Linking osteopetrosis and pycnodysostosis: Regulation of cathepsin K expression by the microphthalmia transcription factor family G. Motyckova*, K. N. Weilbaecher*†, M. Horstmann*‡, D. J. Rieman§, D. Z. Fisher¶, and D. E. Fisher*ʈ *Division of Pediatric Hematology͞Oncology, Dana–Farber Cancer Institute and Children’s Hospital, Harvard Medical School, Boston, MA 02115; §Department of Bone and Cartilage Biology, SmithKline Beecham Pharmaceuticals, King of Prussia, PA 19406; and ¶Department of Cardiology, University of Massachusetts Medical Center, Worcester, MA 01655 Edited by Robert N. Eisenman, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved February 26, 2001 (received for review October 6, 2000) Various genetic conditions produce dysfunctional osteoclasts re- deficiency (14). Cathepsin K is a cysteine protease from the sulting in osteopetrosis or osteosclerosis. These include human papain family of proteases and plays an important role in pycnodysostosis, an autosomal recessive syndrome caused by osteoclast function (14). This enzyme has been shown to cleave cathepsin K mutation, cathepsin K-deficient mice, and mitf mutant a number of bone matrix proteins including collagen type I, II, rodent strains. Cathepsin K is a highly expressed cysteine protease and osteonectin. Both the Mitfmi/mi and cathepsin K mutant mice in osteoclasts that plays an essential role in the degradation of develop osteopetrosis due to defective osteoclasts. Osteoclasts protein components of bone matrix. Cathepsin K also is expressed derived from the Mitfmi/mi mutant mice are primarily mononu- in a significant fraction of human breast cancers where it could clear, do not form ruffled borders, and resorb bone poorly (3, 4, contribute to tumor invasiveness. Mitf is a member of a helix– 15). In addition, they contain decreased levels of tartrate- loop–helix transcription factor subfamily, which contains the po- resistant acid phosphatase (TRAP) consistent with the finding tential dimerization partners TFE3, TFEB, and TFEC. In mice, dom- that Mitf regulates TRAP expression in osteoclasts (16). Oste- inant negative, but not recessive, mutations of mitf, produce oclasts from cathepsin K mutant mice are multinucleated and osteopetrosis, suggesting a functional requirement for other fam- can demineralize bone, but cannot degrade the protein matrix of ily members. Mitf also has been found—and TFE3 has been sug- bone. These osteoclasts contain abnormal cytoplasmic vacuoles gested—to modulate age-dependent changes in osteoclast func- filled with bone collagen fibrils, and whereas the resorption pit tion. This study identifies cathepsin K as a transcriptional target of area is larger compared with wild type, these pits are much more Mitf and TFE3 via three consensus elements in the cathepsin K shallow (12–14). Pycnodysostosis is a human disease caused by promoter. Additionally, cathepsin K mRNA and protein were found congenital cathepsin K deficiency (14). The characteristic fea- to be deficient in mitf mutant osteoclasts, and overexpression of tures of pycnodysostosis are short stature and skeletal abnor- wild-type Mitf dramatically up-regulated expression of endoge- malities such as unclosed cranial sutures, apoplastic mandible, nous cathepsin K in cultured human osteoclasts. Cathepsin K and double rows of teeth. Pycnodysostotic osteoclasts are able to promoter activity was disrupted by dominant negative, but not demineralize bone but cannot degrade the organic matrix. Their recessive, mouse alleles of mitf in a pattern that closely matches morphology is similar to the osteoclasts from murine cathepsin their osteopetrotic phenotypes. This relationship between cathep- K null animals. Although once thought to reside exclusively in sin K and the Mitf family helps explain the phenotypic overlap of osteoclasts, cathepsin K expression has been discovered in a their corresponding deficiencies in pycnodysostosis and osteope- significant fraction of human breast cancers (17). Cathepsin K is trosis and identifies likely regulators of cathepsin K expression in an attractive potential target for the treatment of osteoporosis bone homeostasis and human malignancy. and also could play a role in breast cancer invasiveness. Studies of cathepsin K inhibitors are thus underway as therapeutic agents. one resorption is a pivotal process for normal growth and Cathepsin K mRNA and protein have not been characterized Bhomeostasis and is defective in a variety of human diseases in the Mitfmi/mi mouse. This study identifies cathepsin K as a including osteoporosis and osteopetrosis. Bone resorbing oste- target of the Mitf transcription factor family. Cathepsin K oclasts are multinucleated hematopoietic cells with abundant protein and mRNA levels are