Cutting Edge: Human Regulatory T Cells Require IL-35 To Mediate Suppression and Infectious Tolerance

This information is current as Vandana Chaturvedi, Lauren W. Collison, Clifford S. Guy, of September 23, 2021. Creg J. Workman and Dario A. A. Vignali J Immunol 2011; 186:6661-6666; Prepublished online 16 May 2011; doi: 10.4049/jimmunol.1100315

http://www.jimmunol.org/content/186/12/6661 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2011/05/16/jimmunol.110031 Material 5.DC1 http://www.jimmunol.org/ References This article cites 19 articles, 7 of which you can access for free at: http://www.jimmunol.org/content/186/12/6661.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 23, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/191/4/2018.full.pdf

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Cutting Edge: Human Regulatory T Cells Require IL-35 To Mediate Suppression and Infectious Tolerance Vandana Chaturvedi, Lauren W. Collison, Clifford S. Guy, Creg J. Workman, and Dario A. A. Vignali

Human regulatory T cells (Treg) are essential for the suppression remain obscure (7–9). However, studies with b maintenance of immune tolerance. However, the mech- human Treg have suggested that IL-10 and TGF- may con- anisms they use to mediate suppression remain contro- tribute to these events (10, 11). Nevertheless, mechanistic in- versial. Although IL-35 has been shown to play an sight into the regulatory preferences of human Treg is lacking. important role in Treg-mediated suppression in mice, recent studies have questioned its relevance in human Materials and Methods

Cell isolation, expansion, and labeling Downloaded from T . In this study, we show that human T express reg reg + and require IL-35 for maximal suppressive capacity. CD4 T cells were obtained and purified from human cord blood or apha- seresis rings, as previously described (2, 12). Purity was verified by in- Substantial upregulation of EBI3 and IL12A, but not tracellular staining of FOXP3 (eBioscience, San Diego, CA). Treg and Tconv IL10 and TGFB, was observed in activated human Treg were expanded in X-VIVO medium containing beads coated with anti-CD3 and anti-CD28 (bead/cell ratio 1:1), 20% (v/v) human sera (Lonza, Con- compared with conventional T cells (Tconv). Contact- shohocken, PA), and either 500 IU/ml human IL-2 for Treg or 100 IU/ml for independent Treg-mediated suppression was IL-35 de- Tconv (13–15). For CFSE or eFluor670 labeling, freshly purified naive Tconv http://www.jimmunol.org/ 3 6 pendent and did not require IL-10 or TGF-b.Lastly, or Treg were resuspended in PBS (0.1% BSA) at 2 10 cells/ml, incubated human T -mediated suppression led to the conversion with CFSE or eFluor670 (1 mM) for 10 min at 37˚C, stopped with ice-cold reg PBS, and washed three times in culture media. All experiments using ex- of the suppressed Tconv into iTr35 cells, an IL-35–in- panded Treg were performed at least 9 d postactivation. duced T population, in an IL-35–dependent manner. reg RNA isolation and real-time PCR analysis Thus, IL-35 contributes to human Treg-mediated sup- Analysis was performed as previously described (1, 2). Sequences are detailed pression, and its conversion of suppressed target Tconv in Supplemental Table I. into IL-35–induced Treg may contribute to infectious Intracellular staining and immunofluorescence tolerance. The Journal of Immunology,2011,186: by guest on September 23, 2021 6661–6666. Analysis was performed as previously described (1, 2). PE-conjugated anti– IL-12A (clone 27537) and IgG1 (isotype control; clone 25711) were used for immunofluorescence and intracellular staining (R&D Systems, Minneapolis, MN). The 8E fix/perm buffer used for intracellular staining of IL-12A was nterleukin-35 (EBI3–IL-12a [IL12A] heterodimer) is kindly provided by Dario Campana (St. Jude Children’s Research Hospital).

