1 Major Subject Area: Neuroscience 2 3 4 Differential Effects of Light and Feeding on Circadian Organization of Peripheral Clocks 5 in a Forebrain Bmal1 Mutant 6 7 8 Mariko Izumo1,a, Martina Pejchal2,a, Andrew C Schook2,3, Ryan P Lange2, Jacqueline A 9 Walisser4, Takashi R Sato5,6, Xiaozhong Wang7, Christopher A Bradfield4, and Joseph S 10 Takahashi1,8,* 11 12 1Department of Neuroscience, University of Texas Southwestern Medical Center, Dallas, United 13 States; 2Department of Neurobiology, Northwestern University, Evanston, United States; 14 3Howard Hughes Medical Institute, Evanston, United States; 4McArdle Laboratory for Cancer 15 Research, University of Wisconsin, Madison, United States; 5Werner Reichardt Centre for 16 Integrative Neuroscience, University of Tübingen, Tübingen, Germany; 6JST, PRESTO, 17 University of Tübingen, Tübingen, Germany; 7Department of Molecular Biosciences, 18 Northwestern University, Evanston, United States; 8Howard Hughes Medical Institute, Dallas, 19 United States. 20 21 a These authors contributed equally. 22 23 * For correspondence: [email protected] 24 25 Corresponding author: 26 Joseph S. Takahashi 27 Mailing address: Department of Neuroscience, University of Texas Southwestern Medical 28 Center, 5323 Harry Hines Blvd, NA4.118, Dallas, Texas 75390-9111 29 Telephone: 214-648-1876 30 Fax: 214-648-1801 31 E-mail: [email protected] 32 33 34 Manuscript information: 55 text pages (including references and figure legends), 9 figures, 35 supplemental figures & tables (5 figures and 7 tables). 36 37 38 Abbreviations: BAC, bacterial artificial chromosome; CT, circadian time; DD, constant 39 darkness; DMH, dorsomedial hypothalamus; FAA, food-anticipatory activity; FFT, fast Fourier 40 transform; FR, food restriction; LD 12:12, 12-hr light, 12-hr dark cycle; LL, constant light; Luc. 41 luciferase; Per2, Period2; SCN, suprachiasmatic nucleus; ZT, zeitgeber time 42

43 Keywords: circadian rhythms, Bmal1, Cre/loxP, suprachiasmatic nucleus, peripheral clocks, light 44 entrainment, food entrainment

45

1 46 Abstract

47 In order to assess the contribution of a central clock in the hypothalamic suprachiasmatic nucleus

48 (SCN) to circadian behavior and the organization of peripheral clocks, we generated

49 forebrain/SCN-specific Bmal1 knockout mice by using floxed Bmal1 and pan-neuronal Cre lines.

50 The forebrain knockout mice showed >90% deletion of BMAL1 in the SCN and exhibited an

51 immediate and complete loss of circadian behavior in constant conditions. Circadian rhythms in

52 peripheral tissues persisted, but became desynchronized and damped in constant darkness. The

53 loss of synchrony was rescued by light/dark cycles, and partially by restricted feeding (only in

54 the liver and kidney but not in the other tissues) in a distinct manner. These results suggest that

55 the forebrain/SCN is essential for the internal temporal order of robust circadian programs in

56 peripheral clocks; thus,individual peripheral clocks are affected differently by light and feeding

57 in the absence of a functional oscillator in the forebrain.

58

59

60 Impact Statement:

61 Conditional deletion of Bmal1 in the forebrain/SCN reveals an essential role of a

62 functional master clock in maintaining synchronized and high amplitude rhythms of peripheral

63 clocks.

64

65

2 66 Introduction

67 The suprachiasmatic nucleus (SCN) in the hypothalamus is the primary regulator of daily

68 rhythms of behavior and physiology in mammals (Meijer and Rietveld, 1989; Ralph et al., 1990;

69 Sujino et al., 2003; Welsh et al., 2010), yet the majority of tissues in the body possess

70 autonomous cellular oscillators (Yamazaki et al., 2000; Abe et al., 2002; Nagoshi et al., 2004;

71 Welsh et al., 2004; Yoo et al., 2004; Abraham et al., 2005). The circadian clock in the SCN as

72 well as in other mammalian cells is composed of interacting positive and negative transcriptional

73 and post-translational feedback loops involving Clock and Bmal1 transcription factors and their

74 target genes, Period (Per1, 2, and 3) and Cryptochrome (Cry1 and 2) (King et al., 1997; Gekakis

75 et al., 1998; Hogenesch et al., 1998; Lee et al., 2001; Lowrey and Takahashi, 2004; Lowrey and

76 Takahashi, 2011; Mohawk et al., 2012; Huang et al., 2012). Extensive evidence suggests that the

77 SCN controls not only behavioral rhythms but also the circadian programs of peripheral tissues

78 (Yoo et al., 2004; Guo et al., 2005; Guo et al., 2006; Saini et al., 2013; Yamaguchi et al., 2013).

79 However, much remains unclear regarding the relationship between the central clock and

80 peripheral oscillators, which can be entrained by many different stimuli (Stokkan et al., 2001;

81 Buhr et al., 2010; Saini et al., 2012). To clarify the contribution of a central clock to the

82 circadian rhythms of peripheral tissues, we sought to find a way to disable the molecular

83 oscillators in the brain without affecting the genetic components in the rest of the body.

84 Traditionally, a functional role of a gene has been investigated by a gene targeting

85 strategy, which eliminates the gene from embryonic stem cells so that it is inactivated

86 ubiquitously in mice. While this approach provides a powerful method to study the function of

87 genes in vivo, it cannot be applied to genes that affect developmental or metabolic processes

88 crucial for survival. Moreover, even if the knockout mice survive to adulthood, some lines suffer

3 89 from systemic conditions and hence require special handling in experiments. For instance,

90 although a global knock out of Bmal1 (Bmal1-/-) completely eliminates circadian rhythms

91 (Bunger et al., 2000), the animals suffer from morbid conditions including arthropathy (Bunger

92 et al., 2005), sterility (Alvarez et al., 2008; Boden et al., 2010), defects in glucose homeostasis

93 (Rudic et al., 2004; Lamia et al., 2008; Marcheva et al., 2010), premature aging and decreased

94 lifespan [their average lifespan is 37 weeks (Kondratov et al., 2006; Sun et al., 2006)]. Possibly

95 due to the pleiotropic effects of Bmal1, results of studies such as food entrainment behavior with

96 Bmal1-/- mice have been controversial (Fuller et al., 2008; Mistlberger et al., 2008; Fuller et al.,

97 2009; Mistlberger et al., 2009a; Mistlberger et al., 2009b; Pendergast et al., 2009; Storch and

98 Weitz, 2009; Mieda and Sakurai, 2011). To circumvent these problems, conditional knockout

99 techniques utilizing Cre recombinase and loxP sequences have been applied widely in the

100 nervous system (Gavériaux-Ruff and Kieffer, 2007; Taniguchi et al., 2011). However, until

101 recently, Cre drivers that can efficiently recombine a floxed allele in the majority of SCN

102 neurons have not been identified [(Mieda and Sakurai, 2011; Musiek et al., 2013) but see (Husse

103 et al., 2011)].

104 Here, we examined the ability of a forebrain-specific Cre driver to excise floxed alleles of

105 Bmal1, a critical component of the molecular oscillator, specifically from brain regions including

106 the SCN. The resulting knockout mice were devoid of BMAL1 expression in the forebrain/SCN

107 but not in other peripheral tissues. Unlike Bmal1 global knockout mice, Bmal1 forebrain

108 knockouts did not display detectable defects in reproduction, activity, body weight or life span,

109 thereby providing an ideal model to study circadian physiology in the absence of a central clock.

110 These genetically engineered mice are better experimentally controlled than mice that receive

111 SCN lesions, which is a classic method to induce arrhythmic behavior in rodents (Meijer and

4 112 Rietveld, 1989). With SCN lesions, precise removal of the SCN tissue varies from mouse to

113 mouse and requires laborious confirmation of the excision. In addition, ablation of the SCN

114 destroys neuronal networks and communication pathways, rendering the network responses and

115 mechanisms incapacitated.

116 With forebrain-specific Bmal1 knockout mice, we examined the impact of defunct brain

117 clocks on the organization of peripheral oscillators as well as their response to environmental

118 signals such as light and food. Cre-mediated excision of Bmal1 in the forebrain/SCN confers

119 complete arrhythmicity to circadian behavior. In contrast to the abolition of rhythms in the SCN,

120 all peripheral tissues in these mice sustained circadian rhythmicity; however, they lacked phase

121 coordination and normal amplitude in constant darkness. The synchrony and the oscillatory

122 amplitude of peripheral rhythms in these mice were completely rescued by exposure to LD

123 cycles, but not fully in time-restricted feeding experiments. The feeding cues appear to control

124 the phase expression of the peripheral clocks in a tissue-specific way and in a distinct manner

125 from light. These results demonstrate that an intact central clock plays an essential role in

126 driving normal circadian behavior as well as synchronized and robust circadian programs in

127 peripheral clocks and that light and feeding act on individual peripheral clocks differently in the

128 absence of a functional oscillator in the SCN.

129

130 Results

131 Forebrain/SCN-specific deletion of Bmal1

132 Bmal1 (also known as Arntl, Mop3) is one of the essential components of the molecular

133 oscillator, unique in that the single knockout of Bmal1 can confer arrhythmicity both at the

134 behavioral and molecular levels (Bunger et al., 2000). To generate a forebrain-specific knockout

5 135 of circadian rhythms, we crossed floxed Bmal1 (Bmal1fx/fx) mice (Johnson et al., 2014) to

136 Camk2a::iCreBAC mice (CamiCre or Cre) (Casanova et al., 2001) and produced CamiCre+;

137 Bmal1fx/fx (that we denote as “Brain” Knockout, BKO, defined as a forebrain-specific knockout)

138 as well as Bmal1fx/fx (Fx/Fx), CamiCre+ (Cre) and CamiCre+; Bmal1fx/+ (Het) control mice.

139 Camk2a::iCreBAC mice were used because their Cre expression is faithful to the endogenous

140 Camk2a gene expression pattern: it is neuron-specific, forebrain-enriched (Casanova et al., 2001)

141 and expressed highly in the SCN as observed in Cre-dependent fluorescence reporter mice,

142 CamiCre+; tdTom+ (Figure 1A-E). Although there are more than 37 different Camk2a::Cre

143 transgenic lines reported in Mouse Genome Informatics database

144 (http://www.informatics.jax.org/searchtool/Search.do?query=Camk2a-cre&page=featureList),

145 the majority do not appear to express well in the SCN (e.g., http://connectivity.brain-

146 map.org/transgenic/experiment/81162458) likely because of shorter promoter regulatory

147 sequences and position effects. The other advantage of this Cre driver is that its Cre expression

148 is postnatal and starts at P3 (Casanova et al., 2001), thus reducing potential developmental

149 effects. Bmal1fx/fx mice were generated by inserting loxP sites into the introns surrounding exon

150 4, which codes for the DNA-binding bHLH domain (Westgate et al., 2008). Upon Cre

151 recombination, exon 4 is deleted in BKO brain tissues that express Camk2a::iCre. The predicted

152 BMAL1 sequence encounters a STOP codon after a stretch of 18 non-native residues following

153 native coding exon 3. The resulting protein is 91 amino acids long (vs 626 amino acids of native

154 BMAL1) and is almost identical to the truncated BMAL1 protein of Bmal1-/- mice (Bunger et al.,

155 2000); both proteins contain no known functional domains and do not accumulate to a detectable

156 level.

6 157 In contrast to global Bmal1 knockouts, the reproduction, longevity and health of BKO mice

158 were as robust as that of wild-type mice. The fertility of both males and females was

159 indistinguishable from wild-type. At 2 months and 4-6 months of age, the body weights of

160 BKO’s were found to be nearly identical to Fx/Fx, Cre and Het mice (Figure 1-figure

161 supplement 1).

162 In order to assess the deletion of Bmal1 in the SCN, we examined the circadian mRNA

163 expression pattern of Bmal1 and Per2, a key Bmal1 target gene, by in situ hybridization after two

164 days of constant darkness (DD). At all 7 time points taken over a period of 24 hours, BKO’s

165 showed a low level of Bmal1 and Per2 mRNA in the SCN as well as in the entire coronal brain

166 section (Figure 1F,G). In more detailed analysis, control mice (Cre, Fx/Fx) showed intense

167 mRNA expression of Bmal1 in the SCN at its peak time (CT18) as well as circadian fluctuation

168 (CT18 vs CT6) (Figure 1F,H; Figure 1-figure supplement 2). Accordingly, Per2 mRNA was

169 also robustly expressed in the SCN in a circadian manner (Figure 1G,I; Figure 1-figure

170 supplement 2). Het mice showed reduction in the Bmal1 mRNA abundance, yet cycling of Per2

171 mRNA was retained in the SCN (Figure 1-figure supplement 2), indicating that 50% wild-type

172 Bmal1 mRNA is sufficient to sustain Per2 expression in the SCN. In contrast, in BKO mice,

173 Bmal1 mRNA was reduced ~90% in the SCN (Figure 1F,H; Figure 1-figure supplement 2),

174 and Per2 mRNA cycling was significantly attenuated (~20% WT levels at CT10. See Figure

175 1G,I).

176 To confirm that no BMAL1 protein was expressed in the SCN of BKO’s, we performed

177 immunohistochemistry in the SCN at Zeitgeber Time (ZT) 16. In contrast to the intense BMAL1

178 staining in the SCN of Fx/Fx controls, BMAL1 staining in the BKO and global Bmal1 knockout

179 SCN was reduced to background levels (Figure 1J). To further characterize the tissue

7 180 specificity of the BKO’s, we used Western blot analyses to measure BMAL1 protein levels in

181 various brain and body tissues at ZT16 (Figure 1K,L). In contrast to Fx/Fx and Cre controls,

182 BMAL1 (~69 kD) was detected only faintly in BKO frontal cortex and olfactory bulb (Figure

183 1K) likely due to glial and non-neuronal expression of BMAL1 since Camk2a is not expressed in

184 glial cells (Lin et al., 1987). Levels of BMAL1 in the cerebellum of BKO’s were similar to

185 Fx/Fx and Cre control mice (Figure 1L). Outside of the brain, like Fx/Fx mice, but unlike global

186 Bmal1-/- mice, BKO’s showed equivalent BMAL1 expression levels in the liver, spleen, kidney,

187 heart and lung (Figure 1K). Taken together, these results confirm the forebrain specificity of our

188 Bmal1 conditional knockouts.

189

190 Lack of circadian rhythms in BKO’s

191 To assess whether forebrain/SCN Bmal1 is necessary for normal circadian behavior, we

192 examined circadian rhythms of locomotor activity in Cre, Fx/Fx, Het and BKO mice in a 12

193 hour:12 hour light:dark (LD) cycle followed by DD and constant light (LL) conditions (Figure

194 2). In both DD and LL, control mice (Cre, Fx/Fx and Het) expressed robust circadian rhythms of

195 activity (Figure 2A,C,D). The locomotor activity of Het mice was indistinguishable from that of

196 the other controls. In contrast to controls, Bmal1 brain knockouts exhibited no circadian rhythm

197 of activity in DD or in LL (Figure 2B-D). Out of 31 BKO mice, none had a period in the

198 circadian (18-30 hour) range in DD. In LL, only 2 out of 21 mice had a period in the circadian

199 range (24.1 and 20.9 hrs). However, they showed extremely low amplitudes of circadian activity

200 (0.025 and 0.019, respectively, fraction of power in the circadian range where 1.0 represents the

201 total power in the normalized power spectrum) and spectral analysis using Fast Fourier

8 202 Transform (FFT) did not detect periodicity in the circadian range in any of the BKO’s under

203 either DD or LL conditions (Figure 2D).

