thyroid receptor (TR), antagonising triiodothyronine (T3) activity (Iwamuro et al, 2003). Its estrogenic potential as well as its structural similarity to T3 and thyroxine (T4) makes BPA an effective endocrine disruptor. The delicate nature of the developmental processes that are associated with early ontogeny can be altered by exposure of embryos to stressful stimuli, possibly permanently altering the functional capabilities of the organism, leading to changes in physiological phenotype. Therefore, in recent years environmental pollutants such as BPA have been the subject of intense attention regarding their mode of action and the effects that they can have on ecosystems and animals within these ecosystems, including human populations. Nevertheless, there remain significant gaps in our understanding of the molecular actions of these compounds and further increases in knowledge in this area will play a critical role in influencing the establishment of international policies that control the use and disposal of these harmful toxins from the environment.
1. ER and GR Interaction
The ERs and GRs play crucial roles in various physiological processes such as in the metabolic, immunological, developmental, and reproductive systems (Kinyamu & Archer, 2003).
Both ER and GR are nuclear receptors within the steroid receptor superfamily, and are activated when an agonist, or ligand, binds to the receptor forming a complex that will bind to DNA response elements contained within promoter regions of the target genes (Kinyamu & Archer,
2003). The DNA-bound complexes recruit chromatin remodelling complexes, coactivator or corepressor proteins, resulting in the activation or repression of transcription, respectively
(Kinyamu & Archer, 2003).
The primary ligands of the ER and GR, 17p-estradiol (E2) and CL, respectively, often oppose one another when these two receptors are expressed by the same tissues (Kinyamu &
Archer, 2003). Numerous glucocorticoid response elements (GREs) have been discovered on the promoter region of the ER gene, thus it is possible that an activated GR may be able to regulate
ER activity directly by binding to one of the many GREs that exist in its promoter region
(Letimonier et al., 2002). The GR may activate ER directly, thereby increasing ER activation under normal circumstances, and repressing ER activity under stressful circumstances. The 3 following section explores some aspects of the complexity of the interactions between these two types of receptors.
1,1 Estrogen Receptors (ERs)
Estrogen receptor proteins are found in a wide variety of tissues and may play differential roles depending on the cell type to which they belong. Furthermore, it has been proposed that
ERa and ERp regulate cellular pathways that are distinct from one another (reviewed by
Matthews & Gustafsson, 2003). Coexpression of ERa and ERp occurs in a variety of tissues including thyroid, bone, adrenal cortex, epididymis, breast, and various regions of the brain
(Matthews & Gustafsson, 2003). When coexpressed, ERp tends to inhibit gene expression that is mediated by ERa (Matthews & Gustafsson, 2003). In tissues in which only one ER protein is expressed, ERa is primarily expressed in kidney, heart, liver and uterus, and ERp is expressed in prostate, lung, ovary, bladder, gastrointestinal (GI) tract, and the central nervous system (CNS)
(Matthews & Gustafsson, 2003).
Along with other ligand-activated transcription factors, ER has been found to regulate gene expression through various mechanisms (Quaedackers et al, 2007). Described as the classical pathway, E2 activated ER, in the form of a homeodimer can form a direct bond to the estrogen response element (ERE) located in the promoter of target genes (Lethimonier et al,
2002, Berg et al, 2004, Klinge et al, 2004, Quaedackers et al, 2007). Co-regulators are then recruited in order to mediate the transcription of that gene (Quaedackers et al, 2007). The interaction of ERa or ERp with the co-regulators are impacted by the sequence of the ERE
(Klinge, 2004). An alternate pathway of gene expression regulation involves altering transcription factor activity, such as activator protein-1 (AP-1) and nuclear factor (NF)-KB, without directly binding to DNA (Quaedackers et al, 2007).
Like all steroid hormones, ERs can act through non-genomic pathways to influence a wide array of physiological mechanisms. Included in ERs non-genomic effects is vasorelaxation
4 (Otto et ah, 2006, Fan et ah, 2011), intracellular calcium processing that affects bone density and strength (Fan et ah, 2011, van der Eerden et ah, 2002), growth mechanisms (growth plate width, tibial length and body weight gain) (van der Eerden et ah, 2002) and the regulation of vascular smooth muscle and endothelial cell proliferation or apoptosis (Fan et ah, 2011). Rapid, nongenomic signalling by E2 is mediated by networks of proteins, including ER and steroid binding proteins such as the G protein-coupled estrogen receptor (GPER or GPR30) (Cheskis,
2004, Liu & Mauvais-Jarvis, 2009).
Non-genomic effects of ERs have been found to activate signalling pathways involving
ERK1/2 and PI3-kinase (PI3-K), which leads to the activation of endothelial nitrous oxide synthase (eNOS), demonstrating ERs vasorelaxation capability (Otto et ah, 2006, Fan et ah,
2011). The adaptor protein She seems to play an important role in the nongenomic actions of steroid receptors as evidenced by its ability to interact both with the N-terminal of ERa, as well as phosphorylation site of insulin-like growth factor type 1 receptor (IGFIR), allowing the interaction of ERa, She, IGFIR with the cell membrane of MCF7 cells (Song et ah, 2002, 2004).
Xenoestrogens can also act via these non-genomic pathways and disrupt normal signalling pathways by altering the signalling of endogenous estrogens (Watson et al, 2011).
Xenoestrogens, therefore, have the ability to act rapidly to disrupt estrogen signalling pathways, with the capacity to affect a wide range of tissues. Furthermore, the nongenomic actions of xenoestrogens can be maintained through continuing ligand stimulation (Watson et ah, 2011).
Additional exploration of the nongenomic effects of xenoestrogens is needed to gain a greater picture of the endocrine disrupting abilities of these substances.
1.2. Glucocorticoid Receptors (GRs)
Inactive GRs exist in the cytoplasm, where they form complexes with immunophilins and heat shock proteins (Schaaf et ah, 2009, Leatherland et ah, 2010). Once activated by a ligand,
GRs dissociate from the complexes and translocate to the nucleus (Schaaf et al, 2009). The 5 activated GRs are homeodimers that can bind to glucocorticoid response elements (GREs) in the promoter region of target genes, and interact with transcriptional co-factors (Schaaf et al, 2009,
Leatherland et al, 2010). Through transactivation, the downstream gene is then transcribed
(Schaaf et al, 2009). As was found for the ERE, the nucleotide sequence of the GRE determines the nature of the interaction between the GRs and the co-regulators (Lemon and Freedman, 1999).
Glucocorticoid receptors also have the ability to inhibit gene expression that is induced by transcription factors such as NF-KB and AP-1 through transrepression (Schaaf et al, 2009). The transcription factors that the GR can inhibit the transcription of many pro-inflammatory genes, thus the inhibition of these transcription factors explains some aspects of GRs anti-inflammatory actions (Schaaf et al, 2009).
Expression of GR mRNA exists widely throughout the body (Stolte et al, 2008). Effector hormones are used by GR in order to control its transcriptional regulatory activity through binding to an allosteric site (Meijsing et al, 2009). The primary role of GR is to mediate the effects of glucocorticoids, which are responsible for regulating various processes such as the immune response, metabolism, neural processes, and bone formation (Schaaf et al., 2009). The
GR is a widespread receptor crucial to various physiological mechanisms. It has the ability to interact with numerous hormones that regulate its activity.
It is now known that glucocorticoids can act not only through genomic actions, but also through rapid, non-genomic activity resulting in cellular responses within a matter of seconds or minutes (Borski, 2000, Stellato, 2004, Lowenberg, 2007, Grazanka & Jarzab, 2009). The non- genomic activities of glucocorticoids are, in part, mediated by GRs, which play a critical role in these activities (Tasker et al 2006, Lowenberg, 2007, Di et al, 2009, Grazanka & Jarzab, 2009).
Both membrane-bound (mGR) and cytosolic forms of GR have been found to mediate non- genomic effects of glucocorticoids, though glucocorticoids also exert non-genomic action through nonspecific physicochemical interactions with the cell membrane and through other membrane receptors such as G-protein-coupled receptors (GPCRs) (Stello, 2004, Lowenberg, 2007, Park et
6 al., 2008). The mediation of glucocorticoid's non-genomic action by GR promotes the activation of protein kinase signal transduction pathways such as the mitogen-activated protein kinase
(MAPK), Src and PI3K (Grzanka & Jarzab, 2009) pathways, through which glucocorticoids are able to exert these rapid signals onto cellular targets (Di et al, 2009).
Non-genomic effects of glucocorticoids affect a wide array of cellular activities. Negative feedback regulation of the HPA axis is mediated by both genomic and non-genomic actions of glucocorticoids at the anterior pituitary, the hypothalamic paraventricular nucleus (PVN) and the hippocampus (Tasker et al., 2006). This explains the rapid inactivation of ACTH cells, which are located in the anterior pituitary, and CRH and vasopressin, whose receptors are located in the anterior pituitary and regulate ACTH secretion, and whose neurons are located in the hypothalamus (Tasker et ah, 2006). The rapid non-genomic signalling cascades of glucocorticoids can be neuroprotective and cardioprotective (Lowenberg, 2007, Di et al., 2009).
The non-genomic actions of GRs have been found to activate nitrous oxide synthase (NOS) via the PBK/Akt pathway which induces the release of eNOS, resulting in smooth muscle vasorelaxation (Tasker et al 2006, Di et al., 2009). Non-genomic, as well as genomic, actions may regulate the immunosuppressive and anti-inflammatory actions of glucocorticoids (Stahn &
Buttgereit, 2008). Non-genomic actions of glucocorticoids have also been documented to influence intracellular Ca2+ levels (Lowenberg, 2007), behavioural responses, and pigment redistribution (Borski, 2000).
1.3. Links between the ER and GR
There are many known interactions between the ER and GR genes, but the mechanisms of these interactions are not fully understood. Co-repression of ER and GR occurs in several tissues throughout the body (Lethimonier et al., 2002). Multiple signalling pathways are thought to be involved in cross-talk between ER and GR genes, suggesting functional diversity within the steroid receptors' regulation of transcription (Kinyamu & Archer, 2003).
7 Protein levels of ER can be mediated by acute or chronic glucocorticoid exposure (Gunin
et al., 2003). There was found to be a negative association between plasma CL concentration and the number of hepatic cytosolic and nuclear E2-binding sites in immature rainbow trout (Pottinger
& Pickering, 1990). This antiestrogenic effect was also observed when a synthetic glucocorticoid,
dexamethasone (Dex), was administered to ovariectomized mice being chronically treated with E2
(Gunin et al, 2003). The observed findings included a reduction in uterine weight, endometrial
hyperplasia, as well as proliferation of uterine epithelia (Gunin et al., 2003). Protein levels of
ERa were increased by this treatment, indicating that glucocorticoid exposure may increase protein stability by inhibiting enzymatic degradation or promoting protein synthesis (Gunin et al.,
2003). The GR protein response decreased as a result of the treatments, possibly due to down-
autoregulation (Gunin et al, 2003). Despite extensive research, the mechanisms by which
glucocorticoids act on estrogen-dependent mechanisms within the uterus have not been fully
elucidated.
In oviparous species, CL has an inhibitory affect on vitellogenesis (Lethimonier et al,
2002). Cortisol-activated GR protein has the ability to inhibit vitellogenesis of rainbow trout due
to the repression of £7?-positive autoregulation that is normally induced by E2 (Lethimonier et al,
2002). It has been found that this repression by GR acts through a proximal region of the ER,
through which C/EBPp-like protein, when bound, enhances the E2-induced upregulation of ER
(Lethimonier et al, 2002). The FP3-specific transcription factor, C/EBPp, has been implicated in
both the stimulatory effect of E2 as well as the repression by the GR (Lethimonier et al, 2002).
The GR is able to suppress the binding of C/EBPp on the promoter of ER through its DNA-
binding domain, preventing the transcription factor from exhibiting its enhancer effects
(Lethimonier et al, 2002). Therefore, activated GR is able to repress E2 inducible ER activity by preventing the binding of C/EBPp-like proteins to the ER promoter through an interaction with its
DNA-binding domain (Lethimonier et al, 2002).
8 Transcription of GR has also been found to be affected by ER activity. Estradiol may affect GR-regulated transcription of mouse mammary tumour virus (MMTV), a promoter organized as chromatin that can be used to investigate mechanisms controlling the regulation of genes through cross-talk between steroid receptors (Kinyamu & Archer, 2003). Agonists of ER, but not antagonists, have been found to inhibit MMTV-LUC transcription as well as chromatin remodelling that are mediated by GR (Kinyamu & Archer, 2003). A decrease in GR protein levels was found to occur post-transcriptionally, suggesting that GR protein stability is affected at the translational or post-translational step by estrogen agonists such as E2 (Kinyamu & Archer, 2003).
Estradiol was found to down-regulate GR protein levels through the proteasomal degradation pathway (Kinyamu & Archer, 2003). Proteins known to promote GR degradation, Mdm2 and E3 ubiquitin ligase, were increased as a result of E2 administration, providing a viable mechanism for the GR-inhibiting actions of E2 (Kinyamu & Archer, 2003). As ER may have a role in the regulation of Mdm2 expression, in the presence of estrogen agonists it can promote the degradation of GR (Kinyamu & Archer, 2003). Thus, by promoting the degradation of GR, estrogen agonists have the ability to impact transcriptional regulation by GR (Kinyamu & Archer,
2003). The ability of GR to remodel chromatin has also been found to be inhibited by E2
(Kinyamu & Archer, 2003).
It appears that GR and ER interact through various pathways. It is also likely that the two receptors, which are so critical to development and maintenance of various physiological processes, are able to directly interact through mechanisms that have not yet been elucidated.
Investigations into a possible direct interaction between the two receptors may provide a greater understanding of the physiological mechanisms that are so crucial to early development and later survival
9 2. Cortisol and the Stress Axis
Cortisol is a glucocorticoid that plays an important role in most physiological systems. Its synthesis and release into the bloodstream is primarily modulated by the HPA or HPI axes which are activated due to a stressor such as psychosocial, metabolic, or immune stress (Breen &
Karsch, 2006). However, the effects of extra-adrenal tissue CL concentrations can also be modulated by factors such as biotransformation by microsomal enzymes, and by the production of other steroid hormones, particularly 17oc-OH-progesterone (Andersen, 2002, Thurston et ah,
2007, Alsop & Vijayan, 2008, Staab & Maser, 2010). Follicular production of 17a-OH- progesterone can reach levels that remove CL from cortisol-binding protein (CBP), increasing the bioavailability of CL (Andersen, 2002). The microsomal enzymes 11 (3-hydroxysteroid dehydrogenases (ll(3-HSDs) regulate CL levels by the interconversion of CL and its inactive form, cortisone (Andersen, 2002). Cortisone is converted to CL by 1 lp-HSDl, and 1 lp-HSD2 converts CL to cortisone, as depicted in Figure 1 (Andersen, 2002).
Cortisone Cortisol
Figure 1. . The 1 ip-HSD enzymes regulate Cortisol activity by the interconversion of Cortisol and its inactive form, cortisone (recreated from Andersen, 2002).
10 Cortisol is released continuously throughout the life of the organism and plays a key role in metabolic regulation that is central to maintaining homeostasis during the "normal" range of normal body functions. Adjustments to meet the needs of the organism are made via changes in the HPI axis activity. Exposure to stressors over-rides this regulatory process, and allows an increase in CL secretion that acts to maintain homeostasis during the stress-related period through physiological and behavioural adjustments (Yao et al, 2008). Cortisol is synthesized in the adrenal cortex in response to activation of the HPI axis (Aluru & Vijayan, 2009, Leatherland,
2010) and is involved in the regulation of metabolism (Nyirenda et al, 2009, Staab & Maser,
2010), and cardiovascular (Wintour, 2006, Reini et al, 2008), endocrine (Hobby et al, 2000,
Breen & Karsch, 2006, Pierce et al, 2008, Alsop et al, 2009) and immune (Stahn & Buttgereit,
2008) systems. When the stress response is elicited, the somatic nervous system as well as the sympathetic division of the autonomic nervous system (S-ANS) increase output (Leatherland et al, 2010). The somatic nervous system regulates contraction of skeletal muscle whereas the sympathetic division of the autonomic nervous system regulates the release of epinephrine and norepinephrine (Leatherland et al, 2010). These neurotransmitters are released into the vascular system from synapses through the activation of interrenal chromaffin cells by the S-ANS. This increases vascular flow and glycogenosis to release glucose and respiratory rates while decreasing visceral function (Leatherland et al, 2010). A schematic representation of the stress response is depicted in Figure 2.
The response to stressors also activates the HPI axis by causing neurons in the hypothalamus to project into the anterior pituitary to secrete increasing amounts of CRH
(Leatherland et al, 2010). Subsequently, CRH stimulates the release of ACTH into the blood stream (Metz et al, 2005) which binds to the melanocortin 2 receptor (MC2R) at the head kidney in fish (or the adrenal cortex in mammals) (Alsop & Vijayan, 2009). Once bound to MC2R, CL biosynthesis is activated through a series of enzymatic reactions and released into the bloodstream
(Alsop & Vijayan, 2009), where it has the affinity to bind to mineralocorticoid receptors (MRs)
11 and the GRs (Yao et al., 2008). The series of reactions resulting in CL release due to stimulation by a stressor is depicted in Figure 3.
That the stress axis can be significantly impacted throughout life due to a growth- restrictive prenatal environment in mammals has been well documented (Matthews & Phillips,
2010). Prenatal glucocorticoid exposure appears to alter the feedback sensitivity of the HPA axis, resulting in a hyper-reactive HPA response (Gitau et ah, 2001) and elevated basal CL levels in adults (Kivlighan et al., 2008). Dysregulation of the stress axis due to prenatal programming can lead to vulnerability of offspring to various pathological concerns (Matthews & Phillips, 2010).
The HPA axis becomes functional around midgestation in the human fetus (Gitau et al.,
2001) and appears to be extremely sensitive to early programming. HPA programming in utero increases the activity of the stress axis (Matthews & Phillips, 2010) and is thought to lead to hypercortisolism later in life, possibly due to an enhanced CL response following ACTH stimulation (Tenhola et ah, 2010). Pathological hypercortisolism can lead to symptoms of the metabolic syndrome (MetS) such as insulin resistance (Tenhola et ah, 2010), although the responses evident in animal studies have been inconsistent, depending on the nature, intensity and duration of the manipulation (Matthews & Phillips, 2010). Nevertheless, there is a growing consensus that maternal stress can have detrimental effects on fetal development based on dysregulation of the HPA axis in offspring (Matthews & Phillips, 2010).
