GenScript Product Catalog
2010-2011 GenScript Product Catalog
GenScript USA Inc. 120 Centennial Ave. Piscataway, NJ 08854 USA
Tel: 1-732-885-9188 / 1-732-885-9688 Toll-Free Tel: 1-877-436-7274 Fax: 1-732-210-0262 / 1-732-885-5878 Email: [email protected]
Business Development Tel: 1-732-317-5088 Email: [email protected] 2010-2011
GenScript GenScript The Biology CRO The Biology CRO
Date Version: 04/21/2010 Your Innovation Partner in Drug Discovery! Welcome to GenScript
GenScript USA Incorporation, founded in 2002, is a fast growing biotechnology company and contract research organization (CRO) specialized in custom services and consumable products for academic and pharmaceutical research. Built on our assembly-line mode, one-stop solution, continuous improvement, and stringent IP protection, GenScript provides a comprehensive portfolio of products and services at the most competitive prices in the industry to meet your research needs every day.
Over the years, GenScript’s scientists have developed many innovative technologies that allow us to maintain the position at the cutting edge of biological and medical research while offering cost-effective solutions for customers to accelerate their research. Our advanced expertise includes proprietary technology for custom gene synthesis, OptimumGeneTM codon optimization technology, CloneEZ® seamless cloning technology, FlexPeptideTM technology for custom peptide synthesis, BacPowerTM technology for protein expression and purification, T-MaxTM adjuvant and advanced nanotechnology for custom antibody production, as well as ONE-HOUR WesternTM detection system and eStainTM protein staining system.
GenScript offers a broad range of reagents, optimized kits, and system solutions to help you unravel the mysteries of biology. We also provide a comprehensive portfolio of customized services that include Bio-Reagent, Bio-Assay, Lead Optimization, and Antibody Drug Development which can be effectively integrated into your value chain and your operations. All of this adds up to maximum flexibility and convenience to meet your most demanding research needs.
Our dedication to innovation and quality has helped us establish strong partnerships with customers in over 70 countries, including many top pharmaceutical companies in the world. GenScript is headquartered in Piscataway, the heart of New Jersey’s pharmaceutical valley, with subsidiaries in France, Germany, Japan, and China.
Navigating the Catalog
The 2010-2011 product catalog is organized by scientific application and divided into six chapters. Browse through the catalog for information on the popular products in molecular biology and cell biology and see our featured products. We are confident you will find 2010-2011 Product Catalog full of relevant and timely products and services to support your discovery or development program. Please visit our website at www.genscript.com to find new product information, cutting-edge tools, and resources as well as to view the complete portfolio of products and services.
Your Innovation Partner in Drug Discovery! - 1 - Ordering and Technical Support Table of Contents
For your convenience, you may place your order by the method Technical Support that is best for you: choose to order online, by email, phone, mail, or fax. Our highly efficient customer service representatives will 3 Our technical support lines are 24-hour service Monday through process your order quickly and accurately. Friday. Customer Service representatives are here to assist you with ordering. Contact us from anywhere in the US: Order Online • Technical Support Email: [email protected] Protein Analysis Online: http://www.genscript.com/technical_support.html You have two options for placing orders electronically: 1 • Customer Service • Get your account, and place your order online after you login Protein Expression ...... 37 Email: [email protected] in at http://www.genscript.com Phone: 1-732-885-9188 / 1-732-885-9688 Protein Isolation and Purification ...... 39 • Email your order to [email protected] Toll-free phone: 1-877-436-7274 Protein Electrophoresis ...... 43 Nucleic Acid Purification and Analysis Endotoxin Detection and Removal System ...... 47 Order by Phone, Mail, or Fax International Order Plasmid DNA Purification ...... 3 Protein Detection and Immunoassay ...... 49 PCR Purification ...... 5 Related Reagents for Protein Analysis ...... 61 When you order, please include the following information: International customers should order directly from the nearest ...... • Name and phone number of the end user Nucleic Acid Electrophoresis ...... 6 Catalog Proteins 65 authorized distributor of GenScript products. For the location of • Name of the principal investigator ...... the nearest distributor, refer to the distributor address list at Nucleic Acid Markers ...... 8 Custom Protein Services 71 • Name and phone number of the purchasing agent http://www.genscript.com/distributor.html. International • Catalog number and description of product Custom Plasmid Preparation Services ...... 11 customers can easily order from GenScript directly without local • Quantity and size of product distributor for most countries. The estimated shipping price is • Shipping address based on FedEx international priority with 1LB FedEx Envelope • Billing address and 3LB Box.
Order by Phone 4 Call 1-732-885-9188/1-732-885-9688 to place your order by 2 phone. You will speak directly with a helpful customer service representative. GenScript provides 24-hour service Monday through Friday. You can also place your order by voicemail anytime, day or Antibodies night. We accept Visa, MasterCard, American Express, and the PCR and Cloning American Express Corporate Purchasing Card. THETM Elite Antibodies ...... 75 ...... Green PCR 15 MiniFresh® Antibodies ...... 77 Routine PCR ...... 16 Order by Mail Primary Antibodies ...... 89 ...... Direct PCR 17 Secondary Antibodies ...... 179 If you would like to send us written confirmation of your order, PCR Cloning ...... 22 ...... please be sure it is clear marked “Confirming Order—Do Not Custom Antibody Services 180 TM Duplicate”. GenPool ORF Clones ...... 23 GenScript USA Inc. siRNA Expression Vectors ...... 24 120 Centennial Ave...... Piscataway, NJ 08854 USA Custom Molecular Biology Services 31
Order by Fax
Fax your order to: 1-732-210-0262 / 1-732-885-5878
Your Innovation Partner in Drug Discovery! - i - www.genscript.com - ii - Appendix 5 THETHETMTM EliteElite AntibodiesAntibodies
Amino Acids Table ...... 241 Atomic Weights of the Elements ...... 242 The unmistakable, the irreplaceable, and the Peptides Genetic Markers in E.coli ...... 243 ...... best quality in the industry β-Amyloid Peptides ...... 185 Genetic Code Table 245 Determining the Molar Mass Using S Values ...... Blocking Peptides ...... 186 20, W 245 ...... Cosmetic Peptides ...... 191 Spectrophotometric Quantitation of DNA or RNA 247 ...... Pharmaceuticals ...... 191 Agarose and Polyacrylamide Gels 248 ...... Peptide Building Blocks ...... 191 Miscellaneous 248 ...... Other Peptides ...... 195 Alphabetical Index 251 ...... Related Biology Reagents 208 THETM Elite Antibody series are the most precise Custom Peptide Services ...... 215 and effective antibodies that meet the most demanding research requirements.
6 Ultra Sensitivity-More sensitive than the most popular antibodies in the market Ultra Specificity-No cross-reactivity Cellular Analysis Ultra Affinity-Ultra-low dissociation constant Kd Apoptosis ...... 219 Ultra Reactivity-Recognize and bind even ...... Cell Cycle Analysis 224 partially exposed terminal and internal tags Cell Proliferation ...... 224 Cell Lines ...... 225 Ultra Clear Background Reagents for Cell Analysis...... 229 Ultra Convenience-No secondary antibody ...... Custom Cell Line Services 231 needed for conjugated antibodies Ultra Stability-Stable lyophilized form for at least two years
Your Innovation Partner in Drug Discovery! - iii - www.genscript.com - iv - Featured Products QuickClean 5M MiniPrep Kit KB Plus DNA Logical Ladder
For rapid purification of up to 20 μg plasmid DNA One DNA marker meets all your sizing and quantifying needs
• Fast—Minipreps can be completed within 5 minutes • Save Money—Purchase only one ladder • High Capacity—Up to 20 μg • Easy—Sizing and quantifying DNA fragments together • High Purity—Removal efficiency >99% • Save time and effort—The ready-to-use format eliminates preparation steps and • Reproducible Yields—Recovery efficiency > 90 % can be conveniently stored on your bench top.
The QuickClean 5M Miniprep Kit is ideal for rapid purification of 1,500 75 ng The KB Plus DNA Logical Ladder provides accurate sizing and quantifying of nucleic molecular biology-grade plasmid DNA from 1-5 ml overnight bacterial acid fragments from 100 to 10,000 base pairs. The ready-to-use format minimizes time cultures, yielding up to 20 μg. The mini-spin columns make use of an spent thawing, diluting, and adding sample buffer to your DNA ladders. Simply transfer unique silica membrane to achieve high yields using a simple your ready-to-use DNA Ladder from the vial to the gel. The ladder is stable at room bind-wash-elute procedure. The QuickClean 5M Miniprep Kit provides temperature and can be stored on your bench top. reproducible yields of plasmid DNA, free of RNA, proteins, and other contaminants. Plasmid DNA is eluted in water or TE and ready for use in For most electrophoresis applications you need only one ladder—KB Plus DNA Logical standard molecular biology applications. Ladder. You’ll accurately size and quantify fragments from 100 bp to 10 kb and save money, time and effort. Order today. For more information on plasmid DNA purification, see page 3 or visit http://www.genscript.com/dna_purification.html For more information on KB Plus DNA Logical Ladder, see page 9 or visit http://www.genscript.com/dna_marker.html
Green PCR Reagents CloneEZ® PCR Cloning Kit
The environmentally friendly PCR reagents for your success No more restriction site headaches Primers with 15 bases of sequence homology Target fragment • Universal—Clone any insert, into any location within any vector you to lineanized vector • Stable at room temperature choose PCR product • Enhanced yield with longer enzyme half-life • Fast and Easy—30 minutes, one-step incubation at room temperature Linearized vector • Stop refrigerating and save energy • High Efficiency—Success rate over 95% • Compatibility—The kits is highly compatible with high-throughput PCR Linearized vector GenScript's advanced high-stability technology has led to the cloning invention of the new generation of PCR reagents—Green PCR Reagents. The Green series of reagents, from the proprietary GenScirpt’s preprietary CloneEZ® seamless cloning technology is a Taq, dNTP, to PCR mixtures, are stable at room temperature for cutting-edge, recombination-based cloning technology that can accurately CloneEZ® PCR one month or at 4°C for over six months. The high-stability feature Recombination Cloning Kit in 30 mitutes and efficiently assemble genes and gene fragments in any combination of vector allows the increase in the half-life of active enzymes at high sequences. The CloneEZ® PCR Cloning Kit is designed for the quick cloning temperatures, therefore more amplification cycles are carried out of PCR products without any headaches of restriction sites. The univeral Transformation and higher yield generated. With no freeze-thaw cycles, Green CloneEZ® cloning method works with any insert and any vector at any PCR reagents provide you an instant access to high-throughput restriction site. Using our proprietary CloneEZ® enzyme, this kit rapidly PCR automation. In addition, GenScript's Green PCR Reagents generates precise, directional constructs in 30-minute at room temperature. can help to preserve energy in storage and shipping. Classical Restriction disgestion Gel extraction Ligation CloneEZ® PCR Cloning Kit can cut down PCR cloning time to 30 minutes Cloning (2-4h) (1h) (0.5-3h) For more information on Green PCR Reagents, see page 15 or from traditional 3.5 hours, with one-step procedure instead of multiple steps. visit http://www.genscript.com/green_pcr_reagents.html CloneEZ® One step by CloneEZ® Seamless in Order today! Seamless 0.5h0.5h
1h 2h 3h 4h 5h 6h 7h 8h For more information on CloneEZ® PCR Cloning Kit, see page 22 or visit http://www.genscript.com/cloneez_PCR_Cloning_kit.html
Your Innovation Partner in Drug Discovery! - v - www.genscript.com - vi - Magnetic Beads for Protein Isolation ExpressTM PAGE Gel System
Magnetic separation of protein and protein complexes High-performance and high-quality precast protein gels
GenScript Magbeads • Quick and convenient separation Add sample Add sample with antibody High capacity • Superior protein band resolution with antibody and target protein complex • Fast sample running time (45 min or less) • Minimum nonspecific binding • Add sample with Reusable up to six times • High protein transfer efficiency target protein • • Long shelf life (Up to 12 months at 4°C) GenScript provides a series of magnetic beads that efficiently and reliably purify target Wash and The ExpressTM PAGE Gel System is a high-performance precast elute Add 1xSDS PAGE recombinant proteins and antibodies from any type of cell lysates. Monosized, magnetic beads loading buffer and polyacrylamide gel system with a variety of acrylamide percentages. With heat to 100°C with Protein A, or Protein G, or a specific antibody coupled to their surface provide a TM suspendable solid support for immunoprecipitation of pure target proteins. The captured GenScript’s proprietary technology, Express PAGE gels are designed as an immune complexes are easily removed from the supernatant by magnetic separation. easy-to-use tool. The unique gel formulations eliminate the “smiles” and poor Magnetic separation technology allows for simple and efficient washing. The pure precipitate resolution of other gel types. You’ll produce reliable separation results every time. In addition, proteins transfer from ExpressTM PAGE gels is more efficient, Isolate pure can then be eluted from the beads and analyzed by western blotting or mass spectrometry. antibodies leading to more sample on your membrane for higher detection signals during For more information on MagBeads for protein isolation, see page 41 or visit western analysis. Seperate supernanant http://www.genscript.com/Magnetic_bead_products.html with target protein For more information on ExpressTM PAGE Gel system, see page 43 or visit http://www.genscript.com/express_page_gels.html
eStainTM Protein Staining System ONE-HOUR WesternTM Detection System Revolutionary electric staining system for Accurate western analysis in less time and with less effort 7-min protein gel staining The ONE-HOUR WesternTM detection system is designed to produce high signal with low background for quick and clear Western analysis of proteins. • Faster—Complete protein staining in 7 minutes or less GenScript Classical GenScript's breakthrough ONE-HOUR WesternTM technology streamlines the • Easier—Hit button and run ONE-HOUR WesternTM Western Blot classical Western blot analysis by bypassing secondary antibody binding and Detection • Cleaner—No buffer prepared Blot Detection washing steps. The kits reduce the total Western blot analysis time from 4.5 • Safer—Unique formulation without methanol hours down to only one hour.
TM The eStain Protein Staining System is designed to quickly and reliably ONE-HOUR WesternTM Kit Selection Guide Blocking perform protein staining with Coomassie Blue dye reagents in 7 minutes or Pretreatment e TM e TM ONE-HOUR WesternTM less. It consists of the Stain Protein Staining Device and Stain Protein Features Total Time Primary Antibody Detection Kits Staining Pad. The eStainTM Protein Staining System integrates three steps ONE-HOUR TM • Recommended for regular users Western Kit Primary of traditional Coomassie Blue staining procedure into one step and greatly Titanium Cathode TM Development Antibody 2e- + 2H O H + 2OH- ONE-HOUR Western • Convenient package with all reagents included 2 2 1 hour cuts down the time required for protein staining analysis, thereby resulting in Standard Kits • Fast and easy to perform consistent performance. • High sensitivity and low background E Secondary • Recommended for detection of E E TM Antibody E ONE-HOUR Western The eStainTM Protein Staining System is compatible with a wide range of eStainTM Cathode Pad low amounts of protein 1.25 hours Advanced Kits • Higher sensitivity and lower background TM CBB polyacrylamide gels, including Express PAGE, Bis-Tris, Tris-Acetate, CBB CBB dye dye dye • For immunoprecipitated proteins ONE-HOUR IP-Western Tris-Glycine, and Tris-Tricine gels. In addition to ease and convenience, the • Low background 1 hour 1hour Development Pre-run gel Kits eStainTM Protein Staining System provides as high detection sensitivity as • Journal-quality images CBB CBB CBB dye conventional Coomassie Blue staining method. In the end, you’ll see sharp dye • No dark room, developer or X-Ray film is needed dye ONE-HOUR WesternTM • More sensitive than traditional 1.25 hours protein bands with clear background. eStainTM Anode Pad Fluorescent Kit chemiluminescence methods • Simultaneous detection of multiple targets on 4.5 hours e TM ONE-HOUR WesternTM a single blot For more information on Stain Protein Staining System, see page 49 or 1.25 hours Multiplex Fluorescent Kit visit http://www.genscript.com/eStain_protein_staining_system.html • Saves time associated with optimizing fluorescent Graphite Anode Western blots - - 4OH - 4e O2 + 2H2O For more information on ONE-HOUR WesternTM detection system, see page 51 or visit http://www.genscript.com/western_tech.html
Your Innovation Partner in Drug Discovery! - vii - www.genscript.com - viii - Endotoxin Detection and Removal System Catalog Peptides
Endotoxin-free world coming with GenScript Tired of small peptide pools? Come swim in our ocean!
Endotoxin test is the most critical quality control test required by FDA for all GenScript has a comprehensive collection of pharmaceutical peptides drugs in the final formulation. Because endotoxins are invariably including β-amyloid peptides, blocking peptides and cosmetic peptides, associated with every gram-negative bacteria, they cause severe reactions and etc. We have a worldwide customer base in the cosmetic and in humans and animals and retain high toxic activity even at low pharmaceutical industries along with academic institutions. GenScript can concentration. In addition, endotoxins are suspected to play an important provide a variety of reliable cGMP peptides capable of increasing the role in the occurrence and development of many different diseases. speed and accuracy of your research.
GenScript is a leading company to provide innovative techniques for All GenScript's peptides come equipped with QC data, including HPLC and endotoxin detection and removal. The ToxinSensorTM Endotoxin Assay Kits MS profiles. There are over 1,500 different peptides with several quantity are designed to detect in vitro endotoxin level in a broad range of scales available. All the peptides in our catalog are offered at over 95% 0.005–1 EU/ml for human and animal parenteral drugs and biological purity. Let GenScript's state-of-the-art peptide synthesis technology and samples. The ToxinEraserTM Endotoxin Removal Kit provides higher experienced peptide chemists to be your partners toward your success. removal efficiency in which endotoxin level can drop below 0.1 EU/ml. If your peptide is not listed in our catalog, GenScript can synthesize any quantity of cGMP or research grade peptides for you. For more information on Endotoxin Detection and Removal System, see page 47 or visit For more information on Catalog Peptides, see page 185 or visit http://www.genscript.com/endotoxin_detection_and_removal_system.html http://www.genscript.com/peptide_products.html
THETM Elite Antibodies Ready-to-UseTM Frozen Cell Lines
The most precise and effective antibodies Make GPCR studies easy and standard
• Ultra Sensitivity—More sensitive than most popular antibodies in the market • Reliability—Each batch of Ready-to-UseTM Frozen Cells is validated • Ultra Specificity—No cross-reactivity according to stringent criteria to assure consistent results. • Ultra Affinity—Ultra-low dissociation constant Kd • Convenience—Ready-to-UseTM Frozen Cells can trim time and • Ultra Reactivity—Recognize and bind even partially exposed terminal and aggravation out of functional testing. Instead of engaging in a lengthy internal tags in-house culturing process, simply thaw the cells, plate them, and run • Ultra Clear Background the assays. THE unmistakable THE • Ultra Convenience—No secondary antibody needed for conjugated irreplaceable • Variability Arrest—Chemically treated cells with optimized protocol to antibodies alleviate biological variability. • Ultra Stability—Stable in lyophilized form for at least two years THE • Speed—Assays can be finished within 24 hours after thawing the cells.
THE best TM THE highest THE Elite Antibody series are the most precise and effective antibodies that quality specificity Cell-based assays can often be challenging and time-consuming. meet the most demanding research requirements. THETM stands for THE To smooth and streamline this complicated process, GenScript has unmistakable, THE irreplaceable, and THE best quality in the industry. To developed a series of Ready-to-UseTM Frozen Cells that can be produce THETM Elite Antibodies, the most productive and stable hybridoma cell conveniently employed in functional GPCR receptor assays. GenScript’s clones were selected. THETM Elite Antibodies are then isolated from the cell line scientists culture and freeze the cells using optimized protocols that can that shows the highest specificity against the corresponding immunogens. arrest cell growth to reduce variability in cellular assays.
Are you concerned about small samples, partially exposed tags, fusion-protein For more information on Ready-to-UseTM Frozen Cells, see page 227 or denaturation, or any other obstacles? Order GenScript's THETM Elite antibodies, visit http://www.genscript.com/ready-to-use_frozen_cells.html and you are on your way to solve the problems you encounter in your research.
For more information on THETM Elite Antibodies, see page 75 or visit http://www.genscript.com/THE_antibody.html
Your Innovation Partner in Drug Discovery! - ix - www.genscript.com - x - Chapter 1 Nucleic Acid Purification and Analysis
Plasmid DNA Purification 3 PCR Purification 5 Nucleic Acid Electrophoresis 6 Nucleic Acid Markers 8 Custom Plasmid Preparation Services 11 - 3 Plasmid DNA purification Nucleic Acid Purification and Analysis GenScript For rapidpurificationofupto20 Plasmid DNA Purification Kit vs.otherbrandkit Comparison ofpreparationtime:QuickClean5MMiniprep molecular biologyapplications. is elutedinwateror TE andreadyforuseinstandard free ofRNA,proteins,andothercontaminants.PlasmidDNA 5M MiniprepKitprovidesreproducibleyieldsofplasmidDNA, using asimplebind–wash–eluteprocedure. The QuickClean make useofanuniquesilicamembranetoachievehighyields bacterial cultures,yieldingupto20 of molecularbiology-gradeplasmidDNA from1–5mlovernight The QuickClean5MMiniprepKitisidealforrapidpurification • • • • QuickClean 5MMiniprepKit Product Overview: Brand Q Reproducible Yields— High Purity— High Capacity— Fast— QuickClean 5MMiniprepKit Product 0 5 10 0 20 15 Completed within5minutes Time perreaction(min.) Removal efficiency >99% Up to20 Recovery efficiency >90% μ g μ μ g. The mini-spincolumns g plasmidDNA Sample handing Elution Wash Sol’n II&III Resuspens oninSol’nl Your Innovation PartnerinDrugDiscovery! 250 Preps Quantity high-copy-number plasmids Plasmid DNA purificationfrom low-copy-number plasmids Plasmid DNA preparationfrom Competitor A forrapidpurificationofplasmidDNA from The QuickClean5MMiniprepKit*isalsocomparedwiththekit*from E. coli available kit*(Competitor A) forrapidpurificationofplasmidDNA from The QuickClean5MMiniprepKit*iscomparedtoacommercially the manufacturers. * Bothkitshavebeenusedincompliancewiththeprotocolsprovidedby low-copy-number plasmid. bearing high-copy-numberplasmids. Kit fromCompetitor A KitfromGenScript Kit fromCompetitor A KitfromGenScript L00193 Cat. No. E. coli E. coli bearing bearing E. coli Price $145 bearing From QuickClean 96-wellPlasmidMiniprepKit two 96-wellplates,afilterplate,andbindingplatetopurify plasmid DNA from 96-well platedesignformanualorautomatedprocessingof advanced silicaplateextractionchemistrywithanoptimized The QuickClean96-wellPlasmidMiniprepKitcombines • Improvedplatedesignandeasy-to-useprotocol • Processingflexibilitywithmulti-formatprotocols • Highyieldsofhigh-purityplasmidDNA For purificationofupto20 Product Overview: QuickClean 96-wellPlasmidMiniprepKit Product For moreinformationonplasmindDNA purification,visit E. coli culturetohigh-purityplasmidDNA in60minutes E. coli inaslittle60minutes. The kituses 96-well CollectionPlate μ g plasmidDNA ina96-wellformat 96-well BindingPlate 96-well BindingPlate 96-well GrowthPlate 96-well GrowthPlate 96-well FilterPlate http://www.genscript.com/dna_purification.html 384 Preps Quantity PCR. including sequencing,restrictionenzymedigestion,cloningand DNA iselutedandreadyforuseindownstreamapplications, After washingstepstoremoveanycontaminants,high-purity Plate wheretheplasmidDNA bindstothesilicamembrane. QuickClean FilterPlateandcollectedintheBinding plasmid DNA. The bacteriallysateisthenappliedtothe Elute plasmidDNA Wash twicewithWash Solution to silica-basedmembrane Transfer filtrateandbindplasmidDNA Transfer supernatantandfilter lysis andneutralization Harvest cellsandperformresuspension, Grow Cells L00237 Cat. No. www.genscript.com
Price $488 and Analysis and
- 4 Plasmid DNA purification DNA Plasmid Nucleic Acid Purification Acid Nucleic - 5 Nucleic Acid Purification PCR Purification and Analysis Simple andrapidpurificationofPCRproducts PCR Purification are shownbelow: DNA productpurificationfromPCRreactions.Theresults commercially availablekit(Competitor A) forrapidPCR The QuickClean5MPCRPurificationKitiscomparedtoa QuickClean 5MPCRPurificationKit Product Overview: Lane 1showsunpurifiedmaterial. kit. The samevolumeof PCR materialwasusedineachpurification. manufacturers. Two PCRDNA purificationswereperformedusingeach Both kitswereusedinaccordancewiththeprotocolsprovidedby enzymes, andsaltsfromPCRreactions.DNA molecules efficient removalofshortprimers,unincorporateddNTPs, The QuickClean5MPCRPurificationKitprovidesrapidand • Single-columnor96-wellplateformat • 15minutesprotocolwithnogelpurification • RapidPCRproductpurification QuickClean 96-wellPCRPurificationKit QuickClean 5MPCRPurificationKit Product For moreinformationonPCRpurification,visit 1 Competitor A GenScript Your Innovation PartnerinDrugDiscovery! http://www.genscript.com/dna_purification.html 384 Preps 250 Preps Quantity Lane 9:150bp10:100 Lane 7:500bp8:200 Lane 5:2kb6:1 Lane 3:8kb4:4 Lane 1:15kb2:10 U: UnpurifiedPCRproductsP:Purified M: KBPlusDNA LogicalLadder(GenScript,Cat.No.M103R) M 12 3 45678910 below: fragment between100bpand15kb.Theresultsareshown QuickClean 96-wellPurificationKitisusedtopurifyDNA washed away. short oligonucleotides(suchasprimersandprobes)are proteins, smallDNA fragments,dyes,salts,nucleotidesand QuickClean columnwhileimpuritiessuchasenzymesand ranging insizefrom70to10,000basepairsareadsorbedonto U P UP UP UP UP UP UP UP U P U P L00238 L00198 Cat. No. Price $295 $145 Nucleic Acid Electrophoresis Nucleic Acid Electrophoresis Resultsfor All-In-One Precast Agarose Gel ElectrophoresisKits Fast, convenientandeasyelectrophoresis All-In-One Precast Agarose GelElectrophoresisKits • • ethidiumbromide • loadingbuffer withdyeandready-to-useDNA marker • contain precastagarosegels,loadingbuffer withdye,and provide fast,convenient,andeasyelectrophoresis. The kits Kits areself-contained,precastagarosegelsdesignedto GenScript's All-In-One Precast Agarose GelElectrophoresis Long ShelfLife— Fast— Improved Safety— All-In-One Format— Done inaslittle30minutes 100 300 500 700 1,000 1,500 2,000 3,000 100 300 500 700 1,000 1,500 2,000 3,000 bp M1 bp M1 1: PCRProducts(500bp) M: Middle-RangeDNA Marker Cat. No.L00333 0.8% Agarose 0.8% Agarose 1: PCRProducts(500bp) M: Middle-RangeDNA Marker Cat. No.L00347 Up to6months GelRed tobemuchlessmutagenicthan Includes precastagarosegels, 100 300 500 700 1,000 1,500 2,000 3,000 100 300 500 700 1,000 1,500 2,000 3,000 bp M1 1.2% Agarose 1: PCRProducts(500bp) M: Middle-RangeDNA Marker Cat. No.L00334 bp M1 1.2% Agarose 1: PCRProducts(500bp) M: Middle-RangeDNA Marker Cat. No.L00348 of wellformatsandagarosepercentages. To meetyourdifferent needs,thekitsareavailableinavariety offer excellentresolutionandclarityinaslittle30minutes. environmentally-friendly thanethidiumbromide.Precastgels GelRed ismoresensitive,lessmutagenic,and Precast gelscontainGelReddyeforDNA visualization. samples andruninaregulargelbox. to pour, staininganddestainingrequired.Justloadyour ready-to-use DNA markersinonepackage. There arenogels 100 300 500 700 1,000 1,500 2,000 3,000 100 300 500 700 1,000 1,500 2,000 3,000 1: PCRProducts(500bp) M: Middle-RangeDNA Marker Cat. No.L00335 2.0% Agarose bp M1 2.0% Agarose 1: PCRProducts(500bp) M: Middle-RangeDNA Marker Cat. No.L00349 bp M1
www.genscript.com
and Analysis and
- 6 Electrophoresis Acid Nucleic Nucleic Acid Purification Acid Nucleic - 7 Nucleic Acid Electrophoresis Nucleic Acid Purification and Analysis Product Overview: Kit Components: Gel ElectrophoresisKit(17-Well) All-In-One Precast2.0% Agarose Gel ElectrophoresisKit(17-Well) All-In-One Precast1.2% Agarose Gel ElectrophoresisKit(17-Well) All-In-One Precast0.8% Agarose Gel ElectrophoresisKit(2x9-Well) All-In-One Precast2.0% Agarose Gel ElectrophoresisKit(2x9-Well) All-In-One Precast1.2% Agarose Gel ElectrophoresisKit(2x9-Well) All-In-One Precast0.8% Agarose Gel ElectrophoresisKit(9-Well) All-In-One Precast2.0% Agarose Gel ElectrophoresisKit(9-Well) All-In-One Precast1.2% Agarose Gel ElectrophoresisKit(9-Well) All-In-One Precast0.8% Agarose Product L00349 L00348 L00347 L00346 L00345 L00344 PrecastGels L00335 L00334 L00333 Cat. No. For moreinformationonprecastagarosegels,visit 8 (17-Well) 8 (17-Well) 8 (17-Well) 8 (2x9-Well) 8 (2x9-Well) 8 (2x9-Well) 8 (9-Well) 8 (9-Well) 8 (9-Well) Your Innovation PartnerinDrugDiscovery! 300 300 300 300 300 300 150 150 150 Containing GelRed 6X DNA LoadingBuffer http://www.genscript.com/agarose_gel_kits.html μ μ μ μ μ μ μ μ μ l l l l l l l l l Quantity 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 100 60 100 1 KBDNA Ladder Ready-to-Use μ μ μ l l l TM L00349 L00348 L00347 L00346 L00345 L00344 L00335 L00334 L00333 Cat. No.
100 100 100 60 60 100 Ready-to-Use Middle-Range DNA Ladder μ μ μ μ μ μ l l l l l l TM Price $44 $44 $44 $40 $40 $40 $40 $40 $40 Original formats DNA Ladders Markers Nucleic Acid Product Overview: provides accuratesizingofnucleicacidsmallfragmentsfrom single-stranded DNA fragments. The 100bpDNA ladder length designedforsizinglineardouble-strandedor DNA Laddersarenucleicacidfragmentsofspecificbasepair no needtoheat,mix,ordilutethesemarkerspriorloading markers arealsoavailableintheready-to-useformat. There is and estimatingthesizequantityofDNA. A varietyofthese ranging from100bpto23kbforaccuratelyseparatingbands GenScript providesawideselectionofnucleicacidmarkers Nucleic Acid MarkersSelectionGuideline: Lambda DNA /EcoRI+HindIII Marker Middle-Range DNA Ladders PCR DNA Ladder 100 bpDNA Ladder 1 KBDNA Ladder Product 0 10bp100500100050 100 bpDNA Ladder Middle-Range DNA Ladder PCR DNA Ladder 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes Lambda DNA/EcoRI+HindlIIMarker KB PlusDNA LogicalLadders Quantity of yourfragments. appear crispandclear, makingiteasytoidentifythepropersize size fragmentsrangingfrom100bpto10kb. The bands 100 to1500basepairs.Byusing1KBDNA Ladder, youcan to helpyouchoosetheoneneed. markers foryourparticularapplication.Usethefollowingtable formats. The keytoaccuratebandanalysisisusethecorrect markers forawidevarietyofsizeranges,applicationsand them onyourgel.GenScriptoffers 6uniquenucleicacid 1 KBDNA Ladder 00 bp10,00050,000 MM1302 M00414 M106O M102O M101O Cat. No. www.genscript.com
Price $170
$20 $85 $25 $85 $25 $44 $85 $25 and Analysis and
- 8 Nucleic Acid Markers Acid Nucleic Nucleic Acid Purification Acid Nucleic - 9 Nucleic Acid Markers Nucleic Acid Purification and Analysis One DNA Markermeetsallyoursizingandquantifyingneeds KB PlusDNA LogicalLadders Ready-to-Use Product Overview: Product Overview: the separationrangesbetweenbandsinaspecificregion. By adjustingthepercentagaroseofyourgel,youcanincrease read ataglance. size andthequantityofaparticularDNA fragmentcouldbe quantitative measurementoftheDNA fragments. Thus boththe easy recognitionofthebandsongel,butalsogivea Plus DNA LogicalLaddersnotonlyrevealanuniquepatternfor the DNA fragmentthatcorrelatestoitssize. Therefore, theKB yield suchapatternthateachbandcontainslogicamountof pairs. The KBPlusDNA LogicalLaddersareformulatedto and quantifyingnucleicacidfragmentsfrom100to10,000base The KBPlusDNA KBLogicalLaddersprovideaccuratesizing Formats forultimateconvenience • Ready-to-useformat • • Room temperaturestorage Convenience— Ready-to-Use Ready-to-Use Ready-to-Use Ready-to-Use Ready-to-Use Product Ready-to-Use KB PlusDNA LogicalLadder Product For moreinformationonDNA markers,visit TM TM TM TM TM TM Lambda DNA/HindIIIMarker Middle-Range DNA Ladder PCR DNA Ladder 100 bpDNA Ladder 1 KBDNA Ladder KB PlusDNA LogicalLadder No needtoheat,mixanddilute. TM DNA Ladders Your Innovation PartnerinDrugDiscovery!
http://www.genscript.com/dna_marker.html 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes Quantity Quantity available intheready-to-useformat. time, andefforts. The KBPlusDNA LogicalLadderisalso and quantifyfragmentsfrom100bpto10kbsavemoney, ladder –KBPlusDNA LogicalLadder. You’ll accuratelysize For mostelectrophoresisapplications,youneedonlyone lower percentageagarosegel. the separationrangesbetweenlargerbands,choosea your samplesonahigherpercentageagarosegel. To increase If youareconcentratingonsmallerbands,runtheladderand GenScript’s Ready-to-Use and canbestoreonyourbenchtop. the vialtogel. These ladd ladders. Simplytransferyourready-to-useDNA Ladderfrom in thawing,dilutingandaddingsamplebuffer toyourDNA MM1212 M00415 M106R M102R M101R Cat. No. M103R M103O Cat. No. TM DNA Laddersminimizetimespent ers arestableat room te Price Price $180 $180 $320 $300 mpera $87 $27 $50 $95 $30 $50 $95 $30 $75 $70 ture 1 mMEDTA. Forready-to-use 500 ng/5ulin10mM Tris-HCl (pH7.5), 0.8%agarosegel 500 ng/5 2.0%agarosegel 1 mMEDTA. Forready-to-use loading tothegel. marker, andthemarkerisreadyfor 1X loadingbuffer hasbeen addedtothe loading tothegel. marker, andthemarkerisreadyfor 1Xloading buffer hasbeenaddedtothe 1 KBDNA Ladder 100 bpDNA Ladder μ l in10mM Tris-HCl (pH7.5), 500 (10ng/ 1,000 (10ng/ 2,000 (10ng/ 3,000 (20ng/ 4,000 (10ng/ 5,000 (10ng/ 6,000 (10ng/ 8,000 (10ng/ 10,000 (10ng/ bp 100 (10ng/ 600 (10ng/ 800 (10ng/ 400 (10ng/ 300 (10ng/ 200 (10ng/ 1,500 (10ng/ 1,000 (10ng/ 500 (20ng/ bp TM TM format, format, μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ l) l) l) l) l) l) l) l) l) l) l) l) l) l) l) l) l) l) 1 mMEDTA. Forready-to-use 400 ng/5 2.0%agarosegel loading tothegel. marker, andthemarkerisreadyfor 1X loadingbuffer hasbeen addedtothe 1 mMEDTA. Forready-to-use 450 ng/ 1.0%agarosegel loading tothegel. marker, andthemarkerisreadyfor 1Xloading buffer hasbeenaddedtothe KB PlusDNA LogicalLadder μ PCR DNA Ladder l in10mM Tris-HCl (pH7.5), μ l in10mM Tris-HCl (pH7.5), 100 (10ng/ 300 (10ng/ 500 (20ng/ 1,500 (10ng/ 2,000 (10ng/ bp 1,000 (10ng/ 700 (10ng/ TM TM format, format, μ μ μ μ μ μ μ l) l) l) l) l) l) l) 1 mMEDTA. Forready-to-use 500 ng/5 0.8%agarosegel loading tothegel. marker, andthemarkerisreadyfor 1X loadingbuffer hasbeen addedtothe solution 1 mMEDTA andwith1Xloading dye 83 ng/ulin10mM Tris-HCl (pH7.5), 0.7%agarosegel Lambda DNA/HindIIIMarker Middle-Range DNA Ladder 100 300 500 700 1,000 1,500 2,000 3,000 bp M1 μ l in10mM Tris-HCl (pH7.5), www.genscript.com 125 564 2027 2322 4361 6557 9416 23130 bp
TM
format, and Analysis and
- 10 Nucleic Acid Markers Acid Nucleic Nucleic Acid Purification Acid Nucleic - 11 - Custom Plasmid Preparation Services Nucleic Acid Purification and Analysis the mostconvenientorderingmethod. Quotations andordersmaybeplacedbyemail,phone,orfaxwith eitheraformalPO(PurchaseOrder)orcreditcard.Pleasech Quotations andOrdering Custom PlasmidPreparationServices Services List and otherpreclinicalstudies. efficient celltransfection,DNA vaccination,antibodyproduction, GenScript’s highqualityplasmidswillhelpyouachievehighly for biotechsuppliersandpharmaceuticalcompanies. cotructs forresearchlabsaswelllargescalemanufacturing GenScript’s plasmidDNA preparationservicescoverindividual • ReproduciblequalityofplasmidDNA byarchivinginCloneArch • Completelyenzyme-freeandanimal-freeprocessforSCGrade Advanced SCGradeplasmids'production • Flexiblescaleofuptogramlevel.Startingfrom$50.00foraMidiPrep(100 • Fastdeliverytime RNA,genomicDNA,concentrations,restrictionanalysis,andendotoxinlevel(uponrequest) • Stringentandcomprehensivequalitycontrol—atleastsevenitems,includingappearance, A260/280, supercoiledcontent,resi • BacteriastockandplasmidDNA thatisdryonpaperareacceptablebutnotrecommended. • Dissolvedinwater, TE buffer ordryin1.5/0.5mlcentrifugetube. • PlasmidDNA templateof>1 Sample SubmissionRequirements Advanced SCGrade SC Grade Research Grade Quality Grades For moreinformationoncustomplasmid preparationservices,visit Secured Web Server: Fax: Phone: Email: Quotation Form: 1-732-210-0262; 1-732-885-5878 [email protected] 1-877-436-7274 (Toll-Free); 1-732-885-9188 https://www.genscript.com/ssl-bin/quote_gene_synthesis https://www.genscript.com/ssl-bin/secure_data μ g withaconcentrationof>100ng/ ≤ ≥ ≤ ≥ Predominantly Supercoiled Features 0.005EU/ 95%Supercoiled 0.03EU/ 95%Supercoiled Your Innovation PartnerinDrugDiscovery! μ μ g Endotoxin g Endotoxin TM CloneStorageandManagementCenter
http://www.genscript.com/custom_plasmid_preparation.html μ l. (Supercoiled content are currentlyoffering SCGradeand Advanced SCGrade GenScript hasupgradeditsplasmidpreparationplatform.We production tosatisfycustomers’ variableneeds. process) plasmidsalongwithroutineResearchGradeplasmid μ g) • Genevaccineandgenetherapystudies • Animal studies • Proteinmanufacturing • Antibody production • Highlyeffective transfection andco-transfection • Genevaccineandgenetherapystudies • Animal studies • Proteinmanufacturing • Antibody production andco-transfection • Recommendedforeffective transfection Typical molec Typical Applications ≥ 95%,withenzyme-freeandanimal-free μ lar biologyresearch dual oose Product List Human GenomicDNA TrioMol IsolationReagent 6X LoadingBuffer with Agarose GelLoadingDye(with ficoll) 6X LoadingBuffer with Agarose GelLoadingDye 6X LoadingBuffer withGelRed Ready-to-Use KB PlusDNA Logicalladder Ready-to-Use Ready-to-Use Ready-to-Use Ready-to-Use Ready-to-Use Middle-Range DNA Ladder PCR DNA Ladder 100 bpDNA Ladder 1 KBDNA Ladder Gel ElectrophoresisKit(17-Well) All-In-One Precast2.0% Agarose Gel ElectrophoresisKit(17-Well) All-In-One Precast1.2% Agarose Gel ElectrophoresisKit(17-Well) All-In-One Precast0.8% Agarose Gel ElectrophoresisKit(2x9-Well) All-In-One Precast2.0% Agarose Gel ElectrophoresisKit(2x9-Well) All-In-One Precast1.2% Agarose Gel ElectrophoresisKit(2x9-Well) All-In-One Precast0.8% Agarose Gel ElectrophoresisKit(9-Well) All-In-One Precast2.0% Agarose Gel ElectrophoresisKit(9-Well) All-In-One Precast1.2% Agarose Gel ElectrophoresisKit(9-Well) All-In-One Precast0.8% Agarose QuickClean 96-wellPCRPurificationKit QuickClean 5MPCRPurificationKit QuickClean 5MMiniprepKit Product QuickClean 96-wellPlasmidMiniprepKit TM TM TM TM TM TM KB PlusDNA Logicalladder Lambda DNA/HindIIIMarker Middle-Range DNA Ladder PCR DNA Ladder 100 bpDNA Ladder 1 KBDNA Ladder 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 500 Lanes 100 Lanes 384 Preps 250 Preps 384 Preps 250 Preps Quantity 100 100 ml 300 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 1 Kit 5 ml 5 ml μ μ g l D0109 M00120 M103R M103O MM1212 M00415 M106R M102R M101R M00414 M106O M102O M101O L00349 L00348 L00347 L00346 L00345 L00344 L00335 L00334 L00333 L00238 L00198 L00237 L00193 Cat. No. M00094 M00105 D0084 www.genscript.com
Price $320 $300 $180 $180 $170 $295 $488 $488 $145
$79 $89 $48 $48 $10 $75 $70 $87 $27 $50 $95 $30 $50 $95 $30 $85 $25 $85 $25 $44 $85 $25 $44 $44 $44 $40 $40 $40 $40 $40 $40 and Analysis and
- 12 Product List Product Nucleic Acid Purification Acid Nucleic Chapter 2 PCR and Cloning
Green PCR 15 Routine PCR 16 Direct PCR 17 PCR Cloning 22 GenPoolTM ORF Clones 23 siRNA Expression Vectors 24 Custom Molecular Biology Services 31 Green PCR High Stability PCR Kit
The environmentally friendly PCR reagents for your success GenScript’s High-Stability PCR Kit contains Green Taq DNA stability of Taq DNA Polymerase at higher temperature (72°C), • Stable at room temperature for one month or at 4°C for over six months . The high-stability Polymerase, 10X PCR buffer, and 10 mM dNTP, all specially increasing the PCR yield of long DNA amplification. This kit • Enhanced yields with longer enzyme half-life feature allows the increase in the half-life of active enzyme at formulated for higher stability using our proprietary facilitates quick and easy PCR setup without any need for • Stop refrigerating and save energy high temperatures, therefore more amplification cycles are technology. The kit can be stored at 4°C for over six months thawing. This kit can be used in high-throughput assays in carried out and higher yields are generated. With no freeze-thaw or at room temperature (25°C) for one month without significant which all the PCR reagents need to be ready and stable for GenScript's advanced high-stability technology has led to the cycles, Green PCR reagents provide you an instant access to loss of activity. The stabilizers in the buffer also increase the PCR setup at any time. invention of the new generation of PCR reagents—Green PCR high-throughput PCR automation. In addition, GenScript's reagents. The Green series of reagents, from the proprietary Green PCR reagents can help preserve energy during storage Product Overview: PCR and Cloning Taq, dNTP, to PCR master mix, are stable at room temperature and shipping. Product Quantity Cat. No. Price High-Stability PCR Kit 200 rxns L00342 $64
Green Taq DNA Polymerase For more information on Green PCR, visit http://www.genscript.com/green_pcr_reagents.html
PCR and Cloning • Improved specificity and PCR yield. The Green Taq DNA Polymerase can be stored at 37°C for • Room temperature reaction assembly 14 days without loss of activity. • Stable for 1 month at room temperature or 6 months at 4°C Routine PCR
Green Taq DNA Polymerase has terminal transferase activity Routine PCR Reliable and affordable PCR reagents for routine PCR that results in the addition of a single nucleotide (adenosine) at 3′-end of the extension product. This enzyme also has a longer enzyme half-life and therefore increases the PCR yields when
Green PCR amplifying long DNA fragments. Taq DNA Polymerase
A 2 kb 23S rRNA fragment from E. coli genomic DNA was amplified Taq DNA Polymerase is a thermostable DNA Polymerase Taq DNA Polymerase PCR performance using Green Taq DNA Polymerase stored at -20°C and 37°C, isolated from an E. coli strain that carries the Taq DNA The Green Taq DNA Polymerase provides high yield and respectively. GenScript Leading Brand A polymerase gene. The enzyme consists of a single polypeptide specificity when amplifying long DNA fragment. with a molecular weight of 94 kDa. Taq DNA polymerase is the most common polymerase used for PCR. Genscript’s best-selling Taq DNA polymerase offers your cost-effective solution (6¢/unit) to the routine PCR with the satisfactory results.
Units of Taq (U) 2.5 2.0 1.5 1.0 2.5 2.0 1.5 1.0
A 500 bp λDNA fragment was amplified with Taq DNA polymerase from A 8 kb λDNA fragment was amplified with both Taq DNA Polymerase different brands. and Green Taq DNA Polymerase. For amplification of long DNA fragment, where longer elongation time is needed (in this case, the elongation time was three minutes), the Green Taq DNA polymerase has Product Overview: a longer enzyme half-life and therefore increases the PCR yield significantly. Product Quantity Cat. No. Price 1,000 U E00007 $60 Taq DNA Polymerase Product Overview: 50,000 U E00044 $2,700 Taq DNA Polymerase without Mg2+ 1,000 U E00008 $60 Taq DNA Polymerase, concentrated 2,500 U E00012 $149 Product Quantity Cat. No. Price Taq and dNTP: 1,000 U of Taq (E00007); 0.5 ml of Green Taq DNA Polymerase 1,000 U E00043 $60 1 Kit E00101 $79 10 mM dNTP (D0056)
Your Innovation Partner in Drug Discovery! - 15 - www.genscript.com - 16 - 2X Taq Master Mix TissueDirectTM Multiplex PCR System
Fast and convenient PCR reaction set-up Simple & speedy PCR system for genomic DNA of tissue
2X Taq Master Mix is an optimized solution containing PCR amplification. It can amplify up to 4 kb from complex The TissueDirectTM Multiplex PCR System is designed to extract Multiplex PCR amplification of human genomic DNA ready-to-use Taq DNA polymerase, salts, magnesium, and genomic DNA or 8 kb from lambda DNA. For a 50 μl reaction, genomic DNA from a single sperm for a multiplex PCR extracted by the TissueDirectTM Multiplex PCR System dNTPs for efficient PCR amplification. All you have to do is to simply add 25 μl of 2X Taq Master Mix to primers, DNA amplification of more than 1,000 amplicons. DNA extracts are 1 2 3 4 5 6 bp add template and primers, significantly reducing setup time. template and PCR-grade H2O. from animal cells and tissues such as mouse tail samples, The Master Mix is optimized for consistent and efficient routine micro-dissection samples, buccal cells, hair shafts, saliva, sperm, and fresh, frozen, or paraffin tissues.
Product Overview: PCR and Cloning PCR analysis of genomic DNA prepared from mouse tails
Product Quantity Cat. No. Price Mouse Tails 2X Taq Master Mix 100 rxns E00019 $43 No.1 No.2 No.3 M For more information on Routine PCR, visit http://www.genscript.com/pcr.html PCR and Cloning
The sizes of the DNA samples are shown on the right. Lanes 1 and 2: 30 HEK293 cells 396 bp Direct PCR Lanes 3 and 4: Breast cancer microdissections Direct PCR Lanes 5 and 6: Human hair shafts Direct multiplex PCR amplification of more than 1000 amplicons
The TissueDirectTM Multiplex PCR Kit was used to prepared genomic DNA extraction and PCR amplification are two of the most prevents amplification of nonspecific products and increases Direct PCR DNA from nine pieces of tissue, each of different sizes, about 1 mm, common methods used in molecular biology reseach. They are the amplification efficiency of the desired sequences. 2 mm, and 4 mm, respectively cut from three separate mouse tails. All used in SNP genotyping, mutation detection, target detection in genomic DNA samples were amplified using the PCR premix in the kit. transgenic mice, and countless other basic experiments. • Easy to Perform—Simple and rapid procedure to extract The last lane showed a negative control. The PCR products were 396 bp Traditional DNA extraction procedures are time-consuming and and amplity genomic DNA in a single step. for the mouse Ephrin A5 gene, and the sequence is (5’ to 3’): unreliable. • High Specificity—Highly specific amplification of genomic TCCAGCTGTGCAGTTCTCCAAAACA and ATTCCAGAGGGGTGAC- DNA using HotStart ScriptTM DNA polymerase (a GenScript TACCACATT. With Direct Multiplex PCR System, genomic DNA is prepared proprietary DNA polymerase). and amplified in just a few easy steps that eliminate the need • Multiplex PCR—Up to 1,000 DNA sequences can be Product Overview: for any other type of purification such as DNA precipitation and amplified using multiplex PCR primers. column purification, organic extraction, or proteinase digestion. The use of hot-start Taq DNA polymerase in the system Product Quantity Cat. No. Price TissueDirectTM Multiplex PCR Kit (with enzyme) 100 rxns L00195 $159 TissueDirectTM Multiplex PCR Kit (without enzyme) 100 rxns L00194 $113
DNA Extraction and PCR In Minutes...
L00194 (without enzyme) TM TissueDirect L00195 (with enzyme)
L00196 (without enzyme) TM BloodReady L00197 (with enzyme)
L00200 (without enzyme) PlantDirectTM L00201 (with enzyme)
L00202 (without enzyme) TM BacReady L00203 (with enzyme)
Your Innovation Partner in Drug Discovery! - 17 - www.genscript.com - 18 - BloodReadyTM Multiplex PCR System BacReadyTM Multiplex PCR System
Simple & speedy PCR from blood samples BacReadyTM Multiplex PCR System is designed for both rapid Gram-negative Bacteria genomic DNA preparation and PCR BloodReadyTM Multiplex PCR System is a powerful reagent kit Shown below is a PCR analysis of genomic DNA using preparation and multiplex PCR amplification of bacteria amplification designed for both rapid genomic DNA preparation and multiplex the BloodReady™ Multiplex PCR Kit genomic DNA. Genomic DNA are directly released from PCR amplification from blood samples. The genomic DNA can bacteria (both gram-positive and gram-negative) cells in a then be used immediately in PCR amplification of multiple gene single step by adding a proprietary reagent directly to bacteria targets (up to 1,000) or keep stable at 4°C for over 6 months. samples without DNA purification.
The BloodReadyTM Multiplex PCR System can be easily PCR and Cloning adapted to high-throughput automation systems such as the Qiagen BioRobot 9604 for automated nucleic acid preparation Bactaria BR-A Buffer and subsequent amplification of genomic DNA from tissues in a 96-well automated format. PCR analysis of genomic DNAs extracted from blood samples. Genomic PCR analysis of genomic DNA prepared from bacteria samples. DNAs were extracted from nine different blood samples and amplified Genomic DNA were prepared from 4 different E. coli cultures and using BloodReadyTM Multiplex PCR Kit according to the kit instructions. amplified using BacReadyTM Multiplex PCR kit following the kit PCR and Cloning M is 100 bp DNA Ladder (Cat.No M102R). Lane 1 to 9 are from nine instructions. M is 100 bp DNA marker lane. Lane 1 and 2 are bacteria
blood samples. The last lane is a negative control. The size of PCR culture No. 1; Lane 3 and 4 are bacteria culture No. 2, and so on. Blood BR-A Buffer products is 142 bp. Lane 9 is a negative control. PCR products are 544 bp.
123456bp Direct PCR Gram-positive Bacteria genomic DNA preparation and PCR 142 Genomic or plasmid DNA 133 amplification 126 119 M123456
Direct PCR 112 105 100 96 PCR reaction 90 85 Genomic DNA 80 76
Multiplex PCR amplification of human genomic DNA extracted using the PCR reaction BloodReadyTM Multiplex PCR Kit (L00197). The sizes of each PCR DNA molecule are shown on the right. Lane 1 and 2 show the DNA extracted Bacteria genomic DNA was prepared and amplified using BacReadyTM from 100 blood cells. Lane 3 and 4 show DNA extracted from 25 blood Multiplex PCR System (with Enzyme). Five different samples were cells. Lane 5 and 6 show DNA extracted from only five blood cells. tested. Lane 1 and 2 were your samples; Lane 3, 4 and 5 were bacteria samples picked from slants, they were Bacillus globigii, Bacillus ubtillus, Product Overview: and Micrococcus leteus, respectively. Lane 6 is a negative control. PCR products are 355 bp. Product Quantity Cat. No. Price BloodReadyTM Multiplex PCR Kit (without enzyme) 100 rxns L00196 $111 Product Overview: BloodReadyTM Multiplex PCR Kit (with enzyme) 100 rxns L00197 $157
Product Quantity Cat. No. Price BacReadyTM Multiplex PCR Kit (without enzyme) 100 rxns L00202 $111 BacReadyTM Multiplex PCR Kit (with enzyme) 100 rxns L00203 $157
Your Innovation Partner in Drug Discovery! - 19 - www.genscript.com - 20 - PlantDirectTM Multiplex PCR System PCR Cloning
Speedy procedure with the smallest amounts of plant CloneEZ® PCR Cloning Kit The PlantDirectTM Multiplex PCR System is designed for easy PCR analysis of genomic DNA extracted from Arabidopsis and rapid preparation and multiplex PCR amplification of leaves No more restriction site headaches Overview of the method genomic DNA from plant leaves, roots, stems and other tissues. • Universal—Clone any insert into any location within any Primers with 15 bases Target fragment Shown right is a PCR amplification of a 180 bp fragment of vector you choose. of sequence homology to lineanized vector Arabidopsis ubiquitin 10. There is little difference between • Fast and Easy—30 minutes, one-step incubation at room
genomic DNA samples extracted from different Arabidopsis temperature. PCR and Cloning PCR product leaves. This demonstrates the high quality and reproducibility • High Efficiency—Success rate over 95%. of PlantDirectTM Multiplex PCR Kit. 180 bp • Compatibility—The kit is highly compatible with Linearized vector high-throughput PCR cloning.
Genomic DNA was extracted from 12 pieces of Arabidopsis leaves using GenScirpt’s preprietary CloneEZ® seamless cloning technology Linearized vector PlantDirectTM Multiplex PCR Kit in accordance with the kit instructions. is a cutting-edge, recombination-based cloning technology that
PCR and Cloning All genomic DNA samples were amplified using the PCR premix supplied can accurately and efficiently assemble genes and gene in the kit. The PCR products are 180 bp fragments of Arabidopsis fragments in any combination of sequences. The CloneEZ® ubiquitin 10. Lane 13 shows a negative control. PCR Cloning Kit is designed for the quick cloning of PCR products without any headaches of restriction sites. The ® univeral CloneEZ® cloning method works with any insert and CloneEZ PCR
Recombination Cloning Kit PCR Cloning Product Overview: any vector at any restriction site. Using our proprietary vector in 30 minutes CloneEZ® enzyme, this kit rapidly generates precise, directional Product Quantity Cat. No. Price constructs in 30-minute at room temperature. PlantDirectTM Multiplex PCR Kit (without enzyme) 100 rxns L00200 $139 Transformation Direct PCR PlantDirectTM Multiplex PCR Kit (with enzyme) 100 rxns L00201 $159
For more information on Direct PCR Systems, visit http://www.genscript.com/direct_PCR.html
CloneEZ® PCR Cloning Kit can cut down PCR cloning procedure to 30 min from traditional 3.5 hours, with one-step procedure instead of multiple steps. PCR Related Products:
Classical Restriction disgestion Gel extraction Ligation Product Quantity Cat. No. Price Cloning (2-4h) (1h) (0.5-3h) Stabilized dNTP Mix, 10 mM each 0.5 ml C01689 $29 dNTP mixture, 10 mM each 0.5 ml D0056 $25 CloneEZ® One step by CloneEZ® Seamless in dATP (100 mM) >98% HPLC 1 ml C01577* $45 0.5h Cloning dGTP (100 mM) >98% HPLC 1 ml C01578* $45 dCTP (100 mM) >98% HPLC 1 ml C01579* $45 1h 2h 3h 4h 5h 6h 7h 8h dTTP (100 mM) >98% HPLC 1 ml C01580* $45 dNTP (25 mM) >98% HPLC 1 ml C01581* $45 Shown below is number and percentage of positive clones obtained with CloneEZ® PCR Cloning Kit. dNTP (10 mM) >98% HPLC 1 ml C01582* $45
*These products are also available in larger package sizes. 1 kb 2 kb 4 kb Number of positive clones ~1200 ~800 221 Recombinant rate (%) 100% 95% 93%
Your Innovation Partner in Drug Discovery! - 21 - www.genscript.com - 22 - siRNA Expression Vectors
Shown below is PCR screening result of positive clones obtained with the CloneEZ® PCR Cloning Kit. GenScript provides a complete set of vectors for the expression Some of the vectors carry a coral GFP (cGFP) marker for of siRNA. These vectors use U6 (regular or enhanced), H1 tracking transfection efficiency. To complete its siRNA vector set, (regular, inducible or enhanced) or CMV promoter to drive the GenScript also provides viral-based (Lenti, Retro, Adeno) siRNA expression. Each vector carries a neomycin,hygromycin, siRNA vectors for more effective delivery of siRNA into almost zeomycin or puromycin resistance gene as the selectable any mammalian cell, including non-dividing cells and whole marker, which can be used for establishing stable cell lines. model organisms. PCR and Cloning Plasmid siRNA Expression Vectors
Plasmid siRNA vectors are designed for mammalian transfection resistance gene as the selectable marker, which can be used Product Overview: and use U6 (regular or enhanced), H1 (regular or enhanced), or for establishing stable cell lines. The pRNAT vectors also carry CMV promoter** to drive the siRNA expression. These vectors a coral GFP (cGFP) marker, which can be used to track carry a neomycin, hygromycin, puromycin or zeomycin transfection efficiency.
PCR and Cloning Product Quantity Cat. No. Price CloneEZ® PCR Cloning Kit 24 rxns L00339 $175
For more information on PCR Cloning Kit, visit http://www.genscript.com/cloneez_PCR_Cloning_kit.html siRNA Expression Vectors
GenPoolTM ORF Clones ORF Clones TM
• Comprehensive selection—Over 1 million ORF clones and predesigned siRNA collections • Convenient—Delivered as the transfection-ready plasmid DNA
GenePool • Cost-efficient solution
GenScript’s GenPoolTM ORF clones database currently hosts 1,124,477 ORF clones from 90 different species and provides various convenient search options. Such ORF cloning provides easy and quick means to turn DNA sequences into expression-ready clones.
Customer can search and retrieve ORF information from GenPoolTM ORF clones database at http://www.genscript.com/genpool.html
ORF Clones Database 》
Search GenPoolTM ORF clones database (with GeneID, Accession No., or species name)
Go! Advanced search
For more information on GenPoolTM ORF clones, visit http://www.genscript.com/genpool.html
Your Innovation Partner in Drug Discovery! - 23 - www.genscript.com - 24 - Product Overview: Product Overview:
Product Promoter Resistance Marker Quantity Cat. No. Price Product Promoter Resistance Marker Quantity Cat. No. Price pRNA-U6.1/Neo U6.1 Neomycin - 10 μg SD1201 $225 pRNATin-H1.2/Neo H1.2 (inducible) Neomycin cGFP 10 μg SD1223 $350 pRNA-U6.1/Hygro U6.1 Hygromycin - 10 μg SD1202 $225 pRNATin-H1.2/Hygro H1.2 (inducible) Hygromycin cGFP 10 μg SD1224 $350 pRNA-U6.1/Zeo U6.1 Zeomycin - 10 μg SD1207 $225 pRNAin-H1.2/Neo H1.2 (inducible) Neomycin - 10 μg SD1220 $350 pRNA-H1.1/Neo H1.1 Neomycin - 10 μg SD1203 $225 pRNATin-H1.2/Adeno H1.2 (inducible) Kanamycin cGFP 10 μg SD1229 $350 pRNA-H1.1/Hygro H1.1 Hygromycin - 10 μg SD1204 $225 pRNAin-H1.2/Shuttle H1.2 (inducible) Neomycin - 10 μg SD1234 $350 pRNA-H1.1/Zeo H1.1 Zeomycin - 10 μg SD1208 $225 pRNATin-H1.4/Retro H1.4 (inducible) Hygromycin cGFP 10 μg SD1254 $350
pRNA-CMV3.1/Neo CMV3.1 Neomycin - 10 μg SD1231 $225 pRNATin-H1.4/Lenti H1.4 (inducible) Neomycin cGFP 10 μg SD1260 $350 PCR and Cloning pRNA-CMV3.1/Hygro CMV3.1 Hygromycin - 10 μg SD1232 $225 pRNA-CMV3.1/Puro CMV3.1 Puromycin - 10 μg SD1233 $225 pRNAT-U6.1/Neo U6.1 Neomycin cGFP 10 μg SD1211 $350 pRNAT-U6.1/Hygro U6.1 Hygromycin cGFP 10 μg SD1212 $350 Adenoviral siRNA Shuttle Vectors pRNAT-H1.1/Neo H1.1 Neomycin cGFP 10 μg SD1213 $350
PCR and Cloning pRNAT-H1.1/Hygro H1.1 Hygromycin cGFP 10 μg SD1214 $350 The following adenoviral shuttle vectors are compatible with the Clontech Adeno-X Expression system. They use U6 or H1 promoters pRNAT-CMV3.1/Neo CMV3.1 Neomycin cGFP 10 μg SD1261 $350 to drive siRNA expression. pRNAT-CMV3.1/Hygro CMV3.1 Hygromycin cGFP 10 μg SD1262 $350 pRNAT-CMV3.1/Puro CMV3.1 Puromycin cGFP 10 μg SD1263 $350 pRNAT-CMV3.2/Neo CMV3.2 Neomycin cGFP 10 μg SD1264 $350 siRNA Expression Vectors pRNAT-CMV3.2/Hygro CMV3.2 Hygromycin cGFP 10 μg SD1265 $350 pRNAT-CMV3.2/Puro CMV3.2 Puromycin cGFP 10 μg SD1266 $350 pRNA-U6.3/Neo U6.3 (enhanced) Neomycin - 10 μg SD1550 $225 pRNA-H1.3/Neo H1.3 (enhanced) Neomycin - 10 μg SD1552 $225 pRNAT-U6.3/Hygro U6.3 (enhanced) Hygromycin cGFP 10 μg SD1561 $350 pRNAT-H1.3/Hygro H1.3 (enhanced) Hygromycin cGFP 10 μg SD1563 $350 siRNA Expression Vectors siRNA Inducible siRNA Expression Vectors
The H1.2 promoter is an engineered inducible promoter* pRNATin-H1.2 is designed for mammalian transfection. They containing a tetracycline operator (TetO1). The tetracycline carry a neomycin or hygromycin resistance gene which can be operator itself has no effect on expression. When the used for establishing stable cell lines and a coral GFP (cGFP) tetracycline repressor (TetR) is present, it effectively binds the marker under CMV promoter** as a control to track the TetO1 and blocks the transcription. In the presence of transfection efficiency. The adenoviral, retroviral, and lentiviral Product Overview: tetracycline or doxycycline, the inducer binds TetR, causes the expression vectors are also available for this inducible system. TetR protein to release the TetO1 site, and derepresses the transcription from the H1 promoter. Product Promoter Resistance Marker Quantity Cat. No. Price pRNA-U6.1/Shuttle U6.1 Neomycin - 10 μg SD1205 $225 pRNA-H1.1/Shuttle H1.1 Neomycin - 10 μg SD1206 $225 pRNAT-H1.1/Shuttle H1.1 Neomycin cGFP 10 μg SD1216 $350 pRNAin-H1.2/Shuttle H1.2 (inducible) Neomycin - 10 μg SD1234 $350
Your Innovation Partner in Drug Discovery! - 25 - www.genscript.com - 26 - Product Overview:
The following adenoviral vectors are compatible with the Stratagene AdEasy Adenoviral Vector System. Each vector uses either an H1 Product Promoter Resistance Marker Quantity Cat. No. Price or inducible H1 promoter to drive siRNA expression. The pRNAT vectors carry a coral GFP marker (cGFP) under the control of CMV pRNAT-U6.2/Lenti U6.2 Neomycin cGFP 10 μg SD1259 $350 promoter*, which can be used to track transfection efficiency. pRNATin-H1.4/Lenti H1.4 (inducible) Neomycin cGFP 10 μg SD1260 $350
Retroviral siRNA Expression Vectors PCR and Cloning
GenScript’s Retroviral siRNA expression vectors are compatible hygromycin resistance gene under the control of a CMV with the Clontech Retro-X Expression System. The siRNA promoter* for establishing stable cell lines. The vector uses insert is cloned between the MluI and XhoI sites. An H1 MSV 3'LTR for viral transcription and a CMV enhancer/promoter promoter drives siRNA expression. The vector contains a joined to MSV 5'LTR (CMV/MSV 5'LTR) for packaging. PCR and Cloning siRNA Expression Vectors
Product Overview:
Product Promoter Resistance Marker Quantity Cat. No. Price pRNA-H1.1/Adeno H1.1 Kanamycin - 10 μg SD1209 $225 pRNAT-H1.1/Adeno H1.1 Kanamycin cGFP 10 μg SD1219 $350 pRNATin-H1.2/Adeno H1.2 (inducible) Kanamycin cGFP 10 μg SD1229 $350 siRNA Expression Vectors siRNA
Lentiviral siRNA Expression Vectors Product Overview: GenScript’s Lentiviral siRNA expression vectors are compatible reporter for tracking transfection efficiency. These are driven by with the Invitrogen ViraPowerTM Lentiviral Expression System. a SV40 promoter and a CMV promoter, respectively. The They are designed for siRNA expression in both dividing and vector uses a Rous sarcoma virus (RSV) enhancer/promoter Product Promoter Resistance Marker Quantity Cat. No. Price nondividing cells. Each vector contains a neomycin resistance fused to HIV 5'LTR (PRSV/5'LTR) for viral transcription and HIV pRNA-H1.1/Retro H1.1 Hygromycin - 10 μg SD1241 $225 gene for establishing stable cell lines and a coral GFP (cGFP) 3'LTR for packaging. pRNAT-H1.4/Retro H1.4 Hygromycin cGFP 10 μg SD1253 $350 pRNATin-H1.4/Retro H1.4 (inducible) Hygromycin cGFP 10 μg SD1254 $350
Your Innovation Partner in Drug Discovery! - 27 - www.genscript.com - 28 - siRNA Positive Controls cGFP (Coral Green Fluorescence Protein) siRNA Postive Control Vectors FireFly Luciferase siRNA Postive Control Vectors si-cGFP controls are siRNA constructs designed to knock down si-cGFP controls are easy to use and allow scientists to monitor the coral GFP (cGFP) expression. In our control experiments, the effects of siRNA by using a fluorescence microscope. The siFLuc controls are siRNA constructs designed to knock down The target sequence (CTTACGCTGAGTACTTCGA) is from the si-cGFP can knock down cGFP fluorescence by ~80%. si-cGFP insert has been cloned into pRNA-U6.1/neo and firefly luciferase. The siLuc insert has been cloned into siRNA reference Nat. Genet. 32: 107. The target sequence matches pRNA-H1.1/Neo vectors. Therefore, they can be used to test expression vectors and verified by sequencing. In our control pGL3-control (Promega, Cat. #E1741), and is designed to the effects of both U6 and H1 promoters. experiments, the siFluc controls can knock down firefly silence firefly luciferase expressed by a co-transfected luciferase activity by ~80%. pGL3-control vector. Product Overview: Product Overview: Product Promoter Resistance Marker Quantity Cat. No. Price PCR and Cloning pRNA-U6.1/Neo/sicGFP U6.1 Neomycin 10 μg SD1701 $225 Product Promoter Resistance Marker Quantity Cat. No. Price - pRNA-H1.1/Neo/sicGFP H1.1 Neomycin - 10 μg SD1702 $225 pRNA-U6.1/Neo/siFLuc U6.1 Neomycin - 10 μg SD1501 $225
pRNA-U6.1/Hygro/siFLuc U6.1 Hygromycin - 10 μg SD1502 $225 pRNA-H1.1/Neo/siFLuc H1.1 Neomycin - 10 μg SD1503 $225 pRNA-H1.1/Hygro/siFLuc H1.1 Hygromycin - 10 μg SD1504 $225 PCR and Cloning pRNA-CMV3.1/Neo/siFLuc CMV3.1 Neomycin - 10 μg SD1531 $225 siRNA Negative Controls pRNA-CMV3.1/Hygro/siFLuc CMV3.1 Hygromycin - 10 μg SD1532 $225 pRNAT-U6.1/Hygro/siFLuc U6.1 Hygromycin cGFP 10 μg SD1512 $225 For the negative control, you may use our online siRNA GenScript also provides a universal negative control. The sense scrambler tool to design a specific negative control for your sequence of this negative control is 21-mer in length, and its pRNA-U6.3/Neo/siFLuc U6.3 (enhanced) Neomycin - 10 μg SD1551 $225 target sequence. This is the specific negative control because it GC content is 48%. It shows no homology to human, mouse, pRNA-H1.3/Neo/siFLuc H1.3 (enhanced) Neomycin - 10 μg SD1553 $225 siRNA Expression Vectors has the same nucleotide composition as that of your target and rat mRNA sequences collected in NCBI RefSeq database. pRNAT-U6.3/Hygro/siFluc U6.3 (enhanced) Hygromycin cGFP 10 μg SD1565 $350 sequence. At the same time, it shows no homology to mRNA pRNAT-H1.3/Hygro/siFluc H1.3 (enhanced) Hygromycin cGFP 10 μg SD1566 $350 sequences collected in NCBI RefSeq database. pRNATin-H1.2/Neo/siFLuc H1.2 (inducible) Neomycin cGFP 10 μg SD1523 $225 pRNA-Luc/Neo CMV 3.1 Neomycin - 10 μg SD0226 $350 Product Overview:
Product Promoter Resistance Marker Quantity Cat. No. Price pRNA-U6.1/Neo/CTL U6.1 Neomycin - 10 μg SD1801 $225
siRNA Expression Vectors siRNA Renilla Luciferase siRNA Postive Control Vectors pRNA-H1.1/Neo/CTL H1.1 Neomycin - 10 μg SD1802 $225 siRLuc controls are siRNA constructs designed to knock The target sequence (GTAGCGCGGTGTATTATAC) is from pRNA-CMV3.1/Neo/CTL CMV3.1 Neomycin - 10 μg SD1831 $225 down Renilla luciferase. The siRLuc insert has been reference Nat. Biotechnol. 20: 497. The target sequence cloned into GenScript pRNA series vector and verified by matches pRL-TK (Promega, Cat. #E2241), and is designed Note: Empty vectors may not make good negative controls because they do not have proper termination signals downstream of their promoters. sequencing. In our control experiments, the siRLuc controls to silence Renilla luciferase expressed by a co-transfected can knock down Renilla luciferase activity by ~80%. pRL-TK vector. For more information on siRNA Expression Vectors, visit http://www.genscript.com/Vectors.html
Product Overview:
* Limited Use Label License: This H1.2 inducible promoter is covered by United States Patents Application No. 60,505,677, Product Promoter Resistance Marker Quantity Cat. No. Price owned by GenScript USA Inc. The purchase of this product conveys to the buyer the limited, non-exclusive, pRNA-U6.1/Neo/siRLuc U6.1 Neomycin - 10 μg SD1601 $225 non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the pRNA-U6.1/Hygro/siRLuc U6.1 Hygromycin - 10 μg SD1602 $225 siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction pRNA-H1.1/Neo/siRLuc H1.1 Neomycin - 10 μg SD1603 $225 with this product. pRNA-H1.1/Hygro/siRLuc H1.1 Hygromycin - 10 μg SD1604 $225 ** Limited Use Label License: The use of the CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed b1 the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.
Your Innovation Partner in Drug Discovery! - 29 - www.genscript.com -30 - Custom Molecular Biology Services Competitive Advantages
GenScript provides a comprehensive repertoire of molecular CloneEZ® seamless cloning technology is capable of placing Advanced Gene Design Algorithms (OptimumGeneTM) State-of-the-art Facilities biology services, ranging from gene cloning and any gene in any vector independent of restriction and ligation, GenScript's proprietary and gene design technologies can GenScript is equipped with advanced bioscience facilities with a characterization to advanced genetic engineering and mutant seamlessly. Our CloneArchTM clone storage and management significantly improve the expression level of target proteins. working area of about 20,000 square feet. libraries. We have delivered over 100,000 synthetic genes and system provides our customers with worry-free clone storage Our advanced optimization takes the entire mRNA structure constructs with the most complex and difficult traits through our and a portal to all molecular biology, simply one-click away. into consideration as opposed to traditional optimization Comprehensive Package Gene-on-Demand® de novo synthesis platform. Our proprietary methodologies which only consider the codon usage frequency We also offer mutagenesis, protein expression and purification, and the structure of mRNA partially. The patent-pending and plasmid preparation. Our full complements of upstream OptimumGeneTM Gene Design Technology can typically and downstream services provide our clients with a one-stop Genes of any length Gene-on-Demand® increase at least 10-fold of protein expression level in E. coli, source for all their laboratory needs. PCR and Cloning and complexity Gene Synthesis provided that the protein expression and purification methods are appropriate. Experienced Team We have synthesized more than 100,000 genes and constructs Gene up to 50,000 bp CloneEZ® Seamless Cloning Technology de novo. Our record length for gene synthesis is over 50,000 High GC content OptimumGeneTM CloneEZ® This new-generation, recombination-based cloning technology bp. We routinely synthesize long constructs (>10 kb), complex Repeat Sequence can accurately and efficiently assemble genes and gene genes, and genes with extremely high or low GC content, PCR and Cloning Codon Optimization Seamless Cloning fragments in any combination of sequences. repetitive sequences, and strong secondary structures.
Services List
Quotations and Ordering Custom Molecular Biology Services Gene Synthesis KI/KO Vector Construction GenScript's Gene-on-Demand® service offers synthesis of any Record-proven expertise and experience enables GenScript to Quotations and orders may be placed by email, phone, or fax with either a formal PO (Purchase Order) or credit card. Please choose gene. Our advanced OptimumGeneTM codon optimization efficiently and reliably deliver traditional (or conditional) KI/KO the most convenient ordering method. technology can optimize your gene sequence, allowing it to constructs and other types of custom vectors for genetic reach the highest possible level of gene expression and protein engineering. Typical turnaround time is less than four weeks. solubility. Our prices are 30% less expensive than those of our Quotation Form: https://www.genscript.com/ssl-bin/quote_gene_synthesis competitors. Vector-based siRNA and miRNA GenScript offers cost-efficient vector-based RNAi services Email: [email protected] Mutagenesis stand on their Tet-on and inducible expression vectors with our Mutagenesis is one economical alternative to de novo gene acclaimed 2nd generation design tools. Phone: 1-877-436-7274 (Toll-Free); 1-732-885-9188 synthesis. GenScript offers cost-effective mutagenesis as a
Custom Molecular Biology Services complement to its gene synthesis service package. Large-scale DNA Sequencing Fax: 1-732-210-0262; 1-732-885-5878 With years of experience, GenScript offers quick, high-quality, PCR Cloning and Subcloning and cost-effective DNA sequencing services. We perform all Secured Web Server: https://www.genscript.com/ssl-bin/secure_data GenScript provides PCR cloning and subcloning services. This sequencing services in a GLP-compliant laboratory environment. package is highly flexible and can be tailored to any specific set We have processed hundreds of thousands of samples, and of project requirements. Our recently developed CloneEZ® have the capacity to sequence thousands of samples per day. For more information on Molecular Biology Services, visit http://www.genscript.com/molecular_biology_service.html seamless cloning technology allows direct fusion of any DNA sequence in one 30-minute procedure. CloneArchTM Clone Storage and Management Center CloneArchTM is a worry-free clone storage and management Plasmid Preparation system. It prevents unnecessary clone loss, preserving Our services include industry-scale plamid production, batch precious time that can be reinvested in more productive tube aliquoting, and labeling, packaging, and step-by-step total biological research and drug development projects. QC management. GenScript currently offers SC Grade and Advanced SC Grade (Supercoiled content ≥ 95%, with enzyme-free and animal-free process) plasmids along with routine Research Grade plasmid production to satisfy customers’ variable needs.
Mutant Libraries (Protein Engineering) GenScript's strong expertise in de novo gene synthesis allows us to synthesize complex protein libraries without any dramatic increase in cost. Our mutant library services include site-directed mutagenesis libraries, sequential permutation scanning libraries, and randomized and degenerated libraries.
