DOCSLIB.ORG

Regulation of Cathepsin K Expression by the Microphthalmia Transcription Factor Family

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulation of Cathepsin K Expression by the Microphthalmia Transcription Factor Family Linking osteopetrosis and pycnodysostosis: Regulation of cathepsin K expression by the microphthalmia transcription factor family G. Motyckova*, K. N. Weilbaecher*†, M. Horstmann*‡, D. J. Rieman§, D. Z. Fisher¶, and D. E. Fisher*ʈ *Division of Pediatric Hematology͞Oncology, Dana–Farber Cancer Institute and Children’s Hospital, Harvard Medical School, Boston, MA 02115; §Department of Bone and Cartilage Biology, SmithKline Beecham Pharmaceuticals, King of Prussia, PA 19406; and ¶Department of Cardiology, University of Massachusetts Medical Center, Worcester, MA 01655 Edited by Robert N. Eisenman, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved February 26, 2001 (received for review October 6, 2000) Various genetic conditions produce dysfunctional osteoclasts re- deficiency (14). Cathepsin K is a cysteine protease from the sulting in osteopetrosis or osteosclerosis. These include human papain family of proteases and plays an important role in pycnodysostosis, an autosomal recessive syndrome caused by osteoclast function (14). This enzyme has been shown to cleave cathepsin K mutation, cathepsin K-deficient mice, and mitf mutant a number of bone matrix proteins including collagen type I, II, rodent strains. Cathepsin K is a highly expressed cysteine protease and osteonectin. Both the Mitfmi/mi and cathepsin K mutant mice in osteoclasts that plays an essential role in the degradation of develop osteopetrosis due to defective osteoclasts. Osteoclasts protein components of bone matrix. Cathepsin K also is expressed derived from the Mitfmi/mi mutant mice are primarily mononu- in a significant fraction of human breast cancers where it could clear, do not form ruffled borders, and resorb bone poorly (3, 4, contribute to tumor invasiveness. Mitf is a member of a helix– 15). In addition, they contain decreased levels of tartrate- loop–helix transcription factor subfamily, which contains the po- resistant acid phosphatase (TRAP) consistent with the finding tential dimerization partners TFE3, TFEB, and TFEC. In mice, dom- that Mitf regulates TRAP expression in osteoclasts (16). Oste- inant negative, but not recessive, mutations of mitf, produce oclasts from cathepsin K mutant mice are multinucleated and osteopetrosis, suggesting a functional requirement for other fam- can demineralize bone, but cannot degrade the protein matrix of ily members. Mitf also has been found—and TFE3 has been sug- bone. These osteoclasts contain abnormal cytoplasmic vacuoles gested—to modulate age-dependent changes in osteoclast func- filled with bone collagen fibrils, and whereas the resorption pit tion. This study identifies cathepsin K as a transcriptional target of area is larger compared with wild type, these pits are much more Mitf and TFE3 via three consensus elements in the cathepsin K shallow (12–14). Pycnodysostosis is a human disease caused by promoter. Additionally, cathepsin K mRNA and protein were found congenital cathepsin K deficiency (14). The characteristic fea- to be deficient in mitf mutant osteoclasts, and overexpression of tures of pycnodysostosis are short stature and skeletal abnor- wild-type Mitf dramatically up-regulated expression of endoge- malities such as unclosed cranial sutures, apoplastic mandible, nous cathepsin K in cultured human osteoclasts. Cathepsin K and double rows of teeth. Pycnodysostotic osteoclasts are able to promoter activity was disrupted by dominant negative, but not demineralize bone but cannot degrade the organic matrix. Their recessive, mouse alleles of mitf in a pattern that closely matches morphology is similar to the osteoclasts from murine cathepsin their osteopetrotic phenotypes. This relationship between