204 Unexpectedly, total daily activity of BKO’s was significantly higher than that of control

205 mice both in DD and in LL (Figure 2E). Previous studies have found that the locomotor activity

206 of Bmal1-/- mice is decreased dramatically below wild-type levels (Bunger et al., 2000) and that

207 transgenic BMAL1 expression in skeletal muscle rescues this diminished activity (McDearmon

208 et al., 2006). Taken together, these results suggest that a peripheral defect in BMAL1 is

209 responsible for the low activity levels that had been reported in global Bmal1-/- mice. In BKO’s

210 (which do not have this peripheral defect so that locomotion is normal), the absence of a central

211 circadian gating mechanism, that normally suppresses activity during the subjective daytime

212 (Davis and Menaker, 1980), likely contributes to an increase in overall levels of activity.

213

214 Entrainment to light cycles and masking

215 One of the notable differences between BKO and SCN lesioned mice is that BKO’s display

216 apparent entrainment to light/dark cycles (probably because BKO’s are spared from surgical

217 interruption of retinal inputs to the SCN which usually occur in lesion experiments) (Figure 2).

218 However, the activity onset of BKO’s in LD was variable and on average earlier than controls.

219 As a result, daytime activity level was higher in BKO’s (15.58 ± 1.8% of total daily activity)

220 compared to the three control groups (3.81 ± 0.96%, average of the three control groups ± SEM)

221 (Figure 3-figure supplement 1). Yet it was unclear whether the pre-dark activity of Bmal1 brain

222 knockouts around the light/dark transition was due to poor entrainment of a residual circadian

223 pacemaker or to a defect in masking.

9 224 In order to test whether Bmal1 brain knockouts entrain to light, we used a skeleton

225 photoperiod (LDLD 1:10:1:12, Figure 3A-E). The activity patterns of Cre, Fx/Fx and Het mice

226 during the skeleton photoperiod were virtually indistinguishable from the activity patterns in LD

227 12:12 (Figure 3A). In contrast, none of the 10 BKO mice used in this study entrained normally

228 to the skeleton photoperiod (Figure 3B): 3 BKO mice showed activity that resembled their

229 activity in DD (Figure 3B, left), 2 BKO mice displayed a bimodal activity pattern (Figure 3B,

230 right), and 5 BKO mice exhibited activity that was intermediate between these two phenotypes

231 (Figure 3B, middle). Unlike control mice, BKO mice distributed their running activity equally

232 between the subjective day and the subjective night of the skeleton photoperiod (Figure 3C,D).

233 In fact, controls spent 97.9% of their activity during the skeleton night, compared to only 52.5%

234 for BKO mice (Figure 3E). The amount of activity that BKO’s spent during skeleton day vs.

235 night was not significantly different. This type of abnormal entrainment to skeleton

236 photoperiods is reminiscent of the entrainment behavior of pinealectomized sparrows, which

237 behave as a population of circadian oscillators that entrain with two opposite phase relationships

238 to the skeleton photoperiod (Takahashi and Menaker, 1982). Therefore, we conclude that

239 entrainment in Bmal1 brain knockout mice is abnormal under skeleton photoperiods, consistent

240 with the idea that the coherence of phase during entrainment may be compromised. Overall this

241 suggests that the periodicity seen in LD 12:12 in BKO’s arises from entrainment of a population

242 of driven oscillators in which phase control is labile.

243 Since the skeleton photoperiod and LD photoperiod results both indicated some impairment

244 of masking in BKO’s, we next tested whether negative masking (the ability of light to acutely

245 suppress locomotor activity) in Bmal1 brain knockouts was defective. To assess masking in

246 BKO mice, we used an LD 3.5:3.5-hr light-dark cycle (Redlin et al., 2005) (Figure 3B,F,G).

10 247 Mice are unable to entrain to LD 3.5:3.5 cycles, thus permitting the masking and the entraining

248 effects of light to be distinguished. Maintaining this schedule for a week ensures the testing of

249 all phases of a circadian cycle (Figure 3G). On average, BKO’s exhibited significantly less

250 activity during the light portions of LD 3.5:3.5 (4.68 ± 0.71 % of total activity vs 9.56 ± 1.83 %

251 for Fx/Fx littermates, P < 0.032 by t-test). Fx/Fx mice display more activity during the light

252 portions of LD 3.5:3.5 because the circadian clock is promoting activity despite the presence of

253 light (Figure 3G, left). While Fx/Fx mice have an underlying circadian component of activity

254 under LD 3.5:3.5, BKO’s have none (Figure 3G-I; Figure 3-figure supplement 1). Aside from

255 this difference, when we examined the time course of the masking response, it became apparent

256 that the masking of BKO’s is delayed compared to controls (Figure 3F; a score of 50% indicates

257 failure to mask). Thus BKO's failed to mask during the first 30 min of the light phases. Plotting

258 actograms on a 7-hr time scale aids in visualization of this masking impairment in BKO’s

259 (Figure 3-figure supplement 1). These entrainment and masking studies led us to conclude that

260 BKO’s lack an endogenous clock but also exhibit some impaired masking.

261

262 Phase synchrony and desynchrony in peripheral tissues of BKO’s

263 To analyze the temporal organization of peripheral oscillators at an organismal level, we crossed

264 the BKO’s to PER2::LUC mice (Yoo et al., 2004) and monitored the bioluminescence signals

265 from the SCN and other tissues in the body. Compared with the robust oscillation of the control

266 SCN, the SCN of BKO’s exhibited blunted expression patterns with low-amplitude but

267 detectable rhythms, that were close to 24 hr (23.54  0.29 hr in Fx/Fx control SCN vs. 22.99 

268 2.36 hr in BKO SCN for mean period length  SD, Figure 4A). These rhythms are likely to be

269 derived from glial cells and/or residual neurons in which Cre-mediated excision of floxed Bmal1

11 270 was incomplete (see Figure 1J), or possibly from residual stochastic oscillations that we have

271 observed in the SCN of global Bmal1 knockouts (Ko et al., 2010). Rhythmic expression in the

272 dorsomedial hypothalamus (DMH) in BKO’s was also significantly attenuated. In contrast to the

273 SCN and DMH, peripheral tissues retained persistent circadian rhythms (Figure 4A), consistent

274 with the normal expression of BMAL1 in peripheral tissues (Figure 1K).

275 These observations prompted us to use the forebrain-specific knockout mice to re-

276 investigate the relationship between the brain’s central pacemaker and circadian oscillations of

277 peripheral tissues. Previous studies have addressed a similar question by lesioning the SCN

278 (Yoo et al., 2004; Tahara et al., 2012; Saini et al., 2013). Unlike SCN lesioned mice, however,

279 BKO’s preserve intact neural networks and show normal or enhanced levels of behavioral

280 activity in LD and in constant conditions. This new analysis allows us to determine whether

281 deleting BMAL1 (thus inactivating the molecular clock) in the forebrain, without destroying the

282 structure of the SCN, is sufficient to affect the organization of peripheral rhythms.

283 Age-matched pairs of mice (Fx/Fx littermate control and BKO) were maintained in DD for

284 more than 30 days (30–44 days) before harvesting eight different tissues for real-time reporting

285 of circadian gene expression. As a light synchronized control group, tissues were also collected

286 from mice in LD12:12. Consistent with previous studies (Yoo et al., 2004; Tahara et al., 2012),

287 mean period length was variable yet characteristic from tissue to tissue (Figure 4B,C). The

288 difference of the mean periods between the Fx/Fx control and BKO mice, however, was not

289 significant either in LD or DD, except for the SCN and DMH (Figure 4B,C).

290 To analyze the temporal organization of the rhythms of each tissue, we constructed a phase

291 map by plotting the peak on the second day in the luminometry recording. Fx/Fx control mice

292 displayed tightly clustered phases in peripheral rhythms in both LD and DD conditions (Figure

12 293 5A,B,E). On the other hand, while BKO’s exhibited relatively coherent rhythms in peripheral

294 tissues in LD (Figure 5C,E; Figure 5-source data 1), their phases were significantly dispersed

295 among animals in DD (Figure 5D,E; Figure 5-source data 1). In order to measure the degree of

296 phase coherence of peripheral clocks within individual animals, the circular variance of peak

297 bioluminescence of all tissues in each mouse was compared (Figure 5-source data 2,3).

298 Statistical analysis (Figure 5F,G) showed that BKO cultures from the DD condition have a

299 significantly wider phase distribution among organs (Figure 5G, P = 0.0008 by Mann Whitney

300 test). This result indicates that a loss of phase coordination occurred in peripheral clocks within

301 individual BKO animals when placed in DD. In contrast, we found that BKO’s displayed well-

302 phased rhythms from tissue to tissue when maintained in LD (Figure 5F, N.S. by Mann Whitney

303 test), suggesting that the internal phase synchrony is still maintained even in the absence of a

304 functional master pacemaker when the animals are exposed to LD cycles.

305

306 Decreased oscillatory amplitude in peripheral tissues of BKO’s

307 In addition to period and phase, we also estimated amplitude because there was a trend for

308 oscillatory amplitudes in peripheral tissues from BKO’s to be lower than that of controls (Figure

309 6-figure supplement 1). To compare across different experiments, all time-series data were

310 adjusted for PMT background counts and PMT gain, before applying FFT-NLLS computation as

311 developed previously (Izumo et al., 2006). Only normalized amplitudes were compared in this

312 study. For the SCN and DMH in which Bmal1 is deleted from the majority of neurons, only

313 residual amplitude was detected (Figure 6A,B). Likewise, the amplitude of the pituitary was

314 lower in BKO’s from LD, which was likely due to partial deletion of BMAL1 (see Figure 1K).

315 This decrease was further pronounced when BKO pituitary was harvested from DD (Figure

13 316 6A,B). For all other peripheral tissues, the relative amplitude was significantly decreased when a

317 light-driven signal was removed from BKO’s in DD, but the severe reduction was not observed

318 in BKO’s from LD (Figure 6A,B, except for liver). These damped rhythms, however, regained

319 oscillation after receiving a stimulatory medium change (Figure 6-figure supplement 1), which

320 suggests the possibility that phase desynchrony is taking place within individual tissues of

321 BKO’s.

322 To distinguish whether the decreased amplitude of BKO tissues is due to phase desynchrony

323 between the cells or to lowered amplitude within the cells, we performed bioluminescence

324 imaging on a peripheral BKO tissue from DD. Heart tissue was chosen for this experiment,

325 because the heart showed both significant phase dispersion and severe amplitude reduction in

326 DD (Figure 5D; Figure 6B,C). In this imaging, bioluminescence signals from heart tissue were

327 insufficient to identify single cells in the field of view. Therefore, we developed a grid method

328 to allow extraction of time-series data in a narrow area of the target-imaging sample (Figure

329 6D). The size of the grid was narrowed down to 40µm x 40µm. Circadian rhythms in the

330 brightest 200 grids were aligned in the order of expression intensity in a heatmap (Figure 6E).

331 Consistent with the organotypic recording by LumiCycle luminometry (Figure 6C), while the

332 heart cells from a wild-type mouse exhibited robust oscillation, those from a BKO displayed

333 damped rhythms with broader phase distribution. The damped rhythms were also clear in a

334 linear graph in which the top 50 time-series were plotted (Figure 6F,G). Amplitude analysis of

335 these 50 time-series data showed that the oscillatory amplitude was significantly reduced within

336 the grids in the BKO heart sample (Figure 6H). Furthermore, their phases were significantly

337 dispersed (Figure 6I). These results suggest that the amplitude decrease in the BKO tissue is

338 caused by a combined effect of amplitude reduction and phase desynchrony at the cellular level.

14 339

340 Intact food-anticipatory activity in brain Bmal1 knockouts

341 Because nutrient signals can provide a potent entraining cue for peripheral circadian oscillators

342 (Green et al., 2008; Bass and Takahashi, 2010; Mohawk et al., 2012), we investigated whether

343 scheduled food restriction (FR) could restore circadian temporal organization of peripheral

344 oscillators in forebrain-specific Bmal1 knockouts. First, to test the effect of forebrain Bmal1 on

345 food-anticipatory activity (FAA), we subjected BKO’s to a schedule of FR under both LD and

346 DD conditions (Figure 7A).

347 Both qualitatively and quantitatively, mice lacking forebrain Bmal1 exhibited clear food

348 anticipatory behavior in LD that was similar to that of control mice (Figure 7B-E). Notably, the

349 mean FAA profiles of BKO’s were enhanced in DD during temporal food restriction (Figure 7C,

350 G), and the total daily activity levels in BKO’s during FR were significantly higher (almost 2-

351 fold higher) than those of controls, despite the observation that BKO’s exhibited a trend to eat

352 less during FR (Figure 7-figure supplement 1). Surprisingly, FAA profiles showed that, during

353 FR in DD, BKO’s had extended activity for up to 15 hours before food availability, while

354 controls allocated most of their activity to the 6-hr window of FAA (Figure 7F,G). Another

355 study has found similarly longer FAA in Bmal1-deficient mice (Takasu et al., 2012). To further

356 characterize the food anticipatory behavior, we measured the time course over which FAA

357 emerged in BKO’s and controls after the start of food restriction. We found FAA development

358 to be similar in the two genotypes under both LD and DD conditions. FAA appeared after about

359 2 days and reached a plateau after about 4 days in both genotypes (Figure 7D,H). The mean

360 time by which FAA anticipated the daily onset of food (phase angle with respect to food

361 presentation) was not significantly different between the two genotypes during FR in LD (Figure

15 362 7E). During FR in DD, the random activity in BKO’s partially obscured their FAA; however,

363 FAA was still recognizable above the baseline both in individual records (Figure 7F) and in the

364 population activity profile (Figure 7G). This activity change was statistically significant

365 (Figure 7I). Therefore, behavioral responses to temporal food restriction in BKO’s were

366 enhanced in DD.

367 Previously, the DMH was thought to be a possible candidate site of a food entrainable

368 oscillator (FEO) that regulates feeding behavior [(Gooley et al., 2006; Mieda et al., 2006) but see

369 (Landry et al., 2006; Landry et al., 2007; Moriya et al., 2009; Acosta-Galvan et al., 2011; Landry

370 et al., 2011)]. To examine Bmal1 deletion and Per2 gene expression at this anatomical site, we

371 conducted in situ analysis on the DMH. We collected brains at CT6 and CT18 on the third day

372 of ad lib feeding in DD. Controls showed high expression levels of Bmal1 mRNA in the DMH,

373 albeit with no circadian fluctuation. On the other hand, BKO’s had no significant Bmal1 mRNA

374 in the DMH at either time point (Figure 7-figure supplement 1). Despite a complete lack of

375 Bmal1 in the DMH, BKO’s exhibited normal FAA, indicating that Bmal1 in the DMH is not

376 necessary for food entrainment. Surprisingly, BKO’s showed Per2 expression levels comparable

377 to those of controls (Figure 7-figure supplement 1). Both genotypes displayed intense staining

378 in the ventromedial portion of the compact nucleus of the DMH (DMC, Figure 7-figure

379 supplement 1), and the difference between peak and trough Per2 mRNA was not significant for

380 either genotype. This result implies that transcriptional regulation of Per2 in the DMH involves

381 activation pathways (e.g., cAMP response element (CRE) and serum response element (SRE)

382 mediated pathways) in addition to CLOCK:BMAL1 as seen previously (Travnickova-Bendova et

383 al., 2002; Gerber et al., 2013).