required for murine regulatory T cells (Treg) function (1) Treg suppression assay and has been shown to induce the conversion of murine I Assay was performed as previously described (2, 12). Briefly, 96-well round- and human conventional T cells (Tconv) into IL-35–induced bottom microtiter plates were used to perform standard suppression assays. 3 4 Treg (iTr35) (2). Furthermore, IL-35 is produced by human Freshly purified 5 10 naive Tconv were activated with anti-CD3/anti- Tconv exposed to rhinovirus-infected dendritic cells (3) and CD28–coated latex beads and IL-2 (10 IU/ml) and used as target cells with + varying concentrations of naive Treg, in vitro-activated Treg, or CFSE-labeled human peripheral blood CD4 T cells from chronic hepati- m 3 suppressed Tconv. The cultures were pulsed with 1 Ci [ H]thymidine for the tis B virus-infected patients (4). However, two studies have final 8 h of the 5-d assay and harvested with a Packard harvester (Perkin- suggested that human Treg neither express nor produce IL-35, Elmer). Counts per minute were determined using a Packard Matrix 96 direct increasing the controversy surrounding the physiological im- counter (PerkinElmer, Waltham, MA). Transwell experiments were performed in 96-well Transwell plates with portance of IL-35 in human Treg (5, 6). Several studies have m a 0.4 M pore size (Millipore, Billercia, MA). Freshly purified naive Tconv shown that both murine and human Treg can mediate in- were activated as described above and used as target cells in the bottom fectious tolerance, the contagious spread of suppressive ca- chamber of the 96-well plate. The suppressor populations in the top chamber of the Transwell were activated Treg, activated Treg cultured with naive Tconv, pacity from Treg to the suppressed target cell. The mechanisms or suppressed Tconv. In some experiments, cocultured naive Tconv were fixed used to mediate this induction and the subsequent mecha- with 4% formaldehyde for 10 min at room temperature and washed twice nisms used by this induced regulatory population to mediate prior to assay. The suppressor population was activated with anti-CD3/anti-

Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN Address correspondence and reprint request to Dr. Dario Vignali, Department of Im- 38105 munology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105-3678. E-mail address: [email protected] Received for publication February 7, 2011. Accepted for publication April 25, 2011. The online version of this article contains supplemental material. This work was supported by the National Institutes of Health (Grants R01 AI39480 and AI091977 to D.A.A.V.), a sponsored research agreement from NovoNordisk (to D.A.A.V.), Abbreviations used in this article: iTr35, IL-35–induced regulatory T cell; Tconv, con- an Individual National Research Service award (F32 AI072816 to L.W.C.), a National ventional T cells; Treg, regulatory T cells. Cancer Institute Comprehensive Cancer Center Support CORE grant (CA21765 to D.A.A.V.), and the American Lebanese Syrian Associated Charities (to D.A.A.V.). Copyright Ó 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1100315 6662 CUTTING EDGE: HUMAN Treg AND IL-35

CD28–coated latex beads and IL-2 (40 IU/ml). Where indicated, neutralizing due to the difficultly of generating pure populations from anti-Ebi3 (clone V1.4F5.25) (2) anti–IL-10 (JES39D7; BioLegend, San adult cells (Supplemental Fig. 1A). EBI3 and IL12A expres- Diego, CA), anti–TGF-b (1D11; R&D Systems), or isotype controls were added. A combination of both anti-Ebi3 (clone V1.4F5.25) and anti-IL12A sion was not induced or influenced by IL-2, as the inclusion (clone 27537) was used at indicated concentrations when anti–IL-35 Ab was of reduced concentrations with Treg or its inclusion with Tconv used in neutralization studies. After 112 h, the top chambers were removed (100 IU/ml) had no affect (note that .100 IU/ml IL-2 in- and [3H]thymidine was added to the bottom chambers for the final 8 h of the 5-d assay. Cultures were harvested with a Packard harvester (PerkinElmer), duced Tconv death). Surprisingly, expression of IL10 and and counts per minute were determined using a Packard Matrix 96 direct TGFB mRNA in cord blood Treg was modest in comparison counter (PerkinElmer). with EBI3 and IL12A. Expression of mRNA encoding the Results and Discussion other IL-12 family members, IL23 (p19), IL27 (p28), and IL12B (p40), was not upregulated in Treg isolated from either Human umbilical cord blood is an ideal source of naive Tconv cords or PBMC, inferring that IL-35 may be the only IL-12 and naive Treg due to their lack of previous antigenic exposure and thus the ease with which they can be reliably purified family cytokine human Treg to have the capacity to upregulate based on CD4 and CD25 expression (data not shown). Naive upon activation compared with Tconv (Fig. 1A, Supplemental cord blood Treg expressed low levels of mRNA encoding both Fig. 1A). Expression of EBI3 and IL12A following activation the EBI3 and IL12A subunits of IL-35 compared with T remained low until day 3 postactivation, when there was a conv . (data not shown). However, following activation with anti- steep increase compared with similarly activated Tconv ( 100- CD3/anti-CD28–coated beads, EBI3 and IL12A were sub- fold), which was maintained through day 9 (Fig. 1B,1C). We . Downloaded from stantially upregulated in Treg ( 35-fold over Tconv) (Fig. 1A). note that previous studies suggesting that human Treg do not Although a similar observation was made with Treg isolated express EBI3 and IL12A only analyzed expression in resting from adult PBMC, the fold upregulation was less, perhaps or activated Treg up to day 2 poststimulation (10, 11). http://www.jimmunol.org/ by guest on September 23, 2021