cathep- K null animals. Although once thought to reside exclusively in sin K and the Mitf family helps explain the phenotypic overlap of osteoclasts, cathepsin K expression has been discovered in a their corresponding deficiencies in pycnodysostosis and osteope- significant fraction of human breast cancers (17). Cathepsin K is trosis and identifies likely regulators of cathepsin K expression in an attractive potential target for the treatment of osteoporosis bone homeostasis and human malignancy. and also could play a role in breast cancer invasiveness. Studies of cathepsin K inhibitors are thus underway as therapeutic agents. one resorption is a pivotal process for normal growth and Cathepsin K mRNA and protein have not been characterized Bhomeostasis and is defective in a variety of human diseases in the Mitfmi/mi mouse. This study identifies cathepsin K as a including osteoporosis and osteopetrosis. Bone resorbing oste- target of the Mitf transcription factor family. Cathepsin K oclasts are multinucleated hematopoietic cells with abundant protein and mRNA levels are decreased in Mitfmi/mi mouse mitochondria and ruffled borders, which resorb calcified bone osteoclasts. The cathepsin K promoter contains four E-boxes, through resorption pits (Howship’s lacunae) (1, 2). Osteoblastic putative Mitf binding sites, three of which respond to the Mitf stromal cells are involved in bone formation and can regulate family in transactivation assays. Electrophoretic mobility-shift osteoclast function. Defects in osteoclast function resulting in studies show that the same three sites are bound by Mitf derived osteopetrosis have been described in several mitf mutant rodent from osteoclast nuclear extracts. Osteopetrotic mouse mitf al- strains (3–5). The Mitfmi/mi mouse was described in the 1940s and contains a mutation, now known to affect a basic͞helix–loop– helix͞leucine-zipper transcription factor, resulting in severe os- This paper was submitted directly (Track II) to the PNAS office. teopetrosis (marble bone disease), absence of neural crest- Abbreviations: TRAP, tartrate-resistant acid phosphatase; M-CSF, macrophage colony- derived pigment cells, and mast cell defects (6). Mitf stimulating factor; RANKL, receptor activator of NF-␬B ligand; GFP, green fluorescent subsequently was found to belong to a family of transcription protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. factors, which includes Mitf, TFE3, TFEB, and TFEC. All See commentary on page 5385. members of this Mitf family of transcription factors are capable †Present address: Division of Medical Oncology, Washington University School of Medicine, of forming homodimers or heterodimers and bind an E-box St. Louis, MO 63110. ͞ ‡Present address: Department of Pediatric Oncology, Children’s Hospital University Clinic consensus sequence CA[C T]GTG (7–9). Both Mitf and TFE3 Eppendorf, 20246 Hamburg, Germany. are abundantly expressed in osteoclasts (5) and have been linked ʈTo whom reprint requests should be addressed at: Dana–Farber Cancer Institute, 44 Binney to changes in osteoclast function with age (5, 10, 11). Street, Boston, MA 02115. E-mail: david_fi[email protected]. There is a phenotypic similarity between microphthalmia The publication costs of this article were defrayed in part by page charge payment. This mi/mi Mitf mutant mice and cathepsin K null mice (12, 13) as well article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. as the human disease pycnodysostosis caused by cathepsin K §1734 solely to indicate this fact. 5798–5803 ͉ PNAS ͉ May 8, 2001 ͉ vol. 98 ͉ no. 10 www.pnas.org͞cgi͞doi͞10.1073͞pnas.091479298 Downloaded by guest on September 24, 2021 leles [mitf oakridge (mitfor) and mitf microphthalmia (mitfmi by using PCR and the following primers: 5Ј primer, CGG- delR217) (8, 9)] disrupt cathepsin K promoter activity in the GGTACCCCGTCTCCTTCCCCACATCTGTTTATGG; 3Ј presence of wild-type