384

16 385 Restricted feeding selectively resynchronizes peripheral tissues

386 It has been shown that rhythms of peripheral tissues can be dissociated from the control of the

387 central clock in the SCN and be re-entrained to a new phase by temporal feeding restriction

388 (Damiola et al., 2000; Stokkan et al., 2001). The ability of the peripheral tissues to respond to

389 feeding signals was further demonstrated in vivo (Tahara et al., 2012; Saini et al., 2013), with an

390 observation that phase changes take place faster in the liver when the SCN is surgically lesioned.

391 To assess the impact of feeding cues on the synchrony of peripheral rhythms, we subjected BKO;

392 PER2::LUC mice to a restricted feeding schedule in the absence of light signals (Figure 8A).

393 The duration of constant darkness was the same as the desynchronization experiment (Figure 5).

394 During these >30 days, mice were fed ad libitum for the first two weeks, and after five days of a

395 food ramp, temporal food restriction was performed for 2 weeks before harvesting the tissues for

396 real-time gene expression recording.

397 Consistent with a previous report (Storch and Weitz, 2009), Fx/Fx control mice exhibited

398 both free-running activity and FAA in constant darkness (Figure 8B). The peripheral tissues in

399 these mice displayed variable phase relationships with respect to the feeding time (Figure 8D).

400 However, when the peak phases were converted to the circadian time of the animal at harvest,

401 the phases in a majority of tissues examined (except for pituitary and liver) became markedly

402 clustered (Figure 8E,G; Figure 8-source data 1), suggesting that the circadian rhythms in many

403 peripheral tissues in wild-type mice are still dictated by the signals from the intact central clock.

404 On the other hand, the peripheral tissues of BKO’s showed distinct changes in phase expression

405 patterns in response to restricted feeding cues (Figure 8F). Although BKO’s exhibited

406 prolonged pre-feeding activity in DD (Figure 7F; Figure 8C), only the liver and kidney showed

407 tightly clustered phases (Figure 8G; Figure 8-source data 1). Other tissues (heart, lung, spleen)

17 408 were variable in phase, though their phase distribution was different either from that found in an

409 ad libitum condition (see also Figure 5D) or from those in Fx/Fx (Figure 8G, Figure 8-source

410 data 1). These results suggest that feeding cues differentially entrain peripheral clocks; FR

411 strongly synchronizes circadian clocks in the liver and kidney, but has weaker effects on other

412 peripheral tissues such as the pituitary, heart, lung and spleen.

413 To our surprise, with the exception of the liver, oscillatory amplitude of peripheral

414 rhythms of BKO’s remained lower than that of Fx/Fx control mice even after two weeks of FR

415 (Figure 8I). Lower amplitude is not related to the state of phase synchrony, because relative

416 amplitude of kidney still remained low even though FR synchronized its phase. This indicates

417 that the damped rhythms were not completely restored by food signals.

418 To compare ad libitum and FR conditions directly, we performed a “meta-analysis” on

419 phase and amplitude within Fx/Fx and BKO’s, respectively (Figure 9A-D). Statistical

420 comparison between ad libitum in DD (BKO from DD) and FR in DD (BKO from DD+FR)

421 confirmed tissue-specificity of phase entrainment by feeding (Figure 9; Figure 9-source data

422 1,2). This result is in striking contrast to the case in which BKO’s were exposed to LD cycles,

423 which synchronized all peripheral rhythms examined even in the absence of a functioning SCN

424 (Figure 9B,D; Figure 9-source data 2). Nevertheless, both internal synchrony and oscillatory

425 amplitude in peripheral tissues were maintained most optimally when an intact SCN was present

426 (Figure 5; Figure 6A; Figure 8H). Taken together, these results indicate that, while individual

427 tissues can be entrained by light/dark cycles and feeding schedules independently, the central

428 clock plays an important role in sustaining coherence among peripheral tissues and robust

429 circadian programs at the organismal level.

430

18 431 Discussion

432 Circadian behavioral rhythmicity is abolished by deleting Bmal1 from the forebrain

433 Bmal1 is the only component of the mammalian circadian clock whose sole deletion generates a

434 complete loss of circadian rhythms in mice (Bunger et al., 2000). Therefore, elimination of

435 Bmal1 from a target tissue provides an invaluable model to study the behavioral and

436 physiological consequences of abolishing circadian rhythms in a tissue-specific manner. Here,

437 we succeeded in removing Bmal1 specifically from the forebrain using a Camk2a::iCreBAC line

438 (Casanova et al., 2001). Notably, this CamiCre driver was able to efficiently recombine and

439 delete our target floxed gene in the entire SCN. These forebrain/SCN-specific Bmal1 knockouts

440 exhibited a total loss of circadian behavioral rhythmicity and their circadian phenotype in DD

441 and LL is similar to that of global Bmal1 knockouts (Bunger et al., 2000). Thus, Bmal1 in the

442 forebrain is essential for normal circadian activity rhythms. However, a Cre driver that can

443 express more specifically in the SCN would be necessary to confirm the dominance of the SCN

444 over other sites of the brain.

445 BKO’s displayed apparent entrainment to LD cycles; however, additional experiments

446 revealed two deficits in these mice. First, entrainment in a skeleton photoperiod was abnormal

447 with a bimodal pattern. A similar pattern is found in pinealectomized sparrows in which a

448 population of oscillators entrains with two different and opposite phase angles (Takahashi and

449 Menaker, 1982). Second, there is a delay in masking behavior to light under LD 3.5:3.5 which is

450 similar to that seen in Clock mutants (Redlin et al., 2005). Thus, the variable phase angle of

451 entrainment in BKO’s on LD 12:12 is consistent with weaker synchronization of residual

452 oscillators as well as a small deficit in masking.

453

19 454 Impact of a loss of a functional forebrain clock on circadian organization of peripheral

455 tissues

456 Despite a complete loss of circadian behavioral rhythmicity, Bmal1 forebrain-specific knockout

457 mice are as healthy as wild-type mice, consistent with our earlier results using tissue-specific

458 rescue of Bmal1-/- mice (McDearmon et al., 2006). These results suggest that Bmal1’s

459 contribution to the circadian phenotype seen in Bmal1-/- mice is distinct from its role in the

460 maintenance of normal activity levels, body weight, reproduction and longevity. For instance,

461 the skeletal muscle defects seen in Bmal1-/- mice (Andrews et al., 2010) are likely a causative

462 factor in their low activity. Muscle-rescued Bmal1-/- mice exhibit improvement of body weight,

463 activity and longevity, but not of arthropathy (McDearmon et al., 2006). Our findings as well as

464 others’ suggest that the effects of BMAL1 can be dissociated between brain and other tissues

465 including the reproductive system.

466 While the effect of Bmal1 deletion is local, the impact of disabling the brain’s clock on

467 peripheral circadian organization is significant. Previous studies have investigated the effect of

468 SCN ablation on peripheral rhythms by making SCN lesions and recording circadian gene

469 expression of peripheral tissues either ex vivo (Yoo et al., 2004) or in vivo (Tahara et al., 2012;

470 Saini et al., 2013). Here, we used a Cre-mediated genetic excision approach to remove a critical

471 component of the molecular oscillator from the intact SCN network. This strategy demonstrates

472 that internal synchrony and high amplitude rhythms are lost in the absence of a functional master

473 oscillator in the forebrain/SCN and supports previous reports (Yoo et al., 2004; Tahara et al.,

474 2012; Saini et al., 2013). Nevertheless, further studies are needed to elucidate the functional

475 consequences of damped circadian rhythms in each peripheral organ.

20 476 On the other hand, the dispersed phases in BKO’s were not observed when mice were

477 placed in an LD condition (Figure 5C,E). Given that the BKO’s circadian behavior is driven by

478 light from retinal pathways presumably acting via the SCN, this demonstrates that cyclic photic

479 input (Figure 3) is sufficient to sustain coherent temporal synchrony of peripheral oscillators.

480 Alternatively, the effects of light could also be mediated by activity (wheel-running)-associated

481 stimuli driven by LD as another source of systemic signals impinging on peripheral clocks

482 analogous to that found previously (Kornmann et al., 2007; Hughes et al., 2012).

483

484 Forebrain Bmal1 expression is not necessary for food entrainment behavior

485 BKO’s offer an advantage for investigating the effects of a disabled master clock in the brain

486 because they do not suffer from the morbid phenotypes observed with a global loss of Bmal1.

487 Using the forebrain Bmal1-deficient animals, we were able to conduct food restriction

488 experiments under completely standard conditions. In contrast to global Bmal1 knockouts,

489 altered experimental conditions such as enriched liquid food (Storch and Weitz, 2009), LD 18:6

490 (Pendergast et al., 2009), or food placed on the cage bottom and gentle handling to prompt

491 feeding (Fuller et al., 2008) were not required for these mice. Our results show that BKO’s

492 indeed displayed normal FAA as other studies using global Bmal1 knockouts have reported

493 (Mistlberger et al., 2008; Pendergast et al., 2009; Storch and Weitz, 2009), demonstrating that

494 BMAL1 in the forebrain is not essential for food entrainment behavior. Specifically, our Bmal1

495 in situ results in the DMH indicate that the DMH is not necessary for FAA as reported

496 previously (Landry et al., 2006; Landry et al., 2007; Moriya et al., 2009; Acosta-Galvan et al.,

497 2011; Landry et al., 2011). In our experiments, BKO’s tend to exhibit intact food anticipatory

498 behavior under constant darkness conditions. However, overall activity of BKO’s circadian

21 499 behavior was also significantly elevated in DD, which makes it difficult to distinguish whether

500 the elevated pre-feeding activity is due to enhanced FAA or to the effect of overall activity

501 increase. Nevertheless, these results suggest that an inhibitory system (Davis and Menaker,

502 1980) suppresses the total activity of both circadian behavior and FAA. It remains to be

503 determined what factors underlie suppression of the activity and how their regulation in the SCN

504 and other brain regions is altered by the deletion of BMAL1.

505

506 Differential effects of light/dark cycles and feeding cues

507 Previous work has shown that restricted feeding can alter the phase of peripheral rhythms

508 without affecting the phase of the SCN (Damiola et al., 2000; Stokkan et al., 2001). While

509 peripheral oscillators can be uncoupled from the central clock in the SCN, recent studies have

510 suggested that SCN-derived signals counteract the feeding cues for rapid phase-shifting of

511 peripheral clocks (Saini et al., 2013) and that phase-shifting rates are variable among different

512 tissues (Damiola et al., 2000; Yamazaki et al., 2000). Consistent with these observations,

513 peripheral tissues in our control mice displayed variable phases relative to the FR schedule when

514 conducted in constant darkness (Figure 8D). In these free-running conditions, the circadian

515 activity rhythms of the mice were not affected by FR; and as a consequence, the phase

516 relationships between the FR schedule and circadian phase could be dissociated. When control

517 mice in DD under ad libitum conditions were compared to control mice in DD under FR using

518 circadian phase as a marker, the liver, kidney and heart significantly shifted their mean circular

519 phase in response to feeding, showing an effect of FR on these tissues (Figure 9A, compare

520 Fx/Fx from DD with Fx/Fx from DD+FR (in CT); Figure 9-source data 1). However, the

521 phases of the peripheral rhythms were significantly clustered with the phase of the activity

22 522 rhythm (Figure 8E), strongly suggesting that signals from the SCN continue to dictate the

523 expression of peripheral phases in wild-type mice despite the expression of FAA behavior.

524 Indeed, only the liver was strongly clustered in phase with FR in DD (Figure 8G, Fx/Fx from

525 DD+FR) compared to the circadian phase of activity [Figure 8G, Fx/Fx from DD+FR (in CT)]

526 in which all peripheral tissues were clustered in phase. Thus we see a rather complex picture in

527 control mice in which FR exerts tissue-specific effects on peripheral organ circadian phase and

528 coherence.

529 In contrast, in the absence of a functional pacemaker in the forebrain, liver and kidney

530 clocks shifted to a distinct phase in response to food restriction and became synchronized

531 (Figure 8F,G; Figure 9B), which supports the results of an in vivo study using SCN-lesioned

532 animals (Saini et al., 2013). We found, however, that other tissues such as heart, lung, and

533 spleen did not entrain to food restriction even after two weeks of treatment (Figure 9B; Figure

534 9-source data 2). Although the precise mechanism is not known, the lower degree of synchrony

535 of these tissues could be due to the longer duration of pre-feeding behavioral activity which

536 could mobilize additional (conflicting) signals. At the same time, these tissues showed distinct

537 phase shifts in response to feeding (Figure 9B; Figure 9-source data 2). Circular phase

538 variance analysis indicates that internal coherence among different organs within an individual

539 mouse still remained disrupted (Figure 8H). Therefore, these results suggest that, while

540 synchrony of individual tissues such as liver and kidney can be maintained independently by a

541 feeding schedule, synchrony among peripheral tissues requires central clocks in the

542 forebrain/SCN.

543 The effects of FR were different from the effects of LD cycles (Figure 5; Figure 9B), which

544 sustained both phase synchrony and oscillatory amplitude in peripheral clocks in BKO’s (Figure

23 545 9). Notably, both phase angle (Figure 5E; Figure 5-source data 1) and phase coherence among

546 peripheral tissues (Figure 5F) were similar to those in Fx/Fx control mice which possess an

547 intact central clock. We speculate that, while feeding cues can antagonize SCN-derived signals,

548 LD cycles appear to act in concert with the SCN or signals arising from the SCN. Although

549 detailed pathways through which the SCN controls the peripheral clocks remain unknown,

550 recently, SRF was identified as a transcription factor that regulates gene expression in peripheral

551 tissues in response to systemically oscillating signals (Gerber et al., 2013). It will be interesting

552 to explore how these signals affect circadian gene expression in vivo to determine the

553 mechanisms by which the SCN communicates with peripheral oscillators. Our experiments

554 reveal the diverse behavioral and peripheral physiological consequences of inactivating a

555 forebrain clock. They pave the way for further exploring the complex relationship between

556 central and peripheral clocks.