+ 2 + + FIGURE 1. Human Treg express IL-35. CD4 CD25 (Tconv) and CD4 CD25 (Treg) were purified by FACS from cord blood. A, Relative mRNA expression in Treg was determined. B and C, Cell types noted were analyzed for EBI3 or IL12A expression at the indicated days postactivation. Naive Tconv were used for normalization (arbitrarily set to 1). D, At indicated time points, Tconv (blue) and Treg (red) were stained with anti–IL-12A or isotype control. A representative histogram (left panels) and the mean percentage of IL-12A high cells (right panels) are depicted. E, Activated cells were restimulated with PMA plus ionomycin for 6 h and then stained with an isotype control or anti–IL-12A (yellow) plus phalloidin (actin, gray) and DAPI (nucleus, blue). Original magnification 363 Data represent the mean 6 SEM of 4 to 5 (A), 5 (B, C, E),and8,13,and11(D) independent experiments at the three time points indicated. *p , 0.05, **p , 0.005, ***p , 0.001. The Journal of Immunology 6663

Comparable, minimal intracellular expression of IL12A + + (p35) was seen in resting human Treg and CD4 and CD8 Tconv (data not shown). However, IL-12A expression increases ∼ 10-fold following activation of human Treg but not Tconv, as determined by flow cytometry (Fig. 1D) and immunoflu- orescence (Fig. 1E). Although expression was bimodal (∼30%) 9 d postactivation, subsequent restimulation and analysis 3 d later resulted in ∼100% expression of intracellular IL-12A and further increases in IL-12A mean fluorescence (∼30-fold) and EBI3 and IL12A mRNA expression (Fig. 1D, Supple- mental Fig. 2A). It is possible that this bimodal IL-12A ex- pression is related to the activation state of the Treg.Itis important to note that neither activation nor reactivation substantially altered the low-level intracellular expression + + of IL-12A in CD4 and CD8 Tconv (Fig. 1D and data not shown). The basal amount of IL-35 expression detected in Tconv could be attributed to their activation state, as it has been shown that activated human Tconv also express FOXP3, Downloaded from TGF-b, and IL-10 and thus may express small amounts of IL- 12A and EBI3, or this could be due to some low-level background due to the staining procedure (5). The relation- ship between FOXP3 and IL-35 expression following Tconv and Treg activation was then assessed. Whereas all the acti- vated Tconv and Treg populations examined expressed com- http://www.jimmunol.org/ parable FOXP3 IL-12A expression differed (Supplemental FIGURE 2. Treg-mediated contact-independent suppression is IL-35 de- Fig. 1B). Restimulated T exhibit the highest IL-12A ex- pendent. A, Transwell suppression assay was performed with activated Treg reg stimulated in the top chamber of a Transwell culture plate in the presence or pression, whereas a high percentage of Treg-suppressed Tconv m absence of indicated Abs (all at 10 g/ml). Naive target Tconv were placed in express IL-12A and thus may be iTr35. Although activated the bottom chamber with anti-CD3/CD28–coated beads. The Treg (top Tconv express low levels of IL-12A, despite high FOXP3 ex- chamber)/Tconv (bottom chamber) ratio was 1:8. B, Assay was established as pression, they are unlikely to secrete IL-35 given the absence above in the presence of a titration of isotype control or neutralizing IL-35 of Ebi3 mRNA. Taken together, these data demonstrate that mAbs. Counts per minute of activated Tconv alone, in the absence of any suppression, were 50,000–120,000. Data represent the mean 6 SEM of 3–10