Mitf or TFE3 whereas the nonosteope- primer, CTTCTAGAAGCAGCAAAGTGTGGGCACAC- trotic recessive allele mitf cloudy eyes (mitfce) (8, 9) does not CATCAG, cloned into a pCR-blunt vector by using a Zero-Blunt interfere with wild-type Mitf function, thus recapitulating a key Cloning Kit (Invitrogen), retrieved by using KpnI and BglII, and genetic feature of Mitf-dependent osteopetrosis. This study also cloned into the pGL2.basic luciferase vector (Promega). Point shows that endogenous cathepsin K mRNA levels are up- mutations in the cathepsin K promoter were made by PCR, regulated upon overexpression of Mitf in primary human oste- incorporating the same double mutants as in the binding studies oclasts and thus identifies cathepsin K as a transcriptional target (see Fig. 2B). Deletion of E-boxes 1–3 in the Cathepsin K of the Mitf transcription factor family. promoter (del1–3.luc) was performed by HindIII cleavage of the full-length, wild-type promoter fragment, followed by Klenow Materials and Methods treatment, KpnI cleavage, and ligation into pGL2.basic. Animals and Cell Lines. C57BL͞6J mice ages 6–8 weeks and heterozygous ϩ͞Mitf (B6C3Fe-a͞a-mitfmi) breeding pairs were Transfections. Transfection experiments were performed in obtained from The Jackson Laboratories. MCF-7 (American MCF-7 cells by using Lipofectamine͞Plus reagent (GIBCO͞ Type Culture Collection) and ST2 (Riken Cell Bank, Tsukuba, BRL) (see Fig. 3). Individual wells of a 24-well plate (1 ϫ 104 Japan) cells were grown in DMEM͞10% FBS supplemented cells) received 0.1 ␮g cathepsin K promoter, 0.1 ␮g sea pansey with 0.1% penicillin͞streptomycin. luciferase plasmid (Promega), and 0.7 ␮g Mitf.pEBB expression vector (19), TFE3.pSV2A (20), or vector controls. Cells were Mouse Osteoclasts. Mouse spleen cells were cultured in MEM harvested after 24 h of transfection in 1ϫ passive lysis buffer (Cellgro, Herndon, VA)͞10% FBS (HyClone), 100 ng͞ml mac- (Promega),
Load more

Recommended publications
  • A Comparative Study of Pycnodysostosis, Cleidocranial Dysostosis, Osteopetrosis and Acro-Osteolysis
    18 Mei 1974 S.-A. MEDIESE TYDSKRIF 1011 A Comparative Study of Pycnodysostosis, Cleidocranial Dysostosis, Osteopetrosis and Acro-osteolysis A. WOLPOWITZ, A. MATISONN SUMMARY thalmos, and blue sclerae have been noted. There may be a high, grooved palate. Platybasia may be found. There are A radiological study of cases of pycnodysostosis, osteo­ often poor dental formation and dental caries. Madelung's petrosis, cleidocranial dysostosis and acro-osteolysis type of deformity has been reported. revealed an interwoven relationship as regards the X-ray Laboratory findings are usually normal but reduced findings with numerous identical signs that these condi­ alkaline phosphatase values and slight hypercalcaemia tions had in common. Open fontanelles and sutures as have been reported. In recent reports cases with anaemia, well as metopic sutures were found in all 4 conditions; thrombocytopenia and splenomegaly were described."'· wormian bones, diminution or complete loss of mandibular angles, and hypoplastic paranasal sinuses and facial bones were noted in cleidocranial dysostosis, pycnodysostosis Radiological Findings and acro-osteolysis. Undertubulation of .Iong bones is seen in cleidocranial dysostosis and osteopetrosis. Osteo­ The most striking radiological finding is increased den­ petrosis and pycnodysostosis show sclerosis of bone, sity of bone. In spite of the bone sclerosis the medullary dense orbital margins, fractures after minimal trauma with canals are evident and the tubular bones are usually more abundant callus and rapid healing in common, while there delicate in calibre than normal, but normal in shape. is absorption of terminal phalanges and disturbance in There has, however, been a report of a case with splaying the development of the teeth in both pycnodysostosis and of the metaphyseal ends.' acro-osteolysis.