Increases in CL during pregnancy due to maternal stress, anxiety or malnutrition can result in permanent epigenetic modifications altering offspring gene expression (Matthews &
Phillips, 2010). This can have detrimental effects on the endocrine, metabolic and behavioural strategies of the offspring (Matthews & Phillips, 2010). For instance, in rats and human beings methylation of hypothalamic CRH and GR promoters is altered in umbilical cord cells due to maternal stress during pregnancy (Matthews & Phillips, 2010). These findings are consistent with the results in prenatally-stressed rats which exhibit an upregulation of amygdalar CRH and
GR expression, in addition to exhibiting hyperanxiety (Welberg et al, 2001).
12 Ep/N
Visceral. Metabolite rcspiratpry. mobilization cardiovascular
Figure 2: A schematic representation of the stress response pathways involving the central and peripheral nervous systems (CNS and PNS, respectively). Elements of these sensory systems detect stressors, which prompts sensory inputs through afferent neurons of the PNS into the CNS (A). Sensory inputs within the CNS are processed rapidly, which can initiate efferent signalling through both the somatic nervous system (SNS)(B) and the autonomic nervous system (ANS)(C). Efferent signals travel via cholinergic (ACh) neurons. Those carrying signals from the SNS innervate skeletal muscle by way of forming part of the PNS (D). Preganglionic ACh neurons of the sympathetic branch of the autonomic nervous system (S-ANS) can be rapidly activated, stimulating sympathetic postganglionic norepinephrine (NEp) neurons, resulting in the release of NEp intro critical organ systems such as visceral, respiratory and cardiovascular systems (E). Furthermore, S-ANS ACh neurons may also activate interrenal chromaffin cells, resulting in the release of epinephrine and NEp into the vascular system, influencing metabolic activity (F). The visceral, respiratory, and cardiovascular systems can also be affected through activation of the parasympathetic division of the autonomic nervous system, which extend ACh neurons into the sympathetic chain ganglia, resulting in ACh neurons helping to regulate the visceral, respiratory and cardiovascular systems (G) (Recreated from Leatherland et a!., 2010). Stressor ACTH (•raS)
Cholesterol transport StAR Cholesterol CYP1U1
Pregnenolone CYP17 J \30-HSD 17-OH Pregnenolone Progesterone 3j3-HSD\ JCYP17 17-OH Progesterone CYP21a2 * 11-DeoxycortisoI Head kidney Cortisol \l1fi-HSD2 Cortisol Cortisone
Figure 3. A simplified depiction of the signalling cascade of the HPI axis in zebrafish (Alsop & Vijayan, 2009).
14 CL release due to activation of the HPI by a stressor is an adaptive mechanism that allows the organism to respond to the stressor by adapting through physiological mechanisms, such as increased plasma glucose levels, which prepares the animal for a possible increased energy output. Allostatic load can be described as the physiological burden that is imposed on various systems throughout the body as a result of chronic activation of the stress axis (McEwen,
2000). Excessive or chronic CL release can be maladaptive, particularly during embryonic development, affecting the wide range of processes that CL normally regulates. A wide range of stressors, including environmental stressors such as BPA, have the ability to cause a chronic elevation in plasma CL levels, depending on the nature and duration of the stressor. This can have a direct effect on the GRs and ERs, thereby affecting a vast number of physiological processes. A greater understanding of how these interactions function and are affected, as well as the resulting physiological effects can provide great insight into the mode of action of specific stressors. This is particularly the case when these stressors are anthropogenic chemicals released into the environment; this knowledge will provide essential input necessary for the regulation of such chemicals as an attempt to protect human health and safety, as well as the health of other organisms that co-inhabit the ecosystems in which we live.
2.1. HPA/HPI Interaction with the Hvpothalamus-Pituitary Gland-Gonad (HPG) Axis
Interactions between the HPA and HPG axes play a significant role in the suppression of reproductive function (Berghold et al., 2007). Cortisol not only suppresses reproductive function locally at the ovarian and uterine levels, but inhibits the normal functioning of hormones at the level of the hypothalamus and pituitary gland (Breen & Karsch, 2006, Berghold et al., 2007).
Thus, the effects of CL during times of stress on the HPG axis may play a major role in reproductive dysfunction induced by heightened stress (Alsop et al., 2009). The intensity and duration of the stress response are important mediating factors in the severity of the impact that
CL may have on the HPG axis (Alsop et al., 2009). The species and sex of the organism
15 experiencing excessive stress may also determine the extent to which it is affected (Alsop et al,
2009). The differences between sexes may be primarily due to the role that sex steroids have toward the impact of the stress response (Tilbrook et al, 1999). The interaction between CL and its secretagogues with various hormones will be discussed in detail.
2.1.1. CL interaction with HPG hormones
Cortisol has the ability to interact with various hormones such as progesterone (Lahoz et al, 2007), LH (Pierce et al., 2008), GnRH (Breen & Karsch, 2006), testosterone (Alsop et al,
2009), and E2 (Alsop et al, 2009). The actions that CL has on various hormones may differ in times of stress than during homeostasis. In a stable state, CL may stimulate or repress the synthesis of various hormones. Hormonal influences may also play a role in the regulation of CL synthesis, bioavailability and function.
Glucocorticoids stimulate progesterone synthesis and release (Lahoz et al, 2007), and therefore variances in progesterone levels are likely related to the state of stress experienced by the animal. As noted previously, progesterone has the ability to increase the bioavailability of CL in follicular granulose cells by disassociating CL from Cortisol binding proteins (CBP) (Andersen,
2002). The heightened levels of 17a-OH-progesterone that occur in the late stages of the follicular phase of the estrous cycle drastically increase the bioavailability of local CL, which is released into the follicular fluid (FF) (Andersen, 2002).
Plasma Cortisol levels have been linked to suppression of E2 and testosterone both in vitro and in vivo, however the level at which they are suppressed differs. Increased plasma CL has been found to inhibit the in vitro synthesis of E2 and testosterone by ovarian follicles (Barkataki,
2007). Plasma levels of testosterone and E2 are decreased in response to increase plasma Cortisol levels; however it has been suggested that plasma Cortisol levels must reach a threshold concentration before decreases in plasma testosterone and E2 are observed (Pankhurst & van der
16 Kraak, 2000). Response of E2 and testosterone levels influenced by plasma Cortisol levels varies with regards to the species studies as well as plasma Cortisol levels experienced.
Secretion of CL due to psychosocial stress in ewes resulted in a disruption of LH pulsatility, and an inhibition of LH secretion (Tilbrook et al., 1999, Breen & Karsch, 2006,
Oakley et ah, 2009). The mechanism by which CL acts in order to reduce secretion of GtHs is unclear. It is thought that CL may act at the pituitary gland to reduce its responsiveness to GnRH, as has been indicated through in vitro studies (Breen & Karsch, 2006). It has also been suggested that CL may suppress GnRH secretion from the hypothalamus (Oakley et al., 2009). Oakley et al.
(2009) found that increased plasma CL levels in ewes resulted in an inhibition of GnRH pulse frequency in follicular phase ewes, suggesting that CL acts on hypothalamic GnRH neurons.
However, studies revealing a suppression of LH without a decrease in GnRH secretion indicated an inhibitory effect on the pituitary responsiveness to GnRH, rather than an inhibition of GnRH release (Breen & Karsch, 2006).
The extent to which stress can inhibit GnRH secretion and pituitary responsiveness to
GnRH may depend on the presence of sex steroids in the circulation (Tilbrook et al., 1999,
Oakley et al., 2009). In addition, the impact that the stress response has on LH secretion may be influenced by the bioavailability of ovarian steroids (Tilbrook et al., 1999). A reduction in LH pulse frequency due to elevated plasma CL was only exhibited in ovariectomized ewes undergoing an artificial follicular phase, compared to ovariectomized ewes that were not expressing gonadal sex hormones (Oakley et al., 2009). Additionally, the plasma levels of E2 and progesterone in female sheep and androgens in male sheep were found to have an impact on the severity of LH inhibition brought on by stimulation of the HPA axis (Tilbrook et al., 1999).
Levels of GtH have been observed to be decreased in a wide variety of species in response to physical, psychological or immunological stress (Breen & Karsch, 2006).
There is evidence to suggest that the mediators affecting stress-induced reproductive suppression may be largely determined by the type of stress that is experienced (Breen & Karsch,
17 2006). For instance, increased plasma CL levels have been found to be involved in the suppression of the pulsatile LH secretions in ovariectomized ewes as a result of psychosocial stress (Breen & Karsch, 2006, Pierce et ah, 2008), whereas CRH and arginine vasopressin (AVP) may suppress gonadotrophin secretion in response to metabolic stress (Breen & Karsch, 2006), and cytokines and prostaglandins play a role in response to immune stress (Breen & Karsch,
2006).
2.1.2. HPI and ovarian disease The interaction between CL and neuroendocrine and immunomodulatory mechanisms have been cited as pathways through which a broad spectrum of cancers develop (Glaser & Kiecolt-Glaser,
2005, Thaker et al., 2006), including breast and ovarian cancers (Sood et al., 2006, Thaker et al.,
2006). Dysregulated CL levels have been associated with ovarian cancer in various studies
(Touitou et al., 1996, Lutgendorf et al., 2008). A dysregulation of the HPA axis leading to hypercortisolism has been associated with ovarian cancer in addition to increased levels of IL6
(Lutgendorf et al., 2008). A significant association was found between the stage of ovarian cancer, and plasma CL and IL6 levels (Lutgendorf et al., 2008), implicating a connection between glucocorticoid and immunomodulatory activity and progression of the disease. A disruption in the circadian pattern of CL release has been linked to ovarian cancer (Touitou et al., 1996). A large majority of ovarian cancer patients were found to exhibit drastic rhythm alterations in CL release, which is closely related to the circadian rhythm of ACTH secretion (Touitou et al., 1996).
As CL is an indicator of circadian function, this may indicate that dysregulation of circadian rhythm plays a critical role in ovarian cancer (Touitou et al., 1996).
The interleukins IL1 and IL6 are closely related to the secretion and action of ACTH, further implicating an interaction between the HPA axis and the immune response in the development of ovarian cancer (Touitou et ah, 1996). It has therefore been suggested that changes
18 in the immunomodulatory circuit may result in the changes in the circadian CL rhythmicity that is found in the majority of ovarian cancer patients (Touitou et al., 1996).
As mentioned earlier, CL levels are normally decreased by conversion into cortisone by the enzyme 11 (3-HSD2 in granulose cells during follicle development (Andersen, 2002). In ovarian cysts, this inactivation of CL is dramatically decreased, leading to local hypercortisolism
(Sunak et al., 2007). Cortisol has therefore been implicated in cyst development (Sunak et al.,
2007). Conversely, patients with polycystic ovarian syndrome (PCOS) exhibit low levels of CL in relation to cortisone, suggesting increased 11P-HSD2 activity and/or decreased 11 p-HSD 1 activity (Thurston et al, 2003). Ovarian modulators of 11 P-HSD enzymatic activity have been found in follicles as well as in ovarian cysts (Thurston et al., 2003). As the mechanism of cyst development is still unclear, it is plausible that the changes in CL are indicative of ovarian cysts, but may not necessarily act in their etiology. However, it has been suggested that stress may promote cyst development through its ability to disrupt hormone synthesis (Khan et al., 2011)
Altered peripheral CL metabolism may also play a role in cyst development for patients with cystic ovary disease (COD). Increased metabolism of CL can reduce negative feedback of the HPA axis, resulting in abnormally high levels of ACTH (Thurston et al., 2003). Heightened plasma ACTH concentration leads to decreased LH synthesis which is thought to be an important regulator of mature follicle development (Thurston et ah, 2003). The low levels of LH maintain
E2 production by the mature follicles, which then develop into ovarian cysts due to a failure to ovulate (Thurston et al., 2003).
Functional regulation of CL levels, both systemic and local, is crucial for proper development and function of physiological systems in all stages of life. Cortisol's known, and likely many unknown, interactions with hormones are critical to the functioning of the reproductive system. Dysregulation of these interactions can lead to reproductive dysfunction, infertility, and disease.
19 2.1.3. The Role of CL Secretagogues
Activation of the stress response may not only exert hormonal effects through increased
CL, but secretagogues CRH and ACTH have been found to interact with hormones and influence hormone secretion. For instance, LH secretion was inhibited by CRH administration in gonadectomized female rats (Rivier & Vale., 1984). A CRH-related neuropeptide, UcnII, suppressed the pulsatility of LH secretion in a dose-dependent manner in adult female ovariectomized Wistar rats receiving E2 replacement (Li et al., 2005). These conditions enhance the suppression of LH that is induced by stress and CRH. Similarly, restraint stress was found to suppress LH secretion pulsatility (Li et al., 2005). This inhibition of pulsatile LH was blocked by administration of a CRH-R2-specific antagonist prior to the onset of restraint stress, suggesting that CRH is, at least partly, responsible for the suppression of pulsatile LH due to stress..
Additionally, ACTH has been found to down regulate E2 biosynthesis in ovarian follicles in response to stress-induced activation of the HPA axis in zebrafish (Alsop et al., 2009). The mechanism of this interaction is not clear; however a possible pathway for this occurrence is through human chorionic gonadotrophin (hCG) (Alsop et al., 2009). Follicular E2 secretion has been found to be increased by hCG, and ACTH-stimulated hCG inhibition resulted in a dose- dependent decrease in E2 secretion from ovarian follicles (Alsop et al., 2009). Interestingly, CL did not have the same inhibitory effect on hCG-stimulated E2 secretion (Alsop et al., 2009), thus a general increase in HPA activation could not account for E2 suppression.
2.2 CL and the Somatotropic (ST) axis
The HPI is also known to interact extensively with the ST axis. Cortisol implantation as well as induced stress has been found to suppress plasma GH levels in fish (Farbridge &
Leatherland, 1992). Furthermore, CRH was found to inhibit GH secretion when injected via the intracerebroventricular cannulae (Katakami et al., 1985) and via the median eminence (Puertas et al., 1996) in rats, but not when CRH was injected intravenously (Katakami et al., 1985). 20 Cortisol also has the ability to alter gene transcription of various growth-related genes in fish as reported in Li et al. (2010). Administration of CL prior to fertilization resulted in elevated
GH1 mRNA transcripts in rainbow trout embryos sampled at Odpf (Li et al., 2010). The same treatment conditions resulted in a decrease in GH2 mRNA at 13- and 21 dpf compared to controls
(Li et al., 2010). Expression of GHR1 was suppressed in a dose-dependent manner in rainbow trout embryos sampled at 7-, 13- and 21 dpf and GHR2 expression was suppressed by 0.1 ng/mL
Cortisol at 13- and 21-dpf. Expression oflGFl mRNA was found to be increased due to CL exposure prior to fertilization in rainbow trout (Li et al., 2010). Expression of IGF2 expression was significantly increased at the 21 dpf developmental point.
3. Bisphenol A (BPA)
Bisphenol A, 4,4'isopropylidenediphenol (Fig. 4), is a synthetic chemical used in the manufacturing of polycarbonate plastics and epoxy resins (Pastva et al, 2001, Lahnsteiner et al,
2005). It is prepared by the combining phenol and acetone at a 2:1 ratio (Vandenberg et al,
2009). With over 6 billion pounds manufactured each year, BPA is one of the highest volume synthetic chemicals currently produced worldwide (Vandenberg et al, 2009). It is easily produced and is manufactured and utilized around the world (Alexander & Dill, 1988).
CH3
Oh C _/^ OH
ChN
Figure 4. Molecular structure of BPA.
21 Environmental levels of BPA are positively correlate with human population densities, with domestic and industrial waste being the mitigating factors for BPA pollution (Kawahata et al, 2004). Manufacturing facilities of BPA are the primary sources of BPA release into the environment (Pastva et al, 2001, Lahnsteiner et al, 2005). The effluent from these facilities is discharged to the surface waters found at sewage treatment plants (Zha & Wang, 2006), and can then readily enter waterways. Low concentrations of BPA are present in streams and rivers, where it has the potential to exert detrimental effects on local ecosystems (Pastva et al, 2001,
Oehlmann et al, 2008). Even small concentrations of BPA have the potential to cause deformities and functional abnormalities in aquatic animals (Pastva et al, 2001); one example is the study by
Kwak et al. (2001) which found that the sword growth of the swordtail fish (Xiphophorus helleri) was inhibited by exposure to BPA levels as low as 200 ppt.
Bisphenol A is considered to be non-persistent due to rapid biodegradation and its half life of 2.5 - 4 days (Staples et al, 1998). However, the degradation of BPA has been found to differ due to its substrate. Increased persistency and therefore higher levels of BPA have been found in sediment and seawater in comparison to freshwater (Staples et al, 1998, Kang et al,
2007). Sediment concentrations of BPA reflect accumulation of BPA more accurately than freshwater concentrations (Kawahata et al, 2004). It is thought that the anaerobic or semiaerobic conditions of sediment environments may contribute to the increased persistence of BPA under these conditions (Voordeckers et al, 2002, Kang et al, 2007). Aerobic conditions may therefore play an important role in the degradation and metabolism of BPA both in the environment and within organisms.
It is well known that BPA poses possible health risks to mammals, but the current knowledge of its effects on the early development offish is limited (Honkanen et al, 2004).
Documented affects of BPA exposure on zebrafish development include no blood flow, cardiac edema, tail deformities, delayed hatching, and death (Duan et al., 2008). The established
22 estrogenic properties of BPA (Baek et al, 2007) poses many risks to animals exposed to BPA pollution.
3.1 BPA and Early Development
Reproductive processes are affected by BPA in a number of ways. During the fetal or perinatal period, hormone exposure is crucial for normal brain sexual differentiation (Vandenberg et al., 2009), providing an explanation for observations that exposure to xenoestrogens such as
BPA during perinatal development can potentially interrupt the normal development of sexually dimorphic pathways (Vandenberg et al., 2009). The estrogenicity of BPA can inhibit testicular steroidogenesis through activation of ER, even when present at low levels (Vandenberg et al.,
2009). Reports have varied regarding BPA's affects on reproductive success and fertility.