557

24 558 Materials and methods

559 Animals

560 All mice were housed under LD 12:12 unless otherwise noted. Camk2a::iCreBAC mice

561 (CamiCre) (MGI:2181426) were kindly provided by Dr. G. Schutz (Casanova et al., 2001). For

562 a Cre reporter mouse, Rosa26-CAG-LSL-tdTomato (Ai14, kindly provided by Dr. Hongkui

563 Zeng) was used (Madisen et al., 2010). Bmal1fx/fx mice (Johnson et al., 2014) are homozygous

564 for a Bmal1 allele which has loxP sites inserted into the introns surrounding exon 4. Bmal1fx/fx

565 mice (129SvJ × C57BL/6J N3 backcross) were crossed to CamiCre to produce Bmal1fx/fx

566 (Fx/Fx), CamiCre+;Bmal1fx/+ (Het) , and CamiCre+; Bmal1fx/fx (BKO) mice. CamiCre mice

567 were mated to their siblings (FVB/N × C57BL/6J N3 backcross) to generate CamiCre

568 hemizygous controls. Bmal1-/- global knockout mice (Bunger et al., 2000) were 129SvJ ×

569 C57BL/6J N14 backcross congenic animals. For the real-time reporting assay, PER2::LUC mice

570 (Yoo et al., 2004) were crossed to Bmal1fx/fx to produce CamiCre+; Bmal1fx/fx; Per2Luc/+ and its

571 control littermate, Bmal1fx/fx; Per2Luc/+. For the bioluminescence imaging experiments, Per2Luc

572 mice were homozygous. For all experiments, male and female mice were used in balanced

573 ratios; mice were 2-7 months old for behavior experiments and 3-11 months old for

574 bioluminescence recordings and age-matched across groups, except for FR (males only were

575 used for behavior experiments), where mice were 1.9-3.6 months old at the start of the

576 experiment. All animal studies and experimental procedures were in accordance with

577 Northwestern University and UT Southwestern Medical Center guidelines for animal care and

578 use.

579

580 PCR genotyping

25 581 The following sets of genotyping primers were used: CamiCre: iCre-PCR-F 5’-

582 TCTGATGAAGTCAGGAAGAACC -3’ and iCre-PCR-R 5’-

583 GAGATGTCCTTCACTCTGATTC -3’ (amplified a 400 bp product). PCR reactions were

584 carried out in a final volume of 30 µl buffer consisting of 5 µl Promega 5x Colored buffer, 2.7 µl

585 25 mM MgCl2, 0.38 µl 20 µM each primer, 3 µl 2 mM dNTPs, 3 µl NaOH-extracted tail

586 genomic DNA, and 0.3 µl Promega Go Taq (1 U/rx; Promega, Madison, WI). PCR conditions

587 were: 5 min at 95º C, followed by 30 cycles of 1 min at 94º C, 2 min at 58º C, and 2 min at 72º

588 C, followed by 8 min at 72º C. The reaction products were analyzed on a 2% agarose gel.

589 Bmal1fx/fx: OL5436 5’- CCC TGA ACA TGG GAA AGA GA -3’ and OL6013 5’- ATT CAC

590 CTT TTG GGG AGG AC -3’ (floxed band: 360 bp, WT band: 310 bp). PCR reactions were

591 carried out in a final volume of 25 µl buffer consisting of 5 µl Promega 5x Colored buffer, 3 µl

592 25 mM MgCl2, 1 µl 20 µM each primer, 2.5 µl 2 mM dNTPs, 3 µl NaOH-extracted tail genomic

593 DNA, and 0.3 µl Promega Go Taq (1.25 U/rx). PCR conditions were: 5 min at 95º C; followed

594 by 37 cycles of 30 sec at 95º C, 30 sec at 60º C, and 30 sec at 72º C, followed by 5 min at 72º C.

595 Ai14: Ai14F 5’- TAC GGC ATG GAC GAG CTG TAC AAG TAA -3’and Ai14R 5’- CAG

596 GCG AGC AGC CAA GGA AA -3’ (amplified a 517 bp product). Bmal1-/- and PER2::LUC

597 mice were genotyped as previously described (Bunger et al., 2000; Yoo et al., 2004).

598

599 Behavioral experiments and activity monitoring

600 To record the rhythm of locomotor activity, adult mice (at least 8 weeks old) were individually

601 housed in activity wheel-equipped cages under LD 12:12 for at least 10 days. Locomotor

602 activity was recorded and analyzed using ClockLab software (Actimetrics, Wilmette, IL) as

603 previously described (Vitaterna et al., 1999; Siepka and Takahashi, 2005; McDearmon et al.,

26 604 2006; Vitaterna et al., 2006). Fluorescent lights (300-600 lux inside the cage) were used for

605 behavior experiments. Mice were transferred into DD for 4 weeks, returned to LD for 2 weeks,

606 released into LL for 4 weeks, and then returned to LD for at least 2 weeks. For the entrainment

607 experiment, mice were placed in LD12:12 for at least 10 days, released into DD for 4 wks,

608 followed by LD for 2 wks, before they were introduced to a skeleton photoperiod (LDLD

609 1:10:1:12) for 4 wks. The mice were returned to LD for 2 wks and then switched to an ultradian

610 cycle (LD 3.5:3.5) for 3 wks.

611

612 Food restriction experiments

613 For the food restriction experiment, the mice were placed in wheel-equipped cages under LD

614 12:12 for 2 weeks, then underwent a 5-day FR ramp of gradually decreasing food availability

615 (Figure 7A), followed by 14 days of FR in LD. They were returned to ad lib feeding under LD

616 for 2 weeks, DD for 2 weeks, and LD for 2 weeks. Then the mice underwent a 5-day FR ramp

617 after which they were released into DD for 14 days of FR in DD. On the first day of the FR

618 ramp, food was removed at ZT/CT18, and 12 hours later food was returned. On each successive

619 day, food was removed 2 hrs earlier until food was available for 4 hrs, from ZT/CT6-10 (Figure

620 7A). This was the final food availability window for 14 days of FR. A regular mouse diet

621 (5K52; Lab Diet, Richmond, IN; contains 19.3% protein and 6.2% fat, or 2918; Irradiated Global

622 Diet, Teklad Diets, Madison, WI; contains 18.6% protein and 6.2% fat) was used during FR

623 experiments. Food pellets were weighed daily for each mouse before and after food availability

624 to monitor food consumption. Individual mean daily activity profiles were computed by

625 ClockLab; group average profiles were made using Microsoft Excel.

27 626 For the bioluminescence recording experiment, mice were initially entrained in LD12:12

627 for a minimum of 6 days (6-12 days), as the light-on time was delayed for 6 hr, before they were

628 released into DD for 2 weeks. Then the mice underwent a 5-day FR ramp as above, after which

629 4-hr FR was conducted from ZT/CT6-10 for 2 weeks (Figure 8A). On the final day of 2 weeks

630 of FR, tissues were harvested for bioluminescence recordings at 2 hrs after the food was

631 withdrawn (ZT/CT12).

632

633 Behavioral data analysis

634 Wheel-running activity was recorded and analyzed essentially as previously described (Vitaterna

635 et al., 2006). The free-running periods in DD and LL were calculated from the entire 28-day

636 interval by using 2 periodogram analysis (Clocklab software, Actimetrics). The amplitude of

637 circadian rhythm was analyzed using the fast Fourier transform (FFT), which estimates the

638 relative power of approximately 24 hour period rhythm in comparison with all other periodicities

639 in the time series (Shimomura et al., 2001). The power spectral densities for frequencies ranging

640 from 0 to 1 cycle/hr were determined and normalized to a total power (area under the curve) of

641 1.0. The peak in the circadian range (18- to 30-hr period or 0.033–0.055 cycles/hr) of the

642 relative power was determined for each animal for comparison. If no significant periodicity in

643 the 18-30 hr range was detected by FFT, the free running period was not scored. For analysis of

644 total daily activity, the total number of wheel revolutions per day was averaged in LD (last 10

645 days of initial LD interval), DD and LL (28 days) using the same days described above for free-

646 running period and amplitude analysis. Effects of genotype were analyzed by a Generalized

647 Model (GLM) ANOVA by using NCSS (Kayesville, UT), with Tukey-Kramer multiple

648 comparison post-tests for pairwise comparisons.

28 649 Two-sample t-tests were used to analyze subjective day vs night activity during skeleton

650 photoperiod and amplitudes during LD 3.5:3.5, and Repeated Measures GLM ANOVA with

651 Tukey-Kramer multiple comparison post-tests was used to compare the time course of masking

652 between genotypes during days 3-15 of the 21-day LD 3.5:3.5 cycle. FFT was used to analyze

653 amplitudes in the circadian as well as 7-hr range during LD 3.5:3.5. To analyze FR data,

654 Repeated Measures GLM ANOVA with Tukey-Kramer multiple comparison post-tests was used

655 to compare the effect of genotype, time, and interaction between the two on FAA (absolute

656 counts), FAA (% of total activity), weights, total daily activity, and food intake. Two-sample t-

657 test and paired t-test, respectively, was used to calculate FAA onset and activity fold change

658 from ad lib to FR.

659

660 In situ hybridization

661 For the time course collection of brain tissue for in situ hybridization, after 2 weeks of

662 entrainment in LD, animals were released into DD for two days, and tissues were harvested on

663 the third day of DD. Brains were rapidly dissected and frozen on dry ice, and stored at -80ºC

664 until further processing. Standard in situ hybridization procedures were used as previously

665 described (Sangoram et al., 1998). Alternate 20-µm thick coronal sections were collected from

666 each brain from the rostral to the caudal end of the SCN or DMH (24-32 total, 12-16 for each

667 probe) by using a Leica CM3050S cryostat. Sections were thaw-mounted onto superfrost plus

668 microscope slides (VWR, Radnor, PA), then stored at -80º C until all sectioning was completed.

669 Alternate sections were hybridized to a combination oligoprobe against mBmal1 exon 4 and to a

670 riboprobe against Per2. For the Bmal1 combination oligoprobe, three 37 to 50-mer

671 oligonucleotide probes (IDT, Coralville, IA) were radiolabeled at the 3’ ends with 33P via

29 672 terminal I Deoxynucleotidyl Transferase (Gibco/Invitrogen, Life Technologies, Grand Island,

673 NY) and used in equal proportions: Mop3Ex4Probe1 5'-

674 AACTGTTCATTTTGTCCCGACGCCTCTTTTCAATCTGACTGTGGGCCTCC - 3',

675 Mop3Ex4Probe2 5'- CCTGGACATTGCATTGCATGTTGGTACCAAAGAAGCCAATTCATC

676 - 3', Mop3Ex4Probe3 5'- CTGAACAGCCATCCTTAGCACGGTGAGTTTATCTAAC - 3'.

677 Templates for the antisense and sense Per2 probes were PCR-generated by using the following

678 primers: Per2-insitu-f 5' - ACG AGA ACT GCT CCA CGG GAC - 3', Per2-insitu-r 5' - ACA

679 GCC ACA GCA AAC ATA TCC GC - 3'. PCR products were cloned into a TA cloning vector

680 (Invitrogen). The T7 promoter from the TA cloning vector was used to generate both antisense

681 and sense probes. All probes were labeled with 33P. Quantitation of the autoradiogram signal

682 was performed by using NIH ImageJ 1.34s software (NIH, Bethesda, MD) and normalized to

683 radioactive standards as described previously (Vitaterna et al., 1999). The optical density (OD)

684 of individual SCN or DMC (the compact nucleus of DMH) was normalized by subtracting the

685 OD of an area of identical size in the lateral hypothalamus or the magnocellular nucleus of lateral

686 hypothalamus, respectively, from the same side (left or right) and section. Normalized values

687 from three sections near the middle (anterior-posterior) SCN or caudal DMH (at the level of

688 DMC) were used to calculate an average for each brain. Effects of genotype, time, or their

689 interactions were analyzed by GLM ANOVA, with Tukey-Kramer multiple comparison post-

690 tests for pairwise comparisons.

691

692 Western blotting

693 For Westerns blots, tissues were harvested at ZT16 from mice in LD 12:12. Tissues were

694 homogenized by a polytron homogenizer in a buffer containing 44.6 mM Tris HCl, 5.5 mM Tris

30 695 Base, 154 mM NaCl, 29.8 mM Sodium Pyrophosphate, 20 mM Glycerol 2-phosphate, 50 mM

696 NaF, 1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 mM PMSF, 1 mM sodium orthovanadate, 1 mM

697 EDTA, 1 mM p-nitrophosphate, 0.1% SDS, 0.5% Sodium Deoxycholate, and 1% NP-40.

698 Homogenates were centrifuged at 15,000 x g for 20 min at 4º C. Supernatants were collected

699 and protein concentration was estimated using Bio-Rad DC Protein Assay according to the

700 manufacturer’s instructions. Total protein (10 µg) was diluted 1:1 with Laemmli sample buffer

701 and resolved on a 10% SDS–polyacrylamide gel by electrophoresis. Thereafter, proteins were

702 electrotransferred onto a GE Healthcare PVDF transfer membrane. The membranes were

703 blocked with PBST (PBS + 0.1% Tween-20) containing 5% non-fat powdered milk for 1 hr and

704 then incubated with the rabbit polyclonal anti-MOP3 antibody (1:6,250, generated in Dr.

705 Bradfield’s lab and is available at NB100-2288, Novus Biologicals LLC, Littleton, CO) followed

706 by anti–rabbit IgG secondary antisera horseradish peroxidase (1:1,000; PI-1000, Vector

707 Laboratories, Burlingame, CA). Proteins were visualized with a chemiluminescence detection

708 system (ECL Western blotting detection analysis system; Amersham Pharmacia, GE Healthcare

709 Bio-Sciences, Pittsburgh, PA) and with subsequent exposure to autoradiographic films.

710

711 Immunohistochemistry and microscopy

712 Brain tissues for immunohistochemistry were harvested at ZT16 under LD 12:12. Animals were

713 anesthetized with ketamine/xylazine/saline cocktail (10 mg/ml ketamine, 10 mg/ml xylazine) at

714 0.01 ml/g body weight or with sodium pentobarbital at 120 mg/kg body weight and then perfused

715 intracardially with 25 ml of 4% paraformaldehyde (pH 7.4, Sigma-Aldrich, St Louis, MO) in

716 63.4 mM phosphate buffer (pH 7.5). The brains were removed and postfixed for 2 hrs at 4º C in

717 4% paraformaldehyde in 63.4 mM phosphate buffer and transferred to 20% sucrose/phosphate

31 718 buffer overnight. For immunohistochemistry, 50-µm coronal sections were collected through the

719 entire SCN using a Leica cryostat and processed free-floating. Sections were incubated with the

720 rabbit polyclonal anti-MOP3 (BMAL1) antibody (1:1,000) followed by anti–rabbit IgG

721 secondary biotinylated antisera (1:200; BA-1000, Vector Laboratories) and visualized using

722 Vectastain ABC Kit and 0.5 mg/ml diaminobenzidine, 0.01% hydrogen peroxide, and 0.03%

723 NiCl2 in 0.05 M Tris (pH 7.2). Sections were mounted onto gelatin-coated microscope slides

724 using aquaeous mounting medium (3:1 glycerol/phosphate buffer), coverslipped, and imaged

725 with a Leica DM-RB upright microscope using Openlab software in the Biological Imaging

726 Facility at Northwestern University. For the whole brain imaging, a Zeiss Stereo Discovery

727 Microscope V12 was used under a bright field. Fluorescence images were taken by Olympus

728 MVX10 (1x) and a Zeiss LSM 510 confocal microscope (20x objective).

729

730 Real-time bioluminescence recording and data analysis

731 To monitor real-time reporting of PER2::LUC oscillations, tissues were harvested after cervical

732 dislocation between ZT/CT10.5-13. Coronal sections of the brain were sliced at 300 μm

733 thickness by a vibratome in ice-cold Hank’s balanced salt solution (HBSS, Invitrogen). Each

734 individual SCN was dissected out and cultured on a Millicell organotypic membrane (PICM

735 ORG50, Millipore, Billerica, MA) in a 35 mm tissue culture dish containing 1.2 ml DMEM (90-

736 013-PB, Mediatech, Manassas, VA) supplemented with 2% B27 (Invitrogen), 10 mM Hepes (pH

737 7.2), 4 mM L-glutamine, 0.035% sodium bicarbonate, 25 units/ml penicillin, 25 μg/ml

738 streptomycin, and 0.1 mM luciferin (L-8240, Biosynth AG, Staad, Switzerland). Other tissues

739 were processed as previously described (Yamazaki and Takahashi, 2005) and cultured as above.