    [Show full text]
  • Blueprint Genetics Comprehensive Skeletal Dysplasias and Disorders
    Comprehensive Skeletal Dysplasias and Disorders Panel Test code: MA3301 Is a 251 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of disorders involving the skeletal system. About Comprehensive Skeletal Dysplasias and Disorders This panel covers a broad spectrum of skeletal disorders including common and rare skeletal dysplasias (eg. achondroplasia, COL2A1 related dysplasias, diastrophic dysplasia, various types of spondylo-metaphyseal dysplasias), various ciliopathies with skeletal involvement (eg. short rib-polydactylies, asphyxiating thoracic dysplasia dysplasias and Ellis-van Creveld syndrome), various subtypes of osteogenesis imperfecta, campomelic dysplasia, slender bone dysplasias, dysplasias with multiple joint dislocations, chondrodysplasia punctata group of disorders, neonatal osteosclerotic dysplasias, osteopetrosis and related disorders, abnormal mineralization group of disorders (eg hypopohosphatasia), osteolysis group of disorders, disorders with disorganized development of skeletal components, overgrowth syndromes with skeletal involvement, craniosynostosis syndromes, dysostoses with predominant craniofacial involvement, dysostoses with predominant vertebral involvement, patellar dysostoses, brachydactylies, some disorders with limb hypoplasia-reduction defects, ectrodactyly with and without other manifestations, polydactyly-syndactyly-triphalangism group of disorders, and disorders with defects in joint formation and synostoses. Availability 4 weeks Gene Set Description
    [Show full text]
  • Two Cases with Pycnodysostosis in a Family: a Case Report
    International Journal of Contemporary Pediatrics Reddy KV et al. Int J Contemp Pediatr. 2020 Jun;7(6):1441-1443 http://www.ijpediatrics.com pISSN 2349-3283 | eISSN 2349-3291 DOI: http://dx.doi.org/10.18203 /2349-3291.ijcp20202164 Case Report Two cases with pycnodysostosis in a family: a case report K. Venkataramana Reddy1*, Chapay Soren1, M. Geethika2, V. Malathi1 1Department of Pediatrics, 2Department of Radiodiagnosis, SVS Medical College, Mahabubnagar, Telangana, India Received: 06 February 2020 Revised: 28 April 2020 Accepted: 05 May 2020 *Correspondence: Dr. K. Venkataramana Reddy, E-mail: [email protected] Copyright: © the author(s), publisher and licensee Medip Academy. This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. ABSTRACT Pycnodysostosis (Greek, pycnos - density, dys - defect, ostosis - bone) is a rare inherited disorder of the bone, first described by Maroteaux and Lamy. Pycnodysostosis is an autosomal recessive disorder, with incidence estimated to be 1.7 per 1 million births. Clinical presentation of this disorder include short stature, dolichocephalic skull, frontal bossing, obtuse mandibular angle, dysplastic clavicles, and short hands and feet, diffuse osteosclerosis, acro- osteolysis along with the finger and nail abnormalities. The main oral aspects are midfacial hypoplasia, a grooved palate, and dental abnormalities include double row of teeth, delayed eruption of permanent dentition, multiple caries. Pathological fractures of the bones occur due to sclerosis. Radiologically, skull bones appear thickened with open fontanels which look like ‘lakes of bones’, hypoplasia of facial bones, generalized osteosclerosis, open fontanels and cranial sutures, non pneumotization of paranasal sinuses, and fractures commonly in lower limbs.
    [Show full text]
  • Osteopetrosis Associated with Familial Paraplegia: Report of a Family
    Paraplegia (1975), 13, 143-152 OSTEOPETROSIS ASSOCIATED WITH FAMILIAL PARAPLEGIA: REPORT OF A FAMILY By SKIP JACQUES*, M.D., JOHN T. GARNER, M. D., DAVID JOHNSON, M.D. and C. HUNTER SHELDEN, M. D. Departments of Neurosurgery and Radiology, Huntington Memorial Hospital, Pasadena, Ca., and the Huntington Institute of Applied Medical Research, Pasadena, Ca., U.S.A. Abstract. A clinical analysis of three members of a family with documented osteopetrosis and familial paraplegia is presented. All patients had a long history of increased bone density and slowly progressing paraparesis of both legs. A thorough review of the literature has revealed no other cases which presented with paraplegia without spinal cord com­ pression. Although the etiologic factor or factors remain unknown, our review supports the contention that this is a distinct clinical entity. IN 1904, a German radiologist, Heinrich Albers-Schonberg, described a 26-year­ old man with multiple fractures and generalised sclerosis of the skeleton. The disease has henceforth commonly been known as Albers-Schonberg disease or marble osteopetrosis, a term first introduced by Karshner in 1922. Other eponyms are bone disease, osteosclerosis fragilis generalisata, and osteopetrosis generalisata. Approximately 300 cases had been reported in the literature by 1968. It has been generally accepted that the disease presents in two distinct forms, an infantile progressive disease and a milder form in childhood and adolescence. The two forms differ clinically and genetically. A dominant pattern of inheritance is usually seen in the benign type whereas the severe infantile form is usually inherited as a Mendelian recessive. This important distinction has not been well emphasised.