Your Innovation Partner in Drug Discovery! - 31 - www.genscript.com - 32 - Product List
Product Quantity Cat. No. Price Product Quantity Cat. No. Price Green Taq DNA Polymerase 1,000 U E00043 $60 SD1258 Reverse 500 pmol DA0028 $30 High-Stability PCR Kit 200 rxns L00342 $64 SD0122 Reverse 500 pmol DA0029 $30 1,000 U E00007 $60 SD0123 Forward 500 pmol DA0030 $30 Taq DNA Polymerase 50,000 U E00044 $2,700 SD1563 Forward 500 pmol DA0032 $30 Taq DNA Polymerase without Mg2+ 1,000 U E00008 $60 Taq DNA Polymerase, concentrated 2,500 U E00012 $149 Taq and dNTP: 1,000 U of Taq (E00007); 0.5 ml of 1 Kit E00101 $79 PCR and Cloning 10 mM dNTP (D0056) 2X Taq Master Mix 100 Rxns E00019 $43 TissueDirectTM DNA Multiplex PCR Kit (without enzyme) 100 Rxns L00194 $113 TissueDirectTM DNA Multiplex PCR Kit (with enzyme) 100 Rxns L00195 $159 BloodReadyTM DNA Multiplex PCR Kit (without enzyme) 100 Rxns L00196 $111 BloodReadyTM DNA Multiplex PCR Kit (with enzyme) 100 Rxns L00197 $157
PCR and Cloning PlantDirectTM DNA Multiplex PCR Kit (without enzyme) 100 Rxns L00200 $139 PlantDirectTM DNA Multiplex PCR Kit (with enzyme) 100 Rxns L00201 $159 BacReadyTM DNA Multiplex PCR Kit (without enzyme) 100 Rxns L00202 $111 BacReadyTM DNA Multiplex PCR Kit (with enzyme) 100 Rxns L00203 $157 CloneEZ® PCR Cloning Kit L00339
24 rxns $175 Product List Stabilized dNTP Mix, 10 mM each 0.5 ml C01689 $29 dNTP mixture, 10 mM each 0.5 ml D0056 $25 dATP (100 mM) >98% HPLC 1 ml C01577* $45
Product List dGTP (100 mM) >98% HPLC 1 ml C01578* $45 dCTP (100 mM) >98% HPLC 1 ml C01579* $45 dTTP (100 mM) >98% HPLC 1 ml C01580* $45 dNTP (25 mM) >98% HPLC 1 ml C01581* $45 dNTP (10 mM) >98% HPLC 1 ml C01582* $45 pUC57 Forward 500 pmol DA0001 $30 pUC57 Reverse 500 pmol DA0002 $30 M13 Forward (-20) 500 pmol DA0003 $30 M13 Forward (-41) 500 pmol DA0004 $30 M13 Reverse (-27) 500 pmol DA0005 $30 M13 Reverse (-48) 500 pmol DA0006 $30 BGH Reverse 500 pmol DA0007 $30 SP6 500 pmol DA0008 $30 T7 500 pmol DA0009 $30 T7 Terminator 500 pmol DA0010 $30 pRNA-U6 Forward 500 pmol DA0011 $30 pRNA Reverse 500 pmol DA0012 $30 pRNA-H1 Forward 500 pmol DA0013 $30 pShuttle-H1.1 Reverse 500 pmol DA0014 $30 pAdTrack-H1.1 Forward 500 pmol DA0015 $30 pAdTrack-H1.1 Reverse 500 pmol DA0016 $30 T3 promoter 500 pmol DA0018 $30 pET 5' (T7) 500 pmol DA0019 $30 pET 3' 500 pmol DA0020 $30 pGEX 5' 500 pmol DA0021 $30 pGEX 3' 500 pmol DA0022 $30 pRNA-CMV Forward 500 pmol DA0023 $30 pRNA-H1.3 Forward 500 pmol DA0024 $30 SD1241 Forward 500 pmol DA0025 $30 SD1255 Forward 500 pmol DA0026 $30 SD1258 Forward 500 pmol DA0027 $30
*These products are also available in larger package sizes.
Your Innovation Partner in Drug Discovery! - 33 - www.genscript.com - 34 - Chapter 3 Protein Analysis
Protein Expression 37 Protein Isolation and Purification 39 Protein Electrophoresis 43 Endotoxin Detection and Removal System 47 Protein Detection and Immunoassay 49 Related Reagents for Protein Analysis 61 Catalog Proteins 65 Custom Protein Services 71 Overview pGen2.1 Vector pGS-21a Vector
Active and purified proteins play crucial roles in nearly all broad spectrum of protein products, including protein expression pGen2.1 is a human cytomegalovirus (CMV) promoter-based The pGS-21a vector is designed for cloning, high-level biological processes, especially effect in the fields of functional vectors, protein isolation & purification resins and magnetic mammalian gene expression vector. CMV promotor is one of expression and convenient purification of proteins fused with and structural analysis, assay development, and drug candidate beads, ExpressTM PAGE gels, protein markers, eStainTM Protein the strongest promoters described. A target gene can be both 6xHis and GST. Two 6xHis sequences are introduced into discovery. With GenScript’s expertise and years of experience, Staining System, ONE-HOUR WesternTM detection kits, and a conveniently cloned into pGen2.1 vector at the multiple cloning the vector for easy detection and purification of fused proteins. you will have a trusted and committed provider, who offers a wide selection of catalog proteins. site (MCS). The target protein is expressed with a flag tag at The first 6xHis is fused to GST and the fused tag 6xHis-GST direct path to your successful protein research projects with the N-terminal. This vector also contains a selectable marker can be cleaved using enterokinase. The second 6xHis is used for mammalian cells, neomycin phosphotransferase gene, for detection and further purification after the cleavage of under SV40 promoter. pGen2.1 vector is used for either transient 6xHis-GST. expression or stable expression in the presence of the antibiotic Protein Expression G418.
Protein Expression Vectors
GenScript offers four unique expression vectors with enhanced promoters for efficient expression, selection, and analysis of Protein Analysis recombinant proteins.
pDream 2.1/MCS Expression Vector pDream 2.1-cGFP Expression Vector Protein Analysis Protein pDream 2.1/MCS is a widely used expression vector, which has pDream2.1-cGFP vector is a positive control vector. cGFP seven restriction enzyme sites in MCS. The gene that is cloned gene that is cloned into pDream2.1/Neo can be expressed into MCS can be expressed in three major protein expression directly without any further cloning work in three major protein systems: bacteria, insect cells, and mammalian cells. expression systems: bacteria, insect cells, and mammalian
cells. Protein Expression
Product Overview:
Protein Expression Product Quantity Cat. No. Price pDream2.1/MCS 10 μg SD0222 $150 pDream2.1-cGFP 10 μg SD0220 $250 pGen2.1 10 μg SD0122 $175 pGS-21a 10 μg SD0121 $140
For more information on protein expression vectors, visit http://www.genscript.com/Vectors.html
Flag Tag BamH I 1804 TAT ACC ATG GAT TAC AAG GAT GAC GAC GAT AAG GGA TCC 1778 ATC Met Asp Tyr Lys Asp Asp Asp Asp Lys Gly Ser TAG ATA TGG TAC CTA ATG TTC CTA CTG CTG CTA TTC CCT AGG
Bgl II EcoR I Kpn I Sac I Hind III Not I 1843 GAG ATC TGG AAT TCG GTA CCG AGC TCA AGC TTG CGG CCG CTC TAG ACC TTA AGC CAT GGC TCG AGT TCG AAC GCC GGC Glu Ile Trp Asn Ser Val Pro Ser Ser Ser Leu Arg Pro ATG GCC AG...TAC AAG TGA SP6 Primer TAC CGG TC...ATG TTC ACT 1882 CCTATAGTGTCACCTAAATCGTAACCCAGC Met Ala Tyr Lys ... SP6 Primer Sequence GGATATCACAGTGGATTTAGCATTGGGTCG
Your Innovation Partner in Drug Discovery! - 37 - www.genscript.com - 38 - Easy Self-Induction Medium
• Higher yield than IPTG induction systems Higher protein yield achieved with the Easy Self-Induction SDS-PAGE analysis of protein purified by Hight-Affinity SDS-PAGE analysis of protein purified by Ultra Protein A • No tedious O.D. monitoring and induction steps Medium GST Resin (L00206) Resin (L00400) • Ideal for T7-regulated E. coli expression systems kD 100 GenScript's Easy Self-Induction Medium facilitates high-yield 1 2 3 4 75 kD 1 2 3 4 5 6 7 expression of recombinant proteins in T7-regulated E. coli 100 expression systems without IPTG induction. Using this 75 medium, researchers have no need to monitor cell optical 50 density (OD) or to optimize IPTG induction conditions. 50 Furthermore, the protein yield is typically three times higher than that obtained by traditional LB-IPTG methods. Supplied as 35 a pre-sterilized and ready-to-use liquid, the Easy Self-Induction 25 35 Medium requires no other supplements beside antibodies. 25 1 2 3 4 5 6
Lane 1: NC, un-induced protein Protein Analysis Lane 2: Protein induction with LB + IPTG 15 Lane 3: Purified protein from LB + IPTG Lane 4: Protein induction with Easy Self-Induction Medium Lane 5: Purified Protein from Easy Self-Induction Medium Lane 6: Smart Protein Standard (GenScript, MM0900) Lane 1: Whole proteins were passed through high-affinity GST-resin Lane 1: Smart Middle-Range Protein Standard (Genscript, MM0900) Product Overview: (GenScript, L00206). Lane 2-4: Protein A Resin (GenScript, L00400) Lane 2: Flow through Lane 2: Flow through Lane 3: Wash Lane 4: Elution Protein Analysis Protein Lane 3: Wash Lane 5-7: Protein A Resin (Competitor X) Product Quantity Cat. No. Price Lane 4: Elution Lane 5: Flow through Lane 6: Wash Lane 7: Elution Easy Self-Induction Medium 500 ml M00104 $29
For more information on protein expression reagents, visit http://www.genscript.com/Protein_Expression_Reagents.html
Product Overview: Protein Isolation and Purification
Product Quantity Cat. No. Price HIgh-Affinity GST Resin 10 ml L00206 $98 Protein Isolation and Purification Protein A Resin 5 ml L00210 $98 Ultra Protein A Resin 5 ml L00400 $249 Protein G Resin 5 ml L00209 $129 Protein Purification Resins Protein L Resin 5 ml L00239 $129 IminoBiotin Resin 5 ml L00272 $118 • Quick and convenient separation SDS-PAGE analysis of protein purified by Protein A Resin Streptavidin Resin 5 ml L00353 $139
Protein Isolation and Purification • Minimum cross-contamination (L00210) High Affinity Ni-Charged Resin 10 ml L00223 $80 • High binding capacity L00405 $169 1 2 3 4 5 6 7 Goat Anti-Chicken IgY Precipitating Resin 1 ml • Reusable at least six times High-Affinity Iodoacetyl Resin 10 ml L00403 $150 KD 100 For more information on protein purification resins, visit http://www.genscript.com/protein_purification_resins.html GenScript provides a series of protein purification resins that 75 allow efficient and reliable purification of target proteins and antibodies from biological samples, including cell lysates and 50 culture supernatants. These resins are covalently cross-linked 35 or coated with Protein A, Protein G, Protein L, antibodies, Ni2+, biotin, or glutathione. Resin-based purification methods 25 significantly have lowered the possibility of cross-contamination and loss of proteins associated with centrifugation or gravity 15 precipitation methods. Protein resins purification is also less labor-intensive and time-consuming. SDS-PAGE analysis of antibody purification using Protein A Resin Lane 1-3: Protein A Resin (Corporation X)
Lane 1: Flow through Lane 2: Wash Lane 3: Elution Lane 4-6: Protein A Resin (GenScript, L00210) Lane 4: Flow through Lane 5: Wash Lane 6: Elution Lane 7: Smart Middle-Range Protein Standard (Genscript, MM0900)
Your Innovation Partner in Drug Discovery! - 39 - www.genscript.com - 40 - Magnetic Beads for Protein Isolation Product Overview: Magnetic separation of protein and protein complexes Product Quantity Cat. No. Price GenScript Magbeads Protein A MagBeads 1 ml L00273 $89 • Quick and convenient separation Add sample Protein G MagBeads 0.5 ml L00274 $125 • High capacity with antibody Add sample with antibody and target protein complex • Minimum nonspecific binding Protein A/G MagBeads 0.5 ml L00277 $148 • Reusable up to six times Add sample with Goat Anti-Rabbit IgG MagBeads 1 ml L00328 $159 target protein Donkey Anti-Goat IgG MagBeads 0.5 ml L00332 $159 GenScript provides a series of magnetic beads that efficiently GST MagBeads 2 ml L00327 $108
and reliably purify target recombinant proteins and antibodies Wash and Mouse Anti-GST mAb MagBeads 0.5 ml L00336 $159 elute Add 1xSDS PAGE from any type of cell lysates. Monosized, maganetic beads with loading buffer and Anti-His mAb MagBeads 0.5 ml L00275 $197 heat to 100°C Protein A, or Protein G, or a specific antibody coupled to their Mouse Anti-Trx mAb MagBeads 0.5 ml L00337 $159 surface provide a suspendable solid support for Ni-Charged Magnetic Beads 2 ml L00295 $98 immunoprecipitation of pure target proteins. The captured 2-Tube Magnetic Separation Racks 1 rack M00112 $29 immune complexes are easily removed from the supernatant by Multifunctional Magnetic Separation Rack 1 rack M00140 $99 magnetic separation. Magnetic separation technology allows Isolate pure for simple and efficient washing. The pure precipitate can then antibodies
be eluted from the beads and analyzed by western blotting or For more information on magnetic beads for protein isolation, visit http://www.genscript.com/Magnetic_beads_products.html Protein Analysis mass spectrometry. Seperate supernanant with target protein
Easy BacLysis Protein Extraction Solution
Protein Analysis Protein • Easy-to-use, single solution format in just 20-min SDS-PAGE analysis and Coomassie blue staining of • Rapid cell lysis of recombinant E. coli extracted soluble proteins from E. coli with Easy BacLysis Choose MagBeads for your immunoprecipitation or protein isolation application • Compatible with small- and large-scale protein extraction Protein Extraction Solution (GenScript, L00230) • Suitable for soluble and insoluble protein extraction Application Product Technology Binding Capacity Cat.No. Easy BacLysis Protein Quantity M
Extraction Solution Protein Isolation and Purification Mammalian IgGs capture through >10 mg Porcine IgG/ml Protein extraction reagents are used for the initial purification Competitor A Protein A MagBeads 1 ml L00273 the Fc regions with Protein A beads and preparation of proteins from any tissues and cells. The 1 2 3 4 5 6 7 8 9 Mammalian IgGs capture through Easy BacLysis Protein Extraction Solution facilitates the removal SSPPSPP S the Fc regions with Protein G, but of soluble proteins from E. coli by gently disrupting the bacterial Protein G MagBeads Unlike protein A, protein G > 10 mg Goat IgG/ml 0.5 ml L00274 cell wall. This precisely formulated product provides a simple, Immunoglobulin MagBeads does not bind to human beads speedy, low-cost alternative to mechanical methods such as isolation IgM, IgD and IgA. French Press or sonication. The proprietary formulation Has a much broader binding range employs a mixture of non-ionic detergents that perforate the cell > 10 mg Goat or Protein A/G MagBeads than either Protein A or Protein G 0.5 ml L00277 wall without denaturing soluble protein. Porcine IgG/ml beads individually. Goat Anti-Rabbit IgG Rabbit IgG capture through Goat 50-100 μg Rabbit
Protein Isolation and Purification 0.5 ml L00328 MagBeads anti-rabbit IgG IgG /ml beads S: Supernatent P: Pellet Donkey Anti-Goat IgG Goat IgG capture through 150-200 μg Goat 0.5 ml L00332 MagBeads Donkey anti-Goat IgG IgG /ml beads 1.5 ml cultures of E. coli strain BL21 (DE3) containing pET-28a Isolation and enrichment Poly-histidine tagged fusion protein encoding target protein were harvested by centrifugation and > 150 μg His-tagged of polyhistidine-tagged Anti-His mAb MagBeads capture through anti-His monoclonal 0.5 ml L00275 resuspended in 300 μl competitor A protein extraction reagent or protein/ml beads protein or protein complex antibody Easy BacLysis Protein Extraction Solution. Samples in lysis reagent were treated according to their respective protocols. Extracts were in immunoprecipitation Poly-histidine tagged fusion protein 5 - 20 mg of His-tagged Ni-Charged MagBeads 2 ml L00295 clarified by centrifugation, then supernatants were removed and (IP) capture through nickel ion protein/ml beads insoluble fractions were resuspended in 300 μl distilled water. The Mouse Anti-GST mAb GST-fusion protein capture through 50-100 μg GST Immunoprecipitation (IP) 0.5 ml L00336 supernatant and insoluble fractions were analyzed by SDS-PAGE MagBeads anti-GST monoclonal antibody Protein/ml beads and GST or GST fusion and coomassie blue staining GST-fusion protein capture through 5 - 10 mg of GST/ml protein isolation GST MagBeads 2 ml L00327 Product Overview: reduced glutathione beads Immunoprecipitation (IP) Trx-fusion protein capture through Mouse Anti-Trx mAb > 50 μg Trx-fusion Product Quantity Cat. No. Price and Trx-fusion Mouse anti-Thioredoxin (TRX) 0.5 ml L00337 MagBeads Protein/ml beads Easy BacLysis Protein Extraction Solution 500 ml L00230 $148 protein isolation monoclonal antibody Easy BacLysis Protein Extraction Solution 1 Kit L00240 $228 with Hercules Endonuclease
For more information on protein extraction solution, visit http://www.genscript.com/protein_extraction_reagents.html
Your Innovation Partner in Drug Discovery! - 41 - www.genscript.com - 42 - Protein Purification Kits
• High binding capacity GenScript Company X Proteins ranging from 6.5 kDa to 205 kDa would be % Acrylamide resolved best on 4-20% ExpressTM PAGE gels as following • Minimal loss of antigen protein 200 M 1 2 3 4 performance: 150 8% 10% 12% 4-20% 8-16% Protein Purification Kits contain high-affinity resins and all the necessary buffers need to facilitate proteins or antibodies 100 Anti-His-tag IgG 1 2 3 4 5 6 7 8 9 10 75 purification. Protein Expression and Purification Kit also 205 kDa 2056 kDa 2056 kDa 2056 kDa 2056 kDa contains pGS-21a vector for easy cloning, high-level expression Serum albumin and convenient purification of proteins fused with both 6xHis tag 50 116 kDa 116 kDa 116 kDa 116 kDa and GST tag. 35 116 kDa 67 kDa 25 67 kDa 67 kDa 67 kDa 67 kDa 15 45 kDa 45 kDa 45 kDa 45 kDa SDS-PAGE analysis of Anti-His-tag IgG purified by Iodoacetyl Resin 29 kDa 29 kDa from GenScript and Company X. A peptide containing His-tag was 20 kDa Protein Analysis coupled to the resin from GenScript and Company X , respectively. 45 kDa 21 kDa The flow through and the elution fractions were analyzed. Three kinds of protein standards were run electrophoresis at 140 24 kDa volts for 45 minutes and semi-dry transferred at 20 volts for 30 M: Smart Broad-Range Protein Standard (GenScript, MM0906) 14.2 kDa 6.5 kDa minutes. Lane 1: Flow through (GenScript) Lane 2: Elution (GenScript) 14.2 kDa Lane1, 2, 3, 10: Smart Broad-Range Protein Standard (GenScript, Lane 3: Flow through (Company X ) Lane 4: Elution (Company X ) MM0906) Product Overview: Lane4, 5, 6: Smart Middle-Range Protein Standard (GenScript, Protein Analysis Protein MM0900) Product Quantity Cat. No. Price Lane7, 8, 9: EasyWestern Protein Standard (GenScript, MM0908) Protein Expression and Purification Kit 1 Kit L00208 $235 Product Overview: GST Fusion Protein Purification Kit 1 Kit L00207 $139 High-Affinity Antibody Purification Kit 1 Kit L00404 $139 Product Separation Range Volumn Quantity Cat. No. Price Protein Electrophoresis ExpressTM PAGE gels (4 -20%), 10 Wells 205 - 6.5 kDa 50 μl 1 Box of 10 MG420W10 $68 For more information on protein purification kits, visit http://www.genscript.com/protein_purification_resins.html ExpressTM PAGE gels (4 -20%), 12 Wells 205 - 6.5 kDa 30 μl 1 Box of 10 MG420W12 $68 ExpressTM PAGE gels (4 -20%), 15 Wells 205 - 6.5 kDa 25 μl 1 Box of 10 MG420W15 $68 ExpressTM PAGE gels (8 -16%), 10 Wells 205 - 14 kDa 50 μl 1 Box of 10 MG816W10 $68 ExpressTM PAGE gels (8 -16%), 12 Wells 205 - 14 kDa 30 μl 1 Box of 10 MG816W12 $68 Protein Electrophoresis ExpressTM PAGE gels (8 -16%), 15 Wells 205 - 14 kDa 25 μl 1 Box of 10 MG816W15 $68 TM
Protein Electrophoresis Express PAGE gels (12%), 10 Wells 205 - 14 kDa 50 μl 1 Box of 10 MG012W10 $68 ExpressTM PAGE gels (12%), 12 Wells 205 - 14 kDa 30 μl 1 Box of 10 MG012W12 $68 Electrophoresis is a rapid, simple, and highly sensitive tool of provides high-quality products and reagents for protein ExpressTM PAGE gels (12%), 15 Wells 205 - 14 kDa 25 μl 1 Box of 10 MG012W15 $68 proteins analysis. The separation of denatured protein bound electrophoresis, which include a full range of ExpressTM PAGE TM with SDS with negative charges by electrophoresis is based on gels and most accurate pre-stained and unstained protein Express PAGE gels (10%), 10 Wells 205 - 24 kDa 50 μl 1 Box of 10 MG010W10 $68 TM the fact that molecules with different weights will migrate through standards. The widespread use of PAGE gels and protein Express PAGE gels (10%), 12 Wells 205 - 24 kDa 30 μl 1 Box of 10 MG010W12 $68 a gel matrix upon application of an electric filed. GenScript standards ensures you to achieve reliable separation results. ExpressTM PAGE gels (10%), 15 Wells 205 - 24 kDa 25 μl 1 Box of 10 MG010W15 $68 ExpressTM PAGE gels (8%), 10 Wells 205 - 45 kDa 50 μl 1 Box of 10 MG008W10 $68 ExpressTM PAGE gels (8%), 12 Wells 205 - 45 kDa 30 μl 1 Box of 10 MG008W12 $68 ExpressTM PAGE gels (8%), 15 Wells 205 - 45 kDa 25 μl 1 Box of 10 MG008W15 $68 TM Express PAGE Gel System 5X Sample Buffer - - 5 ml MB01015 $25 Express Gel Running Buffer Powder - - 1 Box (5/PK) M00138* $38 High-performance and high-quality precast protein gels Transfer Bufffer Powder - - 1 Box (10/PK) M00139* $58
• Superior protein band resolution time. In addition, proteins transfer from ExpressTM PAGE gels is *To make 1000 ml 1X Running Buffer or Transfer Bufffer per package • Fast sample running time (45 min or less) more efficient, leading to more sample on your membrane for • High protein transfer efficiency higher detection signals during western analysis. For more information on ExpressTM PAGE gel system, visit http://www.genscript.com/express_page_gels.html • Long shelf life (Up to 12 months at 4°C) The protein migration table as below can help you to choose The ExpressTM PAGE Gel System is a high-performance the appropriate gels for your protein samples. You’re sure to precast polyacrylamide gel system with a variety of acrylamide find one that meets your electrophoresis needs. The data of percentages. With GenScript proprietary technology, ExpressTM this table is from gels run at 140 volts for 45 min. At 140 volts, PAGE gels are designed as an easy-to-use tool. The unique the Bromophenol Blue band will reach the bottom of the gels in gel formulations eliminate the “smiles” and poor resolution of about 30 min. other gel types. You’ll produce reliable separation results every
Your Innovation Partner in Drug Discovery! - 43 - www.genscript.com - 44 - Pre-Stained and Unstained Protein Standards
Monitoring molecular weight separation during electrophoresis Smart Pre-Stained EasyWestern Middle-Range Protein Standard Protein Standard • Sharp Bands—Clearer estimation of MW The Pre-Stained Protein Standards consist of color bands for • Broad Molecular Weight Range (6 kDa to 220 kDa) easy identification and allow you to monitor molecular weight • Easy Identification—Ladder-like band separation. separation during electrophoresis. The Unstained Protein 110 kD
Standards provide bands that are unmodified by the presence 80 kD 120 kD Protein molecular weight standards are used to estimate of dye, for accurate molecular weight estimation of gel 65 kD sample molecular weights, monitor the progress of an electrophoresis. Available in convenient package sizes, all 85 kD electrophoresis run, and serve as a positive control for the standards have undergone stringent QC to assure consistent 40 kD 60 kD electrophoresis and Western applications. GenScript offers a performance to provide the sharper bander in the broader wide selection of pre-stained and unstained protein standards. molecular weight range available. 40 kD 20 kD
10 kD 22 kD
Smart Broad-Range Smart Middle-Range Smart His-Tagged Protein Analysis Protein Standard Protein Standard Protein Standard 4-20% gradient SDS-PAGE gel. The Smart EasyWestern Protein Standard is a mixture of five highly Pre-Stained Middle-Range Protein Standard is a purified recombinant proteins ranging in size from 22 to 220 kD 100 kD 100 kD mixture of six highly purified recombinant 120 kD. During Western blotting, it binds to constant 150 kD 75 kD proteins ranging in size from 10 to 110 kD, chains of primary and secondary antibodies, enabling the 75 kD 100 kD covalently coupled to blue and red dyes. direct visualization of the standard. The EasyWestern 50 kD 75 kD Protein Standard can bind IgGs from human, mouse, rat,
Protein Analysis Protein 50 kD sheep, goat, and rabbit. However, it is not stained when 32 kD 50 kD protein A- or protein G-based detection methods are 32 kD 25 kD used. 32 kD 25 kD Product Overview: 25 kD Protein Electrophoresis 15 kD Product Quantity Cat. No. Price 15 kD Smart Broad-Range Protein Standard 100 Lanes MM0906 $58 15 kD Smart Middle-Range Protein Standard 100 Lanes MM0900 $49 6 kD Smart His-tagged Protein Standard 100 Lanes MM0904 $98 Smart Pre-Stained Middle-Range Protein Standard 100 Lanes MM0905 $95 4-20% gradient SDS-PAGE gel, The Smart Middle-Range Protein Smart His-Tagged Protein Standard EasyWestern Protein Standard 100 Lanes MM0908 $68 Coomassie stating. Smart Standard is a mixture of six highly detected with THETM His-tag antibody High Range EasyWestern Protein Standard 100 Lanes M00276 $68 Broad-Range Protein Standard purified recombinant proteins (GenScript, A00186) and Goat Protein Electrophoresis Protein Marker for Fluorescent Western Blotting 100 Lanes M00124 $98 shows nine bands ranging in size ranging in size from 15 to 100 kD . Anti-Mouse IgG [HRP] (GenScript, from 6 to 220 kD. A00160) (4-25% Tris-glycine gradient gel, PVDF membrane, For more information on Pre-Stained and Unstained Protein Standards, visit http://www.genscript.com/protein_markers.html chemiluminenscent substrate).
Your Innovation Partner in Drug Discovery! - 45 - www.genscript.com - 46 - Endotoxin Detection and Removal System
Edotoxin-free world coming with GenScript 1. Sample: Protein A, 1 mg/ml in PBS, pH 7.4. It is purified from E. coli sonicate by Ni-NTA Resin. Endotoxin test is the most critical quality control test required GenScript is a leading company to provide innovative techniques 2. Dilution by LAL Water: 1: 200,000, 1: 400,000, 1: 800,000 by FDA for all drugs in the final formulation. Because endotoxins for endotoxin detection and removal. The ToxinSensorTM 3. The test is performed as described above and the assay result is: in vitro are invariably associated with every gram-negative bacteria, they Endotoxin Assay Kits are designed to detect endotoxin Positive Control Negative Control 1: 200,000 1: 400,000 1: 800, 000 cause severe reactions in humans and animals and retain high levels in a broad range of 0.005 - 1 EU/ml for human and animal + - + - - toxic activity even at low concentration. In addition, endotoxins parenteral drugs and biological samples. The ToxinEraserTM are suspected to play an important role in the occurrence and Endotoxin Removal Kit provides higher removal efficiency in 4. Endotoxin concentration in the sample is: from 200,000×0.25 to 400,000×0.25, that is, from 50,000 to 100,000 EU/ml. development of many different diseases. which endotoxin level can drop below 0.1 EU/ml. Product Overview:
Product Quantity Cat. No. Price ToxinSensorTM Gel Clot Endotoxin Assay Kit 1 Kit L00351 $90 ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit
• Superior linearity and reproducibility Draw a best-fit straight line among these points and
TM Protein Analysis • High sensitivity and board application range determine endotoxin concentrations of samples graphically. ToxinEraser Endotoxin Removal System • Ready-to-use reagents and materials The Effect of pH on Removal Efficiency • High binding capacity (>2,000,000 EU/ml ) TM ToxinSensor Chromogenic LAL Endotoxin Assay Kit is • Superior removal efficiency designed as a quantitative in vitro end-point endotoxin test for • Reusable up to five times human and animal parenteral drugs, biological products, and
TM Protein Analysis Protein medical devices. This method utilizes a modified Limulus GenScript’s ToxinEraser Endotoxin Removal System includes Amebocyte Lysate (LAL) and a synthetic color producing Endotoxin Removal Kit, ToxinEraserTM Endotoxin Removal substrate to detect endotoxin chromogenically in a broad range Resin, and ToxinEraserTM buffers. The system is based on the of 0.005 - 1 EU/ml. The procedures described in manual herein affinity matrix of modified polymyxin B (PMB), which allows conform to those described in the FDA guideline. highly efficient endotoxin removal. The final endotoxin level can
drop below 0.1 EU/ml after repeated use of resin. Endotoxin Detection and Removal System Under the standard conditions, the absorbance at 545 nm is linear in the concentration range of 0.005 to 0.1 or 0.1 to 100 1 EU/ml endotoxin. Plot the mean absorbance for the four Endotoxin removal can be performed in solution from pH 5-10 but the 95 standards on the x-axis, the corresponding endotoxin highest removal efficiency occurs at pH 7-8. The removal efficiency concentration in EU/ml on the y-axis. 90 decreases with the deviation from neutral pH. 85 Product Overview: 80 75
Product Quantity Cat. No. Price Removal Efficiency (%) ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit 1 Kit L00350 $125 70 0.1 1 10 100 1000 10000 1E+05 1E+06 Endotoxin Concentration (EU/ml)
Endotoxin Detection and Removal System TM Endotoxin removal efficiency is highly affected by and directly ToxinSensor Gel Clot Endotoxin Assay Kit proportional to endotoxin concentration
TM in vitro ToxinSensor Gel Clot Endotoxin Assay Kit is used for end-product endotoxin test for human and animal Product Overview: qualitative test for gram-negative bacterial endotoxin. Limulus parenteral drugs, biological products, and medical devices. The Amebocyte Lysate as supplied is to be reconstituted with LAL procedures described in manual conform to those described in Product Quantity Cat. No. Price reagent water and then mixed in equal parts with the solution the FDA Guideline. Similar performance requirements for gel TM being tested. After incubation, gelation occurs in the presence clot assays have been published and are updated regularly in ToxinEraser Endotoxin Removal Kit 1 Kit L00338 $110 TM of endotoxin and does not occur in the absence of endotoxin. the United States Pharmacopeia. ToxinEraser Endotoxin Removal Resin 1 ml L00402 $60 TM ToxinSensorTM Gel Clot Endotoxin Assay Kit is designed as an ToxinEraser Regeneration Buffer 125 ml M01053 $25 ToxinEraserTM Equilibration Buffer 125 ml M01054 $25
For more information on endotoxin detection and removal system, visit http://www.genscript.com/endotoxin_detection_and_removal_system.html
Your Innovation Partner in Drug Discovery! - 47 - www.genscript.com - 48 - Protein Detection and Immunoassay
TM How eStainTM Protein Staining System Works eStain Protein Staining System The high electric force generated between graphite anode and stain the proteins and the free staining reagents out of the gel titanium cathode of the eStainTM Device drives negatively matrix to destain the gel. Revolutionary electric staining system for 7-min protein gel staining charged Coomassie Blue dye reagents into the gel matrix to
• Faster—Complete protein staining in 7 minutes or less Titanium Cathode 2e- + 2H O H + 2OH- • Easier—Hit button and run 2 2 • Cleaner—No buffer prepared • Safer—Unique formulation without methanol E E E The eStainTM Protein Staining System is designed to quickly The eStainTM Protein Staining System is compatible with a wide E eStainTM Cathode Pad and reliably perform protein staining with Coomassie Blue dye range of polyacrylamide gels, including ExpressTM PAGE, TM CBB reagents in 7 minutes or less. It consists of the eStain Bis-Tris, Tris-Acetate, Tris-Glycine, and Tris-Tricine gels. CBB CBB dye dye dye Protein Staining Device and eStainTM Protein Staining Pad. In addition to ease and convenience, the eStainTM Protein TM The eStain Protein Staining System integrates three steps of Staining System provides as high detection sensitivity as Pre-run gel conventional Coomassie Blue staining procedure into one step conventional Coomassie Blue staining method. In the end,
CBB Protein Analysis and greatly cuts down the time required for protein staining you’ll see sharp protein bands with clear background. CBB CBB dye dye dye analysis, thereby resulting in consistent performance. eStainTM Anode Pad
Protein Analysis Protein Graphite Anode TM 4OH- - 4e- O + 2H O The eStain Protein Staining System take less time than the Coomassie blue staining products from other manufacturers 2 2
Conventional SimplyBlueTM GelcodeTM Blue Bio-safe eStain® Protein Coomassie SafeStain Safe Protein Stain TM Coomassie Stain Staining System eStain Protein Staining System provides high staining efficiency as conventional Coomassie Blue staining method Blue Staining (Basic Protocol) (Basic Protocol) Protein Detection and Immunoassay 1 2 3 4 5 6 7 1 2 3 4 5 6 7 Fix Rinse Wash Wash - 1 hour 15 min 15 min 15 min
Stain Stain Stain Stain Electric Staining 30 min - 1 hr 1 – 3 hr 1 hr 15 min – 1 hr 7 min
Destain Wash Rinse Destain - 2 hr – overnight 1 – 3 hr 30 min 1 – 2 hr
TM 2 hr, 15 min – 1 hr, 30 min – High staining efficiency achieved using the eStain System. Samples ≥3 hr, 30 min 1 hr, 45 min Only 7 min 6 hr, 15 min 3 hr, 15 min were separated on ExpressTM 4-20% PAGE gels and stained by eStainTM Protein Staining System (L) and conventional Coomassie Blue staining method (R) with R-250. Lanes 1-7 : 5 ul NEB broad range protein marker. Protein Detection and Immunoassay
Product Overview:
Product Quantity Cat. No. Price eStainTM Protein Staining Device 1 unit L02010 $550 eStainTM Protein Staining Pad (R-250, 20-pak) 1 box L02011 $40 eStainTM Protein Staining Pad (G-250, 20-pak) 1 box L02012 $40 eStainTM Graphite Electrode (10 mm, 1-pak) 1 unit L02013 $50 eStainTM Graphite Electrode (11 mm, 1-pak) 1 unit L02014 $50 eStainTM Graphite Electrode (12 mm, 1-pak) 1 unit L02015 $50
For more information on eStainTM protein staining system, visit http://www.genscript.com/eStain_protein_staining_system.html
Your Innovation Partner in Drug Discovery! - 49 - www.genscript.com - 50 - ONE-HOUR WesternTM Detection System ONE-HOUR WesternTM Standard Kits
Accurate western analysis in less time and with less effort GenScript Classical Optimized and ready-to-go system for Western analysis ONE-HOUR WesternTM Western Blot Detection Blot Detection The ONE-HOUR WesternTM Detection System is designed to • Fast and Easy—The entire Western procedure is completed ONE-HOUR WesternTM Standard Kits, equiped with prioritary produce high signal with low background for quick and clear within one hour. GenScript’s ONE-HOUR WesternTM technology, contain all the Western analysis of proteins. GenScript's breakthrough • Ready-to-Go—The kits come with complete secondary necessary reagents, buffers, nitrocellulose membrane and ONE-HOUR WesternTM technology streamlines the classical Blocking antibodies and need no special labeling and far less substrates for performing the Western or dot blot analysis. All Western blot analysis by bypassing secondary antibody binding Pretreatment optimization than traditional three-step kits. the components in ONE-HOUR WesternTM Standard Kits have and washing steps. The system reduces the total Western blot • High Sensitivity—The sensitivity of the ONE-HOUR been optimized for the best results. analysis time from 4.5 hours down to only one hour. Primary Antibody Western™ Complete Kits is comparable to or even better ONE-HOUR than that of any classical 4.5-hour procedure. WesternTM Kit Primary Development Antibody ONE-HOUR(1hr) Classical(4.5hrs) 1 2 3 4 5 6 7 8
Secondary Antibody HeLa cell α-Tubulin 1 hour lysate(μg) Protein Analysis 10 2.5 0.63 0.16 10 2.5 0.63 0.16 Development HeLa cell lysate(μg) 10 5.0 2.5 1.25 0.62 0.31 0.16 0.08
Western blots detection of α-Tubulin protein from HeLa cell lysate by Western blot detection of α-Tubulin using the ONE-HOUR WesternTM both classical Western and ONE-HOUR WesternTM Standard Kit Standard Kit (GenScript, L00204C) and α-tubulin polyclonal antibody TM 4.5 hours (L00205C10) (Abcam, ab4074). The blot was developed with the LumiSensor Protein Analysis Protein Chemiluminescent HRP Substrate included in the kit. ONE-HOUR WesternTM Kit Selection Guide Product Overview:
ONE-HOUR WesternTM Detection Kits Features Total Time
Product Quantity Cat. No. Price Protein Detection and Immunoassay • Recommended for regular users ONE-HOUR WesternTM Standard Kit (Goat) 1 Kit (5 assays) L00228 $75 • Convenient package with all reagents included ONE-HOUR WesternTM Standard Kits 1 hour ONE-HOUR WesternTM Standard Kit (Mouse) 1 Kit (5 assays) L00205C $75 • Fast and easy to perform ONE-HOUR WesternTM Standard Kit (Rabbit) 1 Kit (5 assays) L00204C $75 • High sensitivity and low background ONE-HOUR WesternTM Standard Kit Using TMB (Rabbit) 1 Kit (5 assays) L00204T $75 • Recommended for detection of low amounts of protein ONE-HOUR WesternTM Advanced Kits 1.25 hours ONE-HOUR WesternTM Standard Kit Using TMB (Mouse) 1 Kit (5 assays) L00205T $75 • Higher sensitivity and lower background ONE-HOUR WesternTM Standard Kit Using TMB (Goat) 1 Kit (5 assays) L00228T $75 • For immunoprecipitated proteins ONE-HOUR IP-Western Kits • Low background 1 hour • Journal-quality images For more information on ONE-HOUR WesternTM Standard Kit , visit http://www.genscript.com/western_complete_kit.html • No dark room, developer or X-Ray film is needed ONE-HOUR WesternTM Fluorescent Kit 1.25 hours • More sensitive than traditional chemiluminescence methods • Simultaneous detection of multiple targets on a single blot ONE-HOUR WesternTM Multiplex Fluorescent Kit 1.25 hours Protein Detection and Immunoassay • Saves time associated with optimizing fluorescent Western blots
For more information about ONE-HOUR WesternTM Detection System, visit http://www.genscript.com/western_tech.html
Your Innovation Partner in Drug Discovery! - 51 - www.genscript.com - 52 - ONE-HOUR WesternTM Advanced Kits ONE-HOUR IP-Western Kits
The best Western detection kit for lower quantity of proteins Rapid and simple procedure to reach reproducible results
• Superior Sensitivity—The kits reveal very low amount of The kits boast greater sensitivity with much less antibody. • No Contamination—GenScript’s proprietary blocking Classical ONE-HOUR relevant protein. ONE-HOUR WesternTM Advanced Kits contain all the necessary reagents eliminate all contamination originated from Western IP-Western • Less Amount of Antibody Needed—As low as 0.5-2 μg of reagents, buffers, nitrocellulose membrane, and HRP substrate antibody heavy chains, light chains, and proteins A/G. antibody is required to attain superior results. for performing a Western blot. • Superior Sensitivity—Comparable to or better than that of classical three-step Western blot kits. Taking the reduced GenScript’s ONE-HOUR WesternTM Advanced Kits are background into account, the effective sensitivity of the designed to detect very low amount of relevant protein. ONE-HOUR IP-Western kits is even higher. Ab(H) • Simple Procedure—Fewer and simpler steps than classical Trx Fusion Western blot kits, leaving less room for human error. Protein G Protein Comparison of two ONE-HOUR WesternTM kits using Comparison of two ONE-HOUR WesternTM kits using • No Secondary Antibody Required—ONE-HOUR monoclonal antibodies polyclonal antibodies IP-Western Kits include GenScript's proprietary secondary Ab(L) antibodies, bypassing the need for any additional secondary Standard Kit Standard Kit antibodies. 1 2 3 4 5 6 7 1 2 3 4 5 6 IP-Western analysis frequently suffers from heavy/light Protein Analysis chain, protein A and G contamination, particularly when the 1 2 molecular weight of the target protein is close to those of the contaminants. This problem can be solved using A Trx fusion protein was immunoprecipitated using Trx-tag Antibody, GenScript’s ONE-HOUR IP-Western Kits. This breakthrough mAb, Mouse (GenScript, A00180) bound to Protein G Resin (GenScript,
33.0 11.0 3.60 1.20 0.41 0.13 0.045 25.0 12.5 2.25 3.10 1.50 0.74 has several significant advantages: enhanced sensitivity, L00209). Trx fusion protein was then immunoblotted with the same elimination of background noise, and increased chances of primary antibody by using HRP-conjugated goat anti-mouse IgG (Fc
Protein Analysis Protein identifying rare proteins. Like all ONE-HOUR Western™ Kits, specific, Sigma, A 0168) (Lane 1) and using the ONE-HOUR IP-Western Advanced Kit Advanced Kit the ONE-HOUR IP-Western Kits reduce total Western blot Kit L00232 (Lane 2). analysis time to about one hour. 1 2 3 4 5 6 7 1 2 3 4 5 6
GST Kit Components:
GST Protein Detection and Immunoassay
Components L00231 (Rabbit) L00232 (Rabbit) L00232 (Rabbit)
Loading Loading Pretreat A solution 100 ml 100 ml 100 ml 33.0 11.0 3.60 1.20 0.41 0.13 0.045 GST(ng) 25.0 12.5 2.25 3.10 1.50 0.74 GST(ng) Pretreat B solution 100 ml 100 ml 100 ml A&G blocker (100X) - 1 ml 1 ml Western blots detection of GST protein using two ONE-HOUR Western blots detection of GST protein using two ONE-HOUR Protein G blocker (100X) 1 ml - - WesternTM Kits: Standard (GenScript, L00205C) and Advanced WesternTM kits: Standard (GenScript, L00204C) and Advanced (GenScript, L00242). 10 μg and 2.5 μg of THETM GST-tag mAb (GenScript, L00241). 10 μg and 2.5 μg of GST-tag Antibody, IP-WB 1 solution 1 ml 1 ml 1 ml (GenScript, A00865) were used with these two kits to detect pAb, Rabbit (GenScript, A00097) were used to detect GST IP-WB 2 solution 1 ml 1 ml 1 ml GST protein, respectively. protein,respectively. IP-WB 3 solution 100 ml 100 ml 100 ml
Product Overview: 10X Wash solution 125 ml 125 ml 125 ml Protein Detection and Immunoassay WestClearTM Nitrocellulose 10 Sheets 10 Sheets 10 Sheets Membrane (0.2 μm, 7.5×8 cm) Product Quantity Cat. No. Price ONE-HOUR WesternTM Advanced Kit (Rabbit) 1 Kit (10 assays) L00241 $275 LumiSensorTM Chemiluminescent 2×30 ml 2×30 ml 2×30 ml HRP Substrate ONE-HOUR WesternTM Advanced Kit (Mouse) 1 Kit (10 assays) L00242 $275 Protocol 1 1 1 ONE-HOUR WesternTM Advanced Kit (Goat) 1 Kit (10 assays) L00243 $275
Product Overview: For more information on ONE-HOUR WesternTM Advanced Kits, visit http://www.genscript.com/ipt.com/advanced_western_tech.html
Product Quantity Cat. No. Price ONE-HOUR IP-Western Kit (Rabbit) 1 Kit (5 assays) L00231 $125 ONE-HOUR IP-Western Kit (Mouse) 1 Kit (5 assays) L00232 $125 ONE-HOUR IP-Western Kit (Goat) 1 Kit (5 assays) L00233 $125
For more information on ONE-HOUR IP-Western Kits, visit http://www.genscript.com/ip_western_tech.html
Your Innovation Partner in Drug Discovery! - 53 - www.genscript.com - 54 - TM ONE-HOUR Western Fluorescent Kits Product Overview: Far-less time and journal-quality Western blot Product Quantity Cat. No. Price • Strong Versatility—Any primary antibody from any species Fluorescent Western blot detection of GAPDH Antibody, ONE-HOUR WesternTM Multiplex Fluorescent Kit 1 Kit L00398 $245 can be used with ONE-HOUR Western™ Fluorescent Kits. pAb, Goat (GenScript, A00191) For more information on ONE-HOUR WesternTM Multiplex Fluorescent Kit, visit • Superior Sensitivity—ONE-HOUR Western™ Fluorescent 1 2 3 4 5 6 7 8 Kits are more sensitive than traditional chemiluminescence http://www.genscript.com/one-step_multiplex_fluorescent_western_kit.html methods.
GenScript's ONE-HOUR WesternTM Fluorescent Kit yields journal-quality Western blot results in just one hour. ExpressTM ELISA Kits Using GenScript’s breakthrough immunodetection technology (patent pending), this kit replaces the classical three-step Detect any antigen with ELISA assay in one hour Overview of Indirect ELISA Procedures Western, allowing the membrane to be scanned on LI-COR® HeLa cell lysate (μg) 5.0 2.5 1.25 0.62 0.31 0.16 0.08 0.04 Odyssey® Infrared Imaging System with far less time than • Fast—Cut indirect ELISA time down to one hour. Express Classical Fluorescent Western blots for the detection of GAPDH using the traditional Western blot. • High Sensitivity ONE-HOUR WesternTM Fluorescent Kit (GenScript, L00397). 5.0 μg, Antigen coating Antigen coating • Reproducible Results o 2.5 μg, 1.25 μg, 0.62 μg, 0.31 μg, 0.16 μg, 0.08 μg and 0.04 μg of HeLa RT for 5 min 37 C for 2 hrs or • Less Optimization o cell lysates were loaded into lanes 1, 2, 3, 4, 5, 6, 7 and 8 respectively. 4 C o/n Protein Analysis Blocking: 5 min Product Overview: GenScript’s ExpressTM ELISA Kits are designed to detect and Blocking: 1 hr quantify antigen-specific antibodies in serums and other
Product Quantity Cat. No. Price samples using a proprietary (patent pending) one-hour indirect Primary Antibody ELISA procedure. These kits allow users to perform a Binding: 30 min ONE-HOUR WesternTM Fluorescent Kit 1 Kit (10 Assay) L00397 $185 complete ELISA from antigen coating to signal development in Primary Antibody Protein Analysis Protein just one hour. The kit contains all necessary reagents and ELISA solution Binding: 1hr TM For more information on ONE-HOUR Western Fluorescent Kits, visit http://www.genscript.com/one_step_fluorescent_western_kits.html buffers for performing indirect ELISA using ten 96-well plates. for 20 min
Development
Secondary Antibody Protein Detection and Immunoassay Binding: 1 hr ONE-HOUR WesternTM Multiplex Fluorescent Kit
Quick and clear Western analysis for multiple proteins 1 hr Development
The ONE-HOUR WesternTM Multiplex Fluorescent Kit is Multiplex fluorescent Western detection of GAPDH using designed to deliver quick and clear Western blot analysis with GAPDH Antibody, pAb, Goat (GenScript, A00191) high signals on low background for multiple proteins. This kit allows researchers to detect multiple antigens using multiple antibodies on the same membrane at the same time. The 5 hrs or more process includes a five-minute incubation of the membrane with
Protein Detection and Immunoassay the pretreated solution and 40-minute incubation with WB-M Product Overview: solution together with primary antibodies and corresponding fluorescent-dye-labeled secondary antibodies. After washing Price A: 700 nm fluorescence image; B: 800 nm fluorescence image; C: The Product Quantity Cat. No. three times for ten minutes, the membrane can then be scanned two fluorescence colors were imaged simultaneously in a single scan on Express™ ELISA Kit (Rabbit) 1 Kit (10 assays) L00251 $396 on LI-COR® Odyssey® Infrared Imaging System. a LI-COR® Odyssey® Infrared Imaging Systems; M: Protein Marker for Express™ ELISA Kit (Mouse) 1 Kit (10 assays) L00252 $396 Fluorescent Western Blotting (GenScript, M00124). Express™ ELISA Kit (Goat) 1 Kit (10 assays) L00253 $396 Dot Blot Box (Clear) pack of 10 M00108 $98 Dot Blot Box (Blue) pack of 10 M00109 $98 Antigens Primary Antibodies Amount Secondary Antibodies Amount Dot Blot Box (Yellow) pack of 10 M00110 $98 α-Tubulin Mouse Anti-α-Tubulin mAb (Sigma, T6074) 6 μg IRDye® 680y Anti-Mouse 3 μg 2X Coating Buffer 125 ml M01018 $40 β-Actin Mouse Anti-β-Actin mAb (GenScript, A00702) 6 μg IRDye® 800CW Goat Anti-Mouse 3 μg 20X Wash Solution 125 ml M01016 $69 GAPDH GAPDH Antibody, pAb, Goat (GenScript, A00191) 4 μg IRDye® 680 Donkey Anti-Goat 2 μg Stop Solution 125 ml M01017 $25 GST GST-tag Antibody, pAb, Rabbit (GenScript, A00097) 6 μg IRDye® 800CW Goat Anti-Rabbit 3 μg One-Solution Microwell TMB 110 ml M00078 $40 Pretreat Solution (A + B) 250 ml M01019 $149
For more information on ExpressTM ELISA Kits, visit http://www.genscript.com/express_elisa_kit.html
Your Innovation Partner in Drug Discovery! - 55 - www.genscript.com - 56 - Western QuickBlock Kits Product Overview: 5-minute reliable blocking for Immunoblots and ELISA Product Quantity Cat. No. Price • Fast—Five minutes blocking of any membranes. surface, such as the microtiter plates used for ELISA. Instead Western QuickBlock Kit 1 Kit (20 assays) L00276 $175 • Ultra Sensitivity—QuickBlock makes your Western of the classical one-hour blocking procedure, this kit enables Western QuickBlock Optimization Kit 1 Kit (20 assays) L00278 $195 detection more sensitive. the complete blocking of the solid surface in just five minutes. Customized Western QuickBlock Kit A 1 Kit (20 assays) L00279 $175 • Ease to Perform—We offer a quick and simple procedure. Furthermore, the QuickBlock method has been shown to Customized Western QuickBlock Kit B 1 Kit (20 assays) L00280 $175 increase the sensitivity of Western detections when compared Customized Western QuickBlock Kit C 1 Kit (20 assays) L00281 $175 GenScript's Western QuickBlock Kits are designed for the to the dry milk method, allowing the researcher to reach the Customized Western QuickBlock Kit D 1 Kit (20 assays) L00282 $175 reliable and speedy blocking of any membranes used for same antigen detection level with less amounts of antibody.
Western blots. It can also be used to block any other solid For more information on Western QuickBlock Kits, visit http://www.genscript.com/western_quickblock_kit.html
Applications Product Description Quantity Cat. No. Western QuickBlock Kit Quick blocking in 5 min 20 Assays L00276 ONE-HOUR WesternTM Kit Accessories Western QuickBlock Quick blocing optimization 20 Assays L00278 TM Optimization Kit in few hours. GenScript provides a varity reagents and related products for its line of ONE-HOUR Western Kits and ELISA Kits, including detection Protein Analysis Customized Western substrates, solutions, and membranes. 20 Assays L00279 Blocking Reagents QuickBlock Kit A for Western Customized Western Provide the best blocking Product Overview: 20 Assays L00280 QuickBlock Kit B regents based on the Customized Western customer’s requirements. Product Quantity Cat. No. Price 20 Assays L00281 TM QuickBlock Kit C LumiSensor Plus Chemiluminescent HRP Substrate Kit 1 Kit (2×30 ml) L00225 $89 TM Protein Analysis Protein Customized Western LumiSensor Chemiluminescent HRP Substrate Kit 1 Kit (2×30 ml) L00221V60 $55 20 Assays L00282 TM QuickBlock Kit D LumiSensor Chemiluminescent HRP Substrate Kit 1 Kit (2×150 ml) L00221V300 $145 LumiSensorTM Chemiluminescent HRP Substrate Kit 1 Kit (2×250 ml) L00221V500 $235 ChromoSensorTM One-Solution TMB Substrate 1 pk (60 ml) L00222V60 $28 ChromoSensorTM One-Solution TMB Substrate 1 pk (125 ml) L00222V125 $39 TM Shown below is a Western blot using the Western Shown below is a western blot using the Western QuickBlock ChromoSensor One-Solution TMB Substrate 1 pk (250 ml) L00222V250 $68 Protein Detection and Immunoassay QuickBlock Kit (GenScript, L00276) Optimization Kit (GenScript, L00278) ChromoSensorTM One-Solution TMB Substrate 1 pk (500 ml) L00222V500 $119 10X Wash Solution 100 ml MB01011 $65 A&G Blocker (100 X) 1 ml M01014 $20 Pretreat A (100 ml) & B (100 ml) M01013 $145 1 Hour Blocking 5 Min Blocking Using Ootimization Kit 1 pack Using GenScript Kit Using 10% Dry Milk A BCD Pretreat Stripping Solution 100 ml M01015 $30 1 2 3 4 5 6 12 34 Pretreat A-b solution 100 ml M01057 $28 LumiSensorTM Super HRP Substrate 1 Kit L00354 $135 Western Wash Box (Clear) M00100 $80 GAPDH 1 pack of 10 Western Wash Box (Blue) M00101 $80 α-Tubulin 1 pack of 10 Western Wash Box (Yellow) 1 pack of 10 M00102 $80 Western Wash Box (Black) 1 pack of 10 M00103 $80
Protein Detection and Immunoassay HeLa Cell Lysate Dot Blot Box (Clear) 1 pack of 10 M00108 $98 5.0 1.7 0.6 5.0 1.7 0.6 Loading(μg) Dot Blot Box (Blue) 1 pack of 10 M00109 $98 Dot Blot Box (Yellow) 1 pack of 10 M00110 $98 Western Membrane Forceps 1 pack of 10 M00099 $50 1 pk (10 sheets WestClearTM Nitrocellulose Membrane L00224A60 $61 Western blots for the detection of GAPDH protein from HeLa cell lysate Western blots for the detection of α-Tubulin in HeLa cell lysate by using of 7.5 x 8 cm) using either the classical 10% dry milk blocking or the Western the Western QuickBlock Optimization Kit A, B, C, and D, respectively. TM 1 pk (5 sheets QuickBlock Kit. 5.0 μg, 1.7 μg, and 0.6 μg of HeLa cell lysate (BD 10.0 μg of HeLa cell lysate (BD Biosciences, #611449) was loaded in WestClear Nitrocellulose Membrane L00224A225 $76 of 15 x 15 cm) Biosciences, #611449) were loaded in different lanes as shown in the each of the four different lanes as shown in the figure. Monoclonal 20 sheets $60 figure. Both of the Western blots were developed with LumiSensorTM anti-α-Tubulin (Mouse Ascites Fluid, Sigma, T5168) was used with the High-Sensitivity X-Ray Film (5 X 7 inches) L00358 100 sheet $193 Chemiluminescent HRP Substrate (GenScript, L00221V60). Western Optimization Kit (GenScript, L00258), which contains all the components of the Western QuickBlock Optimization Kit. For more information on Western Accessories, visit http://www.genscript.com/western_accessories.html
Your Innovation Partner in Drug Discovery! - 57 - www.genscript.com - 58 - Cell Lysates
GenScript provides researchers with a variety of ready-to-use cell lysates from individual cell lines for various research applications Product Quantity Cat. No. Price including electrophoresis, Western blot, immunoprecipitation, enzymatic activity analysis and protein-protein interaction analysis. HeLa Lysates 100 μg M0045 $72 C33A Lysates 100 μg M0046 $72 Product Overview: SIHA Lysates 100 μg M0047 $72 USO2 Lysates 100 μg M0048 $72 Epitope Tag Positive Control Lysates U2OS Lysates 100 μg M0049 $72 HT1080 Lysates 100 μg M0050 $72
Product Quantity Cat. No. Price T-24 Lysates 100 μg M0051 $72 GST Lysates 100 μg M0001 $72 B16 Lysates 100 μg M0052 $72 Myc Lysates 100 μg M0002 $72 MMAN Lysates 100 μg M0053 $72 HA lysates 100 μg M0004 $72 MMRU Lysates 100 μg M0054 $72 DYKDDDDK Lysates 100 μg M0005 $72 SK-Mel-3 Lysates 100 μg M0055 $72 Multiple Tag Cell Lysate 200 μg M0100 $72 JEG-13 Lysates 100 μg M0056 $72 Multiple Tag (Purified) 200 μg M0101 $98 WEHI-274.1 Lysates 100 μg M0057 $72 THP1 Lysates 100 μg M0058 $72 Cell Line Lysates CB3 Lysates 100 μg M0059 $72 Protein Analysis K562 Lysates 100 μg M0060 $72 Product Quantity Cat. No. Price Jurkat Lysates 100 μg M0061 $72 Neuro2A Lysates 100 μg M0006 $72 EL-4 Lysates 100 μg M0062 $72 NIE115 Lysates 100 μg M0007 $72 HEL Lysates 100 μg M0063 $72 SH-Sy5y Lysates 100 μg M0008 $72 Raji Lysates 100 μg M0064 $72 U87MG Lysates 100 μg M0009 $72 NIH3T3 Lytes 100 μg M0065 $72 Protein Analysis Protein TE671 Lysates 100 μg M0010 $72 Rat2 Lysates 100 μg M0066 $72 SHEP Lysates 100 μg M0011 $72 MES-13 Lysates 100 μg M0067 $72 ABMC1 Lysates 100 μg M0012 $72 C2C12 Lysates 100 μg M0068 $72 IMR-90 Lysates 100 μg M0013 $72 L6 Lysates 100 μg M0069 $72 MRC-5 Lysates 100 μg M0014 $72 100 μg SKMC Lysates M0070 $72 Protein Detection and Immunoassay WI38 Lysates 100 μg M0015 $72 HUVEC Lysates 100 μg M0071 $72 LLC1 Lysates 100 μg M0016 $72 Y1 Lysates 100 μg M0072 $72 H441 Lysates 100 μg M0017 $72 TM3 Lysates 100 μg M0073 $72 Calu-6 Lysates 100 μg M0018 $72 MDA-435 Lysates 100 μg M0074 $72 MDA-MB-468 Lysates 100 μg M0019 $72 SK-BR3 Lysates 100 μg M0075 $72 MDA-MB-231 Lysates 100 μg M0020 $72 A549 Lysates 100 μg M0076 $72 MCF7 Lysates 100 μg M0021 $72 WI38 Lysates 100 μg M0077 $72 SW-48 Lysates 100 μg M0022 $72 T-47D Lysates 100 μg M0023 $72 Hep3B Lysates 100 μg M0024 $72 HepG2 Lysates 100 μg M0025 $72 HCT115 Lysates 100 μg M0026 $72 Protein Detection and Immunoassay HCT116 Lysates 100 μg M0027 $72 HT29 Lysates 100 μg M0028 $72 MDCK Lysates 100 μg M0029 $72 Cos1 Lysates 100 μg M0030 $72 BOSC23 Lysates 100 μg M0031 $72 293 Lysates 100 μg M0032 $72 293T Lysates 100 μg M0033 $72 ABMC2 Lysates 100 μg M0034 $72 A2780 Lysates 100 μg M0035 $72 BG1 Lysates 100 μg M0036 $72 Skov3 Lysates 100 μg M0037 $72 Ovcar3 Lysates 100 μg M0038 $72 Ovcar5 Lysates 100 μg M0039 $72 Ovcar8 Lysates 100 μg M0040 $72 Ovcar10 Lysates 100 μg M0041 $72 DU145 Lysates 100 μg M0042 $72 HTB-81 Lysates 100 μg M0043 $72 PC-3 Lysates 100 μg M0044 $72
Your Innovation Partner in Drug Discovery! - 59 - www.genscript.com - 60 - Related Reagents for Protein Analysis
Get fast and easy protein analysis with highest purity reagents Product Quantity Cat. No. Price GenScript offers a comprehensive line of chemical products pharmaceuticals, quaternary ammonium salts, tetrazolium salts, 100 g $45 with different sizes and the highest level of purity, including and etc. We always provide solutions to every protein analysis MOPS sodium salt 500 g C01636 $158 amino acids, dNTPs, biological buffers, diagnostic chromogens, problem with the best quality reagents at the most competitive 5000 g $1,103 prices. 25000 g $3,859 Product Overview: 100 g $56 MOPS hemisodium salt 500 g C01635 $197 Product Quantity Cat. No. Price 5000 g $1,382 100 g $9 25000 g $4,836 Tris HCl 500 g C01650 $32 100 g $36 5000 g $225 PS 500 g C01633 $127 100 g $77 5000 g $892 TAPS Ultra 500 g C01648 $270 25000 g $3,121 5,000 g $1887 100 g $52 25,000 g $6603 HEPPS 500 g C01626 $181
100 g $45 5000 g $1,264 Protein Analysis 500 g $158 25000 g $4,425 TAPS 5,000 g C01647 $1103 100 g $76 25,000 g $3859 500 g C01625 $267 100 g $79 HEPES Sodium salt Ultra 5000 g $1,872 500 g $275 25000 g $6,551 PIPES Dipotassium salt 5000 g C01646 $1,926 100 g $45 Protein Analysis Protein 25000 g $6,740 500 g C01624 $158 100 g $53 HEPES Sodium salt 5000 g $1,103 500 g $186 25000 g $3,859 PIPES Sesquisodium salt 5000 g C01645 $1,303 500 g $158
25000 g $4,562 HEPES hemisodium salt 5000 g C01623 $1,103 Related Reagents for Protein Analysis PIPES Disodium salt 100 g C01644 $50 25000 g $3,859 100 g $50 100 g $58 PIPES Monosodium salt 500 g $176 500 g $1,156 HEPBS C01620 5000 g C01643 $1,230 5000 g $8,095 25000 g $4,305 25000 g $28,332 100 g $43 500 g $204 PIPES Ultra 500 g $151 CHES Ultra 5000 g C01619 $1,426 5000 g C01642 $1,058 25000 g $4,991 25000 g $3,704 100 g $38 100 g $35 500 g $134 CHES C01618 PIPES 500 g $123 5000 g $941 5000 g C01641 $862 25000 g $3,293
Related Reagents for Protein Analysis Related Reagents for Protein 25000 g $3,018 100 g $75 100 g $77 500 g $261 CAPSO Sodium salt C01617 MOPSO sodium salt Ultra 500 g $270 5000 g $1,828 5000 g C01640 $1,887 25000 g $6,397 25000 g $6,603 100 g $73 100 g $57 CAPSO Ultra 500 g C01616 $256 MOPSO sodium salt 500 g $200 5000 g $1,789 5000 g C01639 $1,397 100 g $132 25000 g $4,888 CAPS 5000 g C01613 $921 100 g $38 25000 g $3,224 MOPSO 500 g $134 100 g $99 5000 g C01638 $936 500 g $346 BES Ultra C01612 25000 g $3,276 5000 g $2,421 100 g $57 25000 g $8,472 MOPS Sodium salt Ultra 500 g $200 100 g $49 5000 g C01637 $1,401 500 g $171 BES C01611 25000 g $4,905 5000 g $1,196 25000 g $4,185
Your Innovation Partner in Drug Discovery! - 61 - www.genscript.com - 62 - Product Overview:
Product Quantity Cat. No. Price Product Cas. No. Purity Quantity Cat. No. Price 100 g $54 10 g $164 500 g $190 DTNB 69-78-3 ≥99% 100 g C01604 $1,396 ADA Disodium salt C01608 5000 g $1,328 500 g $5,583 25000 g $4,648 10 g $302 100 g $54 HDAOS 82692-88-4 ≥99% 100 g C01596 $2,571 500 g $190 500 g $10,282 ADA Monosodium salt C01607 5000 g $1,328 10 g $374 25000 g $4,648 MADB 209518-16-1 ≥99% 100 g C01597 $3,181 100 g $76 500 g $12,723 500 g $267 10 g $266 ADA Ultra C01606 5000 g $1,872 MAOS 82692-97-5 ≥99% 100 g C01598 $2,261 25000 g $6,551 500 g $9,044 100 g $37 10 g $167 500 g $130 TBHBA 14348-40-4 ≥99% 100 g C01590 $1,421 ADA C01605 5000 g $907 500 g $5,685 Protein Analysis 25000 g $3,173 10 g $243 TMB 54827-17-7 ≥99% 100 g C01601 $2,066 500 g $8,262 10 g $243 TMB HCl 64285-73-0 ≥99% 100 g C01602 $2,066 500 g $8,262 Protein Analysis Protein Immunology Reagents 10 g $374 TODB NA ≥99% 100 g C01599 $3,181 GenScript provides a broad range of immunology reagents that are widely used in diagnostic assays and biochemical examinations. 500 g $12,723 Please select the high quality reagents for your immunology experiment from the following lists. . 10 g $195 82692-93-1 C01594
TOOS ≥99% 100 g $1,660 Related Reagents for Protein Analysis Product Overview: 500 g $6,640 10 g $197 Product Quantity Cat. No. Price TOPS 40567-80-4 ≥99% 100 g C01593 $1,677 One-Solution Microwell TMB 110 ml M00078 $40 500 g $6,706 Biotin-Protein A 2 mg M00095 $80 Biotin-Protein G 1 mg M00096 $98 Biotin-Protein L 1 mg M00097 $98 Coating Stabilizer 500 ml M00085 $135 HRP-Protein A 1 mg M00089 $55 HRP-Protein G 1 mg M00090 $75 HRP-Protein L 1 mg M00098 $95 Lyophilization Stabilizer 5 ml M00084 $55
Related Reagents for Protein Analysis Related Reagents for Protein Lyophilization Stabilizer 25 ml M00084 $195 Streptavidin-HRP 1 mg M00091 $89
Product Cas. No. Purity Quantity Cat. No. Price 10 g $292 ADOS 82692-96-4 ≥99% 100 g C01592 $2,480 500 g $9,921 10 g $216 ADPS 82611-88-9 ≥99% 100 g C01591 $1,840 500 g $7,359 10 g $220 ALPS 82611-85-6 ≥99% 100 g C01600 $1,870 500 g $7,480 10 g $292 DAOS 83777-30-4 ≥99% 100 g C01595 $2,483 500 g $9,933
Your Innovation Partner in Drug Discovery! - 63 - www.genscript.com - 64 - Catalog Proteins
Cytokines & Growth Factors Product Quantity Cat. No. Price 10 μg $91 Cytokines, a category of immunoactive proteins, act as humoral system to regulate immune response. Growth factors typically Interleukin (IL)-1 Receptor Antagonist, human 50 μg Z00367 $300 regulators which modulate the functional activities of individual act as signaling molecules between cells which play an 1 mg $1,600 cells and tissues at nano to picomolar concentrations either important role in regulating a variety of cellular processes. 10 μg $125 under normal or pathological conditions. The cytokine family Interleukin (IL)-10, mouse 50 μg Z02036 $390 consists mainly of smaller, water-soluble proteins and GenScript offers a comprehensive package of cytokine and 1 mg $2,000 glycoproteins with molecular mass between 8 and 30 kDa, growth factor products which facilitate scientists’ researching 10 μg $91 including haemopoietin, interleukin, interferon, epidermal activities. It provides the scientists a quick and easy access to Interleukin (IL)-11, human 50 μg Z00375 $320 growth factor, tumor necrosis factor, transforming growth factor, these proteins to accelerate the biology and medical research. 1 mg $1,600 chemokine, and others that are secreted by the cells of immune 10 μg $91 Interleukin (IL)-15, human 50 μg Z00377 $320 1 mg $1,600 Product Overview: 10 μg $130 Interleukin (IL)-16, human 50 μg Z02196 $400
Product Quantity Cat. No. Price 1 mg $2,400 Protein Analysis 10 μg $95 10 μg $75 Bone Morphogenetic Protein (BMP)-2, human 50 μg Z00327 $237 50 μg Z02061 $250 Interleukin (IL)-17, human 1 mg $1,185 1 mg $2,300 10 μg $50 10 μg $130 CD40 (CD154) Ligand/TRAP, human 50 μg $130 Z02022 Interleukin (IL)-1α, mouse 50 μg Z02193 $390 1 mg $800 1 mg $2,340 Protein Analysis Protein 10 μg $26 10 μg $130 Epidermal Growth Factor (EGF), human 50 μg Z00333 $80 Interleukin (IL)-1β, mouse 50 μg Z02194 $390 1 mg $180 1 mg $2,340 10 μg $52 10 μg $39 Fibroblast Growth Factor (FGF)-acidic, mouse 50 μg Z02053 $129 Interleukin (IL)-2, human 50 μg Z00368 $130 Catalog Proteins Fibroblast Growth Factor (FGF)-basic, human 10 μg Z00339 $70 1 mg $500 10 μg $52 10 μg $130 Fibroblast Growth Factor (FGF)-basic, mouse Z02054 50 μg $129 Interleukin (IL)-22, mouse 50 μg Z02197 $400 Glucagon-Like Peptide (GLP)-1, human 50 μg Z00212 $180 1 mg $2,400 10 μg $91 10 μg $91 Catalog Proteins 50 μg Z00342 $320 50 μg Z00372 $300 Granulocyte Colony Stimulating Factor (G-CSF), human Interleukin (IL)-6, human 1 mg $1,600 1 mg $1,600 10 μg $91 10 μg $91 50 μg $320 50 μg Z02189 $230 Granulocyte Macrophage Colony Stimulating Factor Z00349 Interleukin (IL)-8 (3-79), human 1 mg $1,600 1 mg $1,600 10 μg $100 10 μg $52 (GM-CSF), human 50 μg Z02190 $320 50 μg Z02195 $130 Granulocyte Macrophage Colony Stimulating Factor Interleukin (IL)-8 (8-79), human 1 mg $1,800 1 mg $800 10 μg $130 10 μg $140 (GM-CSF), P. Pichia Derived (Sargramostim), human 50 μg Z02019 $480 50 μg Z00384 $400 Human Serum Albumin and Interferon (HSA-IFN)-α 2b Leukemia Inhibitory Factor (LIF), human 1 mg $2,400 1 mg $3,120 10 μg $26 10 μg $130 Z02187 Long Arg3 Insulin-like Growth Factor-I Insulin Like Growth Factor (IGF)-1 (4-70), human 50 μg $80 50 μg Z02191 $800 (Long-R3-IGF-I) (Media Grade), human 1 mg $480 1 mg $3,250 10 μg $26 10 μg $26 Long Arg3 Insulin-like Growth Factor-I 50 μg Z00362 $80 Z02188 Insulin-Like Growth Factor (IGF)-1, human (Long-R3-IGF-I) (Receptor Grade), human 50 μg $80 1 mg $480 1 mg $480 10 μg $26 Macrophage Colony Stimulating Factor (M-CSF), 100 μg $340 Z02001 Interferon (IFN)-α 2a, human 50 μg Z00358 $80 human 1 mg $3,000 1 mg $480 10 μg $170 Pegylated Granulocyte Colony Stimulating Factor 10 μg $26 50 μg Z00393 $640 Z00353 (PEG-G-CSF), human Interferon (IFN)-α 2b, human 50 μg $80 1 mg $3,200 1 mg $480 10 μg $39 Interferon(IFN)-γ, human 50 μg Z00357 $105 1 mg $500
Your Innovation Partner in Drug Discovery! - 65 - www.genscript.com - 66 - Product Overview: Enzymes & Inhibitors
Product Quantity Cat. No. Price Enzymes which serve a variety of functions inside living developed many widely-used enzyme products. GenScript's organisms are widely used in academic research and industrial comprehensive line of enzymes includes protein modifying 10 μg $221 Pegylated Interferon-α 2b, human production. Almost all processes in a biological cell require the enzyme, DNA modifying enzyme and RNA modifying enzyme. 50 μg $640 Z02020 presence of enzymes to occur at significant rates. Through 1 mg $3,600 years of experiences in satisfying customers’ needs in the 10 μg $91 Stem Cell Factor (SCF), human Z00400 constantly changing technological fields, GenScript has 50 μg $320 1 mg $1,600 Product Overview: 10 μg $52 Tumor Necrosis Factor (TNF)-α, human 50 μg Z01001 $129 Product Quantity Cat. No. Price 1 mg $1,050 Porcine Enterokinase, Lyophilized 100 IU Z02199 $80 Tumor Necrosis Factor (TNF)-α, murine 5 μg Z00414 $70 Ribonuclease Inhibitor 2,000 U Z02041 $43 10 μg $91 Tumor Necrosis Factor alpha (TNF)-α (mutant), 50 μg Moloney Murine Leukemia Virus (M-MLV) Reverse human Z00404 $260 10,000 U Z02040 Transcriptase (RNase H-) $59 1 mg $1,560 Glutathione S-Transferase (GST), Schistosoma japonicum Vascular Endothelial Growth Inhibitor (VEGI), 10 μg $129 1 mg Z02039 $70 Z02198
Hercules Endonuclease Protein Analysis human 50 μg $800 25,000 U Z02038 $130 Moloney Murine Leukemia Virus (M-MLV) Reverse 10,000 U Z02032 $39 Transcriptase Proteinase K 100 mg Z02003 $78 Kinases Enterokinase, Light Chain, Porcine 100 IU Z01003 $80 Urokinase, human 100 μg Z00054 $80
Protein Analysis Protein Kinases play important roles in cellular signaling pathways and GenScript provides a series of kinases aiming to accelerate various other complex processes involving phosphorylation. your drug discovery processes involving kinase targets. The dysregulation of kinases is often associated with GenScript continuously offers new kinases to meet your pathogenic pathways of many diseases, such as cancer, research needs. Hormones inflammatory diseases, neural disorders, and many metabolic disorders. Protein kinases have extraordinary potential as drug Hormones are produced by specialized glands, act as a chemical messenger that transports a signal from one cell to another, and they Catalog Proteins targets. can function at sites away from their releasing locations.