740 The bioluminescence was monitored by a light-tight 32-channel LumiCycle luminometry

32 741 (Actimetrics, Wilmette, IL) maintained at 36C and was recorded at an inverval of 10-min

742 continuously for a minimum of 8 days followed by medium change to confirm the viability of

743 the samples.

744 All data were analyzed essentially as described previously (Izumo et al., 2006). Briefly,

745 raw data of bioluminescence records were corrected for background counts and PMT gain. For

746 animals harvested from a DD condition (30-44 days in DD), activity onset of each Fx/Fx control

747 mouse was set as CT12. The time series data were detrended by a 24-hr running average and

748 then subjected to FFT-NLLS analysis to calculate periods and phases. The initial 20 hrs of data

749 were trimmed because they contain an acute effect of explant preparation. Data beyond 192 hr

750 before medium change was also trimmed except for one group (1 Fx/Fx control and 1 BKO),

751 which was affected by an electrical shutdown on Day 6. The amplitude was computed at a 36–

752 60 hr range and normalized as previously described (Izumo et al., 2006). For all data, the

753 calculations were averaged where duplicated samples were prepared from the same tissue within

754 an individual mouse, and the averaged value was used to map or calculate for all mice collected.

755 Samples with RelAmp Error  0.84 (background counts) or out of a circadian (17-31 hr) range

756 (24 hr  30% of 24 hr) in the periodicity were excluded from the analysis. A total of 1106

757 LumiCycle files were processed and used in this study. To construct a phase map, smoothed

758 time series were used to determine the peak on the second day. Phase angles and circular

759 variances of circular plots were computed using Oriana (Kovach Computing Services, Wales,

760 UK). The variance of the peak phases between two groups was compared using bootstrap

761 analysis (Sato et al., 2007). For each iteration of the bootstrap, the difference of the variance

762 between the two groups was calculated by random sampling with replacement from the data

33 763 within the each of the two groups. Following 20,000 iterations, ninety-five percent confidence

764 intervals were used to determine whether the differences were significantly different from zero.

765

766 Bioluminescence imaging and data analysis

767 For real-time bioluminescence imaging analysis, age-matched pairs of mice (Fx/Fx control and

768 BKO) were placed in DD for >30 days before harvesting the tissues. The tissue collection was

769 repeated for a total of three pairs of mice. The tissues were processed and prepared in the same

770 manner as in the luminometry recording, except that a glass bottom culture dish (MatTek,

771 Ashland, MA) was used. The sealed culture was placed onto the stage chamber maintained at

772 36C inside the LV200 Bioluminescence Imaging System (Olympus America, Irving, TX). The

773 sample was imaged using a 10x objective lens with 10-min exposure time at 25-min invetvals for

774 7 days. The imaging files were converted to linear time series by quantifying the signals on grid

775 matrices. The heat map was generated using the top 200 time series data starting with the

776 strongest signals. The top 50 of these time series data were analyzed for period, phase, and

777 relative amplitude by FFT-NLLS as desribed above. The phases calculated by FFT-NLLS were

778 further converted to the actual time and divided by each circadian period to normalize period

779 differences. Statistical analysis was conducted between paired mice as described above.

780

781 Acknowledgements

782 We thank Ms. Amanda Falk for help with mouse production, Dr. Tereza Smejkalova for help

783 with Westerns, Dr. William Russin at the Biologial Imaging Facility and Dr. Xinran Liu for help

784 with imaging, Dr. David Ferster for help with data analysis, Mr. Giuseppe Fruci for assistance

785 with figure production, Drs. Martha Vitaterna, Hee-Kyung Hong, Marleen de Groot, Kazuhiro

34 786 Shimomura, and Ethan Buhr for helpful discussions. We also thank Dr. Hongkui Zeng at Allen

787 Institute for Brain Science for Ai14 mice. J.S.T. is an investigator in the Howard Hughes

788 Medical Institute.

789

790

791

35 792 Additional information

793 Funding

Funder Grant reference number Author Howard Hughes Medical H0690101 Joseph S Takahashi Institute National Institutes of Health U01 MH61915, Joseph S Takahashi P50 MH074924 National Institutes of Health 1F30NS056551-01 Martina Pejchal National Alliance for Mariko Izumo Research on Schizophrenia and Depression (NARSAD) Young Investigator Award National Institutes of Health R01 ES005703 Christopher A Bradfield Japan Science and Technology Takashi R Sato Agency (PRESTO: Precursory Research for Embryonic Science and Technology)

794

795 Competing interests

796 The authors declare that no competing interests exist.

797 Author Contributions

798 MI, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or 799 revising the article. 800 MP, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or 801 revising the article. 802 ACS, Acquisition of data, Analysis and interpretation of data. 803 RPL, Acquisition of data, Analysis and interpretation of data. 804 JAW, Analysis and interpretation of data, Contributed unpublished essential data or reagents. 805 TRS, Analysis and interpretation of data, Contributed unpublished essential data or reagents, 806 Drafting or revising the article. 807 XW, Contributed unpublished essential data or reagents, Drafting or 808 revising the article. 809 CAB, Contributed unpublished essential data or reagents, Drafting or 810 revising the article. 811 JST, Conception and design, Analysis and interpretation of data, Drafting or revising the article.

36 812

813 Ethics

814 Animal experimentation: All animal care and use procedures were in accordance with guidelines 815 of the Northwestern University (Protocol 2006-0035) and UT Southwestern Institutional Animal 816 Care and Use Committees (Protocols 2009-0054 and 2012-0090).

37 817 References

818 Abe M, ED Herzog, S Yamazaki, M Straume, H Tei, Y Sakaki, et al. 2002. Circadian rhythms in 819 isolated brain regions. J Neurosci 22: 350-356. 820 Abraham U, JL Prior, D Granados-Fuentes, DR Piwnica-Worms and ED Herzog. 2005. 821 Independent circadian oscillations of Period1 in specific brain areas in vivo and in vitro. J 822 Neurosci 25: 8620-8626. 823 Acosta-Galvan G, CX Yi, J van der Vliet, JH Jhamandas, P Panula, M Angeles-Castellanos, et 824 al. 2011. Interaction between hypothalamic dorsomedial nucleus and the suprachiasmatic 825 nucleus determines intensity of food anticipatory behavior. Proc Natl Acad Sci U S A 826 108: 5813-5818. doi: 10.1073/pnas.1015551108. 827 Alvarez JD, A Hansen, T Ord, P Bebas, PE Chappell, JM Giebultowicz, et al. 2008. The 828 circadian clock protein BMAL1 is necessary for fertility and proper testosterone 829 production in mice. J Biol Rhythms 23: 26-36. doi: 10.1177/0748730407311254. 830 Andrews JL, X Zhang, JJ McCarthy, EL McDearmon, TA Hornberger, B Russell, et al. 2010. 831 CLOCK and BMAL1 regulate MyoD and are necessary for maintenance of skeletal 832 muscle phenotype and function. Proc Natl Acad Sci U S A 107: 19090-19095. doi: 833 10.1073/pnas.1014523107. 834 Bass J and JS Takahashi. 2010. Circadian integration of metabolism and energetics. Science 330: 835 1349-1354. doi: 10.1126/science.1195027. 836 Boden MJ, TJ Varcoe, A Voultsios and DJ Kennaway. 2010. Reproductive biology of female 837 Bmal1 null mice. Reproduction 139: 1077-1090. doi: 10.1530/REP-09-0523. 838 Buhr ED, SH Yoo and JS Takahashi. 2010. Temperature as a universal resetting cue for 839 mammalian circadian oscillators. Science 330: 379-385. doi: 10.1126/science.1195262. 840 Bunger MK, LD Wilsbacher, SM Moran, C Clendenin, LA Radcliffe, JB Hogenesch, et al. 2000. 841 Mop3 is an essential component of the master circadian pacemaker in mammals. Cell 842 103: 1009-1017. 843 Bunger MK, JA Walisser, R Sullivan, PA Manley, SM Moran, VL Kalscheur, et al. 2005. 844 Progressive arthropathy in mice with a targeted disruption of the Mop3/Bmal-1 locus. 845 Genesis 41: 122-132. 846 Casanova E, S Fehsenfeld, T Mantamadiotis, T Lemberger, E Greiner, AF Stewart, et al. 2001. A 847 CamKIIalpha iCre BAC allows brain-specific gene inactivation. Genesis 31: 37-42. 848 Damiola F, N Le Minh, N Preitner, B Kornmann, F Fleury-Olela and U Schibler. 2000. 849 Restricted feeding uncouples circadian oscillators in peripheral tissues from the central 850 pacemaker in the suprachiasmatic nucleus. Genes Dev 14: 2950-2961. 851 Davis FC and M Menaker. 1980. Hamsters through time's window: temporal structure of hamster 852 locomotor rhythmicity. Am J Physiol 239: R149-155. 853 Fuller PM, J Lu and CB Saper. 2008. Differential rescue of light- and food-entrainable circadian 854 rhythms. Science 320: 1074-1077. doi: 10.1126/science.1153277. 855 Fuller PM, J Lu and CB Saper. 2009. Standards of evidence in chronobiology: A response. J 856 Circadian Rhythms 7: 9. doi: 10.1186/1740-3391-7-9. 857 Gavériaux-Ruff C and BL Kieffer. 2007. Conditional gene targeting in the mouse nervous 858 system: Insights into brain function and diseases. Pharmacol Ther 113: 619-634. doi: 859 10.1016/j.pharmthera.2006.12.003. 860 Gekakis N, D Staknis, HB Nguyen, FC Davis, LD Wilsbacher, DP King, et al. 1998. Role of the 861 CLOCK protein in the mammalian circadian mechanism. Science 280: 1564-1569.

38 862 Gerber A, C Esnault, G Aubert, R Treisman, F Pralong and U Schibler. 2013. Blood-borne 863 circadian signal stimulates daily oscillations in actin dynamics and SRF activity. Cell 864 152: 492-503. doi: 10.1016/j.cell.2012.12.027. 865 Gooley JJ, A Schomer and CB Saper. 2006. The dorsomedial hypothalamic nucleus is critical for 866 the expression of food-entrainable circadian rhythms. Nat Neurosci 9: 398-407. doi: 867 10.1038/nn1651. 868 Green CB, JS Takahashi and J Bass. 2008. The meter of metabolism. Cell 134: 728-742. doi: 869 10.1016/j.cell.2008.08.022. 870 Griffin EA, Jr., D Staknis and CJ Weitz. 1999. Light-independent role of CRY1 and CRY2 in the 871 mammalian circadian clock. Science 286: 768-771. 872 Guo H, JM Brewer, A Champhekar, RB Harris and EL Bittman. 2005. Differential control of 873 peripheral circadian rhythms by suprachiasmatic-dependent neural signals. Proc Natl 874 Acad Sci U S A 102: 3111-3116. doi: 10.1073/pnas.0409734102. 875 Guo H, JM Brewer, MN Lehman and EL Bittman. 2006. Suprachiasmatic regulation of circadian 876 rhythms of gene expression in hamster peripheral organs: effects of transplanting the 877 pacemaker. J Neurosci 26: 6406-6412. doi: 10.1523/JNEUROSCI.4676-05.2006. 878 Hogenesch JB, YZ Gu, S Jain and CA Bradfield. 1998. The basic-helix-loop-helix-PAS orphan 879 MOP3 forms transcriptionally active complexes with circadian and hypoxia factors. Proc 880 Natl Acad Sci U S A 95: 5474-5479. 881 Huang N, Y Chelliah, Y Shan, CA Taylor, SH Yoo, C Partch, et al. 2012. Crystal structure of the 882 heterodimeric CLOCK:BMAL1 transcriptional activator complex. Science 337: 189-194. 883 doi: 10.1126/science.1222804. 884 Hughes ME, HK Hong, JL Chong, AA Indacochea, SS Lee, M Han, et al. 2012. Brain-specific 885 rescue of Clock reveals system-driven transcriptional rhythms in peripheral tissue. PLoS 886 Genet 8: e1002835. doi: 10.1371/journal.pgen.1002835. 887 Husse J, X Zhou, A Shostak, H Oster and G Eichele. 2011. Synaptotagmin10-Cre, a driver to 888 disrupt clock genes in the SCN. J Biol Rhythms 26: 379-389. doi: 889 10.1177/0748730411415363. 890 Izumo M, TR Sato, M Straume and CH Johnson. 2006. Quantitative analyses of circadian gene 891 expression in mammalian cell cultures. PLoS Comput Biol 2: e136. doi: 892 10.1371/journal.pcbi.0020136. 893 Johnson BP, JA Walisser, Y Liu, AL Shen, EL McDearmon, SM Moran, et al. 2014. Hepatocyte 894 circadian clock controls acetaminophen bioactivation through NADPH-cytochrome P450 895 oxidoreductase. Proc Natl Acad Sci U S A: (in press). doi: 10.1073/pnas.1421708111. 896 King DP, Y Zhao, AM Sangoram, LD Wilsbacher, M Tanaka, MP Antoch, et al. 1997. 897 Positional cloning of the mouse circadian clock gene. Cell 89: 641-653. 898 Ko CH, YR Yamada, DK Welsh, ED Buhr, AC Liu, EE Zhang, et al. 2010. Emergence of noise- 899 induced oscillations in the central circadian pacemaker. PLoS Biol 8: e1000513. doi: 900 10.1371/journal.pbio.1000513. 901 Kondratov RV, AA Kondratova, VY Gorbacheva, OV Vykhovanets and MP Antoch. 2006. 902 Early aging and age-related pathologies in mice deficient in BMAL1, the core 903 componentof the circadian clock. Genes Dev 20: 1868-1873. doi: 10.1101/gad.1432206. 904 Kornmann B, O Schaad, H Bujard, JS Takahashi and U Schibler. 2007. System-driven and 905 oscillator-dependent circadian transcription in mice with a conditionally active liver 906 clock. PLoS Biol 5: e34. doi: 10.1371/journal.pbio.0050034.