Reproductive success was significantly decreased due to long-term BPA exposure at 640 ug/L of
P. promelas (Sohoni et al., 2001). Kang et al. (2002) reported that BPA did not cause significant alterations to fecundity or fertility in Japanese medaka (Oryzias latipes) at concentrations of 837,
1720, or 3120 ug/L. However the prevalence of ova-testis increased as a result of BPA exposure of all treatment groups of male medaka (Kang et al., 2002). Semen quality early in the spawning season has also been found to be affected in brown trout (Salmo truttaf.fario), with reduced sperm density, reduced motility rate, circular rather than linear motility, and reduced swimming velocity due to BPA exposure (Lahnsteiner et al, 2005). Higher quality semen was produced later in the spawning season, delaying efficient fertilization by 4 weeks (Lahnsteiner et al, 2005).
Similarly, although egg quality was not affected, the ovulation of brown trout exposed to
"environmentally relevant" concentrations of BPA was delayed by 2 to 3 weeks depending on
BPA concentration, with a higher concentration causing a longer delay (Lahnsteiner et al, 2005,
Alurue?a/.,2010).
A study in rats, in which pregnant rats were administered a large, single dose of BPA indicates that persistence of BPA is increased in fetuses, and lactating or pregnant mothers 23 compared to nonpregnant adults (Vandenberg et al, 2009). An explanation for the higher BPA levels provided was a decreased levels and/or activity of UGT2B1, a liver enzyme and a key metabolite of BPA in animals, indicating that mother and fetus may both exhibit increased sensitivity to BPA exposure during pregnancy and lactation (Vandenberg et al, 2009), which, as discussed, is a critical period for normal development.
Exposure to BPA can cause a variety of morphological and behavioural effects to developing embryos. Morphological effects reported in embryos exposed to BPA include reduced body weight, as observed in medaka embryos (Zha & Wang, 2006), and haemorrhages around the gill arches and yolk sac in landlocked Atlantic salmon (Salmo salar m. sebago) (Honkanen et al.,
2004). These embryos were described as "phlegmatic and inactive throughout development"
(Honkanen et al, 2004). Similarly, rainbow trout embryos reared from BPA-exposed oocytes tended to exhibit a delay in hatching, yolk absorption, and a lower body mass than controls
(Aluru e? a/., 2010).
Recent evidence has emerged indicating the ability of BPA to act on the ST axis of rainbow trout embryos reared from BPA-exposed oocytes (Aluru et al, 2010). The growth impairment observed correlated with higher total body GH content, alongside lower GH-R gene expression, as well as a suppression of IGF-1 and IGF-2 mRNA levels (Aluru et al, 2010). An impaired stress response in juvenile rainbow trout as well as dysregulation of plasma glucose levels was also observed in BPA-treated groups (Aluru et al, 2010).
3.2 BPA as an ER agonist
Bisphenol A competes with E2 to bind with the ER (Levy et al, 2004), and it has higher affinity for ERp than for ERa (Matthews et al, 2001, Vandenberg et al, 2009). The synthesis of
ER mRNA in South African clawed frog (Xenopus laevis) tadpoles has been found to be significantly upregulated by BPA (Levy et al, 2004). By interacting with the ER, BPA has the potential to have reproductive, morphological, and behavioural effects on exposed aquatic
24 species. The ability of ER to recruit co-activators that are crucial to tissue-dependent responses is
altered when BPA is the ligand, jeopardizing the efficacy of physiological processes (Vandenberg
et al, 2009). BPA also has the ability to bind to the membrane bound form of ERa (mER), and is
capable of non-genomic steroid actions (Vandenberg et al, 2009). In cells that express mER, low
levels of BPA exposure was found to act nongenomically to induce calcium influx, leading to prolactin release in a clonal rat prolactinoma cell line (Watson et al, 2007). Also, recent
evidence has emerged indicating that BPA can act as a thyroid hormone (TH) antagonist,
presumably because of the molecular similarities between THs and the xenoestrogen
(Vandenberg et al, 2009).
Atlantic salmon embryos exposed to BPA in early life accumulated higher concentrations
of BPA from their environment than embryos exposed at later developmental stages (Honkanen et
al, 2004). Early exposure to BPA has many effects on the development of embryos. Mimicking
E2 exposure, BPA exposure at different concentrations skewed the sex ratio of amphibia toward
females (Levy et al, 2004). Samples of effluent from a banknote printing plant in China caused a
25% change in sex ratio towards feminization of medaka (Zha & Wang, 2006). Apoptosis in
testes, the appearance of ova-testis, and embryonic deformities are some affects discovered on
developing frog (Kwak et al., 2001) and medaka embryos (Pastva et al, 2001, Kang et al, 2002)
after early exposure to "environmentally relevant" concentrations of BPA.
4. The Notochord
One of the findings of the study reported in this thesis is an effect of treatments on the
development of the notochord in rainbow trout embryos. Therefore the following section provides
a brief introduction to the nature, distribution and origin of the organ system in fish, and
vertebrates generally.
The notochord is derived from the blastula and is one of the earliest structures to be
formed in the vertebrate embryo. For example, a rudimentary notochord has developed in 25 damselfish (Pomacentrus amboinensis) within 18 hours post fertilization (hpf) (McCormick &
Nechaev, 2002), although this may vary depending on species-specific developmental rhythms.
The early notochord is comprised of a three-layered notochordal sheath which surrounds a single- file cellular arrangement of chordoblasts (Grotmol et al, 2006, Platz, 2006, Nordvik, 2007). The notochordal sheath comprises an external elastic membrane, a collagenous layer, and a basal lamina (Nordvik, 2007).
This multifunctional structure is present in all members of the phylum Chordata for a period throughout development and remains into adulthood in cyclostomes and some classes of fishes, tunicates and cephalochordates (Stemple, 2005, Grotmol et al, 2006). The notochord serves as the main axial support in all vertebrate species during embryonic development
(Stemple, 2005, Grotmol et al, 2006); it is replaced by a calcified vertebral column in tetrapod vertebrates, but remains into adulthood in combination with a vertebral column in sturgeon, lampreys and hagfishes, various elasmobranchs,and teleostean fish (Stemple, 2005, Grotmol et a/.,2006,Norvik, 2007).
4.1. Dual-segmentation Model
The notochord plays a significant role in the patterning that causes the formation of vertebral bodies and intervertebral discs in teleost fishes (Grotmol et al, 2003, Fleming et al,
2004, Stemple, 2005). These findings are in contradiction to the resegmentation model, which is a widely accepted model for vertebrae development in mammals (Fleming et al, 2004) and birds
(Christ et al, 2000), by which two adjacent sclerotomes combine to form a single vertebrae
(Christ et al, 2000, Fleming et al, 2004). The resegmentation model was previously applied to all vertebrates, however mounting evidence has suggested that vertebral formation in some fish species is derived not only from sclerotomes, but also from notochord segmentation (Grotmol et al, 2003, Fleming et al, 2004).
Fleming et al (2004) found that the notochord in zebrafish was secreting bone matrix to
26 assist in the formation of vertebral bodies, and that notochord cells which lie adjacent to somite boundaries initiate the formation of these vertebral bodies. Fleming et al. (2004) suggests that the somites and notochord work together by sending complementary information to the vertebral column regarding its segmentation. This 'dual segmentation' model theorizes that vertebral formation is regulated by both the notochord, which plays a key role in metameric patterning of vertebral bodies, and somite rows, which influence neural and haemal arch formation (Grotmol et al, 2003, Fleming et al, 2004, Grotmol et al, 2005).
4.2. Chordoblasts
Segmentation of the notochord is formed by migration of the chordoblasts. Waves of wedge-shaped chordoblasts migrate dorsally from the ventral notochord, resulting in the segmentation of the chordoblast layer (Grotmol et al, 2003). The chordoblasts at this point are arranged in circular bands, two of which define where each individual vertebra will develop.
Thus, these rings of chordoblasts line the cranial and caudal borders of what will later develop into vertebral bodies, and they have been described as the rudiments of vertebral bodies (Grotmol et al, 2003). The formation of calcified rings within the notochordal sheath follows chordoblast segmentation, resulting in a ring-shaped chordacentra (Grotmol et al, 2003, Nordvik, 2007). On the surface of the chordacentra, sclerotomal osteoblasts differentiate creating the foundations for further vertebral growth.
Grotmol et al. (2003) outlines the crucial role that the chordoblast layer within the notochord plays in vertebral development. The chordacentra (perichordal centrum) are derived from chordoblasts within the notochord (Grotmol et al, 2003, Haga & Dominique, 2009); they are mineralized by chordoblast signalling, and surround the notochord in a series of segment- forming rings that are developed posteriorly from the cranial end within the notochord sheath
(Haga & Dominique, 2009). The chordacentra form the basis of structures that develop later into calcified vertebrae (Haga & Dominique, 2009).
27 4.3. Notochord Secretions
In addition to its structural properties, the notochord secretes a number of signalling molecules to aid in tissue development from vertebral and intervertebral disc formation to the development of surrounding tissues (Fleming et al., 2004, Nordvik, 2007, Haga & Dominique,
2009). Various chordoblast secretions, including bone matrix, sonic hedgehog (Shh), alkaline phosphatase (ALP), retinoic acid (RA) and one of its catabolising enzymes, Cyp26, have all been implicated in vertebral formation (Fleming et al., 2004, Haga & Dominique, 2009). In zebrafish, the notochord secretes bone matrix leading to the development of vertebral bodies (Fleming et al.,
2004).
Secreted by the notochord and floorplate, Shh plays a critical role in the differentiation of somites in the developing chick embryo (Johnson et al., 1994). Thereby, Shh is critical to axial patterning during embryonic development, and axial deformities have resulted in mice due to targeted disruption of the Shh gene (Chiang et al. 1996). Sonic hedgehog also plays a role in the proliferation and differentiation of chondrocytes (Haga & Dominique, 2009). Notochord segmentation and vertebral and intervertebral disc development may also be influenced by RA secretion from the notochord (Haga & Dominique, 2009).
Activity of ALP in the notochord coincides with the mineralization of the chordacentrum, exhibiting metameric patterning and following closely the cranial and caudal borders of the chordacentra (Grotmol et al., 2005). The expression of ALP within the chordoblast layer occurs prior to that by cells lying external to the notochord which are thought to be somite-derived
(Grotmol et al, 2005). Activity of ALP was found to spread dorsally in the chordoblasts that are located most adjacent to the chordacentra mineralization (Grotmol et al., 2005). Thus, ALP activity within the chordoblast layer mirrored that of the chordacentra undergoing mineralization.
The subpopulations of chordoblasts exhibiting ALP activity are morphologically distinct from the bands of chordoblast cells that lay the barrier for the formation of chordacentra, although they are located in the same areas (Grotmol et al, 2005). 28 4.4, Notochord Development
The dorsal organizer (homologous to the embryonic shield in teleost fish) is the site of origin of the axial mesoderm, the notochord, and the prechordal plate (Stemple et al., 1996,
Nordvik, 2007). The chordamesoderm, the direct precursor to the notochord, is formed in early gastrulation by the dorsal organiser and is molecularly and morphologically distinct from the surrounding mesoderm (Stemple et al., 1996, Stemple, 2005, Grotmol et al, 2006). Meanwhile, cells intercalate towards the midline, and the rudimentary notochord tissue narrows and extends longitudinally (Grotmol et al., 2006, Nordvik, 2007). Cell divisions occur during this time to form a single-file line of chordoblasts. It is from the chordoblasts that the notochordal sheath is developed by the deposition of extracellular matrix components (Nordvik, 2007). Differentiation of the chordoblasts gives rise to the vacuolated chordocytes which lie centrally in the notochord and play a major role in the turgidity of the notochord through the maintenance of hydrostatic pressure within the notochord (Stemple, 2005, Platz, 2006, Nordvik, 2007).
There are several theories on the earliest pathways of notochord development, but there is still much debate on what is occurring (Stemple, 2005). It is believed that there is a relationship between the presence of the basement membrane and notochord differentiation (Stemple, 2005), but the nature of this relationship remains obscure. Basement membrane signalling towards the chordamesoderm may be involved in this relationship (Stemple, 2005). A study by Currie and
Ingham (1996) found that echidna hedgehog {ehh) gene expression from the chordamesoderm is terminated after differentiation of the notochord and inflation of the vacuoles, suggesting that analysing gene expression can help to determine the developmental stage of the notochord
(Stemple, 2005). Other signalling molecules that exist in the basement membrane have been suggested as possible signals for notochord differentiation. Heparin-sulphate proteogylcans are present in the basement membrane of the notochord (Stemple, 2005), and may be host to various growth factor proteins (Stemple, 2005). Another theory of basement membrane signalling
29 involves laminins, which lie in the basement membrane and are critical to basement membrane development (Stemple, 2005).
Stemple et al. (1996) discovered 65 genetic mutations, and 29 distinct genetic loci that affected notochord development in zebrafish. Theflh and boz loci may have a role in the regulation of chordamesoderm formation or maintenance (Talbot et al., 1995). Expression of
Brachyury, shh, and col2al are terminated as notochordal cells become vacuolated during segmentation (Stemple et al., 1996). Once the notochord is vacuolated, snw, mib, mgt, and chg loci mutations result in abnormalities in notochord cell morphology (Stemple et al., 1996).
Similarly, morphological aberrations are observed in notochord cells of not mutants. General prevalence of degeneration is observed and it is thought that cell death may play a role in abnormal morphology. Furthermore, CoUal expression has been implicated as an important factor in axis development (Yan et al, 1995); in zebrafish, Collal expression may be activated by axial development regulators (Yan et al., 1995).
5. Cortisol and Vertebral Development
Cortisol is critically important during embryonic development of vertebrates. McCormick
& Nechaev (2002) found that the relative growth rate of anemone fish embryos at various stages was affected by CL; the administration of CL to fertilized anemone fish eggs interfered with the somatic rhythms of the embryo affecting myotomal contractions, heart rate, lateral flexions of the body and growth pulsation of somites (McCormick & Nechaev, 2002). Cortisol may also play a critical role in vertebral development, since the administration of glucocorticoids was found to reduce the occurrence of spinal abnormalities (Kim & Brown, 1997, McCormick & Nechaev,
2002). It is therefore possible that an excess of, or insufficiency in the supply of CL may have negative effects on vertebral formation.
30 5.1 Cortisol and Thyroid Hormone (TH) Interactions on Development
The thyroid hormones, T3 and T4, are critical in embryonic development, metabolism and growth of vertebrates (Szisch et al., 2005, Heimeier et al, 2009, Heimeier & Shi, 2010). The stimulatory affects of THs on larval and juvenile fish development are well known (Kim &
Brown, 1997). Maternal TH and CL have been found to be present prior to hatch in teleost eggs of many various species (Leatherland & Barrett, 1993, Raine & Leatherland, 2003). Cortisol and
TH have been demonstrated to follow a parallel expression patterns through embryogenesis and up to first feeding in sea bream, Sparus aurata (Szisch et al, 2005).
The interaction of CL and T3 has been found to have beneficial effects on Pacific threadfin (Polydactylus sexfilis) embryonic development, similar to results found with various other vertebrate models during development (Kim & Brown, 1997). Kim and Brown, (1997) reported improved survival of embryos due to combined exposure to T3 and CL, and suggested that CL enhances absorptive ability, allowing adequate supply of nutrients to the developing embryo.
RATIONALE
The primary purpose of this study was to investigate the interactions between the ER and
GR in response to CL and BPA exposure of rainbow trout embryos. In doing so, a novel finding regarding BPA exposure and notochord development was discovered, therefore the work described expanded to incorporate these findings. The chemicals (described later) used as treatments in the study were chosen based on their agonistic or antagonistic properties towards
ER or GR. The greatest difference between the present studies and the existing literature, with a few exceptions, is the in ovo exposure of rainbow trout eggs to various chemicals prior to fertilization. This approach approximates the situation in the wild in which CL and other hormones, as well as many environmental toxicants are transferred from maternal tissues to the lipid rich oocytes during gonadal maturation. 31 The following chapters are laid out as an attempt to test the following hypotheses. The interaction between ER and GR is more direct than previously thought; the receptors may directly activate or repress one another depending on the metabolic state of the animal. Exposure to BPA in ovo affects notochord development in rainbow trout embryos by disrupting normal chordoblast development.
CHAPTER 1 - EFFECTS OF IN OVO EXPOSURE TO GLUCOCORTICOID (GR) AND
ESTROGEN RECEPTOR (ER) AGONISTS AND ANTAGONISTS ON ER and GR
GENE EXPRESSION, OOCYTE FERTILIZATION AND EMBRYO MORTALITY
Introduction
As discussed in the Introduction and Literature review, extensive cross talk is known to exist between ERs and GRs, and this interaction appears to involve multiple pathways. The purpose of the genetic analysis described in this Chapter is to attempt to identify possible direct interactions between GR and ER.
High mortality in late stage embryogenesis may be indicative of earlier developmental disruptions. Early exposure to toxicants may cause embryos to compensate for this insult by rapidly using yolk-derived resources, leading to the depletion of these resources. Therefore genetic interactions in early embryo development may indicate the mechanisms through which these chemicals exert their lethal capabilities in late embryogenesis. This is the basis for the reasoning of the time points used early in development in this study to analyze GR and ER mRNA expression.
Assessment of fertilization and mortality rates have been used as a marker of oocyte quality, and thus changes in these qualities provide an indication of the burden imposed on a growing embryo by toxicants delivered to the oocyte from maternal tissues prior to fertilization.
32 Fertilization and mortality rates were calculated for each treatment group in order to form a basis for the focus of the current studies. Combinations of chemicals for each of the treatment groups were designed to create situations to agonize or antagonise the ER and/or GR. Fertilization and mortality rates thus give an idea of the ability of these treatments to affect early development and survival. The developmental stage(s) at which high mortalities occur may provide an idea of those stages that are particularly vulnerable to disruptions or the stages at which these systems, in which estrogens and glucocorticoids are critical, to the development and survival of a rainbow trout embryo.
Materials and Methods
Animals
Eggs of the rainbow trout used in this study were obtained from, fertilized and reared at the Alma Aquaculture Research Station (Alma, Ontario, Canada). Once fertilized, embryos were placed in a Heath incubator, receiving a continuous supply of aerated Artesian well water at
8.5°C. The embryos were sampled at various stages of development depending on experimental procedure, as outlined below.