Product Overview: Product Overview:
Product Quantity Cat. No. Price Catalog Proteins Product Quantity Cat. No. Price 10 μg $78 Urokinase, human 100 μg Z00054 $80 Growth Hormone (GH), mouse 50 μg Z02192 $200 Enterokinase, Light Chain, Porcine 100 IU Z01003 $80 1 mg $1,300 Proteinase K 100 mg Z02003 $78 10 μg $39 Porcine Enterokinase, Lyophilized 100 IU Z02199 $80 Parathyroid Hormone (PTH) (1-84 PTH), human 50 μg Z02021 $129 PKCα 20 μg Z02204 $299 1 mg $800 SRC 20 μg Z02205 $299 Glucagon-Like Peptide (GLP)-1, human 10 μg Z00212 $70 AKT1 20 μg Z02206 $299 ACK1 20 μg Z02207 $299 CAMKK1 20 μg Z02208 $299 cAMP-dependent protein kinase catalytic subunit alpha isoform 1 20 μg Z02213 $299 5 μg $495 AMPK (A1/B1/G1), Active (Mammalian Expression System) Z02513 50 μg $2,970 5 μg $495 AMPK (A1/B1/G2), Active (Mammalian Expression System) Z02514 50 μg $2,970 5 μg $495 AMPK (A1/B2/G1), Active (Mammalian Expression System) Z02516 50 μg $2,970 5 μg $495 AMPK(A2/B1/G1), Active (Mammalian Expression System) Z02519 50 μg $2,970 5 μg $495 AMPK (A2/B1/G2), Active (Mammalian Expression System) Z02520 50 μg $2,970 5 μg $495 AMPK (A2/B2/G1), Active (Mammalian Expression System) Z02522 50 μg $2,970
Your Innovation Partner in Drug Discovery! - 67 - www.genscript.com - 68 - Virus Antigens Product Overview:
GenScript provides a comprehensive array of high purity and Varicella Zoster virus, and so on. All these proteins serve as Product Quantity Cat. No. Price high stability virus antigens, including Cytomegalovirus, excellent antigens in ELISA, Western Blots and in the rapid HCV NS3 Subtype 6a, Hepatitis C Virus Antigen, Recombinant 1 mg Z00080 $1,000 Epstein-Barr virus, Hepatitis A/…/E virus, Herpes Simplex virus, detection of relative virus seroconverters with minimal specificity HCV NS4 a+b (1658-1863), Hepatitis C Virus Antigen, Recombinant 1 mg Z00081 $1,300 HIV, Human T-Lymphocyte virus, Rubbella virus, SARS virus, problems. HCV NS5 Genotype 1, Hepatitis C Virus Antigen, Recombinant 1 mg Z00100 $420 HCV NS5 Genotype 2, Hepatitis C Virus Antigen, Recombinant 1 mg Z00107 $1,000 Product Overview: HCV NS5 Genotype 3, Hepatitis C Virus Antigen, Recombinant 1 mg Z00108 $1,000 HCV NS5 Genotype 6, Hepatitis C Virus Antigen, Recombinant 1 mg Z00109 $1,000 Product Quantity Cat. No. Price HCV NS5 Genotype 5, Hepatitis C Virus Antigen, Recombinant 1 mg Z00110 $1,000 Epstein-Barr Virus (HHV-4) EA Protein, Recombinant 1 mg Z02031 $1,000 100 μg $735 HCV NS5 Genotype 4, Hepatitis C Virus Antigen, Recombinant Z00111 Epstein-Barr Virus (HHV-4) mosaic EBNA2 Protein, Recombinant 1 mg Z02030 $1,000 500 μg $210 CMV Pp150 (UL32), CytomegaloVirus Antigen, Recombinant 1 mg Z02027 $1,000 HCV Nucleocapsid Genotype 1, Hepatitis C Virus Antigen, Recombinant 1 mg Z00130 $1,000 CMV Pp28 (UL99), CytomegaloVirus Antigen, Recombinant 1 mg Z02026 $1,000 HCV Nucleocapsid Genotype 6a, Hepatitis C Virus Antigen, Recombinant 1 mg Z00133 $1,000 SARS-Associated Coronavirus Spike mosaic S (N) 1 mg Z02025 $1,000 HCV Nucleocapsid Genotype 5, Hepatitis C Virus Antigen, Recombinant 1 mg Z00134 $1,000 SARS-Associated Coronavirus Nucleocapsid (1-49/192-220) 1 mg Z02024 $1,000 HCV Nucleocapsid Genotype 4, Hepatitis C Virus Antigen, Recombinant 1 mg Z00135 $1,000 Combined Hepatitis C Virus (HCV) 1 mg Z02018 $1,000 HTLV-1 p24 Core, Human T-Lymphocyte Virus Antigen, Recombinant 1 mg Z00145 $1,000
SARS-Associated Coronavirus E 1 mg Z02017 $1,000 HTLV-1 Envelope, Human T-Lymphocyte Virus Antigen, Recombinant 1 mg Z00147 $1,000 Protein Analysis SARS-Associated Coronavirus M 1 mg Z02016 $1,000 Rubella Virus Capsid C 1 mg Z00167 $1,000 Hepatitis E Virus (HEV) ORF2/ORF3 1 mg Z02015 $1,000 Rubella Virus E1 Mosaic 1 mg Z00176 $1,000 Human Immunodeficiency Virus (HIV)-1, 2 Envelope 1 mg Z02014 $1,300 Rubella Virus E2 1 mg Z00177 $1,000 Human Immunodeficiency Virus (HIV) Type 1 mg Z02013 $150 O Envelope (synthetic) Human Immunodeficiency Virus (HIV)-2 gp36 Protein Analysis Protein 1 mg Z02012 $150 Envelope (synthetic) Other Catalog Proteins Human Immunodeficiency Virus (HIV)-2 gp36 Envelope 1 mg Z02011 $1,000 Human Immunodeficiency Virus (HIV)-1 Envelope 1 mg Z02010 $1,000 Product Overview: HIV-1 p24 Core, Human Immunodeficiency Virus Antigen, Recombinant 1 mg Z00150 $1,000
HCV NS5 (2061-2302), Hepatitis C Virus Antigen, Recombinant Z00102 Catalog Proteins 1 mg $1,000 Product Quantity Cat. No. Price HCV NS3 Subtype 2c, Hepatitis C Virus Antigen, Recombinant Z00069 1 mg $1,000 T4 Gene 32 Protein 100 μg Z02042 $39 HCV NS3 Subtype 2b, Hepatitis C Virus Antigen, Recombinant Z00068 1 mg $1,000 10 mg $79 HCV NS3 Subtype 1c, Hepatitis C Virus Antigen, Recombinant Z00065 1 mg $1,000 Purified Protein A 50 mg Z02201 $350 HSV-2 gG, Herpes Simplex Virus Antigen, Recombinant Z00061 1 mg $1,000 500 mg $2,500 HSV-2 gD, Herpes Simplex Virus Antigen, Recombinant Z00060 1 mg $1,000 Streptavidin 5 mg Z02043 $150 Catalog Proteins HSV-1 gG, Herpes Simplex Virus Antigen, Recombinant Z00059 1 mg $1,000 Protein G 5 mg Z02007 $125 HSV-1 gD, Herpes Simplex Virus Antigen, Recombinant 1 mg Z00058 $1,000 Hepatitis C Virus (HCV) NS3 1 mg Z00042 $1,000 , HBV HBe, Hepatitis B Virus Antigen, Recombinant 1 mg Z00031 $1,000 For more information on Catalog Proteins visit http://www.genscript.com/protein_list.html HBV Core, Hepatitis B Virus Antigen, Recombinant 1 mg Z00029 $1,000 VZV ORF9, Varicella Zoster Virus Antigen, Recombinant 1 mg Z00013 $1,000 CMV Pp65 (UL83), CytomegaloVirus Antigen, Recombinant 1 mg Z00010 $1,000 CMV Pp38 (UL80a), CytomegaloVirus Antigen, Recombinant 1 mg Z00008 $1,000 Hepatitis A Virus (HAV) VP3 1 mg Z00005 $1,000 VZV ORF26, Varicella Zoster Virus Antigen, Recombinant 1 mg Z00014 $1,000 Epstein-Barr Virus (HHV)-4 p23 Protein, Recombinant 1 mg Z00018 $1,000 HAV P2C, Hepatitis A Virus Antigen, Recombinant 1 mg Z00022 $1,000 HAV P2C-P3A, Hepatitis A Virus Antigen, Recombinant 1 mg Z00023 $1,000 HAV P3C, Hepatitis A Virus Antigen, Recombinant 1 mg Z00024 $1,000 HAV VP1, Hepatitis A Virus Antigen, Recombinant 1 mg Z00025 $1,000 Hepatitis A Virus (HAV) VP1-P2A 1 mg Z00026 $420 HAV VP4-VP2, Hepatitis A Virus Antigen, Recombinant 1 mg Z00028 $1,000 SARS-Associated Coronavirus Spike Mosaic S (C) 1 mg Z00030 $1,000 HDV, Hepatitis D Virus Antigen, Recombinant 1 mg Z00032 $1,000 HEV ORF2, Hepatitis E Virus Antigen, Recombinant 1 mg Z00033 $1,000 SARS-Associated Coronavirus Nucleocapsid (1-49) 1 mg Z00037 $1,000 SARS-Associated Coronavirus Nucleocapsid (340-390) 1 mg Z00039 $1,000 SARS-Associated Coronavirus Spike Mosaic S (M) 1 mg Z00041 $1,000 HCV NS3 Subtype 5a, Hepatitis C Virus Antigen, Recombinant 1 mg Z00076 $1,000
Your Innovation Partner in Drug Discovery! - 69 - www.genscript.com - 70 - Custom Protein Services
GenScript takes your project directly from gene synthesis to Extensive recombinant protein production experience protein production! Our free rare codon analysis tool can We have delivered thousands of difficult proteins including determine whether your gene sequence is optimal, and at the trans-membrane proteins, secreted proteins, proteases, and same time explore means to boost your target protein expression. other enzymes at a success rate greater than 90%.
Services List BacPowerTM technology and FoldArtTM protein refolding technology Bacterial Protein Expression Hard-to-express and hard-todissolve proteins are specifically GenScript has developed BacPowerTM technologies to tackle tackled by our proprietary BacPowerTM technology and hard-to-express and hard-to-dissolve proteins. Guaranteed FoldArtTM protein refolding technology. delivery of 3 mg purified soluble protein, starting at only $2,200. From gene sythesis to protein expression and purification, Comprehensive services starting at $2,990, guaranted 10 mg purified protein. GenScript provides a directional streamlined service platform that delivers projects directly from gene synthesis, to protein Quotations and Ordering Yeast Protein Expression expression, and further to stable cell line generation, antibody GenScript's proprietary YeastHIGHTM technology combines production, and assay development. Protein Analysis all the advantages of bacterial and eukaryotic expression Quotations and orders may be placed by email, phone, or fax with either a formal PO (Purchase Order) or credit card. Please choose systems. Our yeast expression system employs stable and High quality services the most convenient ordering method. durable production strains that resemble mammalian protein GenScript provides high quality protein expression services to processing. meet your stringent requirements. We strive to produce high purity, high activity proteins in a timely fashion. The purity level Quotation Form: Obtainable on our website Baculovirus/Insect Cell Protein Expression of our deliverables has been over 95% with endotoxin level
Protein Analysis Protein GenScript has pioneered secretion methods for recombinant lower than 0.01 EU/μg. Email: [email protected] proteins om baculovirus-infected insect cells. With a capacity of producing proteins in large quantities up to 100 liters per Applications Phone: 1-877-436-7274 (Toll-Free); 1-732-885-9188 project, GenScript services suit to not only academic institutions GenScript has years of experience in protein expression and but also pharmaceutical and biotechnology industries. Fax: 1-732-210-0262; 1-732-885-5878
purification. Combining our expert specialists with industry Custom Protein Services leading technology and state-of-the-art facilities, we are ready Mammalian Cell Protein Expression Secured Web Server: https://www.genscript.com/ssl-bin/secure_data GenScript’s proprietary 293 and CHO suspension system to deliver projects involving any expression system, construct, platform promotes fast production and delivery of or purification procedure for your individual needs. recombinant proteins and monoclonal antibodies up to grams level. • Target validation • Enzyme characterization Large-scale Protein Production Service • High-throughput screening On top of large-scale purification service, our versatile and • Antibody production
Custom Protein Services reliable protein expression system, which includes • Structural biology studies fermentors, WAVE MixerTM, and bioreactors, allows • Eukaryotic protein analysis GenScript to provide proteins in gram levels to its clients in • NMR studies with isotope-labeled proteins both public and private research sectors, academia, and all • SAR (Structure-activity relationships) levels of the pharmaceutical industry. • Animal feed production • Environmental engineering Protein Purification and Characterization GenScript offers several methods for protein purification and characterization. We deliver proteins in different purity levels, allowing customers to choose the ideal level of purity for their intended downstream applications.
Competitive Advantages
Optimum GeneTM codon optimization technology for gene expression GenScript's advanced Optimum GeneTM codon optimization technology can optimize your gene sequence for highest possible level of gene expression and protein solubility. In addition, OptimumGeneTM algorithm optimizes a variety of parameters that are critical to transcription, translation, and protein folding.
Your Innovation Partner in Drug Discovery! - 71 - www.genscript.com - 72 - Chapter 4 Antibodies
THETM Elite Antibodies 75 MiniFresh® Antibodies 77 Primary Antibodies 89 Secondary Antibodies 179 Custom Antibody Services 180 - 75 THETM Elite Antibodies Antibodies THE • • • • • • requirements. antibodies thatmeetthemostdemandingresearch and drugdiscovery. and anti-His mAb Western blotof6×His-taggedproteinsdetectedwithTHE • The mostpreciseandeffective antibodies THE including THE GenScript providesabroadrangeofhigh-qualityantibodies, have beenemployedtodirectlydiagnoseandtreatdiseases. identifying andlocatingspecificproteins.Increasingly, antibodies effective toolsavailabletoresearcherswhenitcomes Reliable andwell-selectedantibodiesareamongthemost Overview Primary antibody: THE (GenScript, M0101),respectively Lane1-4: 25ng,12.56.253.13ngMultipletagprotein Antibody (GenScript, A00160, 1:10,000) Sencodary antibody:Goat Anti-Mouse IgG(H&L)[HRP]Polyclonal (GenScript, A00186) Ultra Stability— Ultra Reactivity— Ultra Affinity— Ultra Convenience— Ultra ClearBackground Ultra Specificity— Ultra Sensitivity— years conjugated antibodies exposed terminalandinternaltags antibodies inthemarket (ng) Loading etc. TM Elite Antibody seriesarethemostpreciseandeffective , thatcanbeappliedtoallareasinbiologicalresearch TM 501. .5 31 25.012.56.253.13 25.0 12.56.253.13 1 234 TM Elite Antibodies GenScript Elite Antibodies, Phospho-specific Antibodies, Ultra-low dissociationconstantKd TM Stable inlyophilizedformforatleasttwo Anti-His-tag Monoclonal Antibody (Mouse) Monoclonal Antibody Anti-His-tag Recognize andbindevenpartially No cross-reactivity More sensitivethanmostpopular No secondaryantibodyneededfor 1 234 Company Q Your Innovation PartnerinDrugDiscovery! (GenScript, M0101) Fused Tag-HHHHHH TM
THE Western blotdetectionfordifferentHis-fusionproteinswith Antibody (GenScript, A00160, 1:10,000) Secondary Antibody: Goat Anti-Mouse IgG(H&L)[HRP]Polyclonal (GenScript, A00186) Primary antibody: THE Lane 10:SmartHis-taggedProteinStandard (GenScript,MM0904) Lane 3,6,9:Negativecontrol Lane 7-8:100ngand50internalHis-fusionprotein Lane 4-5:100ngand50N-terminalHis-fusionprotein Lane 1-2:100ngand50C-terminalHis-fusionprotein GenScript's THE fusion-protein denaturation,oranyotherobstacles?Order Are youconcernedaboutsmallsamples,partiallyexposedtags, corresponding immunogens. from thecelllinesthatshowhighestspecificityagainst solve theproblemsyouencounterinyourresearch. THE bestqualityintheindustry. To produce THE THE clones wereselected. THE antibodies, themostproductiveandstablehybridomacell MiniFresh antibodies thatmeetthemostdemandingresearchrequirements. THE purity andquality. antibodies arethoroughlytestedtoensurethehighestlevelof determine yourneedsandchoosethebestmatch.Our package andsoldfor$50toreduceyourresearchcost.Simply TM TM TM 100 50NCM anti-HismAb standsfor THE unmistakable, THE irreplaceable,and Eliteantibodyseriesarethemostpreciseandeffective 1 2345678910* ® antibodieshavebeenlaunchedasthetrialsize TM Eliteantibodies,andyouareonyourwayto TM Anti-His-tag Monoclonal Antibody (Mouse) Monoclonal Antibody Anti-His-tag TM eliteantibodiesarethenisolated (ng) Loading TM elite Product Overview: THE THE THE THE THE THE THE THE THE THE THE THE THE THE THE THE NA: Not Available. THE Product THE For moreinformationonTHE TM TM TM TM TM TM TM TM TM TM TM TM TM TM TM TM TM TM Mouse Anti-DYKDDDDK mAb(HRP) Mouse Anti-DYKDDDDK mAb(Biotin) Mouse Anti-DYKDDDDK mAb Anti- Anti- mAb Anti-His-tag mAb [HRP] Anti-His-tag mAb [Biotin] Anti-His-tag (Mouse) mAb Anti-HA-tag Anti-HA-tag [HRP]mAb(Mouse) Anti-HA-tag [Biotin]mAb(Mouse) Anti-GST-tag [Biotin]mAb(Mouse) Anti-GST-tag mAb(Mouse) Anti-GST-tag [HRP]mAb(Mouse) (Mouse) mAb Anti-c-Myc-tag Anti-c-Myc-tag [HRP]mAb(Mouse) Anti-c-Myc-tag [Biotin]mAb(Mouse) Anti- β α β -actin [HRP]mAb(Mouse) -tubulin mAb -actin mAb(Mouse) TM Elite Antibodies, visit ELISA, WB,IP ELISA, WB,IP ELISA, WB,IP ELISA, WB ELISA, WB ELISA, WB ELISA, WB,IF, FACS, IP ELISA, WB ELISA, WB ELISA, WB,IP ELISA, WB ELISA, WB ELISA, WB,IP ELISA, WB,IP ELISA, WB,IP ELISA, WB,IF, IP ELISA, WB,IF, IP ELISA, WB,IF, IP Applications http://www.genscript.com/THE_antibody.html NA NA NA human, goat,fish, Mouse, rabbit,chicken, NA NA NA NA NA NA NA NA NA NA NA NA NA NA Species Reactivity ect. Quantity 100 100 100 200 200 100 100 100 100 100 100 100 200 500 200 200 200 200 200 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g A01428 A01429 A00187 A00702 A00730 A01410 A00186 A00612 A00613 A01244 A01296 A01297 A00867 A00865 A00866 A00704 A00863 A00864 Cat. No. www.genscript.com $335 $335 $330 $333 $225 $375 $410 $410 $330 $335 $335 $333 $750 $333 $333 $333 Price $311 $311 $311 $69 $74 $74 $69 $74 $69 $74 $74
- 76
Elite Antibodies Elite THE Antibodies TM MiniFresh® Antibodies
GenScript provides small-package antibodies to keep your M 1 2 3 4 5 6 7 8 Product Applications Species Reactivity Quantity Cat. No. Price options open and your supplies fresh. In addition of achieving AHA1 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat 40 μg A01278 $50 ® extraordinary performance, all MiniFresh antibodies are sold 120KD - AKR1C2 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A01054 $50 for $50 to help you reduce your research cost. 85KD - Akt Antibody (Ab-308), pAb, Rabbit WB, IHC Human 40 μg A00304 $50 60KD - Akt Antibody (Ab-473), pAb, Rabbit WB, IHC Human 40 μg A00301 $50 473 Human, mouse 40KD - Akt Antibody (Ser ), pAb, Rabbit ELISA, WB 40 μg A00959 $50 AKT1 Antibody (Ab-450), pAb, Rabbit WB, IHC, IF Human 40 μg A01293 $50 AKT1/AKT2 Antibody (Ab-308/309), 22KD - IHC Human 40 μg A01252 $50 pAb, Rabbit AKT1/AKT2/AKT3 Antibody (Ab-315/316/312), IHC Human, mouse, rat 40 μg A01227 $50 pAb, Rabbit 100 50 20 10 100 50 20 10 (ng) Akt2 Antibody (Ab-474), pAb, Rabbit WB, IHC Human 40 μg A00441 $50 Alpha Internexin Antibody, pAb, Rabbit Human, mouse, rat* 40 μg A01397 $50 Western blot analysis of DYKDDDDK tagged fusion proteins expressed ELISA, WB AMPK Alpha-1 Chain Antibody, pAb, Rabbit NA 40 μg A00893 $50 in E. coli cell lysate using DYKDDDDK Antibody, pAb, Rabbit (GenScript, ELISA, WB AMPK1 Antibody (Ab-174), pAb, Rabbit Human 40 μg A00664 $50 A00170, 1 μg/ml) WB, IHC, IF Amyloid Precursor Protein Antibody (292-312), ELISA, WB Human, mouse 40 μg A00693 $50 pAb, Rabbit Lane M: EasyWestern Protein Standard (GenScript, Cat. No. MM0908) Amyloid Precursor Protein Antibody (44-63), Lane 1-4: Using C-terminal DYKDDDDK-tagged fusion protein as ELISA, WB, IF Human, mouse 40 μg A00692 $50 Immunofluorescent analysis of HEK293 cells transfected with antigens pAb, Rabbit Flag-tagged CD4 protein using DYKDDDDK-tag Antibody (GenScript, Lane 5-8: Using N-terminal DYKDDDDK-tagged fusion protein as Amyloid Precursor Protein Antibody (653-662), ELISA, WB, IF Human, mouse 40 μg A00694 $50 A00170, 10 μg/ml) antigens pAb, Rabbit The signal was developed with IRDyeTM 800 Conjugated Goat Amyloid Precursor Protein Antibody (671-685), ELISA, WB, IF Human mouse 40 μg A00695 $50 Anti-Rabbit IgG. pAb, Rabbit Amyloid Precursor Protein Antibody (747-761), ELISA, WB Human, mouse 40 μg A00696 $50 Antibodies pAb, Rabbit Amyloid Precursor Protein Antibody (Ab-730), ELISA, WB Human 40 μg A00966 $50 pAb, Rabbit Product Overview: Annexin II Antibody, pAb, Rabbit WB Human* 40 μg A01471 $50
Antibodies AP2M1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01212 $50 Product Applications Species Reactivity Quantity Cat. No. Price AP2M1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01247 $50 14-3-3 ζ Antibody (Ab-58), pAb, Rabbit WB, IHC Human, mouse 40 μg A00662 $50 APE1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01205 $50 4E-BP1 Antibody (Ab-36), pAb, Rabbit WB, IHC Human 40 μg A00460 $50 APH1 Antibody, pAb, Rabbit ELISA, WB Human, mouse 40 μg A00884 $50 4E-BP1 Antibody (Ab-45), pAb, Rabbit WB, IHC, IF Human 40 μg A00461 $50 ApoM Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00954 $50 58K Golgi protein Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01433 $50 APP FM Antibody (339-348), pAb, Rabbit ELISA, WB Human 40 μg A00700 $50
5HT2A Receptor Antibody, pAb, Rabbit ELISA, WB Human, mouse 40 μg A01177 $50 ASK1 Antibody (Ab-83), pAb, Rabbit WB, IHC, IF Human 40 μg A00422 $50 MiniFresh 5HT3A Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01210 $50 ASK1 Antibody (Ab-966), pAb, Rabbit IHC, IF Human 40 μg A00425 $50 5HT5A Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01209 $50 ATF-2 Antibody (Ab-51/69), pAb, Rabbit WB, IHC Human 40 μg A00258 $50 ATF-2 Antibody (Ab-55/73), pAb, Rabbit WB, IHC 40 μg A00260 $50 ABL1/2 Antibody (Ab-393/429), pAb, Rabbit IHC,IF Human 40 μg A01262 $50 Human ® Antibodies Antibodies ® ADAM9 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat 40 μg A01313 $50 ATF-2 Antibody (Ab-62/44), pAb, Rabbit WB, IHC, IF Human 40 μg A00257 $50 ADD1 Antibody (Ab-726), pAb, Rabbit WB, IHC,IF Human 40 μg A00925 $50 ATF-2 Antibody (Ab-71/53), pAb, Rabbit WB, IHC, IF Human 40 μg A00259 $50 AFX Antibody (Ab-197), pAb, Rabbit WB, IHC Human 40 μg A00445 $50 ATF-2 Antibody (Ab-94/112), pAb, Rabbit WB, IHC Human 40 μg A00261 $50 ATF-4 Antibody (Ab-245), pAb, Rabbit 40 μg A00300 $50 MiniFresh AHA1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01197 $50 IHC Human AHA1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01245 $50 ATM Antibody (Ab-1981), pAb, Rabbit WB, IF Human 40 μg A01222 $50 ATP1A1 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01483 $50 ATR Antibody (Ab-428), pAb, Rabbit IHC Human 40 μg A01253 $50 AU1-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00628 $50 Avi-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00674 $50 BACE1 Antibody (26-45), pAb, Rabbit ELISA, WB Human 40 μg A00878 $50 BACE1 Antibody (46-65), pAb, Rabbit ELISA, WB Human 40 μg A00879 $50 BACE1 Antibody (485-501), pAb, Rabbit ELISA, WB Human 40 μg A00880 $50 BAD Antibody (Ab-112), pAb, Rabbit WB, IHC Human 40 μg A00309 $50 BAD Antibody (Ab-136), pAb, Rabbit WB, IHC Human 40 μg A00310 $50 BAD Antibody (Ab-155), pAb, Rabbit WB, IHC Human 40 μg A00311 $50 BCL-2 Antibody (Ab-56), pAb, Rabbit WB, IHC, IF Human 40 μg A00306 $50 BCL-2 Antibody (Ab-70), pAb, Rabbit WB, IHC Human 40 μg A00307 $50 BCL-XL Antibody (Ab-62), pAb, Rabbit WB Human 40 μg A00308 $50
Your Innovation Partner in Drug Discovery! - 77 - www.genscript.com - 78 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price Bcr Antibody (Ab-177), pAb, Rabbit WB, IF Human 40 μg A00589 $50 CNPase Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* 40 μg A01308 $50 Human, bovine, goat, Cofilin Antibody (Ab-3), pAb, Rabbit WB, IHC Human 40 μg A00447 $50 Beta-1,3-GalTase 2 Antibody, pAb, Rabbit ELISA, WB 40 μg A00918 $50 sheep, chicken Cofilin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse* 40 μg A01239 $50 BIM Antibody (Ab-69), pAb, Rabbit WB, IHC, Human, mouse 40 μg A00514 $50 Cofilin Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01277 $50 BLBP Antibody, pAb, Rabbit ELISA, WB Human 40 μg A01422 $50 Cofilin1/Cofilin2 Antibody (Ab-88), pAb, Rabbit WB, IHC, IF Human 40 μg A01254 $50 BMP-7 Antibody (1G10H5), mAb, Mouse ELISA, WB NA 40 μg A01286 $50 Connexin 30 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00892 $50 BMP-7 Antibody (2A5F3), mAb, Mouse ELISA, WB Human 40 μg A01285 $50 Connexin 32 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat 40 μg A01312 $50 BMP-7 Antibody (2C2F8), mAb, Mouse ELISA, WB Human 40 μg A01283 $50 Connexin 43 Antibody (Ab-367), pAb, Rabbit WB, IHC Human 40 μg A00544 $50 BMP-7 Antibody (4C3G8), mAb, Mouse ELISA, WB Human 40 μg A01284 $50 Cortactin Antibody (Ab-421), pAb, Rabbit IHC Human, mouse 40 μg A00521 $50 BRCA1 Antibody (Ab-1423), pAb, Rabbit WB, IHC Human 40 μg A00567 $50 Cortactin Antibody (Ab-466), pAb, Rabbit WB, IHC Human, mouse 40 μg A00520 $50 B-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00638 $50 COX IV Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01396 $50 c-Abl Antibody (Ab-412), pAb, Rabbit IHC Human 40 μg A00442 $50 COX IV Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01402 $50 Calbindin Antibody, pAb, Rabbit ELISA, WB, IHC Human* 40 μg A01268 $50 Cre Recombinase Antibody, mAb, Mouse ELISA, WB NA 40 μg A00888 $50 Calcineurin A Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01199 $50 Creatine kinase B Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01458 $50 Calcineurin A Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01200 $50 Creatine kinase M Antibody, pAb, Rabbit WB Mouse, rat* 40 μg A01472 $50 Calnexin Antibody, pAb, Rabbit ELISA, WB Human 40 μg A01234 $50 Creatine kinase MB Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01456 $50 Calnexin Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01240 $50 CREB Antibody (Ab-129), pAb, Rabbit WB, IHC Human 40 μg A00519 $50 Calnexin Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01192 $50 CREB Antibody (Ab-133), pAb, Rabbit WB, IHC Human 40 μg A00286 $50 Calreticulin Antibody, pAb, Rabbit WB Human* 40 μg A01443 $50 CREB Antibody (Ab-142), pAb, Rabbit IHC Human 40 μg A01182 $50 CaMKII Antibody (Ab-286), pAb, Rabbit WB, IF Human, mouse 40 μg A00515 $50 CT-1 Antibody, mAb, Mouse ELISA, WB NA 40 μg A01060 $50 CARM1 Antibody (Ab-228), pAb, Rabbit WB, IF Human 40 μg A00932 $50 CXCR2 Antibody, pAb, Rabbit ELISA, WB, IHC NA 40 μg A00993 $50 Caspase 10 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01280 $50 CXCR4 Antibody, pAb, Rabbit WB Human, mouse* 40 μg A00995 $50 Caspase 10 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01232 $50 Cytochrome P450 2C23 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00891 $50 Antibodies Caspr2 Antibody, pAb, Rabbit WB Mouse,rat* 40 μg A01426 $50 DARPP-32 Antibody, pAb, Rabbit WB Mouse, rat* 40 μg A01424 $50 Catalase Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* 40 μg A01202 $50 DDDDK-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00676 $50 Catalase Antibody, pAb, Rabbit ELISA, WB Mouse* 40 μg A01188 $50 DJ-1 Antibody, pAb, Rabbit ELISA, WB, IHC Human* 40 μg A01207 $50 Catalase Antibody, pAb, Rabbit ELISA, WB, IP Human, mouse* 40 μg A01187 $50 DJ-1 Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01208 $50
Antibodies Catenin Antibody (Ab-33), pAb, Rabbit WB, IHC, IF Human 40 μg A00584 $50 DNA PKcs Antibody (Ab-2609), pAb, Rabbit WB Human, mouse 40 μg A00591 $50 Caveolin-1 Antibody (Ab-14), pAb, Rabbit WB Human, mouse 40 μg A00413 $50 Doublecortin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat* 40 μg A01303 $50 CBP-tag Antibody, pAb, Rabbit ELISA, WB Mouse, rat, bovine, rabbit 40 μg A00635 $50 DYKDDDDK-tag Antibody, pAb, Rabbit ELISA, WB, IF, FACS NA 40 μg A00170 $50 CCR3 Antibody, pAb, Rabbit ELISA, IHC NA 40 μg A00977 $50 E2-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00630 $50 CCR4 Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00978 $50 EB1 Antibody, pAb, Rabbit WB Human 40 μg A00678 $50 CCR5 Antibody, pAb, Rabbit ELISA, IHC NA 40 μg A00979 $50 EGFR Antibody (Ab-1070), pAb, Rabbit WB, IHC Human 40 μg A00344 $50
CDC2 Antibody (Ab-15), pAb, Rabbit WB, IHC, IF Human 40 μg A00565 $50 EGFR Antibody (Ab-1092), pAb, Rabbit WB, IHC Human 40 μg A00346 $50 MiniFresh cdc2 Antibody (Ab-19), pAb, Rabbit IHC Human 40 μg A01295 $50 EGFR Antibody (Ab-1110), pAb, Rabbit WB, IHC Human 40 μg A00538 $50 cdc25A Antibody (Ab-76), pAb, Rabbit WB Human 40 μg A00446 $50 EGFR Antibody (Ab-1172), pAb, Rabbit WB Human 40 μg A00661 $50 cdc25C Antibody (Ab-216), pAb, Rabbit WB, IHC, IF Human EGFR Antibody (Ab-1197), pAb, Rabbit WB Human 40 μg A00578 $50 40 μg A00433 $50 ® Antibodies Antibodies ® CDK5 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01438 $50 EGFR Antibody (Ab-678), pAb, Rabbit WB Human 40 μg A00666 $50 CDK6 Antibody (Ab-13), pAb, Rabbit IHC,IF Human 40 μg A01264 $50 EGFR Antibody (Ab-869), pAb, Rabbit WB, IHC Human 40 μg A00577 $50 CDK6 Antibody (Ab-24), pAb, Rabbit IHC Human 40 μg A01265 $50 eIF2α Antibody (Ab-51), pAb, Rabbit WB, IHC, IF Human 40 μg A00518 $50 NA eIF4E Antibody (Ab-209), pAb, Rabbit WB, IHC, IF Human 40 μg A00574 $50 MiniFresh cGFP-tag Antibody, mAb, Mouse ELISA, WB 40 μg A00185 $50 Chk1 Antibody (Ab-317), pAb, Rabbit WB, IHC Human 40 μg A00608 $50 eIF4G Antibody (Ab-1232), pAb, Rabbit WB, IHC, IF Human 40 μg A01228 $50 Chk1 Antibody (Ser280), pAb, Rabbit ELISA, WB Human* 40 μg A01179 $50 Elk-1 Antibody (Ab-383), pAb, Rabbit WB, IHC Human 40 μg A00198 $50 Chk2 Antibody (Ab-33), pAb, Rabbit IHC Human 40 μg A01261 $50 Elk-1 Antibody (Ab-389), pAb, Rabbit IHC, IF Human 40 μg A00266 $50 Chk2 Antibody (Ab-68), pAb, Rabbit WB, IHC Human 40 μg A00388 $50 Elk-1 Antibody (Ab-417), pAb, Rabbit IHC Human 40 μg A00592 $50 CHRNA7 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01420 $50 eNOS Antibody (Ab-1177), pAb, Rabbit WB, IF Human 40 μg A01152 $50 c-Jun Antibody (Ab-170), pAb, Rabbit WB, IHC Human 40 μg A00587 $50 Enterokinase Antibody, mAb, Mouse ELISA, WB NA 40 μg A00889 $50 c-Jun Antibody (Ab-239), pAb, Rabbit WB, IHC Human 40 μg A00235 $50 Ephrin-B2 Antibody (Ab-316), pAb, Rabbit WB Human 40 μg A00669 $50 c-Jun Antibody (Ab-243), pAb, Rabbit WB, IHC Human 40 μg A00238 $50 Ephrin-B2 Antibody (Ab-330), pAb, Rabbit WB, IF Human 40 μg A00670 $50 c-Jun Antibody (Ab-63), pAb, Rabbit WB Human, mouse 40 μg A00580 $50 ERAB Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01095 $50 c-Jun Antibody (Ab-73), pAb, Rabbit WB, IHC Human 40 μg A00197 $50 ERK2 Antibody, pAb, Rabbit ELISA, WB, FACS, IP Human, mouse, rat* 40 μg A01194 $50 c-Jun Antibody (Ab-91), pAb, Rabbit WB, IHC, IF Human 40 μg A00231 $50 Estrogen Receptor Beta Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00939 $50 c-Jun Antibody (Ab-93), pAb, Rabbit WB, IHC Human 40 μg A00233 $50 Estrogen Receptor-α Antibody (Ab-104), pAb, WB, IHC Human 40 μg A00316 $50 c-Kit Antibody (Ab-721), pAb, Rabbit WB Human 40 μg A01166 $50 Rabbit c-Myc-tag Antibody, pAb, Rabbit ELISA, WB, IF, IP NA 40 μg A00172 $50
Your Innovation Partner in Drug Discovery! - 79 - www.genscript.com - 80 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price Estrogen Receptor-α Antibody (Ab-106), HA-tag Antibody, pAb, Goat ELISA, WB, IF, IP NA 40 μg A00168 $50 WB, IHC Human 40 μg A00317 $50 pAb, Rabbit HAT-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00636 $50 Estrogen Receptor-α Antibody (Ab-118), HDAC1 Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01279 $50 WB, IHC Human 40 μg A00322 $50 pAb, Rabbit HDAC2 Antibody (Ab-394), pAb, Rabbit WB, IHC, IF Human 40 μg A00428 $50 Estrogen Receptor-α Antibody (Ab-167), HDAC2 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01178 $50 WB, IHC Human 40 μg A00323 $50 pAb, Rabbit HDAC4 Antibody (Ab-632), pAb, Rabbit WB, IF Human 40 μg A00429 $50 E-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00631 $50 HDAC4/HDAC5/HDAC9 Antibody WB, IHC, IF Human, mouse 40 μg A01257 $50 Ezrin Antibody (Ab-353), pAb, Rabbit WB Human 40 μg A00392 $50 (Ab-246/259/220), pAb, Rabbit Ezrin Antibody (Ab-567), pAb, Rabbit WB Human 40 μg A00457 $50 HDAC5 Antibody (Ab-498), pAb, Rabbit WB, IHC Human, mouse 40 μg A00430 $50 FAK Antibody (Ab-861), pAb, Rabbit WB, IHC Human 40 μg A00350 $50 HDAC8 Antibody (Ab-39), pAb, Rabbit WB, IHC Human, mouse 40 μg A00431 $50 FAK Antibody (Ab-925), pAb, Rabbit WB, IHC, IF Human 40 μg A00434 $50 HER2 Antibody (Ab-1221,1222), pAb, Rabbit WB, IHC Human 40 μg A00327 $50 FEN-1 Antibody, pAb, Rabbit WB Human* 40 μg A01421 $50 HER2 Antibody (Ab-1248), pAb, Rabbit WB, IHC Human 40 μg A00331 $50 FEN-1 Antibody, pAb, Rabbit WB Human, mouse, rat. 40 μg A01461 $50 HER2 Antibody (Ab-877), pAb, Rabbit WB, IHC Human 40 μg A00325 $50 FGF Receptor 1 Antibody (Ab-154), pAb, HER3/ErbB3 Antibody (Ab-1328), pAb, Rabbit WB, IHC, IF Human 40 μg A01255 $50 WB Human, mouse 40 μg A01155 $50 Rabbit His-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00174 $50 FGF-16 Antibody (8B6D8), mAb, Mouse ELISA, WB NA 40 μg A01468 $50 Histone 2B Antibody, pAb, Rabbit ELISA, WB Human 40 μg A01174 $50 FGF-16 Antibody (8D6F2), mAb, Mouse ELISA, WB NA 40 μg A01469 $50 Histone H2A Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01173 $50 FGF-16 Antibody (9D6B4), mAb, Mouse ELISA, WB NA 40 μg A01470 $50 Histone H2A.X Antibody (Ab-139), pAb, Rabbit WB, IHC Human 40 μg A00529 $50 FGF-6 Antibody, mAb, Mouse ELISA, WB NA 40 μg A01411 $50 Histone H3.1 Antibody (Ab-10), pAb, Rabbit WB, IF Human 40 μg A00426 $50 FGF-Acidic Antibody (5F12C10), mAb, Mouse ELISA, WB NA 40 μg A01282 $50 Histone H4 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A01176 $50 FGF-Acidic Antibody (5F5G8), mAb, Mouse ELISA, WB NA 40 μg A01281 $50 hnRNP C1/C2 Antibody, pAb, Rabbit WB Human 40 μg A01484 $50 Fibrillarin Antibody, pAb, Rabbit WB Human* 40 μg A01462 $50 HRP Antibody (Horseradish Peroxidase), ELISA NA 200 μg A00619 $50 FKHR Antibody (Ab-256), pAb, Rabbit WB, IHC, IF Human 40 μg A00427 pAb, Rabbit $50 Antibodies FKHR Antibody (Ab-319), pAb, Rabbit WB, IHC Human 40 μg A00444 $50 HSF1 Antibody (Ab-303), pAb, Rabbit WB, IHC Human 40 μg A00610 $50 FKHRL1 Antibody (Ab-253), pAb, Rabbit WB, IHC, IF Human, mouse 40 μg A00450 $50 HSF1 Antibody (Ab-307), pAb, Rabbit WB, IHC Human 40 μg A00671 $50 FOXA1 Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01389 $50 HSP27 Antibody (Ab-15), pAb, Rabbit WB, IHC Human 40 μg A00432 $50 G3BP-1 Antibody (Ab-232), pAb, Rabbit WB, IHC Human 40 μg A00404 $50 HSP27 Antibody (Ab-78), pAb, Rabbit WB, IHC Human 40 μg A00560 $50
Antibodies Gab1 Antibody (Ab-627), pAb, Rabbit WB, IHC Human 40 μg A00512 $50 HSP27 Antibody (Ab-82), pAb, Rabbit WB, IHC Human 40 μg A00558 $50 GABRB1 Antibody (Ab-434), pAb, Rabbit WB Human 40 μg A01231 $50 HSP27 Antibody, pAb, Rabbit ELISA, WB, FACS Human 40 μg A01378 $50 GAD65 Antibody, pAb, Rabbit WB NA 40 μg A01496 $50 HSP40 Antibody, pAb, Rabbit WB Human, mouse* 40 μg A01241 $50 GAD65+GAD67 Antibody, pAb, Rabbit WB Mouse, rat* 40 μg A01437 $50 HSP70 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01243 $50 GAD67 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01440 $50 HSP70 Antibody, pAb, Rabbit ELISA, WB, FACS Human, mouse* 40 μg A01236 $50 GAP43 Antibody (Ab-41), pAb, Rabbit WB, IHC, IF Mouse, rat* 40 μg A01046 $50 HSP70 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* 40 μg A01242 $50
GAP-43 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat, goat 40 μg A01414 $50 HSP90B Antibody (Ab-254), pAb, Rabbit WB, IHC, IF Human 40 μg A00672 $50 MiniFresh GAP-43 Antibody, pAb, Rabbit WB Rabbit, chicken, hamster 40 μg A01441 $50 HSV-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00624 $50 GAPDH Antibody, pAb, Goat ELISA, WB bovine, swine, fish, E. coli 40 μg A00191 $50 HtrA2 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01427 $50 GATA1 Antibody (Ab-142), pAb, Rabbit ICAM-1 Antibody (Ab-512), pAb, Rabbit WB, IHC, IF Human 40 μg A00270 $50 WB Human 40 μg A01038 $50 ® Antibodies Antibodies ® GATA1 Antibody (Ab-310), pAb, Rabbit WB Human 40 μg A00273 $50 IDO Antibody, pAb, Rabbit WB NA 40 μg A00887 $50 Geminin Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01251 $50 IDO Antibody, pAb, Rabbit ELISA, WB NA 40 μg A01053 $50 Geminin Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01246 $50 IGF-1R Antibody (Ab-1161), pAb, Rabbit WB, IHC Human 40 μg A00380 $50 GFAP Antibody, pAb, Rabbit IGF-1R Antibody (Ab-1165, 1166), pAb, Rabbit MiniFresh ELISA, WB, IHC Human, rat* 40 μg A01309 $50 WB Human 40 μg A00383 $50 GFP Antibody, pAb, Rabbit ELISA, WB, IP NA 40 μg A01388 $50 IGF-1R Antibody (Ab-1346), pAb, Rabbit WB, IHC Human 40 μg A00927 $50 Glu-Glu-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00627 $50 IKKα Antibody (Ab-23), pAb, Rabbit WB, IHC Human 40 μg A00421 $50 GluR1 Antibody (Ab-849), pAb, Rabbit WB Human, mouse 40 μg A01043 $50 IL-1 beta Antibody (7C10B9), mAb, Mouse ELISA NA 40 μg A01487 $50 Glutamine Synthetase Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat 40 μg A01305 $50 IL-1 beta Antibody (6B1G11), mAb, Mouse ELISA, WB NA 40 μg A01485 $50 GM-CSF Antibody (A01287.01), mAb, Mouse ELISA, WB NA 40 μg A01287 $50 IL-8 Antibody, mAb, Mouse ELISA, WB NA 100 μg A00044 $50 GM-CSF Antibody (A01290.01), mAb, Mouse ELISA, WB NA 40 μg A01290 $50 IL-8 Antibody, pAb, Goat ELISA, WB Human 40 μg A00158 $50 GPR30 Antibody, pAb, Rabbit ELISA, WB, IHC Human 40 μg A01074 $50 Integrin β3 Antibody (Ab-773), pAb, Rabbit WB, IHC Human 40 μg A00386 $50 GSK3α Antibody (Ab-21), pAb, Rabbit WB, IHC, IF Human 40 μg A00210 $50 Integrin β3 Antibody (Ab-785), pAb, Rabbit WB Human 40 μg A01167 $50 GSK3β Antibody (Ab-9), pAb, Rabbit WB, IHC, IF Human 40 μg A00196 $50 IP-10 Antibody, mAb, Mouse ELISA, WB NA 100 μg A00163 $50 GST-tag Antibody, pAb, Goat ELISA, WB NA 40 μg A01379 $50 IRS-1 Antibody (Ab-312), pAb, Rabbit WB Human 40 μg A01151 $50 GST-tag Antibody, pAb, Rabbit ELISA, WB Schistosoma japonicum 40 μg A00097 $50 IRS-1 Antibody (Ab-636), pAb, Rabbit WB, IHC, IF Human 40 μg A00575 $50 H1N1 PB2 Antibody, pAb, Rabbit WB Influenza A virus (H1N1) 40 μg A01464 $50 IRS-1 Antibody (Ab-639), pAb, Rabbit WB, IF Human 40 μg A01042 $50 HA-Tag Antibody, mAb, Mouse ELISA, WB NA 40 μg A00189 $50 IκB-α Antibody (Ab-32, 36), pAb, Rabbit WB, IHC, IF Human 40 μg A00609 $50
Your Innovation Partner in Drug Discovery! - 81 - www.genscript.com - 82 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price IκB-α Antibody (Ab-42), pAb, Rabbit WB, IHC Human 40 μg A00453 $50 NF-κB p105/p50 Antibody (Ab-907), WB, IHC Human 40 μg A00228 $50 IκB-β Antibody (Ab-23), pAb, Rabbit WB, IHC Human 40 μg A00928 $50 pAb, Rabbit JAK1 Antibody (Ab-1022), pAb, Rabbit WB, IHC Human 40 μg A00418 $50 NF-κB p105/p50 Antibody (Ab-927), WB, IF Human 40 μg A00929 $50 JAK2 Antibody (Ab-1007), pAb, Rabbit WB Human, mouse 40 μg A01185 $50 pAb, Rabbit JAK2 Antibody (Ab-221), pAb, Rabbit IHC Human 40 μg A00419 $50 NF-κB p105/p50 Antibody (Ab-932), WB, IHC Human 40 μg A00555 $50 Jak2 Antibody (Ab-570), pAb, Rabbit IHC Human 40 μg A01259 $50 pAb, Rabbit JunB Antibody (Ab-259), pAb, Rabbit WB, IHC Human 40 μg A00256 $50 NF-κB p65 Antibody (Ab-254), pAb, Rabbit IHC Human 40 μg A00581 $50 JunB Antibody (Ab-79), pAb, Rabbit IHC, IF Human 40 μg A00255 $50 NF-κB p65 Antibody (Ab-276), pAb, Rabbit WB, IHC, IF Human 40 μg A00212 $50 JunD Antibody (Ab-255), pAb, Rabbit WB, IHC, IF Human 40 μg A00590 $50 NF-κB p65 Antibody (Ab-311), pAb, Rabbit WB, IHC Human 40 μg A00542 $50 Ki-67 Antibody, pAb, Rabbit IHC Human 40 μg A01495 $50 NF-κB p65 Antibody (Ab-435), pAb, Rabbit WB, IHC Human 40 μg A00213 $50 KLH Antibody, mAb, Mouse ELISA NA 40 μg A01486 $50 NF-κB p65 Antibody (Ab-468), pAb, Rabbit WB, IHC Human 40 μg A00219 $50 KT3-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00632 $50 NF-κB p65 Antibody (Ab-505), pAb, Rabbit IHC Human, mouse, rat 40 μg A01163 $50 Lamin A+C Antibody, pAb, Rabbit WB Human, mouse* 40 μg A01455 $50 NF-κB p65 Antibody (Ab-529), pAb, Rabbit WB, IHC Human 40 μg A00459 $50 LC3A Antibody, pAb, Rabbit WB, IF Human 40 μg A00971 $50 NF-κB p65 Antibody (Ab-536), pAb, Rabbit WB, IHC Human 40 μg A00222 $50 MARCKS Antibody (Ab-158), pAb, Rabbit WB, IF Human, mouse 40 μg A00511 $50 Niban Antibody, pAb, Rabbit WB, IF Human 40 μg A00933 $50 MAT-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00681 $50 Nicastrin Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00883 $50 MBP-tag Antibody, mAb, Mouse ELISA, WB NA 40 μg A00190 $50 NMDAR1 Antibody (Ab-896), pAb, Rabbit WB Human, mouse 40 μg A01149 $50 M-CSF Antibody, mAb, Mouse ELISA, WB NA 100 μg A00184 $50 NSE Antibody, pAb, Rabbit ELISA,WB, IHC Human, mouse, rat* 40 μg A01405 $50 MDM2 Antibody (Ab-166), pAb, Rabbit IHC, IF Human 40 μg A01267 $50 NSE Antibody, pAb, Rabbit ELISA,WB, IHC, IP Human, mouse, rat* 40 μg A01406 $50 MEF2A Antibody (Ab-312), pAb, Rabbit WB, IHC Human, mouse 40 μg A00642 $50 NSE Antibody, pAb, Rabbit ELISA,WB, IHC Human, mouse, rat* 40 μg A01412 $50 MEF2A Antibody (Ab-319), pAb, Rabbit IHC Human 40 μg A00268 $50 NSG1 Antibody, pAb, Rabbit ELISA,WB, IP Human, mouse, rat* 40 μg A01442 $50 MEK1 Antibody (Ab-217), pAb, Rabbit WB, IHC, IF Human 40 μg A01041 $50 NWSHPQFEK Antibody, pAb, Rabbit ELISA,WB NA 40 μg A00626 $50 MEK1 Antibody (Ab-221), pAb, Rabbit WB, IHC Human 40 μg A00452 $50 OLIG2 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01474 $50 Antibodies MEK1 Antibody (Ab-291), pAb, Rabbit WB, IHC Human 40 μg A00510 $50 p21Cip1 Antibody (Ab-145), pAb, Rabbit WB, Human 40 μg A01150 $50 MEK2 Antibody (Ab-394), pAb, Rabbit WB, IHC Human 40 μg A00211 $50 p27Kip1 Antibody (Ab-10), pAb, Rabbit WB, IHC Human 40 μg A00436 $50 MELK Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01390 $50 p35 Antibody, pAb, Rabbit WB Mouse, rat* 40 μg A01423 $50 MEP50 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01385 $50 p38 MAPK Antibody (Ab-182), pAb, Rabbit WB Human, mouse 40 μg A00553 $50
Antibodies Merlin Antibody (Ab-518), pAb, Rabbit WB, IHC Human 40 μg A00533 $50 p44/42 MAP Kinase Antibody (Ab-202), WB Human 40 μg A00564 $50 Met Antibody (Ab-1234), pAb, Rabbit WB Human 40 μg A00464 $50 pAb, Rabbit Met Antibody (Ab-1349), pAb, Rabbit WB Human 40 μg A00569 $50 p53 Antibody (Ab-15), pAb, Rabbit WB, IHC, IF Human 40 μg A00595 $50 mGluR5 Antibody, pAb, Rabbit WB Human 40 μg A01493 $50 p53 Antibody (Ab-315), pAb, Rabbit WB Human 40 μg A00598 $50 Mitoferrin-1 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00916 $50 p53 Antibody (Ab-37), pAb, Rabbit WB Human 40 μg A01221 $50 MKK3 Antibody (Ab-189), pAb, Rabbit WB, IHC, IF Human 40 μg A00415 $50 p53 Antibody (Ab-46), pAb, Rabbit WB Human 40 μg A00596 $50
MKK6 Antibody (Ab-207), pAb, Rabbit WB, IHC, IF Human 40 μg A00438 $50 p53 Antibody (Ab-9), pAb, Rabbit WB Human 40 μg A01162 $50 MiniFresh MPS1/RPS27 Antibody, mAb, Mouse ELISA, WB NA 40 μg A01056 $50 p62Dok Antibody (Ab-362), pAb, Rabbit WB, IHC Human 40 μg A01044 $50 MSK1 Antibody (Ab-376), pAb, Rabbit WB Human 40 μg A00588 $50 p62Dok Antibody (Ab-398), pAb, Rabbit WB, IHC, IF Human 40 μg A01045 $50 mTOR Antibody (Ab-2448), pAb, Rabbit WB, IHC, IF Human 40 μg A01154 $50 p70 S6 Kinase Antibody (Ab-421), pAb, Rabbit 40 μg A00550 $50
WB, IHC Human ® Antibodies Antibodies
® Myc Antibody (Ab-358), pAb, Rabbit WB, IHC Human 40 μg A00264 $50 p70 S6 Kinase Antibody (Ab-424), pAb, Rabbit WB, IHC, IF Human 40 μg A00516 $50 Myc Antibody (Ab-373), pAb, Rabbit WB, Human, mouse 40 μg A00265 $50 p73 Antibody (Ab-99), pAb, Rabbit WB Human 40 μg A00348 $50 Myc Antibody (Ab-58), pAb, Rabbit WB, IHC Human 40 μg A00262 $50 p90RSK Antibody (Ab-348), pAb, Rabbit WB, IF Human 40 μg A00603 $50 Myelin Basic Protein Antibody, pAb, Rabbit ELISA, WB Mouse, rat* 40 μg A01407 $50 p90RSK Antibody (Ab-352), pAb, Rabbit 40 μg A00601 $50 MiniFresh WB, IHC Human MyoD Antibody (Ab-200), pAb, Rabbit WB Human 40 μg A00607 $50 p95/NBS1 Antibody (Ab-343), pAb, Rabbit WB, IHC Human 40 μg A00305 $50 NCAM Antibody, pAb, Rabbit ELISA, WB Rat, mouse* 40 μg A01415 $50 PAK1 Antibody (Ab-212), pAb, Rabbit WB, IHC, IF Human 40 μg A00651 $50 Nestin Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01413 $50 PAK1/PAK2/PAK3 Antibody (Ab-423/402/421), IHC, IF Human, mouse, rat 40 μg A01040 $50 Neurofascin Antibody, pAb, Rabbit ELISA, WB Rat, mouse* 40 μg A01377 $50 pAb, Rabbit Neurofilament-M Antibody, pAb, Rabbit ELISA, WB Mouse, rat* 40 μg A01395 $50 Parkin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat* 40 μg A01250 $50 Neuroserpin Antibody, pAb, Rabbit WB Mouse, rat* 40 μg A01482 $50 Parvalbumin Antibody, pAb, Rabbit ELISA, WB, IP Human, mouse, rat* 40 μg A01439 $50 NF-κB p100/p52 Antibody (Ab-866), Paxillin Antibody (Ab-118), pAb, Rabbit WB, IHC Human 40 μg A00409 $50 WB, IHC Human 40 μg A00583 $50 pAb, Rabbit Paxillin Antibody (Ab-31), pAb, Rabbit WB, IHC Human 40 μg A00456 $50 NF-κB p100/p52 Antibody (Ab-870), PCNA Antibody, mAb, Mouse WB NA 40 μg A01055 $50 WB, IHC Human 40 μg A00225 $50 pAb, Rabbit PDI Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* 40 μg A01434 $50 NF-κB p105/p50 Antibody (Ab-337), PDK1 Antibody (Ab-241), pAb, Rabbit WB, IHC, IF Human 40 μg A00208 $50 IHC Human 40 μg A00585 $50 pAb, Rabbit PEN2 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00882 $50 NF-κB p105/p50 Antibody (Ab-893), Peroxiredoxin-6 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00962 $50 WB, IHC Human 40 μg A00227 $50 pAb, Rabbit PGK1 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00961 $50
Your Innovation Partner in Drug Discovery! - 83 - www.genscript.com - 84 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price PGP9.5 Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01398 $50 PSD95 Antibody,pAb,Rabbit WB Mouse, rat 40 μg A01501 $50 PIN1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01090 $50 Rac1 Antibody (Ab-71), pAb, Rabbit WB, IF Human 40 μg A00660 $50 Piwi-like Protein 1 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00963 $50 Raf-1 Antibody (Ab-259), pAb, Rabbit WB, IHC Human 40 μg A00209 $50 PKA RIIα Antibody, pAb, Rabbit WB Human 40 μg A00948 $50 Raf1 Antibody (Ab-338), pAb, Rabbit WB, IHC Human 40 μg A01153 $50 PKA RIIβ Antibody, pAb, Rabbit ELISA, WB Human, mouse 40 μg A00949 $50 RAGE Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00972 $50 PKA RIβ Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00947 $50 RANTES Antibody (1E11G5), mAb, Mouse ELISA, WB NA 40 μg A01475 $50 PKC ε Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00675 $50 RANTES Antibody (2H8G2), mAb, Mouse ELISA, WB NA 40 μg A01476 $50 PKCα Antibody, pAb, Rabbit ELISA, WB Human, mouse 40 μg A00901 $50 RANTES Antibody (3C2E3), mAb, Mouse ELISA, WB NA 40 μg A01477 $50 PKCα/β2 Antibody (Thr638/641), pAb, Rabbit ELISA, WB Human, mouse 40 μg A01052 $50 RANTES Antibody (3G2D10), mAb, Mouse ELISA, WB NA 40 μg A01478 $50 PKCβ Antibody (Ab-641), pAb, Rabbit WB, IHC, IF Human 40 μg A00655 $50 RANTES Antibody (4A10F2), mAb, Mouse ELISA, WB NA 40 μg A01479 $50 PKCβ2 Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00903 $50 RANTES Antibody (4G8F2), mAb, Mouse ELISA, WB NA 40 μg A01480 $50 PKCγ Antibody, pAb, Rabbit WB NA 40 μg A00904 $50 RANTES Antibody (4H2B3), mAb, Mouse ELISA, WB NA 40 μg A01481 $50 PKCδ Antibody (Ab-645), pAb, Rabbit WB, IHC, IF Human 40 μg A00509 $50 RAP1A and RAP1B Antibody, pAb, Rabbit ELISA, WB NA 40 μg A01047 $50 PKCδ Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00905 $50 Rb Antibody (Ab-780), pAb, Rabbit WB, IHC Human 40 μg A00412 $50 PKCζ Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00908 $50 Rb Antibody (Ab-795), pAb, Rabbit WB Human 40 μg A00410 $50 PKCη Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00906 $50 Rb Antibody (Ab-807), pAb, Rabbit WB, IHC Human 40 μg A00411 $50 PKCθ Antibody (Ab-676), pAb, Rabbit WB, IHC, IF Human 40 μg A00508 $50 RelB Antibody (Ab-573), pAb, Rabbit WB Human 40 μg A00547 $50 PKCθ Antibody (Ab-695), pAb, Rabbit WB, IHC Human 40 μg A00656 $50 RFP-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00682 $50 PKCι/λ Antibody, pAb, Rabbit ELISA, WB Human 40 μg A00910 $50 Runx3 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00973 $50 PKCμ Antibody, pAb, Rabbit ELISA, WB Human, mouse 40 μg A00909 $50 S1-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00679 $50 PKCν Antibody, pAb, Rabbit ELISA, WB NA 40 μg A01067 $50 S6 Ribosomal Protein Antibody (Ab-235), WB, IHC, IF Human 40 μg A00465 $50 PKD/PKCμ Antibody (Ab-738), pAb, Rabbit WB, IF Human 40 μg A00606 $50 pAb, Rabbit PKD/PKCμ Antibody (Ab-910), pAb, Rabbit WB, Human 40 μg A00605 $50 SAA1 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00944 $50 Antibodies PKG-2 Antibody, pAb, Rabbit ELISA, WB Human 40 μg A01070 $50 SAPK/JNK Antibody (Ab-183), pAb, Rabbit IHC Human 40 μg A00557 $50 PLCγ1 Antibody (Ab-771), pAb, Rabbit WB, IHC Human 40 μg A01260 $50 SAPK/JNK Antibody (Ab-183), pAb, Rabbit WB, IHC Human 40 μg A01161 $50 PLCγ1 Antibody (Ab-783), pAb, Rabbit WB Human 40 μg A01039 $50 SCF Antibody, mAb, Mouse ELISA, WB NA 40 μg A01061 $50 PLC-γ2 Antibody (Ab-1217), pAb, Rabbit IHC Human 40 μg A01294 $50 SEK1/MKK4 Antibody (Ab-261), pAb, Rabbit IHC, IF Human 40 μg A00423 $50
Antibodies PLCγ2 Antibody (Ab-753), pAb, Rabbit WB, IF Human 40 μg A00658 $50 SEK1/MKK4 Antibody (Ab-80), pAb, Rabbit WB, IHC Human, mouse 40 μg A00424 $50 PON2 Antibody, pAb, Rabbit WB NA 40 μg A00816 $50 Serum Amyloid P Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00701 $50 PP2A-α Antibody, pAb, Rabbit WB Human 40 μg A01226 $50 Shc1 Antibody (Ab-427), pAb, Rabbit WB, IHC, IF Human 40 μg A00930 $50 Presenilin 1 Antibody, pAb, Rabbit ELISA, WB Human, mouse 40 μg A00881 $50 SHP-1 Antibody (Ab-536), pAb, Rabbit WB, IHC, IF Human 40 μg A00970 $50 Presenilin 2 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00943 $50 Smad2 Antibody (Ab-220), pAb, Rabbit WB, IHC Human 40 μg A01223 $50 PRMT1 Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01401 $50 Smad3 Antibody (Ab-208), pAb, Rabbit IHC, IF Human, mouse, rat 40 μg A01224 $50
Progesterone Receptor Antibody (Ab-190), Smad3 Antibody (Ab-425), pAb, Rabbit IHC, IF Human, mouse, rat 40 μg A01225 $50 MiniFresh WB, IF Human 40 μg A01165 $50 pAb, Rabbit SMC1 Antibody (Ab-957), pAb, Rabbit WB, IHC Human 40 μg A00455 $50 Prohibitin Antibody, pAb, Rabbit WB NA 40 μg A00706 $50 SNAP25 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg A01445 $50 Prohibitin Antibody, pAb, Rabbit ELISA, WB Human, mouse* 40 μg A01195 $50 SNAP-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00684 $50 ® Antibodies Antibodies
® Prohibitin Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* 40 μg A01238 $50 Src Antibody (Ab-529), pAb, Rabbit WB, IHC Human 40 μg A00449 $50 Protein C -tag Antibody (HPC4), pAb, Rabbit ELISA, WB NA 40 μg A00637 $50 SRT-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00725 $50 PTEN Antibody (Ab-370), pAb, Rabbit WB, IHC Human 40 μg A00303 $50 S-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00625 $50 PTEN Antibody (Ab-380, 382, 383), STAT1 Antibody (Ab-701), pAb, Rabbit WB, IHC Human MiniFresh 40 μg A00274 $50 WB, IHC Human 40 μg A00302 $50 pAb, Rabbit STAT1 Antibody (Ab-727), pAb, Rabbit WB, IHC Human 40 μg A00454 $50 Pyk2 Antibody (Ab-402), pAb, Rabbit WB, IHC, IF Human 40 μg A00586 $50 Stat2 Antibody (Ab-690), pAb, Rabbit WB, IHC Human 40 μg A01263 $50 Rab5 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat 40 μg A01302 $50 STAT3 Antibody (Ab-727), pAb, Rabbit WB, IHC Human 40 μg A00278 $50 C-Fos Antibody, pAb, Rabbit WB Human 40 μg A01512 $50 STAT4 Antibody (Ab-693), pAb, Rabbit WB, IHC Human 40 μg A00279 $50 C-Fos Antibody, pAb, Rabbit WB Human 40 μg A01513 $50 STAT5A Antibody (Ab-694), pAb, Rabbit WB, IHC Human 40 μg A00280 $50 Cytochrome C Antibody, pAb, Rabbit WB Human, mouse 40 μg A01507 $50 STAT5A Antibody (Ab-780), pAb, Rabbit WB, IHC Human 40 μg A00281 $50 EEA1 Antibody, pAb, Rabbit WB Human, mouse, rat 40 μg A01514 $50 STAT6 Antibody (Ab-641), pAb, Rabbit WB, IHC Human 40 μg A00282 $50 GRP94 Antibody, pAb, Rabbit WB Human 40 μg A01510 $50 STAT6 Antibody (Ab-645), pAb, Rabbit WB, IHC Human 40 μg A00284 $50 H1N1 HA Antibody, pAb, Rabbit WB Influenza A virus (H1N1) 40 μg A01500 $50 Stathmin 1 Antibody (Ab-16), pAb, Rabbit WB, IHC Human 40 μg A00573 $50 H1N1 NP Antibody, pAb, Rabbit WB Influenza A virus (H1N1) 40 μg A01506 $50 Stathmin 1 Antibody (Ab-25), pAb, Rabbit WB, IHC, IF Human 40 μg A00462 $50 H1N1 NS2 Antibody, pAb, Rabbit WB Influenza A virus (H1N1) 40 μg A01499 $50 Stathmin 1 Antibody (Ab-38), pAb, Rabbit WB, IHC Human 40 μg A00463 $50 HEC1 Antibody, pAb, Rabbit WB Human 40 μg A01504 $50 Stathmin1 Antibody (Ab-62), pAb, Rabbit WB, IHC Human 40 μg A01258 $50 Histone H3 Antibody, pAb, Rabbit WB Human, mouse, rat 40 μg A01502 $50 Superoxide Dismutase 1 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A01005 $50 NQO1 Antibody, pAb, Rabbit WB Human 40 μg A01511 $50 Syk Antibody (Ab-323), pAb, Rabbit IHC, IF Human 40 μg A01266 $50
Your Innovation Partner in Drug Discovery! - 85 - www.genscript.com - 86 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price Synapsin Antibody (Ab-9), pAb, Rabbit WB Human 40 μg A00531 $50 β-Amyloid Antibody (1-40), pAb, Rabbit ELISA, WB, IF Human 40 μg A00688 $50 Synaptophysin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat 40 μg A01307 $50 β-Amyloid Antibody (25-35), pAb, Rabbit ELISA, WB Human 40 μg A00687 $50 Synaptotagmin I/II Antibody (Ab-202/199), β-Catenin Antibody (Ab-37), pAb, Rabbit WB, IHC, IF Human 40 μg A00582 $50 WB, IF Human 40 μg A01170 $50 pAb, Rabbit β-Catenin Antibody (Ab-41, 45), pAb, Rabbit WB Human 40 μg A00407 $50 T7-tag Antibody, pAb, Rabbit WB NA 40 μg A00622 $50 β-catenin Antibody (Ab-654), pAb, Rabbit WB Human 40 μg A01229 $50 Tag-100-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00677 $50 β-Catenin Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01211 $50 TAP-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00683 $50 β-Catenin Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01235 $50 Tau Antibody (Ab-181), pAb, Rabbit WB Human 40 μg A00397 $50 ELISA, WB, IHC β-Tubulin III Antibody, pAb, Rabbit Human, mouse, rat* 40 μg A01203 $50 Tau Antibody (Ab-205), pAb, Rabbit WB Human 40 μg A00398 $50 FACS Tau Antibody (Ab-212), pAb, Rabbit WB Human, rat 40 μg A00545 $50 Tau Antibody (Ab-217), pAb, Rabbit ELISA, WB Human, mouse, rat 40 μg A00942 $50 *: This product has not been tested with reactivity to other species. Tau Antibody (Ab-231), pAb, Rabbit WB, IHC Human, mouse, rat 40 μg A00400 $50 NA: Not Available. Tau Antibody (Ab-235), pAb, Rabbit WB Human, mouse 40 μg A00393 $50 Tau Antibody (Ab-262), pAb, Rabbit WB Human, mouse 40 μg A00600 $50 For more information on MiniFresh® Antibodies, visit http://www.genscript.com/cgi-bin/products/antibody_list_price_below_70.cgi Tau Antibody (Ab-396), pAb, Rabbit WB, IHC Human, mouse, rat 40 μg A00389 $50 Tau Antibody (Ab-404), pAb, Rabbit WB Human 40 μg A00401 $50 Tau Antibody (Phospho-Ser262), pAb, Rabbit ELISA, WB Human, mouse 40 μg A01099 $50 Tau Antibody (Phospho-Ser356), pAb, Rabbit ELISA, WB Human 40 μg A01048 $50 Tau Antibody (Phospho-Ser396), pAb, Rabbit ELISA, WB Human, mouse, rat* 40 μg A01387 $50 Tau Antibody (Phospho-Ser400), pAb, Rabbit ELISA, WB Human, mouse, rat 40 μg A01049 $50 Tau Antibody (Phospho-Ser409), pAb, Rabbit ELISA, WB Human 40 μg A01050 $50 Tau Antibody (Phospho-Ser422), pAb, Rabbit ELISA, WB Human 40 μg A01051 $50 TDP43 Antibody, pAb, Rabbit Human, mouse, rat* ELISA, WB 40 μg A01304 $50 Antibodies TF-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A01329 $50 Thioredoxin Antibody (TRX), mAb, Mouse ELISA, WB Human 40 μg A00164 $50 TPMT Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01196 $50 TPMT Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01248 $50
Antibodies TRF1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01198 $50 TRF1 Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01237 $50 TrkA Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01403 $50 TrkA Antibody, pAb, Rabbit ELISA, WB Human* 40 μg A01404 $50 Trx-tag Antibody, mAb, Mouse ELISA, WB E. coli, human 40 μg A00180 $50 Trx-tag Antibody, pAb, Goat ELISA, WB E. coli, human 40 μg A00129 $50
Ty1-tag Antibody, pAb, Rabbit ELISA, WB, IP NA 40 μg A01004 $50 MiniFresh TYK2 Antibody (Ab-1054), pAb, Rabbit IHC Human 40 μg A00416 $50 Universal-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00680 $50 V5-tag Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00623 $50 ® Antibodies Antibodies ® VASP Antibody (Ab-157), pAb, Rabbit WB, IF Human 40 μg A00458 $50 VASP Antibody (Ab-239), pAb, Rabbit WB, IHC Human, mouse 40 μg A00451 $50 V-ATPase Subunit B 2 Antibody, pAb, Rabbit ELISA, WB NA 40 μg A00960 $50 Vav Antibody (Ab-174), pAb, Rabbit MiniFresh WB Human 40 μg A00448 $50 VDAC1 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* 40 μg A01419 $50 VEGFR2 Antibody (Ab-1175), pAb, Rabbit IHC Human 40 μg A00352 $50 VEGFR2 Antibody (Ab-1214), pAb, Rabbit IHC Human 40 μg A00355 $50 VEGFR2 Antibody (Ab-951), pAb, Rabbit WB, IHC Human 40 μg A00357 $50 Vimentin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse* 40 μg A01191 $50 Vimentin Antibody, pAb, Rabbit ELISA, WB, IHC Human* 40 μg A01193 $50 Vimentin Antibody, pAb, Rabbit ELISA, WB, IHC Human* 40 μg A01189 $50 VSV-G-tag Antibody, pAb, Rabbit ELISA, WB, IP NA 40 μg A00199 $50 WISP2 Antibody, mAb, Mouse ELISA, WB * 40 μg A01012 $50 Zap-70 Antibody (Ab-493), pAb, Rabbit IHC Human 40 μg A00593 $50 α-Actin-1 Antibody, pAb, Rabbit WB NA 40 μg A00885 $50 α-catenin Antibody (Ab-177), pAb, Rabbit WB, IHC Human 40 μg A01230 $50 α-Catenin Antibody (Ab-641), pAb, Rabbit WB, Human 40 μg A00931 $50 β-Amyloid Antibody (1-17), pAb, Rabbit ELISA, WB, IF Human 40 μg A00685 $50
Your Innovation Partner in Drug Discovery! - 87 - www.genscript.com - 88 - - 89 Primary Antibodies Antibodies Product Overview: consists ofageneinterestandanepitopetag. These fusion DNA technology, wecanconstructfusionproteinsthateach or sequencetowhichanantibodybinds.Usingrecombinant An epitopeisanantigenicdeterminantandabiologicalstructure Epitope Tag Antibodies are usefulindetectingspecificbiomoleculesandmeasuring antibodies and/oraspolyclonalantibodies. These antibodies biomolecules. They areavailableashighspecificitymonoclonal specificity touniqueepitopesacrossabroadspectrumof Primary antibodiesrecognizeandbindwithhighaffinity and Primary Antibodies c-Myc-tag Antibody, pAb,Rabbit c-Myc-tag Antibody [HRP],pAb,Rabbit c-Myc-tag Antibody [Biotin], pAb,Rabbit cGFP-tag Antibody, mAb,Mouse CBP-tag Antibody, pAb,Rabbit B-tag Antibody, pAb,Rabbit Avi-tag Antibody, pAb,Rabbit AU1-tag Antibody, pAb,Rabbit THE THE THE THE THE THE THE THE THE THE THE THE THE THE THE Product TM TM TM TM TM TM TM TM TM TM TM TM TM TM TM Mouse Anti-DYKDDDDK mAb(HRP) Mouse Anti-DYKDDDDK mAb(Biotin) Mouse Anti-DYKDDDDK mAb Anti-His-tag mAb(Mouse) Anti-His-tag [HRP]mAb Anti-His-tag [Biotin]mAb Anti-HA-tag mAb(Mouse) Anti-HA-tag [HRP]mAb(Mouse) Anti-HA-tag [Biotin]mAb(Mouse) Anti-GST-tag [Biotin]mAb(Mouse) Anti-GST-tag mAb(Mouse) Anti-GST-tag [HRP]mAb(Mouse) Anti-c-Myc-tag mAb(Mouse) Anti-c-Myc-tag [HRP]mAb(Mouse) Anti-c-Myc-tag [Biotin]mAb(Mouse) Your Innovation PartnerinDrugDiscovery! ELISA, WB,IF, IP ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB,IP ELISA, WB,IP ELISA, WB,IP ELISA, WB,IF, FACS, IP ELISA, WB ELISA, WB ELISA, WB,IP ELISA, WB ELISA, WB ELISA, WB,IP ELISA, WB,IP ELISA, WB,IP ELISA, WB,IF, IP ELISA, WB,IF, IP ELISA, WB,IF, IP Applications research applications. GenScript offers highlyspecificepitopetagantibodiesforyour Hemagglutinin, 6-Histidine,c-Myc,GST, andDYKDDDDK. antibodies. The mostcommonlyusedepitopetagsinclude proteins canbepurifiedandidentifiedbyepitopetagspecific antibodies, coveringallareasoflifescienceresearch. now offers over1000highlyspecificmonoclonalandpolyclonal as phosphorylation,methylation,orglycosylation.GenScript changes intheirlevelandspecificityduetomodificationssuch NA NA NA NA rabbit Mouse, rat,bovine, NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Species Reactivity Quantity 100 100 100 100 100 100 100 100 100 200 200 200 500 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00172 A00173 A00204 A00185 A00635 A00638 A00674 A00628 A01428 A01429 A00187 A00186 A00612 A00613 A01244 A01296 A01297 A00867 A00865 A00866 A00704 A00863 A00864 Cat. No. Price $225 $248 $248 $225 $225 $225 $225 $225 $335 $335 $330 $375 $410 $410 $330 $335 $335 $333 $750 $333 $333 $333 $311 $311 $50 $55 $55 $50 $50 $50 $50 $50 $74 $69 $74 $69 $74 $74 MBP-tag Antibody, mAb,Mouse MAT-tag Antibody, pAb, Rabbit KT3-tag Antibody, pAb,Rabbit KT3 Antibody [HRP],pAb,Rabbit KLH Antibody, mAb,Mouse HSV-tag Antibody, pAb,Rabbit His-tag Antibody, pAb,Rabbit HAT-tag Antibody, pAb,Rabbit HA-tag Antibody, pAb,Goat HA-Tag Antibody, mAb,Mouse HA-tag Antibody [HRP],pAb,Goat HA-tag Antibody [Biotin],pAb,Goat GST-tag Antibody, pAb,Rabbit GST-tag Antibody, pAb,Goat GST-tag Antibody [HRP],pAb,Rabbit GST-tag Antibody [HRP],pAb,Goat GST-tag Antibody [Biotin],pAb,Rabbit Glu-Glu-tag Antibody, pAb,Rabbit GFP Antibody, pAb,Rabbit GFP Antibody [HRP],mAb,Mouse E-tag Antibody, pAb,Rabbit E-tag Antibody [HRP],pAb,Rabbit E2-tag Antibody, pAb,Rabbit E2-tag Antibody [HRP],pAb,Rabbit DYKDDDDK-tag Antibody, pAb,Rabbit DDDDK-tag Antibody, pAb,Rabbit Cre Recombinase Antibody, mAb,Mouse Product ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA ELISA, WB ELISA, WB ELISA, WB ELISA, WB,IF, IP ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB,IP ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB,IF, FACS ELISA, WB ELISA, WB Applications NA NA NA NA NA NA NA NA NA NA NA NA Schistosoma japonicum NA Schistosoma japonicum NA Schistosoma japonicum NA NA NA NA NA NA NA NA NA NA Species Reactivity Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00190 A00681 A00632 A00873 A01486 A00624 A00174 A00636 A00168 A00189 A00169 A00203 A00097 A01379 A00130 A01380 A00202 A00627 A01388 A00886 A00631 A00874 A00630 A00876 A00170 A00676 A00888 Cat. No. www.genscript.com Price $248 $225 $225 $225 $225 $225 $225 $248 $248 $225 $225 $248 $248 $248 $225 $225 $248 $225 $248 $225 $248 $225 $225 $225 $225 $225 $225 $55 $50 $50 $50 $50 $50 $50 $55 $55 $50 $50 $55 $55 $55 $50 $50 $55 $50 $55 $50 $55 $50 $50 $50 $50 $50 $50