39 907 Kume K, MJ Zylka, S Sriram, LP Shearman, DR Weaver, X Jin, et al. 1999. mCRY1 and 908 mCRY2 are essential components of the negative limb of the circadian clock feedback 909 loop. Cell 98: 193-205. 910 Lamia KA, KF Storch and CJ Weitz. 2008. Physiological significance of a peripheral tissue 911 circadian clock. Proc Natl Acad Sci U S A 105: 15172-15177. doi: 912 10.1073/pnas.0806717105. 913 Landry GJ, MM Simon, IC Webb and RE Mistlberger. 2006. Persistence of a behavioral food- 914 anticipatory circadian rhythm following dorsomedial hypothalamic ablation in rats. Am J 915 Physiol Regul Integr Comp Physiol 290: R1527-1534. doi: 10.1152/ajpregu.00874.2005. 916 Landry GJ, GR Yamakawa, IC Webb, RJ Mear and RE Mistlberger. 2007. The dorsomedial 917 hypothalamic nucleus is not necessary for the expression of circadian food-anticipatory 918 activity in rats. J Biol Rhythms 22: 467-478. doi: 10.1177/0748730407307804. 919 Landry GJ, BA Kent, DF Patton, M Jaholkowski, EG Marchant and RE Mistlberger. 2011. 920 Evidence for time-of-day dependent effect of neurotoxic dorsomedial hypothalamic 921 lesions on food anticipatory circadian rhythms in rats. PLoS One 6: e24187. doi: 922 10.1371/journal.pone.0024187. 923 Lee C, JP Etchegaray, FR Cagampang, AS Loudon and SM Reppert. 2001. Posttranslational 924 mechanisms regulate the mammalian circadian clock. Cell 107: 855-867. 925 Lin CR, MS Kapiloff, S Durgerian, K Tatemoto, AF Russo, P Hanson, et al. 1987. Molecular 926 cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad 927 Sci U S A 84: 5962-5966. 928 Lowrey PL and JS Takahashi. 2004. Mammalian circadian biology: elucidating genome-wide 929 levels of temporal organization. Annu Rev Genomics Hum Genet 5: 407-441. 930 Lowrey PL and JS Takahashi. 2011. Genetics of circadian rhythms in Mammalian model 931 organisms. Adv Genet 74: 175-230. doi: 10.1016/B978-0-12-387690-4.00006-4. 932 Marcheva B, KM Ramsey, ED Buhr, Y Kobayashi, H Su, CH Ko, et al. 2010. Disruption of the 933 clock components CLOCK and BMAL1 leads to hypoinsulinaemia and diabetes. Nature 934 466: 627-631. doi: 10.1038/nature09253. 935 McDearmon EL, KN Patel, CH Ko, JA Walisser, AC Schook, JL Chong, et al. 2006. Dissecting 936 the functions of the mammalian clock protein BMAL1 by tissue-specific rescue in mice. 937 Science 314: 1304-1308. doi: 10.1126/science.1132430. 938 Meijer J and W Rietveld. 1989. Neurophysiology of the Suprachiasmatic Circadian Pacemaker in 939 Rodents. Physiol Rev 69: 671-698. 940 Mieda M, SC Williams, JA Richardson, K Tanaka and M Yanagisawa. 2006. The dorsomedial 941 hypothalamic nucleus as a putative food-entrainable circadian pacemaker. Proc Natl 942 Acad Sci U S A 103: 12150-12155. doi: 10.1073/pnas.0604189103. 943 Mieda M and T Sakurai. 2011. Bmal1 in the nervous system is essential for normal adaptation of 944 circadian locomotor activity and food intake to periodic feeding. J Neurosci 31: 15391- 945 15396. doi: 10.1523/JNEUROSCI.2801-11.2011. 946 Mistlberger RE, S Yamazaki, JS Pendergast, GJ Landry, T Takumi and W Nakamura. 2008. 947 Comment on "Differential rescue of light- and food-entrainable circadian rhythms". 948 Science 322: 675; author reply 675. doi: 10.1126/science.1161284. 949 Mistlberger RE, RM Buijs, E Challet, C Escobar, GJ Landry, A Kalsbeek, et al. 2009a. Food 950 anticipation in Bmal1-/- and AAV-Bmal1 rescued mice: a reply to Fuller et al. J 951 Circadian Rhythms 7: 11. doi: 10.1186/1740-3391-7-11.

40 952 Mistlberger RE, RM Buijs, E Challet, C Escobar, GJ Landry, A Kalsbeek, et al. 2009b. 953 Standards of evidence in chronobiology: critical review of a report that restoration of 954 Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food 955 anticipatory rhythms in Bmal1-/- mice. J Circadian Rhythms 7: 3. doi: 10.1186/1740- 956 3391-7-3. 957 Mohawk JA, CB Green and JS Takahashi. 2012. Central and peripheral circadian clocks in 958 mammals. Annu Rev Neurosci 35: 445-462. doi: 10.1146/annurev-neuro-060909-153128. 959 Moriya T, R Aida, T Kudo, M Akiyama, M Doi, N Hayasaka, et al. 2009. The dorsomedial 960 hypothalamic nucleus is not necessary for food-anticipatory circadian rhythms of 961 behavior, temperature or clock gene expression in mice. Eur J Neurosci 29: 1447-1460. 962 doi: 10.1111/j.1460-9568.2009.06697.x. 963 Musiek ES, MM Lim, G Yang, AQ Bauer, L Qi, Y Lee, et al. 2013. Circadian clock proteins 964 regulate neuronal redox homeostasis and neurodegeneration. J Clin Invest 123: 5389- 965 5400. doi: 10.1172/JCI70317. 966 Nagoshi E, C Saini, C Bauer, T Laroche, F Naef and U Schibler. 2004. Circadian gene 967 expression in individual fibroblasts: cell-autonomous and self-sustained oscillators pass 968 time to daughter cells. Cell 119: 693-705. 969 Pendergast JS, W Nakamura, RC Friday, F Hatanaka, T Takumi and S Yamazaki. 2009. Robust 970 food anticipatory activity in BMAL1-deficient mice. PLoS One 4: e4860. doi: 971 10.1371/journal.pone.0004860. 972 Ralph MR, RG Foster, FC Davis and M Menaker. 1990. Transplanted suprachiasmatic nucleus 973 determines circadian period. Science 247: 975-978. 974 Redlin U, S Hattar and N Mrosovsky. 2005. The circadian Clock mutant mouse: impaired 975 masking response to light. J Comp Physiol A 191: 51-59. doi: 10.1007/s00359-004-0570- 976 z. 977 Rudic RD, P McNamara, AM Curtis, RC Boston, S Panda, JB Hogenesch, et al. 2004. BMAL1 978 and CLOCK, two essential components of the circadian clock, are involved in glucose 979 homeostasis. PLoS Biol 2: e377. 980 Saini C, J Morf, M Stratmann, P Gos and U Schibler. 2012. Simulated body temperature rhythms 981 reveal the phase-shifting behavior and plasticity of mammalian circadian oscillators. 982 Genes Dev 26: 567-580. doi: 10.1101/gad.183251.111. 983 Saini C, A Liani, T Curie, P Gos, F Kreppel, Y Emmenegger, et al. 2013. Real-time recording of 984 circadian liver gene expression in freely moving mice reveals the phase-setting behavior 985 of hepatocyte clocks. Genes Dev 27: 1526-1536. doi: 10.1101/gad.221374.113. 986 Sangoram AM, L Saez, MP Antoch, N Gekakis, D Staknis, A Whiteley, et al. 1998. Mammalian 987 circadian autoregulatory loop: a timeless ortholog and mPer1 interact and negatively 988 regulate CLOCK-BMAL1-induced transcription. Neuron 21: 1101-1113. doi: S0896- 989 6273(00)80627-3 [pii]. 990 Sato TR, NW Gray, ZF Mainen and K Svoboda. 2007. The functional microarchitecture of the 991 mouse barrel cortex. PLoS Biol 5: e189. doi: 10.1371/journal.pbio.0050189. 992 Shimomura K, SS Low-Zeddies, DP King, TD Steeves, A Whiteley, J Kushla, et al. 2001. 993 Genome-wide epistatic interaction analysis reveals complex genetic determinants of 994 circadian behavior in mice. Genome Res 11: 959-980. doi: 10.1101/gr.171601. 995 Siepka SM and JS Takahashi. 2005. Methods to record circadian rhythm wheel running activity 996 in mice. Methods Enzymol 393: 230-239. doi: 10.1016/S0076-6879(05)93008-5.

41 997 Stokkan KA, S Yamazaki, H Tei, Y Sakaki and M Menaker. 2001. Entrainment of the circadian 998 clock in the liver by feeding. Science 291: 490-493. doi: 10.1126/science.291.5503.490. 999 Storch KF and CJ Weitz. 2009. Daily rhythms of food-anticipatory behavioral activity do not 1000 require the known circadian clock. Proc Natl Acad Sci U S A 106: 6808-6813. doi: 1001 10.1073/pnas.0902063106. 1002 Sujino M, KH Masumoto, S Yamaguchi, GT van der Horst, H Okamura and ST Inouye. 2003. 1003 Suprachiasmatic nucleus grafts restore circadian behavioral rhythms of genetically 1004 arrhythmic mice. Curr Biol 13: 664-668. 1005 Sun Y, Z Yang, Z Niu, W Wang, J Peng, Q Li, et al. 2006. The mortality of MOP3 deficient 1006 mice with a systemic functional failure. J Biomed Sci 13: 845-851. doi: 10.1007/s11373- 1007 006-9108-4. 1008 Tahara Y, H Kuroda, K Saito, Y Nakajima, Y Kubo, N Ohnishi, et al. 2012. In vivo monitoring 1009 of peripheral circadian clocks in the mouse. Curr Biol 22: 1029-1034. doi: 1010 10.1016/j.cub.2012.04.009. 1011 Takahashi JS and M Menaker. 1982. Entrainment of the circadian system of the house sparrow: 1012 A population of oscillators in pinealectomized birds. J Comp Physiol A 146: 245-253. 1013 Takasu NN, G Kurosawa, IT Tokuda, A Mochizuki, T Todo and W Nakamura. 2012. Circadian 1014 regulation of food-anticipatory activity in molecular clock-deficient mice. PLoS One 7: 1015 e48892. doi: 10.1371/journal.pone.0048892. 1016 Taniguchi H, M He, P Wu, S Kim, R Paik, K Sugino, et al. 2011. A resource of cre driver lines 1017 for genetic targeting of GABAergic neurons in cerebral cortex. Neuron 71: 995-1013. 1018 doi: 10.1016/j.neuron.2011.07.026. 1019 Travnickova-Bendova Z, N Cermakian, SM Reppert and P Sassone-Corsi. 2002. Bimodal 1020 regulation of mPeriod promoters by CREB-dependent signaling and CLOCK/BMAL1 1021 activity. Proc Natl Acad Sci U S A 99: 7728-7733. doi: 10.1073/pnas.102075599. 1022 Vitaterna MH, CP Selby, T Todo, H Niwa, C Thompson, EM Fruechte, et al. 1999. Differential 1023 regulation of mammalian period genes and circadian rhythmicity by cryptochromes 1 and 1024 2. Proc Natl Acad Sci U S A 96: 12114-12119. 1025 Vitaterna MH, CH Ko, AM Chang, ED Buhr, EM Fruechte, A Schook, et al. 2006. The mouse 1026 Clock mutation reduces circadian pacemaker amplitude and enhances efficacy of 1027 resetting stimuli and phase-response curve amplitude. Proc Natl Acad Sci U S A 103: 1028 9327-9332. doi: 10.1073/pnas.0603601103. 1029 Welsh DK, SH Yoo, AC Liu, JS Takahashi and SA Kay. 2004. Bioluminescence imaging of 1030 individual fibroblasts reveals persistent, independently phased circadian rhythms of clock 1031 gene expression. Curr Biol 14: 2289-2295. 1032 Welsh DK, JS Takahashi and SA Kay. 2010. Suprachiasmatic nucleus: cell autonomy and 1033 network properties. Annu Rev Physiol 72: 551-577. doi: 10.1146/annurev-physiol- 1034 021909-135919. 1035 Westgate EJ, Y Cheng, DF Reilly, TS Price, JA Walisser, CA Bradfield, et al. 2008. Genetic 1036 components of the circadian clock regulate thrombogenesis in vivo. Circulation 117: 1037 2087-2095. doi: CIRCULATIONAHA.107.739227. 1038 Yamaguchi Y, T Suzuki, Y Mizoro, H Kori, K Okada, Y Chen, et al. 2013. Mice genetically 1039 deficient in vasopressin V1a and V1b receptors are resistant to jet lag. Science 342: 85- 1040 90. doi: 10.1126/science.1238599. 1041 Yamazaki S, R Numano, M Abe, A Hida, R Takahashi, M Ueda, et al. 2000. Resetting central 1042 and peripheral circadian oscillators in transgenic rats. Science 288: 682-685.

42 1043 Yamazaki S and JS Takahashi. 2005. Real-time luminescence reporting of circadian gene 1044 expression in mammals. Methods Enzymol 393: 288-301. doi: 10.1016/S0076- 1045 6879(05)93012-7. 1046 Yoo SH, S Yamazaki, PL Lowrey, K Shimomura, CH Ko, ED Buhr, et al. 2004. 1047 PERIOD2::LUCIFERASE real-time reporting of circadian dynamics reveals persistent 1048 circadian oscillations in mouse peripheral tissues. Proc Natl Acad Sci U S A 101: 5339- 1049 5346. doi: 10.1073/pnas.0308709101. 1050 1051

43 1052 Figure Legends 1053 1054 Figure 1. CamiCre+; Bmal1fx/fx mice are forebrain/SCN-specific Bmal1 knockouts.

1055 (A) Dorsal view of a CamiCre-; tdTom+ control brain. Bright field. Scale bar, 1 mm. (B)

1056 Dorsal view of a CamiCre+; tdTom+ brain. Bright field. (C) Ventral view of (B). (D)

1057 Fluorescence image of a coronal brain section containing the SCN from a CamiCre+; tdTom+

1058 mice. (E) Confocal image of the SCN showing tdTomato expression in the CamiCre+; tdTom+

1059 mice. Scale bar, 50 µm. (F,G) Coronal brain sections at the level of the SCN, prepared from

1060 mice sacrificed every 4 hrs starting at CT2 following two days of DD, were hybridized in situ to

1061 examine Bmal1 (F) and Per2 (G) mRNA levels in CamiCre+; Bmal1fx/fx (BKO) mice (n=3

1062 except n=4 for CT10, 14, 18) and Bmal1fx/fx (Fx/Fx) control littermates (same as BKO except

1063 n=1 for CT18 Bmal1 and n=3 for CT18 Per2). Below each coronal brain section is a close-up of

1064 the SCN. (H,I) Optical density graphs of the in situ time course data displayed in (F) and (G).

1065 Shown are means ± SEM, with significant effect of genotype in (H) [F1,46 = 40.70, P = 0.0000]

1066 and (I) [F1,44 = 1148.03, P = 0.0000] by GLM ANOVA. Tukey-Kramer multiple comparison

1067 post-tests (P ≤ 0.05) showed that in contrast to Fx/Fx littermates, neither Bmal1 nor Per2 mRNA

1068 is rhythmic in BKO’s. (J) Immunohistochemistry for BMAL1 on SCN-containing coronal

1069 sections of Fx/Fx (n=3), BKO (n=3), and Bmal1-/- (KO, n=1) mice sacrificed at ZT16. Captured

1070 with an x20 objective. (K,L) Western blot analysis of BMAL1 in BKO’s sacrificed at ZT16.

1071 (K) Western blot of various tissues in Fx/Fx (n=2), BKO littermate (n=2), and KO (n=1) mice.

1072 (L) Western blot of frontal cortex, cerebellum, and liver in Cre (n=2), Fx/Fx (n=2), BKO (n=3),

1073 and KO (n=2) mice. F. CTX: frontal cortex. Cer.: cerebellum.

1074

44 1075 Figure 1-figure supplement 1. Weights of Bmal1 brain knockout mice are similar to controls at

1076 2 months and 4-6 months of age.