human T express IL-35 to a significantly greater extent than by guest on September 23, 2021 reg independent experiments. *p , 0.05, **p , 0.005. Tconv. Furthermore, expression of FOXP3 does not neces- sarily endow T cells with the ability to express IL-12A/EBI3 and secrete IL-35 (6). required to mediate contact-independent human Treg-mediated We next assessed whether IL-35 secretion by human Treg suppression. contributed to their function. Naive human cord blood Treg Infectious tolerance is thought to play a substantial role in possess minimal suppressive capacity in vitro, whereas acti- propagating Treg-mediated immune control, but the mecha- vated Treg, which exhibit high levels of EBI3 and IL12A nisms used to convert suppressed Tconv into an induced reg- mRNA expression, are potently suppressive (data not shown). ulatory population and the mechanisms by which they in turn Our initial analysis suggested that IL-35 neutralization in suppress third-party Tconv remain contentious. Previous a conventional in vitro Treg assay had a minimal effect on studies have suggested that human Treg mediate the conver- b their suppressive capacity, likely due to the multiple contact- sion of cocultured Tconv into IL-10– or TGF- –induced Treg dependent and contact-independent mechanisms at their populations (10, 11). More recently, we showed that IL-35 disposal (data not shown) (16, 17). However, activated hu- production by murine Treg mediates the conversion of sup- pressed target T into an induced T population, termed man Treg have also been shown to mediate potent suppression conv reg iTr35, that mediate suppression via IL-35, but not IL-10 or when separated from their Tconv targets by a permeable b Transwell membrane, emphasizing the importance of soluble TGF- (2, 18). However, it is not known if human Treg can generate iTr35 cells and if they contribute to immune regu- factors, such as inhibitory cytokines, in mediating suppression lation. Thus, we first assessed whether IL-35 expression and (10, 11). Consequently, we assessed the relative contribution production by human T was modulated following contact of IL-35 as well as IL-10 and TGF-b, two inhibitory cytokines reg with Tconv and whether the latter were induced to express IL- implicated in mediating contact-independent suppression by 35. Modest increases in EBI3 and IL12A mRNA and in- human Treg (10, 11). Surprisingly, neutralizing anti–IL-10 and tracellular IL-12A expression were observed in functionally b anti–TGF- had no effect on Treg-mediated suppression (Fig. suppressive, cocultured Treg compared with activated Treg 2A). In contrast, neutralizing anti–IL-35 completely blocked (Fig. 3A,3B). However, suppressed, cocultured Tconv sub- suppression. Subsequent analysis demonstrated dose-dependent stantially upregulated EBI3 and IL12A mRNA and in- inhibition of Treg-mediated suppression by neutralizing anti– tracellular IL-12A expression to a level indistinguishable from IL-35 (Fig. 2B). Similar observations were also made with adult maximally activated human Treg (Fig. 3A,3B). Contrary to + + 2 PBL-derived CD4 CD25 CD45RA Treg (data not shown). recent studies, we saw modest expression of IL10 and TGFB b These data suggest that IL-35, but not IL-10 and TGF- ,is mRNA in activated human Treg and no evidence for increased 6664 CUTTING EDGE: HUMAN Treg AND IL-35 Downloaded from http://www.jimmunol.org/

FIGURE 3. Treg-mediated induction of iTr35. A and B, Activated Treg were labeled with eFluor670 and cultured with CFSE-labeled naive Tconv at a ratio of 1:4 in the presence anti-CD3/CD28–coated beads and IL-2 (10 IU/ml) with or without neutralizing mAbs against IL-35, TGF-b, or IL-10 (10 mg/ml) for 72 h. Cells were purified by FACS on day 3 and analyzed for relative expression of EBI3 (A, upper panel) and IL12A (A, lower panel) and intracellular expression of IL- by guest on September 23, 2021 12A (B). C, Regulatory capacity of the sorted suppressed Tconv was determined using naive Tconv as targets. D, Regulatory capacity of suppressed Tconv generated in the presence of neutralizing IL-35, IL-10, TGF-b, or an isotype control (10 mg/ml) was determined as in C. E, Assay performed as in D except that the neutralizing mAbs were added during the secondary suppression assay. Counts per minute of activated Tconv alone, in the absence of any suppression, were 70,000–125,000. Data represent the mean 6 SEM of 8–14 (A) and 3 (B–E) independent experiments. *p , 0.05, **p , 0.005, ***p , 0.001.