- 90 Primary Antibodies Primary Antibodies - 91 Primary Antibodies Antibodies NA: Not Available. *: This producthasnotbeen VSV-G-tag Antibody, pAb,Rabbit VSV-G-tag Antibody [HRP],pAb,Rabbit V5-tag Antibody, pAb,Rabbit V5-tag Antibody, pAb,Goat V5-tag Antibody, mAb,Mouse V5-tag Antibody [HRP],pAb,Rabbit Universal-tag Antibody, pAb,Rabbit Ty1-tag Antibody, pAb,Rabbit Trx-tag Antibody, pAb,Goat Trx-tag Antibody, mAb,Mouse TF-tag Antibody, pAb,Rabbit TAP-tag Antibody, pAb,Rabbit TAP-tag Antibody [HRP],pAb,Rabbit Tag-100-tag Antibody, pAb,Rabbit T7-tag Antibody, pAb,Rabbit SUMO-tag Antibody, pAb,Rabbit S-tag Antibody, pAb,Rabbit SRT-tag Antibody, pAb,Rabbit SNAP-tag Antibody, pAb,Rabbit S1-tag Antibody, pAb,Rabbit RFP-tag Antibody, pAb,Rabbit Protein C-tag Antibody (HPC4),pAb,Rabbit Protein A Antibody [HRP],pAb,Chicken NWSHPQFEK Antibody, pAb,Rabbit NWSHPQFEK Antibody [HRP],pAb,Rabbit Product For moreinformationonEpitopeTag Antibodies, visit tested wt eciiyt te pce. withreactivitytootherspecies. Your Innovation PartnerinDrugDiscovery! ELISA, WB,IP ELISA, WB ELISA, WB ELISA, WB,IHC ELISA, WB,IHC ELISA, WB ELISA, WB ELISA, WB,IP ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB Applications http://www.genscript.com/epitope_antibody.html NA NA NA NA NA NA NA NA E. coli E. coli NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Species Reactivity , human , human Quantity 200 200 100 100 200 200 200 200 200 200 200 200 200 200 200 200 200 500 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00199 A00872 A00623 A00099 A00641 A00877 A00680 A01004 A00129 A00180 A01329 A00683 A01435 A00677 A00622 A00640 A00625 A00725 A00684 A00679 A00682 A00637 A00729 A00626 A00875 Cat. No. Price $225 $248 $225 $125 $120 $248 $225 $225 $225 $225 $225 $225 $248 $225 $225 $145 $225 $225 $225 $225 $225 $225 $333 $225 $248 $50 $55 $50 $55 $50 $50 $50 $50 $50 $50 $55 $50 $50 $50 $50 $50 $50 $50 $50 $75 $50 $55 Neuroscience Antibodies Product Overview: • • • phospho-specific antibodiesaswellpeptidesandproteins GenScript offers awiderangeoftools,includingpanand to focusondopamine,betaamyloid,andserotonin. The researchontraditionaltargetsandpathwayswillcontinue increased thedemandforhigh-qualityneuroscienceantibodies. molecules andstructuralproteinsinthebrainhavedramatically The discoveryofnewpotentialdrugtargets,signaling APP Antibody (Phospho-Thr APP Antibody APH1 Antibody, pAb,Rabbit APE1 Antibody, pAb,Rabbit (Ab-730), pAb,Rabbit Amyloid PrecursorProtein Antibody (747-761), pAb,Rabbit Amyloid PrecursorProtein Antibody (671-685), pAb,Rabbit Amyloid PrecursorProtein Antibody (653-662), pAb,Rabbit Amyloid PrecursorProtein Antibody (44-63), pAb,Rabbit Amyloid PrecursorProtein Antibody (292-312), pAb,Rabbit Amyloid PrecursorProtein Antibody Alpha Internexin Antibody, pAb,Rabbit ADAM9 Antibody, pAb,Rabbit Product Calnexin Antibody, pAb,Rabbit Calbindin Antibody, pAb,Rabbit BLBP Antibody, pAb,Rabbit BACE1 Antibody (485-501), pAb,Rabbit BACE1 Antibody (46-65),pAb, Rabbit BACE1 Antibody (26-45),pAb, Rabbit ATP1A1 Antibody, pAb,Rabbit APP FM Antibody (339-348),pAb,Rabbit APP Antibody (Phospho-TyrAPP Antibody MiniFresh Multiple Applications— Full coverage ELISA, andmore. Immunoprecipitation (IP),Immunohistochemistry(IHC), minimal cost. neuroscience antibodiesareavailableinsmallpackagesat ® Trial Size Antibodies— ofneurologicaldiseasepathways 757 668 Western Blot(WB), ), pAb,Rabbit ), pAb,Rabbit Most ofour ELISA, WB ELISA, WB,IHC ELISA, WB ELISA, WB ELISA, WB ELISA, WB WB ELISA, WB ELISA, WB WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB,IF ELISA, WB,IF ELISA, WB,IF ELISA, WB ELISA, WB ELISA, WB Applications Human, mouse* Human* Human Human Human Human Human, mouse,rat* Human Human Human, mouse,rat Human, mouse Human* Human Human, mouse Human, mouse Human, mouse Human, mouse Human, mouse Human, mouse,rat* Human, mouse,rat Species Reactivity lateral sclerosis. Parkinson's disease,Huntington'sandamyotrophic Alzheimer's diseaseandotherneurologicaldiseasesincluding has acomprehensivecollectionofantibodiestargeting epitope, furtherensuringthequalityofantibodies.GenScript affinity chromatographypurificationbasedontherelevant prior todelivery. Mostofourproductionprocessesinvolve All GenScript'sneuroscienceantibodiesarecarefullypurified the bio-reagentskeenlysoughtbyneuroscienceresearchers. various pathwaysleadingtoneurologicaldiseases,areamong antibodies, particularlythoseapplicabletostudiesinvolvingthe geared towarddifferent areasofneuroscienceresearch. These Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01240 A01268 A01422 A00880 A00879 A00878 A01483 A00700 A00697 A01026 A00884 A01205 A00966 A00696 A00695 A00694 A00692 A00693 A01397 A01313 Cat. No. www.genscript.com Price $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $69 $69 $50 $50 $50
- 92 Primary Antibodies Primary Antibodies - 93 Primary Antibodies Antibodies GABRB1 Antibody(Ab-434),pAb,Rabbit ERAB Antibody,pAb,Rabbit EEA1 Antibody,pAb,Rabbit Rabbit pAb, Antibody, Doublecortin Rabbit pAb, DJ-1 Antibody, Rabbit pAb, DJ-1 Antibody, Rabbit pAb, Antibody, DARPP-32 CREB Antibody (Phospho-Ser CREB Antibody (Phospho-Ser CREB Antibody (Phospho-Ser CREB Antibody (Ab-142),pAb,Rabbit CREB Antibody (Ab-133),pAb,Rabbit CREB Antibody (Ab-129),pAb,Rabbit MB kinase Creatine Rabbit Antibody, pAb, Cat.No. M kinase Creatine Rabbit Antibody, pAb, Rabbit pAb, BAntibody, kinase Creatine Connexin 32Antibody, pAb,Rabbit Rabbit pAb, Antibody, Cofilin Rabbit pAb, Antibody, Cofilin Rabbit pAb, CNPase Antibody, Rabbit CHRNA7 Antibody, pAb, C-Fos Antibody,pAb,Rabbit Applications C-Fos Antibody,pAb,Rabbit Rabbit pAb, CDK5 Antibody, Caspr2 Antibody, pAb, Rabbit CaMKII Rabbit Antibody pAb, (Ab-286), Calnexin Rabbit pAb, Antibody, Calnexin Rabbit pAb, Antibody, Product 142 133 129 ), pAb, Rabbit pAb, ), Rabbit pAb, ), Rabbit pAb, ), Your Innovation PartnerinDrugDiscovery! WB ELISA, WB WB IHC ELISA, WB, WB ELISA, IHC ELISA, WB, WB IHC WB, IHC WB, IHC IHC WB, IHC WB, IHC WB WB WB WB ELISA, IHC ELISA, WB, WB ELISA, WB ELISA, WB WB WB WB WB WB, IF WB ELISA, WB ELISA, Species Reactivity Human Human* Human, mouse,rat Human, mouse,rat* Human, mouse* Human* Mouse, rat* Human Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat* * rat Mouse, Human, mouse,rat* Human, mouse,rat Human, mouse* Human, mouse* Human, mouse,rat* Human, mouse,rat* Human Human Human, mouse,rat* rat* Mouse, Human, mouse Human Human* Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01231 A01095 A01514 A01303 A01208 A01207 A01424 A01181 A00267 A00556 A01182 A00286 A00519 A01456 A01472 A01458 A01312 A01239 A01277 A01308 A01420 A01513 A01512 A01438 A01426 A00515 A01234 A01192 Price $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $69 $69 $69 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 GAP-43 Antibody, pAb, Rabbit GAP-43 Antibody, pAb, Rabbit Rabbit Antibody pAb, GAP43 (Ab-41), OLIG2 Antibody, pAb, Rabbit pAb, Antibody, OLIG2 Rabbit pAb, Antibody, NSG1 Rabbit pAb, NSE Antibody, Rabbit pAb, NSE Antibody, Rabbit pAb, NSE Antibody, NMDAR1 Antibody (Phospho-Ser NMDAR1 Antibody (Ab-896),pAb,Rabbit Ki-67 Antibody, pAb, Rabbit pAb, Ki-67 Antibody, Rabbit pAb, Antibody, HtrA2 Rabbit Antibody, Synthetase pAb, Glutamine AntibodyGluR1 (Phospho-Ser GFAP Antibody, pAb,Rabbit GAD65+GAD67 Antibody, pAb, Rabbit Nicastrin Antibody, pAb, Rabbit Rabbit Neuroserpin Antibody, pAb, Antibody, pAb,Rabbit Neurofascin Rabbit pAb, Antibody, Nestin NCAM Rabbit pAb, Antibody, Myelin Rabbit pAb, Antibody, BasicProtein Rabbit Antibody, pAb, mGluR5 Cat.No. Merlin Antibody (Phospho-Ser Merlin Rabbit Antibody pAb, (Ab-518), MELK Rabbit pAb, Antibody, MARCKS Antibody (Ab-162),pAb,Rabbit Mouse Antibody, mAb, Huntingtin Applications Rabbit AntibodyGluR1 pAb, (Ab-849), Product 518 849 ), pAb, Rabbit pAb, ), ), pAb, Rabbit pAb, ), 896 ), pAb, Rabbit pAb, ), ELISA, WB ELISA, WB WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB WB, IF WB, IHC WB ELISA, WB IHC WB, IHC WB IHC ELISA, WB, WB WB IHC ELISA, WB, WB WB ELISA, IF IHC, WB, WB WB IP ELISA, WB, IHC ELISA, WB, IHC, IP ELISA, WB, IHC ELISA, WB, WB WB Species Reactivity Human Mouse, rat* Mouse, rat* Human* Mouse, rat* Mouse, rat* Human Human, mouse,rat Human Human, mouse* Human Human Human, mouse Human, mouse,rat* Human, mouse,rat Human, mouse,rat Human, mouse rat* Human, Mouse, rat* Mouse, rat* Human, mouse Mouse, rat* Human, mouse,rat* Human, mouse,rat* Human, mouse,rat* Human, mouse, rat* Human, mouse, rat* Human Human, mouse Quantity 200 200 200 200 200 200 100 200 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01377 A01413 A01415 A01407 A01493 A00549 A00533 A01390 A01495 A01427 A01305 A01028 A01043 A01309 A01441 A01414 A01046 A01437 A01474 A01442 A01412 A01406 A01405 A00486 A01149 A00883 A01482 A00536 A00089 www.genscript.com Price $225 $225 $225 $172 $225 $259 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $50 $69 $50 $50 $50 $50 $50 $69 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $69 $50 $50 $50 $50 $50 $50 $50
- 94 Primary Antibodies Primary Antibodies - 95 Primary Antibodies Antibodies Synaptophysin Rabbit pAb, Antibody, Rabbit SNAP25 Antibody, pAb, Rabbit pAb, SAA1 Antibody, Rabbit pAb, Rab5 Antibody, PSD95 Antibody,pAb,Rabbit Rabbit pAb, 2Antibody, Presenilin Rabbit pAb, 1Antibody, Presenilin Rabbit pAb, Antibody, PON2 PLC- PLC Rabbit pAb, Antibody, PIN1 PGP9.5 Antibody, pAb, Rabbit Rabbit pAb, PEN2 Antibody, Parvalbumin Rabbit Antibody, pAb, Rabbit Antibody, pAb, Parkin Rabbit pAb, p35 Antibody, Tau AntibodyTau (Ab-396),pAb,Rabbit AntibodyTau (Ab-262),pAb,Rabbit AntibodyTau (Ab-235),pAb,Rabbit AntibodyTau (Ab-231),pAb,Rabbit AntibodyTau (Ab-217),pAb,Rabbit AntibodyTau (Ab-212),pAb,Rabbit AntibodyTau (Ab-205),pAb,Rabbit Tau AntibodyTau (Ab-181),pAb,Rabbit Rabbit pAb, Antibody (Ab-202/199), I/II Synaptotagmin Synapsin Antibody (Phospho-Ser Synapsin Rabbit Antibody pAb, (Ab-9), Serum Amyloid Rabbit PAntibody, pAb, Cat.No. Applications Product γ γ 1 Antibody (Ab-771), pAb, Rabbit 1 Antibody pAb, (Ab-771), 2 Antibody (Ab-1217), pAb, Rabbit 2 Antibody pAb, (Ab-1217), 9 ), pAb,Rabbit ), Your Innovation PartnerinDrugDiscovery! WB WB, IF IHC ELISA, WB, WB, IF WB WB WB ELISA, WB ELISA, WB ELISA, WB WB ELISA, WB ELISA, WB IHC WB, IHC WB ELISA, WB ELISA, WB ELISA, IP ELISA, WB, IHC ELISA, WB, WB WB, IHC WB WB WB, IHC Human WB ELISA, WB WB Species Reactivity Human Human Human, mouse,rat Human, mouse,rat Human Human, mouse,rat* NA NA Human, mouse,rat Mouse, rat NA Human, mouse NA Human Human Human* Human, mouse* NA Human, mouse,rat* Human, mouse,rat* Mouse, rat* Human, mouse,rat Human, mouse Human, mouse Human, mouse,rat Human, mouse,rat Human, rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00600 A00393 A00400 A00942 A00397 A01170 A01307 A00551 A00531 A01445 A00701 A00944 A01302 A01501 A00943 A00881 A00816 A01294 A01260 A01090 A01398 A00882 A01439 A01250 A01423 A00389 A00545 A00398 Price $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $69 $50 β α Rabbit pAb, Antibody, Vimentin Tau AntibodyTau (Phospho-Ser AntibodyTau (Ab-422),pAb,Rabbit NA: Not Available *: This producthasnotbeentestedwithreactivitytootherspecies. Tau AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser Product β β Rabbit pAb, AntibodyTau (Phospho-Thr β β Antibody (Phospho-Tyr TrkB Rabbit pAb, Antibody, TrkA Rabbit pAb, Antibody, TrkA Rabbit pAb, Antibody, TDP43 AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Thr AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Phospho-Ser AntibodyTau (Ab-404),pAb,Rabbit -Catenin Antibody, pAb, Rabbit pAb, Antibody, -Catenin -Amyloid Rabbit Antibody pAb, (25-35), -Amyloid Antibody (1-17),pAb, Rabbit -Amyloid Rabbit Antibody pAb, (32-40), -Amyloid Antibody (1-40),pAb, Rabbit -Synuclein Antibody (Phospho-Ser For moreinformationonNeuroscience Antibodies, visit 217 212 422 409 400 396 356 262 422 422 409 400 262 235 214 199 705 ), pAb, Rabbit pAb, ), Rabbit pAb, ), ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit ), pAb, Rabbit pAb, ), 129 ), plctosCat.No. Applications WB WB ELISA, WB ELISA, IF ELISA, WB, WB ELISA, IF ELISA, WB, IF ELISA, WB, WB IHC ELISA, WB, WB WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB WB ELISA, WB WB ELISA, WB ELISA, IF IHC, WB, WB ELISA, WB ELISA, WB http://www.genscript.com/neuroscience_antibodies_overview.html Species Reactivity Human, mouse,rat Human, rat Human* Human Human Human Human Human, mouse,rat Human* Human, mouse Human* Human* Human, mouserat* Human Human Human, mouse,rat Human, mouse,rat* Human Human, mouse Human, mouse,rat Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse* Human, mouse,rat Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 100 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01304 A01051 A01049 A01387 A01048 A01099 A00896 A01147 A00900 A01148 A00899 A00898 A00489 A01096 A00488 A00894 A00522 A00401 A01235 A00689 A00687 A00688 A00685 A01144 A01189 A01186 A01404 A01403 A01050 www.genscript.com Price $172 $225 $225 $225 $225 $225 $225 $240 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $69 $50 $50 $50 $50 $50 $50 $69 $69 $69 $69 $69 $69 $69 $69 $50 $89 $50 $50 $50 $69 $50 $69 $50 $50 $50 $50
- 96 Primary Antibodies Primary Antibodies - 97 Primary Antibodies Antibodies Product Overview: These moleculesserveasnotmerelymarkers,theyalsohave types, therearespecificcombinationsofmarkersorantigens. antigens withincells’ plasmamembrane.Uniquetodifferent cell identify andclassifycells. The majorityofthemaremoleculesor Cell markers/cellsurfaceantigensserveasamonogramtohelp Cell Marker/CellSurface Antigen Antibodies NA: Notavailable. *: This producthasnotbeen PDI Antibody, pAb,Rabbit Rabbit Lamin A+CAntibody,pAb, Ki-67 Antibody, pAb,Rabbit GRP94 Antibody, pAb,Rabbit GFAP Antibody, pAb,Rabbit GAD65 Antibody, pAb,Rabbit Fibrillarin Antibody, pAb,Rabbit EEA1 Antibody, pAb,Rabbit EB1 Antibody, pAb,Rabbit Cytochrome C Antibody, pAb,Rabbit CNPase Antibody, pAb,Rabbit C-Fos Antibody, pAb,Rabbit C-Fos Antibody, pAb,Rabbit Calreticulin Antibody, pAb,Rabbit Product tested withreactivitytootherspecies. Your Innovation PartnerinDrugDiscovery! ELISA, WB WB IHC WB ELISA, WB,IHC WB WB WB WB WB ELISA, WB WB WB WB Applications Human, mouse,rat* Human, mouse* Human Human Human, rat* NA Human* Human, mouse,rat Human Human, mouse Human, mouse,rat* Human Human Human* Species Reactivity and surface antigensofvariousspecies,includinghuman,mouse, offers awidevarietyofantibodiesrelevanttocellmarkers/cell treatment byidentifyingwhichmoleculesarepresent.GenScript key functionalroles.Itispossibletodiagnosediseaseordirect etc. Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01434 A01455 A01495 A01510 A01309 A01496 A01462 A01514 A00678 A01507 A01308 A01513 A01512 A01443 Cat. No. $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 Price $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 opposed tonon-specificbinding. is duetotheantibody’s interactionwithtargetantigen,as These peptidescanbeusedtoconfirmthattheobservedsignal peptides formostofourphospho-specificandpanantibodies. and immunocytochemicalassays.We alsoprovideblocking suitable formanytasks,includingWestern blotanalysis,ELISA, GenScript offers phospho-specific/panantibodypairsthatare for anygivenprotein. antibody, itispossibletoassessthedegreeofphosphorylation non-phosphorylated formsoftheprotein)andaphospho-specific pan-antibody (thatrecognizesbothphosphorylatedand surrounding aminoacidsequence.Usingacombinationof recognize thephosphorylatedaminoacidsincontextof forms ofproteinsinacomplexproteinmixturewithincells. They Phospho-specific antibodiesdetectonlythephosphorylated do notcrossreactwithnon-phosphorylatedformsofproteins. GenScript’s phospho-specificantibodiesareaffinity-purified and Phospho-Specific Antibodies Product Overview: ABL1/2 Antibody (Phospho-TyrABL1/2 Antibody ABL1/2 Antibody (Ab-393/429), pAb,Rabbit 58K Golgiprotein Antibody, pAb, Rabbit (Phospho-Thr 4E-BP1 Antibody 4E-BP1 Antibody (Phospho-Thr 4E-BP1 Antibody 4E-BP1 Antibody (Ab-45),pAb,Rabbit 4E-BP1 Antibody (Ab-36),pAb,Rabbit 14-3-3 Product AFX Antibody (Ab-197),pAb,Rabbit ADD1 Antibody (Phospho-Ser ADD1 Antibody ADD1 Antibody (Ab-726),pAb, Rabbit ADAM9 Antibody, pAb,Rabbit 14-3-3 ζ ζ Antibody (Ab-58),pAb,Rabbit Antibody (Phospho-Ser Antibody 726 393/429 45 36 58 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit WB, IHC WB, IHC,IF WB, IHC,IF ELISA, WB IHC, IF IHC, IF ELISA, WB WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC Applications Human Human, mouse,rat Human Human, mouse,rat Human Human Human, mouse* Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human, mouse Species Reactivity breast carcinomatissueusingc-Jun Antibody (Phospho-Ser A. Immunohistochemicalanalysisofparaffin-embedded human Antibody (Phospho-Ser B. Western blotanalysisof extractfromHelacellsusingc-Jun pAb, Rabbit. 118kD - 20kD - 26kD - 36kD - 47kD - 85kD - UV -+ Quantity 73 ), pAb,Rabbit. 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ 1 2 g g g g g g g g g g g g g g g g g g g g g g g g g g A00445 A00920 A00925 A01313 A01272 A01262 A01433 A00328 A00329 A00461 A00460 A00919 A00662 Cat. No. (pSer www.genscript.com C-Jun 73 ) $225 $225 $225 $225 $225 $225 $225 $225 Price $311 $311 $311 $311 $311 $69 $50 $50 $69 $50 $50 $69 $50 $50 $69 $50 $50 $69 73 ),
- 98 Primary Antibodies Primary Antibodies Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $69 40 μg $50 AFX Antibody (Phospho-Ser197), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00372 APE1 Antibody, pAb, Rabbit ELISA, WB Human* A01205 200 μg $311 200 μg $225 40 μg $50 40 μg $50 Akt Antibody (Ab-308), pAb, Rabbit WB, IHC Human A00304 APH1 Antibody, pAb, Rabbit ELISA, WB Human, mouse A00884 200 μg $225 200 μg $225 40 μg $50 40 μg $69 Akt Antibody (Ab-473), pAb, Rabbit WB, IHC Human A00301 APP Antibody (Phospho-Thr668), pAb, Rabbit WB Human, mouse, rat A01026 200 μg $225 200 μg $311 40 μg $69 APP Antibody (Phospho-Tyr757), pAb, Rabbit ELISA, WB Human 40 μg A00697 $69 Akt Antibody (Phospho-Ser473), pAb, Rabbit WB, IHC Human A00272 200 μg $311 40 μg $50 APP FM Antibody (339-348), pAb, Rabbit ELISA, WB Human A00700 40 μg $69 200 μg $225 Akt Antibody (Phospho-Ser473), pAb, Rabbit ELISA, WB Human, mouse, rat A00965 200 μg $311 40 μg $50 ASK1 Antibody (Ab-83), pAb, Rabbit WB, IHC, IF Human A00422 40 μg $69 200 μg $225 Akt Antibody (Phospho-Thr308), pAb, Rabbit WB, IHC, IF Human,mouse,rat A00275 200 μg $311 40 μg $50 ASK1 Antibody (Ab-966), pAb, Rabbit IHC, IF Human A00425 40 μg $50 200 μg $225 AKT1 Antibody (Ab-450), pAb, Rabbit WB, IHC, IF Human A01293 200 μg $225 40 μg $69 ASK1 Antibody (Phospho-Ser83), pAb, Rabbit WB, IHC Human A00341 40 μg $69 200 μg $311 AKT1 Antibody (Phospho-Thr450), pAb, Rabbit IHC, IF Human A01291 200 μg $311 40 μg $69 ASK1 Antibody (Phospho-Ser966), pAb, Rabbit WB, IHC Human, mouse A00340 40 μg $50 200 μg $311 AKT1/AKT2 Antibody (Ab-308/309), pAb, Rabbit IHC Human A01252 200 μg $225 40 μg $50 ATF-2 Antibody (Ab-51/69), pAb, Rabbit WB, IHC Human A00258 AKT1/AKT2/AKT3 Antibody 40 μg $50 200 μg $225 IHC Human, mouse, rat A01227 (Ab-315/316/312), pAb, Rabbit 200 μg $225 40 μg $50 ATF-2 Antibody (Ab-55/73), pAb, Rabbit WB, IHC Human A00260 AKT1/AKT2/AKT3 Antibody (Phospho- 40 μg $69 200 μg $225 IHC, IF Human A01217 Tyr315/316/312), pAb, Rabbit 200 μg $311 40 μg $50 ATF-2 Antibody (Ab-62/44), pAb, Rabbit WB, IHC, IF Human A00257 40 μg $50 200 μg $225 Akt2 Antibody (Ab-474), pAb, Rabbit WB, IHC Human A00441 Antibodies 200 μg $225 40 μg $50 ATF-2 Antibody (Ab-71/53), pAb, Rabbit WB, IHC, IF Human A00259 40 μg $69 200 μg $225 Akt2 Antibody (Phospho-Ser474), pAb, Rabbit WB, IHC Human, mouse, rat A00385 200 μg $311 40 μg $50 ATF-2 Antibody (Ab-94/112), pAb, Rabbit WB, IHC Human A00261 40 μg $50 200 μg $225 ELISA, WB Human, mouse, rat* A01397 Alpha Internexin Antibody, pAb, Rabbit 12/94 Antibodies 200 μg $225 ATF-2 Antibody (Phospho-Ser1 ), 40 μg $69 IHC Human, mouse, rat A00476 40 μg $50 pAb, Rabbit 200 μg $311 AMPK1 Antibody (Ab-174), pAb, Rabbit WB, IHC, IF Human A00664 200 μg $225 ATF-2 Antibody (Phospho-Ser62/44), pAb, Rabbit IHC Human, mouse, rat 100 μg A00473 $240 AMPK1 Antibody (Phospho-Thr174), 40 μg $69 40 μg $69 IHC Human A00665 ATF-2 Antibody (Phospho-Thr69/51), pAb, Rabbit IHC, IF Human, mouse, rat A00474 pAb, Rabbit 200 μg $311 200 μg $311 AMPK1/AMPK2 Antibody (Phospho- 40 μg $69 40 μg $69 WB, IHC, IF Human A00345 ATF-2 Antibody (Phospho-Thr71/53), pAb, Rabbit WB, IHC Human, mouse, rat A00241 Ser485/491), pAb, Rabbit 200 μg $311 200 μg $311 Primary Antibodies Amyloid Precursor Protein Antibody 40 μg $50 ATF-2 Antibody (Phospho-Thr73/55), 40 μg $69 ELISA, WB Human, mouse A00693 IHC, IF Human, mouse, rat A00475 (292-312), pAb, Rabbit 200 μg $225 pAb, Rabbit 200 μg $311 Amyloid Precursor Protein Antibody 40 μg $50 40 μg $50 ELISA, WB, IF Human, mouse A00692 ATF-4 Antibody (Ab-245), pAb, Rabbit IHC Human A00300 (44-63), pAb, Rabbit 200 μg $225 200 μg $225 Amyloid Precursor Protein Antibody 40 μg $50 40 μg $69 ELISA, WB, IF Human, mouse A00694 ATF-4 Antibody (Phospho-Ser245), pAb, Rabbit IHC Human A00269
Primary Antibodies (653-662), pAb, Rabbit 200 μg $225 200 μg $311 Amyloid Precursor Protein Antibody 40 μg $50 40 μg $50 ELISA, WB, IF Human, mouse A00695 ATM Antibody (Ab-1981), pAb, Rabbit WB, IF Human A01222 (671-685), pAb, Rabbit 200 μg $225 200 μg $225 Amyloid Precursor Protein Antibody 40 μg $50 40 μg $69 ELISA, WB Human, mouse A00696 ATM Antibody (Phospho-Ser1981), pAb, Rabbit IHC Human, mouse A00437 (747-761), pAb, Rabbit 200 μg $225 200 μg $311 Amyloid Precursor Protein Antibody 40 μg $50 40 μg $50 ELISA, WB Human A00966 ATP1A1 Antibody, pAb, Rabbit WB Human, mouse, rat* A01483 (Ab-730), pAb, Rabbit 200 μg $225 200 μg $225 Androgen Receptor Antibody (Phospho- 40 μg $69 40 μg $69 WB, IF Human A01143 AuroraA Antibody (Phospho-Thr288), pAb, Rabbit IHC Human A01292 Ser213), pAb, Rabbit 200 μg $311 200 μg $311 Androgen Receptor Antibody (Phospho- 40 μg $69 BACE1 Antibody (26-45), pAb, Rabbit ELISA, WB Human 40 μg A00878 $50 IHC Human A01157 Ser650), pAb, Rabbit 200 μg $311 40 μg $50 BACE1 Antibody (46-65), pAb, Rabbit ELISA, WB Human A00879 40 μg $50 200 μg $225 Annexin II Antibody, pAb, Rabbit WB Human* A01471 200 μg $225 40 μg $50 BACE1 Antibody (485-501), pAb, Rabbit ELISA, WB Human A00880 40 μg $50 200 μg $225 AP2M1 Antibody, pAb, Rabbit ELISA, WB Human* A01247 200 μg $225
Your Innovation Partner in Drug Discovery! - 99 - www.genscript.com - 100 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 40 μg $50 BAD Antibody (Ab-112), pAb, Rabbit WB, IHC Human A00309 CaMKII Antibody (Ab-286), pAb, Rabbit WB, IF Human, mouse A00515 200 μg $225 200 μg $225 40 μg $50 40 μg $69 BAD Antibody (Ab-136), pAb, Rabbit WB, IHC Human A00310 CaMKII Antibody (Phospho-Thr286), pAb, Rabbit WB Human, mouse, rat A00563 200 μg $225 200 μg $311 40 μg $50 40 μl $85 BAD Antibody (Ab-155), pAb, Rabbit WB, IHC Human A00311 cAMP Antibody, pAb, Rabbit ELISA NA A00614 200 μg $225 200 μl $400 40 μg $69 40 μg $50 BAD Antibody (Phospho-Ser112), pAb, Rabbit WB, IHC Human,mouse,rat A00295 CARM1 Antibody (Ab-228), pAb, Rabbit WB, IF Human A00932 200 μg $311 200 μg $225 40 μg $69 40 μg $69 BAD Antibody (Phospho-Ser136), pAb, Rabbit IHC Human, mouse, rat A01156 CARM1 Antibody (Phospho-Ser228), pAb, Rabbit WB, IF Human A00924 200 μg $311 200 μg $311 40 μg $69 40 μg $50 BAD Antibody (Phospho-Ser155), pAb, Rabbit WB, IHC Human,mouse,rat A00296 Caspr2 Antibody, pAb, Rabbit WB Mouse, rat* A01426 200 μg $311 200 μg $225 40 μg $50 40 μg $50 BCL-2 Antibody (Ab-56), pAb, Rabbit WB, IHC, IF Human A00306 Catenin Antibody (Ab-33), pAb, Rabbit WB, IHC, IF Human A00584 200 μg $225 200 μg $225 40 μg $50 40 μg $50 BCL-2 Antibody (Ab-70), pAb, Rabbit WB, IHC Human A00307 Caveolin-1 Antibody (Ab-14), pAb, Rabbit WB Human, mouse A00413 200 μg $225 200 μg $225 40 μg $69 Caveolin-1 Antibody (Phospho-Tyr14), 40 μg $69 BCL-2 Antibody (Phospho-Ser70), pAb, Rabbit ELISA, IHC Human A00293 WB, IF Human, mouse, rat A00394 200 μg $311 pAb, Rabbit 200 μg $311 40 μg $69 40 μg $69 BCL-2 Antibody (Phospho-Thr56), pAb, Rabbit WB, IHC Human A00292 c-Cbl Antibody (Phospho-Tyr700), pAb, Rabbit IHC, IF Human A01276 200 μg $311 200 μg $311 40 μg $50 40 μg $50 BCL-XL Antibody (Ab-62), pAb, Rabbit WB Human A00308 CDC2 Antibody (Ab-15), pAb, Rabbit WB, IHC, IF Human A00565 200 μg $225 200 μg $225 40 μg $69 CDC2 Antibody (Ab-161), pAb, Rabbit WB, IF Human 100 μg $172 A00599 Antibodies BCL-XL Antibody (Phospho-Ser62), pAb, Rabbit WB, IHC, IF Human,mouse,rat A00294 200 μg $311 40 μg $50 cdc2 Antibody (Ab-19), pAb, Rabbit IHC Human 40 μg $50 200 μg A01295 $225 Bcr Antibody (Ab-177), pAb, Rab)bit WB, IF Human A00589 200 μg $225 40 μg $69 CDC2 Antibody (Phospho-Thr161), pAb, Rabbit WB, IHC Human, mouse, rat 40 μg $69 200 μg A00374 $311 Bcr Antibody (Phospho-Tyr117), pAb, Rabbit WB, IHC Human, mouse A00496 Antibodies 200 μg $311 40 μg $69 CDC2 Antibody (Phospho-Tyr15), pAb, Rabbit WB Human, mouse, rat 40 μg $50 200 μg A00524 $311 BIM Antibody (Ab-69), pAb, Rabbit WB, IHC Human, mouse A00514 200 μg $225 40 μg $50 cdc25A Antibody (Ab-76), pAb, Rabbit WB Human 40 μg $69 200 μg A00446 $225 BIM Antibody (Phospho-Ser69), pAb, Rabbit IHC, IF Human, mouse, rat A00566 200 μg $311 40 μg $69 cdc25A Antibody (Phospho-Ser76), pAb, Rabbit WB, IHC Human, mouse, rat 40 μg $50 200 μg A00439 $311 BLBP Antibody, pAb, Rabbit ELISA, WB Human A01422 200 μg $225 40 μg $50 Primary Antibodies cdc25C Antibody (Ab-216), pAb, Rabbit WB, IHC, IF Human 40 μg $50 200 μg A00433 $225 BRCA1 Antibody (Ab-1423), pAb, Rabbit WB, IHC Human A00567 200 μg $225 40 μg $69 cdc25C Antibody (Phospho-Ser216), pAb, Rabbit IHC, IF Human 40 μg $69 200 μg A00420 $311 BRCA1 Antibody (Phospho-Ser1423), pAb, Rabbit WB, IHC Human A00523 200 μg $311 40 μg $50 CDK5 Antibody, pAb, Rabbit WB Human, mouse, rat* 40 μg $69 200 μg A01438 $225 BRCA1 Antibody (Phospho-Ser1542), pAb, Rabbit IHC Human A00490
Primary Antibodies 200 μg $311 40 μg $50 CDK6 Antibody (Ab-13), pAb, Rabbit IHC, IF Human 40 μg $50 200 μg A01264 $225 c-Abl Antibody (Ab-412), pAb, Rabbit IHC Human A00442 200 μg $225 40 μg $50 CDK6 Antibody (Ab-24), pAb, Rabbit IHC Human 40 μg $69 200 μg A01265 $225 c-Abl Antibody (Phospho-Tyr412), pAb, Rabbit IHC, IF Human, mouse A00384 200 μg $311 40 μg $69 CDK6 Antibody (Phospho-Tyr24), pAb, Rabbit IHC, IF Human 40 μg $50 200 μg A01274 $311 Calbindin Antibody, pAb, Rabbit ELISA, WB, IHC Human* A01268 200 μg $225 40 μg $50 C-Fos Antibody, pAb, Rabbit WB Human 40 μg $50 200 μg A01512 $225 Calnexin Antibody, pAb, Rabbit ELISA, WB Human* A01192 200 μg $225 40 μg $50 C-Fos Antibody, pAb, Rabbit WB Human 40 μg $50 200 μg A01513 $225 Calnexin Antibody, pAb, Rabbit ELISA, WB Human A01234 200 μg $225 Chk1 Antibody (Ab-317), pAb, Rabbit WB, IHC Human 40 μg A00608 $50 40 μg $50 40 μg $69 Calnexin Antibody, pAb, Rabbit ELISA, WB Human, mouse* A01240 Chk1 Antibody (Phospho-Ser296), pAb, Rabbit ELISA, WB Human, mouse A00727 200 μg $225 200 μg $311 40 μg $50 40 μg $50 Calreticulin Antibody, pAb, Rabbit WB Human* A01443 Chk1 Antibody (Phospho-Ser280), pAb, Rabbit ELISA, WB Human* A01179 200 μg $225 200 μg $225
Your Innovation Partner in Drug Discovery! - 101 - www.genscript.com - 102 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 40 μg $50 Chk2 Antibody (Ab-33), pAb, Rabbit IHC Human A01261 Connexin 43 Antibody (Ab-367), pAb, Rabbit WB, IHC Human A00544 200 μg $225 200 μg $225 Chk2 Antibody (Ab-68), pAb, Rabbit WB, IHC Human 40 μg A00388 $50 Connexin 43 Antibody (Phospho-Ser367), 40 μg $69 WB, IHC Human, mouse, rat A00541 40 μg $69 pAb, Rabbit 200 μg $311 Chk2 Antibody (Phospho-Ser516), pAb, Rabbit WB Human A00365 200 μg $311 40 μg $50 Cortactin Antibody (Ab-421), pAb, Rabbit IHC Human, mouse A00521 40 μg $50 200 μg $225 CHRNA7 Antibody, pAb, Rabbit WB Human, mouse, rat* A01420 200 μg $225 40 μg $50 Cortactin Antibody (Ab-466), pAb, Rabbit WB, IHC Human, mouse A00520 40 μg $50 200 μg $225 c-Jun Antibody (Ab-170), pAb, Rabbit WB, IHC Human A00587 200 μg $225 Cortactin Antibody (Phospho-Tyr466), 40 μg $69 WB Human, mouse A00644 40 μg $50 pAb, Rabbit 200 μg $311 c-Jun Antibody (Ab-239), pAb, Rabbit WB, IHC Human A00235 200 μg $225 40 μg $50 Creatine kinase B Antibody, pAb, Rabbit WB Human, mouse, rat* A01458 40 μg $50 200 μg $225 c-Jun Antibody (Ab-243), pAb, Rabbit WB, IHC Human A00238 200 μg $225 40 μg $50 Creatine kinase M Antibody, pAb, Rabbit WB Mouse, rat* A01472 40 μg $50 200 μg $225 c-Jun Antibody (Ab-63), pAb, Rabbit WB Human, mouse A00580 200 μg $225 40 μg $50 Creatine kinase MB Antibody, pAb, Rabbit WB Human, mouse, rat* A01456 40 μg $50 200 μg $225 c-Jun Antibody (Ab-73), pAb, Rabbit WB, IHC Human A00197 200 μg $225 40 μg $50 CREB Antibody (Ab-129), pAb, Rabbit WB, IHC Human A00519 40 μg $50 200 μg $225 c-Jun Antibody (Ab-91), pAb, Rabbit WB, IHC, IF Human A00231 200 μg $225 40 μg $50 CREB Antibody (Ab-133), pAb, Rabbit WB, IHC Human A00286 40 μg $50 200 μg $225 c-Jun Antibody (Ab-93), pAb, Rabbit WB, IHC Human A00233 200 μg $225 40 μg $50 CREB Antibody (Ab-142), pAb, Rabbit IHC Human A01182 243 40 μg $69 200 μg $225 c-Jun Antibody (Phospho-Ser ), pAb, Rabbit WB, IHC Human, mouse, rat A00237 200 μg $311 40 μg $69 CREB Antibody (Phospho-Ser129), pAb, Rabbit WB, IHC Human, mouse, rat A00556 Antibodies 63 40 μg $69 200 μg $311 c-Jun Antibody (Phospho-Ser ), pAb, Rabbit WB, IHC Human, mouse,rat A00466 200 μg $311 40 μg $69 CREB Antibody (Phospho-Ser133), pAb, Rabbit WB, IHC Human, mouse, rat A00267 73 40 μg $69 200 μg $311 c-Jun Antibody (Phospho-Ser ), pAb, Rabbit WB, IHC Human, mouse, rat A00194 200 μg $311 40 μg $69 CREB Antibody (Phospho-Ser142), pAb, Rabbit IHC Human A01181 Antibodies 239 40 μg $69 200 μg $311 c-Jun Antibody (Phospho-Thr ), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00236 200 μg $311 40 μg $50 Cytochrome C Antibody, pAb, Rabbit WB Human, mouse. A01507 91 40 μg $69 200 μg $225 c-Jun Antibody (Phospho-Thr ), pAb, Rabbit WB, IHC Human, mouse, rat A00232 200 μg $311 40 μg $50 DARPP-32 Antibody, pAb, Rabbit WB Mouse, rat* A01424 93 40 μg $69 200 μg $225 c-Jun Antibody (Phospho-Thr ), pAb, Rabbit WB, IHC NA A00234 200 μg $311 40 μg $50 DJ-1 Antibody, pAb, Rabbit ELISA, WB, IHC Human* A01207 Primary Antibodies 170 40 μg $69 200 μg $225 c-Jun Antibody (Phospho-Tyr ), pAb, Rabbit WB Human, mouse, rat A00471 200 μg $311 40 μg $50 DJ-1 Antibody, pAb, Rabbit ELISA, WB Human, mouse* A01208 40 μg $50 200 μg $225 c-Kit Antibody (Ab-721), pAb, Rabbit WB Human A01166 200 μg $225 40 μg $50 DNA PKcs Antibody (Ab-2609), pAb, Rabbit WB Human, mouse A00591 936 40 μg $69 200 μg $225 c-Kit Antibody (Phospho-Tyr ), pAb, Rabbit IHC Human A01273 200 μg $311 DNA PKcs Antibody (Phospho-Thr2609), 40 μg $69 WB Human A00494
Primary Antibodies 40 μg $50 pAb, Rabbit 200 μg $311 CNPase Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* A01308 200 μg $225 40 μg $50 Doublecortin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat* A01303 40 μg $50 200 μg $225 Cofilin Antibody (Ab-3), pAb, Rabbit WB, IHC Human A00447 200 μg $225 40 μg $50 EB1 Antibody, pAb, Rabbit WB Human A00678 3 40 μg $69 200 μg $225 Cofilin Antibody (Phospho-Ser ), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00369 200 μg $311 40 μg $50 EEA1 Antibody,pAb,Rabbit WB Human, mouse, rat A01514 40 μg $50 200 μg $225 Cofilin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse* A01239 200 μg $225 40 μg $50 EGFR Antibody (Ab-1070), pAb, Rabbit WB, IHC Human A00344 40 μg $50 200 μg $225 Cofilin Antibody, pAb, Rabbit ELISA, WB Human, mouse* A01277 200 μg $225 40 μg $50 EGFR Antibody (Ab-1092), pAb, Rabbit WB, IHC Human A00346 40 μg $50 200 μg $225 Cofilin1/Cofilin2 Antibody (Ab-88), pAb, Rabbit WB, IHC, IF Human A01254 200 μg $225 40 μg $50 EGFR Antibody (Ab-1110), pAb, Rabbit WB, IHC Human A00538 40 μg $50 200 μg $225 Connexin 30 Antibody, pAb, Rabbit ELISA, WB NA A00892 200 μg $225 40 μg $50 EGFR Antibody (Ab-1172), pAb, Rabbit WB Human A00661 40 μg $50 200 μg $225 Connexin 32 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat A01312 200 μg $225
Your Innovation Partner in Drug Discovery! - 103 - www.genscript.com - 104 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 40 μg $50 EGFR Antibody (Ab-1197), pAb, Rabbit WB Human A00578 Ephrin-B2 Antibody (Ab-330), pAb, Rabbit WB, IF Human A00670 200 μg $225 200 μg $225 40 μg $50 40 μg $50 EGFR Antibody (Ab-678), pAb, Rabbit WB Human A00666 ERAB Antibody, pAb, Rabbit ELISA, WB Human* A01095 200 μg $225 200 μg $225 40 μg $50 40 μg $50 EGFR Antibody (Ab-869), pAb, Rabbit WB, IHC Human A00577 Estrogen Receptor Beta Antibody, pAb, Rabbit ELISA, WB NA A00939 200 μg $225 200 μg $225 40 μg $69 Estrogen Receptor-α Antibody (Ab-104), 40 μg $50 EGFR Antibody (Phospho-Ser1070), pAb, Rabbit WB, IHC Human, mouse, rat A00320 WB, IHC Human A00316 200 μg $311 pAb, Rabbit 200 μg $225 40 μg $69 Estrogen Receptor-α Antibody (Ab-106), 40 μg $50 EGFR Antibody (Phospho-Thr678), pAb, Rabbit WB Human, mouse, rat A00667 WB, IHC Human A00317 200 μg $311 pAb, Rabbit 200 μg $225 40 μg $69 Estrogen Receptor-α Antibody (Ab-118), 40 μg $50 EGFR Antibody (Phospho-Thr693), pAb, Rabbit WB Human, mouse, rat A00668 WB, IHC Human A00322 200 μg $311 pAb, Rabbit 200 μg $225 40 μg $69 Estrogen Receptor-α Antibody (Ab-167), 40 μg $50 EGFR Antibody (Phospho-Tyr1092), pAb, Rabbit WB, IHC Human,mouse, rat A00361 WB, IHC Human A00323 200 μg $311 pAb, Rabbit 200 μg $225 40 μg $69 Estrogen Receptor-α Antibody 40 μg $69 EGFR Antibody (Phospho-Tyr1110), pAb, Rabbit WB Human, mouse, rat A00548 IHC Human, mouse A00479 200 μg $311 (Phospho-Ser104), pAb, Rabbit 200 μg $311 40 μg $69 Estrogen Receptor-α Antibody 40 μg $69 EGFR Antibody (Phospho-Tyr1172), pAb, Rabbit WB, IHC Human, mouse, rat A00501 WB, IHC, IF Human, mouse A00297 200 μg $311 (Phospho-Ser106), pAb, Rabbit 200 μg $311 40 μg $69 Estrogen Receptor-α Antibody 40 μg $69 EGFR Antibody (Phospho-Tyr1197), pAb, Rabbit WB, IHC Human, mouse, rat A00502 WB, IHC, IF Human, mouse A00298 200 μg $311 (Phospho-Ser118), pAb, Rabbit 200 μg $311 40 μg $69 Estrogen Receptor-α Antibody 40 μg $69 EGFR Antibody (Phospho-Tyr869), pAb, Rabbit WB Human, mouse, rat A00271 WB, IHC, IF Human, mouse A00299 200 μg $311 (Phospho-Ser167), pAb, Rabbit 200 μg $311 40 μg $50 40 μg $50 eIF2α Antibody (Ab-51), pAb, Rabbit WB, IHC, IF Human A00518 Ezrin Antibody (Ab-353), pAb, Rabbit WB Human A00392 Antibodies 200 μg $225 200 μg $225 40 μg $69 40 μg $50 eIF2α Antibody (Phospho-Ser49), pAb, Rabbit IHC, IF Human A01270 Ezrin Antibody (Ab-567), pAb, Rabbit WB Human A00457 200 μg $311 200 μg $225 40 μg $69 40 μg $69 eIF2α Antibody (Phospho-Ser51), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00559 Ezrin Antibody (Phospho-Thr567), pAb, Rabbit WB Human, mouse, rat A00334 Antibodies 200 μg $311 200 μg $311 40 μg $50 Ezrin Antibody (Phospho-Tyr353), pAb, Rabbit WB, IHC Human, mouse 40 μg A00291 $69 eIF4E Antibody (Ab-209), pAb, Rabbit WB, IHC, IF Human A00574 200 μg $225 40 μg $50 FAK Antibody (Ab-861), pAb, Rabbit WB, IHC Human A00350 40 μg $69 200 μg $225 eIF4E Antibody (Phospho-Ser209), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00504 200 μg $311 40 μg $50 FAK Antibody (Ab-925), pAb, Rabbit WB, IHC, IF Human A00434 40 μg $50 200 μg $225 eIF4G Antibody (Ab-1232), pAb, Rabbit WB, IHC, IF Human A01228 200 μg $225 40 μg $69 Primary Antibodies FAK Antibody (Phospho-Tyr397), pAb, Rabbit WB, IF Human, rat A01142 40 μg $69 200 μg $311 eIF4G Antibody (Phospho-Ser1232), pAb, Rabbit WB, IHC Human A01218 200 μg $311 40 μg $69 FAK Antibody (Phospho-Tyr861), pAb, Rabbit WB Human, mouse ,rat A00287 40 μg $50 200 μg $311 Elk-1 Antibody (Ab-383), pAb, Rabbit WB, IHC Human A00198 200 μg $225 40 μg $69 FAK Antibody (Phospho-Tyr925), pAb, Rabbit WB, IF Human, mouse, rat A00387 40 μg $50 200 μg $311 Elk-1 Antibody (Ab-389), pAb, Rabbit IHC, IF Human A00266
Primary Antibodies 200 μg $225 40 μg $50 FGF Receptor 1 Antibody (Ab-154), pAb, Rabbit WB Human, mouse A01155 40 μg $50 200 μg $225 Elk-1 Antibody (Ab-417), pAb, Rabbit IHC Human A00592 200 μg $225 Human, rat, plant, 40 μg $69 Fibrillarin Antibody, mAb, Mouse WB, IF drosophila, C. elegans, 100 μg A00153 $204 Elk-1 Antibody (Phospho-Ser383), pAb, Rabbit WB, IHC Human, mouse, rat A00195 200 μg $311 S. pombe 40 μg $69 40 μg $50 Elk-1 Antibody (Phospho-Ser389), pAb, Rabbit IHC Human, mouse, rat A00245 FKHR Antibody (Ab-256), pAb, Rabbit WB, IHC, IF Human A00427 200 μg $311 200 μg $225 40 μg $69 40 μg $50 Elk-1 Antibody (Phospho-Thr417), pAb, Rabbit IHC, IF Human, mouse, rat A00246 FKHR Antibody (Ab-319), pAb, Rabbit WB, IHC Human A00444 200 μg $311 200 μg $225 40 μg $50 40 μg $69 eNOS Antibody (Ab-1177), pAb, Rabbit WB, IF Human A01152 FKHR Antibody (Phospho-Ser256), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00395 200 μg $225 200 μg $311 40 μg $69 40 μg $69 eNOS Antibody (Phospho-Ser1177), pAb, Rabbit IHC, IF Human, mouse, rat A01158 FKHR Antibody (Phospho-Ser319), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00373 200 μg $311 200 μg $311 40 μg $50 40 μg $50 Ephrin-B2 Antibody (Ab-316), pAb, Rabbit WB Human A00669 FKHRL1 Antibody (Ab-253), pAb, Rabbit WB, IHC, IF Human, mouse A00450 200 μg $225 200 μg $225
Your Innovation Partner in Drug Discovery! - 105 - www.genscript.com - 106 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $69 40 μg $50 FKHRL1 Antibody (Phospho-Ser253), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00354 HDAC2 Antibody (Ab-394), pAb, Rabbit WB, IHC, IF Human A00428 200 μg $311 200 μg $225 40 μg $50 40 μg $69 G3BP-1 Antibody (Ab-232), pAb, Rabbit WB, IHC Human A00404 HDAC2 Antibody (Phospho-Ser294), pAb, Rabbit WB, IHC, IF Human, mouse, rat A01169 200 μg $225 200 μg $311 40 μg $69 40 μg $50 G3BP-1 Antibody (Phospho-Ser232), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00364 HDAC2 Antibody, pAb, Rabbit ELISA, WB Human* A01178 200 μg $311 200 μg $225 40 μg $50 40 μg $50 Gab1 Antibody (Ab-627), pAb, Rabbit WB, IHC Human A00512 HDAC4 Antibody (Ab-632), pAb, Rabbit WB, IF Human A00429 200 μg $225 200 μg $225 40 μg $69 40 μg $69 Gab1 Antibody (Phospho-Tyr627), pAb, Rabbit WB, IF Human, mouse A00568 HDAC4 Antibody (Phospho-Ser632), pAb, Rabbit WB Human, mouse, rat A00338 200 μg $311 200 μg $311 40 μg $50 HDAC4/HDAC5/HDAC9 Antibody 40 μg $50 GABRB1 Antibody (Ab-434), pAb, Rabbit WB Human A01231 WB, IHC, IF Human, mouse A01257 200 μg $225 (Ab-246/259/220), pAb, Rabbit 200 μg $225 40 μg $50 HDAC4/HDAC5/HDAC9 Antibody (Phospho- 40 μg $69 GAD65 Antibody, pAb, Rabbit WB NA A01496 WB, IHC Human, mouse A01271 200 μg $225 Ser246/259/220), pAb, Rabbit 200 μg $311 40 μg $50 40 μg $50 GAD65+GAD67 Antibody, pAb, Rabbit WB Mouse, rat* A01437 HDAC5 Antibody (Ab-498), pAb, Rabbit WB, IHC Human, mouse A00430 200 μg $225 200 μg $225 40 μg $50 40 μg $69 GAD67 Antibody, pAb, Rabbit WB Human, mouse, rat* A01440 HDAC5 Antibody (Phospho-Ser498), pAb, Rabbit WB, IHC Human, mouse, rat A00337 200 μg $225 200 μg $311 40 μg $50 40 μg $50 GAP43 Antibody (Ab-41), pAb, Rabbit WB, IHC, IF Human, mouse A01046 HDAC8 Antibody (Ab-39), pAb, Rabbit WB, IHC Human, mouse A00431 200 μg $225 200 μg $225 40 μg $50 HDAC8 Antibody (Phospho-Ser39), pAb, Rabbit IHC, IF Human 100 μg A00382 $240 GAP-43 Antibody, pAb, Rabbit ELISA, WB Mouse, rat* A01414 200 μg $225 40 μg $50 HEC1 Antibody,pAb,Rabbit WB Human A01504 40 μg $50 200 μg $225 GAP-43 Antibody, pAb, Rabbit WB Mouse, rat* A01441 Antibodies 200 μg $225 40 μg $50 HER2 Antibody (Ab-1221,1222), pAb, Rabbit WB, IHC Human A00327 40 μg $50 200 μg $225 GATA1 Antibody (Ab-142), pAb, Rabbit WB, IHC, IF Human A00270 200 μg $225 40 μg $50 HER2 Antibody (Ab-1248), pAb, Rabbit WB, IHC Human A00331 40 μg $50 200 μg $225 GATA1 Antibody (Ab-310), pAb, Rabbit WB Human A00273 Antibodies 200 μg $225 40 μg $50 HER2 Antibody (Ab-877), pAb, Rabbit WB, IHC Human A00325 40 μg $69 200 μg $225 GATA1 Antibody (Phospho-Ser142), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00247 200 μg $311 40 μg $69 HER2 Antibody (Phospho-Tyr1221, 1222), pAb, Rabbit WB, IF Human A00314 40 μg $69 200 μg $311 GATA1 Antibody (Phospho-Ser310), pAb, Rabbit WB, IF Human, mouse, rat A00248 200 μg $311 40 μg $69 HER2 Antibody (Phospho-Tyr1248), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00318 Human, cow, pig, mouse, 200 μg $311
GFAP Antibody, mAb, Mouse WB, IF rat, all other mammalian 100 μg A00085 $259 40 μg $69 Primary Antibodies HER2 Antibody (Phospho-Tyr877), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00313 and avian species 200 μg $311 40 μg $50 40 μg $50 GFAP Antibody, pAb, Rabbit ELISA, WB, IHC Human, rat* A01309 HER3/ErbB3 Antibody (Ab-1328), pAb, Rabbit WB, IHC, IF Human A01255 200 μg $225 200 μg $225 40 μg $50 HER3/ErbB3 Antibody (Phospho-Tyr1328), 40 μg $69 GluR1 Antibody (Ab-849), pAb, Rabbit WB Human, mouse A01043 WB, IHC, IF Human A01269 200 μg $225 pAb, Rabbit 200 μg $311
Primary Antibodies 849 40 μg $69 40 μg $50 GluR1 Antibody (Phospho-Ser ), pAb, Rabbit WB Human, mouse, rat A01028 Histone H2A.X Antibody (Ab-139), pAb, Rabbit WB, IHC Human A00529 200 μg $311 200 μg $225 40 μg $50 Histone H2A.X Antibody (Phospho-Ser139), 40 μg $69 Glutamine Synthetase Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat A01305 WB, IF Human A00552 200 μg $225 pAb, Rabbit 200 μg $311 40 μg $50 40 μg $50 GRP94 Antibody, pAb, Rabbit WB Human A01510 Histone H3 Antibody,pAb,Rabbit WB Human, mouse, rat A01502 200 μg $225 200 μg $225 40 μg $50 40 μg $50 GSK3α Antibody (Ab-21), pAb, Rabbit WB, IHC, IF Human A00210 Histone H3.1 Antibody (Ab-10), pAb, Rabbit WB, IF Human A00426 200 μg $225 200 μg $225
10 21 40 μg $69 Histone H3.1 Antibody (Phospho-Ser ), 40 μg $69 GSK3α Antibody (Phospho-Ser ), pAb, Rabbit WB, IHC Human, mouse, rat A00216 WB, IHC, IF Human, mouse, rat A00339 200 μg $311 pAb, Rabbit 200 μg $311 40 μg $50 40 μg $50 GSK3β Antibody (Ab-9), pAb, Rabbit WB, IHC, IF Human A00196 hnRNP C1/C2 Antibody, pAb, Rabbit WB Human A01484 200 μg $225 200 μg $225
9 40 μg $69 40 μg $50 GSK3β Antibody (Phospho-Ser ), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00193 HSF1 Antibody (Ab-303), pAb, Rabbit WB, IHC Human A00610 200 μg $311 200 μg $225
216 40 μg $69 40 μg $50 GSK3β Antibody (Phospho-Tyr ), pAb, Rabbit WB, IHC, IF Human A01031 HSF1 Antibody (Ab-307), pAb, Rabbit WB, IHC Human A00671 200 μg $311 200 μg $225
Your Innovation Partner in Drug Discovery! - 107 - www.genscript.com - 108 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $69 Human, rat, mouse, cat, HSF1 Antibody (Phospho-Ser303), pAb, Rabbit WB, IHC Human A00546 Internexin/NF66 Antibody, pAb, Rabbit WB, IF 100 μg A00149 $204 200 μg $311 other mammals 40 μg $69 IRS-1 Antibody (Ab-307), pAb, Rabbit IHC, IF Human 100 μg A00572 $172 HSF1 Antibody (Phospho-Ser307), pAb, Rabbit WB, IF Human A01164 200 μg $311 40 μg $50 IRS-1 Antibody (Ab-312), pAb, Rabbit WB Human A01151 40 μg $50 200 μg $225 HSP27 Antibody (Ab-15), pAb, Rabbit WB, IHC Human A00432 200 μg $225 40 μg $50 IRS-1 Antibody (Ab-636), pAb, Rabbit WB, IHC, IF Human A00575 40 μg $50 200 μg $225 HSP27 Antibody (Ab-78), pAb, Rabbit WB, IHC Human A00560 200 μg $225 40 μg $50 IRS-1 Antibody (Ab-639), pAb, Rabbit WB, IF Human A01042 40 μg $50 200 μg $225 HSP27 Antibody (Ab-82), pAb, Rabbit WB, IHC Human A00558 200 μg $225 40 μg $69 IRS-1 Antibody (Phospho-Ser307), pAb, Rabbit IHC Human, mouse, rat A00506 40 μg $69 200 μg $311 HSP27 Antibody (Phospho-Ser15), pAb, Rabbit WB, IHC, IF Human A00343 200 μg $311 40 μg $69 IRS-1 Antibody (Phospho-Ser636), pAb, Rabbit WB, IHC Human, mouse, rat A00503 40 μg $69 200 μg $311 HSP27 Antibody (Phospho-Ser78), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00528 200 μg $311 40 μg $69 IRS-1 Antibody (Phospho-Ser639), pAb, Rabbit WB, IHC Human, mouse, rat A01027 40 μg $69 200 μg $311 HSP27 Antibody (Phospho-Ser82), pAb, Rabbit WB, IHC Human A00530 200 μg $311 40 μg $50 IκB-α Antibody (Ab-32, 36), pAb, Rabbit WB, IHC, IF Human A00609 40 μg $50 200 μg $225 HSP90B Antibody (Ab-254), pAb, Rabbit WB, IHC, IF Human A00672 200 μg $225 40 μg $50 IκB-α Antibody (Ab-42), pAb, Rabbit WB, IHC Human A00453 40 μg $69 200 μg $225 HSP90B Antibody (Phospho-Ser254), pAb, Rabbit WB Human, mouse, rat A00921 200 μg $311 40 μg $69 IκB-α Antibody (Phospho-Ser32,36), pAb, Rabbit IHC, IF Human, mouse, rat A00359 40 μg $50 200 μg $311 HtrA2 Antibody, pAb, Rabbit WB Human, mouse, rat* A01427 200 μg $225 40 μg $69 IκB-α Antibody (Phospho-Tyr42), pAb, Rabbit IHC Human, mouse, rat A00349 Huntingtin Antibody, mAb, Mouse WB, IHC Human, mouse 100 μg A00089 $259 200 μg $311 Antibodies 40 μg $50 40 μg $50 ICAM-1 Antibody (Ab-512), pAb, Rabbit WB Human A01038 IκB-β Antibody (Ab-23), pAb, Rabbit WB, IHC Human A00928 200 μg $225 200 μg $225 40 μg $69 40 μg $69 ICAM-1 Antibody (Phospho-Tyr512), pAb, Rabbit WB Human A01020 IκB-β Antibody (Phospho-Ser23), pAb, Rabbit IHC Human, mouse, rat A01032 200 μg $311 200 μg $311
Antibodies 40 μg $50 40 μg $50 IGF-1R Antibody (Ab-1161), pAb, Rabbit WB, IHC Human A00380 JAK1 Antibody (Ab-1022), pAb, Rabbit WB, IHC Human A00418 200 μg $225 200 μg $225 40 μg $50 40 μg $69 IGF-1R Antibody (Ab-1165, 1166), pAb, Rabbit WB Human A00383 JAK1 Antibody (Phospho-Tyr1022), pAb, Rabbit WB, IHC Human, mouse, rat A00363 200 μg $225 200 μg $311 40 μg $50 40 μg $50 IGF-1R Antibody (Ab-1346), pAb, Rabbit WB, IHC Human A00927 JAK2 Antibody (Ab-1007), pAb, Rabbit WB Human, mouse A01185 200 μg $225 200 μg $225
40 μg $69 40 μg $50 Primary Antibodies IGF-1R Antibody (Phospho-Tyr1161), pAb, Rabbit WB, IHC, IF Human A00371 JAK2 Antibody (Ab-221), pAb, Rabbit IHC Human A00419 200 μg $311 200 μg $225 40 μg $69 40 μg $50 IGF-1R Antibody (Phospho-Tyr1165,1166), pAb, Rabbit WB, IF Human, mouse, rat A00376 Jak2 Antibody (Ab-570), pAb, Rabbit IHC Human A01259 200 μg $311 200 μg $225 40 μg $50 40 μg $69 IKKα Antibody (Ab-23), pAb, Rabbit WB, IHC Human A00421 JAK2 Antibody (Phospho-Tyr1007), pAb, Rabbit WB, IHC Human, mouse, rat A00360 200 μg $225 200 μg $311 40 μg $69
Primary Antibodies 40 μg $69 IKKα Antibody (Phospho-Thr23), pAb, Rabbit WB, IHC Human, mouse, rat A00356 JAK2 Antibody (Phospho-Tyr221), pAb, Rabbit IHC Human, mouse, rat A00362 200 μg $311 200 μg $311 40 μg $50 40 μg $50 Integrin β3 Antibody (Ab-773), pAb, Rabbit WB, IHC Human A00386 JunB Antibody (Ab-259), pAb, Rabbit WB, IHC Human A00256 200 μg $225 200 μg $225 40 μg $50 40 μg $50 Integrin β3 Antibody (Ab-785), pAb, Rabbit WB Human A01167 JunB Antibody (Ab-79), pAb, Rabbit IHC, IF Human A00255 200 μg $225 200 μg $225 40 μg $69 40 μg $69 Integrin β3 Antibody (Phospho-Tyr773), pAb, Rabbit WB, IHC Human,mouse A00288 JunB Antibody (Phospho-Ser259), pAb, Rabbit WB, IHC Human, mouse, rat A00240 200 μg $311 200 μg $311 40 μg $69 40 μg $69 Integrin β3 Antibody (phospho-Tyr785), pAb, Rabbit WB Human, mouse A00663 JunB Antibody (Phospho-Ser79), pAb, Rabbit IHC, IF Human, mouse, rat A00239 200 μg $311 200 μg $311 Human, rat, mouse, cat, 40 μg $50 Internexin/NF66 1 Antibody, mAb, Mouse WB, IF, ICC 100 μg A00147 $204 JunD Antibody (Ab-255), pAb, Rabbit WB, IHC, IF Human A00590 other mammals 200 μg $225 Human, rat, mouse, cat, 40 μg $69 Internexin/NF66 2 Antibody, mAb, Mouse WB, IHC, IF 100 μg A00148 $204 JunD Antibody (Phospho-Ser225), pAb, Rabbit WB, IHC Human, mouse, rat A00472 other mammals 200 μg $311 40 μg $69 Internexin/NF66 Antibody, pAb, Chicken WB, IF Human 100 μg A00150 $204 Keratin 18 Antibody (Phospho-Ser33), pAb, Rabbit WB, IHC Human A01033 200 μg $311
Your Innovation Partner in Drug Discovery! - 109 - www.genscript.com - 110 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 40 μg $69 Ki-67 Antibody, pAb, Rabbit IHC Human A01495 MKK3 Antibody (Phospho-Ser189), pAb, Rabbit WB, IHC, IF Human, rat A00440 200 μg $225 200 μg $311 40 μg $50 40 μg $50 LC3A Antibody, pAb, Rabbit WB, IF Human A00971 MKK6 Antibody (Ab-207), pAb, Rabbit WB, IHC, IF Human A00438 200 μg $225 200 μg $225 40 μg $69 40 μg $69 Lck Antibody (Phospho-Tyr394), pAb, Rabbit WB Human, mouse A01024 MKK6 Antibody (Phospho-Ser207), pAb, Rabbit WB, IHC, IF Human, rat A00443 200 μg $311 200 μg $311 MAP2 Antibody, pAb, Chicken WB, IF Human, rat, mouse, bovine 100 μg A00156 $204 40 μg $50 MSK1 Antibody (Ab-376), pAb, Rabbit WB Human A00588 MAPKAPK-2 Antibody (Phospho-Thr334), 40 μg $69 200 μg $225 WB, IHC, IF Human A01034 pAb, Rabbit 200 μg $311 40 μg $50 mTOR Antibody (Ab-2448), pAb, Rabbit WB, IHC, IF Human A01154 40 μg $50 200 μg $225 MARCKS Antibody (Ab-158), pAb, Rabbit WB, IF Human, mouse A00511 200 μg $225 40 μg $69 mTOR Antibody (Phospho-Ser2448), pAb, Rabbit IHC, IF Human, mouse, rat A00643 MARCKS Antibody (Ab-162), pAb, Rabbit WB Human 100 μg A00536 $172 200 μg $311 40 μg $69 Muscleblind Antibody, mAb, Mouse WB, IF, ICC Human, mouse, rat 100 μg A00154 $204 MARCKS Antibody (Phospho-Ser158), pAb, Rabbit WB, IF Human, mouse, rat A00570 200 μg $311 40 μg $50 Myc Antibody (Ab-358), pAb, Rabbit WB, IHC Human A00264 MARCKS Antibody, pAb, Rabbit WB, IF, ICC NA 100 μg A00155 $204 200 μg $225 40 μg $50 40 μg $50 MEF2A Antibody (Ab-312), pAb, Rabbit WB, IHC Human, mouse A00642 Myc Antibody (Ab-373), pAb, Rabbit WB Human, mouse A00265 200 μg $225 200 μg $225 40 μg $50 40 μg $50 MEF2A Antibody (Ab-319), pAb, Rabbit IHC Human A00268 Myc Antibody (Ab-58), pAb, Rabbit WB, IHC Human A00262 200 μg $225 200 μg $225
312 40 μg $69 40 μg $69 MEF2A Antibody (Phospho-Thr ), pAb, Rabbit IHC, IF Human, mouse, rat A00477 Myc Antibody (Phospho-Ser373), pAb, Rabbit IHC Human, mouse, rat A00244 200 μg $311 200 μg $311 40 μg $50 40 μg $69 MEK1 Antibody (Ab-217), pAb, Rabbit WB, IHC, IF Human A01041 Myc Antibody (Phospho-Thr358), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00243 200 μg $225 200 μg $311 Antibodies 40 μg $50 40 μg $69 MEK1 Antibody (Ab-221), pAb, Rabbit WB, IHC Human A00452 Myc Antibody (Phospho-Thr58), pAb, Rabbit WB, IHC Human, mouse, rat A00242 200 μg $225 200 μg $311 40 μg $50 40 μg $50 MEK1 Antibody (Ab-291), pAb, Rabbit WB, IHC Human A00510 Myelin Basic Protein Antibody, pAb, Rabbit ELISA, WB Mouse, rat* A01407 200 μg $225 200 μg $225 Antibodies 217 40 μg $69 40 μg $50 MEK1 Antibody (Phospho-Ser ), pAb, Rabbit IHC Human, mouse, rat A00497 MyoD Antibody (Ab-200), pAb, Rabbit WB Human A00607 200 μg $311 200 μg $225
221 40 μg $69 40 μg $69 MEK1 Antibody (Phospho-Ser ), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00351 MyoD Antibody (Phospho-Ser200), pAb, Rabbit WB Human, mouse, rat A00480 200 μg $311 200 μg $311 40 μg $69 WB, IF 100 μg A00597 $172 MEK1 Antibody (Phospho-Thr291), pAb, Rabbit WB Human, mouse, rat A00571 Myosin Light Chain 2 Antibody (Ab-18), pAb, Rabbit Human 200 μg $311 Myosin Light Chain 2 Antibody 40 μg $69 IHC Human, mouse, rat A01180 40 μg $50 18 200 μg $311 Primary Antibodies MEK2 Antibody (Ab-394), pAb, Rabbit WB, IHC Human A00211 (Phospho-Ser ), pAb, Rabbit 200 μg $225 40 μg $50 NCAM Antibody, pAb, Rabbit ELISA, WB Rat, mouse* A01415 40 μg $69 200 μg $225 MEK2 Antibody (Phospho-Thr394), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00217 200 μg $311 40 μg $50 Nestin Antibody, pAb, Rabbit ELISA, WB Human* A01413 40 μg $50 200 μg $225 MELK Antibody, pAb, Rabbit ELISA, WB Human, mouse* A01390 200 μg $225 40 μg $50 Neurofascin Antibody, pAb, Rabbit ELISA, WB Rat, mouse* A01377
Primary Antibodies 40 μg $50 200 μg $225 Merlin Antibody (Ab-518), pAb, Rabbit WB, IHC Human A00533 200 μg $225 40 μg $50 Neuroserpin Antibody, pAb, Rabbit WB Mouse, rat* A01482 40 μg $69 200 μg $225 Merlin Antibody (Phospho-Ser518), pAb, Rabbit WB, IF Human, mouse, rat A00549 200 μg $311 NF-H Antibody, mAb, Mouse WB, IF A variety of species 100 μg A00137 $204 40 μg $50 Human, rat, mouse, cat, Met Antibody (Ab-1234), pAb, Rabbit WB Human A00464 NF-H Antibody, pAb, Chicken ELISA, WB, IF 100 μg A00136 200 μg $225 chicken $204 40 μg $50 Met Antibody (Ab-1349), pAb, Rabbit WB Human A00569 NF-H Antibody, pAb, Rabbit ELISA, WB, IF A variety of species 100 μg A00135 $204 200 μg $225 40 μg $69 Human, rat, mouse, cat, Met Antibody (Phospho-Tyr1234), pAb, Rabbit WB Human, mouse, rat A00321 NF-L Antibody, mAb, Mouse WB, IF 100 μg A00139 $204 200 μg $311 chicken
1349 40 μg $69 Human, rat, mouse, cat, Met Antibody (Phospho-Tyr ), pAb, Rabbit WB Human, mouse, rat A00507 NF-L Antibody, pAb, Chicken WB, IF 100 μg A00140 $204 200 μg $311 chicken 40 μg $50 Human, rat, mouse, cat, mGluR5 Antibody, pAb, Rabbit WB Human A01493 NF-L Antibody, pAb, Rabbit WB, IF, ICC 100 μg A00138 $204 200 μg $225 chicken 40 μg $50 Human, rat, mouse, cat, MKK3 Antibody (Ab-189), pAb, Rabbit WB, IHC, IF Human A00415 NF-M Antibody, mAb, Mouse IF, Immunoblotting 100 μg A00145 $204 200 μg $225 chicken
Your Innovation Partner in Drug Discovery! - 111- www.genscript.com - 112 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price Human, rat, mouse, cat, 40 μg $69 NF-M Antibody, pAb, Chicken WB, IF 100 μg A00146 $204 NF-κB p65 Antibody (Phospho-Ser529), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00330 chicken 200 μg $311 Human, rat, mouse, cat, 40 μg $69 NF-M Antibody, pAb, Rabbit WB, IF, ICC 100 μg A00144 $204 NF-κB p65 Antibody (phospho-ser536), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00224 chicken 200 μg $311 40 μg $50 40 μg $69 NF-κB p100/p52 Antibody (Ab-866), pAb, Rabbit WB, IHC Human A00583 NF-κB p65 Antibody (Phospho-Thr254), pAb, Rabbit WB, IHC, IF Human A00468 200 μg $225 200 μg $311 40 μg $50 40 μg $69 NF-κB p100/p52 Antibody (Ab-870), pAb, Rabbit WB, IHC Human A00225 NF-κB p65 Antibody (Phospho-Thr435), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00221 200 μg $225 200 μg $311 NF-κB p100/p52 Antibody (Phospho-Ser866), 40 μg $69 40 μg $69 WB, IHC, IF Human, mouse, rat A00469 NF-κB p65 Antibody (Phospho-Thr505), pAb, Rabbit IHC Human, mouse, rat A01159 pAb, Rabbit 200 μg $311 200 μg $311 NF-κB p100/p52 Antibody (Phospho-Ser878), 40 μg $69 40 μg $50 WB, IHC, IF Human, mouse, rat A00226 Niban Antibody, pAb, Rabbit WB, IF Human A00933 pAb, Rabbit 200 μg $311 200 μg $225 40 μg $50 40 μg $50 NF-κB p105/p50 Antibody (Ab-337), pAb, Rabbit IHC Human A00585 Nicastrin Antibody, pAb, Rabbit ELISA, WB Human A00883 200 μg $225 200 μg $225 40 μg $50 40 μg $50 NF-κB p105/p50 Antibody (Ab-893), pAb, Rabbit WB, IHC Human A00227 NMDAR1 Antibody (Ab-896), pAb, Rabbit WB Human, mouse A01149 200 μg $225 200 μg $225 40 μg $50 40 μg $69 NF-κB p105/p50 Antibody (Ab-907), pAb, Rabbit WB, IHC Human A00228 NMDAR1 Antibody (Phospho-Ser896), pAb, Rabbit WB Human A00486 200 μg $225 200 μg $311 40 μg $50 40 μg $50 NF-κB p105/p50 Antibody (Ab-927), pAb, Rabbit WB, IF Human A00929 NQO1 Antibody,pAb,Rabbit WB Human A01511 200 μg $225 200 μg $225 40 μg $50 40 μg $50 NF-κB p105/p50 Antibody (Ab-932), pAb, Rabbit WB, IHC Human A00555 NSE Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat* A01405 200 μg $225 200 μg $225 NF-κB p105/p50 Antibody (Phospho-Ser337), 40 μg $69 40 μg $50 WB, IHC, IF Human, mouse, rat A00470 NSE Antibody, pAb, Rabbit ELISA, WB, IHC, IP Human, mouse, rat* A01406 Antibodies pAb, Rabbit 200 μg $311 200 μg $225 NF-κB p105/p50 Antibody (Phospho-Ser893), 40 μg $69 40 μg $50 IHC, IF Human A00229 NSE Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat* A01412 pAb, Rabbit 200 μg $311 200 μg $225 NF-κB p105/p50 Antibody (Phospho-Ser907), 40 μg $69 40 μg $50 WB, IHC Human A00230 NSG1 Antibody, pAb, Rabbit ELISA, WB, IP Human, mouse, rat* A01442 Antibodies pAb, Rabbit 200 μg $311 200 μg $225 NF-κB p105/p50 Antibody (Phospho-Ser927), 40 μg $69 40 μg $50 WB, IHC, IF Human A00922 OLIG2 Antibody, pAb, Rabbit WB Human, mouse, rat* A01474 pAb, Rabbit 200 μg $311 200 μg $225 NF-κB p105/p50 Antibody (Phospho-Ser932), 40 μg $69 40 μg $50 WB, IHC Human, mouse, rat A00534 p21Cip1 Antibody (Ab-145), pAb, Rabbit WB Human A01150 pAb, Rabbit 200 μg $311 200 μg $225 40 μg $50 40 μg $69 NF-κB p65 Antibody (Ab-254), pAb, Rabbit IHC Human A00581 p21Cip1 Antibody (Phospho-Thr145), pAb, Rabbit IHC Human A01160 200 μg $225 200 μg $311 Primary Antibodies 40 μg $50 40 μg $50 NF-κB p65 Antibody (Ab-276), pAb, Rabbit WB, IHC, IF Human A00212 p27Kip1 Antibody (Ab-10), pAb, Rabbit WB, IHC Human A00436 200 μg $225 200 μg $225 40 μg $50 40 μg $69 NF-κB p65 Antibody (Ab-311), pAb, Rabbit WB, IHC Human A00542 p27Kip1 Antibody (Phospho-Thr187), pAb, Rabbit WB, IHC Human, mouse, rat A00333 200 μg $225 200 μg $311 40 μg $50 40 μg $50 NF-κB p65 Antibody (Ab-435), pAb, Rabbit WB, IHC Human A00213 p35 Antibody, pAb, Rabbit WB Mouse, rat* A01423
Primary Antibodies 200 μg $225 200 μg $225 40 μg $50 40 μg $50 NF-κB p65 Antibody (Ab-468), pAb, Rabbit WB, IHC Human A00219 p38 MAPK Antibody (Ab-182), pAb, Rabbit WB Human, mouse A00553 200 μg $225 200 μg $225 40 μg $50 40 μg $69 NF-κB p65 Antibody (Ab-505), pAb, Rabbit IHC Human, mouse, rat A01163 p38 MAPK Antibody (Phospho-Thr180), pAb, Rabbit IHC Human, mouse, rat A00535 200 μg $225 200 μg $311 40 μg $50 40 μg $69 NF-κB p65 Antibody (Ab-529), pAb, Rabbit WB, IHC Human A00459 p38 MAPK Antibody (Phospho-Tyr182), pAb, Rabbit WB, IHC Human, mouse, rat A00537 200 μg $225 200 μg $311 40 μg $50 40 μg $50 NF-κB p65 Antibody (Ab-536), pAb, Rabbit WB, IHC Human A00222 p44/42 MAP Kinase Antibody (Ab-202), pAb, Rabbit WB Human A00564 200 μg $225 200 μg $225 40 μg $69 p44/42 MAP Kinase Antibody (Ab-204), pAb, Rabbit WB Human, mouse 100 μg A00562 $172 NF-κB p65 Antibody (Phospho-Ser276), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00220 200 μg $311 p44/42 MAP Kinase Antibody (Phospho- 40 μg $69 WB Human, mouse, rat A00525 40 μg $69 Thr202), pAb, Rabbit 200 μg $311 NF-κB p65 Antibody (Phospho-Ser311), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00543 200 μg $311 p44/42 MAP Kinase Antibody (Phospho- 40 μg $69 WB, IHC, IF Human, mouse, rat A00526 40 μg $69 Tyr204), pAb, Rabbit 200 μg $311 NF-κB p65 Antibody (Phospho-Ser468), pAb, Rabbit WB, IF Human, mouse, rat A00223 200 μg $311 p53 Antibody (Ab-15), pAb, Rabbit WB, IHC, IF Human 40 μg A00595 $50