1077 All body weights were measured in live, wheel-naïve animals. Numbers of male mice weighed

1078 at 2 months (= 54-62 days old) and 4-6 months (= 120-195 days old), respectively: Cre (n=25,

1079 35), Het (n=13, 15), Fx/Fx (n=98, 37), and BKO (n=55, 12). Numbers of female mice weighed

1080 at 2 months and 4-6 months, respectively: Cre (n=28, 39), Het (n=23, 35), Fx/Fx (n=84, 54), and

1081 BKO (n=54, 29). Shown are the mean weights  SD. A significant effect of genotype was

1082 found using GLM ANOVA, followed by Tukey-Kramer multiple comparison post-tests. The

1083 difference between Cre and Fx/Fx mice (*P ≤ 0.05) is likely due to the difference in the genetic

1084 background (CamiCre+ is generated in FVB background, and floxed Bmal1 in 129sv).

1085 Importantly, there was no significant difference between BKO males and control males at 4-6

1086 months and BKO females did not weigh less than any control group at either time point.

1087

1088 Figure 1-figure supplement 2. Additional in situ analysis of Bmal1 brain knockout mice.

1089 (A,B) Coronal brain sections at the level of the SCN. Below each coronal brain section is a

1090 close-up of the SCN. (A) Mice were sacrificed at CT18 and CT6 following two days of DD.

1091 Sections were hybridized in situ to examine Bmal1 mRNA levels in Cre (n=5 at CT6 and 4 at

1092 CT18), Fx/Fx (n=7 at CT6 and 7 at CT18), Het (n=6 at CT6 and 6 at CT18), BKO (n=4 at CT6

1093 and 4 at CT18) and Bmal1-/- mice (KO, n=1). (B) Mice were sacrificed at CT10 and CT22

1094 following two days of DD. Sections were hybridized in situ to examine Per2 mRNA levels in

1095 Cre (n=7 at CT10 and 6 at CT22), Fx/Fx (n=10 at CT10 and 8 at CT22), Het (n=7 at CT10 and 7

1096 at CT22) and BKO (n=9 at CT10 and 9 at CT22) mice. (C,D) Optical density of Bmal1 (C) and

1097 Per2 (D) mRNA in the SCN. Shown are means ± SEM, with significant effect of genotype in

45 1098 (C) [F3,42 = 217.91, P = 0.0000] and (D) [F3,62 = 28.00, P = 0.0000] by GLM ANOVA. (C)

1099 Tukey-Kramer multiple comparison post-tests (**P ≤ 0.05) showed that BKO mice had

1100 significantly lower Bmal1 mRNA levels than all three control groups at both CT6 and CT18. At

1101 both time points Het mice had significantly less Bmal1 mRNA than the other two controls but

1102 more mRNA than BKO’s (*P ≤ 0.05). (D) BKO mice had significantly lower levels of Per2

1103 mRNA than all three control groups at CT10 but not at CT22 (*P ≤ 0.05).

1104

1105 Figure 2. Complete loss of circadian rhythmicity of Bmal1 brain knockout mice in constant

1106 darkness and constant light.

1107 (A,B) Representative actograms of daily wheel-running activity of Cre, Fx/Fx, Het, and BKO

1108 mice. Activity records were double plotted, with each day being represented beneath and also to

1109 the right of the preceding day. Horizontal black and white bars at the top of each actogram

1110 represent lights off and on, respectively. Mice were housed in LD, released into DD for 4 wks,

1111 returned to LD for 2 weeks, released into LL for 4 weeks, and then returned to LD. GLM

1112 ANOVA and Tukey-Kramer multiple comparison post-tests were used to compare genotypes

1113 tested. BKO’s showed no significant periodicity in DD or LL. (C-E) Period (C), amplitude of

1114 circadian rhythm (D), and activity levels (E) in Cre mice (n=28 for DD, 12 for LD, 12 for LL),

1115 Fx/Fx mice (n=31 for DD, 18 for LD, 18 for LL), Het mice (n=31 for DD, 13 for LD, 15 for LL)

1116 and BKO mice (n=31 for DD, 16 for LD, 21 for LL). Bar graphs show means ± SEM. (C) Free-

1117 running period was determined using 2 periodogram for days 1-28 of DD or LL. A significant

1118 effect of genotype on period was found for both DD [F3,120 = 164319.90, P = 0.0000] and LL

1119 [F3,65 = 20429.03, P = 0.0000]. In DD, Cre mice were found to have a slightly longer period than

1120 the other two control groups (*P ≤ 0.05). In LL, Het mice were found to have a shorter period

46 1121 than the other two control groups (*P ≤ 0.05). Nevertheless, all three control groups showed a

1122 free-running period in both DD and LL similar to that reported for WT mice. (D) DD and LL

1123 amplitude of circadian rhythm represented by FFT in the circadian range. A significant effect of

1124 genotype on amplitude was found for both DD [F3,120 = 150.64, P = 0.0000] and LL [F3,65 =

1125 23.72, P = 0.0000], with BKO mice having significantly lower amplitude (*P ≤ 0.05) in both DD

1126 and LL. (E) Total daily DD, LD and LL activity levels, in wheel revolutions per 24 hrs. BKO

1127 activity levels were found to be significantly higher than those of controls in DD [F3,119 = 9.00, P

1128 = 0.0000] (*P ≤ 0.05) and LL [F3,65 = 5.84, P = 0.0014] (*P ≤ 0.05), but not in LD.

1129

1130 Figure 3. Both entrainment and masking are abnormal in Bmal1 brain knockout mice.

1131 (A,B) Representative double-plotted actograms of daily wheel-running activity of Cre, Fx/Fx,

1132 Het, and BKO mice. Mice were housed in LD, released into DD for 4 wks, returned to LD for 2

1133 wks, introduced to a skeleton photoperiod (LDLD 1:10:1:12) for 4 wks, returned to LD for 2

1134 wks, and then switched to an ultradian cycle (LD 3.5:3.5) for 3 wks. Shown are days 1-24 of the

1135 skeleton photoperiod and days 3-15 of LD 3.5:3.5. (C,D) Average activity profiles of Fx/Fx

1136 (n=12) and BKO littermates (n=10) during LDLD 1:10:1:12. (C) Average profiles for individual

1137 mice; (D) The ensemble average for the entire group. Each data point represents counts per

1138 minute averaged across a 6-min bin (± SEM for D). (E) Total activity counts (means ± SEM)

1139 during 10 hrs of subjective day (Sk. Day) and 10 hrs of subjective night (Sk. Night) of LDLD

1140 1:10:1:12. In contrast to Fx/Fx littermates, BKO’s are equally active during skeleton day vs.

1141 skeleton night. *P < 0.0001 by t-test. (F) Masking of BKO (n=14) and Fx/Fx littermates (n=9)

1142 during specific 0.5 hr light bins of LD 3.5:3.5. Total activity (mean ± SEM) during each 30 min

1143 light bin is divided by the total of that bin plus the corresponding dark bin. Thus the first data

47 1144 point for each genotype represents the distribution of activity between the first 30 min of light

1145 and the first 30 min of dark. There was a significant interaction between genotype and time

1146 using Repeated Measures GLM ANOVA [F1,160 = 22.31, P = 0.0000]. Specifically, days 1, 6,

1147 and 7 were found to be significantly different by Tukey-Kramer multiple comparison post-tests

1148 (*P ≤ 0.05). (G) Representative double-plotted actograms of daily wheel-running activity of

1149 Fx/Fx (left) and BKO (right) littermates. These are the same mice as those shown in (A, middle

1150 panel) and (B, middle panel), respectively. Light phases are indicated in yellow to show the

1151 structure of the LD 3.5:3.5 cycle as well as to help visualize the occurrence of wheel-running

1152 activity under this schedule. Note that, after one week of this cycle, initial phase relationships

1153 are regained. (H) Representative amplitude power spectra of Fx/Fx and BKO mice, from FFT

1154 analyses performed on the same activity records shown in (G). The highest peaks for both

1155 genotypes were in the 7-hr range, corresponding to the LD 3.5:3.5 schedule. The second-highest

1156 peak for the controls was in the circadian (18-30 hr) range (left). None of the BKO’s was found

1157 to have a period in the circadian range (right). (I) Group averages of amplitudes in the 7-hr

1158 range and in the circadian range for the same Fx/Fx and BKO mice as in (F). Compared to

1159 controls, BKO’s had significantly higher amplitude in the 7-hr range (**P < 0.0001 by t-test) and

1160 significantly lower amplitude in the circadian range (*P < 0.0060 by t-test).

1161

1162 Figure 3-figure supplement 1. Masking in Bmal1 brain knockout mice.

1163 (A) Daytime activity levels during LD, as percentage of total daily activity, in Cre (n=12), Fx/Fx

1164 (n=18), Het (n=13) and BKO (n=16) mice. A significant effect of genotype on daytime activity

1165 was found by GLM ANOVA [F3,58 = 12.43, P = 0.0000], with BKO mice having significantly

1166 higher daytime activity by Tukey-Kramer multiple comparisons post-test (*P ≤ 0.05).

48 1167 Combined, controls allocate an average of 3.81 ± 0.96% of their total activity to running during

1168 the daytime. In contrast, 15.58 ± 1.8% of BKO wheel-running activity occurs during the light

1169 phase. (B-E) Shown are days 3-15 of a 21-day LD 3.5:3.5 cycle; these are the same days as

1170 those shown in Figure 3A,B. (B,C) Representative single-plotted actograms of daily wheel-

1171 running activity of (B) Fx/Fx and (C) BKO littermates. These are the same mice as those shown

1172 in Figure 3A (middle panel), 3B (middle panel), and 3G. Actograms are plotted modulo tau

1173 (25.2 hrs for B) to help visualize the circadian “beating,” i.e. the gaps in activity in controls (B)

1174 caused by the suppressive effects of the light phases of the LD 3.5:3.5 cycle on running. A

1175 circadian component of wheel-running activity is clearly evident in controls (B) but absent in

1176 BKO’s (C). (D,E) Representative actograms of wheel-running activity of Fx/Fx (D) and BKO

1177 littermates (E), plotted on a 7 hr time scale (x axis). Y axis shows successive 7 hr spans for days

1178 3-15 of this cycle. The gaps in activity in some of the dark periods in Fx/Fx controls represent

1179 times when the circadian cycle is specifying rest even though lights are off (see Figure 3G, left

1180 panel). To the right of each actogram is an activity profile for that individual mouse, averaged

1181 over 13 days. Each data point represents counts per minute averaged for each mouse across a 6-

1182 min bin. The boxed area corresponds to the first one-third of all the light phases of the LD

1183 3.5:3.5 schedule. Substantial BKO wheel-running activity is seen during this interval, especially

1184 the first 30 min, during which BKO’s fail to mask altogether (see Figure 3F). Horizontal black

1185 and white bars represent lights off and on, respectively.

1186

1187 Figure 4. Real-time reporting of circadian expression of PER2::LUC in the forebrain/SCN

1188 knockout mice.

49 1189 (A) Representative records of bioluminescence reporting of circadian expression from various

1190 tissues in Fx/Fx and BKO mice. Tissues were prepared from mice in LD. PMT counts are

1191 plotted against the LD cycle of Day 1. Shown are 10 days of continuous recording after explant

1192 preparation, except for the SCN for which medium was changed on Day 12. (B,C) Period plots

1193 of various tissues harvested from Fx/Fx control (open circle) and BKO (dark circle) mice in LD

1194 (B) and DD (C). The sample size is indicated on right. Shown are mean periods  SD. **P <

1195 0.01, ****P < 0.0001 by t-test.

1196

1197 Figure 5. Phase analysis of circadian expression of various peripheral tissues from the

1198 forebrain/SCN knockout mice.

1199 (A) Phase map of circadian rhythms of various peripheral tissues from Fx/Fx control mice in LD

1200 (n=15, except for pituitary n=14). The peak phases (or averaged peak phases where more than

1201 two pieces were prepared from the same tissue) in the second cycle were plotted against the LD

1202 cycle of the day when explant cultures were prepared. Tissues from the same animal are

1203 connected by colored lines with matched symbols. (B) Phase map of Fx/Fx control mice in DD

1204 (n=15). The peak phases (or averaged peak phases) in the second cycle were plotted against the

1205 predicted onset of activity (= CT12) of the day when the explant cultures were prepared. (C)

1206 Phase map of BKO’s in LD (n=15, except for pituitary n=14). (D) Phase map of BKO’s in DD

1207 (n=15). The phases were mapped against the predicted onset of activity (=CT12) of paired

1208 Fx/Fx control mice. (E) Circular plots of peak bioluminescence rhythms in the SCN and

1209 peripheral tissues presented in (A-D). A circle represents a 24-hr clock, and peak phases of

1210 bioluminescence rhythms of individual tissues were calculated as angles and plotted as colored

1211 symbols outside the circle. Each tissue is denoted by the same color and symbol scheme. The

50 1212 direction of the arrow indicates mean phase angle, with the length of the arrow expressing the

1213 strength of phase clustering. The sample size, mean phase angle, and circular variance for each

1214 data set are summarized in Figure 5-source data 1. (F,G) Scattered plot of circular variance in

1215 each individual mouse. Degree of variance among the peak phase values of pituitary, liver,

1216 kidney, heart, lung, and spleen in each individual mouse was calculated and expressed as circular

1217 variance (see Figure 5-source data 2,3), and compared between Fx/Fx controls and BKO’s in

1218 LD (F) and DD (G). The bar is ± SD. A significant effect was found between Fx/Fx control and

1219 BKO mice in DD (P = 0.0008 by Mann Whitney test), but not in LD (P = 0.0627 by Mann

1220 Whitney test). N.S. = not significant.

1221

1222 Figure 5-source data 1. Summary of statistical analysis of circular plots presented in Figure 5.

1223 Figure 5-source data 2. Statistical analysis of circular variance for peak bioluminescence in

1224 individual mice in LD.

1225 Figure 5-source data 3. Statistical analysis of circular variance for peak bioluminescence in

1226 individual mice in DD.

1227

1228 Figure 6. Decreased amplitude in peripheral tissues of BKO’s.

1229 (A,B) Normalized amplitude of bioluminescence rhythms from Fx/Fx control (open bar) vs BKO

1230 (dark bar) in LD (A) and DD (B). Mean relative amplitude ± SD are shown. The sample size is

1231 the same as in Figure 4B & 4C. *P < 0.05, **P < 0.01, ****P < 0.0001 by t-test. (C)

1232 Representative records of real-time monitoring of circadian expression of heart tissues in Fx/Fx

1233 control (upper) and BKO (lower) mice maintained in DD. (D) Representative frames of

1234 bioluminescence imaging with grids over each heart tissue. (E) Heat maps of the brightest 200

51 1235 time series data beginning with the strongest signals in the grids shown in (D). (F,G) Linear

1236 traces of the top 50 of time series data from the Fx/Fx (F) and BKO (G) heart tissue shown in

1237 (E). The Y-axis was expanded for the BKO sample in the most right graph. (H) Normalized

1238 amplitude quantified from the top 50 of time series data shown in (F) and (G). ****P < 0.0001

1239 by t-test. (I) Circular plots of peak phase values of the top 50 time series data shown in (F) for

1240 Fx/Fx and (G) for BKO tissues. Degree of variance was compared between the two samples by

1241 bootstrapping simulation (****P = 0.0000).