    [Show full text]
  • Biochemical, Clinical and Genetic Characteristics in Adults with Persistent Hypophosphatasaemia; Data from an Endocrinological Outpatient Clinic in Denmark
    Bone Reports 15 (2021) 101101 Contents lists available at ScienceDirect Bone Reports journal homepage: www.elsevier.com/locate/bonr Biochemical, clinical and genetic characteristics in adults with persistent hypophosphatasaemia; Data from an endocrinological outpatient clinic in Denmark Nicola Hepp a,*, Anja Lisbeth Frederiksen b,c, Morten Duno d, Jakob Præst Holm e, Niklas Rye Jørgensen f,g, Jens-Erik Beck Jensen a,g a Dept. of Endocrinology, Hvidovre University Hospital Copenhagen, Kettegaard Alle 30, 2650 Hvidovre, Denmark b Dept. of Clinical Genetics, Aalborg University Hospital, Ladegaardsgade 5, 9000 Aalborg C, Denmark c Dept. of Clinical Research, Aalborg University, Fredrik Bajers Vej 7K, 9220 Aalborg Ø, Denmark d Dept. of Clinical Genetics, University Hospital Copenhagen Rigshospitalet, Blegdamsvej 9, 2100 Copenhagen, Denmark e Department of Endocrinology, Copenhagen University Hospital Herlev, Borgmester Ib Juuls Vej 1, 2730 Herlev, Denmark f Dept. of Clinical Biochemistry, Rigshospitalet, Valdemar Hansens Vej 13, 2600 Glostrup, Denmark g Department of Clinical Medicine, Faculty of Health and Medical Sciences, University of Copenhagen, Blegdamsvej 3 B, 2200 Copenhagen, Denmark ARTICLE INFO ABSTRACT Keywords: Background: Hypophosphatasia (HPP) is an inborn disease caused by pathogenic variants in ALPL. Low levels of Alkaline phosphatase alkaline phosphatase (ALP) are a biochemical hallmark of the disease. Scarce knowledge about the prevalence of ALPL HPP in Scandinavia exists, and the variable clinical presentations make diagnostics challenging. The aim of this Hypophosphatasia study was to investigate the prevalence of ALPL variants as well as the clinical and biochemical features among Osteoporosis adults with endocrinological diagnoses and persistent hypophosphatasaemia. Bisphosphonates Methods: A biochemical database containing ALP measurements of 26,121 individuals was reviewed to identify adults above 18 years of age with persistently low levels of ALP beneath range (≤ 35 ± 2.7 U/L).
    [Show full text]
  • REVIEW ARTICLE Genetic Disorders of the Skeleton: a Developmental Approach
    Am. J. Hum. Genet. 73:447–474, 2003 REVIEW ARTICLE Genetic Disorders of the Skeleton: A Developmental Approach Uwe Kornak and Stefan Mundlos Institute for Medical Genetics, Charite´ University Hospital, Campus Virchow, Berlin Although disorders of the skeleton are individually rare, they are of clinical relevance because of their overall frequency. Many attempts have been made in the past to identify disease groups in order to facilitate diagnosis and to draw conclusions about possible underlying pathomechanisms. Traditionally, skeletal disorders have been subdivided into dysostoses, defined as malformations of individual bones or groups of bones, and osteochondro- dysplasias, defined as developmental disorders of chondro-osseous tissue. In light of the recent advances in molecular genetics, however, many phenotypically similar skeletal diseases comprising the classical categories turned out not to be based on defects in common genes or physiological pathways. In this article, we present a classification based on a combination of molecular pathology and embryology, taking into account the importance of development for the understanding of bone diseases. Introduction grouping of conditions that have a common molecular origin but that have little in common clinically. For ex- Genetic disorders affecting the skeleton comprise a large ample, mutations in COL2A1 can result in such diverse group of clinically distinct and genetically heterogeneous conditions as lethal achondrogenesis type II and Stickler conditions. Clinical manifestations range from neonatal dysplasia, which is characterized by moderate growth lethality to only mild growth retardation. Although they retardation, arthropathy, and eye disease. It is now be- are individually rare, disorders of the skeleton are of coming increasingly clear that several distinct classifi- clinical relevance because of their overall frequency.