expression in the functionally suppressive Treg or suppressed regulatory capacity determined in a secondary, standard Tconv isolated from cocultures (Supplemental Fig. 2B). in vitro suppression assay. These Treg-suppressed Tconv To determine if the increased EBI3 and IL12A expression exhibited potent, dose-dependent suppressive capacity, as b observed was driven by IL-35, IL-10, and/or TGF- ,Treg/ previously reported (Fig. 3C). To determine the cytokines Tconv cocultures were established in the presence of neutral- responsible for induction of this regulatory capacity, Treg/ izing Abs. EBI3 and IL12A mRNA expression was not sig- Tconv cocultures were performed in the presence or absence nificantly affected by neutralization of TGF-b or IL-10 (Fig. neutralizing anti–IL-35, TGF-b, or IL-10 prior to purifica- 3A). Conversely, in the presence of neutralizing anti–IL-35, tion and secondary suppression assay. When suppressed Tconv EBI3 and IL12A expression was substantially reduced in were isolated from cocultures established in the presence of cocultured Treg and essentially prevented in cocultured Tconv neutralizing anti–IL-35, no regulatory potential was observed (Fig. 3A). These data suggest that IL-35 generation is induced (Fig. 3D). In contrast, the addition of neutralizing anti–IL-10 b and expression maintained by IL-35 in an autocrine (in Treg) or anti–TGF- had no effect. To determine the cytokine and paracrine (in suppressed Tconv) fashion following cell responsible for the regulatory capacity exhibited by the sup- contact between human Treg and Tconv. pressed Tconv, neutralizing Abs were added to the secondary We have previously shown that activation of human Tconv in suppression assay. As above, neutralizing anti–IL-35 blocked the presence of IL-35 mediates the generation of an induced their regulatory capacity, whereas neutralizing Abs to IL-10 b Treg population, iTr35 (2). The substantial expression of and TGF- had no effect (Fig. 3E). Taken together, these EBI3 and IL12A mRNA and intracellular IL-12A expression data suggest that human Treg-derived IL-35 is required for the in suppressed Tconv, and the requirement for IL-35 to me- conversion of suppressed human Tconv into iTr35 cells, which diate this induction, infers the generation of iTr35 (2). This subsequently suppress via IL-35. prompted us to investigate whether these suppressed Tconv Finally, we asked whether the iTr35 cells generated by IL- gained regulatory activity and determine the mechanism of 35–producing human Treg can mediate contact-independent conversion and suppression. CFSE-labeled suppressed Tconv suppression during Treg insufficiency. At low Treg (top were purified from Treg/Tconv cocultures after 3 d and their chamber)/target Tconv (bottom chamber) ratios (1:256), the The Journal of Immunology 6665

regulatory capacity of Treg is insufficient to mediate effective suggest that human Treg-generated iTr35 might contribute to suppression, a scenario that might occur in vivo (Fig. 4A). global suppression and mediate infectious tolerance during However, if fresh, naive Tconv were added to the top well Treg insufficiency. under these conditions, substantial cell contact-independent Our results demonstrate for the first time, to our knowledge, suppression across a Transwell membrane was observed that activated cord blood- and PBMC-derived human Treg (∼60%), raising the possibility that iTr35 generated by the express and secrete IL-35, which contributes significantly to human Treg could compensate for this Treg insufficiency. In- their suppressive capacity (19). Surprisingly, there appeared to b deed, this suppression was lost when the naive Tconv added to be a minimal role of IL-10 and TGF- . These data are in the top well were fixed (and thus could not be converted to contrast with previous reports suggesting that IL-35 is not iTr35), confirming that iTr35 generated in the presence expressed by Treg isolated from PBMCs (5) and that IL-35 of very low numbers of human Treg can mediate contact- does not play a role in suppression mediated by FOXP3- independent suppression (Fig. 4B). Addition of neutralizing transduced T cells (6). These discrepancies may be due to mAbs confirmed that the suppression observed was mediated the timing of analysis, purification techniques, and/or by IL-35 and not TGF-b or IL-10 (Fig. 4B,4C). These data reagents used and the populations under analysis. In addi- tion, our data suggest that human Treg-derived IL-35 mediates the conversion of suppressed Tconv into iTr35 that sub- sequently suppress via IL-35 in a manner analogous to our

observations in the mouse (2). These parallels raise the pos- Downloaded from sibility that iTr35 may constitute a mechanism of infectious tolerance in humans. These findings suggest that IL-35 neu- tralization may represent a valid immunotherapeutic strategy for the treatment of cancer and conditions in which excessive regulatory control might exist. http://www.jimmunol.org/ Acknowledgments We thank Kate Vignali for technical assistance, Jessie Ni for Abs, Dario Cam- pana for the 8E permeabilization buffer, Brandon Triplett, Michelle Howard, and Melissa McKenna at St. Louis Cord Blood Bank for cord blood samples, and the staff of the Blood Donor Centre at St. Jude Children’s Research Hospital for aphaeresis rings. We also thank Richard Cross, Greig Lennon, and Stephanie Morgan for FACS and the staff of the Hartwell Center for Biotechnology and Bioinformatics at St. Jude for real-time PCR primer/probe synthesis. by guest on September 23, 2021