Basic Experimental Design
Oocytes were manually harvested from 8 three-year old rainbow trout and pooled.
Oocytes were randomly distributed in approximately equal numbers into the various treatment groups (described later). The oocytes were incubated in native ovarian fluid or an artificial incubation medium at 8°C for 3 h and stirred occasionally. Post-incubation, the oocytes were fertilized with milt pooled from 8 four-year old rainbow trout. The containers were immediately stirred to mix the oocytes and milt, and water was added to activate the sperm. The fertilized eggs were placed in a Heath incubator receiving water at a flow rate of 10 L/min.
33 Treatment Groups
The treatment groups and the concentrations of the included chemicals used for genetic analysis are as shown in Table 1.1. Treatment groups used for calculating fertilization and mortality rates are depicted in Table 1.2.
Embryos were sampled at tO, ldpf, 7dpf, 13dpf and 26dpf. Eggs were sampled shortly after fertilization, representing the tO developmental stage. Methylation and down-regulation of the maternal genome is taking place in the tO and ldpf embryos. Embryonic genome expression commences around the 7dpf stage, and predominates at 13dpf stages. The 26dpf sampling stage was chosen because it is at this time in which the embryonic genome is complete and most organ systems of the developing embryos are in place.
Table 1.1: Treatment groups and concentrations used in genetic analysis.
Treatment groups Concentrations of reagents in the oocyte incubation medium CI CI -0.1 ug/mL CI-0.1 ug/mL Cl+BPA BPA - 50 ug/mL CI -0.1 ug/mL Cl+ICI ICI - 1 ug/mL CI -0.1 ug/mL Cl+ICI+RU ICI - 1 ug/mL RU -1 ug/mL CI -0.1 ug/mL Cl+BPA+ICI BPA - 50 ug/mL ICI - 1 ug/mL CI -0.1 ug/mL Cl+BPA+RU BPA - 50 ug/mL RU -1 ug/mL CI-0.1 ug/mL BPA - 50 ug/mL Cl+BPA+ICI+RU ICI - 1 ug/mL RU -1 ug/mL
34 Table 1.2. Treatment groups co-administered with ethanol control (A) or Cortisol (B) and the concentrations used. The values shown are concentrations of the reagents in the ovarian fluid; CL content of the oocytes, as measured by radioimmunoassay were ~3, ~5, and ~7 ng/oocyte for the CC, CI and C2 treatment groups, respectively.
A B Treatment Concentrations of Treatment Concentrations of reagents in reagents in medium medium CI CL -O.lug/mL CC (control) - C2 CL - 1 ug/mL CC+ICI ICI - 1 ug/mL CL-0.1 ug/mL Cl+BPA BPA - 50 ug/mL CC+RU RU -1 ug/mL CI -0.1 ^ig/mL ICI - 1 ug/mL Cl+ICI ICI - 1 ug/mL CC+ICI+RU RU -1 ug/mL CL -0.1 ug/mL Cl+RU RU-1 \ig/mL CC+BPA BPA - 50 ug/mL CL - 1 ug/mL C2+RU BPA -50 ug/mL RU - 1 ug/mL CC+BPA+ICI ICI - 1 ug/mL CL-0.1 ug/mL BPA - 50 ug/mL Cl+ICI+RU ICI - 1 ug/mL CC+BPA+RU RU -1 ug/mL RU -1 ug/mL
BPA-50 ug/mL CL-0.1 ug/mL CC+BPA+ICI+RU ICI - 1 ug/mL Cl+BPA+ICI BPA - 50 ug/mL RU -1 ug/mL ICI- 1 ug/mL
CL-0.1 ug/mL Cl+BPA+RU BPA-50 |ag/mL RU -1 ug/mL
CL-0.1 ug/mL BPA - 50 ug/mL Cl+BPA+ICI+RU ICI - 1 ug/mL RU -1 ug/mL
35 Chemicals
The reagents used in this experiment, CL, BPA, 7a,17p-[9-[(4,4,5,5,5-Pentafluoropentyl) sulfinyl] nonyl] estra-l,3,5(10)-triene-3,17-diol (ICI-182,780) (ICI), and lip-[p-(Dimethylamino) phenyl]-17p-hydroxy-17-(l-propynyl) estra-4,9-dien-3-one (Fulvestrant, RU-486) (RU), were obtained from Sigma Life Sciences, Oakville, ON. Prior to incubation of the oocytes, the various treatment conditions were prepared by combining the different chemicals with ovarian fluid at concentrations shown in Table 1.1.
Mortality and Fertility Rates
Mortality rates were calculated based on the survival percentage of embryos at different developmental stages until 68dpf. Morality rates were calculated for embryos prior to eye-up, prior to hatch, and hatched embryos until 44dpf. Mortalities of juveniles placed in swim-up tanks were calculated between 44dpf and 68dpf.
Fertility rates were calculated based on embryos reaching the eyed stage. Mortality and fertility rates were calculated in comparison to the total number of zygotes originally placed in the
Heath Incubators at tO. The number of embryos sampled were discounted since mortality and fertility rates of embryos that were sampled cannot be assumed.
Quantitative real time RT-PCR (qPCR)
Embryos were placed immediately after collection in KNAlater and stored at -70° C in accordance with the manufacturer's instructions (Applied Biosystems,Foster City, California,
US). Total RNA was isolated from whole embryo samples using Qiagen RNeasy kits (Qiagen,
Germantown, Maryland, USA) and on-column DNase digestion according to the manufacturer's instructions. RNA concentrations were measured using NanoDrop ND-1000 Spectrophotometer and total RNA had 260/280 absorbance ratios of 1.88-2.11 in double-distilled water.
Total RNA was reverse transcribed into cDNA to a final concentration of 500ng/uL.
Each sample was reverse transcribed in a 20uL solution. Of this solution, lOuL reaction contained
2uL lOx RT Buffer, 0.8nL dNTP mix (lOOmM), 2pL lOx RT Random Primers, 1 pL MultiScribe
36 Reverse Transcriptase, and 4.2piL H20. The other lOixL was dictated by the concentration of RNA needed to be added in order to reach a final concentration of 500ng/uL. The amount of RNA added was calculated by dividing 500ng/uL by the average RNA concentration (ng/uL) of each sample determined from 2 measurements per sample conducted on the NanoDrop
Spectrophotometer. Double-distilled water was then added at a volume of lOuL-RNA(uL), The lOuL RNA/water solution was added to the lOuL master mix to be reverse transcribed.
Reagents were obtained from High Capacity cDNA Reverse Transcription kits according to the manufacturer's instructions (Applied Biosystems, Foster City, California, USA) with use of
Eppendorf Mastercycler Gradient. The conditions used in the light cycler were: 10 minutes at
25°C, 2 hours at 37°C, 5 minutes at 85°C, and held at 4°C until removed from cycler. Resulting cDNA samples were diluted to a working solution of 1:5 and stored at -20°C.
Primers were obtained from Laboratory Services, University of Guelph, Guelph, Ontario.
The following conditions were used in order to amplify primer products with RT-PCR: for 40 uL of sample, 5 ul lOx of thermol, 1 uL of dNTP, 1 uL of primer (F), 1 uL of primer (R), 0.5 uL of
Taq, and 31.5 uL of sdH20. The resulting PCR products were purified using QiaQuick spin columns (Qiagen, Qiagen,Germantown, Maryland, USA). Primer sequences were verified at
(Genomics Facility, Advanced Analysis Centre, University of Guelph) through genomic sequencing, and amplicon size was evaluated on a 2% DNA agarose gel with a low mass 100 bp
DNA ladder (Invitrogen, Burlington, Ontario ) to confirm amplicon size. The identified bands were excised, purified using Qiagen Gel Extraction Kit (Qiagen,Germantown, Maryland, USA), and sequenced at The Genomics Facility, University of Guelph, Guelph, Ontario.
Gene expression was analyzed quantitatively through qPCR. Each sample was analyzed with two technical replicates and four biological replicates. Genetic analysis by qPCR was carried out using Applied Biosystems OneStep v.2.0 (Genomics Lab, Integrative Biology, University of
Guelph). Each qPCR each 25 mL of master mix consisted of 14.7 mL Sybr Green (Perfecta
37 SYBR Fastmx, Quanta Biosciences), 4.4 mL of (2 nM) selected primer (as shown in Table 1.3), and 5.9 mL ddH20. Each reaction of 20 uL consisted of 17 uL of Mastermix and 3 uL of cDNA.
Negative control samples consisted of 17 uL of Mastermix and 3 uL of ddH20.
The qPCR conditions used were as follows for the specified primers. ERa and ER0:
Holding stage: 30 seconds at 95°C; Cycling stage (40 cycles): 1 second at 95°C (Step 1), 30 seconds at 55°C (Step 2); Melt curve stage: 15 seconds at 95°C (Step 1), 1 minute at 60°C (Step
2), 15 seconds at 95°C. GR1 and GR2: Holding stage: 30 seconds at 95°C; Cycling stage (40 cycles): 1 second at 95°C (Step 1), 30 seconds at 60°C (Step 2); Melt curve stage: 15 seconds at
95°C (Step 1), 1 minute at 60°C (Step 2), 15 seconds at 95°C.
It was not possible to find a housekeeping gene that remained stable across treatment groups examined. Therefore, absolute quantification was performed using standard curves of purified primers. Pooled total RNA from liver samples from adult rainbow trout was extracted and used to generate standard curves for each gene. The RNA extracted from liver samples was diluted serially in 1:5 dilutions and added to reaction mixtures to generate a standard curve for each gene.
In order to find the absolute quantities, a number of calculations were performed:
1. The log concentration was determined from the Ct value and an equation was generated using standard curves: log x = (Ct - y intercept)/slope 2. The normal concentration was determined: concentration = 10Alog concentration 3. The final concentration was determined by multiplying the normal concentration by 5, since all samples were diluted 1:5. 4. The concentrations for individual embryos were determined by dividing the final concentration by the number of embryos homogenized during RNA extraction. tO and ldpf = 7 embryos 7dpf and 13dpf = 4 embryos 26dpf= 2 embryos Two technical replicates were run for each treatment per plate, and 4 biological replicates were performed for each gene analysed.
38 Table 1.3: Oligonucleotide primers of genes used in quantitative real-time PCR. Included are the annealing temperature (Tm) and amplicon size in base pairs (bp).
Gene Forward Primer Sequence Reverse Primer Sequence Tm Amplicon (5'-3') (S'-3') size (bp) (°C)
ERa GCTCCTGCTGCTGCTCTC CCCTATGCTGGAGCCTGT 55 216
ER(3 GAGCATCCAAGGTCACAATG CACTTTGTCATGCCCACTTC 55 126
GR1 TTCCAAGTCCACCACATCAA GGAGAGCTCCATCTGAGTCG 60 115
GR2 GGGGTGATCAAACAGGAGAA CTCACCCCACAGATGGAGAT 60 147
Statistical Analysis
Standard error was calculated using SigmaPlot v. 12.0. One way ANOVA was used to analyse variance between the CI group and the respective treatment groups with chemicals co administered with CL; where F values indicated significance, individual means were compared using Holma-Sidak test; p < 0.05 was considered to be statistically significant.
Results
Fertility Rates
Fertility rates for all treatment groups ranged from 74% to 89% (Table 1.4). Control embryos (CC) exhibited a fertilization rate of 81 %. Slight decreases in fertility rates were observed in the treatment groups C2, C2+RU, and Cl+ICI+RU, all exhibited a fertility rate of
74%. Interestingly, slight increases in fertilization rate were observed in the treatment groups
CC+ICI+RU and Cl+BPA which each exhibited fertility rate of 89%.
39 Table 1.4. Percentage of embryos fertilized for each treatment group co-administered with ethanol control (A) or Cortisol (B). The fertility rates were calculated based on embryos reaching the eyed stage, compared to the total number placed in the incubators, while discounting the number of embryos sampled, as the fertility rate of sampled embryos cannot be assumed. A B Fertilization Fertilization Treatment Group Treatment Group Rate Rate
CC 81% CI 81%
CC+ICI 86% C2 74%
CC+RU 87% Cl+BPA 89%
CC+ICI+RU 89% Cl+ICI 84%
CC+BPA 86% Cl+RU 87%
CC+BPA+ICI 86% C2+RU 74%
CC +BPA+RU 83% C1+ICI+ RU 74%
CC +BPA+ICI+RU 82% Cl+BPA + ICI 79%
CI+BPA+RU 83%
CI +BPA+ICI+RU 81% Mortality Rates
The cumulative mortality rates for embryos of all treatment groups at various developmental stages are presented in Table 1.5. Higher dose of Cortisol administration (C2) prior to fertilization resulted in higher mortality rates, with these effects becoming more dramatic as development progressed (Table 1.5 and 1.6). Treatments including BPA exhibited lower mortality rates than CC prior to eye-up (with the exception of Cl+ICI+RU) (Table 1.5). However, after eye-up, these treatment groups exhibited higher mortalities compared to CC, with effects most dramatic during swim-up (Tables 1.5 and 1.6). At this point mortalities of embryos containing
BPA, (Cl+BPA+ICI+RU), exceeded 85%, with multiple treatment groups reaching 100% (Table
1.6). Treatment groups CC+ICI, Cl+ICI exhibited lower mortality rates prior to 44dpf; however these mortality levels rose to in excess of 95% after this point. Treatment groups CC+RU,
Cl+RU, exhibited lower mortality rates than CC prior to 44dpf, and similar rates after that point. 40 Table 1.5. Mortality rates of embryos at developmental stages. Mortality rates were calculated for embryos prior to eyed stage, eyed embryos, and hatched embryos prior to placement in swim-up tanks (44dpf) based on the number of dead embryos compared to the total number placed in the incubators, discounting the number of embryos sampled, as the mortality rate of sampled embryos cannot be assumed. Mortality rates of hatched embryos in swim-up tanks (44-68 dpi) was calculated based on the number of dead embryos compared to the total number placed in swim-up tanks at 44dpf.
Mortalities of Mortalities of Mortalities Mortalities Embryos post-hatch Treatment Group of Eyed of hatched prior to eyed embryos placed Embryos embryos stage into tanks
CC 22% 26% 5% 11%
CC+ICI 15% 25% 6% 100%
CC+RU 16% 24% 4% 11%
CC+ICI+RU 12% 24% 4% 89%
CC+BPA 14% 47% 4% 100%
CC+BPA+ICI 14% 42% 7% 100%
CC+BPA+RU 17% 47% 3% 100%
CC+RU+BPA+ICI 19% 31% 3% 97%
CI 23% 22% 5% 7%
C2 32% 39% 5% 29%
Cl+BPA 12% 22% 6% 96%
Cl+ICI 17% 22% 4% 98%
Cl+RU 15% 24% 6% 13%
C2+RU 31% 36% 3% 100%
Cl+ICI+RU 26% 21% 3% 85%
Cl+BPA+ICI 22% 31% 4% 97%
Cl+BPA+RU 18% 41% 3% 100%
CI +BPA+ICI+RU 19% 35% 4% 13%
41 Table 1.6. Mortality rates of hatched embryos in swim-up tanks (44-68dpf) for each treatment group co-administered with ethanol control (A) or Cortisol (B). A B Mortalities of Mortalities of post-hatch post-hatch Treatment Group embryos placed Treatment Group embryos placed into tanks into tanks (44dpf-68dpf) (44dpf-68dpf) CI 7% CC 11% C2 29% CC+ICI 100% Cl+BPA 96% CC+RU 11% Cl+ICI 98% CC+ICI+RU 89% Cl+RU 13% CC+BPA 100% C2+RU 100% CC+BPA+ICI 100% Cl+ICI+RU 85% CC+BPA+RU 100% Cl+BPA+ICI 97% CC+RU+BPA+ICI 97% Cl+BPA+RU 100%
CI +BPA+ICI+RU 13%
42 The mortality rates of hatched embryos placed in tanks at 44dpf was calculated at the end of the experiment, 68dpf (Table 1.6). The mortality rate during this period (swim-up) in the CC and CI treatment groups were 11% and 7%, respectively. The mortality rate for the C2 treatment group was 29%. The remaining treatment groups (with a few exceptions) exposed to the reagents
(RU, BPA, ICI) in the oocyte incubation medium, either alone or in combination, had mortality rates in excess of 85%. The exceptions were CC+RU (11%), Cl+RU (13%) and
C1+BPA+ICI_RU (13%)
BPA does not affect ER gene expression
In ovo exposure to CL or BPA prior to fertilization had no significant effects on of ERa or ERp mRNA expression at any embryo developmental stage studied. Similarly, although there were variances in ERa or ERJ3 mRNA expression among the CL+BPA treatment groups, these were not statistically significant (Fig. 1.1).
BPA exerts differential effects on GR gene expression
GR2 mRNA expression was increased at tO (p = 0.001) and 26dpf (p = 0.001) and GRl mRNA expression was increased at 26dpf (p=0.025) in embryos reared from BPA-exposed oocytes. However, both GRl and GR2 mRNA expression levels were decreased in the BPA treatment group at 7dpf (p = 0.009 and 0.007, respectively) (Fig. 1.2).
BPA alters expression pattern otERs and GRs during embryonic development
In comparison with the CI treatment group, Cl+BPA affected the expression trend observed throughout the 5 developmental points for ERa, ERp, GRl, and GR2. Figure 1.1 depicts
ERa (A) and ERp (B) expression at tO, 1-, 7-, 13-, and 26dpf. The CI treatment group exhibits a gradual increase in ERa expression throughout the 5 sampling points, whereas this expression is delayed in the Cl+BPA, with levels remaining similar until after 7dpf where expression rises more gradually (Figure 1.1 A).
Expression of ERP of the CI treatment depicted comparable levels with a sharp increase
43 at 13dpf (Figure LIB). Expression ofERfi exhibited by the Cl+BPA treatment group does not follow this pattern but appears to be approximately consistent until after 13dpf, with a sharp increase in expression at 26dpf, later than observed in the CI group.
Expression of GR1 in both the CI and Cl+BPA treatment groups decreased until 13dpf, with an increase in expression observed for both groups at 26dpf (Figure 1.2A). Expression was significantly lower in the Cl+BPA group compared to the CI group at 7dpf (p=0.009), but expression levels at 13dpf were similar between the two treatment groups (Figure 1.2A). Both treatment groups increased at 26dpf, with the Cl+BPA treatment group exhibiting a significantly higher level of GR1 expression compared to the CI group (p=0.025) (Figure 1.2A).