    [Show full text]
  • Human Osteopetroses and the Osteoclast V-H+-Atpase Enzyme
    [Frontiers in Bioscience 10, 2940-2954, September 1, 2005] HUMAN OSTEOPETROSES AND THE OSTEOCLAST V-H+-ATPASE ACIDIFICATION SYSTEM Kalu U.E. Ogbureke 1 Qingxiao Zhao 2,3 and Yi-Ping Li 2,3,4, 5 1 Department of Oral Biology and Maxillofacial Pathology School of Dentistry Medical College of Georgia Augusta Georgia. 2 Zhejiang Cell Biomedical Research College, Hangzhou, China. 3 Life Science College, Zhejiang University, Hangzhou, China. 4 Department of Cytokine Biology Forsyth Institute and 5Department of Oral Biology Harvard school of Dental Medicine Boston Massachusetts USA TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Clinical perspective, genetic aberrations of human osteopetrosis 3.1. Human infantile malignant autosomal recessive OP (arOP) 3.2. Intermediate forms of arOP 3.3. Autosomal dominant OP type I (ADOI) 3.4. Autosomal dominant OP type II (ADOII) 3.5. Reported conditions associated with human osteopetrosis 3.5.1. Human Pycnodysostosis 3.5.2. Glanzmann’s thrombasthenia 3.5.3. Severe pulmonary hypertension 3.5.4.Lymphoedema-Anhydrotic Ectodermal Dysplasia-Immunodeficiency SyndromOL-EDA-ID “syndrome” ) 3.5.5. “Acquired” (Iatrogenic) osteopetrosis 4. Osteoclast V-H+ ATPase enzyme system and animal models of human osteopetrosis 4.1. Osteoclast V-H+ ATPase enzyme system 4.2. Mouse models 4.2.1. Defects in Atp6i 4.2.2. Defects in Clc-7 4.2.3. Defects in grey lethal (gl) 4.2.4. Defects in Cathepsin K 4.2.5. Defects in αvβ3 integrin 4.2.6. Defects in genes regulating osteoclast differentiation 5. Summary and Perspective 6. Acknowledgment 7. References 1. ABSTRACT Osteopetroses are a heterogeneous group of present with defects in the OC116-KDa (also refers to ATP6i, human genetic diseases characterized by generalized TCIRGI, a3) subunit of the osteoclast vacuolar H+-ATPase increase in bone density due either to a lack of osteoclast (V-H+-ATPase) proton pump.