Disclosures D.A.A.V., L.W.C., and C.J.W. have submitted patents that are pending and are entitled to a share in net income generated from licensing of these patent rights for commercial development.

References 1. Collison, L. W., C. J. Workman, T. T. Kuo, K. Boyd, Y. Wang, K. M. Vignali, R. Cross, D. Sehy, R. S. Blumberg, and D. A. Vignali. 2007. The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature 450: 566–569. 2. Collison, L. W., V. Chaturvedi, A. L. Henderson, P. R. Giacomin, C. Guy, J. Bankoti, D.Finkelstein,K.Forbes,C.J.Workman,S.A.Brown,J.E.Rehg,M.L.Jones, H.T.Ni,D.Artis,M.J.Turk,andD.A.Vignali.2010.IL-35-mediatedin- duction of a potent regulatory T cell population. Nat. Immunol. 11: 1093–1101. 3. Seyerl, M., S. Kirchberger, O. Majdic, J. Seipelt, C. Jindra, C. Schrauf, and J. Sto¨ckl. 2010. Human rhinoviruses induce IL-35-producing Treg via induction of B7-H1 (CD274) and sialoadhesin (CD169) on DC. Eur. J. Immunol. 40: 321–329. 4. Liu, F., F. Tong, Y. He, and H. Liu. 2011. Detectable expression of IL-35 in CD4(+) T cells from peripheral blood of chronic Hepatitis B patients. Clin. Immunol. 139: 1–5. 5. Bardel, E., F. Larousserie, P. Charlot-Rabiega, A. Coulomb-L’Hermine´,and O. Devergne. 2008. Human CD4+ CD25+ Foxp3+ regulatory T cells do not constitutively express IL-35. J. Immunol. 181: 6898–6905. 6. Allan, S. E., G. X. Song-Zhao, T. Abraham, A. N. McMurchy, and M. K. Levings. 2008. Inducible reprogramming of human T cells into Treg cells by a conditionally active form of FOXP3. Eur. J. Immunol. 38: 3282–3289. FIGURE 4. IL-35–expressing Treg can mediate suppression across the 7. Gershon, R. K., and K. Kondo. 1971. Infectious immunological tolerance. Im- Transwell. A, Transwell suppression assay was set up as in Fig. 2A with either munology 21: 903–914. activated T stimulated alone or activated T stimulated with naive T in 8. Qin, S., S. P. Cobbold, H. Pope, J. Elliott, D. Kioussis, J. Davies, and H. Wald- reg reg conv mann. 1993. “Infectious” transplantation tolerance. Science 259: 974–977. the top chamber. B, Assays were set up as in Fig. 2A, except that the cells in 9. Waldmann, H., E. Adams, P. Fairchild, and S. Cobbold. 2006. Infectious tolerance top chamber were at 1:256 ratio with the target Tconv. C, Assays were set up as and the long-term acceptance of transplanted tissue. Immunol. Rev. 212: 301–313. above in presence of a titration of the Abs indicated. Counts per minute of 10. Dieckmann, D., C. H. Bruett, H. Ploettner, M. B. Lutz, and G. Schuler. 2002. Human CD4(+)CD25(+) regulatory, contact-dependent T cells induce interleukin activated Tconv alone, in the absence of any suppression, were 40,000– 6 10-producing, contact-independent type 1-like regulatory T cells [corrected]. 150,000. Data represent the mean SEM of three independent experiments. [Published erratum appears in 2002 J. Exp. Med. 196: 559 and 2002 J. Exp. Med. *p , 0.05, **p , 0.0005. 196: 867.] J. Exp. Med. 196: 247–253. 6666 CUTTING EDGE: HUMAN Treg AND IL-35