1242

1243 Figure 6-figure supplement 1. Real-time monitoring of circadian expression in forebrain/SCN

1244 knockout mice from DD.

1245 Representative records of bioluminescence reporting of circadian expression from Fx/Fx and

1246 BKO mice maintained in DD. Tissues were harvested before the predicted onset of activity (=

1247 CT12) of Fx/Fx control mice. Shown are 10 days of continuous recordings followed by medium

1248 change. Quantification of period, phase, and relative amplitude of these samples are shown in

1249 Figure 4C,5,6B.

1250

1251 Figure 7. Intact FAA in Bmal1 brain knockout mice.

1252 (A) Schedule of a gradual temporal FR protocol in LD (upper) or DD (lower). Horizontal black

1253 and white bars represent lights off and on, respectively. Gray bars represent food availability.

1254 Since abrupt shifts to FR can have a high morbidity in mice, a gentle temporal FR paradigm was

1255 used (FR ramp), decreasing the duration of daily food availability from constant to a final 4 hr

1256 window over the course of 5 days. Because free-running in DD can obscure FAA in control

1257 mice, we obtained DD baseline activity and then switched mice to 14 days of LD (not shown).

52 1258 We then transferred our mice directly from LD into DD FR following an LD food ramp (lower).

1259 It should be noted that once gradual FR began, the time of onset of food availability was the

1260 same each day. (B,F) Representative double-plotted actograms of daily wheel-running activity

1261 of 3 Fx/Fx control littermates and 3 BKO mice during ad lib feeding and under subsequent FR

1262 during LD (B) or DD (F). The boxed area toward the left side of each actogram indicates the

1263 daily interval of food availability under FR, and yellow areas indicate time of lights-on during

1264 LD 12:12. After 5 days of gradually decreasing food availability, the final food availability

1265 window was ZT/CT6-10. For clarity, the 5-day FR ramp is not included in the boxed area (B).

1266 (C,G) Mean locomotor activity profiles of Fx/Fx littermates (n=7) and BKO mice (n=14) under

1267 ad lib feeding (left) and during FR days 8-14 (right) under LD (C) or DD (G). Each data point

1268 represents counts per minute averaged for each genotype across a 6-min bin (± SEM). The

1269 dashed boxed area (left) indicates, for comparison, the daily interval corresponding to subsequent

1270 food availability. The solid boxed area (right) indicates the daily interval of food availability

1271 under FR. (D,H) Time course of the development of FAA in Fx/Fx controls (n=7) and BKO

1272 mice (n=14) during LD FR (D) or DD FR (H). FAA is plotted as the total number of activity

1273 counts (mean ± SEM) allocated to a 6-hr time interval prior to mealtime, ZT/CT0-6 (D,H). (E)

1274 Number of hours by which FAA preceded daily meal times in Fx/Fx (n=7) and BKO mice

1275 (n=14) during LD FR. Wheel-running activity profiles were averaged for each individual during

1276 stable FR (as in C), and the average time of onset of FAA was determined as the time before

1277 food availability at which FAA rose to its half-maximum value (mean ± SEM). (I)

1278 Quantification of FAA under DD conditions in BKO mice (n=14). Plotted is fold-change of

1279 wheel-running activity (counts per minute, mean ± SEM) in each mouse for CT0-6 (window of

1280 FAA) compared with CT10-24 (the rest of the day except for the window of food availability).

53 1281 During FR, increased locomotor activity during CT0-6 compared with CT10-24 was highly

1282 significant (*P = 0.0001 by paired t-test).

1283

1284

1285 Figure 7-figure supplement 1. Lack of Bmal1 expression in the DMH of Bmal1 brain knockout

1286 mice.

1287 (A,B) Food consumed during FR was significantly lower in BKO's compared to controls using

1288 Repeated Measures GLM ANOVA for both LD conditions [F1,291 = 43.40, P = 0.0000] (A) and

1289 DD conditions [F1,293 = 15.47, P = 0.0009] (B). Food consumed on days 12-14 of LD FR (A)

1290 represents the average food consumed over those three days and is plotted in triplicate to enable

1291 comparison between LD and DD food consumed. (C,D) Coronal brain sections at the level of

1292 the DMH, prepared from mice under ad lib feeding at CT6 and CT18 following two days of DD,

1293 were hybridized in situ to examine Bmal1 exon 4 (C) and Per2 (D) mRNA levels in Fx/Fx

1294 control littermates (n=6 for CT6, n=7 for CT18) and BKO mice (n=6 for CT6, n=8 for CT18).

1295 On the right of each coronal brain section is a close-up of the DMH. (E,F) Optical density of

1296 Bmal1 (E) and Per2 (F) mRNA in the DMC. Shown are means ± SEM, * significant effect of

1297 genotype in (E) [F1,26 = 208.31, P = 0.0000] but not in (F) using GLM ANOVA.

1298

1299 Figure 8. Effects of restricted feeding on circadian rhythms of peripheral tissues.

1300 (A) Schedule of a temporal FR protocol in DD for real-time circadian reporting assay.

1301 Horizontal black and white bars representing lights off and on for LD 12:12 are shown above as

1302 a reference for a daily feeding schedule. Gray bars represent food availability. After

1303 entrainment to LD12:12, mice were released into and maintained in DD for a total of >30 days.

54 1304 In DD, mice were fed ad libitum for the initial 2 weeks and underwent a 5-day FR ramp of

1305 gradually decreasing food availability to reach the final food availability window of 4 hrs (from

1306 ZT/CT6-10) for 2 weeks of FR. Tissues were harvested at 2 hrs after removal of the food. (B,C)

1307 Representative double-plotted actograms of 2 Fx/Fx control (B) and 2 BKO mice (C) during 2

1308 weeks of ad lib feeding followed by the 5-day FR ramp and subsequent 2 weeks of FR in DD.

1309 The boxed area toward the left side of each actogram indicates the daily interval of food

1310 availability under FR (ZT/CT6-10). (D) Phase map of circadian rhythms of various peripheral

1311 tissues from Fx/Fx controls in DD+FR (n=11). The peak phases (or averaged peak phases) were

1312 plotted against the feeding time (green bar). Tissues from the same animal are connected by

1313 colored lines with matched symbols. (E) Phase map of (D) was converted to CT for the harvest

1314 time. (F) Phase map of BKO’s in DD+FR (n=11). The peak phases (or averaged peak phases)

1315 were plotted against the feeding time (green bars). (G) Circular plots of peak bioluminescence

1316 rhythms in the SCN and peripheral tissues presented in (D-F). The mapping strategy is the same

1317 as in Figure 5E. The sample size, mean phase angle, and circular variance for each data set are

1318 summarized in Figure 8-source data 1. (H) Scattered plot of circular variance in each individual

1319 mouse. Degree of variance among the peak phase values of pituitary, liver, kidney, heart, lung,

1320 and spleen in an individual mouse was calculated and expressed as circular variance (see Figure

1321 8-source data 2), and compared between Fx/Fx controls and BKO’s in DD+FR. The bar is ± SD.

1322 Note that the degree of variance is not changed by phase data conversion from ZT to CT. A

1323 significant effect was found between Fx/Fx control and BKO mice (P = 0.0002 by Mann

1324 Whitney test). (I) Normalized amplitude of bioluminescence rhythms from Fx/Fx control (open

1325 bar) vs BKO (dark bar) in DD+FR. Mean relative amplitude ± SD are shown. The sample size

1326 is the same as in (D,F). ***P < 0.001, ****P < 0.0001 by t-test.

55 1327

1328 Figure 8-source data 1. Summary of statistical analysis of circular plots presented in Figure 8.

1329 Figure 8-source data 2. Statistical analysis of circular variance for peak bioluminescence in

1330 individual mice under restriction feeding.

1331

1332 Figure 9. Analysis of circadian rhythms of peripheral tissues under different conditions.

1333 (A,B) Comparison of peak bioluminescence rhythms in the peripheral tissues in Fx/Fx (A) and

1334 BKO (B) mice under LD, DD, and FR conditions. Circular plots are as presented in Figure 5E

1335 and Figure 8G. Watson-Williams F-test and bootstrap analysis were performed to compare the

1336 mean phase angle () and the variance (V, distribution of peak phase values) between two

1337 circular data, respectively. Statistical comparison was summarized in Figure 9-source data 1,2.

1338 *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. N.S. = not significant. (C,D) Comparison

1339 of normalized amplitude of bioluminescence rhythms from Fx/Fx (C) and BKO (D) mice under

1340 LD, DD, and FR conditions. Each bar graph is as presented in Figure 6A,B and Figure 8I.

1341 Mean relative amplitude ± SD are shown. *P < 0.05, **P < 0.01, ***P < 0.001 by ANOVA.

1342

1343 Figure 9-source data 1. Summary of statistical comparison of peak phases from Fx/Fx mice 1344 under different conditions. 1345 Figure 9-source data 2. Summary of statistical comparison of peak phases from BKO mice 1346 under different conditions.

56 AB C DE

F CT2 CT6CT10CT14 CT18 CT22 CT2 H Fx/Fx BKO 350 Fx/Fx 300 250 200 150

Bmal1 100 Bmal1 mRNA BKO 50 0 2 6 10 14 18 22 2 G Circadian Time (hr) I 350 Fx/Fx 300 250 200 150 Per2 100 Per2 mRNA BKO 50 0 2 6 10 14 18 22 2 Circadian Time (hr)

J Fx/Fx BKO KO

K L Cortex Bulb Eye Frontal Olfactory Cerebellum Pituitary Muscle Liver Spleen Kidney Heart Lung Cre Cre Fx/Fx Fx/Fx BKO BKO KO KO Fx/Fx F. CTX

BKO BMAL1 Cer.

KO Liver A Cre Fx/Fx Het C Period 0 LD LD LD 26 DD LL 25 * DD DD DD 24 * Hours 23 LD LD LD 22 Days CreFx/Fx Het BKO LL LL LL D Amplitude LD LD LD 104 0.2 DD 0.16 LL B BKO BKO BKO 0.12 0.08

0 LD LD LD FFT Power 0.04 * * 0 CreFx/Fx Het BKO DD DD DD E LD LD LD Activity Level DD

Days * LD 40 * LL LL LL LL * 30 20 * 104 LD LD LD (x 1000) 10 024480244802448

Wheel revs/day 0 Time of day (hr) Time of day (hr) Time of day (hr) Cre Fx/Fx Het BKO A Cre Fx/Fx Het C D 0 LD 80 80 60 60 DD 40 40 Fx/Fx LD 20 20 Mean counts/min

LDLD Mean counts/min 0 0

Days 1:10:1:12 80 80 LD 60 60 LD 40 40 BKO 116 3.5:3.5 B 20 20 BKO BKO BKO 0 0 Mean counts/min Mean counts/min 0 LD 01224 01224 Time of day (hr) Time of day (hr) DD E Sk.Day F Fx/Fx LD Sk.Night BKO 22.5 50 * LDLD Days 1:10:1:12 15 25 7.5 * *

LD (x1000) 0 * 0 % of activity Wheel revs

LD Fx/Fx BKO 0-½ ½-1 116 3.5:3.5 1-1½ 1½-2 2-2½ 2½-3 3-3½ 0 24 48 0 24 48 0 24 48 ½ hr light bins Time of day (hr) Time of day (hr) Time of day (hr) G H I Fx/Fx BKO Fx/Fx BKO 0 0.25 0.2 7 hr ** 18-30 hr 0.2 0.15 0.15 0.1 Days 0.1 0.05 0.05 13 FFT Power * Relative power 0 0 0244802448 0 0.1 0.2 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5 Fx/Fx BKO Time of day (hr) Time of day (hr) Freq (cyc/hr) Freq (cyc/hr) A B SCN DMH Pituitary Liver 120 30 50 150 40 90 20 100 30 60 20

Fx/Fx 10 50 30 10 0 0 0 0 0 2 4 6 8 10121416182022 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 160 40 50 180

120 30 40 120 30 80 20

BKO 20 60 40 10 10 Bioluminescence (counts/sec) 0 0 0 0 0 2 4 6 8 10121416182022 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 Lung Heart Spleen Kidney C 280 25 90 40 20 210 30 60 15 140 20 10 Fx/Fx 30 70 5 10

0 0 0 0 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 210 30 90 40

30 140 20 60 20 BKO 70 10 30 10 Bioluminescence (counts/sec) 0 0 0 0 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 Time (Day) Time (Day) Time (Day) Time (Day) A C

BD

E Fx/Fx BKO Fx/Fx BKO F from LD from LD from DD from DD

SCN

Pituitary

G Liver

Kidney

Heart

Lung

Spleen

Time (hr) Time (hr) Time (hr) Time (hr) A B

CDHeart Fx/Fx E Fx/Fx 100

50

50 100

150

0 200 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 BKO BKO 100

50

50 100 BKO Fx/Fx Bioluminescence (counts/sec) 150

0 200 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Time (Day) Time (Day) F G Fx/Fx BKO BKO 4x1044 4x1044 2x1044

3x1044 3x1044

2x1044 2x1044 1x1044

1x1044 1x1044 0 0 0 Bioluminescence (a.u.) 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Time (Day) Time (Day) Time (Day) HI Fx/Fx BKO

0 0 **** 6 18 6 18 12 12

CT (hr) CT (hr) A LD

DD

food available progressive final window of ad libitum food restriction food availability B C Fx/Fx BKO 80 0 constant restricted 60 Fx/Fx 40 20

33 Counts/min 0 012 012 ZT (hr) ZT (hr) 0 DE 20 2 BKO 10 1 (hrs) (x1000) 0

FAA/6 hrs 1471013 0

33 FAA Onset Days after onset of FR Fx/Fx BKO F G 80 0 constant restricted Fx/Fx 60 14 0 40 20 14 Counts/min 0 012 012 0 CT (hr) CT (hr) BKO H I 14 0 20 2 * 10 14 1 (x1000) 0 00024 4824 48 24 48 ad FR FAA/6 hrs 1471013 0 lib Time of day (hr)Time of day (hr) Time of day (hr) Days after onset of FR Activity fold A LD

DD ------food available progressive final window of ad libitum food restriction food availability Tissue (2 weeks in DD) (2 weeks) collection

Fx/Fx Fx/Fx B G Fx/Fx from Fx/Fx from BKO from 0 DD+FR DD+FR (in CT) DD+FR 14 19 Days

33 SCN C BKO BKO 0

14 19

Days Pituitary

33 0243612 0243612 Time of day (hr) Time of day (hr) D Liver

Kidney

Heart E

Lung

Spleen F Time (hr) Time (hr) Time (hr)

I

H A B Fx/Fx Fx/Fx Fx/Fx from BKO BKO BKO from from LD from DD DD+FR (in CT) from LD from DD DD+FR μ: N.S. μ: N.S. V: DDDD* V: LD

μ: *** μ: N.S. μ: *** V: DDDDFR**** V: LD

μ **** μ: ** μ: *** μ: * V: DD>DDFR**** Kidney V: N.S. V: N.S. Kidney V: LD

μ: ** μ: ** μ: N.S. μ: **** V: LD

μ: * μ: N.S. μ: N.S. μ: **** Lung V: N.S. V: N.S. Lung V: LD

μ: N.S. μ: N.S. μ: N.S. μ: **** V: LD>DD* V: N.S. V: LD

Time (hr) Time (hr) Time (hr)Time (hr) Time (hr) Time (hr)

C D