The Cl+BPA treatment group exhibits a higher expression of GR2 initially (p=0.001) than the CI group, followed by a more gradual increase in GR2 expression than CI until 13dpf
(Figure 1.2B). Both groups exhibited an increase in GR2 expression at 7dpf, however expression was significantly lower in the Cl+BPA group compared to the CI group (p=0.007) (Figure 1.2B).
From this sampling point, GR2 expression rose steadily with another sharp increase at 26dpf in both groups, however the rise in GR2 expression at 26dpf was more pronounced in the Cl+BPA group, resulting in significantly a higher expression level than the CI treatment group (p=0.001)
(Figure 1.2B).
ICI exerts differential effects on ER gene expression
The effect of the in ovo ICI treatment on ER gene expression varied, depending on the embryo developmental time points investigated. Expression of ERa mRNA was significantly increased in the ICI treatment group at tO (p = 0.021), and ERfi mRNA expression was significantly increased at ldpf (p = 0.037) and 26dpf (p = 0.005). The expression of both ERa and
ERfi mRNAs was significantly decreased in the ICI treatment group at 13dpf (p = 0.05 and 0.013, respectively) (Fig. 1.3).
44 CD E 'c CO a3 D-
o oCOr o a. cr
co c U) Q. b CO c co
c CD
c CO 1dpf 7dpf 13dpf 26dpf 0) 2 Days post fertilization
C1 C1+BPA
CD E c 0.006 R CD
g 0.005
o co EH 0.004 O DL cr _i 0.003
.9- 0.002
0 001 c CD cr 0.000 cz co "Idpf 7dpf 13dpf 26dpf CD Days post fertilization
C1 C1+BPA
Figure 1.1. Effect of BPA on ERa (A) and ERfi (B) mRNA transcription. Data are shown as means ± SEM. The units are defined as the mean quantity of primer-targeted transcripts in ng/ul of qPCR reagent, calculated to represent the quantity of transcripts per animal.
45 CD E TO 0.07 a) a. c o 0.06 o CO 0.05 o CT
c to 0.02
<0 0.01
CD 3 0.00 CD 1dpf 7dpf 13dpf CD 26dpf Days post fertilization
C1 C1+BPA
CD E c CO 0.18 1_ CD Q. R ^~ 0.16 O
= 0.14 o 0.02 CO CT 0.00 CD CD 7dpf 13dpf 26dpf Days post fertilization C1 C1+BPA Figure 1.2. Effect of in ovo BPA treatment on GRl (A) and GR2 mRNA transcription (B) in embryos at different developmental stages. Data are shown as means ± standard error. The units are defined as the mean quantity of primer-targeted transcripts in ng/ul of qPCR reagent, calculated to represent the quantity of transcripts per animal. 46 1dpf 7dpf 13dpf Days post fertilization C1 C1+ICI R ro 0.006 1dpf 7dpf 13dpf Days post fertilization C1 C1+ICI Figure 1.3. Effect of in ovo ICI treatment on ERa (A) and ERp mRNA transcription (B) in embryos at different developmental stages. Data are shown as means ± standard error. The units are defined as the mean quantity of primer-targeted transcripts in ng/ul of qPCR reagent, calculated to represent the quantity of transcripts per animal. 47 ICI alters expression pattern of ERs during embryonic developing Expression of ERa is initially (tO) higher in the Cl+BPA treatment group in comparison to the CI group (p=0.021) but exhibits a slight decrease in expression until 13dpf, whereas ERa expression in the CI group gradually increases to this point (Fig. 1.3A). The Cl+BPA treatment group at 13dpf exhibited a significantly lower ERa expression level than the CI group (p=0.05) (Fig 1.3A). Both groups rise to similar expression levels at 26dpf, although the rise was more gradual throughout the developmental points for the CI group. This increase in expression is more pronounced in the Cl+BPA group due to its previously low expression levels (Fig. 1.3A). Expression oiERfi of the CI treatment depicted comparable levels from tO to 7dpf, and exhibited a sharp increase at 13dpf, at which point levels remained similar at 26dpf (Fig 1.3B). Expression was altered by the Cl+ICI treatment group whose expression increased at a later time point, 26dpf (Fig 1.3B). Expression remained at similar levels until 13dpf with the exception of a temporary increase at ldpf, resulting in significantly higher levels of mRNA expression compared to the CI treatment group (p=0.037) (Fig. 1.3B). Since the rise in expression occurred later in the Cl+ICI treatment group, mRNA expression of ERfi was significantly lower than theCl group at 13dpf (p=0.013) (Fig 1.3B). However, once the rise in mRNA expression did occur in the Cl+ICI group, the level of expression was found to be significantly higher than the CI group (p=0.005) (Fig 1.3B). Discussion The higher mortality rates of C2 in comparison with both CC and CI indicates that ovarian fluid levels of CL may reach a threshold at which point it can affect the survival of the developing embryo. The trend exhibited by most treatment groups containing BPA or ICI, in which mortality rates were lower than controls to a point in development and rose dramatically in late embryogenesis may indicate a compensatory mechanism that is activated due to certain toxicant exposures. The high levels of mortality in late development may indicate a depletion of 48 resources brought on by excessive use in early embryogenesis. Thus exposure to these chemicals prior to fertilization may cause embryos to use yolk-derived resources more rapidly than under "normal" circumstances in an attempt to compensate for the toxic insult. This can explain both lower mortalities in early development and higher mortalities in later development, once these resources have been depleted. Examining genetic interactions early in development may provide insight into the cause of the high mortalities late in development. In the present studies, BPA exposure in ovo did not appear to influence ER mRNA expression levels during embryo development of rainbow trout between tO and 26-dpf. The absence of BPA-related changes in ERa or ERfi mRNA expression suggests that the ER ligand does not interact with genomic events related to ER expression. However, the possibility exists that the concentration of BPA used, its mode of administration, and the duration of the BPA exposure may account for the absence of the interaction. Furthermore, BPA levels administered in ovo have been demonstrated to fall to very low levels by 13dpf (Aluru et al., 2010), which may affect BPA's ability to affect ER gene expression. In addition, there may be ER-inhibiting effects of CL or other hormones, or perhaps interactions with other receptors such as the TRs. It is also important to note that protein levels can be affected without notable changes to gene expression levels (Dauvois et al., 1992). No other studies have examined whether ER mRNA expression is affected in fish exposed to BPA. The range of concentrations used in BPA exposure studies of various fish species will be discussed below, but it is important to note that it is not only the concentration, but the exposure method that influences of the level of the response to BPA exposure, and for most studies to date the total exposure time was markedly higher than in the present studies. With the exception of the Aluru et al. (2010) report, the present study differs from many cited in the literature in that the one-time exposure to BPA occurs prior to fertilization, and only for a 3 h period before the eggs were fertilized, following which the embryos were maintained in a continuous supply of fresh (non-contaminated) water. In the present study, the exposure of 49 oocytes to the combination of CL and BPA had no significant effects on the expression of either ERa or ERfi mRNA at any of the 5 sampling time points. As discussed below, these observations are contrary to effects of BPA reported in other studies (Gould et al, 1998, Kuiper et al, 1998, Levy et al., 2004). Gould et al. (1998) and Kuiper et al. (1998) used plasmid transfection assays in mammals in order to evaluate estrogenic abilities of BPA, including its effect on ERa and ERfi gene expression. Gould et al. (1998) demonstrated the agonistic ability of BPA on ERa in which immature female rats were exposed orally to BPA. Ligand interactions with ERa were examined by the use of human ERa mutants in the AF1 or AF2 regions. BPA was found to act as a partial agonist on both the ER-AFl and ER-AF2 mutants (Gould et ah, 1998), and it was suggested that BPA may mediate E2-induced luciferase activity to exert their ER agonistic properties. The ER inhibitor, ICI, inhibited BPAs ability to induce luciferase activity, suggesting that BPA's demonstrated estrogenic effects in this case do not occur through ERa (Gould et al., 1998). Kuiper et al. (1998) evaluated the ability of various estrogenic chemicals, including BPA, to bind to ERa and ER(3 proteins as well as their effects on ERa and ERfi gene expression. Binding affinity analyses were conducted through ligand binding experiments using ERa and ER(3 plasmid vector extracts. Additionally, gene expression analyses were conducted using human 293 embryonal kidney cells in which cultures with recombinant ERa or ERfi complementary DNA creates an acute estrogenic response in the presence of a reporter plasmid which is estrogen-dependent. Through these studies, Kuiper et al. (1998) found that BPA exhibited similar agonistic effects on ERa and ERfi gene expression, but a 10,000-fold lower binding affinity for both ERa and ERfi than E2. However, in vitro analyses may be ineffective in estimating the estrogenic potency of xenoestrogens in vivo (Kuiper et al., 1998). For instance, Steinmetz et al. (1997) found BPA to have a 1000- to 5000- lower potency than E2 when examined in vitro using anterior pituitary cells, but it had pronounced estrogenic capabilities in some cells, such as increased prolactin release in GH3 cell lines. 50 In vivo experiments have also been employed to evaluate the effects of BPA on ER expression (Matthews et al., 2001, Takao et al., 2003, Levy, 2004). Levy et al. (2004) exposed tadpoles to BPA once they had reached developmental stage 42/43 (Nieuwkoop & Faber, 1956). The tadpoles were reared in tanks supplied with a static-renewal regime to allow for continuous exposure to BPA at concentrations between 10"7M and 10"8M. Exposure to BPA resulted in an increased ER mRNA expression in the tadpoles (Levy et al., 2004), and there was evidence of feminization of the BPA-exposed animals (Levy et al., 2004). Furthermore, mice receiving 0.5 or 50 Lig/mL of BPA in their drinking water for a period of 8 weeks exhibited a decrease in testicular ERp protein and ER/i mRNA expression in both treatment groups, and an increase in ERa protein and ERa mRNA expression in mice receiving the higher BPA exposure (Takao et al, 2003). In all three of the above studies the BPA exposures were far higher than the one-time exposure used in the present study, which may explain the lack of a response in the rainbow trout embryos (Fig. 1.1). The amount of BPA administered is clearly an important determinant of the responses observed, and future directions of this work may necessarily test additional ranges of BPA concentrations (particularly the range of exposures that are "environmentally relevant") in order to determine if there is a differential response of ERa or ERfi gene expression at different BPA exposure levels. Conversely, it may be argued that the very high exposures in the mammalian and amphibian studies, whilst of academic interest, are not "environmentally-relevant". In previous studies, BPA has been found to cause detrimental effects on a developing embryo at various exposure methods and concentrations. For example, Kashiwada et al. (2001) found that vitellogenesis in male medaka embryos was induced due to BPA exposure of 10 ug/L, and spinal deformities were reported due to BPA exposure at 100 ug/L. Newly hatched embryos were immersed in a BPA-solution using a static-renewal protocol; thus, the embryos were constantly exposed to BPA at a much higher levels of exposure compared to the present studies. The constant exposure approach was meant to represent environmental conditions in Japanese rivers which receive effluent from landfill sites. The concentrations at which effects were 51 observed (10 ug/L and 100 ug/L) fall within the range that has been discovered in Japanese leachate pollution. BPA has been found in concentrations ranging from 0.15 ug/L to 2960 ug/L in raw leachates from landfill sites, with a mean concentration of 256 ug/L (Kashiwada et al., 2005). However, the medaka embryos were exposed to the BPA only after they had hatched, whereas in the wild, toxicant exposure would occur both before fertilization (by transfer of BPA from maternal blood) and throughout embryonic development (by the uptake of the toxicant via the gills). Zha & Wang (2006) observed an increased incidence of lesions and a higher mortality rate in medaka embryos, following a constant-renewal exposure of the newly fertilized embryos to BPA at a concentration of 200 ug/L for 15 days. Various effects of BPA exposure were also observed in a study conducted on adult, sexually-mature fathead minnows which were exposed to BPA concentrations ranging from 1 to 1280 ug/L (Sohoni et al., 2001). Somatic growth was inhibited (after 71 and 164 days of exposure) and vitellogenin synthesis in males was induced (after 164 days of exposure) at concentrations of 640 ug/L and 1280 ug/L BPA (Sohoni et al, 2001). Spermatogenesis was also inhibited following exposure to 16 ug/L BPA, as indicated by the sex cell composition in testes, and egg production was inhibited at BPA concentrations greater than 1280 ug/L (Sohoni et al, 2001). Following 42 days of BPA exposure, adult fathead minnows were randomly sampled and assigned to breeding pairs. Concentrations of BPA above 640 ug/L resulted in a reduced hatch rate of the Fl generation (Sohoni et al., 2001). Cortisol and activated GR protein have been found to inhibit E2 activity in two fish species (Foo & Lam, 1993, Lethimonier et al, 2002). It is therefore possible that CL inhibits the estrogenic actions of BPA, by mechanisms that are currently not understood. The results of studies examining the inhibitory actions of CL on E2 function in rainbow trout liver tissue suggest that the steroid acts through the modulation of the transcriptional factors that regulate ER gene transcription; ligand activated GR can inhibit the E2-stimulated ER transcriptional activity, thus decreasing ER protein levels (Lethimonier et al., 2000). Another possible route of action of CL is 52 by non-GR transcriptional factors. For example, GR activation has been implicated in the stimulation of transcription factors such as API; these are also activated by the E2-ER complex. In addition, it has been indicated that an activated GR can inhibit ER transcription in rainbow trout liver by interfering with ER transcription stimulator, C/EBPp (Lethimonier et al, 2002). By preventing C/EBPp or other stimulatory transcription factors of ER to exert their actions; de activated GR can effectively inhibit ER function. Thus, CL may also have the ability to block the estrogenic properties of BPA, possibly through the same GR-mediated interference of transcriptional factors that are known for other estrogen ligands. Recent studies have shown that BPA is an agonist of TRa and TRp proteins and can disrupt thyroid signalling (Moriyama et al, 2002, Iwamuro et al, 2003, Seiwa et al, 2004, Iwamuro et al., 2006, Kaneko et al, 2008, Vandenberg et al, 2009). The actions of T3 are apparently antagonized by BPA, which suppresses the transcriptional activity that is normally stimulated by T3, and activates transcription that is normally suppressed by T3 (Moriyama et al, 2002). It has been proposed that BPA can replace TR-bound T3, and in so doing modify the genetic transcription that is regulated by the TR (Moriyama et al, 2002). Bisphenol A has also been found to suppress TRa and TRfi gene expression in amphibian tail and larval tissues (Iwamuro et al, 2003, 2006) as well as the transcriptional activity that is stimulated or suppressed by T3. Amphibian metamorphosis, which is known to be a TH-regulated mechanism in that class of vertebrates, has also been found to be suppressed by BPA (Iwamuro et al, 2003, Iwamuro et al, 2006). In the present study, BPA exhibited different effects on GR gene expression depending on the time points studied. Expression of GR2 mRNA was increased at tO and 26dpf, and both GRl and GR2 expression decreased at 7dpf in response to BPA exposure (Fig. 1.2). Expression of GR mRNA has shown to be increased as a result of T3 treatment in rat pituitary GH3 cells (Williams et al, 1991) and the absence of T3 has resulted in reduced GR numbers in liver of hypothyroid rats compared to normal rats (Leseney, 1987). As discussed above, in some 53 vertebrates BPA has the ability to bind the TR, antagonising the actions of T3, and therefore, if BPA does antagonize this stimulatory action, it might explain the decrease of GR mRNA found in the 7dpf rainbow trout embryos (Fig. 1.2). Interestingly, administration of the synthetic glucocorticoid, dexamethasone (Dex), has been shown to inhibit the T3-stimulated increase in GR mRNA synthesis in rat pituitary GH3 cells (Williams et al, 1991). If BPA does antagonise T3 activity by interacting with TR in the rainbow trout embryos studied here, the lowered T3 action may, in turn, result in a decrease in GR mRNA synthesis and lower GR protein levels. Bisphenol A was found to alter the gene expression trend indicated by the 5 sampling points for all genes tested, ERa, ERfi, GR1, and GR2 (Figs 1.1 and 1.2). The rise in mRNA expression in the ERa, ER/i, and GR2 genes occur at a later stage than the CI group, and that of GR2 decreases earlier than the CI group. In the cases of GR1 and GR2 expression, following this early decrease or delayed increase in gene expression respectively, mRNA expression is higher than the CI groups at 26dpf. (Fig 1.2). These results indicate that BPA has the ability to alter the normal gene expression trend of ERa, ERfi, GR1, and GR2, and interfere with the normal progression of gene expression throughout embryonic development. This may consequently affect processes that are mediated by these genes and normal developmental rhythms In the present study, ERa mRNA expression increased in tO zygotes, and ERfi mRNA expression was increased in 1- and 26dpf rainbow trout embryos that were reared from oocytes incubated in the ER antagonist, ICI, prior to fertilization. However, ERa and ER/i mRNA expression were both decreased in the ICI exposed 13 dpf embryos. These findings suggest a differential response depending on developmental stage of the rainbow trout embryo. The tO and 1 dpf animals were in the process of methylating and down-regulating the maternal genome, whereas by 13dpf the gene expression was predominantly of the embryonic genome, and by 26dpf, the transition from maternal to embryonal genome was complete and most of the organ systems were in place. 