11. Jonuleit, H., E. Schmitt, H. Kakirman, M. Stassen, J. Knop, and A. H. Enk. 2002. of potent and stable human CD4+ T regulatory cells by activation-independent Infectious tolerance: human CD25(+) regulatory T cells convey suppressor activity expression of FOXP3. Mol. Ther. 16: 194–202. to conventional CD4(+) T helper cells. J. Exp. Med. 196: 255–260. 16. Vignali, D. A., L. W. Collison, and C. J. Workman. 2008. How regulatory T cells 12. Collison, L. W., and D. A. Vignali. 2011. In vitro treg suppression assays. Methods work. Nat. Rev. Immunol. 8: 523–532. Mol. Biol. 707: 21–37. 17. Bluestone, J. A., Q. Tang, and C. E. Sedwick. 2008. T regulatory cells in auto- 13. Earle, K. E., Q. Tang, X. Zhou, W. Liu, S. Zhu, M. L. Bonyhadi, and J. A. immune diabetes: past challenges, future prospects. J. Clin. Immunol. 28: 677– Bluestone. 2005. In vitro expanded human CD4+CD25+ regulatory T cells sup- 684. press effector T cell proliferation. Clin. Immunol. 115: 3–9. 18. Collison, L. W., M. R. Pillai, V. Chaturvedi, and D. A. Vignali. 2009. Regulatory 14. Levings, M. K., R. Sangregorio, and M. G. Roncarolo. 2001. Human cd25(+) T cell suppression is potentiated by target T cells in a cell contact, IL-35- and IL-10- cd4(+) t regulatory cells suppress naive and memory T cell proliferation and can be dependent manner. J. Immunol. 182: 6121–6128. expanded in vitro without loss of function. J. Exp. Med. 193: 1295–1302. 19. Thornton, A. M., and E. M. Shevach. 1998. CD4+CD25+ immunoregulatory 15. Allan, S. E., A. N. Alstad, N. Merindol, N. K. Crellin, M. Amendola, R. Bacchetta, T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 L. Naldini, M. G. Roncarolo, H. Soudeyns, and M. K. Levings. 2008. Generation production. J. Exp. Med. 188: 287–296. Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021 The Journal of Immunology

Letter of Retraction

We wish to retract the article titled “Human Regulatory T Cells Require IL-35 To Mediate Suppression and Infectious Tolerance” by Vandana Chaturvedi, Lauren W. Collison, Clifford S. Guy, Creg J. Workman, and Dario A. A. Vignali, The Journal of Immunology, 2011, 186: 6661–6666. A recent review by our research team found the approaches used by the first author, Vandana Chaturvedi, to calculate data in several suppression assays (Fig. 3C–E) to be flawed. The authors feel there is sufficient concern over these data in the article that retraction is warranted. All the authors concur with this retraction and sincerely regret any inconvenience this may have caused.

Vandana Chaturvedi Department of Pediatrics and Infectious Diseases Cincinnati Children’s Hospital Cincinnati, OH Lauren W. Collison Opexa Therapeutics The Woodlands, TX Clifford S. Guy Creg J. Workman Dario A. A. Vignali Department of Immunology St. Jude Children’s Research Hospital Memphis, TN

Copyright Ó 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1390040 Supplemental Table and Figures Chaturvedi et al

SUPPLEMENTAL TABLE 1: Primers used in this study.

Gene Name Forward Primer Reverse Primer EBI3 5’ GCAGCAGACGCCAACGT 3 ’, 5’ CCATGGAGAACAGCTGGACAT 3 ’ IL12A 5’ CCTTCACCACTCCCAAAAC 3’ 5’ TGTCTGGCCTTCTGGAGCAT 3’ IL12B 5’ TTTTCTGGCATCTCCCCTCGTG 3' 5' GGGTGGGTCAGGTTTGATGATG 3' TGFB 5’ CTGCTGAGGCTCAAGTTAAAAGTG 3’ 5’ TGAGGTATCGCCAGGAATTGTT 3’ IL27 5’ GCGGAATCTCACCTGCCA 3’; 5’ GGAAACATCAGGGAGCTGCTC 3’ IL23 5’ GAGCCTTCTCTGCTCCCTGAT3’ 5’ AGTTGGCTGAGGCCCAGTAG 3’ IL10 5’ GCCGTGGAGCAGGTGAAG 3’; 5’ TGGCTTTGTAGATGCCTTTCTCT 3’