Your Innovation Partner in Drug Discovery! - 113 - www.genscript.com - 114 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 40 μg $69 p53 Antibody (Ab-315), pAb, Rabbit WB Human A00598 PAK1 Antibody (Phospho-Thr212), pAb, Rabbit WB, IHC, IF Human A00650 200 μg $225 200 μg $311 40 μg $50 PAK1/PAK2/PAK3 Antibody (Ab-423/402/421), 40 μg $50 p53 Antibody (Ab-37), pAb, Rabbit WB Human A01221 IHC, IF Human, mouse, rat A01040 200 μg $225 pAb, Rabbit 200 μg $225 40 μg $50 40 μg $50 p53 Antibody (Ab-46), pAb, Rabbit WB Human A00596 Parkin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat* A01250 200 μg $225 200 μg $225 40 μg $50 40 μg $50 p53 Antibody (Ab-9), pAb, Rabbit WB Human A01162 Parvalbumin Antibody, pAb, Rabbit ELISA, WB, IP Human, mouse, rat* A01439 200 μg $225 200 μg $225 40 μg $69 40 μg $50 p53 Antibody (Phospho-Ser315), pAb, Rabbit WB, IHC, IF Human A00485 Paxillin Antibody (Ab-118), pAb, Rabbit WB, IHC Human A00409 200 μg $311 200 μg $225 40 μg $69 40 μg $50 p53 Antibody (Phospho-Ser37), pAb, Rabbit WB, IF Human A01213 Paxillin Antibody (Ab-31), pAb, Rabbit WB, IHC Human A00456 200 μg $311 200 μg $225 40 μg $69 40 μg $69 p53 Antibody (Phospho-Ser46), pAb, Rabbit WB, IF Human A00484 Paxillin Antibody (Phospho-Tyr118), pAb, Rabbit WB, IHC Human, mouse, rat A00379 200 μg $311 200 μg $311 40 μg $69 40 μg $69 p53 Antibody (Phospho-Ser6), pAb, Rabbit WB Human, mouse A01168 Paxillin Antibody (Phospho-Tyr31), pAb, Rabbit WB Human A00335 200 μg $311 200 μg $311 40 μg $69 40 μg $50 p56Dok-2 Antibody (Phospho-Tyr299), pAb, Rabbit WB, IHC, IF Human A01029 PDK1 Antibody (Ab-241), pAb, Rabbit WB, IHC, IF Human A00208 200 μg $311 200 μg $225 40 μg $50 40 μg $69 p62Dok Antibody (Ab-362), pAb, Rabbit WB, IHC Human A01044 PDK1 Antibody (Phospho-Ser241), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00207 200 μg $225 200 μg $311 40 μg $50 40 μg $50 p62Dok Antibody (Ab-398), pAb, Rabbit WB, IHC, IF Human A01045 PEN2 Antibody, pAb, Rabbit ELISA, WB NA A00882 200 μg $225 200 μg $225 40 μg $69 Peptidylprolyl Isomerase Antibody, pAb, Chicken WB, IF, ICC NA 100 μg A00151 $204 p62Dok Antibody (phospho-Tyr362), pAb, Rabbit WB, IHC Human, mouse, rat A00647 Antibodies 200 μg $311 Peripherin 1 Antibody, mAb, Mouse WB, ICC Cat, human, mouse, rat 100 μg A00142 $204 40 μg $69 Peripherin 2 Antibody, mAb, Mouse WB, IF Cat, human, mouse, rat, rabbit 100 μg A00143 $204 p62Dok Antibody (Phospho-Tyr398), pAb, Rabbit WB, IHC Human, mouse, rat A00648 200 μg $311 Peripherin Antibody, pAb, Rabbit WB, ICC Cat, human, mouse, rat, rabbit 100 μg A00141 $204 p70 S6 Kinase Antibody (Ab-411), pAb, Rabbit WB, IHC, IF Human 100 μg A00527 $172 40 μg $50 PGP9.5 Antibody, pAb, Rabbit ELISA, WB Human, mouse* A01398 Antibodies 40 μg $50 200 μg $225 p70 S6 Kinase Antibody (Ab-421), pAb, Rabbit WB, IHC Human A00550 200 μg $225 40 μg $50 PIN1 Antibody, pAb, Rabbit ELISA, WB Human* A01090 40 μg $50 200 μg $225 p70 S6 Kinase Antibody (Ab-424), pAb, Rabbit WB, IHC, IF Human A00516 200 μg $225 40 μg $50 PKCα Antibody, pAb, Rabbit ELISA, WB Human, mouse A00901 p70 S6 Kinase Antibody (Phospho-Ser411), 40 μg $69 200 μg $225 WB, IHC, IF Human, mouse, rat A00554 pAb, Rabbit 200 μg $311 40 μg $69 PKCα/β2 Antibody (Phospho-Thr638/641), pAb, Rabbit ELISA, WB Human, mouse A00913 p70 S6 Kinase Antibody (Phospho-Ser424), 40 μg $69 200 μg $311 Primary Antibodies WB, IHC, IF Human, mouse, rat A00561 pAb, Rabbit 200 μg $311 40 μg $50 PKCβ Antibody (Ab-641), pAb, Rabbit WB, IHC, IF Human A00655 p70 S6 Kinase Antibody (Phospho-Thr421), 40 μg $69 200 μg $225 WB, IHC, IF Human, mouse, rat A00539 pAb, Rabbit 200 μg $311 40 μg $69 PKCβ Antibody (Phospho-Thr641), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00654 40 μg $50 200 μg $311 p73 Antibody (Ab-99), pAb, Rabbit WB Human A00348 200 μg $225 40 μg $50 PKCβ2 Antibody, pAb, Rabbit ELISA, WB Human A00903
Primary Antibodies 40 μg $69 200 μg $225 p73 Antibody (Phospho-Tyr99), pAb, Rabbit WB Human, mouse, rat A00285 200 μg $311 40 μg $50 PKCγ Antibody, pAb, Rabbit WB NA A00904 40 μg $50 200 μg $225 p90RSK Antibody (Ab-348), pAb, Rabbit WB, IF Human A00603 200 μg $225 40 μg $50 PKCδ Antibody (Ab-645), pAb, Rabbit WB, IHC, IF Human A00509 40 μg $50 200 μg $225 p90RSK Antibody (Ab-352), pAb, Rabbit WB, IHC Human A00601 200 μg $225 40 μg $69 PKCδ Antibody (Phospho-Ser645), pAb, Rabbit WB, IHC Human, mouse, rat A00576 40 μg $69 200 μg $311 p90RSK Antibody (Phospho-Ser352), pAb, Rabbit WB Human, mouse, rat A01171 200 μg $311 40 μg $50 PKCδ Antibody, pAb, Rabbit ELISA, WB Human A00905 40 μg $69 200 μg $225 p90RSK Antibody (Phospho-Thr348), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00487 200 μg $311 40 μg $50 PKCζ Antibody, pAb, Rabbit ELISA, WB Human A00908 40 μg $50 200 μg $225 p95/NBS1 Antibody (Ab-343), pAb, Rabbit WB, IHC Human A00305 200 μg $225 40 μg $50 PKCη Antibody, pAb, Rabbit ELISA, WB Human A00906 40 μg $69 200 μg $225 p95/NBS1 Antibody (Phospho-Ser343), pAb, Rabbit WB Human A00283 200 μg $311 40 μg $50 PKCθ Antibody (Ab-676), pAb, Rabbit WB, IHC, IF Human A00508 40 μg $50 200 μg $225 PAK1 Antibody (Ab-212), pAb, Rabbit WB, IHC, IF Human A00651 200 μg $225
Your Innovation Partner in Drug Discovery! - 115 - www.genscript.com - 116 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 40 μg $50 PKCθ Antibody (Ab-695), pAb, Rabbit WB, IHC Human A00656 PTEN Antibody (Ab-380, 382, 383), pAb, Rabbit WB, IHC Human A00302 200 μg $225 200 μg $225 40 μg $69 40 μg $69 PKCθ Antibody (Phospho-Ser676), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00579 PTEN Antibody (Phospho-Ser370), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00290 200 μg $311 200 μg $311 40 μg $69 40 μg $69 PKCθ Antibody (Phospho-Ser695), pAb, Rabbit IHC Human, mouse, rat A00657 PTEN Antibody (Phospho-Ser380), pAb, Rabbit IHC, IF Human, mouse, rat A00218 200 μg $311 200 μg $311 40 μg $50 PTEN Antibody (Phospho-Ser380, Thr382,383), 40 μg $69 PKCι/λ Antibody, pAb, Rabbit ELISA, WB Human A00910 WB, IHC, IF Human, mouse, rat A00277 200 μg $225 pAb, Rabbit 200 μg $311 40 μg $50 40 μg $50 PKCμ Antibody, pAb, Rabbit ELISA, WB Human, mouse A00909 Pyk2 Antibody (Ab-402), pAb, Rabbit WB, IHC, IF Human A00586 200 μg $225 200 μg $225 40 μg $50 40 μg $69 PKD/PKCμ Antibody (Ab-738), pAb, Rabbit WB, IF Human A00606 Pyk2 Antibody (Phospho-Tyr402), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00498 200 μg $225 200 μg $311 40 μg $50 40 μg $50 PKD/PKCμ Antibody (Ab-910), pAb, Rabbit WB Human A00605 Rab5 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat A01302 200 μg $225 200 μg $225 40 μg $69 40 μg $50 PKD/PKCμ Antibody (Phospho-Ser738), pAb, Rabbit WB, IF Human, mouse, rat A00481 Rac1 Antibody (Ab-71), pAb, Rabbit WB, IF Human A00660 200 μg $311 200 μg $225 40 μg $69 40 μg $69 PKD/PKCμ Antibody (Phospho-Ser910), pAb, Rabbit WB Human A01021 Rac1 Antibody (Phospho-Ser71), pAb, Rabbit WB Human, mouse, rat A01146 200 μg $311 200 μg $311 40 μg $69 40 μg $50 PKR Antibody (Phospho-Thr446), pAb, Rabbit WB, IHC, IF Human A00649 Raf-1 Antibody (Ab-259), pAb, Rabbit WB, IHC Human A00209 200 μg $311 200 μg $225 40 μg $69 40 μg $50 PKR Antibody (Phospho-Thr451), pAb, Rabbit IHC Human A01030 Raf1 Antibody (Ab-338), pAb, Rabbit WB, IHC Human A01153 200 μg $311 200 μg $225 40 μg $50 40 μg $69 PLCγ1 Antibody (Ab-771), pAb, Rabbit WB, IHC Human A01260 Raf-1 Antibody (Phospho-Ser259), pAb, Rabbit WB, IHC Human, mouse, rat A00215 Antibodies 200 μg $225 200 μg $311 40 μg $50 40 μg $50 PLCγ1 Antibody (Ab-783), pAb, Rabbit WB Human A01039 RAGE Antibody, pAb, Rabbit ELISA, WB NA A00972 200 μg $225 200 μg $225 40 μg $69 40 μg $50 PLCγ1 Antibody (Phospho-Tyr783), pAb, Rabbit WB Human, mouse, rat A01022 Rb Antibody (Ab-780), pAb, Rabbit WB, IHC Human A00412 Antibodies 200 μg $311 200 μg $225 40 μg $50 40 μg $50 PLC-γ2 Antibody (Ab-1217), pAb, Rabbit IHC Human A01294 Rb Antibody (Ab-795), pAb, Rabbit WB Human A00410 200 μg $225 200 μg $225 40 μg $50 40 μg $50 PLCγ2 Antibody (Ab-753), pAb, Rabbit WB, IF Human A00658 Rb Antibody (Ab-807), pAb, Rabbit WB, IHC Human A00411 200 μg $225 200 μg $225 40 μg $69 40 μg $69 PLC-γ2 Antibody (Phospho-Tyr1217), pAb, Rabbit IHC Human A01219 Rb Antibody (Phospho-Ser780), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00377 200 μg $311 200 μg $311 Primary Antibodies 40 μg $69 40 μg $69 PLCγ2 Antibody (Phospho-Tyr753), pAb, Rabbit WB, IF Human, mouse, rat A00659 Rb Antibody (Phospho-Ser795), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00381 200 μg $311 200 μg $311 40 μg $50 40 μg $69 PON2 Antibody, pAb, Rabbit WB NA A00816 Rb Antibody (Phospho-Ser807), pAb, Rabbit WB, IHC Human, mouse, rat A00378 200 μg $225 200 μg $311 40 μg $50 40 μg $50 PP2A-α Antibody, pAb, Rabbit WB Human A01226 RelB Antibody (Ab-573), pAb, Rabbit WB Human A00547
Primary Antibodies 200 μg $225 200 μg $225 40 μg $50 40 μg $69 Presenilin 1 Antibody, pAb, Rabbit ELISA, WB Human, mouse A00881 RelB Antibody (Phospho-Ser573), pAb, Rabbit WB, IHC Human, mouse A00540 200 μg $225 200 μg $311 40 μg $50 S6 Ribosomal Protein Antibody (Ab-235), 40 μg $50 Presenilin 2 Antibody, pAb, Rabbit ELISA, WB NA A00943 WB, IHC, IF Human A00465 200 μg $225 pAb, Rabbit 200 μg $225 Progesterone Receptor Antibody (Ab-190), 40 μg $50 S6 Ribosomal Protein Antibody 40 μg $69 WB, IF Human A01165 WB, IF Human, mouse, rat A00315 pAb, Rabbit 200 μg $225 (Phospho-Ser235), pAb, Rabbit 200 μg $311 Progesterone Receptor Antibody 40 μg $69 40 μg $50 WB, IHC Human A00312 SAA1 Antibody, pAb, Rabbit ELISA, WB NA A00944 (Phospho-Ser190), pAb, Rabbit 200 μg $311 200 μg $225 40 μg $50 40 μg $50 Prohibitin Antibody, pAb, Rabbit WB NA A00706 SAPK/JNK Antibody (Ab-183), pAb, Rabbit IHC Human A00557 200 μg $225 200 μg $225 40 μg $50 40 μg $50 PSD95 Antibody, pAb, Rabbit WB Mouse, rat A01501 SAPK/JNK Antibody (Ab-183), pAb, Rabbit WB, IHC Human A01161 200 μg $225 200 μg $225 40 μg $50 40 μg $69 PTEN Antibody (Ab-370), pAb, Rabbit WB, IHC Human A00303 SAPK/JNK Antibody (Phospho-Thr183), pAb, Rabbit WB, IHC Human, mouse, rat A00532 200 μg $225 200 μg $311
Your Innovation Partner in Drug Discovery! - 117- www.genscript.com - 118 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 40 μg $50 SEK1/MKK4 Antibody (Ab-261), pAb, Rabbit IHC, IF Human A00423 STAT6 Antibody (Ab-641), pAb, Rabbit WB, IHC Human A00282 200 μg $225 200 μg $225 40 μg $50 40 μg $50 SEK1/MKK4 Antibody (Ab-80), pAb, Rabbit WB, IHC Human, mouse A00424 STAT6 Antibody (Ab-645), pAb, Rabbit WB, IHC Human A00284 200 μg $225 200 μg $225 40 μg $69 40 μg $69 SEK1/MKK4 Antibody (Phospho-Ser80), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00495 STAT6 Antibody (Phospho-Thr645), pAb, Rabbit IHC Human A00478 200 μg $311 200 μg $311 40 μg $69 40 μg $69 SEK1/MKK4 Antibody (Phospho-Thr261), pAb, Rabbit IHC, IF Human, mouse, rat A00342 STAT6 Antibody (Phospho-Tyr641), pAb, Rabbit WB, IHC Human A00263 200 μg $311 200 μg $311 40 μg $50 40 μg $50 Serum Amyloid P Antibody, pAb, Rabbit ELISA, WB NA A00701 Stathmin 1 Antibody (Ab-16), pAb, Rabbit WB, IHC Human A00573 200 μg $225 200 μg $225 40 μg $50 40 μg $50 Shc1 Antibody (Ab-427), pAb, Rabbit WB, IHC, IF Human A00930 Stathmin 1 Antibody (Ab-25), pAb, Rabbit WB, IHC, IF Human A00462 200 μg $225 200 μg $225 40 μg $69 40 μg $50 Shc1 Antibody (Phospho-Tyr427), pAb, Rabbit WB, IHC, IF Human A01035 Stathmin 1 Antibody (Ab-38), pAb, Rabbit WB, IHC Human A00463 200 μg $311 200 μg $225 40 μg $50 40 μg $69 SHP-1 Antibody (Ab-536), pAb, Rabbit WB, IHC, IF Human A00970 Stathmin 1 Antibody (Phospho-Ser16), pAb, Rabbit IHC Human, mouse, rat A00505 200 μg $225 200 μg $311 40 μg $69 40 μg $69 SHP-1 Antibody (Phospho-Tyr536), pAb, Rabbit IHC, IF Human, mouse, rat A00969 Stathmin 1 Antibody (Phospho-Ser25), pAb, Rabbit WB, IHC Human, mouse, rat A00326 200 μg $311 200 μg $311 40 μg $50 40 μg $69 SMC1 Antibody (Ab-957), pAb, Rabbit WB, IHC Human A00455 Stathmin 1 Antibody (Phospho-Ser38), pAb, Rabbit WB, IHC Human, mouse, rat A00324 200 μg $225 200 μg $311 40 μg $69 40 μg $50 SMC1 Antibody (Phospho-Ser957), pAb, Rabbit WB, IHC Human, mouse A00336 Stathmin1 Antibody (Ab-62), pAb, Rabbit WB, IHC Human A01258 200 μg $311 200 μg $225 40 μg $50 40 μg $50 SNAP25 Antibody, pAb, Rabbit WB Human, mouse, rat* A01445 Syk Antibody (Ab-323), pAb, Rabbit IHC, IF Human A01266 Antibodies 200 μg $225 200 μg $225 40 μg $50 40 μg $69 Src Antibody (Ab-529), pAb, Rabbit WB, IHC Human A00449 Syk Antibody (Phospho-Tyr323), pAb, Rabbit IHC, IF Human A01275 200 μg $225 200 μg $311 40 μg $69 40 μg $50 Src Antibody (Phospho-Tyr529), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00358 Synapsin Antibody (Ab-9), pAb, Rabbit WB Human A00531 Antibodies 200 μg $311 200 μg $225 40 μg $50 40 μg $69 STAT1 Antibody (Ab-701), pAb, Rabbit WB, IHC Human A00274 Synapsin Antibody (Phospho-Ser9), pAb, Rabbit WB, IF Human, mouse, rat A00551 200 μg $225 200 μg $311 40 μg $50 40 μg $50 STAT1 Antibody (Ab-727), pAb, Rabbit WB, IHC Human A00454 Synaptophysin Antibody, pAb, Rabbit ELISA, WB, IHC Human, mouse, rat A01307 200 μg $225 200 μg $225 40 μg $69 Synaptotagmin I/II Antibody (Ab-202/199), 40 μg $50 STAT1 Antibody (Phospho-Ser727), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00347 WB, IF Human A01170 200 μg $311 pAb, Rabbit 200 μg $225 Primary Antibodies 40 μg $69 40 μg $50 STAT1 Antibody (Phospho-Tyr701), pAb, Rabbit WB, IHC Human, mouse, rat A00249 Tau Antibody (Ab-181), pAb, Rabbit WB Human A00397 200 μg $311 200 μg $225 40 μg $50 40 μg $50 Stat2 Antibody (Ab-690), pAb, Rabbit WB, IHC Human A01263 Tau Antibody (Ab-205), pAb, Rabbit WB Human A00398 200 μg $225 200 μg $225 40 μg $50 40 μg $50 STAT3 Antibody (Ab-727), pAb, Rabbit WB, IHC Human A00278 Tau Antibody (Ab-212), pAb, Rabbit WB Human, rat A00545
Primary Antibodies 200 μg $225 200 μg $225 40 μg $69 40 μg $50 STAT3 Antibody (Phospho-Ser727), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00251 Tau Antibody (Ab-217), pAb, Rabbit ELISA, WB Human, mouse, rat A00942 200 μg $311 200 μg $225 40 μg $50 40 μg $50 STAT4 Antibody (Ab-693), pAb, Rabbit WB, IHC Human A00279 Tau Antibody (Ab-231), pAb, Rabbit WB, IHC Human, mouse, rat A00400 200 μg $225 200 μg $225 40 μg $69 40 μg $50 STAT4 Antibody (Phospho-Tyr693), pAb, Rabbit WB, IHC Human, mouse, rat A00252 Tau Antibody (Ab-235), pAb, Rabbit WB Human, mouse A00393 200 μg $311 200 μg $225 40 μg $50 40 μg $50 STAT5A Antibody (Ab-694), pAb, Rabbit WB, IHC Human A00280 Tau Antibody (Ab-262), pAb, Rabbit WB Human, mouse A00600 200 μg $225 200 μg $225 40 μg $50 40 μg $50 STAT5A Antibody (Ab-780), pAb, Rabbit WB, IHC Human A00281 Tau Antibody (Ab-396), pAb, Rabbit WB, IHC Human, mouse, rat A00389 200 μg $225 200 μg $225 40 μg $69 40 μg $50 STAT5A Antibody (Phospho-Ser780), pAb, Rabbit WB, IHC Human, mouse, rat A00254 Tau Antibody (Ab-404), pAb, Rabbit WB Human A00401 200 μg $311 200 μg $225 40 μg $69 Tau Antibody (Ab-422), pAb, Rabbit WB Human, rat 100 μg A00522 $172 STAT5A Antibody (Phospho-Tyr694), pAb, Rabbit WB, IHC Human, mouse, rat A00253 200 μg $311 40 μg $69 Tau Antibody (Phospho-Ser199), pAb, Rabbit ELISA, WB Human, mouse, rat A00894 200 μg $311
Your Innovation Partner in Drug Discovery! - 119 - www.genscript.com - 120 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price Tau Antibody (Phospho-Ser214), pAb, Rabbit WB Human, mouse, rat 100 μg A00488 $240 Ubiquitin Antibody, mAb, Mouse IF NA 100 μg A00134 $204 40 μg $69 Ubiquitin Antibody, pAb, Rabbit WB, IF NA 100 μg A00133 $204 Tau Antibody (Phospho-Ser235), pAb, Rabbit WB Human, mouse, rat A00402 200 μg $311 40 μg $50 VASP Antibody (Ab-157), pAb, Rabbit WB, IF Human A00458 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser235), pAb, Rabbit ELISA, WB Human, mouse* A01096 200 μg $311 40 μg $50 VASP Antibody (Ab-239), pAb, Rabbit WB, IHC Human, mouse A00451 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser262), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00489 200 μg $311 40 μg $69 VASP Antibody (Phospho-Ser157), pAb, Rabbit WB, IHC Human, mouse A00332 40 μg $69 200 μg $311 Tau Antibody (Phospho-Ser396), pAb, Rabbit WB, IHC Human, mouse, rat A00399 200 μg $311 40 μg $69 VASP Antibody (Phospho-Ser239), pAb, Rabbit WB, IHC Human, mouse A00353 40 μg $69 200 μg $311 Tau Antibody (Phospho-Ser400), pAb, Rabbit ELISA, WB Human, mouse, rat A00898 200 μg $311 40 μg $50 Vav Antibody (Ab-174), pAb, Rabbit WB Human A00448 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser404), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00408 200 μg $311 40 μg $69 Vav Antibody (Phospho-Tyr174), pAb, Rabbit WB Human, mouse, rat A00368 40 μg $69 200 μg $311 Tau Antibody (Phospho-Ser409), pAb, Rabbit ELISA, WB Human A00899 200 μg $311 40 μg $50 VEGFR2 Antibody (Ab-1175), pAb, Rabbit IHC Human A00352 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser422), pAb, Rabbit ELISA, WB Human A00900 200 μg $311 40 μg $50 VEGFR2 Antibody (Ab-1214), pAb, Rabbit IHC Human A00355 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser422), pAb, Rabbit WB Human, mouse, rat A01148 200 μg $311 40 μg $50 VEGFR2 Antibody (Ab-951), pAb, Rabbit WB, IHC Human A00357 40 μg $69 200 μg $225 Tau Antibody (Phospho-Thr181), pAb, Rabbit WB, IHC Human, mouse, rat A00403 200 μg $311 40 μg $69 VEGFR2 Antibody (Phospho-Tyr1175), pAb, Rabbit IHC, IF Human, mouse, rat A00366 40 μg $69 200 μg $311 Tau Antibody (Phospho-Thr205), pAb, Rabbit WB, IHC Human, mouse, rat A00405 200 μg $311 40 μg $69 VEGFR2 Antibody (Phospho-Tyr1214), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00367 Antibodies 40 μg $69 200 μg $311 Tau Antibody (Phospho-Thr212), pAb, Rabbit WB Human, mouse, rat A01147 200 μg $311 40 μg $69 VEGFR2 Antibody (Phospho-Tyr951), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00370 40 μg $69 200 μg $311 Tau Antibody (Phospho-Thr217), pAb, Rabbit ELISA, WB Human, mouse, rat A00896 200 μg $311 Vimentin Antibody, pAb, Chicken IF Human, rat, mouse 100 μg A00152 $204
Antibodies 40 μg $69 40 μg $50 Tau Antibody (Phospho-Thr231), pAb, Rabbit WB, IHC Human, mouse, rat A00406 Vimentin Antibody, pAb, Rabbit ELISA, WB, IHC Human* A01189 200 μg $311 200 μg $225 40 μg $50 Zap-70 Antibody (Ab-319), pAb, Rabbit WB, IHC Human 100 μg A00594 $172 Tau Antibody (Phospho-Ser262), pAb, Rabbit ELISA, WB Human, mouse A01099 200 μg $225 40 μg $50 Zap-70 Antibody (Ab-493), pAb, Rabbit IHC Human A00593 40 μg $50 200 μg $225 Tau Antibody (Phospho-Ser356), pAb, Rabbit ELISA, WB Human A01048 200 μg $225 40 μg $69 Zap-70 Antibody (Phospho-Tyr319), pAb, Rabbit WB, IF Human, mouse, rat A00491 40 μg $50 200 μg $311 Primary Antibodies Tau Antibody (Phospho-Ser396), pAb, Rabbit ELISA, WB Human, mouse, rat* A01387 200 μg $225 40 μg $69 Zap-70 Antibody (Phospho-Tyr493), pAb, Rabbit IHC Human, mouse, rat A00492 40 μg $50 200 μg $311 Tau Antibody (Phospho-Ser400), pAb, Rabbit ELISA, WB Human, mouse, rat A01049 200 μg $225 40 μg $50 α-catenin Antibody (Ab-177), pAb, Rabbit WB, IHC Human A01230 40 μg $50 200 μg $225 Tau Antibody (Phospho-Ser409), pAb, Rabbit ELISA, WB Human A01050 200 μg $225 40 μg $50 α-Catenin Antibody (Ab-641), pAb, Rabbit WB Human A00931
Primary Antibodies 40 μg $50 200 μg $225 Tau Antibody (Phospho-Ser422), pAb, Rabbit ELISA, WB Human A01051 200 μg $225 40 μg $69 α-Catenin Antibody (Phospho-Ser641), pAb, Rabbit WB Human A00923 40 μg $50 200 μg $311 TDP43 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* A01304 200 μg $225 40 μg $69 α-Synuclein Antibody (Phospho-Ser129), pAb, Rabbit WB Human, mouse, rat A01144 40 μg $50 200 μg $311 TPMT Antibody, pAb, Rabbit ELISA, WB Human* A01248 200 μg $225 40 μg $50 β-Amyloid Antibody (1-17), pAb, Rabbit ELISA, WB, IF Human A00685 40 μg $50 200 μg $225 TrkA Antibody, pAb, Rabbit ELISA, WB Human* A01403 200 μg $225 40 μg $50 β-Amyloid Antibody (1-40), pAb, Rabbit ELISA, WB, IF Human A00688 40 μg $50 200 μg $225 TrkA Antibody, pAb, Rabbit ELISA, WB Human* A01404 200 μg $225 40 μg $50 β-Amyloid Antibody (25-35), pAb, Rabbit ELISA, WB Human A00687 40 μg $69 200 μg $225 TrkB Antibody (Phospho-Tyr705), pAb, Rabbit WB Human, mouse A01186 200 μg $311 β-Amyloid Antibody (32-40), pAb, Rabbit ELISA, WB, IF Human 40 μg A00689 $89 40 μg $50 40 μg $50 TYK2 Antibody (Ab-1054), pAb, Rabbit IHC Human A00416 β-Catenin Antibody (Ab-37), pAb, Rabbit WB, IHC, IF Human A00582 200 μg $225 200 μg $225 40 μg $69 40 μg $50 TYK2 Antibody (Phospho-Tyr1054), pAb, Rabbit WB Human, mouse, rat A01184 β-Catenin Antibody (Ab-41, 45), pAb, Rabbit WB Human A00407 200 μg $311 200 μg $225
Your Innovation Partner in Drug Discovery! - 121 - www.genscript.com - 122 - Product Applications Species Reactivity Quantity Cat. No. Price Product Applications Species Reactivity Quantity Cat. No. Price Tau Antibody (Phospho-Ser214), pAb, Rabbit WB Human, mouse, rat 100 μg A00488 $240 Ubiquitin Antibody, mAb, Mouse IF NA 100 μg A00134 $204 40 μg $69 Ubiquitin Antibody, pAb, Rabbit WB, IF NA 100 μg A00133 $204 Tau Antibody (Phospho-Ser235), pAb, Rabbit WB Human, mouse, rat A00402 200 μg $311 40 μg $50 VASP Antibody (Ab-157), pAb, Rabbit WB, IF Human A00458 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser235), pAb, Rabbit ELISA, WB Human, mouse* A01096 200 μg $311 40 μg $50 VASP Antibody (Ab-239), pAb, Rabbit WB, IHC Human, mouse A00451 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser262), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00489 200 μg $311 40 μg $69 VASP Antibody (Phospho-Ser157), pAb, Rabbit WB, IHC Human, mouse A00332 40 μg $69 200 μg $311 Tau Antibody (Phospho-Ser396), pAb, Rabbit WB, IHC Human, mouse, rat A00399 200 μg $311 40 μg $69 VASP Antibody (Phospho-Ser239), pAb, Rabbit WB, IHC Human, mouse A00353 40 μg $69 200 μg $311 Tau Antibody (Phospho-Ser400), pAb, Rabbit ELISA, WB Human, mouse, rat A00898 200 μg $311 40 μg $50 Vav Antibody (Ab-174), pAb, Rabbit WB Human A00448 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser404), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00408 200 μg $311 40 μg $69 Vav Antibody (Phospho-Tyr174), pAb, Rabbit WB Human, mouse, rat A00368 40 μg $69 200 μg $311 Tau Antibody (Phospho-Ser409), pAb, Rabbit ELISA, WB Human A00899 200 μg $311 40 μg $50 VEGFR2 Antibody (Ab-1175), pAb, Rabbit IHC Human A00352 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser422), pAb, Rabbit ELISA, WB Human A00900 200 μg $311 40 μg $50 VEGFR2 Antibody (Ab-1214), pAb, Rabbit IHC Human A00355 40 μg $69 200 μg $225 Tau Antibody (Phospho-Ser422), pAb, Rabbit WB Human, mouse, rat A01148 200 μg $311 40 μg $50 VEGFR2 Antibody (Ab-951), pAb, Rabbit WB, IHC Human A00357 40 μg $69 200 μg $225 Tau Antibody (Phospho-Thr181), pAb, Rabbit WB, IHC Human, mouse, rat A00403 200 μg $311 40 μg $69 VEGFR2 Antibody (Phospho-Tyr1175), pAb, Rabbit IHC, IF Human, mouse, rat A00366 40 μg $69 200 μg $311 Tau Antibody (Phospho-Thr205), pAb, Rabbit WB, IHC Human, mouse, rat A00405 200 μg $311 40 μg $69 VEGFR2 Antibody (Phospho-Tyr1214), pAb, Rabbit WB, IHC, IF Human, mouse, rat A00367 Antibodies 40 μg $69 200 μg $311 Tau Antibody (Phospho-Thr212), pAb, Rabbit WB Human, mouse, rat A01147 200 μg $311 40 μg $69 VEGFR2 Antibody (Phospho-Tyr951), pAb, Rabbit WB, IHC, IF Human, mouse ,rat A00370 40 μg $69 200 μg $311 Tau Antibody (Phospho-Thr217), pAb, Rabbit ELISA, WB Human, mouse, rat A00896 200 μg $311 Vimentin Antibody, pAb, Chicken IF Human, rat, mouse 100 μg A00152 $204
Antibodies 40 μg $69 40 μg $50 Tau Antibody (Phospho-Thr231), pAb, Rabbit WB, IHC Human, mouse, rat A00406 Vimentin Antibody, pAb, Rabbit ELISA, WB, IHC Human* A01189 200 μg $311 200 μg $225 40 μg $50 Zap-70 Antibody (Ab-319), pAb, Rabbit WB, IHC Human 100 μg A00594 $172 Tau Antibody (Phospho-Ser262), pAb, Rabbit ELISA, WB Human, mouse A01099 200 μg $225 40 μg $50 Zap-70 Antibody (Ab-493), pAb, Rabbit IHC Human A00593 40 μg $50 200 μg $225 Tau Antibody (Phospho-Ser356), pAb, Rabbit ELISA, WB Human A01048 200 μg $225 40 μg $69 Zap-70 Antibody (Phospho-Tyr319), pAb, Rabbit WB, IF Human, mouse, rat A00491 40 μg $50 200 μg $311 Primary Antibodies Tau Antibody (Phospho-Ser396), pAb, Rabbit ELISA, WB Human, mouse, rat* A01387 200 μg $225 40 μg $69 Zap-70 Antibody (Phospho-Tyr493), pAb, Rabbit IHC Human, mouse, rat A00492 40 μg $50 200 μg $311 Tau Antibody (Phospho-Ser400), pAb, Rabbit ELISA, WB Human, mouse, rat A01049 200 μg $225 40 μg $50 α-catenin Antibody (Ab-177), pAb, Rabbit WB, IHC Human A01230 40 μg $50 200 μg $225 Tau Antibody (Phospho-Ser409), pAb, Rabbit ELISA, WB Human A01050 200 μg $225 40 μg $50 α-Catenin Antibody (Ab-641), pAb, Rabbit WB Human A00931
Primary Antibodies 40 μg $50 200 μg $225 Tau Antibody (Phospho-Ser422), pAb, Rabbit ELISA, WB Human A01051 200 μg $225 40 μg $69 α-Catenin Antibody (Phospho-Ser641), pAb, Rabbit WB Human A00923 40 μg $50 200 μg $311 TDP43 Antibody, pAb, Rabbit ELISA, WB Human, mouse, rat* A01304 200 μg $225 40 μg $69 α-Synuclein Antibody (Phospho-Ser129), pAb, Rabbit WB Human, mouse, rat A01144 40 μg $50 200 μg $311 TPMT Antibody, pAb, Rabbit ELISA, WB Human* A01248 200 μg $225 40 μg $50 β-Amyloid Antibody (1-17), pAb, Rabbit ELISA, WB, IF Human A00685 40 μg $50 200 μg $225 TrkA Antibody, pAb, Rabbit ELISA, WB Human* A01403 200 μg $225 40 μg $50 β-Amyloid Antibody (1-40), pAb, Rabbit ELISA, WB, IF Human A00688 40 μg $50 200 μg $225 TrkA Antibody, pAb, Rabbit ELISA, WB Human* A01404 200 μg $225 40 μg $50 β-Amyloid Antibody (25-35), pAb, Rabbit ELISA, WB Human A00687 40 μg $69 200 μg $225 TrkB Antibody (Phospho-Tyr705), pAb, Rabbit WB Human, mouse A01186 200 μg $311 β-Amyloid Antibody (32-40), pAb, Rabbit ELISA, WB, IF Human 40 μg A00689 $89 40 μg $50 40 μg $50 TYK2 Antibody (Ab-1054), pAb, Rabbit IHC Human A00416 β-Catenin Antibody (Ab-37), pAb, Rabbit WB, IHC, IF Human A00582 200 μg $225 200 μg $225 40 μg $69 40 μg $50 TYK2 Antibody (Phospho-Tyr1054), pAb, Rabbit WB Human, mouse, rat A01184 β-Catenin Antibody (Ab-41, 45), pAb, Rabbit WB Human A00407 200 μg $311 200 μg $225
Your Innovation Partner in Drug Discovery! - 121 - www.genscript.com - 122 - Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 β-catenin Antibody (Ab-654), pAb, Rabbit WB Human A01229 200 μg $225 40 μg $69 β-Catenin Antibody (Phospho-Ser33), pAb, Rabbit WB, IHC Human, mouse, rat A00499 200 μg $311 Growth factors, 40 μg $69 β-Catenin Antibody (Phospho-Ser37), pAb, Rabbit WB, IHC Human, mouse, rat A00500 Insulin, etc 200 μg $311 β-Catenin Antibody (Phospho-Thr41, Ser45), 40 μg $69 WB Human, mouse, rat A00417 Receptor pAb, Rabbit 200 μg $311 MEMBRANE 40 μg $50 β-Catenin Antibody, pAb, Rabbit ELISA, WB Human* A01235 200 μg $225 PIP3 P S241 P S473 *: This product has not been tested with reactivity to other species. PDK PIP3 P13K Src NA: Not available. AKT/ P Jak1 PKB S383 Y1022 S380 P P P T23 P P PTEN S382 S6/9/15/20/33/37 Signal Transduction Antibodies S370 T308 P P P P P P 1KKa S385 Signal transduction refers to the passing of a signal from the messengers. Massive amplification of the original input signal MDM2 P53 P outside to the inside of a cell. The incoming signal can lead to occurs because of this. P T308 P P P P changes in cellular activity such as gene transcription. This P S473 T145 phenomenon is found in all organisms, from the very simple GenScript has a wide selection of signal transduction antibodies, AKT/ P S46/315/356/396 bacteria reacting to changes in their environment to complex including Akt, Apoptosis, Cytoskeletal, Nuclear Signaling, etc. PKB T18 P21 Antibodies S10 organisms that use cell signaling to control and regulate their They are appropriate for ELISA, Western blot, and immunohis- P CIP1 organization and development. Often, second messengers are tochemistry (IHC) applications as noted for each signal P27 involved in a signal transduction pathway. A signaling cascade transduction antibody. KIP1 S99/136 P forms if the pathway involves numerous proteins and second T187 P S83 P Antibodies S118/155 ASK GSK P S966 S259 P Akt P P BAD -3 S62 P S9 Bcl- P Raf S33 Akt protein family, of which the members are also called protein Pleckstrin, the protein in which it was first discovered. This XL S75/112 P P S37 kinases B (PKB), plays a key role in mammalian cellular domain binds to phosphoinositides with high affinity. GenScript T41 signaling. Akt possesses a protein domain known as a offers a wide selection of antibodies that can be used in your Catenin
P Primary Antibodies Pleckstrin Homology domain (PH domain) which is named after Akt/PKB signaling pathway research. P S45 Primary Antibodies
Product Overview:
Product Applications Species Reactivity Quantity Cat. No. Price 40 μg $50 14-3-3 ζ Antibody (Ab-58), pAb, Rabbit WB, IHC Human, mouse A00662 200 μg $225 40 μg $50 4E-BP1 Antibody (Ab-36), pAb, Rabbit WB, IHC Human A00460 200 μg $225 40 μg $69 4E-BP1 Antibody (Phospho-Thr36), pAb, Rabbit WB, IHC Human, mouse, rat A00329 200 μg $311 40 μg $69 4E-BP1 Antibody (Phospho-Thr45), pAb, Rabbit WB, IHC Human, mouse, rat A00328 200 μg $311
Your Innovation Partner in Drug Discovery! - 123 - www.genscript.com - 124 - - 125 Primary Antibodies Antibodies BAD Antibody (Ab-112), pAb, Rabbit BAD Antibody pAb, (Ab-112), BIM Rabbit Antibody pAb, (Ab-69), BAD Antibody (Phospho-Ser Rabbit BAD Antibody pAb, (Ab-155), c-Jun Antibody (Ab-63),pAb,Rabbit c-Jun Antibody (Ab-243),pAb,Rabbit c-Jun Antibody (Ab-239),pAb,Rabbit cAMP Antibody, pAb,Rabbit rdc plctosCat.No. Applications Product BCL-XL Antibody (Ab-62), pAb, Rabbit Antibody pAb, BCL-XL (Ab-62), BAD Antibody (Phospho-Ser Rabbit BAD Antibody pAb, (Ab-136), BCL-XL AntibodyBCL-XL (Phospho-Ser ASK1 Antibody (Phospho-Ser AKT1 AntibodyAKT1 (Phospho-Thr pAb, Rabbit pAb, Antibody (Ab-315/316/312), AKT1/AKT2/AKT3 Antibody Rabbit (Ab-308/309),pAb, AKT1/AKT2 Antibody (Phospho-Ser Akt Rabbit Antibody pAb, (Ab-473), Akt Rabbit Antibody pAb, (Ab-308), Akt Akt Antibody (Phospho-Ser Akt AntibodyAFX (Phospho-Ser Rabbit Antibody pAb, AFX (Ab-197), Akt2 Antibody (Phospho-Ser Akt2 Rabbit Antibody pAb, (Ab-474), Akt2 ASK1 Antibody (Phospho-Ser ASK1 Antibody (Ab-83), pAb, Rabbit pAb, ASK1 Antibody (Ab-83), Antibody (Phospho-Thr Akt (Phospho-Tyr Antibody AKT1/AKT2/AKT3 315/316/312 ), pAb,Rabbit 308 473 473 197 474 136 112 ), pAb, Rabbit pAb, ), ), pAb, Rabbit pAb, ), Rabbit pAb, ), 450 966 83 ), pAb, Rabbit pAb, ), ), pAb, Rabbit pAb, ), ), pAb, Rabbit pAb, ), Rabbit pAb, ), ), pAb, Rabbit pAb, ), ), pAb,Rabbit 62 ), pAb, Rabbit pAb, ), ), pAb, Rabbit pAb, ), Your Innovation PartnerinDrugDiscovery! WB WB, IHC WB, IHC ELISA WB, IHC IHC, IF WB, WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC IHC, IF WB, WB, IHC WB IHC WB, IHC IHC, IF IHC, IF IHC, IF WB, WB ELISA, WB, IHC WB, IHC IHC IHC WB, IHC IHC, IF WB, WB, IHC Human, mouse Human Human NA Human, mouse rat mouse, Human, Human Human, mouse,rat rat mouse, Human, Human Human Human Human, mouse Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human rat mouse, Human, Human, mouse,rat Human Human Human Human, mouse,rat Human Species Reactivity Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g l l A00580 A00238 A00235 A00614 A00514 A00294 A00308 A01156 A00295 A00311 A00310 A00309 A00340 A00341 A00422 A00385 A00441 A01217 A01227 A01252 A01291 A00275 A00965 A00272 A00301 A00304 A00372 A00445 Price $225 $225 $225 $400 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $50 $50 $50 $85 $50 $69 $50 $69 $69 $50 $50 $50 $69 $69 $50 $69 $50 $69 $50 $50 $69 $69 $69 $69 $50 $50 $69 $50 eIF2 GSK3 (Phospho-Ser eIF4E Antibody GSK3 GSK3 eIF4G Antibody (Phospho-Ser eIF4G Antibody eIF4G Antibody (Ab-1232),pAb,Rabbit c-Jun Antibody (Phospho-Tyrc-Jun Antibody (Phospho-Thr c-Jun Antibody eNOS Antibody (Phospho-Ser eNOS Antibody eNOS Antibody (Ab-1177), pAb,Rabbit (Phospho-Thr c-Jun Antibody FKHRL1 Antibody (Phospho-Ser FKHRL1 Antibody (Phospho-Ser FKHR Antibody (Phospho-Ser FKHR Antibody FKHR Antibody (Ab-319),pAb,Rabbit FKHR Antibody (Ab-256),pAb,Rabbit FAK(Phospho-Tyr Antibody FAK(Phospho-Tyr Antibody FAK Antibody (Ab-925),pAb,Rabbit FAK Antibody (Ab-861),pAb,Rabbit c-Jun Antibody (Phospho-Ser c-Jun Antibody c-Jun Antibody (Ab-93),pAb,Rabbit c-Jun Antibody (Ab-91),pAb,Rabbit Product c-Jun Antibody (Phospho-Ser c-Jun Antibody Gab1 Antibody (Phospho-TyrGab1 Antibody Gab1 Antibody (Ab-627),pAb, Rabbit GSK3 α Antibody (Phospho-Ser Antibody α β β β Antibody (Phospho-Ser Antibody Antibody (Ab-9),pAb,Rabbit Antibody (Phospho-Tyr Antibody Antibody (Ab-21),pAb,Rabbit 861 397 170 627 93 91 73 243 49 209 ), pAb,Rabbit ), pAb,Rabbit 319 256 1177 1232 ), pAb,Rabbit ), pAb,Rabbit 216 ), pAb,Rabbit ), pAb,Rabbit 9 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 253 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IF WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB WB, IF WB, IHC,IF WB, IHC IHC, IF WB, IF WB, IHC WB, IHC,IF WB, IHC,IF IHC, IF WB WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF Applications Human Human, mouse,rat Human Human Human, mouse Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human, rat Human Human Human, mouse,rat Human Human Human Human, mouse,rat Human Human, mouse,rat NA Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Species Reactivity Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01031 A00193 A00196 A00210 A00568 A00512 A00354 A00373 A00395 A00444 A00427 A00287 A01142 A00434 A00350 A01158 A01152 A01218 A01228 A00504 A01270 A00471 A00234 A00232 A00194 A00237 A00233 A00231 Cat. No. www.genscript.com Price $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $69 $69 $50 $50 $69 $50 $69 $69 $69 $50 $50 $69 $69 $50 $50 $69 $50 $69 $50 $69 $69 $69 $69 $69 $69 $69 $50 $50
- 126
Primary Antibodies Primary Antibodies - 127 Primary Antibodies Antibodies NF- NF- NF- pAb, Rabbit mTOR Antibody (Phospho-Ser mTOR Antibody (Phospho-TyrMet Antibody JAK2 Antibody (Phospho-TyrJAK2 Antibody JAK2 Antibody (Ab-221),pAb,Rabbit JAK2 Antibody (Ab-1007),pAb,Rabbit NF- NF- NF- JAK1 Antibody (Phospho-TyrJAK1 Antibody JAK1 Antibody (Ab-1022),pAb,Rabbit I I I I (Phospho-Ser IRS-1 Antibody (Phospho-Ser IRS-1 Antibody IKK Product IKK IRS-1 Antibody (Phospho-Ser IRS-1 Antibody IRS-1 Antibody (Ab-639),pAb,Rabbit IRS-1 Antibody (Ab-312),pAb,Rabbit IRS-1 Antibody (Ab-307),pAb,Rabbit Met Antibody (Phospho-TyrMet Antibody Met Antibody (Ab-1349),pAb,Rabbit Met Antibody (Ab-1234),pAb,Rabbit κ κ κ κ B- B- B- B- α α κ κ κ κ κ κ α α α α B p105/p50 Antibody (Ab-907),pAb,Rabbit B p105/p50 Antibody (Ab-893),pAb,Rabbit B p105/p50 Antibody (Ab-337), pAb,Rabbit B p100/p52 Antibody (Phospho-Ser B p100/p52 Antibody (Ab-870), pAb,Rabbit B p100/p52 Antibody (Ab-866), pAb,Rabbit Antibody (Ab-23),pAb,Rabbit Antibody (Phospho-Thr Antibody Antibody (Phospho-Tyr Antibody (Phospho-Ser Antibody Antibody (Ab-42),pAb,Rabbit Antibody (Ab-32,36),pAb,Rabbit 1349 1234 23 42 221 1022 32, 36 639 636 307 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 2448 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 870 ), Your Innovation PartnerinDrugDiscovery! WB, IHC WB, IHC IHC WB, IHC,IF WB, IHC WB, IHC IHC, IF WB WB WB WB IHC IHC WB WB, IHC WB, IHC IHC IHC, IF WB, IHC WB, IHC,IF WB, IHC WB, IHC IHC WB, IF WB IHC, IF WB, IHC WB, IHC Applications Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human Species Reactivity Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00228 A00227 A00585 A00226 A00225 A00583 A00643 A00507 A00321 A00569 A00464 A00362 A00419 A01185 A00363 A00418 A00349 A00359 A00453 A00609 A01027 A00503 A00506 A01042 A01151 A00572 A00356 A00421 Cat. No. Price $225 $225 $225 $225 $225 $225 $225 $225 $225 $172 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $69 $69 $69 $50 $50 $69 $50 $50 $69 $50 $69 $69 $50 $50 $69 $69 $69 $50 $50 $69 $50 $50 $50 $50 $69 $50 $50 p53 Antibody (Phospho-Ser p53 Antibody p53 Antibody (Ab-9),pAb,Rabbit p53 Antibody (Ab-46),pAb, Rabbit p53 Antibody (Ab-37),pAb, Rabbit p53 Antibody (Ab-315),pAb, Rabbit p53 Antibody (Ab-15),pAb, Rabbit NF- NF- NF- NF- NF- NF- pAb, Rabbit NF- pAb, Rabbit NF- pAb, Rabbit NF- pAb, Rabbit NF- pAb, Rabbit p27Kip1 Antibody (Phospho-Thr p27Kip1 Antibody p27Kip1 Antibody (Ab-10),pAb,Rabbit p21Cip1 Antibody (Phospho-Thr p21Cip1 Antibody p21Cip1 Antibody (Ab-145),pAb,Rabbit pAb, Rabbit NF- pAb, Rabbit p53 Antibody (Phospho-Ser p53 Antibody NF- NF- Product NF- pAb, Rabbit NF- pAb, Rabbit p53 Antibody (Phospho-Ser p53 Antibody NF- pAb, Rabbit κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ B p65 Antibody (Phospho-Ser B p65 Antibody (Ab-536),pAb,Rabbit B p65 Antibody (Ab-529),pAb,Rabbit B p65 Antibody (Ab-468),pAb,Rabbit B p65 Antibody (Ab-435),pAb,Rabbit B p65 Antibody (Ab-276),pAb,Rabbit B p105/p50 Antibody (Phospho-Ser932), B p105/p50 Antibody (Phospho-Ser907), B p105/p50 Antibody (Phospho-Ser893), B p65 Antibody (Phospho-Ser B p65 Antibody (Phospho-Thr B p105/p50 Antibody (Phospho-Ser B p105/p50 Antibody (Ab-932),pAb,Rabbit B p65 Antibody (phospho-ser B p65 Antibody (Phospho-Ser B p65 Antibody (Phospho-Thr 46 37 315 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 187 145 536 ), pAb,Rabbit ), pAb,Rabbit 435 254 529 311 276 ), ), ), ), ), ), 337 ), WB, IF WB, IF WB, IHC,IF WB WB WB WB WB, IHC,IF WB, IHC WB, IHC IHC WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC IHC, IF WB, IHC,IF WB, IHC Applications Human Human Human Human Human Human Human Human Human, mouse,rat Human Human Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Species Reactivity Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00484 A01213 A00485 A01162 A00596 A01221 A00598 A00595 A00333 A00436 A01160 A01150 A00221 A00468 A00224 A00330 A00543 A00220 A00222 A00459 A00219 A00213 A00212 A00534 A00230 A00229 A00470 A00555 Cat. No. www.genscript.com Price $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $69 $69 $69 $50 $50 $50 $50 $50 $69 $50 $69 $50 $69 $69 $69 $69 $69 $69 $50 $50 $50 $50 $50 $69 $69 $69 $69 $50
- 128
Primary Antibodies Primary Antibodies - 129 Primary Antibodies Antibodies Zap-70 Antibody (Phospho-TyrZap-70 Antibody Zap-70 Antibody (Ab-493), pAb, Rabbit Zap-70 Antibody (Ab-319), pAb, Rabbit p70 S6Kinase Antibody (Phospho-Ser p70 S6Kinase Antibody (Ab-424),pAb,Rabbit p70 S6Kinase Antibody (Ab-421),pAb,Rabbit p70 S6Kinase Antibody (Ab-411), pAb,Rabbit Zap-70 Antibody (Phospho-TyrZap-70 Antibody Pyk2 Antibody (Phospho-TyrPyk2 Antibody Pyk2 Antibody (Ab-402),pAb,Rabbit PDK1 Antibody (Phospho-Ser PDK1 Antibody PDK1 Antibody (Ab-241),pAb,Rabbit NA: Not Available. *: This producthasnotbeen (Phospho-Ser p53 Antibody Product PTEN Antibody (Phospho-Ser PTEN Antibody PTEN Antibody (Ab-370),pAb,Rabbit PP2A- (Phospho-Ser S6 RibosomalProtein Antibody pAb, Rabbit S6 RibosomalProtein Antibody (Ab-235), Raf1 Antibody (Ab-338),pAb,Rabbit Raf-1 Antibody (Ab-259),pAb,Rabbit Rac1 Antibody (Ab-71),pAb,Rabbit p70 S6Kinase Antibody (Phospho-Thr pAb, Rabbit Paxillin Antibody (Phospho-TyrPaxillin Antibody Paxillin Antibody (Ab-31),pAb,Rabbit Paxillin Antibody (Ab-118), pAb,Rabbit pAb, Rabbit α Antibody, pAb,Rabbit 235 ), pAb,Rabbit 6 ), pAb,Rabbit 402 tested 241 370 118 493 319 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit wt eciiyt te pce. withreactivitytootherspecies. 421 411 ), ), Your Innovation PartnerinDrugDiscovery! IHC WB, IF IHC WB, IHC WB, IF WB, IHC,IF WB, IHC WB, IHC WB, IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB Applications Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse Species Reactivity Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human Human Human Human, mouse,rat Human Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat Human Human Quantity 200 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00492 A00491 A00593 A00594 A00315 A00465 A01153 A00209 A00660 A00498 A00586 A00290 A00303 A01226 A00207 A00208 A00379 A00456 A00409 A00539 A00554 A00516 A00550 A00527 A01168 Cat. No. Price $225 $172 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $172 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $69 $69 $50 $69 $50 $50 $50 $50 $69 $50 $69 $50 $50 $69 $50 $69 $50 $50 $69 $69 $50 $50 $69 Product Overview: chromosomal DNA fragmentationarecausedbyapoptosisthat shrinkage, nuclearfragmentation,chromatincondensation,and blebbing, lossofmembraneasymmetryandattachment,cell and death. A varietyofmorphologicalchanges,suchas biochemical eventsleadingtoacharacteristiccellmorphology may occurinmulticellularorganisms.PCDinvolvesaseriesof Apoptosis istheprocessofprogrammedcelldeath(PCD)that Cancer/Apoptosis rdc plctosCat.No. Applications Product AFX Antibody(Phospho-Ser AFX Antibody(Ab-197),pAb,Rabbit 4E-BP1 Antibody(Ab-45),pAb,Rabbit 4E-BP1 Antibody(Ab-36),pAb,Rabbit 14-3-3 Caspaes-8 Caspaes-3 ζ Antibody(Phospho-Ser T23 P NF-kB Apoptosis NIK IKKa 197 Apaf1 NF-kB FasL 1XB 966 S83 ), pAb,Rabbit 58 Caspaes-9 P P ), pAb,Rabbit JNK P P Ask1 S32/36 Y185 T183 P P P 1AP P Jaks P P STAT S363 T359 WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC WB, IHC,IF P P S133 CREB Src p90RSK P P Diablo Smac/ P ERK1.2 T185/Y187 T202/T204 P S70 T56 -2 Bcl XL Bcl- etc GF, Cytokines P P Bad P S62 P Species Reactivity Human, mouse,rat Human Human Human Human, mouse,rat Cytoc can beusedinyourcancerandapoptosisresearch. inhibition. GenScriptoffers awideselectionofantibodiesthat undergo apoptosisbecauseofmutationorbiochemical role incancerprevention. Tumor developsifacellisunableto differentiate apoptosisfromnecrosis. Apoptosis alsoplaysa of cellulardebriswhoseresultsdonotdamagetheorganism involves aseriesofbiochemicalevents.Processesdisposal P PKC P P S99/136 S118/155 S75/112 S473 Ras Akt P Y326 PI3K Bax S383/385 S370/380/382 P NF-kB P P53 P P P PTEM S46/315/356/396 S6/9/15/20/33/37 P P P Quantity Apoptosis P 200 200 200 200 GSK-3 200 T18 P 40 40 40 40 40 P Chk2 μ μ μ μ μ μ μ μ μ μ ATM g g g g g g g g g g P T58/358 S373 A00372 A00445 A00461 A00460 A00919 MDM2 Myc P www.genscript.com P Price $311 $225 $225 $225 $311 $69 $50 $50 $50 $69
- 130
Primary Antibodies Primary Antibodies - 131 Primary Antibodies Antibodies ASK1 Antibody(Phospho-Ser CREB Antibody(Ab-133),pAb,Rabbit CREB Antibody(Ab-129),pAb,Rabbit BCL-XL Antibody(Phospho-Ser BAD Antibody(Phospho-Ser BAD Antibody(Ab-155),pAb,Rabbit BAD Antibody(Ab-136),pAb,Rabbit BAD Antibody(Ab-112),pAb,Rabbit ATM Antibody(Ab-1981),pAb,Rabbit CDK6 Antibody(Phospho-Tyr CDK6 Antibody(Ab-24),pAb,Rabbit CDK6 Antibody(Ab-13),pAb,Rabbit CDC2 Antibody(Phospho-Thr cdc2 Antibody(Ab-19),pAb,Rabbit CDC2 Antibody(Ab-161),pAb,Rabbit CDC2 Antibody(Ab-15),pAb,Rabbit BIM Antibody(Phospho-Ser BIM Antibody(Ab-69),pAb,Rabbit BCL-2 Antibody(Phospho-Ser BAD Antibody(Phospho-Ser BCL-2 Antibody(Phospho-Thr ASK1 Antibody(Phospho-Ser ASK1 Antibody(Ab-966),pAb,Rabbit ASK1 Antibody(Ab-83),pAb,Rabbit Akt2 Antibody(Ab-474),pAb,Rabbit Product CDC2 Antibody(Phospho-Tyr c-Cbl Antibody(Phospho-Tyr 69 136 112 700 ), pAb,Rabbit 24 966 83 15 161 56 70 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 62 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications WB, IHC WB, IHC IHC, IF IHC IHC, IF WB WB, IHC IHC WB, IF WB, IHC,IF IHC, IF IHC, IF WB, IHC WB, IHC,IF WB, IHC ELISA, IHC IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IF WB, IHC WB, IHC IHC, IF WB, IHC,IF WB, IHC Species Reactivity Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human Human Human, mouse,rat Human, mouse Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human Human Human Human Human, mouse Human Human Human Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00286 A00519 A01274 A01265 A01264 A00524 A00374 A01295 A00599 A00565 A01276 A00566 A00514 A00294 A00292 A00293 A01156 A00295 A00311 A00310 A00309 A01222 A00340 A00341 A00425 A00422 A00441 Price $225 $225 $311 $225 $225 $311 $311 $225 $172 $225 $311 $311 $225 $311 $311 $311 $311 $311 $225 $225 $225 $225 $311 $311 $225 $225 $225 $50 $50 $69 $50 $50 $69 $69 $50 $50 $69 $69 $50 $69 $69 $69 $69 $69 $50 $50 $50 $50 $69 $69 $50 $50 $50 IKK IKK HtrA2 Antibody,pAb,Rabbit HSP90B Antibody(Ab-254),pAb,Rabbit HSP27 Antibody(Phospho-Ser HSP27 Antibody(Phospho-Ser FKHRL1 Antibody(Phospho-Ser FKHRL1 Antibody(Ab-253),pAb,Rabbit FKHR Antibody(Phospho-Ser FKHR Antibody(Phospho-Ser FKHR Antibody(Ab-319),pAb,Rabbit FKHR Antibody(Ab-256),pAb,Rabbit CREB Antibody(Phospho-Ser I CREB Antibody(Phospho-Ser I I GSK3 GSK3 Product I I I HSP27 Antibody(Phospho-Ser HSP27 Antibody(Ab-82),pAb,Rabbit HSP27 Antibody(Ab-78),pAb,Rabbit HSP27 Antibody(Ab-15),pAb,Rabbit GSK3 GSK3 κ κ κ κ κ κ B- B- B- B- B- B- α α α β β α α α Antibody(Phospho-Thr Antibody(Ab-23),pAb,Rabbit Antibody(Phospho-Ser Antibody(Ab-23),pAb,Rabbit Antibody(Phospho-Tyr Antibody(Phospho-Ser Antibody(Ab-42),pAb,Rabbit Antibody(Ab-32,36),pAb,Rabbit α α β β Antibody(Ab-9),pAb,Rabbit Antibody(Phospho-Ser Antibody(Phospho-Ser Antibody(Ab-21),pAb,Rabbit 23 42 23 32,36 319 256 133 129 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 82 78 15 9 21 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 253 ), pAb,Rabbit ), pAb,Rabbit plctosCat.No. Applications IHC WB, IHC IHC IHC, IF WB, IHC WB, IHC,IF WB, IHC WB, IHC WB WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC WB, IHC Species Reactivity Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat* Human Human Human, mouse,rat Human Human Human Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01032 A00928 A00349 A00359 A00453 A00609 A00356 A00421 A01427 A00672 A00530 A00528 A00343 A00558 A00560 A00432 A00193 A00196 A00216 A00210 A00354 A00450 A00373 A00395 A00444 A00427 A00267 A00556 www.genscript.com Price $311 $225 $311 $311 $225 $225 $311 $225 $225 $225 $311 $311 $311 $225 $225 $225 $311 $225 $311 $225 $311 $225 $311 $311 $225 $225 $311 $311 $69 $50 $69 $69 $50 $50 $69 $50 $50 $50 $69 $69 $69 $50 $50 $50 $69 $50 $69 $50 $69 $50 $69 $69 $50 $50 $69 $69
- 132
Primary Antibodies Primary Antibodies - 133 Primary Antibodies Antibodies NF- NF- NF- MEK1 Antibody(Ab-221),pAb,Rabbit LC3A Antibody,pAb,Rabbit JAK2 Antibody(Phospho-Tyr JAK2 Antibody(Phospho-Tyr Jak2 Antibody(Ab-570),pAb,Rabbit JAK2 Antibody(Ab-221),pAb,Rabbit JAK2 Antibody(Ab-1007),pAb,Rabbit JAK1 Antibody(Phospho-Tyr JAK1 Antibody(Ab-1022),pAb,Rabbit NF- NF- NF- NF- NF- NF- NF- NF- NF- NF- NF- NF- NF- NF- NF- NF- Product κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ B p100/p52Antibody(Phospho-Ser B p100/p52Antibody(Ab-870),pAb,Rabbit B p100/p52Antibody(Ab-866),pAb,Rabbit B p65Antibody(Ab-505),pAb,Rabbit B p65Antibody(Ab-468),pAb,Rabbit B p65Antibody(Ab-435),pAb,Rabbit B p65Antibody(Ab-311),pAb,Rabbit B p65Antibody(Ab-276),pAb,Rabbit B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Ab-932),pAb,Rabbit B p105/p50Antibody(Ab-927),pAb,Rabbit B p105/p50Antibody(Ab-907),pAb,Rabbit B p105/p50Antibody(Ab-893),pAb,Rabbit B p105/p50Antibody(Ab-337),pAb,Rabbit B p100/p52Antibody(Phospho-Ser 221 1007 1022 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 932 927 907 893 337 870 866 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC IHC, IF WB, IHC,IF WB, IHC WB, IF WB, IHC WB, IHC IHC WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IF IHC WB, IHC IHC IHC WB WB, IHC WB, IHC Species Reactivity Human, mouse,rat Human Human Human Human Human, mouse,rat Human Human Human Human, mouse,rat Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse Human, mouse,rat Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01163 A00219 A00213 A00542 A00212 A00534 A00922 A00230 A00229 A00470 A00555 A00929 A00228 A00227 A00585 A00226 A00469 A00225 A00583 A00452 A00971 A00362 A00360 A01259 A00419 A01185 A00363 A00418 Price $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $225 $225 $225 $225 $225 $311 $311 $225 $225 $225 $225 $311 $311 $225 $225 $225 $311 $225 $50 $50 $50 $50 $50 $69 $69 $69 $69 $69 $50 $50 $50 $50 $50 $69 $69 $50 $50 $50 $50 $69 $69 $50 $50 $50 $69 $50 p70 S6KinaseAntibody(Phospho-Ser p70 S6KinaseAntibody(Ab-424),pAb,Rabbit p70 S6KinaseAntibody(Ab-421),pAb,Rabbit p70 S6KinaseAntibody(Ab-411),pAb,Rabbit p44/42 MAPKinaseAntibody(Phospho-Thr p44/42 MAPKinaseAntibody(Ab-204),pAb,Rabbit p44/42 MAPKinaseAntibody(Ab-202),pAb,Rabbit Niban Antibody,pAb,Rabbit NF- NF- NF- NF- NF- NF- p53 Antibody(Phospho-Ser p53 Antibody(Phospho-Ser p53 Antibody(Phospho-Ser p53 Antibody(Ab-9),pAb,Rabbit p53 Antibody(Ab-46),pAb,Rabbit p53 Antibody(Ab-37),pAb,Rabbit p53 Antibody(Ab-315),pAb,Rabbit p53 Antibody(Ab-15),pAb,Rabbit Rabbit NF- p44/42 MAPKinaseAntibody(Phospho-Tyr Rabbit p53 Antibody(Phospho-Ser NF- NF- NF- p70 S6KinaseAntibody(Phospho-Ser Product κ κ κ κ κ κ κ κ κ κ B p65Antibody(Phospho-Thr B p65Antibody(Phospho-Thr B p65Antibody(phospho-ser B p65Antibody(Phospho-Ser B p65Antibody(Phospho-Ser B p65Antibody(Phospho-Ser B p65Antibody(Phospho-Thr B p65Antibody(Phospho-Ser B p65Antibody(Ab-536),pAb,Rabbit B p65Antibody(Ab-529),pAb,Rabbit 6 46 37 315 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 536 505 435 254 529 468 311 276 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 424 411 ), pAb,Rabbit ), pAb,Rabbit 204 202 ), pAb, ), pAb, plctosCat.No. Applications WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB WB, IF WB, IF WB, IHC,IF WB WB WB WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB WB WB, IF IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC Species Reactivity Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse Human Human Human Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human, mouse Human Human Human, mouse,rat Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Quantity 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00561 A00554 A00516 A00550 A00527 A01168 A00484 A01213 A00485 A01162 A00596 A01221 A00598 A00595 A00526 A00525 A00562 A00564 A00933 A01159 A00221 A00468 A00224 A00330 A00223 A00543 A00220 A00222 A00459 www.genscript.com Price $311 $311 $225 $225 $172 $311 $311 $311 $311 $225 $225 $225 $225 $311 $311 $172 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $225 $225 $69 $69 $50 $50 $69 $69 $69 $69 $50 $50 $50 $50 $50 $69 $69 $50 $50 $69 $69 $69 $69 $69 $69 $69 $69 $50 $50
- 134
Primary Antibodies Primary Antibodies - 135 Primary Antibodies Antibodies PTEN Antibody(Phospho-Ser PTEN Antibody(Phospho-Ser PKC PKC Rabbit PAK1/PAK2/PAK3 Antibody(Ab-423/402/421),pAb, Raf-1 Antibody(Phospho-Ser Raf1 Antibody(Ab-338),pAb,Rabbit Raf-1 Antibody(Ab-259),pAb,Rabbit PKC PKC Src Antibody(Phospho-Tyr Src Antibody(Ab-529),pAb,Rabbit Rabbit PTEN Antibody(Phospho-Ser PTEN Antibody(Ab-380,382,383),pAb,Rabbit PTEN Antibody(Ab-370),pAb,Rabbit PKD/PKC PKD/PKC PKD/PKC PKD/PKC S6 RibosomalProteinAntibody(Phospho-Ser S6 RibosomalProteinAntibody(Ab-235),pAb,Rabbit p70 S6KinaseAntibody(Phospho-Ser PAK1 Antibody(Phospho-Thr PKC PKC STAT1 Antibody(Ab-727),pAb,Rabbi STAT1 Antibody(Ab-701),pAb,Rabbit Product β β δ δ θ θ Antibody(Phospho-Ser Antibody(Ab-676),pAb,Rabbit Antibody(Phospho-Ser Antibody(Ab-645),pAb,Rabbit Antibody(Phospho-Thr Antibody(Ab-641),pAb,Rabbit μ μ μ μ Antibody(Phospho-Ser Antibody(Phospho-Ser Antibody(Ab-910),pAb,Rabbit Antibody(Ab-738),pAb,Rabbit 529 ), pAb,Rabbit 259 212 641 676 645 380 380 370 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit , Thr ), pAb,Rabbit ), pAb,Rabbit 910 738 382,383 ), pAb,Rabbit ), pAb,Rabbit 411 ), pAb,Rabbit ), pAb,Rabbit 235 ), pAb, Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IF WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC,IF IHC, IF WB, IHC,IF WB, IHC WB, IHC WB WB, IF WB WB, IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF IHC, IF WB, IHC,IF WB, IHC,IF pce eciiyPrice Species Reactivity Human Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00454 A00274 A00358 A00449 A00315 A00465 A00215 A01153 A00209 A00277 A00218 A00290 A00302 A00303 A01021 A00481 A00605 A00606 A00579 A00508 A00576 A00509 A00654 A00655 A01040 A00650 A00539 $225 $311 $225 $311 $225 $225 $311 $311 $225 $225 $311 $225 $311 $225 $311 $225 $225 $311 $311 $311 $225 $225 $311 $311 $225 $225 $311 $69 $50 $69 $50 $69 $50 $50 $69 $69 $50 $50 $69 $50 $69 $50 $69 $50 $50 $69 $69 $69 $50 $50 $69 $69 $50 $50 Cell Cycle NA: Not Available *: This producthasnotbeentestedwithreactivitytootherspecies. renewed. which hair, skin,bloodcells,andsomeinternalorgansare egg developsintoamatureorganism.Itisalsoprocessby The cellcycleisavitalstepbywhichsingle-celledfertilized binary fissioninprokaryotescellsthatdonothavenucleus. (replication). The cellcycleoccursviaaprocesstermedas events thatoccursinacellleadingtoitsdivisionandduplication The cellcycle,alsoknownascell-divisionisaseriesof STAT3 Antibody(Phospho-Ser STAT3 Antibody(Ab-727),pAb,Rabbit Stat2 Antibody(Ab-690),pAb,Rabbit STAT1 Antibody(Phospho-Ser TYK2 Antibody(Phospho-Tyr STAT1 Antibody(Phospho-Tyr Product Withdrawal Growth Factor 3 GSK- β 1054 701 727 727 P S9 T283 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit G1 —PHASE P CyclinD CDK4/6 S780/795/807 P Myc T58/358 S373 P P P P plctosCat.No. Applications WB WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC,IF Rb P T14/160 Y15 Cdc25A R S632 P P HDAC2 S —PHASE P P S394 P CDK2 Inhibition Contact HDAC4 HDAC8 KIPI P27 Myc in yourcellcycleresearch. GenScript offers awideselectionofantibodiesthatcanbeused damage aswellthepreventionofuncontrolledcelldivision. survival ofacell,includingthedetectionandrepairgenetic Regulation ofthecellcycleinvolvesprocessescrucialto HDAC7 CyclinE pce eciiyPrice Species Reactivity Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat P HDAC5 HDAC1 S39 P P S395 CIPI P21 S421/423 P P P P S498 P P p53 DNA Damage P Senescence Replicative T58/358 S373 ATR ATM/ P Quantity P P 200 200 200 200 200 200 Myc 40 40 40 40 40 40 T18 S46/315/356/396 S6/9/15/20/33/37 Chk1/2 P μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g P A01184 A00251 A00278 A01263 A00249 A00347 www.genscript.com $311 $311 $225 $225 $311 $311 $69 $69 $50 $50 $69 $69
- 136
Primary Antibodies Primary Antibodies - 137 Primary Antibodies Antibodies Product Overview: Product cdc25C Antibody(Phospho-Ser cdc25C Antibody(Ab-216),pAb,Rabbit CDC2 Antibody(Phospho-Thr cdc2 Antibody(Ab-19),pAb,Rabbit CDC2 Antibody(Ab-161),pAb,Rabbit CDC2 Antibody(Ab-15),pAb,Rabbit cdc25A Antibody(Phospho-Ser cdc25A Antibody(Ab-76),pAb,Rabbit ABL1/2 Antibody(Phospho-Tyr ABL1/2 Antibody(Ab-393/429),pAb,Rabbit AuroraA Antibody(Phospho-Thr Bcr Antibody(Phospho-Tyr Bcr Antibody(Ab-177),pAb,Rabbit BCL-XL Antibody(Ab-62),pAb,Rabbit BCL-2 Antibody(Ab-70),pAb,Rabbit BCL-2 Antibody(Ab-56),pAb,Rabbit CDK6 Antibody(Phospho-Tyr CDK6 Antibody(Ab-24),pAb,Rabbit CDK6 Antibody(Ab-13),pAb,Rabbit CDC2 Antibody(Phospho-Tyr 14-3-3 ATM Antibody(Phospho-Ser ATM Antibody(Ab-1981),pAb,Rabbit pAb, Rabbit BRCA1 Antibody(Phospho-Ser BRCA1 Antibody(Ab-1423),pAb,Rabbit c-Abl Antibody(Phospho-Tyr c-Abl Antibody(Ab-412),pAb,Rabbit BRCA1 Antibody(Phospho-Ser ζ Antibody(Phospho-Ser 177 1981 412 ), pAb,Rabbit 24 15 161 ), pAb,Rabbit 393/429 ), pAb,Rabbit ), pAb,Rabbit 1524 1423 76 216 ), pAb,Rabbit 58 288 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications IHC, IF IHC IHC, IF IHC, IF WB, IHC,IF WB, IHC WB WB WB, IHC IHC WB, IF WB, IHC,IF IHC, IF IHC IHC WB, IHC WB, IHC WB, IHC WB, IF WB WB, IHC WB, IHC,IF IHC IHC WB, IF IHC, IF IHC, IF WB, IHC,IF Species Reactivity Human Human Human Human Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse Human Human Human Human Human, mouse Human Human Human Human Human Human, mouse Human Human Human Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01274 A01265 A01264 A00420 A00433 A00439 A00446 A00524 A00374 A01295 A00599 A00565 A00384 A00442 A00490 A00523 A00567 A00496 A00589 A00308 A00307 A00306 A01292 A00437 A01222 A01272 A01262 A00919 Price $311 $311 $225 $311 $225 $311 $311 $225 $225 $311 $225 $311 $225 $311 $311 $225 $172 $225 $311 $225 $311 $311 $225 $311 $225 $225 $225 $225 $69 $69 $50 $69 $50 $69 $69 $50 $50 $69 $50 $69 $50 $69 $69 $50 $50 $69 $50 $69 $69 $50 $69 $50 $50 $50 $50 Product HDAC2 Antibody(Phospho-Ser HDAC2 Antibody(Ab-394),pAb,Rabbit Chk2 Antibody(Phospho-Ser Chk2 Antibody(Ab-68),pAb,Rabbit Chk2 Antibody(Ab-33),pAb,Rabbit GSK3 Rabbit GSK3 Myc Antibody(Phospho-Ser Myc Antibody(Ab-58),pAb,Rabbit Myc Antibody(Ab-373),pAb,Rabbit Myc Antibody(Ab-358),pAb,Rabbit mTOR Antibody(Ab-2448),pAb,Rabbit Ki-67 Antibody,pAb,Rabbit HEC1 Antibody,pAb,Rabbit HDAC5 Antibody(Phospho-Ser HDAC5 Antibody(Ab-498),pAb,Rabbit (Phospho-Ser HDAC4/HDAC5/HDAC9 Antibody (Ab-246/259/220), pAb,Rabbit HDAC4/HDAC5/HDAC9 Antibody Chk1 Antibody(Phospho-Ser Chk1 Antibody(Ab-317),pAb,Rabbit DNA PKcsAntibody(Phospho-Thr DNA PKcsAntibody(Ab-2609),pAb,Rabbit Chk1 Antibody(Ser GSK3 HDAC8 Antibody(Phospho-Ser HDAC8 Antibody(Ab-39),pAb,Rabbit HDAC4 Antibody(Phospho-Ser HDAC4 Antibody(Ab-632),pAb,Rabbit HDAC2 Antibody,pAb,Rabbit β β β Antibody(Ab-9),pAb,Rabbit Antibody(Phospho-Ser Antibody(Phospho-Tyr 246/259/220 280 ), pAb,Rabbit ), pAb,Rabbit 373 516 296 ), pAb,Rabbit 216 9 ), pAb,Rabbit ), pAb,Rabbit 39 498 632 394 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 2609 ), pAb, plctosCat.No. Applications IHC WB, IHC WB WB, IHC WB, IHC,IF IHC WB IHC, IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB WB, IF ELISA, WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB WB WB WB, IHC IHC ELISA, WB ELISA, WB WB, IHC Species Reactivity Human, mouse,rat Human Human, mouse Human Human Human Human Human Human, mouse Human, mouse,rat Human, mouse Human, mouse Human, mouse Human, mouse,rat Human Human* Human, mouse,rat Human Human Human, mouse,rat Human Human Human, mouse Human Human Human Human* Human, mouse Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00244 A00262 A00265 A00264 A01154 A01495 A01504 A00382 A00431 A00337 A00430 A01271 A01257 A00338 A00429 A01178 A01169 A00428 A01031 A00193 A00196 A00494 A00591 A00365 A00388 A01261 A01179 A00727 A00608 www.genscript.com $311 $225 $225 $225 $225 $225 $225 $240 $225 $311 $225 $311 $225 $311 $225 $225 $311 $225 $311 $311 $225 $311 $225 $311 $225 $225 $311 Price $69 $50 $50 $50 $50 $50 $50 $50 $69 $50 $69 $50 $69 $50 $50 $69 $50 $69 $69 $50 $69 $50 $69 $50 $50 $50 $69 $50
- 138