54 The antiestrogen ICI has been found to bind to both ERa and ERp proteins (Dauvois et al, 1993, Oliveria, 2003), although it has sometimes been suggested that it may only reduce ERa protein levels (Oliveira 2003). The process by which ERs are accumulated in the nucleus of target cells, which is dependent on E2, is inhibited by ICI (Dauvois et al, 1993, Oliveria, 2003). Although some authors have indicated that ER gene expression is compromised by ICI (Oliveira 2003), others have indicated that ICI can affect ER protein levels without affecting ER mRNA levels (Dauvois et al., 1992). ICI was designed to be a pure antiestrogen with no agonistic effects; however, it does not always act as an ER antagonist in fish, and may even exhibit agonistic effects on various estrogenic processes (Pinto 2006). The actions of ICI are tissue specific, exhibiting either agonistic or antagonistic effects depending on the tissue (Pinto 2006). In the present study, tissue samples from whole embryos were analysed, and therefore differential effects of ICI depending on tissue-specific responses may have affected the results presented. It may be possible that ICI has differential effects on whole embryos at varying time points due to the developmental stage the embryo is in at time of sampling. Similar to BPA, Cl+ICI affected the expression profiles of ERa and ERfi in comparison to the CI treatment groups. In both genes analyzed, the Cl+ICI treatment groups exhibited a later rise in mRNA expression than did the CI groups, and early expression of the genes tend to be erratic, without following an observable trend. These results indicate that ICI has the ability to alter mRNA expression of ERa and ERfi, possibly interfering with gene expression rhythms normally exhibited in early embryo development in rainbow trout. Treatments were mixed in ovarian fluid to represent conditions in which eggs rest prior to ejection under certain conditions such as acute stress or chemical exposure. It is important to note that the ovarian fluid in which the oocytes were incubated with their respective treatment groups consists of endogenous steroid hormones that play a significant role in steroid hormone content of unfertilized eggs and sexual differentiation of embryos (Feist et al., 1990, Olsen et al., 2001, 55 Bayunova et al., 2011) that may potentially interfere with the actions of the chemicals administered. Furthermore, xenoestrogen exposure has been found to alter ovarian fluid composition in Z. viviparous (Korsgaard et al., 2002, Finn, 2007), thus in ovo exposure to BPA by adding it to ovarian fluid may not truly simulate exposure through maternal ovarian fluid, since the effects that BPA exposure may have on ovarian fluid composition may not be fully represented. CHAPTER 2 - EFFECTS OF IN OVO EXPOSURE TO CORTISOL, BISPHENOL A AND THE ANTIESTROGEN ICI 182,780 ON VERTEBRAL MORPHOLOGY Introduction In the present series of studies, a high prevalence of vertebral deformities were noted in the early juvenile rainbow trout that were exposed to some of the treatment groups that contained BPA; other studies have reported similar malformations in early developmental stages of other teleost fish that were exposed to BPA (Urushitani et al., 2002, Warner & Jenkins, 2007, Duan et al, 2008). The microanatomical characteristics of these lesions have yet to be described. In addition, glucocorticoids are known to play a critical role in vertebral development in fish, and abnormal CL levels during embryonic development can exert detrimental effects on vertebral formation (McCormick & Nechaev, 2002). The intent of the study described here was to investigate further the actions of BPA alone or in combination with CL, and the GR and ER antagonists (RU and ICI, respectively) on vertebral development, with the purpose of finding an explanation of the malformations. To this end, histological analysis was made of the vertebral morphology in late stage rainbow trout embryos and early stage juveniles that were reared from either untreated oocytes (CC) or oocytes incubated prior to fertilization with BPA, Cl+BPA, or Cl+BPA+ICI. 56 Materials and Methods Animals See Chapter 1. Basic Experimental Design The experimental design with regards to treatment method, fertilization, and incubation are as described in Chapter 1. Samples taken without co-administration of CI (described later) were run separately with eggs pooled from 3 four year old rainbow trout (following the methods described in Chapter 1), fertilized with milt from 3 three-year old rainbow trout. Treatment Groups The treatment groups utilized for vertebral histological analysis are shown in Table 2.1. Chemicals See Chapter 1. Histological methods Embryos were sampled at 56-days post-fertilization (dpf) (CI), 55- and 72-dpf (Cl+BPA, Cl+BPA+ICI), and 44- and 65-dpf (CC, CC+ BPAb CC+BPAmb CC+BPAm2, CC+ BPAh) and fixed in 10% buffered formalin for at least 12 h. Prior to processing, the head and tails of the post- hatch embryos were removed leaving a section of the anterior embryo running the length of the yolk sac. The embryo sections were transferred from formalin to 70% ethanol, dehydrated through an series of ethanol baths (30 minutes in 90% alcohol, lhour in 100% alcohol, 1 hour in 100% alcohol), cleared in xylene (2 baths of 45 minutes each), and paraffin bath (2 baths of 1 hour each in hot paraffin). When finished the processing procedure, the sample sections were embedded in Paraplast paraffin. Paraffin blocked were sectioned to a thickness of 5 um revealing sections of the anterior notochord and mounted on slides. Once dried, slides were stained with haematoxylin and eosin. Sections were taken of the vertebral column in all animals analyzed just posterior to the head, showing sections of the anterior notochord. 57 Table 2.1. Treatment groups used for the study of the vertebral morphology of rainbow trout embryos and early juveniles reared from oocytes that had been subjected to these treatments for 3 h prior to fertilization. Concentrations of reagents in the oocyte Treatment groups incubation medium CC (control) - CI CI -0.1 ug/mL BPAi BPAi - 0.5 ug/mL BPAml BPAmi - 5 ug/mL BPA^ BPAm2 - 10 ug/mL BPAh BPAh - 50 ug/mL CI -0.1 ^ig/mL Cl+BPAh BPAh - 50 ug/mL CI-0.1 ug/mL Cl+BPAh+ICI BPAh - 50 ug/mL ICI - 1 ug/mL 58 Results The in ovo exposure to the combination of BPA (50 ug/mL) and CI (0.1 ixg/mL), and the combination of BPA, CI, and ICI (1 ug/mL) prior to fertilization had marked affects on the development of the notochord's chordoblast layer in late-stage embryos analysed. The CL-only (CI) group clearly depicted morphological characteristics of an embryonic notochord (Fig 2.1). Observable are the single-file layer of chordoblasts (Fig 2.1 A), the vacuolated chordocytes (Fig 2.IB) and the three-layered notochord sheath (Fig 2.1C). In all embryos examined, the chordoblast layer that was present in the notochord of CI embryos was absent in the Cl+BPA treatment group (Fig.2.2A). The notochord sheath and chordocytes are visible, however there appears to be no chordoblasts present, as normally observed (Fig, 2.2A). Similarly, the chordoblast layer appears to be absent in the Cl+BPA+ICI treatment group (Fig 2.2B). The morphological characteristics observed in the Cl+BPA and Cl+BPA+ICI (Fig. 2.2) treatment groups are similar between these two treatment groups in comparison to the CI treatment group (Fig 2.1). The control embryos (CC) are depicted in Figure 2.3A. Like CI, there is an observable notochord sheath, chordoblast layer, and interior chordocytes. The treatment groups containing BPA without co-administration of CL (CC+BPA1, CC+BPAml, CC+BPAm2, CC+BPAh) are depicted in Figure 2.3 B-E. Interestingly, in ovo exposure to BPA alone at their respective concentrations (0.5 ug/mL, 5 ug/mL, 9.95 ug/mL, and 50 ug/mL) did not exert the same effects on notochord morphology (Fig. 2.3 b-e) as did the Cl+BPA and Cl+BPA+ICI treatment groups (Fig 2.2). 59 B V-A/vv.' - ». ** V * * i i *-.* ** r • ;• f f 5 * <*A * V 1/ A \ F/gure 2.7. Light micrograph depicting a transverse section through the notochord of an animal of the Cortisol treatment group. The chordoblast layer (A), vaculated chordocytes (B), and notochord sheath (C) are shown. Scale bar = 0.05 mm. 60 *"*•; "* V •" ,- ** '^ .^C^,, '»*"* t3 si < < CO + &« % ^« «*- o o ""-.* 4) -a \ o N *% t o •*.,- T3 Si ffl o O :*v o o CI Jl . - ••Am*'.. •""• • , - 4*' j"> o 'V.. * . 1 / - *<•' • 1- £ a .t95 <=ir>> m o to "•*tfmt a -fa 1-1 / v .a m &50 ^+ > ^. ^ Pi rs; pq * ^>*a¥s^s*-^s^ t. »i Figure 2.3. Light micrograph depicting a transverse section through the notochord of a animals of the control (CC) (A), BPAi (B), BPAmi (C), BPAm2 (D), and BPAh (E) treatment groups. Scale bar = 0.05 mm. 62 Discussion The absence of the chordoblast layer in embryos reared from oocytes that had been incubated in Cl+BPA or Cl+BPA+ICI prior to fertilization indicates a marked disruption of normal notochord development in these animals. Chordoblasts are normally retained in salmonid embryos throughout development (Grotmol et al., 2006), and thus the absence of such cells suggests that notochord development can be interrupted by exposure to the combination of the GR and ER agonists (CL and BPA) prior to fertilization. This action may explain the tail deformities that have been reported in BPA exposed embryos in earlier studies (see below). Of particular note is that this response was not found in embryos reared from oocytes that had been incubated in BPA without co-incubation with CL, or in embryos reared from oocytes that had been incubated in CL alone, suggesting an interaction between BPA and CL (and also possibly ERs and GRs) is bringing about the observed morphological changes in the notochord. Also of interest was the observation that blockade of the ER with ICI did not prevent the development of the malformation. Numerous studies have cited the appearance of tail deformities (Urushitani et al, 2002, Warner & Jenkins, 2007, Duan et al, 2008) in teleost embryos exposed to BPA. These reports, together with the present observations, suggest that early BPA exposure can irreversibly affect spinal formation. While tail deformities in BPA-exposed fish have been well documented, the developmental mechanisms that underlie this phenomenon are still debated. The absence of chordoblasts during development may provide an important explanation for this phenomenon. Because the notochord plays such an important role in the development of the vertebral column (Grotmol et al, 2003, Fleming et al, 2004, Stemple, 2005), it is likely that any disruption to notochord development can lead to varying degrees of spinal malformations such as those seen in studies in which notochord development was halted or altered (Talbot et al, 1995, Stemple et al., 1996, Odenthal et al, 1996, Stemple, 2005). Thus, the prevalence of chordoblast development disruption following co-exposure to CL and BPA in the present study may be an important factor 63 in the spinal deformities that have been described previously. However, since the development of the notochord is so complex and still not fully understood it remains difficult to elucidate how CL and BPA, together, act to disrupt notochord development. This of course is made more difficult since BPA does not act specifically, but has been found to interact with various molecules such as the ERs and TRs. Additionally, BPA may be affecting development through various pathways, and spinal deformities observed in some BPA studies may be a result of a mechanism that differs from the one seen in this work. Further analysis is needed to establish the pathways that BPA may interfere with to inhibit proper notochord development. Some of the possible mechanisms are discussed below. Estrogen plays an important role in bone formation both in adults and in the developing vertebrate embryo. It is involved in the proliferation of osteoblast cells and mediates the deposition of cartilage and bone throughout development (Oursler et al, 1993). Various studies have shown that early exposure to excess amounts of E2 and endocrine-disrupting chemicals have resulted in vertebral deformities (Schuytema et al, 1991, Kolmstetter et al, 2000). Warner & Jenkins, (2007) found that exposure to the xenobiotics, 17a-ethinylestradiol (EE2) and BPA from 24-hpf to 26-days post hatch resulted in significant vertebral malformations in fathead minnow. The vertebral deformities found were most marked following exposure to EE2, and although less marked in BPA-exposed animals, the vertebral deformity patterns were similar (Warner & Jenkins, 2007). Bisphenol A has been significantly linked to vertebral deformities in various other studies. Urushitani et al. (2002) showed BPA-treated killifish (Fundulus heteroclitus) exhibited a deformed vertebral column, as well as eye extrusion and faded pigmentation. Furthermore, incomplete ossification of vertebrae as well as other bones was discovered. These findings suggest that BPA can act through its estrogenic actions to disrupt osteogenesis, resulting in vertebral malformations. It is suggested that the effects are mediated by ER directly, making it likely that BPA acts directly on vertebral formation by interaction with ERs in bone tissue. 64 However, in the present study, the BPA-related disruption of notochordal development may not act through estrogenic pathways. This is supported by the observation that BPA alone had no effect on ER gene expression, and the fact that the developmental disruption was still observed with the addition of the ER antagonist, ICI, to CL and BPA. A more likely explanation is that BPA acts through alternative pathways, possibly involving interactions with the thyroid signalling pathway. Limitations do exist in the current histological work including sample size and consistency of the area being sectioned. Additional trials with an increased sample size, while taking care to preserve consistent sectioning may help address this issue. Furthermore, sectioning not only in one area, but several may help to reduce the occurrence of false positives by examining the effect throughout the notochord. GENERAL DISCUSSION, CONCLUSIONS AND FUTURE DIRECTIONS FOR STUDY BPA did not affect ER expression in the present study and may act through an alternative pathway. Protein analysis of ERa and ERp1 would help to determine whether BPA exhibited translational effects on the ERs under these conditions. The change in GR expressoin caused by in ovo exposure to BPA may also be explained through BPA's possible use of another pathway. Similarly, the developmental effects of BPA on notochord development described in Chapter 2 is likely acting through a pathway other than the ERs since ICI was ineffective in inhibiting the observed effect. BPA has been found to exhibit antagonistic properties for both TRoc and TRp (Iwamuro et al., 2006). These effects have been observed from relatively low BPA concentrations ranging from 10"7 and 10"6 M (Iwamuro et al, 2006) to 10"5 and Iff4 M (Iwamuro et al, 2003). It is therefore possible that BPA in this instance may bind to TR rather than, or in addition to ER as 65 was expected. Further qPCR analysis using primers for the TRa and TRp genes would help to address this possibility. Heimeier et al. (2009) found that mX. laevis, BPA suppressed T3-induced transcription and inhibited T3-induced metamorphosis and gene expression. This resulted in vertebral deformities, as has also been demonstrated elsewhere (Baba et al., 2009). Furthermore, the presence of TH in early embryogenesis has been linked to normal stomach development as well as proper yolk absorption (Deane and Woo 2003). Yolk sac edema is a physiological response commonly observed as a result of BPA exposure during embryogenesis (Honkanen et al, 2004, Aluru et al, 2010), as was observed in BPA treated embryos in the present experiments. Further analysis is required to determine if the ability of BPA to act as a T3 antagonist is an important factor in the detriment observed to notochord development in rainbow trout In ovo exposure of treatments may play a role in the results observed in contrast to studies in which exposure occurred in vitro or in vivo. In the present study, oocytes were exposed to the various treatments for a period of 3 hours prior to fertilization. Other studies have exposed embryos to BPA over a wide variation in both concentration and duration. However in the wild, oocytes may be exposed to environmental pollutants such as BPA prior to fertilization through transfer of toxicants from the maternal extracellular fluid and through the environment in which they are released. Environmental contaminants, including xenobiotics, have been found in fish eggs as a result of maternal exposure, suggesting maternal transfer of these chemicals to the oocyte (Ostrach et ah, 2008). The developing embryos may continue to exist in aquatic environments that are contaminated with BPA; the reported contaminant levels range from 0.149 ug/L to 2980 ug/L (Osaki et al., 2006). In mammals, maternal BPA can be passed to the developing embryo throughout gestation (Xu et al, 2010) and via breast milk (Kuruto-Niwa et al, 2007, Ye et al, 2008). These complexities make it difficult to determine the full effect of BPA exposure prior to fertilization and throughout development. 