A * *** * 10 n

o * ** ** *** ** 7.5

5

2.5 ive mRNA Expressi t

Rela 0 IL10 TGF IL23 IL27 IL12B IL12A EBI3

B Naïve Tconv Activated Tconv Stimulated Treg Restimulated Treg Suppressed Tconv

5 5 5 5 5 10 0 0.041 10 0.019 11.4 10 0.055 63.1 10 0.028 93.2 10 0.0097 51

104 104 104 104 104

103 103 103 103 103

2 2 102 2 2 IL12A-PE 10 10 10 10 0 96.6 3.37 0 0 88.6 0 1.59 35.2 0 1.06 2.92 0 0.29 48.7

0102 103 104 105 0102 103 104 105 0102 103 104 105 0102 103 104 105 0102 103 104 105 FoxP3-APC

A + – SUPPLEMENTAL FIGURE S1: ( )Tconv and Treg cells were isolated from PBMCs based on CD4 CD25 + + – – CD45RA (Tconv) [open bars] and CD4 CD25 CD45RA (Treg) [closed bars] expression and expanded for 9d using anti-CD3/anti-CD28-coated latex beads and IL-2 (500 IU/ml) for Tregs and IL-2 (100 IU/ml) for Tconv. After 9d, RNA was isolated, cDNA generated and qPCR analysis performed. Relative expression of mRNA encoding IL10, TGF, IL23, IL27, IL12B, IL12A and EBI3 was determined. Data represent the mean ± SEM of 6 independent

experiments [* p < 0.05, ** p < 0.005 and *** p < 0.001]. Results are presented relative to those of naïve Tconv cells. (B) Indicated cell populations were stained for FoxP3 and IL-12A expression. Cells were fixed and permeabilized using 8E buffer and then stained for IL-12A. This was followed by FoxP3 staining (eBioscience,

San Diego, CA). Representative dot plots are shown. Naïve and Activated Tconv were sued as control. Foxp3 + and IL-12 A expression in CD4 gated cells. Stimulated Treg referto9dayactivatedTregs. Restimulated Treg refer to 9+3 day activated Tregs. Suppressed Tconv are the Tconv isolated for cocultures. Supplemental Table and Figures Chaturvedi et al

A 400 80 ** ** 300 60 ion ion s s 200 40 100 Expres Expres 80 25 20

EBI3 60 IL12A IL12A 15 40

lative 10 lative e 20 e R

R 5 0 0 9d 9+3d 9d 9+3d

B Treg Tconv

Unactivated

+IL-2

Activated NS

Co-culture NS

225 200 175 150 125 100 75 50 25 0 25 50 75 100 125 150 175 200 225 Relative IL10 Expression

Unactivated

+IL-2

Activated NS

Co-culture NS

225 200 175 150 125 100 75 50 25 0 25 50 75 100 125 150175 200 225 Relative TGF Expression

A EBI3 IL12A SUPPLEMENTAL FIGURE S2: ( ) Restimulation of Treg cells after 9d leads to increased and expression. Human Tconv and Treg cells were purified from umbilical cord blood by FACS based on cell surface expression of CD4 and CD25. Purified cells were expanded for 9 d, using anti-CD3/anti-CD28-coated latex beads and IL-2 (500 IU/ml). The cells were restimulated for additional 3 d, with anti-CD3/anti-CD28-coated latex beads and IL-2 (100 IU/ml) after the initial 9 d stimulation. RNA was isolated, cDNA generated and qPCR analysis performed. Relative EBI3 and IL12A expression. Data represents the mean ± SEM of 5 independent experiments [**

p < 0.005]. Results are presented relative to those of Tconv cells. The Tconv cells were expanded similarly to Treg cells except that IL-2 was used at a final concentration of 100 IU/ml for the initial 9 d expansion. (B) Co-culturing

Treg and Tconv cells does not lead to substantial up-regulation of either IL-10 or TGF in either population. Activated ® Treg cells (prepared as described in Fig. 1) were labeled with eFluor 670 and cultured with CFSE-labeled naïve Tconv cells in the presence or absence or IL-2, anti-CD3/CD28-coated latex beads. At the end of 3 d, cells were purified by FACS. RNA was extracted and cDNA was generated from the indicated populations. Relative IL10 (upper panel) and TGFB expression (lower panel) was determined by qPCR. Data represents the mean ± SEM of 5 independent experiments [* p < 0.05, ** p < 0.005, and *** p < 0.001]. Results are presented relative to those of

naïve Tconv cells.