Primary Antibodies Primary Antibodies - 139 Primary Antibodies Antibodies NA: Not Available. *: This producthasnotbeentestedwithreactivitytootherspecies. Product p27Kip1 Antibody(Phospho-Thr p27Kip1 Antibody(Ab-10),pAb,Rabbit p95/NBS1 Antibody(Phospho-Ser p95/NBS1 Antibody(Ab-343),pAb,Rabbit p73 Antibody(Phospho-Tyr p73 Antibody(Ab-99),pAb,Rabbit p53 Antibody(Phospho-Ser SMC1 Antibody(Phospho-Ser SMC1 Antibody(Ab-957),pAb,Rabbit Rb Antibody(Phospho-Ser Rb Antibody(Phospho-Ser Myc Antibody(Phospho-Thr p53 Antibody(Phospho-Ser p53 Antibody(Phospho-Ser37),pAb,Rabbit Rb Antibody(Phospho-Ser Rb Antibody(Ab-807),pAb,Rabbit Rb Antibody(Ab-795),pAb,Rabbit Rb Antibody(Ab-780),pAb,Rabbit Prohibitin Antibody,pAb,Rabbit Rabbit p21Cip1 Antibody(Phospho-Thr p21Cip1 Antibody(Ab-145),pAb,Rabbit p53 Antibody(Phospho-Ser p53 Antibody(Ab-9),pAb,Rabbit p53 Antibody(Ab-46),pAb,Rabbit p53 Antibody(Ab-37),pAb,Rabbit p53 Antibody(Ab-315),pAb,Rabbit p53 Antibody(Ab-15),pAb,Rabbit Myc Antibody(Phospho-Thr 807 795 780 99 6 46 315 58 358 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 957 187 145 ), pAb,Rabbit 343 ), pAb,Rabbit ), pAb,Rabbit ), pAb, Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC WB WB, IHC WB WB WB, IHC WB WB WB WB, IF WB, IF WB, IHC,IF WB WB WB WB WB, IHC,IF WB, IHC WB, IHC IHC WB WB, IHC WB, IHC,IF Species Reactivity Human, mouse Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human NA Human Human Human, mouse,rat Human Human, mouse Human Human Human Human Human Human Human Human Human, mouse,rat Human Human Human Human, mouse,rat Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00336 A00455 A00378 A00381 A00377 A00411 A00410 A00412 A00706 A00283 A00305 A00285 A00348 A01168 A00484 A01213 A00485 A01162 A00596 A01221 A00598 A00595 A00333 A00436 A01160 A01150 A00242 A00243 $311 $225 $311 $311 $311 $225 $225 $225 $225 $311 $225 $311 $225 $311 $311 $311 $311 $225 $225 $225 $225 $311 $225 $311 $225 $311 $311 Price $69 $50 $69 $69 $69 $50 $50 $50 $50 $69 $50 $69 $50 $69 $69 $69 $69 $50 $50 $50 $50 $50 $69 $50 $69 $50 $69 $69 Product Overview: Chromatin/Transcription Both nucleicacidsequencesusecomplementarylanguageand in DNA nucleotidesequenceintoRNA sequenceinformation. DNA. Itistheprocessoftranscribinginformationencoded Transcription isthesynthesisofRNA basedonthedirectionof Product AFX Antibody(Phospho-Ser AFX Antibody(Ab-197),pAb,Rabbit 4E-BP1 Antibody(Phospho-Thr 4E-BP1 Antibody(Phospho-Thr 4E-BP1 Antibody(Ab-45),pAb,Rabbit 4E-BP1 Antibody(Ab-36),pAb,Rabbit 14-3-3 ATF-2 Antibody(Ab-94/112),pAb,Rabbit ATF-2 Antibody(Ab-71/53),pAb,Rabbit ATF-2 Antibody(Ab-62/44),pAb,Rabbit ATF-2 Antibody(Ab-55/73),pAb,Rabbit ATF-2 Antibody(Ab-51/69),pAb,Rabbit ζ Antibody(Ab-58),pAb,Rabbit oTasrpinTranscription No Transcription Histone 197 ), pAb,Rabbit 45 36 ), pAb,Rabbit ), pAb,Rabbit plctosCat.No. Applications WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC HDAC Kinase HDAC HAT Species Reactivity Huma Human Human Human Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse in yourchromatinandtranscriptionresearch. GenScript offers awideselectionofantibodiesthatcanbeused the informationissimplycopiedfromonemoleculetoother. AC HAT AC NUCLEUS Quantity 200 200 200 200 200 200 200 200 200 200 200 200 Acetyl-Histone 40 40 40 40 40 40 40 40 40 40 40 40 AC AC μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g A00261 A00259 A00257 A00260 A00258 A00372 A00445 A00328 A00329 A00461 A00460 A00662 www.genscript.com Price $311 $225 $225 $225 $225 $225 $225 $225 $225 $311 $225 $311 $69 $69 $50 $50 $50 $50 $50 $50 $50 $50 $69 $50
- 140
Primary Antibodies Primary Antibodies - 141 Primary Antibodies Antibodies Product c-Jun Antibody(Phospho-Tyr c-Jun Antibody(Phospho-Thr BRCA1 Antibody(Phospho-Ser BRCA1 Antibody(Ab-1423),pAb,Rabbit ATF-4 Antibody(Phospho-Ser ATF-4 Antibody(Ab-245),pAb,Rabbit ATF-2 Antibody(Phospho-Thr ATF-2 Antibody(Phospho-Thr CREB Antibody(Ab-133),pAb,Rabbit CREB Antibody(Ab-129),pAb,Rabbit c-Jun Antibody(Phospho-Thr c-Jun Antibody(Phospho-Ser ATF-2 Antibody(Phospho-Thr c-Jun Antibody(Phospho-Thr c-Jun Antibody(Phospho-Ser ATF-2 Antibody(Phospho-Ser c-Jun Antibody(Phospho-Ser c-Jun Antibody(Ab-93),pAb,Rabbit c-Jun Antibody(Ab-91),pAb,Rabbit c-Jun Antibody(Ab-73),pAb,Rabbit c-Jun Antibody(Ab-63),pAb,Rabbit c-Jun Antibody(Ab-243),pAb,Rabbit c-Jun Antibody(Ab-239),pAb,Rabbit c-Jun Antibody(Ab-170),pAb,Rabbit ATF-2 Antibody(Phospho-Ser CARM1 Antibody(Phospho-Ser CARM1 Antibody(Ab-228),pAb,Rabbit BRCA1 Antibody(Phospho-Ser 170 93 91 239 63 243 73 73/55 71/53 69/51 245 62/44 112/94 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 1524 1423 ), pAb,Rabbit ), pAb,Rabbit 228 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications WB, IHC WB, IHC WB WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC WB WB, IHC WB, IHC WB, IHC WB, IF WB, IF IHC WB, IHC WB, IHC IHC IHC IHC, IF WB, IHC IHC, IF IHC IHC Species Reactivity Human Human Human, mouse,rat NA Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse Human Human Human Human Human Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00286 A00519 A00471 A00234 A00232 A00236 A00194 A00466 A00237 A00233 A00231 A00197 A00580 A00238 A00235 A00587 A00924 A00932 A00490 A00523 A00567 A00269 A00300 A00475 A00241 A00474 A00473 A00476 $311 $311 $240 $311 $225 $225 $311 $311 $311 $311 $311 $311 $311 $225 $225 $225 $225 $225 $225 $225 $311 $225 $311 $311 $225 $311 $225 $311 Price $69 $69 $69 $50 $50 $69 $69 $69 $69 $69 $69 $69 $50 $50 $50 $50 $50 $50 $50 $69 $50 $69 $69 $50 $69 $50 $69 Product HDAC2 Antibody(Phospho-Ser HDAC2 Antibody(Ab-394),pAb,Rabbit GATA1 Antibody(Phospho-Ser eIF4E Antibody(Phospho-Ser eIF4E Antibody(Ab-209),pAb,Rabbit Elk-1 Antibody(Phospho-Ser Elk-1 Antibody(Ab-417),pAb,Rabbit Elk-1 Antibody(Ab-389),pAb,Rabbit Elk-1 Antibody(Ab-383),pAb,Rabbit FKHRL1 Antibody(Phospho-Ser FKHR Antibody(Phospho-Ser GATA1 Antibody(Phospho-Ser GATA1 Antibody(Ab-310),pAb,Rabbit GATA1 Antibody(Ab-142),pAb,Rabbit FKHR Antibody(Phospho-Ser FKHR Antibody(Ab-319),pAb,Rabbit FKHR Antibody(Ab-256),pAb,Rabbit eIF2 eIF2 CREB Antibody(Phospho-Ser Elk-1 Antibody(Phospho-Thr Elk-1 Antibody(Phospho-Ser G3BP-1 Antibody(Phospho-Ser CREB Antibody(Phospho-Ser HDAC4 Antibody(Phospho-Ser HDAC4 Antibody(Ab-632),pAb,Rabbit HDAC2 Antibody,pAb,Rabbit α α Antibody(Phospho-Ser Antibody(Ab-51),pAb,Rabbit 417 389 383 51 209 319 256 133 129 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 310 142 632 394 232 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 253 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit plctosCat.No. Applications WB WB, IF ELISA,WB WB, IHC,IF WB, IHC,IF WB, IF WB, IHC,IF WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF IHC, IF IHC WB, IHC IHC IHC, IF WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC Species Reactivity Human, mouse,rat Human Human* Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00338 A00429 A01178 A01169 A00428 A00248 A00247 A00273 A00270 A00364 A00354 A00373 A00395 A00444 A00427 A00246 A00245 A00195 A00592 A00266 A00198 A00504 A00574 A00559 A00518 A00267 A00556 www.genscript.com $311 $225 $225 $311 $225 $311 $311 $225 $225 $311 $311 $311 $311 $225 $225 $311 $311 $311 $225 $225 $225 $311 $225 $311 $225 $311 $311 Price $69 $50 $50 $69 $50 $69 $69 $50 $50 $69 $69 $69 $69 $50 $50 $69 $69 $69 $50 $50 $50 $69 $50 $69 $50 $69 $69
- 142
Primary Antibodies Primary Antibodies - 143 Primary Antibodies Antibodies Product JunD Antibody(Phospho-Ser JunD Antibody(Ab-255),pAb,Rabbit JunB Antibody(Phospho-Ser JunB Antibody(Ab-259),pAb,Rabbit HSF1 Antibody(Phospho-Ser JunB Antibody(Phospho-Ser Histone H2A.XAntibody(Phospho-Ser Histone H2A.XAntibody(Ab-139),pAb,Rabbit MEF2A Antibody(Phospho-Thr MEF2A Antibody(Ab-319),pAb,Rabbit MEF2A Antibody(Ab-312),pAb,Rabbit HSF1 Antibody(Phospho-Ser HSF1 Antibody(Ab-307),pAb,Rabbit HSF1 Antibody(Ab-303),pAb,Rabbit hnRNP C1/C2Antibody,pAb,Rabbit Rabbit (Phospho-Ser HDAC4/HDAC5/HDAC9 Antibody (Ab-246/259/220), pAb,Rabbit HDAC4/HDAC5/HDAC9 Antibody HDAC5 Antibody(Phospho-Ser HDAC5 Antibody(Ab-498),pAb,Rabbit Histone H3.1Antibody(Phospho-Ser Histone H3.1Antibody(Ab-10),pAb,Rabbit Histone H3Antibody,pAb,Rabbit pAb, Rabbit HDAC8 Antibody(Phospho-Ser HDAC8 Antibody(Ab-39),pAb,Rabbit Myc Antibody(Phospho-Ser Myc Antibody(Ab-58),pAb,Rabbit Myc Antibody(Ab-373),pAb,Rabbit Myc Antibody(Ab-358),pAb,Rabbit 246/259/220 ), pAb,Rabbit 373 79 259 255 307 303 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 312 ), pAb,Rabbit 39 498 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 10 ), pAb, 139 ), Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications IHC WB, IHC WB WB, IHC IHC, IF IHC WB, IHC WB, IHC WB, IHC,IF IHC, IF WB, IHC WB, IHC WB, IF WB, IHC WB, IHC WB, IHC WB WB, IHC,IF WB, IF WB WB, IF WB, IHC IHC, IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF Species Reactivity Human, mouse,rat Human Human, mouse Human Human, mouse,rat Human Human, mouse Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human Human Human Human Human, mouse,rat Human Human, mouse,rat Human Human Human Human, mouse Human, mouse,rat Human, mouse Human, mouse Human, mouse Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00244 A00262 A00265 A00264 A00477 A00268 A00642 A00472 A00590 A00239 A00240 A00256 A01164 A00546 A00671 A00610 A01484 A00339 A00426 A01502 A00552 A00529 A00382 A00431 A00337 A00430 A01271 A01257 $311 $225 $311 $225 $225 $225 $311 $225 $225 $311 $225 $311 $311 $225 $311 $311 $225 $225 $225 $311 $225 $225 $311 $225 $240 $225 $311 $225 Price $69 $50 $69 $50 $50 $50 $69 $50 $50 $69 $50 $69 $69 $50 $69 $69 $50 $50 $50 $69 $50 $50 $69 $50 $50 $69 $50 Product Myc Antibody(Phospho-Thr Rabbit NF- Rabbit NF- Rabbit NF- NF- NF- Myc Antibody(Phospho-Thr NF- NF- NF- NF- NF- NF- NF- NF- NF- Rabbit NF- Rabbit NF- Rabbit NF- Rabbit NF- NF- NF- NF- NF- Rabbit NF- Rabbit MyoD Antibody(Phospho-Ser MyoD Antibody(Ab-200),pAb,Rabbit κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ B p65Antibody(Phospho-Ser B p65Antibody(Phospho-Ser B p100/p52Antibody(Phospho-Ser B p100/p52Antibody(Ab-870),pAb,Rabbit B p100/p52Antibody(Ab-866),pAb,Rabbit B p65Antibody(Phospho-Ser B p65Antibody(Ab-536),pAb,Rabbit B p65Antibody(Ab-529),pAb,Rabbit B p65Antibody(Ab-505),pAb,Rabbit B p65Antibody(Ab-468),pAb,Rabbit B p65Antibody(Ab-435),pAb,Rabbit B p65Antibody(Ab-311),pAb,Rabbit B p65Antibody(Ab-276),pAb,Rabbit B p65Antibody(Ab-254),pAb,Rabbit B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Phospho-Ser B p105/p50Antibody(Ab-932),pAb,Rabbit B p105/p50Antibody(Ab-907),pAb,Rabbit B p105/p50Antibody(Ab-893),pAb,Rabbit B p105/p50Antibody(Ab-337),pAb,Rabbit B p100/p52Antibody(Phospho-Ser 58 358 ), pAb,Rabbit 200 ), pAb,Rabbit ), pAb,Rabbit 468 311 276 ), pAb, ), pAb, ), pAb, 932 907 893 337 870 866 ), pAb, ), pAb, ), pAb, ), pAb, ), pAb, ), pAb, plctosCat.No. Applications WB, IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF IHC WB, IHC WB, IHC IHC, IF WB, IHC,IF WB, IHC WB, IHC WB, IHC IHC WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC WB WB WB, IHC WB, IHC,IF Species Reactivity Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00223 A00543 A00220 A00222 A00459 A01163 A00219 A00213 A00542 A00212 A00581 A00534 A00230 A00229 A00470 A00555 A00228 A00227 A00585 A00226 A00469 A00225 A00583 A00480 A00607 A00242 A00243 www.genscript.com $311 $311 $311 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $225 $225 $225 $225 $311 $311 $225 $225 $311 $225 $311 $311 Price $69 $69 $69 $50 $50 $50 $50 $50 $50 $50 $50 $69 $69 $69 $69 $50 $50 $50 $50 $69 $69 $50 $50 $69 $50 $69 $69
- 144
Primary Antibodies Primary Antibodies - 145 Primary Antibodies Antibodies Product p70 S6KinaseAntibody(Phospho-Ser p70 S6KinaseAntibody(Ab-424),pAb,Rabbit p70 S6KinaseAntibody(Ab-421),pAb,Rabbit p70 S6KinaseAntibody(Ab-411),pAb,Rabbit p38 MAPKAntibody(Phospho-Tyr Rabbit p38 MAPKAntibody(Phospho-Thr p38 MAPKAntibody(Ab-182),pAb,Rabbit OLIG2 Antibody,pAb,Rabbit Rabbit NF- Rabbit NF- Rabbit NF- Rabbit p53 Antibody(Phospho-Ser NF- Rabbit p53 Antibody(Phospho-Ser p53 Antibody(Ab-9),pAb,Rabbit p53 Antibody(Ab-46),pAb,Rabbit p53 Antibody(Ab-37),pAb,Rabbit p53 Antibody(Ab-315),pAb,Rabbit 53 Antibody(Ab-15),pAb,Rabbit pAb, Rabbit p44/42 MAPKinaseAntibody(Phospho-Tyr pAb, Rabbit NF- p53 Antibody(Phospho-Ser RelB Antibody(Phospho-Ser RelB Antibody(Ab-573),pAb,Rabbit Rabbit p70 S6KinaseAntibody(Phospho-Thr Rabbit p70 S6KinaseAntibody(Phospho-Ser Rabbit p44/42 MAPKinaseAntibody(Phospho-Thr p44/42 MAPKinaseAntibody(Ab-204),pAb,Rabbit Rabbit p44/42 MAPKinaseAntibody(Ab-202),pAb, Rabbit κ κ κ κ κ B p65Antibody(Phospho-Thr B p65Antibody(Phospho-Thr B p65Antibody(phospho-Ser B p65Antibody(Phospho-Thr B p65Antibody(Phospho-Ser 6 46 315 ), pAb,Rabbit 573 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 182 536 505 435 254 180 529 ), pAb, ), pAb, ), pAb, ), pAb, ), pAb, ), pAb, ), pAb, 421 424 411 ), pAb, ), pAb, ), pAb, 204 202 ), ), Your Innovation PartnerinDrugDiscovery! plctosCat.No. Applications WB, IHC WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB WB, IF WB, IHC,IF WB WB WB WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB WB WB, IHC IHC WB WB IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF Species Reactivity Human, mouse Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse Human Human Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human, mouse Human Human, mouse,rat Human, mouse,rat Human, mouse Human, mouse,rat* Human, mouse,rat Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Quantity 200 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00540 A00547 A00539 A00561 A00554 A00516 A00550 A00527 A01168 A00484 A00485 A01162 A00596 A01221 A00598 A00595 A00526 A00525 A00562 A00564 A00537 A00535 A00553 A01474 A01159 A00221 A00468 A00224 A00330 $311 $225 $311 $311 $311 $225 $225 $172 $311 $311 $311 $225 $225 $225 $225 $311 $311 $172 $225 $311 $311 $225 $225 $311 $311 $311 $311 $311 Price $69 $50 $69 $69 $69 $50 $50 $69 $69 $69 $50 $50 $50 $50 $50 $69 $69 $50 $69 $69 $50 $50 $69 $69 $69 $69 $69 Product STAT1 Antibody(Phospho-Ser STAT1 Antibody(Ab-727),pAb,Rabbit STAT1 Antibody(Ab-701),pAb,Rabbit pAb, Rabbit NA: NotAvailable. *: Thisproducthasnotbeentestedwithreactivitytootherspecies. S6 RibosomalProteinAntibody(Phospho-Ser Rabbit S6 RibosomalProteinAntibody(Ab-235),pAb, STAT6 Antibody(Phospho-Thr STAT6 Antibody(Ab-645),pAb,Rabbit STAT6 Antibody(Ab-641),pAb,Rabbit STAT5A Antibody(Phospho-Ser STAT5A Antibody(Ab-780),pAb,Rabbit STAT5A Antibody(Ab-694),pAb,Rabbit STAT3 Antibody(Phospho-Ser STAT3 Antibody(Ab-727),pAb,Rabbit STAT6 Antibody(Phospho-Tyr STAT5A Antibody(Phospho-Tyr STAT4 Antibody(Phospho-Tyr STAT4 Antibody(Ab-693),pAb,Rabbit STAT1 Antibody(Phospho-Tyr 641 693 701 645 727 727 694 780 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 235 ), plctosCat.No. Applications WB, IHC IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC WB, IF WB, IHC,IF Species Reactivity Human Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00263 A00478 A00284 A00282 A00253 A00254 A00281 A00280 A00252 A00279 A00251 A00278 A00249 A00347 A00454 A00274 A00315 A00465 www.genscript.com $311 $311 $225 $225 $311 $311 $225 $225 $311 $225 $311 $225 $311 $311 $225 $225 $311 $225 Price $69 $69 $50 $50 $69 $69 $50 $50 $69 $50 $69 $50 $69 $69 $50 $50 $69 $50
- 146
Primary Antibodies Primary Antibodies - 147 Primary Antibodies Antibodies prokaryotic cytoskeleton.CSKisadynamicstructurethat eukaryotes. However, recentresearchhasdiscovered cells, thecytoskeletonwasoncethoughttobeastructure "skeleton" containedwithinthecytoplasm.Beingpresentinall The cytoskeleton(alsoknownasCSK)iscellular"scaffold" or Cytoskeletal Product Overview: Akt Antibody (Phospho-Thr Akt Antibody (Phospho-Ser Akt Antibody ADD1 Antibody (Phospho-Ser ADD1 Antibody ADD1 Antibody (Ab-726),pAb, Rabbit Product Akt Antibody (Phospho-Ser Akt Antibody Akt Antibody (Ab-473),pAb, Rabbit Akt Antibody (Ab-308),pAb, Rabbit Arp2/3 reorganization Actin cytoskeleton Ezrin factors Growth PKA Connexin 43 VASP WASP PKC 308 473 473 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 726 ), pAb,Rabbit MP MBS Pho-kinase Pho-GTP Pho-GEF Cofilin avtive Your Innovation PartnerinDrugDiscovery! Gq WB, IHC,IF ELISA, WB WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC,IF Applications CPI-17 GPCR phosphatase LIMK12 Vav Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human Species Reactivity inavtive Cofilin that canbeusedinyourcytoskeletonresearch. cellular division.GenScriptoffers awideselectionofantibodies and playsimportantrolesinbothintracellulartransport maintains cellshape,protectsthecell,enablescellularmotion, P130cas Pax Integrins Src FAK Crk cell motility PDK1 PAK1 AKT cell survival Rac1 BAD PIP3 Quantity ILK 200 200 200 200 200 200 200 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ PIP3 P13K g g g g g g g g g g g g g g Nck A00275 A00965 A00272 A00301 A00304 A00920 A00925 Cat. No. Caveolin RTK Ras-GTP cell growth c-Raf Erk MEK Price $225 $225 $225 $311 $311 $311 $311 $69 $69 $69 $50 $50 $69 $50 BIM Antibody (Phospho-Ser BIM Antibody BIM Antibody (Ab-69),pAb,Rabbit AKT1/AKT2/AKT3 Antibody (Phospho-TyrAKT1/AKT2/AKT3 Antibody pAb, Rabbit (Ab-315/316/312), AKT1/AKT2/AKT3 Antibody AKT1/AKT2 Antibody (Ab-308/309),pAb,Rabbit Cofilin Antibody (Phospho-Ser Cofilin Antibody Cofilin Antibody (Ab-3),pAb, Rabbit BAD Antibody (Phospho-Ser BAD Antibody BAD Antibody (Ab-155),pAb,Rabbit BAD Antibody (Ab-136),pAb,Rabbit BAD Antibody (Ab-112), pAb,Rabbit Connexin 43 Antibody (Ab-367),pAb,Rabbit Connexin 30 Antibody, pAb,Rabbit Cofilin1/Cofilin2 Antibody (Ab-88), pAb,Rabbit Cofilin Antibody, pAb,Rabbit Cofilin Antibody, pAb,Rabbit AKT1 Antibody (Phospho-Thr AKT1 Antibody AKT1 Antibody (Ab-450),pAb,Rabbit Product CDC2 Antibody (Phospho-TyrCDC2 Antibody Akt2 Antibody (Phospho-Ser Akt2 Antibody Akt2 Antibody (Ab-474),pAb,Rabbit pAb, Rabbit CDC2 Antibody (Phospho-Thr CDC2 Antibody CDC2 Antibody (Ab-19),pAb,Rabbit CDC2 Antibody (Ab-161),pAb,Rabbit CDC2 Antibody (Ab-15),pAb,Rabbit (Phospho-TyrCaveolin-1 Antibody Caveolin-1 Antibody (Ab-14),pAb,Rabbit CaMKII Antibody (Ab-286),pAb,Rabbit 69 474 112 ), pAb,Rabbit 450 15 161 3 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 14 ), pAb,Rabbit 315/316/312 ), WB, IHC ELISA, WB WB, IHC,IF ELISA, WB ELISA, WB,IHC WB, IHC,IF WB, IHC WB WB, IHC IHC WB, IF WB, IHC,IF WB, IF WB WB, IF IHC, IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC IHC, IF IHC IHC IHC, IF WB, IHC,IF Applications Human NA Human Human, mouse* Human, mouse* Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human, mouse Human, mouse Human, mouse,rat Human, mouse Human, mouse,rat Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human Human Species Reactivity Quantity 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00544 A00892 A01254 A01277 A01239 A00369 A00447 A00524 A00374 A01295 A00599 A00565 A00394 A00413 A00515 A00566 A00514 A00295 A00311 A00310 A00309 A00385 A00441 A01217 A01227 A01252 A01291 A01293 Cat. No. www.genscript.com Price $225 $225 $225 $225 $225 $225 $225 $172 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $50 $50 $50 $50 $50 $69 $50 $69 $69 $50 $50 $69 $50 $50 $69 $50 $69 $50 $50 $50 $69 $50 $69 $50 $50 $69 $50
- 148
Primary Antibodies Primary Antibodies - 149 Primary Antibodies Antibodies Integrin Integrin Integrin FAK(Phospho-Tyr Antibody FAK Antibody (Ab-925),pAb,Rabbit FAK Antibody (Ab-861),pAb,Rabbit Ezrin Antibody (Phospho-Thr Ezrin Antibody Ezrin Antibody (Ab-567),pAb,Rabbit Ezrin Antibody (Ab-353),pAb,Rabbit Ephrin-B2 Antibody (Ab-330),pAb,Rabbit Ephrin-B2 Antibody (Ab-316),pAb,Rabbit Doublecortin Antibody, pAb,Rabbit Ezrin Antibody (Phospho-TyrEzrin Antibody ICAM-1 Antibody (Phospho-TyrICAM-1 Antibody ICAM-1 Antibody (Ab-512),pAb,Rabbit GFAP Antibody, mAb,Mouse Integrin (Phospho-Ser G3BP-1 Antibody G3BP-1 Antibody (Ab-232),pAb,Rabbit Fibrillarin Antibody, mAb,Mouse FAK(Phospho-Tyr Antibody Connexin 43 Antibody (Phospho-Ser Product Name Internexin/NF66 Antibody, pAb,Chicken Internexin/NF66 2 Antibody, mAb,Mouse Internexin/NF66 1 Antibody, mAb,Mouse Cortactin Antibody (Phospho-TyrCortactin Antibody Cortactin Antibody (Ab-466),pAb,Rabbit Cortactin Antibody (Ab-421),pAb,Rabbit pAb, Rabbit β β β β 3 Antibody (Phospho-Tyr3 Antibody 3 Antibody (Ab-785),pAb,Rabbit 3 Antibody (Ab-773),pAb,Rabbit 3 Antibody (phospho-Tyr3 Antibody 925 861 353 567 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 512 232 466 ), pAb,Rabbit 785 ), pAb,Rabbit 773 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 367 ), Your Innovation PartnerinDrugDiscovery! WB, IF WB, IHC,IF WB, IF, ICC WB WB, IHC WB WB, IHC WB WB WB, IF WB, IHC,IF WB, IHC WB, IF WB, IF WB WB, IHC,IF WB, IHC WB, IHC WB WB WB WB, IF WB ELISA, WB,IHC WB WB, IHC IHC WB, IHC Applications C. elegans Human, rat,pl Human, mouse,rat Human, mouse,rat Human Human Human, mouse Human, mouse,rat Human Human Human Human Human, mouse,rat.* Human, mouse Human, mouse Human, mouse Human, mouse,rat Species Reactivity other mammals Human, rat,mouse,cat, other mammals Human, rat,mouse,cat, other mammals Human, rat,mouse,cat, Human, mouse Human,mouse Human Human Human Human avian speciestested rat, allothermammalian, Human, cow, pig,mouse, Human, mouse,rat Human , S. pombe ant, drosophila , Quantity 100 100 200 200 200 200 200 200 100 100 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00150 A00148 A00147 A00663 A00288 A01167 A00386 A01020 A01038 A00085 A00364 A00404 A00153 A00387 A00287 A00434 A00350 A00291 A00334 A00457 A00392 A00670 A00669 A01303 A00644 A00520 A00521 A00541 Cat. No. Price $204 $204 $204 $225 $225 $225 $259 $225 $204 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $69 $69 $50 $50 $69 $50 $69 $50 $69 $69 $50 $50 $69 $69 $50 $50 $50 $50 $50 $69 $50 $50 $69 Merlin Antibody (Phospho-Ser Merlin Antibody Merlin Antibody (Ab-518),pAb,Rabbit (Phospho-Thr MEK2 Antibody MEK2 Antibody (Ab-394),pAb,Rabbit MEK1 Antibody (Phospho-Thr MEK1 Antibody (Phospho-Ser MEK1 Antibody MEK1 Antibody (Phospho-Ser MEK1 Antibody MEK1 Antibody (Ab-291),pAb,Rabbit MEK1 Antibody (Ab-221),pAb,Rabbit MEK1 Antibody (Ab-217),pAb,Rabbit MARCKS Antibody, pAb,Rabbit (Phospho-Ser MARCKS Antibody MARCKS Antibody (Ab-162),pAb,Rabbit MARCKS Antibody (Ab-158),pAb,Rabbit MAP2 Antibody, pAb,Chicken Keratin 18 Antibody (Phospho-Ser Internexin/NF66 Antibody, pAb,Rabbit Product Name (Phospho-Ser Myosin LightChain2 Antibody Myosin LightChain2 Antibody (Ab-18),pAb,Rabbit Muscleblind Antibody, mAb,Mouse p44/42 MAP Kinase Antibody (Ab-204),pAb,Rabbit p44/42 MAP Kinase Antibody (Ab-202),pAb,Rabbit NF-M Antibody, pAb,Rabbit NF-M Antibody, pAb,Chicken NF-M Antibody, mAb,Mouse NF-L Antibody, pAb,Rabbit NF-L Antibody, pAb,Chicken NF-L Antibody, mAb,Mouse NF-H Antibody, pAb,Rabbit NF-H Antibody, pAb,Chicken NF-H Antibody, mAb,Mouse 18 ), pAb,Rabbit 394 291 518 221 217 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 158 33 ), pAb,Rabbit ), pAb,Rabbit WB WB WB, IF, ICC WB, IF IF, Immunoblotting WB, IF, ICC WB, IF WB, IF ELISA, WB,IF ELISA, WB,IF WB, IF IHC WB, IF WB, IF, ICC WB, IF WB, IHC WB, IHC,IF WB, IHC WB WB, IHC,IF IHC WB, IHC WB, IHC WB, IHC,IF WB, IF, ICC WB, IF WB WB, IF WB, IF WB, IHC WB, IF Applications Human, mouse Human cat, chicken Human, rat,mouse, cat, chicken Human, rat,mouse, cat, chicken Human, rat,mouse, cat, chicken Human, rat,mouse, cat, chicken Human, rat,mouse, cat, chicken Human, rat,mouse, A varietyofspecies cat, chicken Human, rat,mouse, A varietyofspecies Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human NA Human, mouse,rat Human Human, mouse bovine Human, rat,mouse, Human other mammals Human, rat,mouse,cat, Species Reactivity Quantity 200 100 100 200 100 200 100 200 100 100 100 100 100 100 100 100 100 100 200 100 100 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00562 A00564 A00144 A00146 A00145 A00138 A00140 A00139 A00135 A00136 A00137 A01180 A00597 A00154 A00549 A00533 A00217 A00211 A00571 A00351 A00497 A00510 A00452 A01041 A00155 A00570 A00536 A00511 A00156 A01033 A00149 Cat. No. www.genscript.com Price $172 $225 $204 $204 $204 $204 $204 $204 $204 $204 $204 $172 $204 $225 $225 $225 $225 $225 $204 $172 $225 $204 $204 $311 $311 $311 $311 $311 $311 $311 $311 $50 $69 $69 $50 $69 $50 $69 $69 $69 $50 $50 $50 $69 $50 $69
- 150
Primary Antibodies Primary Antibodies - 151 Primary Antibodies Antibodies Paxillin Antibody (Phospho-TyrPaxillin Antibody Paxillin Antibody (Ab-31),pAb,Rabbit Paxillin Antibody (Ab-118), pAb,Rabbit pAb, Rabbit PAK1/PAK2/PAK3(Ab-423/402/421), Antibody PKC PKC PKC PKC PKC PKC PKC PKC PKC (Phospho-TyrPaxillin Antibody PKC PKC PKC p44/42 MAP Kinase Antibody (Phospho-Thr Product PDK1 Antibody (Phospho-Ser PDK1 Antibody PDK1 Antibody (Ab-241),pAb,Rabbit PKC PKC Peripherin Antibody, pAb,Rabbit Peripherin 2 Antibody, mAb,Mouse Peripherin 1 Antibody, mAb,Mouse Peptidylprolyl Isomerase Antibody, pAb,Chicken PAK1(Phospho-Thr Antibody PAK1 Antibody (Ab-212),pAb,Rabbit pAb, Rabbit p44/42 MAP Kinase Antibody (Phospho-Tyr pAb, Rabbit θ θ θ η ζ δ β β β δ δ γ α α Antibody, pAb,Rabbit Antibody, pAb,Rabbit Antibody (Phospho-Ser Antibody Antibody (Ab-695),pAb,Rabbit Antibody (Ab-676),pAb,Rabbit Antibody, pAb,Rabbit Antibody, pAb,Rabbit Antibody (Phospho-Ser Antibody Antibody (Ab-645),pAb,Rabbit Antibody (Ab-641),pAb,Rabbit Antibody (Phospho-Thr Antibody 2 Antibody, pAb,Rabbit / Antibody, pAb,Rabbit β 2 Antibody (Phospho-Thr 2 Antibody 212 641 676 241 645 31 118 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 638/641 ), pAb,Rabbit 204 202 ), ), Your Innovation PartnerinDrugDiscovery! WB, IHC,IF WB, IHC WB, IHC,IF ELISA, WB ELISA, WB ELISA, WB WB, IHC WB, IHC,IF WB ELISA, WB WB, IHC,IF WB, IHC,IF ELISA, WB ELISA, WB WB, ICC WB, IF WB, ICC WB, IF, ICC WB, IHC,IF WB, IHC,IF WB WB, IHC WB, IHC WB, IHC IHC, IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF Applications Human, mouse,rat Human Human Human Human Human Human, mouse,rat Human NA Human Human, mouse,rat Human Human, mouse Human, mouse mouse Human, rat,rabbit,cat, cat, mouse Human, rat,rabbit, Human, rat,cat,mouse NA Human, mouse,rat Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Species Reactivity Quantity 100 200 200 200 200 200 200 200 200 200 200 200 200 200 100 100 100 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00579 A00656 A00508 A00906 A00908 A00905 A00576 A00509 A00904 A00903 A00654 A00655 A00913 A00901 A00141 A00143 A00142 A00151 A00207 A00208 A00335 A00379 A00456 A00409 A01040 A00650 A00651 A00526 A00525 Cat. No. $225 $225 $225 $225 $225 Price $311 $311 $225 $225 $225 $225 $225 $204 $204 $204 $204 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $69 $50 $50 $50 $50 $50 $69 $50 $50 $50 $69 $50 $69 $50 $69 $50 $69 $69 $50 $50 $50 $69 $50 $69 $69 Synapsin Antibody (Phospho-Ser Synapsin Antibody Synapsin Antibody (Ab-9),pAb, Rabbit Stathmin1 Antibody (Ab-62), pAb,Rabbit Stathmin 1 Antibody (Phospho-Ser Stathmin 1 Antibody (Phospho-Ser Src Antibody (Phospho-TyrSrc Antibody Src Antibody (Ab-529),pAb,Rabbit VASP Antibody (Ab-239), pAb,Rabbit VASP Antibody (Ab-157), pAb,Rabbit Ubiquitin Antibody, pAb,Rabbit Ubiquitin Antibody, mAb,Mouse Rabbit Synaptotagmin I/II Antibody (Ab-202/199),pAb, (Phospho-TyrPyk2 Antibody Pyk2 Antibody (Ab-402),pAb,Rabbit PKD/PKC PKC PKC PKC Product PKD/PKC PKD/PKC PKD/PKC Stathmin 1 Antibody (Phospho-Ser Stathmin 1 Antibody (Ab-38),pAb,Rabbit Stathmin 1 Antibody (Ab-25),pAb,Rabbit Stathmin 1 Antibody (Ab-16),pAb,Rabbit Raf-1 Antibody (Phospho-Ser Raf-1 Antibody Raf1 Antibody (Ab-338),pAb,Rabbit Raf-1 Antibody (Ab-259),pAb,Rabbit Rac1 Antibody (Ab-71),pAb,Rabbit μ ι θ / λ Antibody (Phospho-Ser Antibody Antibody, pAb,Rabbit Antibody, pAb,Rabbit μ μ μ μ Antibody (Phospho-Ser Antibody Antibody (Ab-738),pAb,Rabbit Antibody (Phospho-Ser Antibody Antibody (Ab-910),pAb,Rabbit 529 402 ), pAb,Rabbit 259 695 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 9 ), pAb,Rabbit 38 25 16 910 738 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit WB, IHC WB, IF WB, IF IF WB, IF WB, IF WB WB, IHC WB, IHC WB, IHC IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IF WB, IHC,IF WB, IHC,IF WB WB, IF WB WB, IF ELISA, WB ELISA, WB IHC Applications Human, mouse Human NA NA Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human Human, mouse,rat Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human Human, mouse Human Human, mouse,rat Species Reactivity Quantity 100 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00451 A00458 A00133 A00134 A01170 A00551 A00531 A01258 A00324 A00326 A00505 A00463 A00462 A00573 A00358 A00449 A00215 A01153 A00209 A00660 A00498 A00586 A01021 A00481 A00605 A00606 A00909 A00910 A00657 Cat. No. www.genscript.com Price $225 $225 $204 $204 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $50 $50 $50 $69 $50 $50 $69 $31 $69 $69 $50 $50 $50 $69 $50 $69 $50 $50 $50 $69 $50 $69 $69 $50 $50 $50 $50 $69
- 152
Primary Antibodies Primary Antibodies - 153 Primary Antibodies Antibodies NA: Not Available. *: This producthasnotbeen Vav(Phospho-Tyr Antibody Vav Antibody (Ab-174),pAb,Rabbit VASP(Phospho-Ser Antibody VASP(Phospho-Ser Antibody Product α α Vimentin Antibody, pAb,Rabbit Vimentin Antibody, pAb,Chicken -Catenin Antibody (Phospho-Ser -Catenin Antibody -Catenin Antibody (Ab-641),pAb,Rabbit 174 tested ), pAb,Rabbit 239 157 ), pAb,Rabbit ), pAb,Rabbit 641 withreactivitytootherspecies. ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! WB WB ELISA,WB,IHC IF WB WB WB,IHC WB,IHC Applications Human Human Human* Human, mouse,rat Human, mouse,rat Human Human, mouse Human, mouse Species Reactivity Quantity 200 200 200 100 200 200 200 200 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g A00923 A00931 A01189 A00152 A00368 A00448 A00353 A00332 Cat. No. Price $225 $225 $204 $225 $311 $311 $311 $311 $69 $50 $50 $69 $50 $69 $69 Insulin/Glucose an energysource,wheninsulinisabsentorinastateof is nottakenupbybodycellsandthebeginstousefatas muscle. The useoffatasenergysourceisstopped.Glucose glucose fromtheblood,storingitasglycogeninliverand causes cellsintheliver, muscle,andfattissuetotakeup other bodyfunctions,suchasvascularcompliance,insulin As ahormonethathasextensiveeffects onmetabolismand GLUT-4 Glucose Apoptosis PKC GLUT-4 BAD λ / ζ PDK1/2 PTEN PIP3 GSK-3 AKT AKT AKT P13K Receptor Insulin Growth andDifferentiation PKC Synthesis Glycogen λ IRS / ζ Insulin be usedinyourinsulinandglucoseresearch. fails. GenScriptoffers awideselectionofantibodiesthatcan the body. Diabetesmellitusresultswhencontrolofinsulinlevel body systems.Ithasseveralotheranaboliceffects throughout mechanism. Itsstatusisalsousedasacontrolsignaltoother shortage. The levelofinsulinisacentralmetaboliccontrol Shc GRB2 PKC IRS1 MTOR θ Fyn GRB10 ERK Jnk TNFR1 IKK TNF MEK1/2 c-Raf ERK SDS Ras MEMBRANE www.genscript.com NUCLEUS
- 154
Primary Antibodies Primary Antibodies - 155 Primary Antibodies Antibodies Product Overview: rdc plctosCat. No. Product Applications AFX Antibody(Phospho-Ser 4E-BP1 Antibody(Phospho-Thr Akt Antibody(Phospho-Ser Akt Antibody(Ab-473),pAb,Rabbit Akt Antibody(Ab-308),pAb,Rabbit Akt Antibody(Phospho-Thr Akt Antibody(Phospho-Ser AMPK1/AMPK2 Antibody(Phospho-Ser AMPK1 Antibody(Phospho-Thr Akt2 Antibody(Phospho-Ser Akt2 Antibody(Ab-474),pAb,Rabbit BIM Antibody(Phospho-Ser BIM Antibody(Ab-69),pAb,Rabbit BCL-XL Antibody(Ab-62),pAb,Rabbit BAD Antibody(Phospho-Ser BAD Antibody(Phospho-Ser 4E-BP1 Antibody(Phospho-Thr Caveolin-1 Antibody(Ab-14),pAb,Rabbit AKT1 Antibody(Phospho-Thr AKT1 Antibody(Ab-450),pAb,Rabbit (Phospho-Tyr AKT1/AKT2/AKT3 Antibody pAb, Rabbit AKT1/AKT2/AKT3 Antibody(Ab-315/316/312), AKT1/AKT2 Antibody(Ab-308/309),pAb,Rabbit BAD Antibody(Phospho-Ser BAD Antibody(Ab-155),pAb,Rabbit BAD Antibody(Ab-136),pAb,Rabbit BAD Antibody(Ab-112),pAb,Rabbit pAb, Rabbit 315/316/312 ), pAb,Rabbit 308 473 473 69 197 474 155 136 112 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 450 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 174 45 36 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 485/491 ), Your Innovation PartnerinDrugDiscovery! WB IHC, IF WB, IHC WB WB, IHC IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF IHC WB, IHC WB, IHC IHC, IF IHC IHC IHC, IF WB, IHC,IF WB, IHC,IF WB, IHC ELISA, WB WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC Species Reactivity Human, mouse Human, mouse,rat Human, mouse Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human Human Human, mouse,rat Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00413 A00566 A00514 A00308 A00296 A01156 A00295 A00311 A00310 A00309 A00345 A00665 A00385 A00441 A01217 A01227 A01252 A01291 A01293 A00275 A00272 A00965 A00301 A00304 A00372 A00328 A00329 $225 $225 $311 $311 $311 $225 $311 $225 $225 $311 $311 $311 $225 $225 $225 $311 $311 $311 $225 $311 $225 $225 $311 $225 $311 $311 $311 Price $69 $50 $50 $69 $69 $69 $50 $69 $50 $50 $69 $69 $69 $50 $50 $50 $69 $69 $69 $50 $69 $50 $50 $69 $50 $69 $69 rdc plctosCat. No. Product Applications GSK3 GSK3 IKK IGF-1R Antibody(Ab-1346),pAb,Rabbit eIF4E Antibody(Phospho-Ser eIF4E Antibody(Ab-209),pAb,Rabbit GSK3 GSK3 eNOS Antibody(Phospho-Ser eNOS Antibody(Ab-1177),pAb,Rabbit FKHRL1 Antibody(Phospho-Ser FKHR Antibody(Phospho-Ser IRS-1 Antibody(Phospho-Ser IRS-1 Antibody(Phospho-Ser FKHR Antibody(Phospho-Ser FKHR Antibody(Ab-319),pAb,Rabbit FKHR Antibody(Ab-256),pAb,Rabbit Gab1 Antibody(Phospho-Tyr Gab1 Antibody(Ab-627),pAb,Rabbit Caveolin-1 Antibody(Phospho-Tyr IRS-1 Antibody(Phospho-Ser IRS-1 Antibody(Ab-639),pAb,Rabbit IRS-1 Antibody(Ab-636),pAb,Rabbit IRS-1 Antibody(Ab-312),pAb,Rabbit IRS-1 Antibody(Ab-307),pAb,Rabbit GSK3 eIF2 eIF2 α α α Antibody(Phospho-Thr Antibody(Phospho-Ser Antibody(Ab-51),pAb,Rabbit β β α α β Antibody(Ab-9),pAb,Rabbit Antibody(Phospho-Ser Antibody(Phospho-Tyr Antibody(Phospho-Ser Antibody(Ab-21),pAb,Rabbit 23 627 639 636 307 51 209 319 256 1177 ), pAb,Rabbit 216 ), pAb,Rabbit 9 21 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 253 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 14 ), pAb,Rabbit ), pAb,Rabbit WB, IHC WB, IHC IHC WB, IF WB, IHC,IF WB IHC, IF WB, IHC WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB, IF WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF IHC, IF WB, IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IF Species Reactivity Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Quantity 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01027 A00503 A00506 A01042 A00575 A01151 A00572 A00356 A00927 A01031 A00193 A00196 A00216 A00210 A00568 A00512 A00354 A00373 A00395 A00444 A00427 A01158 A01152 A00504 A00574 A00559 A00518 A00394 www.genscript.com $311 $311 $311 $225 $225 $225 $172 $311 $225 $311 $311 $225 $311 $225 $311 $225 $311 $311 $311 $225 $225 $311 $225 $311 $225 $311 $225 $311 Price $69 $69 $69 $50 $50 $50 $69 $50 $69 $69 $50 $69 $50 $69 $50 $69 $69 $69 $50 $50 $69 $50 $69 $50 $69 $50 $69
- 156
Primary Antibodies Primary Antibodies - 157 Primary Antibodies Antibodies rdc plctosCat. No. Product Applications mTOR Antibody(Phospho-Ser mTOR Antibody(Ab-2448),pAb,Rabbit MEK2 Antibody(Phospho-Thr MEK2 Antibody(Ab-394),pAb,Rabbit p44/42 MAPKinaseAntibody(Phospho-Thr p44/42 MAPKinaseAntibody(Ab-204),pAb,Rabbit Rabbit p44/42 MAPKinaseAntibody(Ab-202),pAb, MEK1 Antibody(Phospho-Thr MEK1 Antibody(Phospho-Ser PKC PKC I p70 S6KinaseAntibody(Phospho-Ser p70 S6KinaseAntibody(Ab-424),pAb,Rabbit p70 S6KinaseAntibody(Ab-421),pAb,Rabbit p70 S6KinaseAntibody(Ab-411),pAb,Rabbit pAb, Rabbit PP2A- I I p44/42 MAPKinaseAntibody(Phospho-Tyr pAb, Rabbit MEK1 Antibody(Phospho-Ser MEK1 Antibody(Ab-291),pAb,Rabbit MEK1 Antibody(Ab-221),pAb,Rabbit MEK1 Antibody(Ab-217),pAb,Rabbit PDK1 Antibody(Phospho-Ser PDK1 Antibody(Ab-241),pAb,Rabbit Rabbit p70 S6KinaseAntibody(Phospho-Thr Rabbit p70 S6KinaseAntibody(Phospho-Ser Rabbit κ κ κ B- B- B- α α α β β Antibody(Phospho-Tyr Antibody(Phospho-Ser Antibody(Ab-32,36),pAb,Rabbit Antibody(Phospho-Thr Antibody(Ab-641),pAb,Rabbit α Antibody,pAb,Rabbit 42 32,36 641 241 394 291 221 217 ), pAb,Rabbit 2448 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 421 424 411 ), pAb, ), pAb, ), pAb, 204 202 ), ), Your Innovation PartnerinDrugDiscovery! WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB WB IHC, IF WB, IHC,IF WB, IHC,IF WB, IHC WB WB, IHC,IF IHC WB, IHC WB, IHC WB, IHC,IF IHC IHC, IF WB, IHC,IF Species Reactivity Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human, mouse,rat Human, mouse Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human, mouse,rat Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 100 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01226 A00654 A00655 A00207 A00208 A00539 A00561 A00554 A00516 A00550 A00527 A00526 A00525 A00562 A00564 A00643 A01154 A00217 A00211 A00571 A00351 A00497 A00510 A00452 A01041 A00349 A00359 A00609 $225 $311 $225 $311 $225 $311 $311 $311 $225 $225 $172 $311 $311 $172 $225 $311 $225 $311 $225 $311 $311 $311 $225 $225 $225 $311 $311 $225 Price $50 $69 $50 $69 $50 $69 $69 $69 $50 $50 $69 $69 $50 $69 $50 $69 $50 $69 $69 $69 $50 $50 $50 $69 $69 $50 Jak/Stat activated. Although Statswereoriginallydiscoveredas targets where geneexpressionmodificationbyStatproteinsis carried bytheseextracellularpolypeptidestothecellnucleus, of Transcription (Stats),thepathwaytransducessignal Janus kinases(Jaks)or/andSignal Transducers and Activators cellular responsestocytokinesandgrowthfactors.Employing The Jak/Statsignalingpathwayisinvolvedintheregulationof rdc plctosCat. No. Product Applications PTEN Antibody(Phospho-Ser PTEN Antibody(Phospho-Ser SHP-1 Antibody(Phospho-Tyr SHP-1 Antibody(Ab-536),pAb,Rabbit Raf-1 Antibody(Phospho-Ser Raf1 Antibody(Ab-338),pAb,Rabbit Raf-1 Antibody(Ab-259),pAb,Rabbit pAb, Rabbit Shc1 Antibody(Phospho-Tyr Shc1 Antibody(Ab-427),pAb,Rabbit pAb, Rabbit S6 RibosomalProteinAntibody(Phospho-Ser Rabbit S6 RibosomalProteinAntibody(Ab-235),pAb, NA: NotAvailable. *: Thisproducthasnotbeentestedwithreactivitytootherspecies. PTEN Antibody(Phospho-Ser PTEN Antibody(Ab-380,382,383),pAb,Rabbit PTEN Antibody(Ab-370),pAb,Rabbit 427 259 380 380 370 536 ), pAb,Rabbit ), pAb,Rabbit , Thr ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 382,383 ), 235 ), IHC, IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IF WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC,IF IHC, IF WB, IHC,IF WB, IHC WB, IHC Species Reactivity Human, mouse,rat Human Human Human Human, mouse,rat Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human be usedinyourJak/Statsignalingpathwayresearch. cells. GenScriptoffers awideselectionofantibodiesthatcan is particularlyimportantinhematopoiesis-productionofblood processes ofcellproliferation,differentiation, andapoptosis.It central roleindicidingprincipalcellfateandregulatingthe activate themindependentofJaks. This pathwayplaysa of Jaks,ithasnowbecomeapparentthatcertainstimulican Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00969 A00970 A01035 A00930 A00315 A00465 A00215 A01153 A00209 A00277 A00218 A00290 A00302 A00303 www.genscript.com $311 $311 $311 $225 $225 $311 $225 $311 $225 $311 $225 $311 $225 $225 Price $69 $69 $69 $50 $50 $69 $50 $69 $50 $69 $50 $69 $50 $50
- 158
Primary Antibodies Primary Antibodies - 159 Primary Antibodies Antibodies Product Overview: Product Estrogen Receptor- Akt Antibody(Phospho-Thr Akt Antibody(Phospho-Ser Estrogen Receptor- CaMKII Antibody(Phospho-Thr Akt Antibody(Phospho-Ser Akt Antibody(Ab-473),pAb,Rabbit Akt Antibody(Ab-308),pAb,Rabbit Akt2 Antibody(Phospho-Ser Akt2 Antibody(Ab-474),pAb,Rabbit AKT1 Antibody(Phospho-Thr AKT1 Antibody(Ab-450),pAb,Rabbit AKT1/AKT2/AKT3 Antibody(Phospho-Tyr AKT1/AKT2/AKT3 Antibody(Ab-315/316/312),pAb,Rabbit AKT1/AKT2 Antibody(Ab-308/309),pAb,Rabbit α α Antibody(Phospho-Ser Antibody(Phospho-Ser 308 473 473 474 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 450 ), pAb,Rabbit 286 ), pAb,Rabbit ), pAb,Rabbit MTOR PI3K AKt 315/316/312 106 104 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! P P Cytokines STAT P P P JAK P ISRE/GAS STAT STAT plctosCat.No. Applications WB, IHC,IF IHC WB WB, IHC WB, IHC IHC, IF IHC IHC IHC, IF WB, IHC,IF WB, IHC,IF ELISA, WB WB, IHC WB, IHC WB, IHC P Tyk2 P P P STAT P P Human, mouse Human, mouse Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human Species Reactivity Erk Raf NUCLEUS MEMBRANE Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00297 A00479 A00563 A00385 A00441 A01217 A01227 A01252 A01291 A01293 A00275 A00965 A00272 A00301 A00304 $225 $225 $311 $311 $311 $311 $225 $311 $225 $225 $311 $225 $311 $311 $311 Price $69 $50 $50 $69 $69 $69 $69 $50 $69 $50 $50 $69 $50 $69 $69 Product MEK2 Antibody(Phospho-Thr MEK2 Antibody(Ab-394),pAb,Rabbit mTOR Antibody(Phospho-Ser mTOR Antibody(Ab-2448),pAb,Rabbit JAK2 Antibody(Phospho-Tyr JAK2 Antibody(Phospho-Tyr Jak2 Antibody(Ab-570),pAb,Rabbit JAK2 Antibody(Ab-221),pAb,Rabbit JAK2 Antibody(Ab-1007),pAb,Rabbit p44/42 MAPKinaseAntibody(Phospho-Thr Rabbit p44/42 MAPKinaseAntibody(Ab-204),pAb, Rabbit p44/42 MAPKinaseAntibody(Ab-202),pAb, Raf-1 Antibody(Phospho-Ser Raf1 Antibody(Ab-338),pAb,Rabbit Raf-1 Antibody(Ab-259),pAb,Rabbit pAb, Rabbit STAT1 Antibody(Phospho-Ser STAT1 Antibody(Ab-727),pAb,Rabbit STAT1 Antibody(Ab-701),pAb,Rabbit STAT3 Antibody(Phospho-Ser STAT3 Antibody(Ab-727),pAb,Rabbit Stat2 Antibody(Ab-690),pAb,Rabbit p44/42 MAPKinaseAntibody(Phospho-Tyr pAb, Rabbit Estrogen Receptor- STAT1 Antibody(Phospho-Tyr JAK1 Antibody(Phospho-Tyr JAK1 Antibody(Ab-1022),pAb,Rabbit pAb, Rabbit Estrogen Receptor- pAb, Rabbit α α Antibody(Phospho-Ser Antibody(Phospho-Ser 221 1007 1022 259 394 2448 701 727 727 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 204 202 167 118 ), ), ), ), plctosCat.No. Applications WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC,IF WB WB IHC, IF WB, IHC,IF WB, IHC,IF WB, IHC IHC WB, IHC IHC IHC WB WB, IHC WB, IHC WB, IHC,IF WB, IHC,IF Species Reactivity Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human, mouse Human Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse Human, mouse,rat Human Human, mouse Human, mouse Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00251 A00278 A01263 A00249 A00347 A00454 A00274 A00215 A01153 A00209 A00526 A00525 A00562 A00564 A00643 A01154 A00217 A00211 A00362 A00360 A01259 A00419 A01185 A00363 A00418 A00299 A00298 www.genscript.com $311 $225 $225 $311 $311 $225 $225 $311 $225 $225 $311 $311 $172 $225 $311 $225 $311 $225 $311 $311 $225 $225 $225 $311 $225 $311 $311 Price $69 $50 $50 $69 $69 $50 $50 $69 $50 $50 $69 $69 $50 $69 $50 $69 $50 $69 $69 $50 $50 $50 $69 $50 $69 $69
- 160
Primary Antibodies Primary Antibodies - 161 Primary Antibodies Antibodies Kinase/Phosphatases Product Overview: If aproteinisphosphorylatedbykinase,thephosphategroup phosphatase. an enzymethatremovesphosphategroupsisknownasa molecules, suchas ATP, tospecificsubstrates.Onthecontrary, which aphosphategroupistransferedfromhigh-energydonor A kinaseisatypeofenzymeinvolvedinphosphorylationby NA: NotAvailable. *: Thisproducthasnotbeentestedwithreactivitytootherspecies. rdc plctosCat. No. Product Applications AuroraA Antibody(Phospho-Thr Akt Antibody(Phospho-Ser Bcr Antibody(Phospho-Tyr Bcr Antibody(Ab-177),pAb,Rabbit ABL1/2 Antibody(Phospho-Tyr ABL1/2 Antibody(Ab-393/429),pAb,Rabbit AMPK1 Antibody(Phospho-Thr AMPK1 Antibody(Ab-174),pAb,Rabbit rdc plctosCat. No. Product Applications STAT6 Antibody(Phospho-Thr STAT6 Antibody(Ab-645),pAb,Rabbit STAT6 Antibody(Ab-641),pAb,Rabbit TYK2 Antibody(Phospho-Tyr TYK2 Antibody(Ab-1054),pAb,Rabbit STAT5A Antibody(Phospho-Ser STAT5A Antibody(Ab-780),pAb,Rabbit STAT5A Antibody(Ab-694),pAb,Rabbit STAT4 Antibody(Phospho-Tyr STAT4 Antibody(Ab-693),pAb,Rabbit STAT6 Antibody(Phospho-Tyr STAT5A Antibody(Phospho-Tyr 177 473 ), pAb,Rabbit ), pAb,Rabbit 1054 641 693 393/429 645 174 288 694 ), pAb,Rabbit 780 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! WB, IHC WB, IF IHC IHC WB, IHC,IF ELISA, WB IHC, IF IHC, IF WB IHC WB, IHC IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC Species Reactivity Human, mouse,rat Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human in yourkinaseandphosphataseresearch. GenScript offers awideselectionofantibodiesthatcanbeused phosphatases regulateallaspectsofcellularfunction. constant activatedorinhibitedstate.Kinasesand hydrolysis. Ifnot,thephosphorylatedproteinwouldstayina must eventuallyberemovedbyaphosphatasethrough Species Reactivity Human, mouse Human Human Human Human Human, mouse Human Human Quantity Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01184 A00416 A00263 A00478 A00284 A00282 A00253 A00254 A00281 A00280 A00252 A00279 A00496 A00589 A01292 A00665 A00664 A00959 A01272 A01262 $311 $225 $311 $311 $225 $225 $311 $225 Price $311 $225 $311 $311 $225 $225 $311 $311 $225 $225 $311 $225 Price $69 $50 $69 $69 $50 $50 $69 $50 $69 $50 $69 $69 $50 $50 $69 $69 $50 $50 $69 $50 rdc plctosCat. No. Product Applications CDK6 Antibody(Phospho-Tyr CDK6 Antibody(Ab-24),pAb,Rabbit CDK6 Antibody(Ab-13),pAb,Rabbit cdc2 Antibody(Ab-19),pAb,Rabbit cAMP Antibody,pAb,Rabbit HER2 Antibody(Ab-877),pAb,Rabbit HER2 Antibody(Ab-1248),pAb,Rabbit HER2 Antibody(Ab-1221,1222),pAb,Rabbit EGFR Antibody(Phospho-Ser EGFR Antibody(Ab-869),pAb,Rabbit EGFR Antibody(Ab-678),pAb,Rabbit EGFR Antibody(Ab-1197),pAb,Rabbit EGFR Antibody(Ab-1172),pAb,Rabbit EGFR Antibody(Ab-1110),pAb,Rabbit EGFR Antibody(Ab-1092),pAb,Rabbit EGFR Antibody(Ab-1070),pAb,Rabbit Chk2 Antibody(Ab-33),pAb,Rabbit EGFR Antibody(Phospho-Thr CaMKII Antibody(Phospho-Thr GSK3 FAK Antibody(Phospho-Tyr EGFR Antibody(Phospho-Tyr EGFR Antibody(Phospho-Thr EGFR Antibody(Phospho-Tyr EGFR Antibody(Phospho-Tyr EGFR Antibody(Phospho-Tyr EGFR Antibody(Phospho-Tyr β Antibody(Phospho-Tyr 397 24 869 1197 1172 1110 1092 693 678 1070 ), pAb,Rabbit 216 ), pAb,Rabbit 286 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IF WB WB, IHC WB, IHC WB WB, IHC WB WB WB, IHC WB, IHC WB WB WB WB, IHC WB, IHC WB, IHC IHC IHC, IF IHC IHC, IF IHC ELISA WB Species Reactivity Human Human Human Human Human, rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human Human Human Human Human Human Human Human Human NA Human, mouse,rat Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g l l A00325 A00331 A00327 A01031 A01142 A00271 A00502 A00501 A00548 A00361 A00668 A00667 A00320 A00577 A00666 A00578 A00661 A00538 A00346 A00344 A01261 A01274 A01265 A01264 A01295 A00614 A00563 www.genscript.com $225 $225 $225 $225 $225 $225 $225 $311 $225 $225 $225 $400 $311 $225 $225 $225 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $225 Price $50 $50 $50 $50 $50 $50 $50 $69 $50 $50 $50 $85 $69 $50 $50 $50 $69 $69 $69 $69 $69 $69 $69 $69 $69 $69 $50
- 162
Primary Antibodies Primary Antibodies - 163 Primary Antibodies Antibodies Product Applications IGF-1R Antibody(Phospho-Tyr PKC PKC PKA RI PKA RII PKA RII pAb, Rabbit PAK1/PAK2/PAK3 Antibody(Ab-423/402/421), mTOR Antibody(Ab-2448),pAb,Rabbit MEK1 Antibody(Ab-217),pAb,Rabbit Rabbit PKC Rabbit HER3/ErbB3 Antibody(Phospho-Tyr HER3/ErbB3 Antibody(Ab-1328),pAb,Rabbit HER2 Antibody(Phospho-Tyr HER2 Antibody(Phospho-Tyr HER2 Antibody(Phospho-Tyr IGF-1R Antibody(Phospho-Tyr IGF-1R Antibody(Ab-1346),pAb,Rabbit IGF-1R Antibody(Ab-1165,1166),pAb,Rabbit IGF-1R Antibody(Ab-1161),pAb,Rabbit Rabbit PKC PKC PKC PKC Lck Antibody(Phospho-Tyr Jak2 Antibody(Ab-570),pAb,Rabbit JAK2 Antibody(Ab-1007),pAb,Rabbit Rabbit MAPKAPK-2 Antibody(Phospho-Thr α α α η ζ δ β Antibody,pAb,Rabbit Antibody,pAb,Rabbit Antibody,pAb,Rabbit 2 Antibody,pAb,Rabbit / Antibody,pAb,Rabbit / β β β 2 Antibody(Phospho-Thr 2 Antibody(Thr β α Antibody,pAb,Rabbit Antibody,pAb,Rabbit Antibody,pAb,Rabbit 638/641 394 ), pAb,Rabbit ), pAb,Rabbit 877 1248 1221,1222 1165,1166 1161 ), pAb,Rabbit ), pAb,Rabbit 638/641 ), pAb,Rabbit ), pAb,Rabbit 1328 334 ), pAb, , pAb, ), pAb, ), pAb, Your Innovation PartnerinDrugDiscovery! ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB WB IHC, IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB IHC WB WB, IF WB, IHC,IF WB, IHC WB WB, IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IF Species Reactivity Human Human Human Human Human, mouse Human, mouse Human, mouse Human Human, mouse Human Human, mouse,rat Human Human Human Human, mouse Human Human, mouse Human, mouse,rat Human Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g Cat. No. A00906 A00908 A00905 A00903 A01052 A00913 A00901 A00947 A00949 A00948 A01040 A01154 A01041 A01034 A01024 A01259 A01185 A00376 A00371 A00927 A00383 A00380 A01269 A01255 A00313 A00318 A00314 $225 $225 $225 $225 $225 $311 $225 $225 $225 $225 $225 $225 $225 $311 $311 $225 $225 $311 $311 $225 $225 $225 $311 $225 $311 $311 $311 Price $50 $50 $50 $50 $50 $69 $50 $50 $50 $50 $50 $50 $50 $69 $69 $50 $50 $69 $69 $50 $50 $50 $69 $50 $69 $69 $69 Product Applications VEGFR2 Antibody(Phospho-Tyr VEGFR2 Antibody(Phospho-Tyr VEGFR2 Antibody(Phospho-Tyr VEGFR2 Antibody(Ab-951),pAb,Rabbit VEGFR2 Antibody(Ab-1214),pAb,Rabbit VEGFR2 Antibody(Ab-1175),pAb,Rabbit PLC PLC PLC PKR Antibody(Phospho-Thr Syk Antibody(Phospho-Tyr Syk Antibody(Ab-323),pAb,Rabbit SHP-1 Antibody(Ab-536),pAb,Rabbit SAPK/JNK Antibody(Ab-183),pAb,Rabbit PP2A- PLC PLC PLC- PKR Antibody(Phospho-Thr PKG-2 Antibody,pAb,Rabbit Rabbit PKD/PKC Rabbit NA: NotAvailable. *: Thisproducthasnotbeentestedwith reactivitytootherspecies. PKD/PKC PKC TYK2 Antibody(Phospho-Tyr TrkB Antibody(Phospho-Tyr γ γ γ γ γ ν γ 1 Antibody(Phospho-Tyr 1 Antibody(Ab-783),pAb,Rabbit 1 Antibody(Ab-771),pAb,Rabbit 2 Antibody(Phospho-Tyr 2 Antibody(Ab-753),pAb,Rabbit Antibody,pAb,Rabbit 2 Antibody(Ab-1217),pAb,Rabbit α Antibody,pAb,Rabbit μ μ Antibody(Phospho-Ser Antibody(Phospho-Ser 323 705 451 446 1054 ), pAb,Rabbit 753 783 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 951 1214 1175 ), pAb,Rabbit 910 738 ), pAb,Rabbit ), pAb,Rabbit ), pAb, ), pAb, WB, IHC,IF WB, IHC,IF IHC, IF WB, IHC IHC IHC WB WB IHC, IF IHC, IF WB, IHC,IF WB, IHC WB WB, IF WB, IF IHC WB WB WB, IHC IHC WB, IHC,IF ELISA, WB WB WB, IF ELISA, WB Species Reactivity Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse,rat Human, mouse Human Human Human Human Human Human, mouse,rat Human Human Human, mouse,rat Human Human Human Human Human Human Human, mouse,rat NA Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g Cat. No. A00370 A00367 A00366 A00357 A00355 A00352 A01184 A01186 A01275 A01266 A00970 A01161 A01226 A00659 A00658 A01294 A01022 A01039 A01260 A01030 A00649 A01070 A01021 A00481 A01067 www.genscript.com $311 $311 $311 $225 $225 $225 $311 $311 $311 $225 $225 $225 $225 $311 $225 $225 $311 $225 $225 $311 $311 $225 $311 $311 $225 Price $69 $69 $69 $50 $50 $50 $69 $69 $69 $50 $50 $50 $50 $69 $50 $50 $69 $50 $50 $69 $69 $50 $69 $69 $50
- 164
Primary Antibodies Primary Antibodies - 165 Primary Antibodies Antibodies key roleinregulatingtheimmuneresponsetoinfection. oxidized LDL,andbacterialorviralantigens.NF- such asstress,cytokines,freeradicals,ultravioletirradiation, cell types,NF- that actsasatranscriptionfactor. Foundinalmostallanimal light-chain-enhancer ofactivatedBcells)isaproteincomplex cells) isaproteincomplexthatNF- NF- pathologies. An increasingnumberofdiseasesthenervous therefore fundamentaltotheunderstandingofavarietybrain knowledge ofcellularandmolecularbiologyneuronsis that cancompromisethefunctionofnervoussystem. The unique signalingabilitiesarealsotargetsfordiseaseprocesses The cellularandmolecularmechanismsthatgiveneuronstheir Product Overview: Nuclear Signaling NF- NA: Not Available. *: This producthasnotbeen testedwithreactivitytootherspecies. p35 Antibody, pAb,Rabbit Rabbit Lamin A+CAntibody,pAb, Histone H3 Antibody, pAb,Rabbit HEC1 Antibody, pAb,Rabbit Geminin Antibody, pAb,Rabbit Geminin Antibody, pAb,Rabbit Fibrillarin Antibody, pAb,Rabbit FEN-1 Antibody, pAb,Rabbit FEN-1 Antibody, pAb,Rabbit Product κ B (nuclearfactorkappa-light-chain-enhancerofactivated κ B Pathway κ B isinvolvedincellularresponsestostimuli κ B (nuclearfactorkappa- WB WB WB WB ELISA, WB ELISA, WB WB WB WB Applications Your Innovation PartnerinDrugDiscovery! κ B playsa Mouse, rat* Human, mouse* Human, mouse,rat Human Human* Human* Human* Human* Human, mouse,rat Species Reactivity research. selection ofantibodiesthatcanbeusedinyourNF- synaptic plasticityandmemory. GenScriptoffers awide ment. NF- septic shock,viralinfection,andimproperimmunedevelop- linked tocancer, inflammatoryandautoimmunediseases, Consistent withthisrole,incorrectregulationofNF- nuclear signalingresearch. offers awideselectionofantibodiesthatcanbeusedinyour approaches todiagnoseandtreatthesediseases.GenScript stimulating novelpharmacologicalandmolecularbiological neuronal signalingmolecules. This informationisnow system arebeginningtobeunderstoodasdiscretedisordersof κ B hasalsobeenimplicatedintheprocessesof Quantity 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g Cat. No. A01423 A01455 A01502 A01504 A01251 A01246 A01462 A01421 A01461 κ κ B hasbeen B pathway $225 $225 $225 $225 $225 $225 $225 $225 $225 Price $50 $50 $50 $50 $50 $50 $50 $50 $50 Product Overview: eIF2 eIF2 ATM Antibody (Ab-1981),pAb,Rabbit Product HDAC2 Antibody, pAb,Rabbit GSK3 HDAC2 Antibody (Phospho-Ser HDAC2 Antibody HDAC2 Antibody (Ab-394), pAb,Rabbit GSK3 GSK3 α α Antibody (Phospho-Ser Antibody Antibody (Ab-51),pAb,Rabbit β β β Antibody (Phospho-Tyr Antibody Antibody (Phospho-Ser Antibody Antibody (Ab-9),pAb,Rabbit Processing Proteasomal BAFF/BLys LT, CD40L 51 NF-kB2 216 ), pAb,Rabbit 9 394 ), pAb,Rabbit IKKa p100 ), pAb,Rabbit NIK ), pAb,Rabbit P T23 NF-kB2 S865 P RelB B CellMaturation Lymphogenesis BR3 CD40 LT p52 β R RelB NF-kB2 p52 ELISA, WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB,IF Applications RelB S865 P PIK3 Insulin, Growth factors, S32/36 T23 P AKt etc. IkB FR TNFR GF-Rs P NF-kB2 p50/52 P Ras IKK P α S473 Human* Human, mouse,rat Human Human Human, mouse,rat Human Human, mouse,rat Human Human Species Reactivity Survival, Proliferation Inflammation, ImmuneRegulation α T254/435 S276/468/536 RelA P65/ P IKK P P NF-kB2 p50/52 β P P RelA P65/ MEKK3 IKK S865 α / P β TNF NF-kB2 RelA P65/ Quantity p52 GSK- 200 200 200 200 200 200 200 200 200 3 P 40 40 40 40 40 40 40 40 40 β RIP μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ NF-kB2 S337/893 g g g g g g g g g g g g g g g g g g P p50 /907 P A01178 A01169 A00428 A01031 A00193 A00196 A00559 A00518 A01222 Cat. No. P www.genscript.com $225 $225 $225 $225 $225 Price $311 $311 $311 $311 $50 $69 $50 $69 $69 $50 $69 $50 $50
- 166
Primary Antibodies Primary Antibodies - 167 Primary Antibodies Antibodies Lck Antibody (Phospho-TyrLck Antibody pAb, Rabbit NF- pAb, Rabbit NF- NF- NF- NF- NF- NF- pAb, Rabbit NF- pAb, Rabbit HDAC5 Antibody (Phospho-Ser HDAC5 Antibody HDAC5 Antibody (Ab-498),pAb,Rabbit I I I pAb, Rabbit HDAC4 Antibody (Phospho-Ser HDAC4 Antibody HDAC4 Antibody (Ab-632),pAb,Rabbit Product Name IKK IKK I I I HDAC8 Antibody (Phospho-Ser HDAC8 Antibody HDAC8 Antibody (Ab-39),pAb,Rabbit pAb, Rabbit (Phospho-Ser HDAC4/HDAC5/HDAC9 Antibody (Ab-246/259/220), pAb,Rabbit HDAC4/HDAC5/HDAC9 Antibody Rabbit NF- NF- NF- κ κ κ κ κ κ B- B- B- B- B- B- α α κ κ κ κ κ κ κ κ κ κ κ β β α α α α B p105/p50 Antibody (Phospho-Ser B p105/p50 Antibody (Phospho-Ser B p105/p50 Antibody (Ab-932), pAb,Rabbit B p105/p50 Antibody (Ab-927), pAb,Rabbit B p105/p50 Antibody (Ab-907), pAb,Rabbit B p105/p50 Antibody (Ab-893), pAb,Rabbit B p105/p50 Antibody (Ab-337), pAb,Rabbit B p100/p52 Antibody (Phospho-Ser B p100/p52 Antibody (Phospho-Ser B p100/p52 Antibody (Ab-870),pAb,Rabbit B p100/p52 Antibody (Ab-866),pAb,Rabbit Antibody (Ab-23),pAb,Rabbit Antibody (Phospho-Thr Antibody Antibody (Phospho-Ser Antibody Antibody (Ab-23),pAb,Rabbit Antibody (Phospho-Tyr Antibody Antibody (Phospho-Ser Antibody Antibody (Ab-42),pAb,Rabbit Antibody (Ab-32,36),pAb,Rabbit 246/259/220 ), pAb,Rabbit 394 23 42 23 32, 36 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 39 498 632 ), ), pAb,Rabbit ), ), pAb, 893 337 870 866 ), ), ), ), Your Innovation PartnerinDrugDiscovery! IHC, IF WB, IHC,IF WB, IHC WB, IF WB, IHC WB, IHC IHC WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC WB IHC WB, IHC IHC IHC, IF WB, IHC WB, IHC,IF WB, IHC WB, IHC IHC, IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB WB, IF Applications Human Human, mouse Human, mouse,rat Human, mouse Human, mouse Human, mouse Human, mouse,rat Human Species Reactivity Human Human, mouse,rat Human Human Human Human Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00229 A00470 A00555 A00929 A00228 A00227 A00585 A00226 A00469 A00225 A00583 A01024 A01032 A00928 A00349 A00359 A00453 A00609 A00356 A00421 A00382 A00431 A00337 A00430 A01271 A01257 A00338 A00429 Cat. No. $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $240 $225 $225 $225 $225 Price $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $69 $69 $50 $50 $50 $50 $50 $69 $69 $50 $50 $69 $69 $50 $69 $69 $50 $50 $69 $50 $50 $69 $50 $69 $50 $69 $50 PLC PLC (Phospho-Thr PKR Antibody NF- pAb, Rabbit PKR Antibody (Phospho-Thr PKR Antibody p38 MAPK Antibody (Phospho-Thr p38 MAPK Antibody (Ab-182),pAb,Rabbit pAb, Rabbit NF- pAb, Rabbit NF- pAb, Rabbit p38 MAPK Antibody (Phospho-Tyr pAb, Rabbit NF- pAb, Rabbit NF- pAb, Rabbit NF- pAb, Rabbit NF- Product Name NF- pAb, Rabbit PKC PKC pAb, Rabbit NF- NF- NF- NF- NF- NF- NF- NF- pAb, Rabbit NF- pAb, Rabbit NF- pAb, Rabbit κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ κ γ γ β β B p65 Antibody (Phospho-Ser B p65 Antibody (Phospho-Thr B p65 Antibody (Phospho-Thr B p65 Antibody (phospho-ser B p65 Antibody (Phospho-Ser B p65 Antibody (Phospho-Ser B p105/p50 Antibody (Phospho-Ser B p65 Antibody (Phospho-Thr B p65 Antibody (Phospho-Ser B p65 Antibody (Ab-536),pAb,Rabbit B p65 Antibody (Ab-529),pAb,Rabbit B p65 Antibody (Ab-505),pAb,Rabbit B p65 Antibody (Ab-468),pAb,Rabbit B p65 Antibody (Ab-435),pAb,Rabbit B p65 Antibody (Ab-311), pAb,Rabbit B p65 Antibody (Ab-276),pAb,Rabbit B p105/p50 Antibody (Phospho-Ser B p105/p50 Antibody (Phospho-Ser 1 Antibody (Ab-783),pAb,Rabbit 1 Antibody (Ab-771),pAb,Rabbit Antibody (Phospho-Thr Antibody Antibody (Ab-641),pAb,Rabbit 451 446 641 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 536 182 505 435 254 180 529 468 311 276 ), ), ), ), ), ), ), ), ), ), 932 927 907 ), ), ), WB WB, IHC IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC IHC WB IHC WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC Applications Human Human Human Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse Human, mouse,rat Human, mouse,rat Human Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human, mouse,rat Human Human Human Human Human, mouse,rat Human Human Species Reactivity Human Quantity 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01039 A01260 A01030 A00649 A00654 A00655 A00537 A00535 A00553 A01159 A00221 A00468 A00224 A00330 A00223 A00543 A00220 A00222 A00459 A01163 A00219 A00213 A00542 A00212 A00534 A00922 A00230 Cat. No. www.genscript.com $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 Price $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $311 $50 $50 $69 $69 $69 $50 $69 $69 $50 $69 $69 $69 $69 $69 $69 $69 $69 $50 $50 $50 $50 $50 $50 $50 $69 $69 $69
- 168
Primary Antibodies Primary Antibodies - 169 Primary Antibodies Antibodies Zap-70 Antibody (Phospho-TyrZap-70 Antibody RelB Antibody (Phospho-Ser RelB Antibody RelB Antibody (Ab-573),pAb,Rabbit PLC PLC PLC NA: NotAvailable. *: Thisproducthasnotbeentestedwithreactivitytootherspecies. PLC PLC Product Zap-70 Antibody (Phospho-TyrZap-70 Antibody Zap-70 Antibody (Ab-319),pAb,Rabbit Syk Antibody (Phospho-TyrSyk Antibody Syk Antibody (Ab-323),pAb,Rabbit γ γ γ γ γ 2 Antibody (Phospho-Tyr2 Antibody 2 Antibody (Ab-753),pAb,Rabbit 2 Antibody (Ab-1217),pAb,Rabbit 2 Antibody (Phospho-Tyr2 Antibody 1 Antibody (Phospho-Tyr1 Antibody 323 573 ), pAb,Rabbit 753 1217 783 493 319 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! IHC WB, IF WB, IHC IHC, IF IHC, IF WB, IHC WB WB, IF IHC WB,IF IHC WB Applications Human Human, mouse,rat Human Human Human Human, mouse,rat Species Reactivity Human, mouse,rat Human, mouse,rat Human Human Human Human, mouse Quantity 200 200 100 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g A00492 A00491 A00594 A01275 A01266 A00540 A00547 A00659 A01219 A00658 A01294 A01022 Cat. No. $172 $225 $225 $225 $225 Price $311 $311 $311 $311 $311 $311 $311 $69 $69 $69 $50 $69 $50 $69 $69 $50 $50 $69 and CK1leadstoitsubiquitinationproteasomaldegradation phosphorylation of Product Overview: β In theabsenceofWnt-signal(Off-state), APC/Axin/GSK-3 displacement ofGSK-3 receptors. This furthertriggersacascadeandcausesthe secreted glycoprotein,theWnt-ligandbindstoFrizzled the developmentofvertebratesandinvertebrates. As a The Wnt/ Wnt/ -complex targets Akt Antibody (Phospho-Thr Akt Antibody (Phospho-Ser Akt Antibody Akt Antibody (Phospho-Ser Akt Antibody Akt Antibody (Ab-473),pAb, Rabbit Akt Antibody (Ab-308),pAb, Rabbit 14-3-3 Product β ζ β -Catenin Antibody (Phospho-Ser Antibody -Catenin pathwayregulatescellfatedecisionsduring TAK1 β β -catenin fordegradation. Appropriate -catenin bycoordinatedactionofGSK-3 Target geneoff β fromthe APC/Axin/GSK-3 308 473 473 NLK ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit NLK 58 ), pAb,Rabbit TGF- β CK1 HDAC APC β -Catenin WB, IHC,IF WB, IHC ELISA, WB WB, IHC WB, IHC WB, IHC,IF Applications PP2A TCF β -complex. Groucho β FrizzledF -Catenin Dsh r Axin Wnt i z β z