    [Show full text]
  • Bone Health in Patients with Inborn Errors of Metabolism
    Reviews in Endocrine and Metabolic Disorders (2018) 19:81–92 https://doi.org/10.1007/s11154-018-9460-5 Bone health in patients with inborn errors of metabolism M. Langeveld1 & C. E. M. Hollak1 Published online: 12 September 2018 # The Author(s) 2018 Abstract Inborn errors of metabolism encompass a wide spectrum of disorders, frequently affecting bone. The most important metabolic disorders that primarily influence calcium or phosphate balance, resulting in skeletal pathology, are hypophosphatemic rickets and hypophosphatasia. Conditions involving bone marrow or affecting skeletal growth and development are mainly the lyso- somal storage disorders, in particular the mucopolysaccharidoses. In these disorders skeletal abnormalities are often the present- ing symptom and early recognition and intervention improves outcome in many of these diseases. Many disorders of interme- diary metabolism may impact bone health as well, resulting in higher frequencies of osteopenia and osteoporosis. In these conditions factors contributing to the reduced bone mineralization can be the disorder itself, the strict dietary treatment, reduced physical activity or sunlight exposure and/or early ovarian failure. Awareness of these primary or secondary bone problems amongst physicians treating patients with inborn errors of metabolism is of importance for optimization bone health and recognition of skeletal complications. Keywords Osteopenia . Osteoporosis . Inborn error of metabolism . Lysosomal storage disorder . Skeletal dysplasia . Bone metabolism 1 Introduction
    [Show full text]
  • Subbarao K Skeletal Dysplasia (Sclerosing Dysplasias – Part I)
    REVIEW ARTICLE Skeletal Dysplasia (Sclerosing dysplasias – Part I) Subbarao K Padmasri Awardee Prof. Dr. Kakarla Subbarao, Hyderabad, India Introduction Dysplasia is a disturbance in the structure of Monitoring germ cell Mutations using bone and disturbance in growth intrinsic to skeletal dysplasias incidence of dysplasia is bone and / or cartilage. Several terms have 1500 for 9.5 million births (15 per 1,00,000) been used to describe Skeletal Dysplasia. Skeletal dysplasias constitute a complex SCLEROSING DYSPLASIAS group of bone and cartilage disorders. Three main groups have been reported. The first Osteopetrosis one is thought to be x-linked disorder Pyknodysostosis genetically inherited either as dominant or Osteopoikilosis recessive trait. The second group is Osteopathia striata spontaneous mutation. Third includes Dysosteosclerosis exposure to toxic or infective agent Worth’s sclerosteosis disrupting normal skeletal development. Van buchem’s dysplasia Camurati Engelman’s dysplasia The term skeletal dysplasia is sometimes Ribbing’s dysplasia used to include conditions which are not Pyle’s metaphyseal dysplasia actually skeletal dysplasia. According to Melorheosteosis revised classification of the constitutional Osteoectasia with hyperphosphatasia disorders of bone these conditions are Pachydermoperiosteosis (Touraine- divided into two broad groups: the Solente-Gole Syndrome) osteochondrodysplasias and the dysostoses. There are more than 450 well documented Evaluation by skeletal survey including long skeletal dysplasias. Many of the skeletal bones thoracic cage, hands, feet, cranium and dysplasias can be diagnosed in utero. This pelvis is adequate. Sclerosing dysplasias paper deals with post natal skeletal are described according to site of affliction dysplasias, particularly Sclerosing epiphyseal, metaphyseal, diaphyseal and dysplasias. generalized. Dysplasias with increased bone density Osteopetrosis (Marble Bones): Three forms are reported.
    [Show full text]
  • Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis
    0163-769X/00/$03.00/0 Endocrine Reviews 21(2): 115–137 Copyright © 2000 by The Endocrine Society Printed in U.S.A. Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis STAVROS C. MANOLAGAS Division of Endocrinology & Metabolism, Center for Osteoporosis & Metabolic Bone Diseases, University of Arkansas for Medical Sciences, and the Central Arkansas Veterans Healthcare System, Little Rock, Arkansas 72205, USA ABSTRACT these cells. The purpose of this article is 3-fold: 1) to review the role The adult skeleton regenerates by temporary cellular structures and the molecular mechanism of action of regulatory molecules, such that comprise teams of juxtaposed osteoclasts and osteoblasts and as cytokines and hormones, in osteoclast and osteoblast birth and replace periodically old bone with new. A considerable body of evi- apoptosis; 2) to review the evidence for the contribution of changes in dence accumulated during the last decade has shown that the rate of bone cell birth or death to the pathogenesis of the most common forms genesis of these two highly specialized cell types, as well as the of osteoporosis; and 3) to highlight the implications of bone cell birth prevalence of their apoptosis, is essential for the maintenance of bone and death for a better understanding of the mechanism of action and homeostasis; and that common metabolic bone disorders such as os- efficacy of present and future pharmacotherapeutic agents for osteo- teoporosis result largely from a derangement in the birth or death of porosis. (Endocrine Reviews 21: 115–137, 2000) I. Introduction B.