decreased in Mitfmi/mi mouse mitochondria and ruffled borders, which resorb calcified bone osteoclasts. The cathepsin K promoter contains four E-boxes, through resorption pits (Howship’s lacunae) (1, 2). Osteoblastic putative Mitf binding sites, three of which respond to the Mitf stromal cells are involved in bone formation and can regulate family in transactivation assays. Electrophoretic mobility-shift osteoclast function. Defects in osteoclast function resulting in studies show that the same three sites are bound by Mitf derived osteopetrosis have been described in several mitf mutant rodent from osteoclast nuclear extracts. Osteopetrotic mouse mitf al- strains (3–5). The Mitfmi/mi mouse was described in the 1940s and contains a mutation, now known to affect a basic͞helix–loop– helix͞leucine-zipper transcription factor, resulting in severe os- This paper was submitted directly (Track II) to the PNAS office. teopetrosis (marble bone disease), absence of neural crest- Abbreviations: TRAP, tartrate-resistant acid phosphatase; M-CSF, macrophage colony- derived pigment cells, and mast cell defects (6). Mitf stimulating factor; RANKL, receptor activator of NF-␬B ligand; GFP, green fluorescent subsequently was found to belong to a family of transcription protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. factors, which includes Mitf, TFE3, TFEB, and TFEC. All See commentary on page 5385. members of this Mitf family of transcription factors are capable †Present address: Division of Medical Oncology, Washington University School of Medicine, of forming homodimers or heterodimers and bind an E-box St. Louis, MO 63110. ͞ ‡Present address: Department of Pediatric Oncology, Children’s Hospital University Clinic consensus sequence CA[C T]GTG (7–9). Both Mitf and TFE3 Eppendorf, 20246 Hamburg, Germany. are abundantly expressed in osteoclasts (5) and have been linked ʈTo whom reprint requests should be addressed at: Dana–Farber Cancer Institute, 44 Binney to changes in osteoclast function with age (5, 10, 11). Street, Boston, MA 02115. E-mail: david_fi[email protected]. There is a phenotypic similarity between microphthalmia The publication costs of this article were defrayed in part by page charge payment. This mi/mi Mitf mutant mice and cathepsin K null mice (12, 13) as well article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. as the human disease pycnodysostosis caused by cathepsin K §1734 solely to indicate this fact. 5798–5803 ͉ PNAS ͉ May 8, 2001 ͉ vol. 98 ͉ no. 10 www.pnas.org͞cgi͞doi͞10.1073͞pnas.091479298 Downloaded by guest on September 24, 2021 leles [mitf oakridge (mitfor) and mitf microphthalmia (mitfmi by using PCR and the following primers: 5Ј primer, CGG- delR217) (8, 9)] disrupt cathepsin K promoter activity in the GGTACCCCGTCTCCTTCCCCACATCTGTTTATGG; 3Ј presence of wild-type Mitf or TFE3 whereas the nonosteope- primer, CTTCTAGAAGCAGCAAAGTGTGGGCACAC- trotic recessive allele mitf cloudy eyes (mitfce) (8, 9) does not CATCAG, cloned into a pCR-blunt vector by using a Zero-Blunt interfere with wild-type Mitf function, thus recapitulating a key Cloning Kit (Invitrogen), retrieved by using KpnI and BglII, and genetic feature of Mitf-dependent osteopetrosis. This study also cloned into the pGL2.basic luciferase vector (Promega). Point shows that endogenous cathepsin K mRNA levels are up- mutations in the cathepsin K promoter were made by PCR, regulated upon overexpression of Mitf in primary human oste- incorporating the same double mutants as in the binding studies oclasts and thus identifies cathepsin K as a transcriptional target (see Fig. 2B). Deletion of E-boxes 1–3 in the Cathepsin K of the Mitf transcription factor family. promoter (del1–3.luc) was performed by HindIII cleavage of the full-length, wild-type promoter fragment, followed by Klenow Materials and Methods treatment, KpnI cleavage, and ligation into pGL2.basic. Animals and Cell Lines. C57BL͞6J mice ages 6–8 weeks and heterozygous ϩ͞Mitf (B6C3Fe-a͞a-mitfmi) breeding pairs were Transfections. Transfection experiments were performed in obtained from The Jackson Laboratories. MCF-7 (American MCF-7 cells by using Lipofectamine͞Plus reagent (GIBCO͞ Type Culture Collection) and ST2 (Riken Cell Bank, Tsukuba, BRL) (see Fig. 3). Individual wells of a 24-well plate (1 ϫ 104 Japan) cells were grown in DMEM͞10% FBS supplemented cells) received 0.1 ␮g cathepsin K promoter, 0.1 ␮g sea pansey with 0.1% penicillin͞streptomycin. luciferase plasmid (Promega), and 0.7 ␮g Mitf.pEBB expression vector (19), TFE3.pSV2A (20), or vector controls. Cells were Mouse Osteoclasts. Mouse spleen cells were cultured in MEM harvested after 24 h of transfection in 1ϫ passive lysis buffer (Cellgro, Herndon, VA)͞10% FBS (HyClone), 100 ng͞ml mac- (Promega),