66 Although experimental conditions do not exactly replicate conditions encountered in the wild, in ovo exposure to BPA may give a more accurate portrayal of its developmental effects in the wild. However, methods used in the current experiments can also be improved. It is difficult to determine the concentration of treatments and length of exposure to use as an appropriate representation of environmental conditions. The ER and GR blockers used, ICI and RU, were utilized to create a specific response; the blocking of these receptors. However, the effects CL and BPA would be best represented if environmental conditions can be replicated. Incorporating varying concentrations of BPA and a lipid analysis of BPA concentration in embryos may help to determine appropriate treatment conditions to best represent environmental exposure levels and effects. The results of the work discussed in this thesis has led to development of additional questions that need to be addressed in order to gain a clearer picture of embryonic development in rainbow trout with regards to stress-induced physiological mechanisms, cross talk between the ERs and GRs, and the developmental effects induced by an early one-time exposure to BPA. In this study, BPA did not alter ER gene expression as has been cited previously. In addition, the histopathological results suggest that BPA may not be acting via the ER as was previously hypothesized, but acts via different pathways; as discussed, TR involvement may be a possibility, but further analyses are required to confirm this hypothesis. Since BPA did not alter ER transcript levels, it was difficult to fully investigate the interactions between ERs and GRs and in future studies the inclusion of an E2 treatment group may provide new insights into the interactions, and also help form the basis of a comparative analysis between the activities of E2 itself and that of BPA. Genetic analysis of samples taken without co-administration with CL is essential to determine if CL is inhibiting the actions of BPA on the ERs. Analysis of these treatment groups may also provide a better understanding of the action of BPA on GR expression. The thyroid signalling pathway is a possible mechanism through which BPA is exerting these actions on GR 67 therefore analysis of T3, and TRa and /? mRNA would help to reveal any interaction of BPA with the thyroid system. Incorporating TR antagonists, such as NH3 (Grover et al., 2007, Figueira et al., 2011), into both the genetic and histological analyses may also provide further understanding of these processes. 68 REFERENCES Alexander, H.C., Dill D.C., Smith, L.W., Guiney, P.D. & Dorn, P.B. (1988). Bisphenol A: Acute aquatic toxicity. Environmental Toxicology and Chemistry, 7(1), 19-26. Alsop, D., Ings, J. S. & Vijayan, M. M. (2009). Adrenocorticotropic hormone suppresses gonadotropin-stimulated estradiol release from zebrafish ovarian follicles. PloS One, 4(7), e6463. Alsop, D. & Vijayan, M. M. (2008). Development of the corticosteroid stress axis and receptor expression in zebrafish. American Journal of Physiology.Regulatory, Integrative and Comparative Physiology, 294(3), R711-9. Alsop, D. & Vijayan, M. M. (2009). Molecular programming of the corticosteroid stress axis during zebrafish development. Comparative Biochemistry and Physiology. Part A, Molecular & Integrative Physiology, 153(1), 49-54. Aluru, N., Leatherland, J. F. & Vijayan, M. M. (2010). Bisphenol A in oocytes leads to growth suppression and altered stress performance in juvenile rainbow trout. PloS One, 5(5), el0741. Andersen, C. Y. (2002). Possible new mechanism of Cortisol action in female reproductive organs: Physiological implications of the free hormone hypothesis. Journal of Endocrinology, 773(2), 211-217. Auperin, B., & Geslin, M. (2008). Plasma Cortisol response to stress in juvenile rainbow trout is influenced by their life history during early development and by egg Cortisol content. General and Comparative Endocrinology, 158(3), 234-239. 69 Baba, K., Okada, K., Kinoshita, T. & Imaoka, S. (2009). Bisphenol A disrupts notch signaling by inhibiting gamma-secretase activity and causes eye dysplasia of Xenopus laevis. Toxicological Sciences, 108(2), 344-355. Baek, H. J., Hwang, I. J., Kim, K. S., Lee, Y. D., Kim, H. B. & Yoo, M. S. (2007). Effects of BPA and DES on longchin goby (Chasmichthys dolichognathus) in vitro during the oocyte maturation. Marine Environmental Research, 64(1), 79-86. Barkataki, S. (2007). In vitro stressor related changes in ovarian steroidogenesis in rainbow trout (Oncorhynchus mykiss). MSc Thesis, University of Guelph, Canada. Bayunova, L., Semenkoca, T., Canario, A.V.M., Gerasimov, A. & Barannikova, I. (2011). Free and conjugated androgen and progestin levels in the serum of stellate sturgeon (Acipenser stellatus Pallas) males treated with female coelomic fluid. Journal of Applied Ichthyology, 27(2), 655-659. Berg, H., Modig, C. & Olsson, P. E. (2004). 17P-Estradiol induced vitellogenesis is inhibited by Cortisol at the post-transcriptional level in arctic char (Salvelinus alpinus). Reproductive Biology and Endocrinology, 2(62). Berghold, P., Mostl, E. & Aurich, C. (2007). Effects of reproductive status and management on Cortisol secretion and fertility of oestrous horse mares. Animal Reproduction Science, 102(3- 4), 276-285. Bilang-Bleuel, A., Ulbricht, S., Chandramohan, Y., De Carli, S., Droste, S. K. & Reul, J. M. (2005). Psychological stress increases histone H3 phosphorylation in adult dentate gyrus granule neurons: Involvement in a glucocorticoid receptor-dependent behavioural response. European Journal of Neuroscience, 22(7), 1691-1700. 70 Borski, R. J. (2000). Nongenomic membrane actions of glucocorticoids in vertebrates. Trends in Endocrinology and Metabolism: TEM, 77(10), 427-436. Breen, K. M. & Karsch, F. J. (2006). New insights regarding glucocorticoids, stress and gonadotropin suppression. Frontiers in Neuroendocrinology, 27(2), 233-245. Carragher, J.F. & Sumpter, J.P. (1990). The effect of Cortisol on the secretion of sex steroids from cultured ovarian follicles of rainbow trout. General and Comparative Endocrinology, 77(3), 403-407. Cheskis B J. 2004. Regulation of cell signalling cascades by steroid hormones. J Cell Biochem P3(l):20-27. Cheskis, B. J., Greger, J. G., Nagpal, S., & Freedman, L. P. (2007). Signaling by estrogens. Journal of Cellular Physiology, 213(3), 610-617. Christ, B., Huang, R. & Wilting, J. (2000). The development of the avian vertebral column. Anatomy and Embryology, 202(3), 179-194. Currie, P.D. & Ingham, P.W. (1996). Induction of a specific muscle cell type by a hedgehog-like protein in zebrafish. Nature. 382, 452-455. Dauvois, S., Danielian, P. S., White, R. & Parker, M. G. (1992). Antiestrogen ICI 164,384 reduces cellular estrogen receptor content by increasing its turnover. Proceedings of the National Academy of Sciences of the United States of America, 89(9), 4037-4041. Dauvois, S., White, R. & Parker, M. G. (1993). The antiestrogen ICI 182780 disrupts estrogen receptor nucleocytoplasmic shuttling. Journal of Cell Science, 106(4), 1377-1388. 71 De Falco, M., Cobellis, L., Giraldi, D., Mastrogiacomo, A., Perna, A., Colacurci, N., Miele, L. & De Luca, A. (2007). Expression and distribution of notch protein members in human placenta throughout pregnancy. Placenta, 25(2-3), 118-126. Deane, E.E & Woo, N.Y.S. (2003). Ontogeny of thyroid hormones, Cortisol, hsp70 and hsp90 during silver sea bream larval development. Life Sciences 72, 805-818. Di, S., Maxson, M. M., Franco, A., & Tasker, J. G. (2009). Glucocorticoids regulate glutamate and GABA synapse-specific retrograde transmission via divergent nongenomic signaling pathways. Journal of Neuroscience, 29(2), 393-401. Duan, Z., Zhu, L., Zhu, L., Kun, Y. & Zhu, X. (2008). Individual and joint toxic effects of pentachlorophenol and bisphenol A on the development of zebrafish (Danio rerio) embryo. Ecotoxicology and Environmental Safely, 7/(3), 774-780 Fan, G., Zhu, Y., Guo, H., Wang, X., Wang, H., & Gao, X. (2011). Direct vasorelaxation by a novel phytoestrogen tanshinone IIA is mediated by nongenomic action of estrogen receptor through endothelial nitric oxide synthase activation and calcium mobilization. Journal of Cardiovascular Pharmacology, 57(3), 340-347. Farbridge, K.J. & Leatherland, J.F. (1992). Plasma growth hormone levels in fed and fasted rainbow trout (Oncorhynchus mykiss) are decreased following handling stress. Fish Physiology and Biochemistry, 10(\), 61-T5. Feist, G., Schreck, C.B., Fitzpatrick, M.S., & Redding, J.M. (1990). Sex steroid profiles of Coho Salmon (Oncorhynchus kisutch) during early development and sexual differentiation. General and Comparative Endocrinology, 80(2), 299-313 72 Figueira, A. C, Saidemberg, D. M., Souza, P. C, Martinez, L., Scanlan, T. S., Baxter, J. D., et al. (2011). Analysis of agonist and antagonist effects on thyroid hormone receptor conformation by hydrogen/deuterium exchange. Molecular Endocrinology, 25(1), 15-31. Finn, R. N. (2007). The physiology and toxicology of sahnonid eggs and larvae in relation to water quality criteria. Aquatic Toxicology, 81(4), 337-354. Fleming, A., Keynes, R. & Tannahill, D. (2004). A central role for the notochord in vertebral patterning. Development (Cambridge, England), 131(A), 873-880. Foo, J.T.W. & Lam, T.J. (1933). Retardation of ovarian growth and depression serum steroid levels in the tilapia, Oreochromis mossambicus, by Cortisol implantation. Aquaculture. 115: 133- 143. Gitau, R., Fisk, N. M., Teixeira, J. M., Cameron, A., & Glover, V. (2001). Fetal hypothalamic- pituitary-adrenal stress responses to invasive procedures are independent of maternal responses. Journal of Clinical Endocrinology and Metabolism, 86(1), 104-109 Glaser, R., & Kiecolt-Glaser, J. K. (2005). Stress-induced immune dysfunction: Implications for health. Nature Reviews. Immunology, 5(3), 243-251. Gould, J. C., Leonard, L. S., Maness, S. C., Wagner, B. L., Conner, K., Zacharewski, T., Safe, S., McDonnell, D. P. & Gaido, K. W. (1998). Bisphenol A interacts with the estrogen receptor alpha in a distinct manner from estradiol. Molecular and Cellular Endocrinology, 142(1-2), 203-214. Grotmol, S., Kryvi, H., Keynes, R., Krossoy, C, Nordvik, K. & Totland, G. K. (2006). Stepwise enforcement of the notochord and its intersection with the myoseptum: An evolutionary path leading to development of the vertebra? Journal of Anatomy, 209(3), 339-357. 73 Grotmol, S., Kryvi, H., Nordvik, K. & Totland, G. K. (2003). Notochord segmentation may lay down the pathway for the development of the vertebral bodies in the Atlantic salmon. Anatomy and Embryology, 207(4-5), 263-272. Grotmol, S., Nordvik, K., Kryvi, H. & Totland, G. K. (2005). A segmental pattern of alkaline phosphatase activity within the notochord coincides with the initial formation of the vertebral bodies. Journal of Anatomy, 206(5), 427-436. Grover, G. J., Dunn, C, Nguyen, N. H., Boulet, J., Dong, G., Domogauer, J., et al. (2007). Pharmacological profile of the thyroid hormone receptor antagonist NH3 in rats. Journal of Pharmacology and Experimental Therapeutics, 322(1), 385-390. Gunin, A. G., Emelianov, V. U. & Tolmachev, A. S. (2003). Expression of estrogen receptor-a, glucocorticoid receptor, p-catenin and glycogen synthase kinase-3(3 in the uterus of mice following long-term treatment with estrogen and glucocorticoid hormones. European Journal of Obstetrics, Gynecology, and Reproductive Biology, 107(\), 62-67. Grzanka, A., & Jarzab, J. (2009). [Nongenomic effects of glucocorticoids]. [Niegenomowy mechanizm dzialania glikokortykosteroidow] Pneumonologia i Alergologia Polska : Organ Polskiego Towarzystwa Ftyzjopneumonologicznego, Polskiego Towarzystwa Alergologicznego, i Instytutu Gruzlicy i Chorob Pluc, 77(A), 387-393. Haga, Y., Dominique, V. J.,3rd & Du, S. J. (2009). Analyzing notochord segmentation and intervertebral disc formation using the twhh:gfp transgenic zebrafish model. Transgenic Research, 18(5), 669-683. 74 Heimeier, R. A., Das, B., Buchholz, D. R. & Shi, Y. B. (2009). The xenoestrogen bisphenol A inhibits postembryonic vertebrate development by antagonizing gene regulation by thyroid hormone. Endocrinology, 150(6), 2964-2973. Heimeier, R. A. & Shi, Y. B. (2010). Amphibian metamorphosis as a model for studying endocrine disruption on vertebrate development: Effect of bisphenol A on thyroid hormone action. General and Comparative Endocrinology, 168(2), 181-189. Hobby A.C., Pankhurst, N.W. & Haddy, J.A. (2000). The effect of short term confinement stress on binding characteristics of sex steroid binding protein (SBP) in female black bream (Acanthopagrus butcheri) and rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry and Physiology, 125A, 85-94. Honkanen, J. O., Holopainen, I. J. & Kukkonen, J. V. (2004). Bisphenol A induces yolk-sac oedema and other adverse effects in landlocked salmon (Salmo salar m. sebago) yolk-sac fry. Chemosphere, 55(2), 187-196. Iwamuro, S., Sakakibara, M., Terao, M., Ozawa, A., Kurobe, C, Shigeura, T., Kato, M. & Kikuyama S. (2003). Teratogenic and anti-metamorphic effects of bisphenol A on embryonic and larval Xenopus laevis. General and Comparative Endocrinology, 133(2), 189-198. Iwamuro, S., Yamada, M., Kato, M. & Kikuyama, S. (2006). Effects of bisphenol A on thyroid hormone-dependent up-regulation of thyroid hormone receptor alpha and beta and down- regulation of retinoid X receptor gamma in Xenopus tail culture. Life Sciences, 79(23), 2165- 2171. 75 Johnson, R. L., Laufer, E., Riddle, R. D. & Tabin, C. (1994). Ectopic expression of sonic hedgehog alters dorsal-ventral patterning of somites. Cell, 79(7), 1165- 1173. Kalman, S.M. (1959). Sodium and water exchange in the trout egg. Journal of Cell and Comparative Physiology, 54(2), 155-162. Kaneko, M., Okada, R., Yamamoto, K., Nakamura, M., Mosconi, G., Polzonetti-Magni, A. M. & Kikuyama, S. (2008). Bisphenol A acts differently from and independently of thyroid hormone in suppressing thyrotropin release from the bullfrog pituitary. General and Comparative Endocrinology, 155(3), 574-580. Kang, I. J., Yokota, H., Oshima, Y., Tsuruda, Y., Oe, T., Imada, N., Tadokoro, H. & Honjo, T. (2002). Effects of bisphenol a on the reproduction of Japanese medaka (Oryzias latipes). Environmental Toxicology and Chemistry / SET AC, 21(11), 2394-2400. Kang, J. H., Asai, D., & Katayama, Y. (2007). Bisphenol A in the aquatic environment and its endocrine-disruptive effects on aquatic organisms. Critical Reviews in Toxicology, 37(1), 607-625. Kashiwada, S., Osaki, K., Yasuhara, A., & Ono, Y. (2005). Toxicity studies of landfill leachates using Japanese medaka (Oryzias latipes). Australasian Journal ofEcotoxicology, 11(2), 59- 71. Kashiwada, S., Oshnishi, Y., Ishikawa, H., Miyamoto, N. & Margara, Y. (2001). Comprehensive risk assessment of estradiol-170, p-nonylphenol and bisphenol A in riverwater in Japan. Environmental Science. 8(1), 89-102. 76 Katakami, H., Arimura, A., & Frohman, L. A. (1985). Involvement of hypothalamic somatostatin in the suppression of growth hormone secretion by central corticotropin-releasing factor in conscious male rats. Neuroendocrinology, 41(5), 390-393. Kawahata, H., Ohta, H., Inoue, M. & Suzuki, A. (2004). Endocrine disrupter nonylphenol and bisphenol A contamination in Okinawa and Ishigaki Islands, Japan—within coral reefs and adjacent river mouths. Chemosphere, 55(11), 1519-1527. Khan, F. A., Das, G. K, Pande, M., Pathak, M. K, & Sarkar, M. (2011). Biochemical and hormonal composition of follicular cysts in water buffalo (Bubalus bubalis). Animal Reproduction Science, 124( 1-2), 61-64. Kim, B.G. & Brown C.I. (1997). Interaction of Cortisol and thyroid hormone in larval development of Pacific threadfin. American Zoology, 37, 470-481 Kinyamu, H. K. & Archer, T. K. (2003). Estrogen receptor-dependent proteasomal degradation of the glucocorticoid receptor is coupled to an increase in mdm2 protein expression. Molecular and Cellular Biology, 25(16), 5867-5881. Kivlighan, K. T., DiPietro, J. A., Costigan, K. A., & Laudenslager, M. L. (2008). Diurnal rhythm of Cortisol during late pregnancy: Associations with maternal psychological well-being and fetal growth. Psychoneuroendocrinology, 35(9), 1225-1235. Klinge, C. M., Jernigan, S. C, Mattingly, K. A., Risinger, K. E. & Zhang, J. (2004). Estrogen response element-dependent regulation of transcriptional activation of estrogen receptors a and (3 by coactivators and corepressors. Journal of Molecular Endocrinology, 35(2), 387- 410. 77 Knight, A. (1963).The embryonic and larval development of the rainbow trout. Transactions of the American Fisheries Society, 92(4), 344-355. Kolmstetter, C, Munson, L. & Ramsay, E. C. (2000). Degenerative spinal disease in large felids. Journal of Zoo and Wildlife Medicine, 31(1), 15-19. Korsgaard, B., Andreassen, T. K., & Rasmussen, T. H. (2002). Effects of an environmental estrogen, 17a-ethinyl-estradiol, on the maternal-fetal trophic relationship in the eelpout (Zoarces viviparous). Marine Environmental Research, 54(i-5), 735-739. Kuiper, G. G., Lemmen, J. G., Carlsson, B., Corton, J. C, Safe, S. H., van der Saag, P. T., van der Burg, B. & Gustafsson J.-A. (1998). Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor p. Endocrinology, 759(10), 4252-4263. Kuriyama, S., Ueda, A. & Kinoshita, T. (2003). Xerl is a secreted protein required for establishing the neural plate/neural crest boundary in Xenopus embryo. Journal of Experimental Zoology. Part A, Comparative Experimental Biology, 296(2), 108-116. Kuruto-Niwa, R., Tateoka, Y., Usuki, Y., & Nozawa, R. (2007). Measurement of bisphenol A concentrations in human colostrum. Chemosphere, 66(6), 1160-1164. Kwak, H. I., Bae, M. O., Lee, M. H., Lee, Y. S., Lee, B. J., Kang, K. S., et al. (2001). Effects of nonylphenol, bisphenol A, and their mixture on the viviparous swordtail fish (Xiphophorus helleri). Environmental Toxicology and Chemistry / SET AC, 20(A), 787-795. Lahnsteiner, F., Weismann, T., & Patzner, R. A. (1995). Composition of the ovarian fluid in 4 salmonid species: Oncorhynchus mykiss, Salmo truttaflacustris, Salvelinus alpinus and Hucho hucho. Reproduction, Nutrition, Development, 35(5), 465-474. 