    [Show full text]
  • Hajdu–Cheney Syndrome: a Systematic Review of the Literature
    International Journal of Environmental Research and Public Health Review Hajdu–Cheney Syndrome: A Systematic Review of the Literature Jonathan Cortés-Martín 1, Lourdes Díaz-Rodríguez 2 , Beatriz Piqueras-Sola 1, Raquel Rodríguez-Blanque 3,*, Antonio Bermejo-Fernández 4 and Juan Carlos Sánchez-García 2 1 Research Group CTS1068, Andalusia Research Plan, Junta de Andalucía, Hospital Universitario Virgen de las Nieves, 18014 Granada, Spain; [email protected] (J.C.-M.); [email protected] (B.P.-S.) 2 Research Group CTS1068, Andalusia Research Plan, Junta de Andalucía, Nursing Department, Faculty of Health Sciences, University of Granada, 18071 Granada, Spain; [email protected] (L.D.-R.); [email protected] (J.C.S.-G.) 3 Andalusia Research Plan, Junta de Andalucía, Research Group CTS1068, San Cecilio Clinical University Hospital, 18071 Granada, Spain 4 Research Group CTS 1068, Andalusia Research Plan. Junta de Andalucía, Clinical RIBER CENTER, 41018 Sevilla, Spain; antoniobermejofi[email protected] * Correspondence: [email protected] Received: 26 July 2020; Accepted: 22 August 2020; Published: 25 August 2020 Abstract: Hajdu–Cheney syndrome (HCS) is a rare genetic disease that causes acroosteolysis and generalized osteoporosis, accompanied by a series of developmental skeletal disorders and multiple clinical and radiological manifestations. It has an autosomal dominant inheritance, although there are several sporadic non-hereditary cases. The gene that has been associated with Hajdu-Cheney syndrome is NOTCH2. The described phenotype and clinical signs and symptoms are many, varied, and evolve over time. As few as 50 cases of this disease, for which there is currently no curative treatment, have been reported to date.
    [Show full text]
  • Orthognathic Surgery in Pycnodysostosis: a Case Report
    110 Herna´ndez-Alfaro et al. Case Report Congenital Craniofacial Deformities F. Herna´ndez-Alfaro1, J. Arenaz Bu´ a2, M. Serra Serrat3, Orthognathic surgery in J. Mareque Bueno1 1Department Oral and Maxillofacial Surgery Teknon Medical Center, Barcelona, Spain; pycnodysostosis: a case report 2Department of Oral and Maxillofacial Surgery, Complejo Hospitalario Universitario de A Corun˜a, Spain; 3Orthodontist, Barcelona, Spain F. Herna´ndez-Alfaro, J. Arenaz Bu´a, M. Serra Serrat, J. Mareque Bueno: Orthognathic surgery in pycnodysostosis: a case report. Int. J. Oral Maxillofac. Surg. 2011; 40: 106–123. # 2010 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved. Abstract. Pycnodysostosis is an extremely rare genetic osteosclerosis caused by cathepsin K deficiency. It is a human autosomal recessive genetic disorder characterized mainly by osteosclerosis of the skeleton due to decreased bone turnover. It is characterized by short stature, brachycephaly, short and stubby fingers, open cranial sutures and fontanelle, and diffuse osteosclerosis. Multiple fractures of the long bones and osteomyelitis of the jaw are frequent complications. The authors describe an 18-year-old girl with a clinical and radiological diagnosis of pycnodysostosis and the ortho-surgical treatment undertaken. Bimaxillary orthognathic surgery was carried out using rigid fixation and bone grafts. The authors recommend bimaxillary orthognathic surgery as a choice for treating the dentofacial deformities of pycnodysostosis, emphasizing the good and stable results Accepted for publication 19 July 2010 obtained in terms of facial aesthetics and occlusion. Available online 21 August 2010 Pycnodysostosis is a rare osteopetrotic nodysostosis are abnormally dense and narrowing of the airway1–3,5–7,10.
    [Show full text]