l e d GSK-3 Human, mouse,rat Human Human, mouse,rat Human Human Human, mouse,rat Species Reactivity that canbeusedinyourWnt/ co-repressors. GenScriptoffers awideselectionofantibodies activator fortranscriptionbydisplacementofGroucho-HDAC to theLEF/TCFDNA-bindingfactorswhereitactsasan stabilization of away fromthedegradationcomplex. This allowsfor least inpartbyphosphorylation,whichturnrecruitsGSK-3 binding (On-state),dishevelled(Dsh)isactivated,seeminglyat through the Akt β -Catenin TCF β -TrCP/SKP complex.InthepresenceofWnt β β -catenin levels,nuclearimportandrecruitment -Catenin CBP Target geneon Quantity β 200 200 200 200 200 200 -Catenin 40 40 40 40 40 40 β PP2A -Catenin pathwayresearch. μ μ μ μ μ μ μ μ μ μ μ μ Catenin g g g g g g g g g g g g A00275 A00272 A00965 A00301 A00304 A00919 Cat. No. www.genscript.com Price $225 $225 $311 $311 $311 $311 $69 $69 $69 $50 $50 $69 β
- 170
Primary Antibodies Primary Antibodies - 171 Primary Antibodies Antibodies rdc plctosCat. No. Product Applications GSK3 GSK3 GSK3 GSK3 Catenin Antibody(Ab-33),pAb,Rabbit CaMKII Antibody(Phospho-Thr Src Antibody(Phospho-Tyr Src Antibody(Ab-529),pAb,Rabbit PP2A- PKC PKC AKT1 Antibody(Phospho-Thr AKT1 Antibody(Ab-450),pAb,Rabbit Akt2 Antibody(Phospho-Ser HDAC8 Antibody(Phospho-Ser HDAC8 Antibody(Ab-39),pAb,Rabbit Ser HDAC4/HDAC5/HDAC9 Antibody(Phospho- (Ab-246/259/220), pAb,Rabbit HDAC4/HDAC5/HDAC9 Antibody HDAC4 Antibody(Phospho-Ser HDAC4 Antibody(Ab-632),pAb,Rabbit HDAC2 Antibody,pAb,Rabbit HDAC2 Antibody(Phospho-Ser HDAC2 Antibody(Ab-394),pAb,Rabbit Tyr AKT1/AKT2/AKT3 Antibody(Phospho- pAb, Rabbit AKT1/AKT2/AKT3 Antibody(Ab-315/316/312), AKT1/AKT2 Antibody(Ab-308/309),pAb,Rabbit HDAC5 Antibody(Phospho-Ser HDAC5 Antibody(Ab-498),pAb,Rabbit 315/316/312 246/259/220 β β Antibody(Phospho-Thr Antibody(Ab-641),pAb,Rabbit β β α α α Antibody(Phospho-Ser Antibody(Ab-9),pAb,Rabbit Antibody(Phospho-Ser Antibody(Ab-21),pAb,Rabbit Antibody,pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit 529 474 ), pAb,Rabbit ), pAb,Rabbit 450 641 9 21 268 498 632 394 39 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit Your Innovation PartnerinDrugDiscovery! WB, IHC,IF WB, IHC WB WB, IHC,IF WB, IHC,IF IHC, IF WB, IHC WB, IHC WB, IHC WB, IHC WB, IHC,IF WB WB, IF ELISA, WB WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC,IF WB, IHC WB, IHC,IF WB, IHC,IF WB WB, IHC IHC, IF IHC IHC IHC, IF WB, IHC,IF Species Reactivity Human, mouse,rat Human Human Human, mouse,rat Human Human Human, mouse Human, mouse,rat Human, mouse Human, mouse Human, mouse Human, mouse,rat Human Human* Human, mouse,rat Human Human, mouse,rat Human Human, mouse,rat Human Human Human, mouse,rat Human, mouse,rat Human Human, mouse,rat Human Human Human Quantity 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00358 A00449 A01226 A00654 A00655 A00382 A00431 A00337 A00430 A01271 A01257 A00338 A00429 A01178 A01169 A00428 A00193 A00196 A00216 A00210 A00584 A00563 A00385 A01217 A01227 A01252 A01291 A01293 $240 Price $225 $225 $311 $225 $311 $225 $311 $225 $225 $311 $225 $311 $225 $311 $225 $225 $311 $311 $311 $311 $225 $311 $311 $225 $225 $311 $225 $50 $50 $69 $50 $69 $50 $69 $50 $50 $69 $50 $69 $50 $69 $50 $50 $69 $69 $69 $69 $50 $69 $69 $50 $50 $69 $50 Cytokine andGrowthFactor Antibodies They areoftensecretedbyimmunecellsthathaveencountered functioning ofboththeinnateandadaptiveimmuneresponse. factors areofvitalimportancetothedevelopmentand are proteins,peptides,orglycoproteins.Cytokinesandgrowth molecules extensivelyactiveincellularcommunication. They Cytokines andgrowthfactorsareacategoryofsignaling Product Overview: rdc aeApiain Cat.No. Applications Product Name IP-10 Antibody,mAb,Mouse IL-8 Antibody,pAb,Goat IL-8 Antibody,mAb,Mouse IL-1 betaAntibody(7C10B9),mAb,Mouse IL-1 betaAntibody(6B1G11),mAb,Mouse FGF-6 Antibody,mAb,Mouse FGF-16 Antibody(9D6B4),mAb,Mouse FGF-16 Antibody(8D6F2),mAb,Mouse FGF-16 Antibody(8B6D8),mAb,Mouse CT-1 Antibody,mAb,Mouse rdc plctosCat. No. Product Applications β β β β pAb, Rabbit pAb, Rabbit NA: NotAvailable. *: Thisproducthasnotbeentestedwithreactivitytootherspecies. α α α β pAb, Rabbit β pAb, Rabbit -Catenin Antibody(Phospho-Ser -catenin Antibody(Ab-654),pAb,Rabbit -Catenin Antibody(Ab-41,45),pAb,Rabbit -Catenin Antibody(Ab-37),pAb,Rabbit -Catenin Antibody(Phospho-Thr -Catenin Antibody(Phospho-Ser -Catenin Antibody(Phospho-Ser -Catenin Antibody(Ab-641),pAb,Rabbit -catenin Antibody(Ab-177),pAb,Rabbit 41 37 33 641 , Ser ), ), ), 45 ), ELISA, WB ELISA, WB ELISA, WB ELISA ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB WB WB, IHC WB, IHC WB WB WB, IHC,IF WB WB WB, IHC NA NA Human NA NA NA NA NA NA NA Species Reactivity Species Reactivity Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human Human Human cytokine andgrowthfactorresearch. offers awideselectionofantibodiesthatcanbeusedinyour developmental processesduringembryogenesis.GenScript Cytokines andgrowthfactorsarealsoinvolvedinseveral cells toenhancethesystem'sresponsepathogen. a pathogen,therebyactivatingandrecruitingfurtherimmune Quantity 500 100 200 500 100 200 200 200 200 200 200 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g Quantity 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g A00163 A00158 A00044 A01487 A01485 A01411 A01470 A01469 A01468 A01060 A00417 A00500 A00499 A01229 A00407 A00582 A00923 A00931 A01230 www.genscript.com Price Price $125 $225 $125 $225 $225 $225 $225 $225 $225 $311 $311 $311 $225 $225 $225 $311 $225 $225 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $69 $69 $69 $50 $50 $50 $69 $50 $50
- 172
Primary Antibodies Primary Antibodies - 173 Primary Antibodies Antibodies GPCRs Antibodies Product Overview: responses. The ligandsthatbindandactivatethesereceptors signal transductionpathwaysandultimatelyinducecellular sense moleculesoutsidethecellandactivateinsidethrough family oftransmembranereceptorsthathavetheabilityto G protein-coupledreceptors(GPCRs)constitutealargeprotein including yeast,plants,choanoflagellates,andanimals. G protein-coupledreceptorsarefoundonlyineukaryotes, rdc aeApiain Cat.No. Applications Product Name SCF Antibody,mAb,Mouse RANTES Antibody(4H2B3),mAb,Mouse RANTES Antibody(4G8F2),mAb,Mouse RANTES Antibody(4A10F2),mAb,Mouse RANTES Antibody(3G2D10),mAb,Mouse RANTES Antibody(3C2E3),mAb,Mouse RANTES Antibody(2H8G2),mAb,Mouse RANTES Antibody(1E11G5),mAb,Mouse M-CSF Antibody,mAb,Mouse NA:Not Available. *:This producthasnotbeentastedwith reactivitytootherspecies. NA: NotAvailable. *: Thisproducthasnotbeentestedwithreactivitytootherspecies. rdc plctosCat. No. Product Applications GPR30 Antibody,pAb,Rabbit DARPP-32 Antibody,pAb,Rabbit CXCR4 Antibody,pAb,Rabbit CXCR2 Antibody,pAb,Rabbit cGMP Antibody,pAb,Rabbit CCR5 Antibody,pAb,Rabbit CCR4 Antibody,pAb,Rabbit CCR3 Antibody,pAb,Rabbit cAMP Antibody,pAb,Rabbit ADP Antibody,pAb,Rabbit Your Innovation PartnerinDrugDiscovery! ELISA, WB,IHC WB WB ELISA, WB,IHC ELISA ELISA, IHC ELISA, WB ELISA, IHC ELISA, ELISA, ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB NA NA NA NA NA NA NA NA NA Species Reactivity Human Mouse, rat* Human, mouse* NA NA NA Human NA NA NA Species Reactivity research. a wideselectionofantibodiesthatcanbeusedinyourGPCRs for almosthalfofallmodernmedicinaldrugs.GenScriptoffers receptors areinvolvedinmanydiseases,andserveastargets molecules topeptidesandlargeproteins.Gprotein-coupled hormones andneurotransmitters,varyinginsizefromsmall range fromlight-sensitivecompounds,odors,pheromones,to Quantity Quantity 200 200 200 200 200 200 200 200 500 100 200 200 200 200 200 200 200 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g l l l l A01061 A01481 A01480 A01479 A01478 A01477 A01476 A01475 A00184 A01074 A01424 A00995 A00993 A00615 A00979 A00978 A00977 A00614 A01316 Price Price $225 $225 $225 $225 $225 $225 $225 $225 $125 $225 $225 $225 $225 $400 $225 $225 $225 $400 $400 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 $85 $50 $50 $50 $85 $85 Product Overview: will beanimportantroleoncuringcancersandothertheriodic to tissuesandorgans,suchasmuscle,bone,nerve. This differentiation. After inducinginvitro,stemcellscanbecultured Stem cells,areintissuesorembryo,havethepotentialof Stem Cell Antibodies rdc plctosCat. No. Product Applications VEGFR2 Antibody(Phospho-Tyr VEGFR2 Antibody(Phospho-Tyr NA: NotAvailable. *: Thisproducthasnotbeentastedwith reactivitytootherspecies. VEGFR2 Antibody(Phospho-Tyr VEGFR2 Antibody(Ab-951),pAb,Rabbit VEGFR2 Antibody(Ab-1214),pAb,Rabbit VEGFR2 Antibody(Ab-1175),pAb,Rabbit Nestin Antibody,pAb,Rabbit NCAM Antibody,pAb,Rabbit GFAP Antibody,pAb,Rabbit GFAP Antibody,mAb,Mouse GAPDH Antibody,pAb,Goat GAPDH Antibody,mAb,Mouse GAPDH Antibody[HRP],pAb,Goat GAPDH Antibody[Biotin],pAb,Goat Vimentin Antibody,pAb,Rabbit Vimentin Antibody,pAb,Rabbit Vimentin Antibody,pAb,Rabbit Vimentin Antibody,pAb,Chicken 961 1214 1175 ), pAb,Rabbit ), pAb,Rabbit ), pAb,Rabbit ELISA, WB,IHC ELISA, WB,IHC ELISA, WB,IHC IF WB, IHC,IF WB, IHC,IF IHC, IF WB, IHC IHC IHC ELISA, WB ELISA, WB ELISA, WB,IHC WB, IF ELISA, WB WB,IF WB WB fish, hamster, bovine,swine, goat, rabbit,chicken, Human, mouse,rat, avian other mammalsand Human, cow,pig,rat, fish, hamster, bovine,swine, goat, rabbit,chicken, Human, mouse,rat, fish, hamster, bovine,swine, goat, rabbit,chicken, Human, mouse,rat, Species Reactivity Human* Human* Human, mouse* Human, rat,mouse Human, mouse,rat Human, mouse,rat Human, mouse,rat Human Human Human Human* Rat, mouse* Human, rat* species mammalian andavian mouse, rat,allother Human, cow,pig, E. coli E. coli E. coli antibodies thatcanbeusedinyourstemcellresearch. life scienceatalltimes.GenScriptoffers awideselectionof diseases. And theresearchingonstemcellsishotpointin
Quantity 200 200 200 200 200 200 200 100 200 200 200 100 200 200 100 200 200 200 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A01189 A01193 A01191 A00152 A00370 A00367 A00366 A00357 A00355 A00352 A01413 A01415 A01309 A00085 A00191 A00084 A00192 A00915 www.genscript.com Price $270 $259 $270 $259 $204 $225 $311 $311 $311 $225 $225 $225 $225 $225 $225 $225 $225 $225 $60 $60 $50 $69 $69 $69 $50 $50 $50 $50 $50 $50 $50 $50 $50
- 174
Primary Antibodies Primary Antibodies - 175 Primary Antibodies Antibodies Loading Controls Isotype Controls Control Antibodies Control Antibodies/Loading GenScript offers awideselectionofpolyclonalandmonoclonal represent someofthewellknownloadingcontrolproteins. Housekeeping proteins,suchasGAPDH,tubulin,andactin stably expressedathighlevelsinalmostalltissuesandcells. Loading controlproteinsareknowntobeconstitutivelyand Product Overview: carbohydrates, andc)cellautofluorescence. All ofthese non-specific proteininteractionswithcellularproteins,lipids,or primary antibody:a)bindingtoFcreceptorsontargetcells,b) contribute tothelevelsofbackgroundstainingassociatedwitha staining fromspecificantibodystaining. Three mainfactors relevant specificitycandistinguishnon-specific"background" cytometry experiment.Isotypecontrolantibodiesthathaveno The selectionofanappropriateisotypecontrolisakeyforflow Product Overview: rdc plctosCat. No. Product Applications Product GAPDH Antibody,pAb,Goat GAPDH Antibody,mAb,Mouse GAPDH Antibody[HRP],pAb,Goat GAPDH Antibody[Biotin],pAb,Goat THE (Mouse) THE (Mouse) THE Rabbit IgGControl[FITC](WholeMolecule),Purified Rabbit IgGControl(WholeMolecule),Purified Mouse IgGControl[FITC](WholeMolecule),Purified Mouse IgGcontrol(WholeMolecule),Purified Human IgGControl(WholeMolecule),Purified Human IgGControl[FITC](WholeMolecule),Purified Goat IgGControl(WholeMolecule),Purified Chicken IgYControl(WholeMolecule),Purified TM TM TM Anti- Anti- Anti- β β α -Actin MonoclonalAntibody(Mouse) -Actin [HRP]MonoclonalAntibody -Tubulin MonoclonalAntibody Your Innovation PartnerinDrugDiscovery! ELISA, WB WB, IF WB WB ELISA, WB ELISA, WB ELISA, WB fish, hamster, bovine,swine, goat, rabbit,chicken, Human, mouse,rat, other mammals,avian Human, cow,pig,ratand fish, hamster, bovine,swine, goat, rabbit,chicken, Human, mouse,rat, fish, hamster, bovine,swine, goat, rabbit,chicken, Human, mouse,rat, goat, fish,pig human, hamster,cow, Mouse, rabbit,chicken, NA NA Species Reactivity E. coli E. coli E. coli loading controlantibodiesthatcanbeusedinyourresearch. antibodies arealsoavailable.GenScriptoffers aserialof several species.HRP-andbiotin-conjugatedversionsofthese loading controlantibodiesforGAPDH, research. serial ofisotypecontrolantibodiesthatcanbeusedinyour specific primaryantibodiesbeingused.GenScriptoffers a primary antibody, isotypecontrolsneedtobematchedthe accurately determinethelevelofspecificstainingby isotype oftheprimaryantibody. Therefore, inorderto factors varygreatlydependingonthetargetcelltypeand Quantity 0.5 mg 0.5 mg 0.5 mg 4 mg 1 mg 4 mg 4 mg 4 mg Quantity 200 100 200 200 200 200 100 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g A01382 A01008 A01381 A01007 A01006 A01383 A01009 A01010 Cat. No. A00191 A00084 A00192 A00915 A00702 A00730 A01410 α -tubulin, and Price Price β $225 $259 $270 $270 $311 $333 $225 -actin for $50 $60 $60 $69 $74 $50 $50 $50 $50 $50 $50 $50 $50 Cholesterol Related Antibodies Other Antibodies Product Overview: mechanisms involvedareonlypartlyunderstood.When regulated bythecholesterollevelspresent. The homeostatic plasma ofallanimals.Biosynthesischolesterolisdirectly are foundinthecellmembranesandtransportedblood to establishpropermembranepermeabilityandfluidity. They component ofmammaliancellmembraneswhereitisrequired Cholesterol isalipidicandwaxysteroid.Itanessential rdc plctosCat. No. Product Applications SCD1 Antibody,mAb,Mouse Plasminogen Antibody,pAb,Sheep LPL Antibody,mAb,Mouse Human Apo(a)Antibody,pAb,Sheep Apo EAntibody,pAb,Goat Apo CIIIAntibody,pAb,Rabbit Apo CIIIAntibody,pAb,Goat Apo CIIAntibody,pAb,Rabbit Apo CIIAntibody,pAb,Goat Apo CIAntibody,pAb,Rabbit Apo CIAntibody,pAb,Goat Apo B-100/48Antibody,pAb,Goat Apo AIIAntibody,pAb,Sheep Apo AIIAntibody,pAb,Rabbit Apo AIIAntibody,pAb,Goat Apo AIAntibody,pAb,Goat AMPK Alpha-1ChainAntibody,pAb,Rabbit Albumin Antibody,pAb,Goat ACAT2 Antibody,mAb,Mouse ACAT1 Antibody,mAb,Mouse ABCA1 Antibody,mAb,Mouse NA: NotAvailable. β α rdc plctosCat. NA: NotAvailable. *: Thisproducthasnotbeentestedwithreactivitytootherspecies. No. Product Applications -Tubulin IIIAntibody,pAb,Rabbit -Actin-1 Antibody,pAb,Rabbit For moreinformationonLoadingControlAntibodies,visit IHC, FACS ELISA, WB, WB ELISA, WB,IHC,IP ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB,IHC,IP
http://www.genscript.com/loading_control_antibody.html Human, mouse,rat* NA Species Reactivity Human, mouse Human Human, bovine Human Human Human Human Human Human Human Human Human Human Human Human Human NA Human Human Human Human, mouse,chicken Species Reactivity cholesterol relatedantibodiesthatcanbeusedinyourresearch. ACAT,and LPL, Apo,ABCA1, relevant tofactorsinvolvedincholesterolmetabolism,including can beturnedoff. GenScriptoffers awidevarietyofantibodies cholesterol levelsarehigh,thesynthesisof Quantity 200 200 40 40 μ μ μ μ g g g g Quantity 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 200 100 100 100 100 40 etc μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g . GenScriptoffers aserialof A01203 A00885 A00093 A00128 A00090 A00116 A00126 A00125 A00124 A00123 A00122 A00120 A00119 A00118 A00115 A00114 A00113 A00117 A00893 A00127 A00083 A00082 A00121 www.genscript.com Price Price $259 $132 $259 $198 $165 $209 $165 $209 $165 $209 $165 $110 $132 $209 $132 $110 $225 $110 $259 $259 $215 $225 $225 $50 $50 $50
- 176
Primary Antibodies Primary Antibodies - 177 Primary Antibodies Antibodies Yeast Antibodies Product Overview: Product Overview: progressed tophase6asannouncedbyWHO.Inresponse phase 4to5.SubsequentlyonJune11th, 2009,thealert influenza pandemicalertofH1N1fluhasbeenraisedfrom responsible forthe2009flupandemic.On April 29th,2009,the influenza inhumans. A strainofswine-originH1N1was subtype ofinfluenzavirus A, isthemostcommoncauseof each virusareonresearching.Influenza A (H1N1)virus,a antibodies havebeendevelopedandthenewerfor virus, hasbecamethehotresearchpoint.SeveralH1N1 protozoa, andparasites.H1N1,oneofthewellknowninfectious Infectious diseasescanbecausedbyviruses,bacteria,fungi, Infectious Diseases rdc plctosCat. No. Product Applications mAb, Mouse Yeast NuclearPoreComplexAntibody, Pma1p Antibody,mAb,Mouse Pdi1p Antibody,mAb,Mouse Pab1p Antibody,mAb,Mouse Nsr1p Antibody,mAb,Mouse Nsp1p Antibody,mAb,Mouse Nop5p/Nop58p Antibody,mAb,Mouse Nop5p, Nop6pAntibody,mAb,Mouse Nop2p Antibody,mAb,Mouse Nop1p/Fibrillarin Antibody,mAb,Mouse Nop1p Antibody,mAb,Mouse Nab1p Antibody(methylated),mAb,Mouse Lys20p, Lys21pAntibody,mAb,Mouse rdc plctosCat. No. Product Applications H1N1 PAantibody,pAb,Rabbit H1N1 PB1antibody,pAb,Rabbit H1N1 PB2Antibody,pAb,Rabbit H1N1 PB2Antibody,pAb,Rabbit H1N1 NPAntibody,pAb,Rabbit H1N1 NS1Antibody,pAb,Rabbit H1N1 NS2antibody,pAb,Rabbit H1N1 HAAntibody,pAb,Rabbit H1N1 HAAntibody,pAb,Rabbit H1N1 HAantibody,pAb,Rabbit Your Innovation PartnerinDrugDiscovery! IF WB, IF WB, IF WB, IF WB, IF WB, IF WB, IF IF, Immunoblotting WB, IF WB, IF WB, IF WB, IF,ICC WB, IF WB WB WB WB WB WB WB WB WB WB Species Reactivity Species Reactivity Drosophia Human, rat,plant, Yeast Yeast Yeast NA Yeast Yeast Yeast Yeast Yeast Yeast Yeast Yeast S. pombe Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) Influenze Avirus(H1N1) for viruscharacterization. Western blotting).Various epitopeantibodiesarealsoavailable influenza A virusthroughroutineimmunoassays(ELISA and quality antibodiescanbereadilyemployedinthedetectionof antibodies, genes,peptides,andproteins.Specifically, high and timelymanner, whichincludehighlysensitiveandspecific At GenScript,weproducehigh-qualitybio-reagentsinaflexible available tohelpresearcherscontainH1N1virus. this severesituation,GenScriptwilloffer whateverresources . , C. elegans ,
Quantity Quantity 200 200 200 200 200 200 200 200 200 200 100 100 100 100 100 100 100 100 100 100 100 100 100 40 40 40 40 40 40 40 40 40 40 μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00100 A00101 A00112 A00111 A00110 A00109 A00107 A00108 A00106 A00104 A00105 A00103 A00102 A01465 A01467 A01552 A01464 A01506 A01551 A01499 A01557 A01556 A01500 Price Price $204 $204 $204 $204 $204 $204 $204 $204 $204 $204 $204 $204 $204 $225 $225 $225 $225 $225 $225 $225 $225 $225 $225 $50 $50 $50 $50 $50 $50 $50 $50 $50 $50 Product Overview: Other Antibodies rdc plctosCat. No. Product Applications β V-ATPase SubunitB2Antibody,pAb, Rabbit V-ATPase SubunitAAntibody,pAb,Rabbit UL94 Antibody,mAb,Mouse Superoxide Dismutase1Antibody,pAb,Rabbit Streptavidin Antibody,pAb,Rabbit SRY Antibody,mAb,Mouse Runx3 Antibody,pAb,Rabbit RAP1A andRAP1BAntibody,pAb,Rabbit Protein AAntibody,pAb,Chicken Protein AAntibody[HRP],pAb,Chicken NA: Not Available. *: This producthasnotbeentestedwithreactivitytootherspecies. PKC Piwi-like Protein1Antibody,pAb,Rabbit PGK1 Antibody,pAb,Rabbit Peroxiredoxin-6 Antibody,pAb,Rabbit Mitoferrin-1 Antibody,pAb,Rabbit MDM2 Antibody(Ab-166),pAb,Rabbit MCL1 Antibody,mAb,Mouse IDO Antibody,pAb,Rabbit IDO Antibody,pAb,Rabbit HRP Antibody(HorseradishPeroxidase),pAb,Rabbit GnRHR Antibody,mAb,Mouse Enterokinase Antibody,mAb,Mouse Degenerating MyelinAntibody,mAb,Mouse Cytochrome P4502C23Antibody,pAb,Rabbit Catalase Antibody,pAb,Rabbit Beta-1,3-GalTase 2Antibody,pAb,Rabbit ATR Antibody(Ab-428),pAb,Rabbit ApoM Antibody,pAb,Rabbit Annexin A8Antibody,pAb,Rabbit AKR1C2 Antibody,pAb,Rabbit -Galactosidase Antibody,pAb,Rabbit ε Antibody,pAb,Rabbit ELISA, WB ELISA, WB WB ELISA, WB ELISA, WB ELISA, WB,Dotblot ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB ELISA, WB IHC, IF ELISA, WB ELISA, WB WB ELISA WB ELISA, WB WB ELISA, WB ELISA, WB,IP ELISA, WB HC ELISA, WB WB ELISA, WB NA NA NA Cytomegalovirus NA NA Mouse NA NA NA NA NA NA NA NA NA Human Human NA NA NA Human NA Human NA Human, mouse* Human, bovine,goat Human NA NA NA Species Reactivity Quantity 100 200 200 200 200 200 100 200 200 200 200 200 200 200 200 200 200 100 200 100 200 200 200 200 100 200 200 100 10 mg 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 1 mg μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ μ g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g A00889 A00096 A00891 A01187 A00918 A01253 A00954 A00703 A01054 A00633 A00960 A00938 A00095 A01005 A00621 A00094 A00973 A01047 A00728 A00729 A00675 A00963 A00961 A00962 A00916 A01267 A00092 A01053 A00887 A00619 A00086 www.genscript.com Price $225 $225 $225 $225 $225 $225 $225 $259 $125 $225 $225 $259 $225 $259 $225 $225 $270 $333 $225 $225 $225 $225 $225 $259 $225 $225 $259 $50 $50 $50 $50 $50 $98 $50 $50 $50 $50 $98 $50 $50 $60 $75 $50 $50 $50 $50 $50 $50 $50 $50 $50
- 178
Primary Antibodies Primary Antibodies - 179
Secondary Antibodies Antibodies Secondary Antibodies Custom Antibody Services CustomAntibody Product Overview: conjugated secondaryantibodies antibody fragmentssuchastheFcorFabregions. The They areavailablewithspecificityforwholeIgmoleculesor of severalhosts,suchasgoat,human,mouse,rabbit,andrat. In GenScript,secondaryantibodiesarepurifiedfromtheserum Secondary Antibodies NA: Not Available. *: This producthasnotbeen testedwithreactivitytootherspecies. Goat Anti-Rat IgG(H&L)[HRP] Antibody, pAb Goat Anti-Rabbit IgG Antibody (H&L),pAb Goat Anti-Rabbit IgG Antibody (H&L)[HRP],pAb Goat Anti-Mouse IgG Antibody (H&L)[HRP],pAb Goat Anti-Mouse IgG Antibody (H&L)[FITC],pAb Goat Anti-Human IgG Antibody (H&L)[HRP],pAb Goat Anti-Chicken IgY Antibody (H&L),pAb Goat Anti-Chicken IgY Antibody (H&L)[HRP],pAb Donkey Anti-Goat IgG Antibody (H&L)[HRP],pAb Product Your Innovation PartnerinDrugDiscovery! ELISA, WB,Dotblot,IHC ELISA, WB,Dotblot,IHC ELISA, WB,Dotblot,IHC ELISA, WB,Dotblot,IHC ICC, FACS ELISA, WB,Dotblot,IHC ELISA, WB,Dotblot,IHC ELISA, WB,Dotblot,IHC ELISA, WB,Dotblot,IHC Applications labled. and conditions,freelychoosethesuitablesecondaryantibodies protein assay. According toyoursourceoftheprimaryantibodies can begenerallyusedforvariousofimmunologyanalysisand Rat Rabbit Rabbit Mouse Mouse Human Chicken Chicken Goat Species Reactivity Quantity 1 mg 1 mg 1 mg 1 mg 1 mg 1 mg 1 mg 1 mg 1 mg A00167 A00131 A00098 A00160 A01318 A00166 A00132 A00165 A00178 Cat. No. Price $60 $39 $60 $60 $60 $60 $49 $63 $63 facility is fragmentation, andimmunoassaydevelopment.Ouranimal monoclonal antibodyproduction,affinity purification,conjuga expression, peptidedesignandsynthesis,polyclonal antibody needs.Ourservicesincluderecombinantprotein GenScript providesaone-stopsolutiontoallitscustomers' staff. Withstate-of-the-arttechniquesanddedicatedspecial industry leadingtechnologiesandexperienced,professional antibodies andantibodyservices. These inturndemand A reliableanalysisofbiologicalmaterialsdemands Competitive Advantages Other methods lon-exchange Protein A/G/L Antigen-based affinity Prices Guaranteed immuneresponse Antibody lyophilization Advanced antigendesign(OptimumAntigen Feature T-Max Nanotechnology forantigenpreparation IP IHC ELISA Western blot AAALAC Internationalaccredited Antigen Design TM adjuvant Acclaimed Immunoassay development Characterization viaabroadrangeofmethods Modification Purification options Immunogen preparation Antibody development Antigen design Guaranteed Response Immune TM ) . Comprehensive Package Monoclonal startsat$3,800.00 Polyclonal startsat$250.00 Two ELISA positiveclones(monoclonalantibody) Immune 1:32,000ELISA titer (polyclonalantibody) (Western-GUARANTEED peptidepolyclonalantibodypackage) Guaranteed Western Yes Yes Yes Yes GenScript ists, tion, Conjugation tobiotin,enzymes,andfluorescentdyes Fragmentation Monoclonal antibodyproduction Polyclonal antibodyproduction Assay kitavailable-easytouse Through-put format Validated positive generatedusingqualifiedproteinantigen,weguarantee • ForbothPolyclonalandMonoclonalantibodyproduct antigen,weguarantee • ForMonoclonal Antibody Developmentusinganyqualified better. qualifiedantigen,weguaranteeELISA titer • Forantibodyproductgeneratedinanyhostusing We guarantee: Competitive Prices Western blot UNBEATABLE SERVICE results. Mouse rat,goatandRabbit, mouse, chicken two positiveclones in vitro and in vivo 30% orhigher Rare No No No No Competitors www.genscript.com 1:32,000 . production or
- 180
Custom Antibody Services Antibody Custom Antibodies Advanced Antigen Design Guaranteed Immune Response GenScript’s OptimumAntigenTM Antigen Design Tool combines We use Western-GUARANTEED peptide polyclonal antibody the advanced algorithms with GenScript's time-tested expertise package to satisfy your need for quality antibodies that generate to provide peptide antigens that produce quality antibodies. positive Western blot results.
Nanotechnology for Antigen Preparation For polyclonal antibody projects that use peptide antigens Unlike those of many other antibody production companies, designed, synthesized, and conjugated by GenScript, we GenScript antigen mixtures are processed down to nanoparticles guarantee a final antibody product with an ELISA titer of 1:32,000 to maximize immunization efficiency and boost immune or better. response. Competitive Prices T-MaxTM Adjuvant Our polyclonal antibody service starts as low as $250.00. Our T-MaxTM adjuvant is significantly more potent in inducing the monoclonal antibody service starts as low as $3,800.00. Our immune reaction than the standard Freund’s adjuvant, which express polyclonal antibody service delivers antibody in 5–8 ensures high specificity and high titer of the produced antibodies. weeks.
Antibody Lyophilization Comprehensive Package Lyophilization extends the shelf life of your antibodies, eliminates GenScript's one-stop antibody services are tailored to each leaking problems, loosens up stringent temperature requirement customer's unique needs. For example, the process of antigen during shipping, and reduces the overall weight of antibodies to design by OptimumAntigenTM design tool and carrier protein be shipped. All antisera or purified antibodies are provided as selection are dictated in part by the customer's intended final lyophilized form except special requirements. application. In addition, we adjust the immunization dosage and number of booster immunizations according to the titer of initial antisera from each animal. Antibodies Quotations and Ordering
Quotations and orders may be placed by email, phone, or fax with either a formal PO (Purchase Order) or credit card. Please choose the most convenient ordering method. Antibodies
Quotation Form: Obtainable on our website
Email: [email protected]
Phone: 1-877-436-7274 (Toll-Free); 1-732-885-9188
Fax: 1-732-210-0262; 1-732-885-5878
Secured Web Server: https://www.genscript.com/ssl-bin/secure_data Custom Antibody Services
Your Innovation Partner in Drug Discovery! - 181 - www.genscript.com - 182 - Chapter 5 Peptides
β-Amyloid Peptides 185 Blocking Peptides 186 Cosmetic Peptides 191 Pharmaceuticals 191 Peptide Building Blocks 191 Other Peptides 195 Related Biology Reagents 208 Custom Peptide Services 215 Overview
GenScript has a comprehensive collection of pharmaceutical catalog are offered at over 95% purity. Let GenScript's ProductPurity Quantity Cat. No. Price peptides including β-amyloid peptides, blocking peptides and state-of-the-art peptide synthesis technology and experienced β-Amyloid (18-28) >95% 1 mg RP20105 $42 cosmetic peptides, and etc. We have a worldwide customer peptide chemists to be your partners toward your success. If β-Amyloid (1-9) >95% 1 mg RP20160 $54 base in the cosmetic and pharmaceutical industries along with your peptide is not listed in our catalog, GenScript can 1 mg $86 academic institutions. GenScript can provide a variety of synthesize any quantity of cGMP or research grade peptides for β-Amyloid (22-35) >95% RP20130 5 mg $380 reliable cGMP peptides capable of increasing the speed and you. β-Amyloid (22-40) >95% 1 mg RP20150 $113 accuracy of every study. 1 mg $52 GenScript constantly launches new peptide products and β-Amyloid (25-35) >95% RP10008 5 mg $209 All GenScript's peptides come equipped with QC data, including updates its website. If prices and the other relevant information 1 mg $54 HPLC and MS profiles. There are over 1,500 different peptides presented here differ with those shown on the website, please β-Amyloid (29-40) >95% RP20178 5 mg $243 with several quantity scales available. All the peptides in our refer to the correct information on the website. β-Amyloid (30-34) >95% 1 mg RP20143 $59 1 mg $27 β-Amyloid (31-35) >95% RP20184 5 mg $122 1 mg $27 β-Amyloid (32-35) >95% RP20177 β-Amyloid Peptides 5 mg $122 β-Amyloid (33-40) >95% 1 mg RP20144 $54
TM 0.5 mg $54 Advanced FlexPeptide technology is applied to synthesize the comprehensive array of human and rat β-amyloid β-Amyloid (35-25) >95% RP20185 peptide fragments. 1 mg $441 β-Amyloid (35-42) >95% 1 mg RP20145 $54 β-Amyloid (37-43) 1 mg $54 β-amyloid is a peptide that forms amyloid plaques in the brains causing amyloidosis and neurodegenerative diseases such as >95% RP20186 5 mg $54 of Alzheimer's disease (AD) patients. β-amyloid peptide AD. Due to β-amyloid’s involvement in the pathogenic process β-Amyloid (4-10) >95% 1 mg RP20173 consists of 43 amino acids. It is formed via the enzymatic of AD, it has become one of the most investigated molecules in $243 digestion of amyloid precursor protein (APP) by β-secretase AD research projects. β-Amyloid (42-1) >95% 0.5 mg RP10034 $285 and γ-secretase. It then forms insoluble fibrous aggregates, β-Amyloid (7-22) >95% 1 mg RP20192 $72 β-Amyloid A4 Protein Precursor $189 >95% 1 mg RP20165 Product Overview: (740-770), APP (C31) $72 β-Amyloid Protein Precursor(657-676) >95% 0.5 mg RP20195 $130 β-Amyloid Protein Precursor 770 1 mg >95% $587 Product PurityQuantity Cat. No. Price (135-155) 5 mg RP20196 β-Amyloid (10-20) >95% 0.5 mg RP20174 $27 β-Amyloid (10-35) >95% 1 mg RP20163 $135 For more information on β-Amyloid Peptides, visit http://www.genscript.com/beta_amyloid_peptide.html β-amyloid (1-11) >95% 1 mg RP20106 $42
β-amyloid (11-22) >95% 0.5 mg RP20102 $28 Peptides β-Amyloid (1-15) >95% 1 mg RP20141 $68 β-amyloid (1-16) >95% 0.5 mg RP20103 $25
Peptides β-Amyloid (1-17) >95% 1 mg RP20161 $81 β-Amyloid (1-20) >95% 1 mg RP20162 $90 Blocking Peptides β-Amyloid (12-20) >95% 1mg RP20175 $45 β-amyloid (12-28) >95% 0.5 mg RP20104 $49 Multiple applications for western blotting and immunohistochemistry assays β-Amyloid (1-28) >95% 0.5 mg RP10002 $81 β-Amyloid (13-27) >95% 1 mg RP20170 $72 It is common for antibodies to bind to proteins other than the antibodies raised against peptide antigens. The binding of the β-amyloid (1-33) >95% 0.5 mg RP20101 $147 intended antigen. However, these non-specific bindings can be antigen to the antibody may be reduced or blocked by β-Amyloid (1-34) >95% 0.5 mg RP20140 $131 identified. The band that is specific to immunizing peptide can pre-absorption with the blocking peptides. These peptides can Blocking Peptides β-Amyloid (1-40) >95% 0.5 mg RP10004 $114 be determined via immunizing peptide blocking experiment. be used to confirm that the observed signal is due to the β-Amyloid (1-40) Binding Peptide >95% 1 mg RP20166 $90 antibody’s interaction with target antigen instead an outcome of β-Amyloid (1-40), rat >95% 0.5 mg RP10016 $157 GenScript provides a comprehensive collection of blocking non-specific binding. We keep more than 200 blocking peptides β-Amyloid (1-42), human >95% 0.5 mg RP10017 $119 peptides as negative controls for antibody customers. These in stock at all times for most of our phospho-specific and pan β-Amyloid (1-42), rat >95% 0.5 mg RP10013 $176 controls include affinity-purified polyclonal and monoclonal antibodies. -Amyloid Peptides
β 1 mg $54 β-Amyloid (15-21) >95% RP20171 5 mg $243 Product Overview: 1 mg $45 β-Amyloid (16-20) >95% RP20172 5 mg $203 Product Quantity Cat. No. Price β-Amyloid (16-23) >95% 1 mg RP20152 $45 4E-BP1 (Phospho-Thr36) pAb Blocking Peptide 100 μg RP19873 $50 β-Amyloid (16-26) >95% 1 mg RP20154 $59 4E-BP1 (Phospho-Thr45) pAb Blocking Peptide 100 μg RP19875 $50 β-Amyloid (17-24) >95% 1 mg RP20148 $54 AFX (Phospho-Ser197) pAb Blocking Peptide 100 μg RP19777 $50 Akt (Phospho-Ser473) pAb Blocking Peptide 100 μg RP19637 $50
Your Innovation Partner in Drug Discovery! - 185 - www.genscript.com - 186 - Product Quantity Cat. No. Price Product Quantity Cat. No. Price Akt (Phospho-Thr308) pAb Blocking Peptide 100 μg RP19639 $50 Elk-1 (Phospho-Ser383) pAb Blocking Peptide 100 μg RP19543 $50 Akt2 (Phospho-Ser474) pAb Blocking Peptide 100 μg RP19753 $50 Elk1 (Phospho-Ser389) pAb Blocking Peptide 100 μg RP19607 $50 AMPK1/AMPK2 (Phospho-Ser485/491) pAb Blocking Peptide 100 μg RP19829 $50 Elk1 (Phospho-Thr417) pAb Blocking Peptide 100 μg RP19609 $50 ASK1 (Phospho-Ser83) pAb Blocking Peptide 100 μg RP19837 $50 Estrogen Receptor-α (Phospho-Ser104) pAb Blocking Peptide 100 μg RP19667 $50 ASK1 (Phospho-Ser966) pAb Blocking Peptide 100 μg RP19839 $50 Estrogen Receptor-α (Phospho-Ser106) pAb Blocking Peptide 100 μg RP19669 $50 ATF2 (Phospho-Ser112/94) pAb Blocking Peptide 100 μg RP19599 $50 Estrogen Receptor-α (Phospho-Ser118) pAb Blocking Peptide 100 μg RP19671 $50 ATF2 (Phospho-Ser62/44) pAb Blocking Peptide 100 μg RP19591 $50 Estrogen Receptor-α (Phospho-Ser167) pAb Blocking Peptide 100 μg RP19673 $50 ATF2 (Phospho-Thr69/51) Antibody Blocking Peptide 100 μg RP19593 $50 Ezrin (Phospho-Thr567) pAb Blocking Peptide 100 μg RP19853 $50 ATF2 (Phospho-Thr71/53) pAb Blocking Peptide 100 μg RP19595 $50 Ezrin(Phospho-Tyr353) pAb Blocking Peptide 100 μg RP19655 $50 ATF2 (Phospho-Thr73/55) pAb Blocking Peptide 100 μg RP19597 $50 FAK (Phospho-Tyr861) pAb Blocking Peptide 100 μg RP19647 $50 ATF4 (Phospho-Ser245) pAb Blocking Peptide 100 μg RP19635 $50 FAK (Phospho-Tyr925) pAb Blocking Peptide 100 μg RP19751 $50 ATM (Phospho-Ser1981) pAb Blocking Peptide 100 μg RP19749 $50 FKHR (Phospho-Ser256) pAb Blocking Peptide 100 μg RP19739 $50 BAD (Phospho-Ser112) pAb Blocking Peptide 100 μg RP19663 $50 FKHR (Phospho-Ser319) pAb Blocking Peptide 100 μg RP19775 $50 BAD (Phospho-Ser155) pAb Blocking Peptide 100 μg RP19665 $50 FKHRL1 (Phospho-Ser253) pAb Blocking Peptide 100 μg RP19805 $50 BCL-2 (Phospho-Ser70) pAb Blocking Peptide 100 μg RP19659 $50 G3BP-1 (Phospho-Ser232) pAb Blocking Peptide 100 μg RP19691 $50 BCL-2 (Phospho-Thr56) pAb Blocking Peptide 100 μg RP19657 $50 Gab1 (Phospho-Tyr627) pAb Blocking Peptide 100 μg RP19963 $50 BCL-XL (Phospho-Ser62) pAb Blocking Peptide 100 μg RP19661 $50 GATA1 (Phospho-Ser142) pAb Blocking Peptide 100 μg RP19613 $50 Bcr (Phospho-Tyr177) pAb Blocking Peptide 100 μg RP19849 $50 GATA1 (Phospho-Ser310) pAb Blocking Peptide 100 μg RP19615 $50 BIM (Ab-69) pAb Blocking Peptide 100 μg RP19960 $50 GSK3α (Phospho-Ser21) pAb Blocking Peptide 100 μg RP19549 $50 BIM (Phospho-Ser69) pAb Blocking Peptide 100 μg RP19959 $50 GSK3β (Phospho-Ser9) pAb Blocking Peptide 100 μg RP19539 $50 BRCA1 (Phospho-Ser1423) pAb Blocking Peptide 100 μg RP19901 $50 HDAC4 (Phospho-Ser632) pAb Blocking Peptide 100 μg RP19843 $50 BRCA1 (Phospho-Ser1524) pAb Blocking Peptide 100 μg RP19743 $50 HDAC5 (Phospho-Ser498) pAb Blocking Peptide 100 μg RP19845 $50 c-Abl (Phospho-Tyr412) pAb Blocking Peptide 100 μg RP19755 $50 HDAC8 (Phospho-Ser39) pAb Blocking Peptide 100 μg RP19761 $50 CaMKII (Phospho-Thr286) pAb Blocking Peptide 100 μg RP19957 $50 HER2 (Phospho-Tyr1221, 1222) pAb Blocking Peptide 100 μg RP19679 $50 Caveolin-1 (Phospho-Tyr14) pAb Blocking Peptide 100 μg RP19705 $50 HER2 (Phospho-Tyr1248) pAb Blocking Peptide 100 μg RP19685 $50 CDC2 (Phospho-Thr161) pAb Blocking Peptide 100 μg RP19773 $50 HER2 (Phospho-Tyr877) pAb Blocking Peptide 100 μg RP19677 $50 CDC2 (Phospho-Tyr15) pAb Blocking Peptide 100 μg RP19903 $50 Histone H3.1 (Phospho-Ser10) pAb Blocking Peptide 100 μg RP19841 $50 cdc25A (Phospho-Ser76) pAb Blocking Peptide 100 μg RP19779 $50 HSF1 (phospho-Ser303) pAb Blocking Peptide 100 μg RP19929 $50 cdc25C (Phospho-Ser216) pAb Blocking Peptide 100 μg RP19745 $50 HSP27 (Phospho-Ser15) pAb Blocking Peptide 100 μg RP19819 $50 CDK2 (Ab-160) pAb Blocking Peptide 100 μg RP19721 $50 HSP27 (Phospho-Ser82) pAb Blocking Peptide 100 μg RP19911 $50 CDK2 (Phospho-Thr160) pAb Blocking Peptide 100 μg RP19771 $50 HSP27(Phospho-Ser78) pAb Blocking Peptide 100 μg RP19909 $50 Peptides Chk1 (Phospho-Ser345) pAb Blocking Peptide 100 μg RP19747 $50 IGF-1R (Phospho-Tyr1161) pAb Blocking Peptide 100 μg RP19699 $50 Chk2 (Phospho-Ser516) pAb Blocking Peptide 100 μg RP19791 $50 IGF-1R (Phospho-Tyr1165,Tyr1166) pAb Blocking Peptide 100 μg RP19701 $50 Chk2 (Phospho-Thr68) pAb Blocking Peptide 100 μg RP19651 $50 IKK α (Phospho-Thr23) pAb Blocking Peptide 100 μg RP19763 $50
Peptides c-Jun (Phospho-Ser243) pAb Blocking Peptide 100 μg RP19583 $50 Integrin β3 (Phospho-Tyr773) pAb Blocking Peptide 100 μg RP19649 $50 c-Jun (Phospho-Ser73) pAb Blocking Peptide 100 μg RP19541 $50 IRS-1 (Phospho-Ser307) pAb Blocking Peptide 100 μg RP19897 $50 c-Jun (Phospho-Thr239) pAb Blocking Peptide 100 μg RP19581 $50 IRS-1 (Phospho-Ser636) pAb Blocking Peptide 100 μg RP19887 $50 c-Jun (Phospho-Thr91) pAb Blocking Peptide 100 μg RP19575 $50 IRS-1 (Phospho-Ser639) pAb Blocking Peptide 100 μg RP19889 $50 c-Jun (Phospho-Thr93) pAb Blocking Peptide 100 μg RP19577 $50 IκB-α (Phospho-Ser32, 36) pAb Blocking Peptide 100 μg RP19799 $50 c-Jun (Phospho-Tyr170) pAb Blocking Peptide 100 μg RP19579 $50 IκB-α (Phospho-Tyr42) pAb Blocking Peptide 100 μg RP19815 $50 cofilin (Phospho-Ser3) pAb Blocking Peptide 100 μg RP19781 $50 JAK1 (Phospho-Tyr1022) pAb Blocking Peptide 100 μg RP19793 $50 Blocking Peptides Connexin 43 (phospho-Ser367) pAb Blocking Peptide 100 μg RP19925 $50 JAK2 (Phospho-Tyr1007) pAb Blocking Peptide 100 μg RP19797 $50 Cortactin (Ab-421) pAb Blocking Peptide 100 μg RP19937 $50 JAK2 (Phospho-Tyr221) pAb Blocking Peptide 100 μg RP19795 $50 Cortactin (Phospho-Tyr466) pAb Blocking Peptide 100 μg RP19941 $50 JunB (Phospho-Ser259) pAb Blocking Peptide 100 μg RP19587 $50 CREB (Phospho-Ser129) pAb Blocking Peptide 100 μg RP19943 $50 JunB (Phospho-Ser79) pAb Blocking Peptide 100 μg RP19585 $50 CREB (Phospho-Ser133) pAb Blocking Peptide 100 μg RP19633 $50 JunD (Phospho-Ser255) pAb Blocking Peptide 100 μg RP19589 $50 DNA PKcs (Phospho-Thr2609) pAb Blocking Peptide 100 μg RP19823 $50 Lck (Phospho-Tyr393) pAb Blocking Peptide 100 μg RP19785 $50 Blocking Peptides EGFR (Phospho-Ser1070) pAb Blocking Peptide 100 μg RP19687 $50 LIMK1 (Phospho-Thr508) pAb Blocking Peptide 100 μg RP19757 $50 EGFR (Phospho-Tyr1092) pAb Blocking Peptide 100 μg RP19689 $50 LIMK2 (Phospho-Thr505) pAb Blocking Peptide 100 μg RP19759 $50 EGFR (phospho-Tyr1110) pAb Blocking Peptide 100 μg RP19931 $50 MARCKS (Phospho-Ser158) pAb Blocking Peptide 100 μg RP19965 $50 EGFR (Phospho-Tyr1197) pAb Blocking Peptide 100 μg RP19883 $50 MEF2A (Phospho-Thr312) pAb Blocking Peptide 100 μg RP19611 $50 EGFR (Phospho-Tyr869) pAb Blocking Peptide 100 μg RP19885 $50 MEK1 (Phospho-Ser221) pAb Blocking Peptide 100 μg RP19813 $50 EGFR (Phospho-Tyr1172) pAb Blocking Peptide 100 μg RP19869 $50 MEK1 (Phospho-Thr291) pAb Blocking Peptide 100 μg RP19967 $50 eIF2α (Phospho-Ser51) pAb Blocking Peptide 100 μg RP19951 $50 MEK-2 (Phospho-Thr394) pAb Blocking Peptide 100 μg RP19551 $50 eIF4E (Phospho-Ser209) pAb Blocking Peptide 100 μg RP19893 $50 Met (Phospho-Tyr1234) pAb Blocking Peptide 100 μg RP19881 $50
Your Innovation Partner in Drug Discovery! - 187 - www.genscript.com - 188 - Product Quantity Cat. No. Price Product Quantity Cat. No. Price Met (Phospho-Tyr1349) pAb Blocking Peptide 100 μg RP19899 $50 PTEN (Phospho-Ser370) pAb Blocking Peptide 100 μg RP19653 $50 MKK3 (Phospho-Ser189) pAb Blocking Peptide 100 μg RP19787 $50 PTEN (Phospho-Ser380) pAb Blocking Peptide 100 μg RP19553 $50 MKK6 (Phospho-Ser207) pAb Blocking Peptide 100 μg RP19789 $50 PTEN (Phospho-Ser380,Thr382, 383) pAb Blocking Peptide 100 μg RP19641 $50 mTOR (Phospho-Ser2448) pAb Blocking Peptide 100 μg RP19871 $50 Pyk2 (Phospho-Tyr402) pAb Blocking Peptide 100 μg RP19861 $50 Myc (Phospho-Ser373) pAb Blocking Peptide 100 μg RP19605 $50 Raf1 (Phospho-Ser259) pAb Blocking Peptide 100 μg RP19547 $50 Myc (Phospho-Thr358) pAb Blocking Peptide 100 μg RP19603 $50 Rb (Ab-780) pAb Blocking Peptide 100 μg RP19723 $50 Myc (Phospho-Thr58) pAb Blocking Peptide 100 μg RP19601 $50 Rb (Ab-795) pAb Blocking Peptide 100 μg RP19727 $50 MyoD (Phospho-Ser200) pAb Blocking Peptide 100 μg RP19681 $50 Rb (Ab-807) pAb Blocking Peptide 100 μg RP19725 $50 NFκB-p100/p52 (Phospho-Ser866) pAb Blocking Peptide 100 μg RP19565 $50 Rb (Phospho-Ser780) pAb Blocking Peptide 100 μg RP19769 $50 NFκB-p100/p52 (Ser870) pAb Blocking Peptide 100 μg RP19567 $50 Rb (Phospho-Ser795) pAb Blocking Peptide 100 μg RP19765 $50 NFκB-p105/p50 (Phospho-Ser337) pAb Blocking Peptide 100 μg RP19569 $50 Rb (Phospho-Ser807) pAb Blocking Peptide 100 μg RP19767 $50 NFκB-p105/p50 (Phospho-Ser893) pAb Blocking Peptide 100 μg RP19571 $50 RelB (Phospho-Ser573) pAb Blocking Peptide 100 μg RP19923 $50 NFκB-p105/p50 (Phospho-Ser907) pAb Blocking Peptide 100 μg RP19573 $50 S6 Ribosomal Protein (Phospho- Ser235) pAb Blocking Peptide 100 μg RP19891 $50 NFκB-p105/p50 (Phospho-Ser932) pAb Blocking Peptide 100 μg RP19915 $50 SAPK/JNK (Phospho-Thr183) pAb Blocking Peptide 100 μg RP19913 $50 NFκB-p65 (Phospho-Ser276) pAb Blocking Peptide 100 μg RP19557 $50 SEK1/MKK4 (Phospho-Ser80) pAb Blocking Peptide 100 μg RP19835 $50 NFκB-p65 (phospho-Ser311) pAb Blocking Peptide 100 μg RP19927 $50 SEK1/MKK4 (Phospho-Thr261) pAb Blocking Peptide 100 μg RP19833 $50 NFκB-p65 (Phospho-Ser468) pAb Blocking Peptide 100 μg RP19561 $50 SMC1 (Phospho-Ser957) pAb Blocking Peptide 100 μg RP19847 $50 NFκB-p65 (Phospho-Ser529) pAb Blocking Peptide 100 μg RP19863 $50 Src (Phospho-Tyr529) pAb Blocking Peptide 100 μg RP19801 $50 NFκB-p65 (Phospho-Ser536) pAb Blocking Peptide 100 μg RP19563 $50 Src (Phospho-Tyr418) pAb Blocking Peptide 100 μg RP19707 $50 NFκB-p65 (Phospho-Thr254) pAb Blocking Peptide 100 μg RP19555 $50 STAT1 (Phospho-Ser727) pAb Blocking Peptide 100 μg RP19817 $50 NFκB-p65 (Phospho-Thr435) pAb Blocking Peptide 100 μg RP19559 $50 STAT1 (Phospho-Tyr701) pAb Blocking Peptide 100 μg RP19617 $50 p27Kip1 (Phospho-Thr187) pAb Blocking Peptide 100 μg RP19857 $50 STAT3 (Phospho-Ser727) pAb Blocking Peptide 100 μg RP19621 $50 P38 MAPK (Phospho-Thr180) pAb Blocking Peptide 100 μg RP19917 $50 STAT3 (Phospho-Tyr705) pAb Blocking Peptide 100 μg RP19619 $50 P38 MAPK (Phospho-Tyr182) pAb Blocking Peptide 100 μg RP19919 $50 STAT4 (Phospho-Tyr693) pAb Blocking Peptide 100 μg RP19623 $50 p44/42 MAP Kinase (Phospho-Thr202) pAb Blocking Peptide 100 μg RP19905 $50 STAT5A (Phospho-Ser780) pAb Blocking Peptide 100 μg RP19627 $50 p44/42 MAP Kinase (Phospho-Tyr204) pAb Blocking Peptide 100 μg RP19907 $50 STAT5A (Phospho-Tyr694) pAb Blocking Peptide 100 μg RP19625 $50 p53 (Phospho-Ser15) pAb Blocking Peptide 100 μg RP19709 $50 STAT6 (Phospho-Thr645) pAb Blocking Peptide 100 μg RP19631 $50 p53 (Phospho-Ser315) pAb Blocking Peptide 100 μg RP19713 $50 STAT6 (Phospho-Tyr641) pAb Blocking Peptide 100 μg RP19629 $50 p53 (Phospho-Ser46) pAb Blocking Peptide 100 μg RP19711 $50 Stathmin 1 (Phospho-Ser16) pAb Blocking Peptide 100 μg RP19895 $50 p56Dok-2 (Phospho-Tyr299) pAb Blocking Peptide 100 μg RP19949 $50 Stathmin 1 (Phospho-Ser24) pAb Blocking Peptide 100 μg RP19877 $50 p62Dok (phospho-Tyr362) pAb Blocking Peptide 100 μg RP19945 $50 Stathmin 1 (Phospho-Ser38) pAb Blocking Peptide 100 μg RP19879 $50 Peptides p62Dok (phospho-Tyr398) pAb Blocking Peptide 100 μg RP19947 $50 Tau (Ab-235) pAb Blocking Peptide 100 μg RP19706 $50 p70 S6 Kinase (Ab-411) pAb Blocking Peptide 100 μg RP19933 $50 Tau (Ab-422) pAb Blocking Peptide 100 μg RP19935 $50 p70 S6 Kinase (Phospho-Ser424) pAb Blocking Peptide 100 μg RP19955 $50 Tau (Phospho-Ser214) pAb Blocking Peptide 100 μg RP19731 $50
Peptides p70 S6 Kinase (Phospho-Thr421) pAb Blocking Peptide 100 μg RP19921 $50 Tau (Phospho-Ser235) pAb Blocking Peptide 100 μg RP19726 $50 p73 (Phospho-Tyr99) pAb Blocking Peptide 100 μg RP19645 $50 Tau (Phospho-Ser262) pAb Blocking Peptide 100 μg RP19735 $50 p95/NBS1 (Phospho-Ser343) pAb Blocking Peptide 100 μg RP19643 $50 Tau (Phospho-Ser404) pAb Blocking Peptide 100 μg RP19737 $50 PAK1 (Phospho-Thr212) pAb Blocking Peptide 100 μg RP19803 $50 Tau (Phospho-Thr231) pAb Blocking Peptide 100 μg RP19733 $50 PAK1/PAK2/PAK3 (Phospho-Thr423/Thr402/Thr421) VASP (Phospho-Ser157) pAb Blocking Peptide 100 μg RP19859 $50 100 μg RP19821 $50 pAb Blocking Peptide VASP (Phospho-Ser239) pAb Blocking Peptide 100 μg RP19807 $50 Paxillin (Ab-118) pAb Blocking Peptide 100 μg RP19729 $50 Vav (Phospho-Tyr174) pAb Blocking Peptide 100 μg RP19783 $50 Blocking Peptides Paxillin (Phospho-Tyr118) pAb Blocking Peptide 100 μg RP19703 $50 VEGFR2 (Phospho-Tyr1175) pAb Blocking Peptide 100 μg RP19693 $50 Paxillin (Phospho-Tyr31) pAb Blocking Peptide 100 μg RP19851 $50 VEGFR2 (Phospho-Tyr1214) pAb Blocking Peptide 100 μg RP19695 $50 PDK1 (Phospho-Ser241) pAb Blocking Peptide 100 μg RP19545 $50 VEGFR2 (Phospho-Tyr951) pAb Blocking Peptide 100 μg RP19697 $50 PKCβ (Phospho-Thr642) pAb Blocking Peptide 100 μg RP19825 $50 Zap-70 (Phospho-Tyr319) pAb Blocking Peptide 100 μg RP19809 $50 PKCδ (Phospho-Ser645) pAb Blocking Peptide 100 μg RP19969 $50 Zap-70 (Phospho-Tyr493) pAb Blocking Peptide 100 μg RP19811 $50 PKCθ (Phospho-Ser676) pAb Blocking Peptide 100 μg RP19971 $50 β-Catenin (Phospho-Ser33) pAb Blocking Peptide 100 μg RP19865 $50 Blocking Peptides PKCθ (Phospho-Ser695) pAb Blocking Peptide 100 μg RP19827 $50 β-Catenin (Phospho-Ser37) pAb Blocking Peptide 100 μg RP19867 $50 PKD/PKCμ (Phospho-Ser738) pAb Blocking Peptide 100 μg RP19683 $50 β-Catenin (Phospho-Thr41,Ser45) pAb Blocking Peptide 100 μg RP19741 $50 PKD/PKCμ (Phospho-Ser910) pAb Blocking Peptide 100 μg RP19717 $50 PKR (Phospho-Thr451) pAb Blocking Peptide 100 μg RP19961 $50 PKR (Phospho-Thr446) pAb Blocking Peptide 100 μg RP19953 $50 PLCγ1 (Phospho-Tyr783) pAb Blocking Peptide 100 μg RP19719 $50 PLCγ2 (Phospho-Tyr753) pAb Blocking Peptide 100 μg RP19831 $50 Progesterone Receptor (Phospho-Ser190) pAb 100 μg RP19675 $50 Blocking Peptide
Your Innovation Partner in Drug Discovery! - 189 - www.genscript.com - 190 - Cosmetic Peptides
Research- and cGMP-grade cosmetic peptides for extra specification Product Cas No. Purity Quantity Cat.No. Price 9-fluorenylmethanol 24324-17-2 ≥98% 500 g C01518 $132 • Quantity—Batch size ranges from mg to kg with purity level The intrinsic properties of peptides, particularly their ability to 100 g $110 up to 98%. Purity levels can be tailored to each customer's mediate key biological functions, have attracted the most BOP-Reagent 56602-33-6 ≥99% C01519 needs. technologically advanced companies in cosmetic industry. 500 g $330 Cosmetic peptides are the new weapon in the battle against 100 g $50 • Modification—We provide an array of peptide modification CDI 530-62-1 ≥97% C01520 options that can improve the skin permeating, anti-aging, skin aging and the latest addition to the ranks of cosmeceuticals 500 g $150 and anti-wrinkle properties of each peptide. and dermaceuticals being developed by skin care companies all 100 g $56 DMAP 1122-58-3 NA C01521 • Consistency—Batch-to-batch consistency is guaranteed. over the world. By employing the most advanced peptide 500 g $154 synthesis techniques and instrumentations available, GenScript • Applicability—GenScript provides custom and generic 100 g $83 can manufacture research- and cGMP-grade cosmetic peptides DMT-Cl 40615-36-9 ≥98.2% C01522 research- and cGMP-grade cosmetic peptides for a range of 500 g to each client's exact specifications. GenScript's technical $250 pharmaceutical and biotechnology applications. 100 g $160 • Content—Our cosmetic peptides are sold by net peptide expertise and stringent QC, together with our dedication to EDC•HCl 25952-53-8 ≥98.5% C01523 500 g $480 weight as determined by amino acid analysis and/or UV. innovation and quality, ensure a strong partnership for success. 25 g $67 • Price—GenScript provides large scale production of Fmoc-Acp-OH 88574-06-5 ≥98% C01524 cosmetic peptides at highly competitive price. 100 g $200 5 g $29 Fmoc-D-Ala-OH 79990-15-1 ≥98% 25 g C01525 $53 Product Overview: 100 g $160 5 g $2,200 Product Cat. No. Price Fmoc-D-Arg(pbf)-OH 187618-60-6 ≥97% 25 g C01526 $733 Acetyl Hexapeptide-3 RP20002 Quote 100 g $244 GHK-Cu RP20125 Quote 5 g $2,070 PAL-GHK RP20128 Quote Fmoc-D-Asn(Trt)-OH 180570-71-2 ≥98% 25 g C01527 $690 Palmitoyl Pentapeptide RP20045 Quote 100 g $230 Palmitoyl Tetrapeptide-3 RP20100 Quote 5 g $230 Fmoc-D-Asp(OtBu)-OH 112883-39-3 ≥98% 25 g C01528 $690 100 g $2,070 5 g $220 Fmoc-D-Cys(Trt)-OH 167015-11-4 ≥98% 25 g C01529 $660 Pharmaceuticals 100 g $1,990 5 g $185 Product Overview: Fmoc-D-Gln(Trt)-OH 200623-62-7 ≥98% 25 g C01530 $553 100 g $1,658 Peptides Product Cas No. Purity Quantity Cat.No. Price 5 g $109 BKC 8001-54-5 ≥99% 100 g C01683 $70 Fmoc-D-Glu(OtBu)-OH 104091-08-9 ≥98% 25 g C01531 $327 Cetrimide 8044-71-1 ≥99% 100 g C01684 $70 100 g $980
Peptides DIMESNA 16208-51-8 ≥99% 100 g C01687 $200 5 g $218 MESNA 19767-45-4 ≥99% 100 g C01686 $112 Fmoc-D-His(Trt)-OH 135610-90-1 ≥98% 25 g C01532 $654 100 g $1,962 5 g $480 Fmoc-D-Ile-OH 143688-83-9 ≥98.5% 25 g C01533 $1,920 100 g $5,760 Peptide Building Blocks 5 g $75 Peptide Building Blocks Fmoc-D-Leu-OH 114360-54-2 ≥98% 25 g C01534 $223 Product Overview: 100 g $668 5 g $93
Product Cas No. Purity Quantity Cat.No. Price Fmoc-D-Lys(Boc)-OH 92122-45-7 ≥98% 25 g C01535 $277 100 g $830 100 g $98 2-Br-Z-Osu 128611-93-8 NA C01514 500 g $426 5 g $66 Cosmetic Peptides Fmoc-D-Met-OH 112883-40-6 ≥98% 25 g C01536 $198 25 g $131 100 g $594 2-Cl-(Trt)-Cl resin 42074-68-0 ≥97% 100 g C01515 $435 5 g $48 500 g $1,744 Fmoc-D-Phe-OH 86123-10-6 ≥98% 25 g C01537 $143 100 g $62 2-Cl-Z-Osu 65853-65-8 NA C01516 100 g $428 500 g $185 5 g $68 25 g $57 Fmoc-D-Pro-OH 101555-62-8 ≥98% 25 g C01538 $202 100 g C01517 $170 3-Tritylmercapto Propionicacid 27144-18-9 ≥98% 100 g $606 500 g $680
Your Innovation Partner in Drug Discovery! - 191 - www.genscript.com - 192 - Product Cas No. Purity Quantity Cat.No. Price Product Cas No. Purity Quantity Cat.No. Price 5 g $212 100 g $75 Fmoc-L-Pro-OH 71989-31-6 ≥98% C01558 Fmoc-D-Ser(tBu)-OH 128107-47-1 ≥98% 25 g C01539 $635 500 g $261 100 g $1,904 25 g $89 5 g $235 Fmoc-L-Ser(tBu)-OH 71989-33-8 ≥98% 100 g C01559 $270 Fmoc-D-Thr(tBu)-OH 138797-71-4 ≥98% 25 g C01540 $700 500 g $938 100 g $2,100 25 g $88 5 g $230 Fmoc-L-Thr(tBu)-OH 71989-35-0 ≥98% 100 g C01560 $263 Fmoc-D-Trp(Boc)-OH 163619-04-3 ≥95% 25 g C01541 $695 500 g $920 100 g $2,075 25 g $188 5 g $55 Fmoc-L-Trp(Boc)-OH 143824-78-6 ≥95% 100 g C01561 $565 Fmoc-D-Trp-OH 86123-11-7 ≥98% 25 g C01542 $160 500 g $1,980 100 g $480 25 g $92 5 g $363 Fmoc-L-Tyr(tBu)-OH 71989-38-3 ≥98% 100 g C01562 $276 Fmoc-D-Tyr(tBu)-OH 118488-18-9 ≥98% 25 g C01543 $1,090 500 g $969 100 g $3,268 100 g $75 Fmoc-L-Val-OH 68858-20-8 ≥98% C01563 5 g $66 500 g $261 Fmoc-D-Val-OH 84624-17-9 ≥98% 25 g C01544 $195 25 g $263 100 g $590 Fmoc-Orn(Boc)-OH 109425-55-0 ≥98% 100 g C01564 $788 100 g $87 500 g $2,760 Fmoc-L-Ala-OH 35661-39-3 ≥98% C01545 500 g $261 100 g $55 Fmoc-Osu 82911-69-1 ≥98% C01565 25 g $230 500 g $134 Fmoc-L-Arg(pbf)-OH 154445-77-9 ≥98% 100 g C01546 $690 25 g $97 500 g $1,790 HATU 148893-10-1 NA 100 g C01566 $364 25 g $140 500 g $1,574 Fmoc-L-Asn(Trt)-OH 132388-59-1 ≥98% 100 g $290 100 g $80 C01547 HBTU 94790-37-1 ≥98% C01567 500 g $801 500 g $280 25 g $104 25 g $79 Fmoc-L-Asp(OtBu)-OH 71989-14-5 ≥98% 100 g C01548 $312 HOAT 39968-33-7 ≥99% 100 g C01568 $296 500 g $938 500 g $1,283 25 g $70 100 g $56 HOSu 6066-82-6 ≥99% C01570 Fmoc-L-Cys(Trt)-OH 103213-32-7 ≥98% 100 g C01549 $210 500 g $150 Peptides 500 g $632 25 g $51 25 g $102 Merrifield resin 55844-94-5 NA 100 g C01571 $152 Fmoc-L-Gln(Trt)-OH 132327-80-1 ≥98% C01550 500 g $920 500 g $535
Peptides 25 g $89 25 g $55 Fmoc-L-Glu(OtBu)-OH 71989-18-9 ≥98.5% 100 g C01551 $268 PyBOP 128625-52-5 ≥97% 100 g C01572 $114 500 g $938 500 g $495 100 g $70 25 g $340 Fmoc-L-Gly-OH 29022-11-5 ≥98% C01588 Rink Amide AM resin NA NA C01573 500 g $210 100 g $1,184 25 g $43 25 g $230 Rink Amide Linker 145069-56-3 ≥99% C01574 Fmoc-L-His(Trt)-OH 109425-51-6 ≥98% 100 g C01552 $153 100 g $692 Peptide Building Blocks 500 g $687 Tert- Butyldimethylsiyl chloride 18162-48-6 ≥98% 500 g C01575 $140 100 g $75 25 g $63 Fmoc-L-Ile-OH 71989-23-6 ≥98% C01553 500 g $261 Wang resin 201058-08-4 NA 100 g C01576 $233 25 g $35 500 g $1,010 Fmoc-L-Leu-OH 35661-60-0 ≥98.5% 100 g C01554 $75 500 g $261 NA: Not available 25 g $60 100 g C01555 $180 Peptide Building Blocks Fmoc-L-Lys(Boc)-OH 71989-26-9 ≥98% 500 g $632 100 g $75 Fmoc-L-Met-OH 71989-28-1 ≥98% C01556 500 g $261 100 g $75 Fmoc-L-Phe-OH 35661-40-6 ≥98% C01557 500 g $261
Your Innovation Partner in Drug Discovery! - 193 - www.genscript.com - 194 - Other Peptides
Peptides with reliable quality and low cost are supplied by GenScript for your research. Product PurityQuantity Cat. No. Price Product Overview: Adipokinetic Hormone (AKH) II, Locusta migratoria >95% 1 mg RP17300 $74 Product PurityQuantity Cat. No. Price Adipokinetic Hormone (AKH) II, Schistocera gregaria >95% 1 mg RP13768 $48 [Arg3, 14]-CTX IV (3-14) >95% 1 mg RP17304 $83 Adipokinetic Hormone (AKH), Heliothis Zea >95% 1 mg RP11316 $24 [Arg8]-Vasotocin >95% 1 mg RP10061 $33 Adipokinetic Hormone (AKH), locust >95% 1 mg RP11319 $33 [Asp371]-Tyrosinase (369-377), human >95% 1 mg RP10270 $52 Adrenocorticotropic Hormone (ACTH) (1-10), human >95% 5 mg RP11299 $57 1 mg $24 Adrenocorticotropic Hormone (ACTH) (1-13), human >95% 0.5 mg RP11300 $29 [D-Ala2]-Deltorphin I >95% RP10433 5 mg $81 Adrenocorticotropic Hormone (ACTH) (1-14) >95% 1 mg RP12908 $48 [Des-Arg9]-Bradykinin >95% 5 mg RP13625 $33 Adrenocorticotropic Hormone (ACTH) (1-16), human >95% 0.5 mg RP11301 $33 [Des-Asp1]-Angiotensin I, human >95% 5 mg RP13717 $38 Adrenocorticotropic Hormone (ACTH) (1-17), human >95% 0.5 mg RP11302 $33 [D-Phe7]-Bradykinin >95% 1 mg RP11140 $38 Adrenocorticotropic Hormone (ACTH) (1-24), human >95% 0.5 mg RP11303 $29 [D-Trp11]-Neurotensin >95% 5 mg RP11887 $95 Adrenocorticotropic Hormone (ACTH) (1-39), human >95% 0.5 mg RP11304 $90 [Gln4]-Neurotensin >95% 1 mg RP10447 $24 Adrenocorticotropic Hormone (ACTH) (1-39), rat >95% 0.5 mg RP11305 $90 [Gln8,9]-Helodermin >95% 0.5 mg RP10633 $90 Adrenocorticotropic Hormone (ACTH) (1-4) >95% 5 mg RP12907 $57 [Gln8]-C517 (LH-RH), chicken >95% 1 mg RP10689 $24 1 mg $95 Adrenocorticotropic Hormone (ACTH) (18-39), human >95% RP11307 [Hyp3]-Bradykinin >95% 0.5 mg RP13626 $24 5 mg $380 [Ile7] Angiotensin III >95% 5 mg RP11267 $24 Adrenocorticotropic Hormone (ACTH) (4-10), human >95% 5 mg RP11308 $57 [Leu5]-Enkephalin >95% 25 mg RP10884 $29 Adrenomedullin (AM) (13-52), human >95% 0.5 mg RP11291 $214 [Leu5]-Enkephalin, amide >95% 5 mg RP10885 $24 Adrenomedullin (AM) (1-52), human >95% 0.5 mg RP11288 $261 [Lys8]-Vasopressin >95% 1 mg RP10069 $24 Adrenomedullin (AM) (22-52), human >95% 0.5 mg RP11293 $90 [Met128]-HA (126-138) >95% 1 mg RP20241 $73 Adrenomedullin (AM), canine >95% 0.1 mg RP13758 $171 [Met5]-Enkephalin >95% 25 mg RP10886 $52 1 mg $29 Adrenorphin >95% RP10421 [Met5]-Enkephalin, amide >95% 10 mg RP10887 $24 5 mg $109 [Nle11]-Substance P >95% 1 mg RP10207 $24 0.1 mg $356 Agouti Related Protein AGRP (87-132), human >95% RP12906 1 mg $67 0.5 mg $1,425 [Nle4, D-Phe7]-α-Melanocyte Stimulating Hormone (MSH), amide >95% RP10658 5 mg $266 Ala-Gly-Asp-Val >95% 5 mg RP10827 $24 [Pro9]-Substance P >95% 0.5 mg RP10208 $24 Ala-Leu-Ala-Leu >95% 1 mg RP10128 $24 [Sar1, Ile8]-Angiotensin II >95% 5 mg RP13720 $38 1 mg $62 Ala-Lys-Arg-Arg-Arg-Leu-Ser-Ser-Leu-Arg-Ala >95% RP11604 [Sar1]-Angiotensin II >95% 5 mg RP11270 $24 5 mg $238 [Sar9]-Substance P >95% 1 mg RP10210 $33 1 mg $33 Allatostatin I >95% RP11281 [Ser140]-Myelin Proteolipid Protein (139-151) (depalmitoylated), bovine, dog, 5 mg $119 Peptides >95% 0.5 mg RP10550 $43 human, mouse, rat 1 mg $24 Alytesin >95% RP10451 5 mg $95 [Thr1-Ala2-Pro3-Arg4]-Atrial Natriuretic Peptide (ANP) (Urodilatin), human >95% 0.5 mg RP11926 $114 Peptides Amylin (8-37), amide, rat >95% 0.5 mg RP11277 $81 [Tyr1]-MIF-1 >95% 5 mg RP13116 $57 Amylin (8-37), human >95% 0.5 mg RP11276 $128 [Tyr1]-Somatostatin >95% 1 mg RP10244 $43 Amylin, amide, rat >95% 0.5 mg RP11280 $109 [Tyr1]-W-MIF-1 >95% 5 mg RP10477 $57 Amylin, feline >95% 0.5 mg RP13732 $238 [Tyr11]-Somatostatin >95% 1 mg RP10242 $43 Amylin, human, amide >95% 0.5 mg RP11278 $138 1 mg $33 Angiotensin Converting Enzyme Inhibitor >95% 5 mg RP11321 $24 4 RP11164 [Tyr ]-Bombesin >95% 2 5 mg $86 Angiotensin I Converting Enzyme Inhibitor ([Des-Pro ]-Bradykinin) >95% 5 mg RP11324 $24 Other Peptides [Tyr5,12, Lys7]-Polyphemusin II >95% 0.1 mg RP10057 $90 Angiotensin I Converting Enzyme Inhibitor (Bradykinin Potentiator C) >95% 5 mg RP11323 $24 [Tyr8]-Bradykinin >95% 5 mg RP11151 $33 Angiotensin I, human >95% 5 mg RP11251 $24 [Tyr8]-Substance P >95% 1 mg RP10213 $24 Angiotensin I-Converting Enzyme Inhibitor (Bradykinin Potentiator B) >95% 5 mg RP11322 $24 [Val5]-Angiotensin II, human >95% 5 mg RP11273 $24 Angiotensin II (1-4), human >95% 5 mg RP11252 $24 Other Peptides Eledoisin >95% 1 mg RP10456 $24 Angiotensin II (3-8), human >95% 5 mg RP11253 $24 1 mg $105 Angiotensin II (4-8), human >95% 5 mg RP11254 $24 2B-(A) >95% RP11391 5 mg $418 Angiotensin II, human >95% 5 mg RP11257 $24 1 mg $105 Angiotensin III, human >95% 5 mg RP11259 $24 2B-(S) >95% RP11392 5 mg $418 Angiotensin, canine, rat >95% 5 mg RP11260 $38 A-779 >95% 1 mg RP11249 $43 1 mg $24 Angiotensinogen (1-14), human >95% RP10253 Abl Cytosolic Substrate >95% 0.5 mg RP19985 $45 5 mg $71 Abz-FR-K (Dnp)-P-OH >95% 1 mg RP20115 $63 Anorexigenic Peptide >95% 1 mg RP10556 $24 Achatina Cardio-Excitatory Peptide-1 (ACEP-1) >95% 1 mg RP20304 $46 Antagonist G >95% 0.5 mg RP10174 $71