78 Lahnsteiner, F. (2000). Morphological, physiological and biochemical parameters characterizing the over-ripening of rainbow trout eggs. Fish Physiology and Biochemistry, 23(2), 107-118. Lahnsteiner, F., Berger, B., Kletzl, M. & Weismann, T. (2005). Effect of bisphenol A on maturation and quality of semen and eggs in the brown trout, Salmo truttaf.fario. Aquatic Toxicology, 75(3), 213-224. Lahoz, M. M., Nagle, C. A., Porta, M., Farinati, Z. & Manzur, T. D. (2007). Cortisol response and ovarian hormones in juvenile and cycling female cebus monkeys: Effect of stress and dexamethasone. American Journal ofPrimatology, 69(5), 551-561. Leatherland, J.F. & Barrett, S.B. (1993). Investigations into the development of the pituitary gland- thyroid tissue axis and distribution of tissue thyroid hormone content in embryonic coho salmon (Oncorhynchus kisutch) from Lake Ontario. Fish Physiology & Biochemistry, 12: 149-159, Leatherland, J. F., Li, M. & Barkataki, S. (2010). Stressors, glucocorticoids and ovarian function in teleosts. Journal of Fish Biology, 76(1), 86-111. Lemon, B. D. & Freedman, L. P. (1999). Nuclear receptor cofactors as chromatin remodelers. Current Opinion in Genetics & Development, 9(5), 499-504. Lethimonier, C, Flouriot, G., Kah, O. & Ducouret, B. (2002). The glucocorticoid receptor represses the positive autoregulation of the trout estrogen receptor gene by preventing the enhancer effect of a C/EBPP-like protein. Endocrinology, 143(8), 2961-2974. Lethimonier, C, Flouriot, G., Valotaire, Y., Kah, O. & Ducouret, B. (2000). Transcriptional interference between glucocorticoid receptor and estradiol receptor mediates the inhibitory effect of Cortisol on fish vitellogenesis. Biology of Reproduction, 62(6), 1763-1771. 79 Levy, G., Lutz, I., Kruger, A. & Kloas, W. (2004). Bisphenol A induces feminization mXenopus laevis tadpoles. Environmental Research, 94(\), 102-111. Li, M., Bureau, D. P., King, W. A., & Leatherland, J. F. (2010). The actions of in ovo Cortisol on egg fertility, embryo development and the expression of growth-related genes in rainbow trout embryos, and the growth performance of juveniles. Molecular Reproduction and Development, 77(10), 922-931. Liu, S., & Mauvais-Jarvis, F. (2009). Rapid, nongenomic estrogen actions protect pancreatic islet survival. Islets, -/(3), 273-275. Lowenberg, M., Verhaar, A. P., van den Brink, G. R., & Hommes, D. W. (2007). Glucocorticoid signalling: A nongenomic mechanism for T-cell immunosuppression. Trends in Molecular Medicine, 73(4), 158-163. Makino, I., Matsuda, Y., Yoneyama, M., Hirasawa, K., Takagi, K., Ohta, H., et al. (2009). Effect of maternal stress on fetal heart rate assessed by vibroacoustic stimulation. Journal of International Medical Research, 37(6), 1780-1788. Matthews, J. & Gustaffson, A. (2003). Estrogen signalling: a subtle balance between the ERa and ERp\ Molecular Interventions, 3(5), 281-292. Matthews, J. B., Twomey, K. & Zacharewski, T. R. (2001). In vitro and in vivo interactions of bisphenol A and its metabolite, bisphenol A glucuronide, with estrogen receptors a and (3. Chemical Research in Toxicology, 14(2), 149-157. Matthews, S. G., & Phillips, D. I. (2010). Minireview: Transgenerational inheritance of the stress response: A new frontier in stress research. Endocrinology, 151(1), 7-13. 80 McCormick, M. I. & Nechaev, I. V. (2002). Influence of Cortisol on developmental rhythms during embryogenesis in a tropical damselfish. The Journal of Experimental Zoology, 293(5), 456- 466. McEwen, B.S. (2000). Allostasis and allostatic load: implications for neuropsychopharmacology. Neuropsychophamacology, 22(2), 108-124. Meijsing, S. H., Pufall, M. A., So, A. Y., Bates, D. L., Chen, L. & Yamamoto, K. R. (2009). DNA binding site sequence directs glucocorticoid receptor structure and activity. Science, 324(5925), 407-410. Metz, J. R., Geven, E. J., van den Burg, E. H. & Flik, G. (2005). ACTH, a-MSH, and control of Cortisol release: Cloning, sequencing, and functional expression of the melanocortin-2 and melanocortin-5 receptor in Cyprinus carpio. American Journal of Physiology.Regulatory, Integrative and Comparative Physiology, 289(3), R814-26. Moriyama, K., Tagami, T., Akamizu, T., Usui, T., Saijo, M., Kanamoto, N., et al. (2002). Thyroid hormone action is disrupted by bisphenol A as an antagonist. Journal of Clinical Endocrinology and Metabolism, 57(11), 5185-5190. Nordvik, K. (2007). From notochord to vertebral column: studies on Atlantic salmon (Salmo salar L.). PhD Dissertation, University of Bergen, Norway. Nyirenda, M.J., Carter, R., Tang, J.I., de Vries, A., Schlumbohm, C, et al, (2009). Prenatal programming of metabolic syndrome in the common marmoset is associated with increased expression of 11 (3-hydroxysteroid dehydrogenase type 1. Diabetes, 55(12), 2873-2879. 81 Oakley, A. E., Breen, K. M., Clarke, I. J., Karsch, F. J., Wagenmaker, E. R. & Tilbrook, A. J. (2009). Cortisol reduces gonadotropin-releasing hormone pulse frequency in follicular phase ewes: Influence of ovarian steroids. Endocrinology, 150(1), 341-349. Odenthal, J., Haffter, P., Vogelsang, E., Brand, M., van Eeden, F. J., Furutani-Seiki, M., et al. (1996). Mutations affecting the formation of the notochord in the zebrafish, Danio rerio. Development, 123(23), 103-115. Oehlmann, J., Oetken, M. & Schulte-Oehlmann, U. (2008). A critical evaluation of the environmental risk assessment for plasticizers in the freshwater environment in Europe, with special emphasis on bisphenol A and endocrine disruption. Environmental Research, 108(2), 140-149. Oliveira, C. A., Nie, R., Carnes, K., Franca, L. R., Prins, G. S., Saunders, P. T., et al. (2003). The antiestrogen ICI 182,780 decreases the expression of estrogen receptor-a but has no effect on estrogen receptor-(3 and androgen receptor in rat efferent ductules. Reproductive Biology and Endocrinology, 1, 75-87. Olsen, K.H., Bjerselius, R., Mayer, I., & Kindahl, H. (2001). Both ovarian fluid and female urine increase sex steroid hormone levels in mature Atlantic Salmon (Salmo salar) male parr. Journal of Chemical Ecology, 27(11), 2337-2349. Osaki, K., Kashiwada, S., Tatarazako, N. & Ono, Y. (2006). Toxicity testing of leachate from waste landfills using medaka (Oryzias latipes) for monitoring environmental safety. Environmental Monitoring and Assessment, 777(1-3), 73-84. 82 Otto, C, Wessler, S., & Fritzemeier, K. H. (2006). Exploiting nongenomic estrogen receptor- mediated signaling for the development of pathway-selective estrogen receptor ligands. Ernst Schering Foundation Symposium Proceedings, 1(1), 163-181. Oursler, M.J., Landers, J.P., Riggs, B.L. & Spelsberg, T.C. (1993). Oestrogen effects on osteoblasts and osteoclasts. Annals of Medicine. 25(4): 361-371. Pankhurst, N.W. & Van Der Kraak, G. (2000). Evidence that acute stress inhibits ovarian steroidogenesis in rainbow trout in vivo through the action of Cortisol. General and Comparative Endocrinology, 117(2), 225-237. Park, Y.-S., Choi, Y.H., Park, C.-H, & Kim, K-T. (2008). Nongenomic glucocorticoid effects on activity-dependent potentiation of catecholamine release in chromaffin cells. Endocrinology, 149(10), 4921-4927 Pastva, S. D., Villalobos, S. A., Kannan, K. & Giesy, J. P. (2001). Morphological effects of bisphenol-A on the early life stages of medaka (Oryzias latipes). Chemosphere, 45(4-5), 535-541. Pierce, B. N., Hemsworth, P. H., Rivalland, E. T., Wagenmaker, E. R., Morrissey, A. D., Papargiris, M. M., et al. (2008). Psychosocial stress suppresses attractivity, proceptivity and pulsatile LH secretion in the ewe. Hormones and Behaviour, 54(3), 424-434. Pino, P.L, Singh, P.B., Condeca, J.B., Teodosio, H.R., Power, D.M. & Canario, A. V. (2006). ICI 182,780 has agonistic effects and synergizes with estradiol-17p in fish liver, but not in testis. Reproductive Biology and Endocrinology, 4(61), 1-11. 83 Platz, F. (2006). Structural and experimental investigations of the functional anatomy and the turgor of the notochord in the larval tail of anuran tadpoles. Annals of Anatomy = Anatomischer Anzeiger, 188(4), 289-302. Pottinger, T. G. & Pickering, A. D. (1990). The effect of Cortisol administration on hepatic and plasma estradiol-binding capacity in immature female rainbow trout (Oncorhynchus mykiss). General and Comparative Endocrinology, 80(2), 264-273. Puertas, A., Frias, J., Ruiz, E., & Orega, E. (1996). Effect of CRF injected into the median eminence on GH secretion in female rats under different steroid status. Neurochemical Research, 27(8), 897-901. Quaedackers, M. E., van den Brink, C. E., van der Saag, P. T. & Tertoolen, L. G. (2007). Direct interaction between estrogen receptor a and NF-KB in the nucleus of living cells. Molecular and Cellular Endocrinology, 273(1-2), 42-50. Raine, J.C. & Leatherland, J.F. (2003). Trafficking of L-triiodothyronine between ovarian fluid and oocytes of rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry and Physiology, 136B, 267-274 Reini, S. A., Dutta, G., Wood, C. E., & Keller-Wood, M. (2008). Cardiac corticosteroid receptors mediate the enlargement of the ovine fetal heart induced by chronic increases in maternal Cortisol. Journal of Endocrinology, 198(2), 419-427. Schaaf, M. J., Chatzopoulou, A. & Spaink, H. P. (2009). The zebrafish as a model system for glucocorticoid receptor research. Comparative Biochemistry and Physiology.Part A, Molecular & Integrative Physiology, 153(1), 75-82. 84 Schuytema, G. S., Nebeker, A. V., Griffis, W. L. & Wilson, K. N. (1991). Teratogenesis, toxicity, and bioconcentration in frogs exposed to dieldrin. Archives of Environmental Contamination and Toxicology, 21(3), 332-350. Seiwa, C., Nakahara, J., Komiyama, T., Katsu, Y., Iguchi, T. & Asou, H. (2004). Bisphenol A exerts thyroid hormone-like effects on mouse oligodendrocyte precursor cells. Neuroendocrinology, 80(1), 21-30. Signorile, P. G., Spugnini, E. P., Mita, L., Mellone, P., D'Avino, A., Bianco, M., et al. (2010). Pre natal exposure of mice to bisphenol A elicits an endometriosis-like phenotype in female offspring. General and Comparative Endocrinology, 168(3), 318-325. Sohoni, P., Tyler, C. R., Hurd, K., Caunter, J., Hetheridge, M., Williams, T., et al. (2001). Reproductive effects of long-term exposure to bisphenol A in the fathead minnow (pimephales promelas). Environmental Science & Technology, 55(14), 2917-2925. Song RXD, McPherson RA, Adam L, Bao Y, ShupnikM, Kumar R, Santen RJ. (2002). Linkage of rapid estrogen action to MAPK activation by ERa-Shc association and She pathway activation. Molecular Endocrinology, 76(1): 116-127. Song, RXD, Barnes CJ, Zhang Z, BaoY, KumarR, SantenRJ. (2004). The role of She and insulin like growth factor 1 receptor inmediating the translocation of estrogen receptor a to the plasma membrane. Proceedings of the National Academy of Sciences, 101(1), 2076—2081. Staab, C. A. & Maser, E. (2010). 11 P-Hydroxysteroid dehydrogenase type 1 is an important regulator at the interface of obesity and inflammation. Journal of Steroid Biochemistry and Molecular Biology, 119(1-2), 56-72. 85 Staples, C. A., Dorn, P. B., Klecka, G. M., O'Block, S. T., & Harris, L. R. (1998). A review of the environmental fate, effects, and exposures of bisphenol A. Chemosphere, 56(10), 2149- 2173. Stellato, C. (2004). Post-transcriptional and nongenomic effects of glucocorticoids. Proceedings of the American Thoracic Society, 7(3), 255-263. Stemple, D. L. (2005). Structure and function of the notochord: An essential organ for chordate development. Development, 132(11), 2503-2512. Stemple, D. L., Solnica-Krezel, L., Zwartkruis, F., Neuhauss, S. C, Schier, A. F., Malicki, J., et al. (1996). Mutations affecting development of the notochord in zebrafish. Development, 123(23), 117-128. Stolte, E. H., de Mazon, A. F., Leon-Koosterziel, K. M., Jesiak, M., Bury, N. R., Sturm, A., et al. (2008). Corticosteroid receptors involved in stress regulation in common carp, Cyprinus carpio. Journal of Endocrinology, 198(2), 403-417. Sunak, N., Green, D.F., Abeydeera, L.R., Thurston, L.M., & Michael, A.E. (2007). Implication of Cortisol and 11 P-hydroxysteroid dehydrogenase enzymes in the development of porcine (Sus scrofa domestica) ovarian follicles and cysts. Reproduction, 133(6), 1149-1158. Szisch, V., Papandroulakis, N., Fanouraki, E. & Pavlidis, M. (2005). Ontogeny of the thyroid hormones and Cortisol in the gilthead sea bream, Sparus aurata. General and Comparative Endocrinology, 142(1-2), 186-192. Takao, T., Nanamiya, W., Nazarloo, H. P., Matsumoto, R., Asaba, K. & Hashimoto, K. (2003). Exposure to the environmental estrogen bisphenol A differentially modulated estrogen 86 receptor-a and -P immunoreactivity and mRNA in male mouse testis. Life Sciences, 72(10), 1159-1169. Talbot, W.S., Trevarrow, B., Halpern, M.E., Melby, A.E., Farr, G., Postlethwait, J.H., Jowett, T., Kimmel, C.B. & Kimelman, D. (1995). A homeobox gene essential for zebrafish notochord development. Nature. 378, 150-157. Tasker, J.G., Di, S., & Malcher-Lopes, R. (2006). Rapid Glucocorticoid Signaling via Membrane- Associated Receptors. Endocrinology, 147(12), 5549-5556. Teitsma, C. A., Anglade, I., Toutirais, G., Munoz-Cueto, J. A., Saligaut, D., Ducouret, B., et al. (1998). Immunohistochemical localization of glucocorticoid receptors in the forebrain of the rainbow trout (Oncorhynchus mykiss). Journal of Comparative Neurology, 401(3), 395-410. Tenhola, S., Todorova, B., Jaaskelainen, J., Janne, O. A., Raivio, T., & Voutilainen, R. (2010). Serum glucocorticoids and adiponectin associate with insulin resistance in children born small for gestational age. European Journal of Endocrinology /European Federation of Endocrine Societies, 162(3), 551-557. Teyssier, C, Belguise, K., Galtier, F. & Chalbos, D. (2001). Characterization of the physical interaction between estrogen receptor alpha and JUN proteins. Journal of Biological Chemistry, 276(39), 36361-36369. Thaker, P. H., Han, L. Y., Kamat, A. A., Arevalo, J. M., Takahashi, R., Lu, C, et al. (2006). Chronic stress promotes tumour growth and angiogenesis in a mouse model of ovarian carcinoma. Nature Medicine, 12(8), 939-944. 87 Thurston, L. M., Abayasekara, D. R. & Michael, A. E. (2007). 11 P-Hydroxysteroid dehydrogenase expression and activities in bovine granulosa cells and corpora lutea implicate corticosteroids in bovine ovarian physiology. Journal of Endocrinology, 193(2), 299-310. Tilbrook, A. J., Canny, B. J., Serapiglia, M. D., Ambrose, T. J. & Clarke, I. J. (1999). Suppression of the secretion of luteinizing hormone due to isolation/restraint stress in gonadectomised rams and ewes is influenced by sex steroids. The Journal of Endocrinology, 160(3), 469-481. Touitou, Y., Bogdan, A., Levi, F., Benavides, M., & Auzeby, A. (1996). Disruption of the circadian patterns of serum Cortisol in breast and ovarian cancer patients: Relationships with tumour marker antigens. British Journal of Cancer, 74(8), 1248-1252. Urushitani, H., Shimizu, A., Katsu, Y. & Iguchi, T. (2002). Early estrogen exposure induces abnormal development of Fundulus heteroclitus. Journal of Experimental Zoology, 293(7), 693-702. van der Eerden, B. C, Emons, J., Ahmed, S., van Essen, H. W., Lowik, C. W., Wit, J. M., et al. (2002). Evidence for genomic and nongenomic actions of estrogen in growth plate regulation in female and male rats at the onset of sexual maturation. The Journal of Endocrinology, 775(2), 277-288. Vandenberg, L. N., Maffini, M. V., Sonnenschein, C, Rubin, B. S. & Soto, A. M. (2009). Bisphenol-A and the great divide: A review of controversies in the field of endocrine disruption. Endocrine Reviews, 30(\), 75-95. Voordeckers, J. W., Fennell, D. E., Jones, K., & Haggblom, M. M. (2002). Anaerobic biotransformation of tetrabromobisphenol A, tetrachlorobisphenol A, and bisphenol A in estuarine sediments. Environmental Science & Technology, 36(4), 696-701. 88 Warner, K. E. & Jenkins, J. J. (2007). Effects of 17a-ethinylestradiol and bisphenol A on vertebral development in the fathead minnow (Pimephales promelas). Environmental Toxicology and Chemistry /SETAC, 26(A), 732-737. Watanabe, Y., Kokubo, H., Miyagawa-Tomita, S., Endo, M., Igarashi, K., Aisaki, K., et al. (2006). Activation of Notch 1 signaling in cardiogenic mesoderm induces abnormal heart morphogenesis in mouse. Development, 133(9), 1625-1634. Watson, C. S., Jeng, Y. J., & Guptarak, J. (2011). Endocrine disruption via estrogen receptors that participate in nongenomic signaling pathways. Journal of Steroid Biochemistry and Molecular Biology, Welberg, L. A., Seckl, J. R., & Holmes, M. C. (2001). Prenatal glucocorticoid programming of brain corticosteroid receptors and corticotrophin-releasing hormone: Possible implications for behaviour. Neuroscience, 104(1), 71-79. Williams, G. R., Franklyn, J. A. & Sheppard, M. C. (1991). Thyroid hormone and glucocorticoid regulation of receptor and target gene mRNAs in pituitary GH3 cells. Molecular and Cellular Endocrinology, 80(1-3), 127-138. Wintour, E. M. (2006). Cortisol: A growth hormone for the fetal heart? Endocrinology, 147(8), 3641-3642. Xu, X. H., Wang, Y. M., Zhang, J., Luo, Q. Q., Ye, Y. P. & Ruan, Q. (2010). Perinatal exposure to bisphenol-A changes A'-methyl-D-aspartate receptor expression in the hippocampus of male rat offspring. Environmental Toxicology and Chemistry /SETAC, 29(1), 176-181. Yan, Y. L., Hatta, K., Riggleman, B. & Postlethwait, J. H. (1995). Expression of a type II collagen gene in the zebrafish embryonic axis. Developmental Dynamics, 203(3), 363-376. 89 Yao, M., Hu, F. & Denver, R. J. (2008). Distribution and corticosteroid regulation of glucocorticoid receptor in the brain of Xenopus laevis. Journal of Comparative Neurology, 508(6), 967- 982. Ye, X., Bishop, A. M., Needham, L. L., & Calafat, A. M. (2008). Automated on-line column- switching HPLC-MS/MS method with peak focusing for measuring parabens, triclosan, and other environmental phenols in human milk. Analytica Chimica Acta, 622(1-2), 150-156. Zha, J. & Wang, Z. (2006). Acute and early life stage toxicity of industrial effluent on Japanese medaka (Oryzias latipes). Science of the Total Environment, 357(1-3), 112-119. 90