Your Innovation Partner in Drug Discovery! - 195 - www.genscript.com - 196 - Product PurityQuantity Cat. No. Price Product PurityQuantity Cat. No. Price Antiestrogen >95% 0.5 mg RP10558 $52 Buccalin >95% 1 mg RP10452 $29 Apamin >95% 0.5 mg RP11002 $62 Bursin >95% 5 mg RP10564 $57 Apelin-13, bovine, human >95% 0.5 mg RP11221 $38 Calcineurin Autoinhibitory Peptide >95% 0.5 mg RP10272 $67 Apelin-36, bovine >95% 0.1 mg RP13713 $95 Calcineurin Substrate >95% 1 mg RP10139 $90 Apelin-36, human >95% 0.1 mg RP13714 $95 Calcitonin (8-32), salmon >95% 0.2 mg RP13606 $138 Arg-Arg-Arg-Asp-Asp-Asp-Ser-Asp-Asp-Asp >95% 0.5 mg RP10318 $52 Calcitonin Gene Related Peptide (CGRP) (8-37), human >95% 0.5 mg RP11089 $90 Arg-Gly-Asp-Cys >95% 5 mg RP10860 $24 Calcitonin Gene Related Peptide (CGRP) (8-37), rat >95% 0.5 mg RP11090 $90 Arg-Gly-Asp-Ser >95% 5 mg RP10861 $24 Calcitonin Gene Related Peptide (CGRP) II, rat >95% 0.5 mg RP11092 $119 Arg-Gly-Asp-Val >95% 5 mg RP10864 $24 Calcitonin Gene Related Peptide (CGRP), chicken >95% 0.5 mg RP11093 $119 Arg-Gly-Glu-Ser >95% 0.5 mg RP13448 $33 Calcitonin Gene Related Peptide (CGRP), rat >95% 0.5 mg RP11095 $128 1 mg $24 Calcitonin, chicken >95% 0.5 mg RP11096 $71 Arg-Gly-Tyr-Ser-Leu-Gly >95% RP10266 5 mg $81 1 mg $109 Calcitonin, eel >95% RP12786 1 mg $24 5 mg $451 Arg-Lys-Arg-Ser-Arg-Ala-Glu >95% RP10268 5 mg $81 Calcitonin, rat >95% 0.5 mg RP11098 $71 Arg-Phe, amide >95% 5 mg RP13655 $25 Calcitonin, salmon >95% 0.5 mg RP11099 $57 Arg-Phe-Asp-Ser >95% 0.5 mg RP13449 $38 Calmodulin Binding Peptide 1 >95% 0.02 mg RP13247 $143 1 mg $24 Cardiotoxin Analog (CTX) IV (6-12) >95% 1 mg RP17303 $58 Arg-Ser-Arg >95% RP10614 5 mg $48 1 mg $256 Casein Kinase Substrates 1 >95% RP20212 Asp-Asp-Asp-Asp-Asp >95% 1 mg RP10575 $38 5 mg $1,150 Asp-Asp-Asp-Asp-Asp-Asp >95% 1 mg RP10576 $38 Catch-Relaxing Peptide (CARP) >95% 1 mg RP13656 $133 Astressin >95% 0.5 mg RP10980 $119 CAYHRLRRC >95% 1 mg RP20098 $54 Atrial Natriuretic Peptide (ANP) (1-11), rat >95% 1 mg RP11190 $38 CDK5 Substrate (Phospho-Thr3) >95% 0.5 mg RP20107 $53 Atrial Natriuretic Peptide (ANP) (1-28), human, porcine >95% 0.5 mg RP11927 $95 Cecropin B >95% 0.5 mg RP11225 $138 Atrial Natriuretic Peptide (ANP) (1-28), rat >95% 0.5 mg RP11195 $114 CEF1, Influenza Matrix Protein M1 (58 - 66) >95% 0.5 mg RP19978 $50 Atrial Natriuretic Peptide (ANP) (1-30), frog >95% 0.5 mg RP11191 $128 CEF10 >95% 1 mg RP11772 $71 Atrial Natriuretic Peptide (ANP), eel >95% 0.2 mg RP13544 $143 CEF11 >95% 1 mg RP11773 $71 Atriopeptin I, rat >95% 0.5 mg RP11201 $81 CEF20 >95% 1 mg RP11781 $71 Atriopeptin II, rat >95% 0.5 mg RP11202 $119 CEF21 >95% 1 mg RP11782 $71 Atriopeptin III, rat >95% 0.5 mg RP11203 $109 CEF25 >95% 1 mg RP11786 $48 Auriculin A >95% 0.5 mg RP11204 $109 CEF3 >95% 1 mg RP11765 $48 Peptides Auriculin B >95% 0.5 mg RP11205 $109 CEF4 >95% 1 mg RP11766 $48 Autocamtide 2 >95% 1 mg RP10271 $48 CEF6 >95% 1 mg RP11768 $48
Peptides 1 mg $57 Cerebellin >95% 1 mg RP10453 $95 Bactenecin, bovine >95% RP11235 5 mg $228 Chemerin-9 (149-157) >95% 1 mg RP20248 $50 BAM-12P >95% 1 mg RP10422 $48 Chromostatin, bovine >95% 0.5 mg RP10400 $90 BAM-22P >95% 1 mg RP10424 $109 1 mg $62 c-Kit Ligand (KL)-1 >95% RP11739 Binin(102-120), Strongylocentrotus Purpuratus >95% 0.5 mg RP19984 $60 5 mg $247 BINP >95% 1 mg RP17301 $96 CKS-17 >95% 0.5 mg RP10281 $43
1 mg $24 1 mg $40 Other Peptides Bombesin >95% RP11157 c-Myc Peptide >95% RP11731 5 mg $90 5 mg $76 Bradykinin >95% 10 mg RP11129 $24 Colivelin >95% 1 mg RP20167 $153 Bradykinin (1-3) >95% 5 mg RP11130 $24 Collagen-Binding Fragment >95% 1 mg RP10828 $43 5 mg $24 Connective Tissue Activating Peptide (CTAP) >95% 0.5 mg RP10218 $52 Bradykinin (1-5) >95% RP11131 Other Peptides 25 mg $95 1 mg $88 Constrained Octapeptide >95% RP20222 5 mg $24 5 mg $394 Bradykinin (1-6) >95% RP11132 25 mg $95 1 mg $33 Corazonin >95% RP10454 5 mg $24 5 mg $128 Bradykinin (1-7) >95% RP11133 25 mg $95 Corticotropin Releasing Factor, bovine >95% 0.5 mg RP10981 $109 5 mg $24 Corticotropin Releasing Factor, human, rat >95% 0.5 mg RP10982 $109 Bradykinin (2-9) >95% RP11135 25 mg $95 Corticotropin Releasing Factor, ovine >95% 0.5 mg RP10983 $109 Brain Natriuretic Peptide (BNP) (1-32), human >95% 0.5 mg RP11119 $109 Cortistatin 14, human, rat >95% 0.5 mg RP10972 $67 Brain Natriuretic Peptide (BNP) (1-32), rat >95% 0.5 mg RP11121 $109 C-Peptide (3-33), human >95% 0.5 mg RP11116 $109
Your Innovation Partner in Drug Discovery! - 197 - www.genscript.com - 198 - Product PurityQuantity Cat. No. Price Product PurityQuantity Cat. No. Price C-Peptide, dog >95% 0.5 mg RP11115 $109 1 mg $24 Fibronectin CS1 Peptide >95% RP10838 1 mg $90 5 mg $62 CREBtide >95% RP10142 5 mg $361 Fibronectin Fragment (Arg-Gly-Asp) >95% 0.5 mg RP13450 $25 Crosstide >95% 5 mg RP20200 $198 Fibronectin-Binding Protein >95% 0.5 mg RP10840 $81 Crustacean Cardioactive Peptide (CCAP) >95% 1 mg RP10572 $43 Flagelin22 >95% 0.5 mg RP19986 $70 Crystalline >95% 1 mg RP10425 $25 FYQLALT >95% 1 mg RP20117 $24 C-telopeptide >95% 0.5 mg RP10566 $43 Galanin Receptor Ligand M35 >95% 0.5 mg RP10808 $71 C-Type Natriuretic Peptide (CNP) (1-22), human >95% 0.5 mg RP11110 $86 Galanin Receptor Ligand M40 >95% 0.5 mg RP10809 $90 C-Type Natriuretic Peptide (CNP), chicken >95% 0.5 mg RP11112 $81 Galanin, bovine >95% 0.2 mg RP13446 $119 C-Type Natriuretic Peptide (CNP), frog >95% 0.2 mg RP13529 $67 Galanin, human >95% 0.5 mg RP10801 $90 Cyclic peptide 1 >95% 1 mg RP20270 $160 Galanin, porcine >95% 0.5 mg RP10802 $109 Cyclic peptide 2 >95% 1 mg RP20264 $160 Galanin, rat >95% 1 mg RP10803 $157 Cys Containing β-Amyloid (1-40) Binding Peptide >95% 1 mg RP20168 $153 Galanin-Like Peptide, human >95% 0.1 mg RP13435 $152 Cystatin C (40-54) >95% 1 mg RP20238 $84 Galanin-Like Peptide, rat >95% 0.1 mg RP13439 $190 Dermaseptin >95% 0.5 mg RP11228 $157 Galantide >95% 0.5 mg RP10804 $71 1 mg $24 Gastric Inhibitory Peptide (GIP), human >95% 0.5 mg RP10795 $90 Dermenkephalin >95% RP10881 5 mg $81 Gastrin Releasing Peptide, porcine >95% 0.5 mg RP10792 $81 Dermorphin >95% 5 mg RP10427 $95 Gastrin, chicken >95% 0.5 mg RP10793 $157 Dermorphin Analog >95% 0.5 mg RP13522 $24 Gastrin-1, human >95% 0.5 mg RP12740 $57 DYKDDDDK Peptide >95% 1 mg RP10586 $34 Gastrin-1, rat >95% 0.5 mg RP12742 $57 EGF Receptor Substrate 2 (Phospho-Tyr5) >95% 0.5 mg RP20109 $67 Gastrin-Releasing Peptide, human >95% 0.5 mg RP10791 $90 EGFR (988-993) (Phospho-Tyr5) >95% 0.5 mg RP20108 $74 Ghrelin, canine >95% 0.1 mg RP13416 $171 Egg Laying Hormone, aplysia >95% 0.5 mg RP10583 $90 Ghrelin, human >95% 0.1 mg RP13422 $90 Eledoisin Related Peptide >95% 5 mg RP10457 $38 1 mg $190 Ghrelin, rat >95% RP10781 1 mg $42 5 mg $760 Endokinin A/B >95% RP20302 5 mg $125 Glucagon (1-29), Human, Hydrochloride Salt >95% 0.5 mg RP10772 $90 Endomorphin-1 >95% 5 mg RP10925 $43 1 mg $24 Glucagon (19-29), human >95% RP10770 Endomorphin-2 >95% 5 mg RP10926 $43 5 mg $95 Endonuclease Antigenic Site >95% 1 mg RP17306 $149 Glucagon-Like Peptide (GLP) I (7-36), amide, human >95% 0.5 mg RP10773 $90
0.25 mg $143 Glucagon-Like Peptide (GLP) I (7-37) >95% 0.5 mg RP12738 $119 Peptides Endothelin 1, human, porcine >95% RP12758 1 mg $361 Glucagon-Like Peptide (GLP) II, human >95% 0.5 mg RP10769 $90 Enfuvirtide (T-20) >95% 1 mg RP17307 $165 Glucagon-Like Peptide (GLP) II, rat >95% 0.5 mg RP10775 $138
Peptides Enterostatin (Ala-Pro-Gly-Pro-Arg), human, mouse, rat >95% 0.5 mg RP13462 $57 Glucagon-Like Peptide (GLP) II-Arg, human >95% 0.5 mg RP10774 $109 Enterostatin (Val-Pro-Asp-Pro-Arg) >95% 5 mg RP10629 $29 Gly-Ala-Tyr >95% 5 mg RP10589 $24 Epithelial Membrane Protein (EMP)-1 >95% 0.1 mg RP13257 $105 Gly-Arg-Gly-Asp-Asn-Pro >95% 1 mg RP10847 $24 Eptifibatide >95% 10 mg RP17308 $165 1 mg $24 Gly-Arg-Gly-Asp-Ser >95% RP10848 Erktide >95% 1 mg RP20197 $68 5 mg $81 Erythromycin Resistance Peptide >95% 5 mg RP17309 $149 Glycoprotein (276-286) >95% 0.5 mg RP19983 $39
Exendin (9-39) >95% 0.5 mg RP10872 $138 Gly-Gln >95% 5 mg RP13263 $25 Other Peptides Exendin-3 >95% 0.5 mg RP10873 $147 Gly-Phe-Arg >95% 20 mg RP10590 $29 0.5 mg $147 Gly-Pro-Arg >95% 5 mg RP10843 $29 Exendin-4 >95% RP10874 100 mg $3,200 1 mg $23 1 mg $48 GnRH-I >95% 5 mg RP20303 $58 Fibrinogen Binding Inhibitor Peptide >95% RP10832 Other Peptides 5 mg $176 25 mg $227 Fibrinogen-Binding Peptide >95% 5 mg RP17310 $50 GP (33-41) >95% 1 mg RP20091 $54 1 mg $24 GP (92-101) >95% 1 mg RP20243 $56 Fibrinolysis Inhibiting Factor >95% RP10834 5 mg $76 gp100 (476-485) >95% 1 mg RP20203 $72 1 mg $43 1 mg $190 Fibrinopeptide A, human >95% RP10835 gp38 >95% RP11942 5 mg $171 5 mg $760 1 mg $48 Granuliberin R >95% 1 mg RP10459 $33 Fibrinopeptide B, human >95% RP10836 5 mg $176 1 mg $29 Group A Streptococcal C5a Peptidase (SCPA) >95% RP10716 5 mg $109
Your Innovation Partner in Drug Discovery! - 199 - www.genscript.com - 200 - Product PurityQuantity Cat. No. Price Product PurityQuantity Cat. No. Price Growth Hormone Releasing Factor (GHRF) (1-44), human >95% 0.5 mg RP10734 $143 IRL-1038 >95% 0.2 mg RP13496 $76 Growth Hormone Releasing Factor (GHRF), bovine >95% 0.5 mg RP10735 $128 IRL-1620 >95% 0.2 mg RP13497 $33 Growth Hormone Releasing Factor (GHRF), mouse >95% 0.5 mg RP10736 $157 Joining Peptide, rat >95% 0.2 mg RP13668 $105 Growth Hormone Releasing Factor (GHRF), ovine >95% 0.5 mg RP10737 $109 1 mg $24 Kallikrein Inhibitor >95% RP10161 Growth Hormone Releasing Factor (GHRF), rat >95% 0.5 mg RP10739 $157 5 mg $90 Growth Hormone Releasing Factor (GHRF)-2 >95% 0.5 mg RP10740 $24 Kassinin >95% 1 mg RP10461 $24 Growth Hormone Releasing Factor (GHRF)-6 >95% 1 mg RP10741 $48 Katacalcin >95% 0.5 mg RP11102 $62 Guanylin, mouse, rat >95% 0.5 mg RP10722 $138 Kemptide >95% 1 mg RP10287 $25 1 mg $38 Kemptide (Phospho-Ser5) >95% 0.5 mg RP20111 $44 HA Peptide >95% RP11735 5 mg $152 Ketolide Resistance Peptide >95% 1 mg RP17320 $33 HABP52 >95% 1 mg RP20246 $90 Kinetensin >95% 1 mg RP10462 $24 Growth Hormone Releasing Factor (GHRF)-2 >95% 0.5 mg RP10740 $24 KLKL5KLK >95% 1 mg RP20088 $24 Growth Hormone Releasing Factor (GHRF)-6 >95% 1 mg RP10741 $48 Leucokinin I >95% 1 mg RP10692 $24 Guanylin, mouse, rat >95% 0.5 mg RP10722 $138 Leucokinin VIII >95% 1 mg RP10698 $24 1 mg $38 Leucomyosuppressin (LMS) >95% 0.5 mg RP13326 $38 HA Peptide >95% RP11735 5 mg $152 Leuprolide Acetate >95% 10 mg RP17321 $59 HABP52 >95% 1 mg RP20246 $90 Levitide >95% 1 mg RP10463 $24 HEL (46-61) >95% 1 mg RP11736 $114 Litorin >95% 1 mg RP10464 $29 Helodermin >95% 0.5 mg RP10591 $90 LL37 (Human) >95% 0.2 mg RP13323 $171 Helospectin I >95% 1 mg RP10592 $223 1 mg $62 L-Selectin >95% RP11740 Helospectin II >95% 1 mg RP10593 $223 5 mg $247 Hemopressin, human >95% 0.2 mg RP20204 $77 LSKL, Inhibitor of Thrombospondin (TSP-1) >95% 1 mg RP19990 $45 Hemopressin, rat, mouse, pig >95% 0.2 mg RP20205 $77 Luteinizing Hormone Releasing Hormone (LH-RH), human >95% 5 mg RP11937 $33 Hemorphin-7 >95% 1 mg RP17312 $66 Luteinizing Hormone Releasing Hormone (LH-RH), salmon >95% 1 mg RP10673 $24 Heparin Binding Peptide >95% 0.5 mg RP13456 $67 Lys-Arg-Gln-His-Pro-Gly >95% 0.5 mg RP12972 $29 Hepatitis B Virus Core (128-140) >95% 1 mg RP17313 $99 1 mg $24 Lys-Gly-Asp-Ser >95% RP10855 1 mg $171 5 mg $76 Hepatitis C Virus NS3 Protease Inhibitor 1 >95% RP11670 5 mg $513 Magainin 1 >95% 0.5 mg RP12814 $76 HER2/neu (654-662) GP2 >95% 1 mg RP17314 $99 Magainin 2 >95% 0.5 mg RP11232 $76
1 mg $71 MAGE-3 (271-279), human >95% 1 mg RP10641 $38 Peptides Hexa-His >95% RP11737 5 mg $190 Malantide >95% 1 mg RP10289 $57 Hexarelin >95% 1 mg RP17315 $165 MAPKAPK2 peptide >95% 1 mg RP20289 $77
Peptides Histatin 5 >95% 0.5 mg RP11240 $90 Mas17 >95% 1 mg RP10601 $24 HIV Integrase Protein Inhibitor(1) >95% 1 mg RP17317 $66 Mas7 >95% 1 mg RP10602 $24 HIV p17 Gag (77-85) >95% 1 mg RP17316 $99 Mas8 >95% 0.5 mg RP13314 $48 HIV Protease Substrate >95% 1 mg RP17318 $66 Mast Cell Degranulating Peptide >95% 0.5 mg RP10663 $119 HIV-I TAT Protein Peptide >95% 0.5 mg RP10129 $57 Mastoparan >95% 1 mg RP10465 $29 1 mg $45 Mastoparan X >95% 1 mg RP10466 $29 Hsp70-derived octapeptide >95% RP20220
5 mg $203 Mca-SEVNLDAEFR-K(Dnp)-RR, amide >95% 0.5 mg RP20114 $75 Other Peptides HSV-gB2 (498-505) >95% 0.5 mg RP19992 $27 Melanin Concentrating Hormone, rat >95% 0.5 mg RP10661 $109 Human Follicular Gonadotropin-Releasing Peptide (Hf-GRP) >95% 1 mg RP17319 $99 Melanin Concentrating Hormone, salmon >95% 0.5 mg RP10662 $109 Human Papillomavirus (HPV) E7 protein (49 - 57) >95% 1 mg RP20249 $45 Melanostatin, frog >95% 0.5 mg RP10467 $119 HYAb Dby >95% 1 mg RP20229 $84 Melanotan (MT)-II >95% 5 mg RP17323 $83
Other Peptides HYDb Smcy >95% 1 mg RP20233 $50 Melanotan (MT)-II, Locusta migratoria >95% 1 mg RP17305 $231 HYDb Uty >95% 1 mg RP20231 $50 0.5 mg $90 Melittin >95% RP10290 HYDk Smcy >95% 1 mg RP20232 $45 1 mg $157 HYEK Dby >95% 1 mg RP20230 $84 Men 10376 >95% 0.5 mg RP10468 $24 Indolicidin >95% 0.5 mg RP11242 $71 Minigastrin >95% 0.2 mg RP13431 $76 Influenza Hemagglutinin (307-319) >95% 1 mg RP20087 $72 1 mg $76 Moth Cytochrome C (MCC) (88-103) >95% RP12808 1 mg $38 5 mg $304 Interleukin (IL)-6 Receptor >95% RP11738 5 mg $152 Motilin, canine >95% 0.5 mg RP10526 $62 1 mg $95 Motilin, human, porcine >95% 0.5 mg RP10527 $62 Interphotoreceptor Retinoid-Binding Protein (1-20) >95% RP11841 5 mg $380
Your Innovation Partner in Drug Discovery! - 201 - www.genscript.com - 202 - Product PurityQuantity Cat. No. Price Product PurityQuantity Cat. No. Price MUC5AC >95% 1 mg RP20290 $72 Opioid Receptor Antagonist >95% 1 mg RP17327 $50 Mycobacterium tuberculosis Protein Ag85A >95% 1 mg RP20202 $90 Orexin B, canine >95% 0.5 mg RP10414 $90 Myelin Basic Protein (MBP) (1-11), human >95% 1 mg RP11629 $143 Orexin B, human >95% 0.5 mg RP10415 $90 Myelin Basic Protein (MBP) (68-82), guinea pig >95% 1 mg RP10605 $62 Orexin B, rat, mouse >95% 0.5 mg RP10416 $90 Myelin Basic Protein (MBP) (87-99), human >95% 1 mg RP11641 $143 Orphanin FQ/Nociceptin, human, mouse, ox, rat >95% 0.5 mg RP13084 $90 1 mg $38 OVA Peptide (257-264) >95% 1 mg RP10611 $62 Myelin Basic Protein (MBP) (synthetic) >95% RP10314 5 mg $152 1 mg $105 OVA Peptide (323-339) >95% RP10610 Myelin Oligodendrocyte Glycoprotein Peptide (35-55), 5 mg $418 >95% 1 mg RP10245 $143 mouse, rat Oxytocin >95% 5 mg RP10407 $57 1 mg $24 P1 >95% 0.5 mg RP13275 $86 Myomodulin >95% RP10606 5 mg $90 P16 Peptide 6 (84-103) >95% 1 mg RP17328 $116 N-Acetyl-Asp-Glu >95% 5 mg RP10553 $24 p2Ca >95% 0.5 mg RP19988 $25 N-Acetyl-Ser-Asp-Lys-Pro >95% 5 mg RP10555 $24 1 mg $62 P55-TNFR >95% RP11806 N-Acetyl-α-Endorphin >95% 1 mg RP11333 $48 5 mg $247 Naltriben (NTB) >95% 0.5 mg RP10221 $52 1 mg $62 P75-TNFR >95% RP11807 N-Boc-Phe-Leu-Phe-Leu-Phe >95% 5 mg RP12950 $29 5 mg $247 N-Cbz-Asp-Glu-Val-Asp-AMC >95% 5 mg RP11730 $143 PA (224-233), Influenza >95% 0.5 mg RP19991 $30 N-Cbz-Phe-Arg-AMC >95% 10 mg RP11385 $76 0.5 mg $105 PACAP (1-27), human, ovine, rat >95% RP10334 N-Cbz-Pro-D-Leu >95% 10 mg RP13118 $25 5 mg $722 N-Dansyl-Tyr-Val-Gly >95% 25 mg RP10144 $33 >95% 0.5 mg $143 PACAP (1-38), human, ovine, rat RP10335 Neurokinin A (4-10) >95% 1 mg RP10516 $33 >95% 5 mg $950 PACAP (6-27), human, ovine, rat Neurokinin B >95% 1 mg RP10517 $48 >95% 0.5 mg RP10337 $81 Neuromedin B >95% 1 mg RP10507 $38 0.5 mg $133 PACAP (6-38), human, ovine, rat >95% RP10338 Neuromedin C >95% 1 mg RP10508 $38 5 mg $950 Neuromedin N >95% 1 mg RP10509 $25 0.5 mg $162 PACAP 38, frog >95% RP10339 1 mg $124 5 mg $1026 Neuromedin U, rat >95% RP10510 PACAP-Related Peptide (PRP), human 5 mg $494 >95% 0.5 mg RP10341 $138 PACAP-Related Peptide (PRP), rat 1 mg $105 >95% 0.5 mg RP10342 $119 Neuropeptide F (NPF) >95% RP11610 Pancreastatin, porcine 5 mg $418 >95% 0.5 mg RP10403 $356
Pancreatic Polypeptide, avian Peptides Neuropeptide FF Morphine Modulating Neuropeptide >95% 1 mg RP10470 $24 >95% 0.5 mg RP10397 $109 Pancreatic Polypeptide, human Neuropeptide K, porcine >95% 0.5 mg RP10471 $119 >95% 0.5 mg RP10398 $81 Pancreatic Polypeptide, rat >95% 0.5 mg $57 >95% 0.5 mg RP10399 $95 Neuropeptide Y (13-36), human RP10488
Peptides Panx1 >95% 5 mg $380 >95% 1 mg RP20093 $24 Papain Inhibitor Neuropeptide Y (3-36), human >95% 0.5 mg RP10491 $81 >95% 5 mg RP10170 $29 PAR-1 agonist peptide Neuropeptide Y, human >95% 0.5 mg RP10492 $71 >95% 1 mg RP19979 $45 Neurotensin >95% 1 mg RP10439 $24 1 mg $124 PAR-1-Derived Peptide >95% RP11819 Neurotensin (1-11) >95% 1 mg RP10440 $24 5 mg $494 Neurotensin (8-13) >95% 5 mg RP10442 $57 1 mg $52 PAR-4 Agonist Peptide, amide >95% RP11529
Neurotensin (9-13) >95% 5 mg RP12913 $81 5 mg $209 Other Peptides Parasin I Neurotensin, frog >95% 0.5 mg RP12914 $38 >95% 0.5 mg RP11233 $90 Parathyroid Hormone (PTH) (1-34), bovine Neurotensin, guinea pig >95% 1 mg RP10444 $24 >95% 0.5 mg RP10364 $109 PB1-F2 (62-70) Neutrophil Activating Peptide (NAP) >95% 0.5 mg RP13271 $76 >95% 1 mg RP20086 $54 Pentagastrin N-Formyl-Met-Ala-Ser >95% 1 mg RP10587 $24 >95% 1 mg RP13432 $52 Other Peptides N-Formyl-Met-Leu-Phe >95% 5 mg RP12956 $29 1 mg $266 Pep 4AK >95% RP11668 N-Formyl-Met-Leu-Phe-Lys >95% 5 mg RP12958 $33 5 mg $798 Pep-1 (uncapped) N-Formyl-Nle-Leu-Phe-Nle-Tyr-Lys >95% 5 mg RP12959 $48 >95% 1 mg RP10130 $143 Pep27 NIVRKKK >95% 1 mg RP20116 $24 >95% 0.1 mg RP13276 $114 Pepducin P4pal-10 Nocistatin >95% 0.5 mg RP10472 $33 >95% 1 mg RP20293 $226 Peptide B, bovine NP (396-404) >95% 1 mg RP20090 $54 >95% 0.5 mg RP10431 $76 Peptide F, bovine NY-BR-1 p904 (A2) >95% 0.5 mg RP19987 $30 >95% 1 mg RP10432 $157 Peptide F-9 Octaneuropeptide >95% 1 mg RP17326 $107 >95% 0.2 mg RP13337 $38 Peptide II Amide Octreotide (SMS 201-995) >95% 5 mg RP10222 $119 >95% 1 mg RP20295 $103
Your Innovation Partner in Drug Discovery! - 203 - www.genscript.com - 204 - Product PurityQuantity Cat. No. Price Product PurityQuantity Cat. No. Price 1 mg $67 1 mg $35 Peptide LT >95% RP20221 SEB-BPI >95% RP20223 5 mg $304 5 mg $158 Peptide Standard 1 >95% 0.5 mg RP11747 $95 1 mg $67 SEB-BPII >95% RP20224 Peptide T >95% 5 mg RP13035 $95 5 mg $304 Peptide YY (PYY) (3-36), human >95% 0.5 mg RP10354 $114 1 mg $35 SEB-BPIII >95% RP20225 Peptide YY (PYY), human >95% 1 mg RP10355 $200 5 mg $158 Peptide YY (PYY), porcine >95% 0.5 mg RP10356 $119 Secretin, canine >95% 0.2 mg RP12943 $76 PGLa >95% 1 mg RP17329 $116 Secretin, chicken >95% 0.2 mg RP12944 $76 Phe-Met-Arg-Phe >95% 5 mg RP10814 $24 Secretin, human >95% 1 mg RP10249 $90 Phe-Met-Arg-Phe Like Peptide, Snail Helix aspersa >95% 1 mg RP13660 $25 Secretin, mouse >95% 0.2 mg RP12945 $143 Phe-Met-Arg-Phe, amide >95% 10 mg RP10818 $48 Secretin, porcine >95% 0.5 mg RP10247 $62 PHI (PHI-27), porcine >95% 0.5 mg RP10077 $109 Secretin, rat >95% 0.5 mg RP10248 $62 PHI (PHI-27), rat >95% 0.5 mg RP10078 $81 Secretoneurin, rat >95% 0.2 mg RP13702 $143 1 mg $38 Serum Thymic Factor >95% 1 mg RP10618 $24 Phosphate Acceptor Peptide >95% RP10299 5 mg $133 SHU 9119 >95% 0.2 mg RP13311 $76 Phyllolitorin >95% 0.5 mg RP12926 $48 Simian Immunodeficiency Virus (SIV) mac239-1, macaquesis >95% 1 mg RP12462 $166 Phyllomedusin >95% 1 mg RP10473 $52 Physalaemin >95% 1 mg RP10474 $29 Simian Immunodeficiency Virus (SIV) mac239-2, macaquesis >95% 1 mg RP12463 $166 PKG Substrate >95% 0.5 mg RP20112 $25 PKG Substrate (Phospho-Ser4) >95% 0.5 mg RP20113 $39 SIYRY >95% 1 mg RP20234 $45 Plasminogen Activator Inhibitor (PAI)-1 >95% 0.5 mg RP13279 $57 SLLK, Control Peptide for TSP1 Inhibitor >95% 1 mg RP19989 $45 PR-19 >95% 0.2 mg RP13281 $114 1 mg $29 Small Cardioactive Peptide B (SCPB) >95% RP10717 PR-39 >95% 0.2 mg RP13282 $209 5 mg $109 Prepro Enkephalin B (226-254) (Leumorphin), human >95% 0.2 mg RP13473 $57 Somatostatin >95% 5 mg RP10226 $57 Prepro Thyrotropin-Releasing Hormone (TRH) (160-169) >95% 1 mg RP10108 $43 Somatostatin 25 >95% 0.5 mg RP10227 $76 Prepro Thyrotropin-Releasing Hormone (TRH) (178-199) >95% 1 mg RP10109 $100 Somatostatin 28 >95% 0.5 mg RP10228 $90 Pressinoic Acid >95% 1 mg RP10408 $24 Somatostatin 28 (1-12) >95% 1 mg RP10229 $81 Proctolin >95% 1 mg RP10475 $24 Somatostatin 28 (1-14) >95% 1 mg RP10230 $81 Prolactin Releasing Peptide (12-31), human >95% 0.5 mg RP11864 $86 Speract >95% 1 mg RP10620 $38
0.5 mg $190 Spinorphin, bovine >95% 5 mg RP10889 $147 Peptides Prolactin Releasing Peptide (1-31), human >95% RP11861 5 mg $912 Stresscopin, human >95% 0.5 mg RP10214 $185 Protease-Activated Receptor-2 Activating Peptide >95% 1 mg RP19975 $41 Substance P >95% 5 mg RP10178 $43
Peptides Protein Kinase C Peptide Substrate >95% 5 mg RP20198 $378 Substance P (1-4) >95% 1 mg RP10179 $24 QL9 >95% 1 mg RP20092 $54 Substance P (1-7) >95% 1 mg RP10180 $24 Rad16-II >95% 1 mg RP20097 $78 Substance P (1-9) >95% 1 mg RP10181 $24 Ranatensin >95% 1 mg RP10476 $29 Substance P (7-11) >95% 1 mg RP10182 $24 Ranatensin R >95% 1 mg RP17330 $99 Substance P, Free Acid >95% 5 mg RP10185 $43 RC-160 (Vapreotide) >95% 0.5 mg RP10224 $52 Substance P, Methyl Ester >95% 5 mg RP10184 $119
Renin Inhibitor Peptide >95% 5 mg RP12817 $43 1 mg $38 Other Peptides Syntide 2 >95% RP10322 RFRP-1, human >95% 0.5 mg RP13686 $114 5 mg $152 1 mg $333 Systemin >95% 0.5 mg RP10622 $43 RGD-4C >95% RP12818 5 mg $1,368 0.5 mg $43 TAT >95% RP12784 Rigin >95% 5 mg RP10615 $29 5 mg $285
Other Peptides RR-SRC >95% 5 mg RP10315 $181 TAT 2-4 >95% 0.5 mg RP10131 $81 1 mg $24 Tetanus toxin (830-843) >95% 0.5 mg RP19980 $36 S6-1 >95% RP10320 5 mg $71 1 mg $62 Thrombin Receptor Agonist >95% RP10623 SAMs Peptide >95% 0.5 mg RP10172 $62 5 mg $247 Sarafotoxin 6c >95% 0.5 mg RP12761 $152 5 mg $24 Thymopentin >95% RP10119 Sauvagine >95% 0.5 mg RP11750 $105 100 mg $166 1 mg $81 Thymosin α1 >95% 0.5 mg RP10123 $119 Scyliorhinin I, amide, dogfish >95% 5 mg RP20301 $172 Thymus Factor >95% 1 mg RP10126 $24 25 mg $686 Thyrotropin-Releasing Hormone (TRH) >95% 5 mg RP10112 $24
Your Innovation Partner in Drug Discovery! - 205 - www.genscript.com - 206 - Related Biology Reagents
Product PurityQuantity Cat. No. Price Product Cas No.Purity Category Quantity Cat. No. Price Thyrotropin-Releasing Hormone (TRH), Free Acid >95% 5 mg RP10114 $24 100 g $37 TLQP-30 >95% 1 mg RP20245 $168 500 g $130 ACES 7365-82-4 ≥99% Biological Buffers C01609 TP508 >95% 1 mg RP20095 $135 5000 g $907 Trp-Lys-Tyr-Met-Val-Met, amide >95% 0.5 mg RP12960 $76 25000 g $3,173 Tuftsin >95% 5 mg RP10624 $24 100 g $51 1 mg $90 Tyrosine Kinase Peptide 1 >95% RP11594 500 g $179 5 mg $361 ACES Ultra 7365-82-4 ≥99% Biological Buffers C01610 5000 g $1,250 ubiquitin (65-76) >95% 0.5 mg RP19981 $27 25000 g $4,373 Uperolein >95% 1 mg RP10478 $52 100 g $37 Urocortin II, human >95% 0.5 mg RP10098 $166 500 g $130 Urocortin II, mouse >95% 0.5 mg RP10099 $166 ADA 26239-55-4 ≥99% Biological Buffers C01605 Urocortin III, human >95% 0.5 mg RP10100 $166 5000 g $907 Urocortin III, mouse >95% 0.5 mg RP10101 $166 25000 g $3,1$73 Urocortin, human >95% 0.5 mg RP10103 $119 100 g $54 Urocortin, rat >95% 0.5 mg RP10104 $109 500 g $190 ADA Disodium salt 41689-31-0 ≥99% Biological Buffers C01608 Urotensin I >95% 0.5 mg RP10094 $119 5000 g $1,328 Urotensin II, frog >95% 0.5 mg RP12919 $238 25000 g $4,648 Urotensin II, human >95% 0.5 mg RP10096 $62 100 g $54 Urotensin II, mouse 0.1 mg RP12920 $333 >95% 500 g $190 V14 1 mg RP20094 $66 ADA Monosodium salt 7415-22-7 ≥99% Biological Buffers C01607 >95% 5000 g $1,328 1 mg $100 Vanilloid Receptor Subtype 1 (VR1) >95% RP11755 25000 g $4,648 5 mg $399 100 g $76 VIP, guinea pig >95% 0.5 mg RP10084 $81 500 g $267 VIP, human, ovine, porcine, rat >95% 0.5 mg RP10085 $62 ADA Ultra 26239-55-4 ≥99% Biological Buffers C01606 Xenin >95% 0.5 mg RP10404 $90 5000 g $1,872 Xenopsin >95% 1 mg RP10479 $24 25000 g $6,551 α-Endorphin >95% 1 mg RP11328 $43 100 g $49 1 mg $24 500 g $171 α-Melanocyte-Stimulating Hormone (MSH), amide >95% RP10644 BES 10191-18-1 ≥99% Biological Buffers C01611 5 mg $57 5000 g $1,196 5 mg $24 25000 g $4,185 Peptides β-Casomorphin, human >95% RP11056 25 mg $95 100 g $99 β-Endorphin, camel >95% 1 mg RP11343 $109 500 g $346
Peptides β-Endorphin, equine >95% 0.2 mg RP13506 $57 BES Ultra 10191-18-1 ≥99% Biological Buffers C01612 5000 g $2,421 β-Endorphin, human >95% 1 mg RP11344 $71 25000 g $8,472 β-Endorphin, rat >95% 1 mg RP11346 $119 100 g $38 β-Melanocyte Stimulating Hormone (MSH), human >95% 1 mg RP10648 $90 500 g $132 γ-1-Melanocyte Stimulating Hormone (MSH), amide >95% 1 mg RP10650 $52 CAPS 1135-40-6 ≥99% Biological Buffers C01613 γ-3-Melanocyte-Stimulating Hormone (MSH) >95% 1 mg RP17325 $165 5000 g $921 25000 g $3,224 γ-Neuropeptide, rabbit >95% 0.5 mg RP10458 $81 Related Biology Reagents δ-Sleep Inducing Peptide >95% 1 mg RP10580 $24 100 g $58 500 g $202 CAPS Ultra 1135-40-6 ≥99% Biological Buffers C01614 5000 g $1,411 25000 g $4,939 Other Peptides 100 g $49 500 g $171 CAPSO 73463-39-5 ≥99% Biological Buffers C01615 5000 g $1,196 25000 g $4,185 100 g $75 500 g $261 CAPSO Sodium salt 102601-34-3 ≥99% Biological Buffers C01617 5000 g $1,828 25000 g $6,397
Your Innovation Partner in Drug Discovery! - 207 - www.genscript.com - 208 - Product Cas No.Purity Category Quantity Cat. No. Price Product Cas No.Purity Category Quantity Cat. No. Price 100 g $73 100 g $26 CAPSO Ultra 73463-39-5 ≥99% Biological Buffers 500 g C01616 $256 500 g $90 MES Monohydrate 145224-94-8 ≥99% Biological Buffers C01627 5000 g $1,789 5000 g $627 100 g $38 25000 g $2,195 500 g $134 100 g $40 CHES 103-47-9 ≥99% Biological Buffers C01618 5000 g $941 500 g $139 MES Monohydrate Ultra 145224-94-8 ≥99% Biological Buffers C01628 25000 g $3,293 5000 g $970 100 g $58 25000 g $3,396 500 g $204 100 g $71 CHES Ultra 103-47-9 ≥99% Biological Buffers C01619 5000 g $1,426 500 g $249 MES potassium salt 39946-25-3 ≥99% Biological Buffers C01632 25000 g $4,991 5000 g $1,740 100 g $330 25000 g $6,088 500 g $1,156 100 g $39 HEPBS 161308-36-7 ≥99% Biological Buffers C01620 5000 g $8,095 500 g $137 MES Sodium salt 71119-23-8 ≥99% Biological Buffers C01631 25000 g $28,332 5000 g $956 100 g $26 25000 g $3,344 500 g $90 100 g $36 HEPES 7365-45-9 ≥99% Biological Buffers C01621 5000 g $627 500 g $127 MOPS 1132-61-2 ≥99% Biological Buffers C01633 25000 g $2,195 5000 g $892 100 g $45 25000 g $3,121 500 g $158 100 g $56 HEPES hemisodium salt 103404-87-1 ≥99% Biological Buffers C01623 5000 g $1,103 500 g $197 MOPS hemisodium salt 117961-20-3 ≥99% Biological Buffers C01635 25000 g $3,859 5000 g $1,382 100 g $45 25000 g $4,836 500 g $158 100 g $45 HEPES Sodium salt 75277-39-3 ≥99% Biological Buffers C01624 5000g $1,103 500 g $158 MOPS sodium salt 71119-22-7 ≥99% Biological Buffers C01636 25000 g $3,859 5000 g $1,103 Peptides 100 g $76 25000 g $3,859 500 g $267 100 g $57 HEPES Sodium salt Ultra 75277-39-3 ≥99% Biological Buffers C01625 5000 g $1,872 500 g $200
Peptides MOPS Sodium salt Ultra 71119-22-7 ≥99% Biological Buffers C01637 25000 g $6,551 5000 g $1,401 100 g $40 25000 g $4,905 500 g $139 100 g $45 HEPES Ultra 7365-45-9 ≥99% Biological Buffers C01622 5000 g $970 500 g $158 MOPS Ultra 1132-61-2 ≥99% Biological Buffers C01634 25000 g $3,396 5000 g $1,107 100 g $52
25000 g $3,876 Related Biology Reagents 500 g $181 100 g $38 HEPPS 16052-06-5 ≥99% Biological Buffers C01626 5000 g $1,264 500 g $134 MOPSO 68399-77-9 ≥99% Biological Buffers C01638 25000 g $4,425 5000 g $936 100 g $38 25000 g $3,276 500 g $132 100 g $57 MES free water 4432-31-9 ≥99% Biological Buffers C01629 5000 g $926 500 g $200 MOPSO sodium salt 79803-73-9 ≥99% Biological Buffers C01639 25000 g $3,241 5000 g $1,397
Related Biology Reagents 100 g $50 25000 g $4,888 500 g $176 100 g $77 MES hemisodium salt 117961-21-4 ≥99% Biological Buffers C01630 5000 g $1,230 500 g $270 MOPSO sodium salt Ultra 79803-73-9 ≥99% Biological Buffers C01640 25000 g $4,305 5000 g $1,887 25000 g $6,603
Your Innovation Partner in Drug Discovery! - 209 - www.genscript.com - 210 - Product Cas No.Purity Category Quantity Cat. No. Price Product Cas No.Purity Category Quantity Cat. No. Price 100 g $35 1 ml $45 500 g $123 10 ml $360 PIPES 5625-37-6 ≥99% Biological Buffers C01641 dNTP (25 mM each) ≥99% HPLC NA ≥99% dNTP C01581 5000 g $862 50 ml $1,600 25000 g $3,018 250 ml $7,500 100 g $79 1 ml $45 500 g $275 10 ml $360 PIPES Dipotassium salt 108321-27-3 ≥99% Biological Buffers C01646 dTTP (100 mM) ≥99% HPLC 18423-43-3 ≥99% dNTP C01580 5000 g $1,926 50 ml $1,600 25000 g $6,740 250 ml $7,500 PIPES Dipotassium salt 76836-02-7 ≥99% Biological Buffers 100 g C01644 $50 Stabilized dNTP Mix, 10 mM each NA ≥99% dNTP 0.5 ml C01689 $29 100 g $50 10 g $292 500 g $176 ADOS 82692-96-4 ≥99% Diagnostic Chromogens 100 g C01592 $2,480 PIPES Monosodium salt 10010-67-0 ≥99% Biological Buffers C01643 5000 g $1,230 500 g $9,921 25000 g $4,305 10 g $216 100 g $53 ADPS 82611-88-9 ≥99% Diagnostic Chromogens 100 g C01591 $1,840 500 g $186 500 g $7,359 PIPES Sesquisodium salt 100037-69-2 ≥99% Biological Buffers C01645 5000 g $1,303 10 g $220 25000 g $4,562 ALPS 82611-85-6 ≥99% Diagnostic Chromogens 100 g C01600 $1,870 100 g $43 500 g $7,480 500 g $151 10 g $292 PIPES Ultra 5625-37-6 ≥99% Biological Buffers C01642 5000 g $1,058 DAOS 83777-30-4 ≥99% Diagnostic Chromogens 100 g C01595 $2,483 25000 g $3,704 500 g $9,933 100 g $45 10 g $164 500 g $158 DTNB 69-78-3 ≥99% Diagnostic Chromogens 100 g C01604 $1,396 TAPS 29915-38-6 ≥99% Biological Buffers C01647 5000 g $1,103 500 g $5,583 25000 g $3,859 10 g $302 100 g $77 HDAOS 82692-88-4 ≥99% Diagnostic Chromogens 100 g C01596 $2,571 500 g $270 500 g $10,282 TAPS Ultra 29915-38-6 ≥99% Biological Buffers C01648 Peptides 5000 g $1,887 10 g $374 25000 g $6,603 MADB 209518-16-1 ≥99% Diagnostic Chromogens 100 g C01597 $3,181 100 g $9 500 g $12,723 Peptides Tris HCl 1185-53-1 ≥99% Biological Buffers 500 g C01650 $32 10 g $266 5000 g $225 MAOS 82692-97-5 ≥99% Diagnostic Chromogens 100 g C01598 $2,261 1 ml $45 500 g $9,044 10 ml $360 10 g $167 dATP (100 mM) ≥99% HPLC 1927-31-7 ≥99% dNTP C01577 50 ml $1,600 TBHBA 14348-40-4 ≥99% Diagnostic Chromogens 100 g C01590 $1,421 $7,500 500 g $5,685
250 ml Related Biology Reagents 1 ml $45 10 g $243 10 ml $360 TMB 54827-17-7 ≥99% Diagnostic Chromogens 100 g C01601 $2,066 dCTP (100 mM) ≥99% HPLC 102783-51-7 ≥99% dNTP C01579 50 ml $1,600 500 g $8,262 250 ml $7,500 10 g $243 1 ml $45 TMB HCl 64285-73-0 ≥99% Diagnostic Chromogens 100 g C01602 $2,066 10 ml $360 500 g $8,262 dGTP (100 mM) ≥99% HPLC 93919-41-6 ≥99% dNTP C01578 50 ml $1,600 10 g $374
Related Biology Reagents 250 ml $7,500 TODB NA ≥99% Diagnostic Chromogens 100 g C01599 $3,181 1 ml $45 500 g $12,723 10 ml $154 10 g $195 dNTP (10 mM each) ≥99% HPLC NA ≥99% dNTP C01582 50 ml $720 TOOS 82692-93-1 ≥99% Diagnostic Chromogens 100 g C01594 $1,660 250 ml $2,500 500 g $6,640
Your Innovation Partner in Drug Discovery! - 211 - www.genscript.com - 212 - Product Cas No.Purity Category Quantity Cat. No. Price Product Cas No.Purity Category Quantity Cat. No. Price 10 g $197 100 g $70 TOPS 40567-80-4 ≥99% Diagnostic Chromogens 100 g C01593 $1,677 STAC 112-03-8 ≥99% Quaternary Ammonium Salts 500 g C01659 $176 500 g $6,706 20000 g $2,106 100 g $88 100 g $70 103B 2082-84-0 ≥99% Quaternary Ammonium Salts 500 g C01652 $221 TTAB 1119-97-7 ≥99% Quaternary Ammonium Salts 500 g C01656 $176 20000 g $2,646 20000 g $2,106 100 g $88 100 g $70 103C 10108-87-9 ≥99% Quaternary Ammonium Salts 500 g C01651 $221 TTAC 4574-4-3 ≥99% Quaternary Ammonium Salts 500 g C01655 $176 20000 g $2,646 20000 g $2,106 100 g $250 100 g $88 BETAB 2758-6-7 ≥99% Quaternary Ammonium Salts 500 g C01670 $625 Ultra C14-alkylbenzyldimethylammonium chloride 139-08-2 ≥99% Quaternary Ammonium Salts 500 g C01663 $221 20000 g $7,500 20000 g $2,646 100 g $250 1 g $175 MTT 2348-71-2 ≥99% Tetrazolium Salts C01678 BPTAB 3779-42-8 ≥99% Quaternary Ammonium Salts 500 g C01671 $625 10 g $1,138 20000 g $7,500 1 g $510 WST-1 150849-52-8 ≥99% Tetrazolium Salts C01672 100 g $38 10 g $3,600 CTAB 57-09-0 ≥99% Quaternary Ammonium Salts 500 g C01658 $94 1 g $510 WST-3 161617-45-4 ≥99% Tetrazolium Salts C01673 20000 g $1,128 10 g $3,600 100 g $70 1 g $510 WST-8 193149-74-5 ≥99% Tetrazolium Salts C01675 CTAC 112-02-7 ≥99% Quaternary Ammonium Salts 500 g C01657 $176 10 g $3,600 20000 g $2,106 1 g $510 XTT 111072-31-2 ≥99% Tetrazolium Salts C01676 100 g $82 10 g $3,600 DDAB 3282-73-3 ≥99% Quaternary Ammonium Salts 500 g C01667 $206 20000 g $2,466 100 g $70 DSAB 3700-67-2 ≥99% Quaternary Ammonium Salts 500 g C01669 $176 20000 g $2,106 100 g $70 Peptides DTAB 1119-94-4 ≥99% Quaternary Ammonium Salts 500 g C01654 $176 20000 g $2,106 Peptides 100 g $70 DTAC 112-00-5 ≥99% Quaternary Ammonium Salts 500 g C01653 $176 20000 g $2,106 100 g $88 EDDAB 68207-00-1 ≥99% Quaternary Ammonium Salts 500 g C01661 $221 20000 g $2,646 Related Biology Reagents 100 g $88 EHDAB 124-03-8 ≥99% Quaternary Ammonium Salts 500 g C01662 $221 20000 g $1,646 100 g $70 HDBAC 122-18-9 ≥99% Quaternary Ammonium Salts 500 g C01664 $176 20000 g $2,106 100 g $82
Related Biology Reagents Octyltrimethylammonium chloride 10108-86-8 ≥99% Quaternary Ammonium Salts 500 g C01665 $206 20000 g $2,466 100 g $70 STAB 1120-02-1 ≥99% Quaternary Ammonium Salts 500 g C01660 $176 20000 g $2,106
Your Innovation Partner in Drug Discovery! - 213 - www.genscript.com - 214 - Custom Peptide Services Applications
GenScript's proprietary FlexPeptideTM platform provides custom large-scale cGMP-grade peptide production services. • Monoclonal and polyclonal antibody production • Immunization and quantitative receptor-ligand interactions peptides of up to 200 residues in length and a capacity of 6,000 • Identification/synthesis of posttranslational modifications • Blocking and competition protease assay peptides per month. With a scale ranging from milligrams to GenScript's secure and simple online quotation/ordering • New techniques for separation by chromatography or • ELISA standards for measuring antibody titer kilograms, comprehensive labeling and modification options, systems offer easy access to our peptide synthesis services, electrophoresis • Non-quantitative enzyme-substrate studies and rapid high-throughput peptide library synthesis, this and our collection of catalog peptides. In addition, GenScript • Enzyme specificity and enzymatic mechanism studies • Non-quantitative peptide blocking studies platform is an ideal choice for peptide synthesis, and peptide offers the most competitive prices in the peptide synthesis • Antibody-antigen interactions • Structure, dynamics, and folding of peptides and proteins via library services. GenScript also offers cosmetic peptides and industry. • Biological effects of defined peptides NMR • Immunization and quantitative receptor-ligand interactions • Epitope mapping
Standard Price Easy Online Competitive UNBEATABLE Peptide Quotations and Ordering High Success Structure Ordering Price SERVICE Rate Quotations and orders may be placed by email, phone, or fax with either a formal PO (Purchase Order) or credit card. Please choose FlexPeptideTM Ensures Delivery and Quality! the most convenient ordering method.
Secured Online Quotation: https://www.genscript.com/ssl-bin/order_peptide_chemical GenScript’s FlexPeptideTM Technology FlexPeptideTM technology can synthesize peptide as long as 200 Quotation Form: Obtainable on our website Includes amino acids, which is a remarkable achievement in the industry. Peptide Modifications Email: [email protected] • Combined Platforms: Flexible choices of LPPS and SPPS, GenScript offers a wide range of peptide modification services achieved highest synthesis success rate including isotope labeling (2H, 15N, and 13C), PEGylation, Phone: 1-877-436-7274 (Toll-Free); 1-732-885-9188 • Microwave Technologies: High yield synthesis of peptides in multiple disulfide bonds, multiple phosphorylations, KLH, BSA, an efficient and smart way ovalbumin, amidation, acetylation, biotin, FITC, etc. Fax: 1-732-210-0262; 1-732-885-5878 • Ligation Technology: Long peptide up to 200 AA can be synthesized Peptide Library Service Secured Web Server: https://www.genscript.com/ssl-bin/secure_data GenScript has developed a rapid high-throughput parallel peptide synthesis platform, providing custom libraries of TM Advantages of GenScript’s FlexPeptide unbound peptides of 5–20 mer at very competitive prices. Technology Cosmetic Peptide Service Peptides GenScript's peptide synthesis offers researchers the following GenScript manufactures research- and cGMP-grade cosmetic benefits: peptides to each customer's exact specifications. We guarantee • High Success Rate Delivery: The technological platform with the best available quality for all cosmetic peptides. Peptides flexible choice of LPPS, SPPS, microwave technology, and Mirror-image Peptide Service proprietary ligation technology allows us to produce peptides as short as 2 AA and as long as 200 AA. GenScript is currently the only company in the industry to provide mirror-image peptide screening services. • High Efficiency: The use of microwave heating in peptide Recombinant Peptides synthesis can markedly reduce the time required to complete each cycle of coupling and deprotection. GenScript's recombinant peptide technology was developed to complement our chemical peptide synthesis service. The Custom Peptide Services • Improved Peptide Yield: Microwave energy can improve combination of the two technologies enables GenScript to peptide yield by preventing unwanted aggregation. provide its customers with peptides of any length and sequence, on any scale. • Decreased Cost: Microwave technology significantly cGMP Peptides decreases the cost of peptide synthesis by enhancing chemical reaction rate and reducing the quantity of GenScript provides a large-scale cGMP peptide service with a chemicals required for synthesis. capacity of up to kilograms per project. Our comprehensive experience in synthesizing cGMP-grade peptides for therapeu- Custom Peptide Services tic and diagnostic applications gives us an edge over the Services List competition. Consistency, viability, and delivery are guaranteed.
Peptide Synthesis GenScript offers quality peptides at very competitive prices in the industry, starting at $3.20 per amino acid. GenScript
Your Innovation Partner in Drug Discovery! - 215 - www.genscript.com - 216 - Chapter 6 Cellular Analysis
Apoptosis 219 Cell Cycle Analysis 224 Cell Proliferation 224 Cell Lines 225 Reagents for Cell Analysis 229 Custom Cell Line Services 231 - 219 Apoptosis Cellular Analysis • using theFITCchannelforgreenmonomers (detects FITCandrhodamine)oranalyzedbyflowcytometry detected byfluorescencemicroscopyusingaband-passfilter fluorescing green. The fluorescentsignalscanbeeasily causes JC-1toremaininthecytoplasmitsmonomerform, cells, thealteredpotentialofmitochondrialtransmembrane mitochondria, givingoff abrightredfluorescence.Inapoptotic cells. Inhealthycells,JC-1accumulatesandaggregatesinthe dye thatfluorescesdifferently inhealthycellsandapoptotic Mitochondrial Apoptosis DetectionKitutilizesJC-1,acationic • • Reliable andlow-costdetectionforpotentialofmitochondrialtransmembrane Mitochondrial Apoptosis DetectionKit apoptosis-associated diseasesandanalyzingtheeffectiveness apoptosis isavitalcomponentindevelopingtreatmentfor facilitate viralinfections.Reliabledetectionandmonitoringof apoptosis levelsmayresultinautoimmunedisordersand including AIDS, Alzheimer's, andParkinson's.Decreased Accelerated apoptosisisassociatedwithmanydiseases, Apoptosis constantly launchescellbiologyproductsandupdatesits proliferation assayreagents,andmanyothers.GenScript chapter ofproductsincludesapoptosisdetectionkits,cell biology, developmentalbiology, andoncologyresearch. This GenScript offers awideselectionofproductssuitableforcell Overview Product Overview: Enhanced Versatility— Quick Procedure— Extra Convenience— cytometer andfluorescencemicroscope. Mitochondrial Apoptosis Detection Kit(JC-1) Product Aassay canbefinishedin30 The kitisready-to-useformat. Directly analyzedbyflow Your Innovation PartnerinDrugDiscovery! minutes. 1 Kit(100 Assays) Quantity The resultsarebelow: stained withMitochondrial Apoptosis DetectionKit(L00291). Fluorescence microscopyanalyzedapoptoticandhealthycells aggregates (Ex/Em=488/590+42nm). (Ex/Em =488/530+30nm)andthePIchannelforred of compoundsthatinitiateor http://www.genscript.com/cell_biology.html correct informationonthewebsite, here differ fromthoseshownonthewebsite,pleasereferto website. Ifpricesandtheotherrelevantinformationpresented compounds. and theefficiency analysisforpro-andanti-apoptotic Apoptosis DetectionKitsare Negative Control L00291 Cat. No. designed for prevent apoptosis. biomedical Positive Control GenScript’s research Price $140 Double Stain Apoptosis DetectionKit(Hoechst33342/PI) Product Overview: Cell Apoptosis DAPIDetectionKit Product Overview: with protocolasdescribedabove. The resultisasfollow: hour at37°C,andprocedureswereaccomplishedaccording cells wereinducedapoptosisby10 observed byCell Apoptosis DAPIDetectionKit(L00312):P388 The morphologicalchangeofnuclearchromatininapoptosis identify apoptoticsamples. reasons, theintensityoffluorescencecanhelpresearchers increased numberofnuclearbodyfragments.Forthese nucleus, heaviercoloring,and,withnuclearpyknosis,an edges aroundthenucleus,chromosomeconcentrationin clear-edged, uniformlystained. Apoptotic cellsshowirregular In addition,thenuclearmorphologyofnormalcellsisround, permeability anduptakeofDAPI,leavingastrongerbluestain. membranes, butapoptosisincreasescellmembrane fluorescence. This dyecanpassthroughintact,livingcell phenylindole (DAPI)DNA-specificdyethatdisplaysablue Cell Apoptosis DAPIDetectionKitcontainsdiamidino-2- DNA), stainsthecondensedchromatininapoptoticcellsmore (excitation/emission maxima to DNA.Hoechst33342,atypeofblue-fluorescencedye apoptotic cells. This kitcontainstwoready-to-usedyesbound based uponfluorescentdetectionofcompactedchromatinin 33342/PI) providesarapidandconvenientassayforapoptosis GenScript’s DoubleStain Apoptosis DetectionKit(Hoechst Special andstrongbluefluorescencefordivisionapoptoticnormalcells Two-color fluorescentdyesforchromatincondensationinapoptoticcells Double Stain Apoptosis DetectionKit(Hoechst33342/PI) Product Cell Apoptosis DAPIDetection Kit Product ≈ 350/461 nmwhenboundto μ M camptothecinforone 1 Kit(100 Assays) 1 Kit(100 Assays) Quantity Quantity I:SaeIaVI:StageIIb III: StageIIa :CnrlII:StageI I: Control red-fluorescence dye(excitation/emissionmaxima brightly thannormalchromatin.Propidiumiodide(PI),a microscopy. dead cellpopulationsbyflowcytometryandfluorescence dyes makesitpossibletodistinguishnormal,apoptotic,and staining patternresultingfromthesimultaneoususeofthese when boundtoDNA),isonlypermeantdeadcells. The L00309 Cat. No. L00312 Cat. No. www.genscript.com ≈ 535/617 nm Price Price $199 $99
- 220
Apoptosis Cellular Analysis Cellular Cell Apoptosis PI Detection Kit Annexin V-EGFP Apoptosis Detection Kit
Reliable and easy kit for cell distinction and analysis More photo-stable and high-quality assay kit using EGFP and PI
• Superior Convenience—The kit is supplied ready-to-use. Observe and Analyze Appoptisis by Flow Cytometry • High Precision—This kit can detect cells in early period of Observation by Flow Cytometry • Simplified Procedure—The kit is quick and easy to use. apoptosis and accurately differentiate and compute the ratio • Strong Versatility—The kit can directly analyze normal and of normal cells, apoptosis cells, and necrotic cells. apoptotic cells by flow cytometry, fluorescence microscopy, Diploid:100.00 % • High Stabilization—EGFP has strong signals that are hard 600 Dip G1:52.46 % at 49.10; or fluorescent photometry. Dip G2:9.18 % at 93.24; to quench. Dip S:38.36 %; G2/G1:1.90; 400 • High Sensitivity—EGFP is brighter and much more %CV:4.58 GenScript's Cell Apoptosis PI Detection Kit provides a rapid and photo-stable than FITC. Apoptosis:3.85% Mean:33.02 convenient assay for apoptosis based upon fluorescent 200 detection. The kit includes ready-to-use propidium iodide (PI), a Apoptotic cells are known to display phosphatidylserine (PS) 0 DNA-specific red-fluorescence dye (excitation/emission maxima 0 20 40 60 80 100 120 molecules on their outer membranes, which allow safe Negative Control ≈ 535/617 nm). Propidium iodide is only permeant to dead Channels (PE-A-PI PE-A) clearance of apoptotic debris without activating inflammatory Control cells. Under fluorescent microscopy, normal cells are not pathways. To better distinguish apoptotic cells from necrotic stained, while dead cells show strong red fluorescence. The cells, GenScript uses a second fluorescent dye, propidium
intensity of the fluorescence of apoptotic cells is between dead Diploid:100.00 % iodide (PI) that only enters necrotic cells across damaged cells and normal cells. Under flow cytometry, DNA in the cells is Dip G1:41.68 % at 46.86; membranes. Using annexin V fused with EGFP to detect PS by 400 Dip G2:7.90 % at 88.03; degraded by endogenous nuclease activity and diffused out of Dip S:50.42 %; G2/G1:1.88; light microscopy or flow cytometry, GenScript’s Annexin cells as part of apoptosis. A highly definable sub-G1 peak 300 %CV:4.92 V-EGFP Apoptosis Detection Kit is nonenzymatic. It does not occurs and is easily quantified by PI. Cells can then be sorted 200 Apoptosis:10.65% Mean:31.19 require fixation and is suitable for both adherent and suspension and further analyzed by microscopy to verify the presence of 100 cells. Induced Group apoptotic cells. The change in DNA of the apoptotic cells is 0 then assayed by flow cytometry. 0 20 40 60 80 100 120 P388 cells were induced apoptosis by H O , and the detections Channels (PE-A-PI PE-A) 2 2 Induced Group were performed in accordance with the procedures described in Observe and analyze apoptosis by GenScript's Cell Apoptosis L00288. The results are as follows: PI Detection Kit (L00311): P388 cells were induced apoptosis by 10 μM camptothecin for one hour at 37°C. The results are Product Overview: as follows: Product Quantity Cat. No. Price Product Overview: Annexin V-EGFP Apoptosis Detection Kit 1 Kit (100 Assays) L00288 $168
Product Quantity Cat. No. Price Cell Apoptosis PI Detection Kit 1 Kit (100 Assays) L00311 $149
Caspase Activity Assay Kits Cellular Analysis
Unsurpassed analysis for caspase activity using bioluminescence
Caspase activity plays a key role in initiation of celluler events employed in each kind of kits. And caspase activity in apoptotic during the apoptotic progress. GenScript’s Caspase Activity progress will degrade the specific substrate and release Assay Kits provide a simple and important colorimetric means bioluminescence to be easier analyzed. The status of cell
Cellular Analysis for testing caspase activity. A novel bioluminescent substrate is apoptosis will be confirmed further.
Product Overview: Apoptosis Product Quantity Cat. No. Price Caspase-3 Colorimetric Assay Kit 1 Kit (100 Assays) L00289 $275 Caspase-2 Colorimetric Assay Kit 1 Kit (100 Assays) L00294 $275 Apoptosis Caspase-6 Colorimetric Assay Kit 1 Kit (100 Assays) L00302 $275 Caspase-8 Colorimetric Assay Kit 1 Kit (100 Assays) L00303 $275 Caspase-9 Colorimetric Assay Kit 1 Kit (100 Assays) L00304 $275
Your Innovation Partner in Drug Discovery! - 221- www.genscript.com - 222 - TUNEL (TdT-Mediated dUTP Nick-End Labeling) Apoptosis Detection Kits Cell Cycle Analysis Kit
Abundant and effective analysis for DNA fragmentation Reliable and convenient for cell distinction and analysis
• Enhanced Sensitivity—This kit can assay the cells during Detection of apoptotic cells in paraffin-embedded myocardium • Enhanced Versatility—This product directly analyzes cell presence of apoptotic cells. After RNA is degraded by RNase, the early stages of apoptosis. tissue sections using A. GenScript's TUNEL Apoptosis cycle for both suspension cells and adherence cells the nucleic acid dye in this kit binds with DNA in the nucleus, in • Streamlined Process—The entire procedure takes about Detection Kit (L00297) and B. Competitor’s TUNEL apoptosis • Superior Utility—Direct quantification of normal, apoptotic, both normal cells, and in apoptotic cells. The change in DNA of three hours. detection kit. and dead cells by flow cytometry cells can be assayed by flow cytometry. • Comprehensive Applications—Not only adherence cells, • Ready-to-use Format but also paraffin-embeded and cryopreserved tissue Negative control group Apoptosis-induced group Observe and analyze the distribution of cell cycle by Cell Cycle sections, can be applied. GenScript's Cell Cycle Analysis Kit enables rapid and Analysis Kit (L00287): P388 cells were induced apoptosis by 10 • Ultimate Convenience—The kit contains ready-to-use convenient cell cycle and cell proliferation assay. In normal μM camptothecin for 1 hour at 37°C. reagents, including proteinase K and DAB. cells, DNA density changes depend on whether the cell is growing, dividing, resting, or performing its ordinary functions. Diploid:100.00 % Apoptosis, also named programmed cell death (PCD), occur in Stained DNA using flow cytometry allows the researcher to Dip G1:41.68 % at 46.86; 400 Dip G2:7.90 % at 88.03; multicellular organisms. Apoptosis involves a series of determine whether the cell is in G0/G1, S, or G2/M, giving a Dip S:50.42 %; G2/G1:1.88; 300 biochemical changes leading to a characteristic cell death and A GenScript GenScript clearer picture of how cells in different parts of the cell cycle are %CV:4.92 morphology, which includes chromatin condensation, nuclear distributed throughout the sample and the level of proliferation 200 Apoptosis:10.65% Mean:31.19 fragmentation, and chromosomal DNA fragmentation, and so activity. In apoptotic cells, DNA is degraded by endogenous 100
on. TUNEL detection kits are a serial of terminal deoxynucleotidyl nucleases and diffused out of cells. A highly definable sub-G1 0 transferees (TdT)-mediated dUTP nick end labeling (TUNEL) peak occurs and is easily quantified by dyes. Cells can then be 0 20 40 60 80 100 120 Channels (PE-A-PI PE-A) kits that are used for assaying fragmental chromosomal DNA. sorted and further analyzed by microscopy to verify the Fig.1 Observe and analyze the distribution of cell cycle by flow cytometer GenScript offers kits designed for several different formats containing adherent cells, paraffin-embedded tissue sections, B Competitor Competitor Product Overview: and cryopreserved tissue sections. Also, according the requirement of usage, we offer colorimetric and fluorescent kits Product Quantity Cat. No. Price analyzed by light microscope and fluorescence microscope. Cell Cycle Analysis Kit 1 Kit (50 Assays) L00287 $88
Product Overview: For more information on Cell Cycle Analysis, visit http://www.genscript.com/kit/L00287-Cell_Cycle_Analysis_Kit.html
Product Quantity Cat. No. Price TUNEL Universal Apoptosis Detection Kit 1 Kit (100 Assays) L00290 $598 (Biotin-labeled POD) Cell Proliferation TUNEL Apoptosis Detection Kit for Adherent Cells 1 Kit (100 Assays) L00296 $598 (Biotin-labeled POD) Specific, simple, and essential solution for cell proliferation assay and cytotoxicity analysis TUNEL Apoptosis Detection Kit for Paraffin-embedded 1 Kit (100 Assays) L00297 $598 Tissue Sections(Biotin-labeled POD) • Easy-to-use interface Spontaneous and HUVEC proliferation assayed using Cell TUNEL Apoptosis Detection Kit for Cryopreserved • No radioactive or toxic reagents are required Proliferation Testing Solution (L00235). The results are below: 1 Kit (100 Assays) L00298 $598 Tissue Sections (Biotin-labeled POD) • Enhanced stability, sensitivity, and accuracy relative to other cell counting methods TUNEL Apoptosis Detection Kit for Adherent Cells Cellular Analysis 1 Kit (100 Assays) L00299 $598 Cell Proliferation Assay (FITC-labeled POD) 0.10 Cell proliferation test is essential in drug discovery and more Colon 205 Cell TUNEL Apoptosis Detection Kit for Paraffin-embedded 0.08 1 Kit (100 Assays) L00300 $598 specific in cytotoxicity analysis. GenScript’s Cell Proliferation Tissue Sections (FITC-labeled POD) 0.06 Testing Solution provides the easiest and the most sensitive TUNEL Apoptosis Detection Kit for Cryopreserved 0.04 1 Kit (100 Assays) L00301 $598 tool of assessing cell viability and cytotoxicity. The Cell Absorbance Tissue Sections ( FITC-labeled POD) 0.02 Proliferation Testing Solution uses nonradioactive reagents to 0.00
determine the number of viable cells in the sample. Mechanisti- 0 5 10 15 20 25 30 35 Cellular Analysis For more information on Apoptosis Detection Kits, visit http://www.genscript.com/apoptosis_detection_kits.html cally, the reagent is reduced by the dehydrogenases in living Cell number(103) cells, giving rise to a color change. The process can be HUVEC Proliferation Stimulated by VEGF detected at 450 nm on a spectrophotometer microplate reader. The absorption is directly proportional for the number of viable 0.07 HUVEC 0.06 Cell Cycle Analysis kit cells, allowing an accurate quantification on cell proliferation, 0.05 viability, and cytotoxicity. The Cell Proliferation Testing Solution 0.04 with VEGF 0.03 without VEGF is more sensitive than MTT, XTT, or MTS-based assays. 0.02 Absorbance Apoptosis 0.01 0.00 0 10 20 30 40 Conc. of VEGF(ng/ml)
Your Innovation Partner in Drug Discovery! - 223 - www.genscript.com - 224 - Product Overview: Product Overview:
Product Quantity Cat. No. Price Product Family Receptor Quantity Cat. No. Price Cell Proliferation Testing Solution 1,000 Assays L00235 $120 CHO-K1/M1 Acetylcholine (muscarinic) M1 2 Vials M00185 Quote HEK293/M1 Acetylcholine (muscarinic) M1 2 Vials M00135 Quote
For more information on Cell Proliferation, visit http://www.genscript.com/kit/L00235-Quick_Cell_Solution.html.html CHO-K1/M3 Acetylcholine (muscarinic) M3 2 Vials M00259 Quote CHO-K1/M5 Acetylcholine (muscarinic) M5 2 Vials M00186 Quote CHO-K1/A1/Gα15 Adenosine A1 2 Vials M00324 Quote CHO-K1/ADRA1A Adrenoceptors ADRA1A 2 Vials M00225 Quote CHO-K1/ADRA1B Adrenoceptors ADRA1B 2 Vials M00260 Quote Cell Lines CHO-K1/ADRB1/Ga15 Adrenoceptors ADRAB1 2 Vials M00269 Quote CHO-K1/ADRB2/Gα15 Adrenoceptors ADRB2 2 Vials M00308 Quote GenScript is a leading bio-reagent manufacturer and an assay GenScript constantly launches new stable cell line products and CHO-K1/BB2 Bombesin BB2 2 Vials M00182 Quote service supplier. A large panel of GPCR and ion channel stable updates its website. If prices and the other relevant information cell lines for cell-based assays has been developed. In presented here differ with those shown on the website, please CHO-K1/BB3 Bombesin BB3 2 Vials M00183 Quote addition, Ready-to-UseTM Frozen Cells is a cost-effective refer to the correct information on the website. CHO-K1/B2/Gα15 Bradykinin B2 2 Vials M00184 Quote alternative to stable cell line. Based on our expertise on assay http://www.genscript.com/cell_lines.html CHO-K1/CALCR/Gα15 Calcitonin CALCR 2 Vials M00320 Quote technologies, all the cells are validated by various methods. CHO-K1/CMKLR1/Gα15 Chemoattractant CMKLR1 2 Vials M00301 Quote CHO-K1/CCKA/Gα15 Cholecystokinin CCKA 2 Vials M00271 Quote CHO-K1/CCKB Cholecystokinin CCKB 2 Vials M00154 Quote CHO-K1/CRF2/Gα15 Corticotropin Releasing Factor CRF2 2 Vials M00208 Quote GPCR Stable Cell Lines HEK293/D1/CRE/β-Lac Dopamine D1 2 Vials M00128 Quote CHO-K1/D2/Gα15 Dopamine D2 2 Vials M00152 Quote • High functional protein expression at the cell surface HEK293/D2/Gα15 Dopamine D2 2 Vials M00129 Quote • Stable cell lines for increased reliability and reproducibility CHO-K1/D2s/Gα15 Dopamine D2s 2 Vials M00274 Quote • Flexible functional readouts are available HEK293/D5/CRE/β-Lac Dopamine D5 2 Vials M00130 Quote CHO-K1/EDNRA Endothelin EDNRA 2 Vials M00149 Quote GenScript offers a wide selection of GPCR stable cell lines. CHO-K1/EDNRB Endothelin EDNRB 2 Vials M00150 Quote Proprietary codon optimization and vector design technologies CHO-K1/GPR40-GFP Free Fatty Acid FFA1/GPR40 2 Vials M00263 Quote enable GenScript to overcome low functional protein expression at the cell surface. All of the cell lines have been optimized for CHO-K1/GPR40/Gα15 Free Fatty Acid FFA1/GPR40 2 Vials M00273 Quote S/B ratio in calcium flux assay, FRET assay, or chemiluminescent HEK293/GPR40/NFAT/β-Lac Free Fatty Acid FFA1/GPR40 2 Vials M00137 Quote assay. They are shown to be stable after over 16 passages. CHO-K1/GAL1/Gα15 Galanin GAL1 2 Vials M00277 Quote Fig2. Shown above are the intracellular calcium responses of CHO-K1 CHO-K1/GAL2 Galanin GAL2 2 Vials M00209 Quote cells stably expressing human arginine vasopressin receptor 1B and of CHO-K1/GHSR Galanin GAL1 2 Vials M00189 Quote untransfected control cells. Cells were loaded with Calcium-4 and then CHO-K1/GLP2/Gα15 Glucagon GHSR 2 Vials M00307 Quote stimulated with the indicated concentrations of AVP. Calcium responses HEK293/GnRHR/NFAT/β-Lac Gonadotropin-Releasing Hormone GnRH 2 Vials M00136 Quote were recorded on a FlexStation plate reader. Data represent the average HEK293/H1 Histamine H1 2 Vials M00131 Quote +/- standard deviation of triplicate determinations. CHO-K1/H2/Gα15 Histamine H2 2 Vials M00306 Quote HEK293/H2/CRE/Luc Histamine H2 2 Vials M00132 Quote Cellular Analysis HEK293/H3/Gα15 Histamine H3 2 Vials M00133 Quote HEK293/H4/Gα16 Histamine H4 2 Vials M00134 Quote CHO-K1/H4/Gα15 Histamine H4 2 Vials M00289 Quote HEK293/MCH1 Melanin-concentrating Hormone MCH1 2 Vials M00211 Quote Fig1. Shown above are intracellular calcium responses from CHO-K1 HEK293/MCH2 Melanin-concentrating Hormone MCH2 2 Vials M00127 Quote cells stably expressing human NK3 Neurokinin receptors and from CHO-K1/MCH2 Melanin-concentrating Hormone MCH2 2 Vials M00280 Quote untransfected control cells. Cells were loaded with Calcium-4 and then
Cellular Analysis CHO-K1/MC4/Gα15 Melanocortin MC4 2 Vials M00272 Quote stimulated with the indicated concentrations of Neurokinin B. Calcium CHO-K1/MT2/Gα15 Melatonin MT2 2 Vials M00312 Quote responses were recorded on a FlexStation plate reader. Data represent Neuromedin U NMU1 2 Vials M00191 Quote the average +/- standard deviation of triplicate determinations. CHO-K1/NMU1 CHO-K1/GPR103/Gα15 Neuropeptide GPR103 2 Vials M00321 Quote Cell Lines CHO-K1/NTS1 Neurotensin NTS1 2 Vials M00194 Quote CHO-K1/FPRL1/Gα15 N-Formyl Peptide FPRL1 2 Vials M00305 Quote CHO-K1/OPRK1/Gα15 Opioid OPRK1 2 Vials M00290 Quote Cell Lines CHO-K1/OPRM1/Gα15 Opioid OPRM1 2 Vials M00304 Quote CHO-K1/OX1 Orexin OX1 2 Vials M00224 Quote CHO-K1/OX2 Orexin OX2 2 vials M00316 Quote CHO-K1/OXTR Oxytocin OT/OXTR 2 vials M00195 Quote
Your Innovation Partner in Drug Discovery! - 225 - www.genscript.com - 226 - Product Family Receptor Quantity Cat. No. Price CHO-K1/PTH1/Gα15 Parathyroid Hormone PTH1 2 Vials M00315 Quote HEK293/PTHR1/CRE/β-Lac Parathyroid Hormone PTH1 2 Vials M00148 Quote HEK293/PTHR2/CRE/β-Lac Parathyroid Hormone PTH2 2 Vials M00141 Quote CHO-K1/PTAFR Platelet Activating Factor PTAFR 2 Vials M00262 Quote HEK293/PAFR/NFAT/β-Lac Platelet Activating Factor PTAFR 2 Vials M00147 Quote HEK293/FP/Gα15 Prostanoid FP 2 Vials M00155 Quote CHO-K1/IP1/Gα15 Prostanoid IP1 2 Vials M00310 Quote HEK293/PTGER1 Prostanoid PTGER1 2 Vials M00228 Quote CHO-K1/PTGER2/Gα15 Prostanoid PTGER2 2 Vials M00311 Quote HEK293/TP Prostanoid TP 2 Vials M00309 Quote This diagram depicts the calcium dose-response of This diagram depicts the calcium dose-response of CHO-K1/PAR4 Proteinase-activated Receptor PAR4 2 Vials M00206 Quote Neurotensin stimulation of CHO-K1/NTS1 Cells Ready-to-UseTM (●) Neurokinin A stimulation of CHO-K1/NK2 Cells Ready-to-UseTM (●) and CHO-K1/5-HT2A Serotonin 5-HT2A 2 Vials M00251 Quote and non-treated cells (●). The result showing an increase in non-treated cells (●). The result showing an increase in intracellular CHO-K1/5-HT2B Serotonin 5-HT2B 2 Vials M00249 Quote intracellular calcium was measured on a FlexStation fluorescent plate calcium was measured on a FlexStation fluorescent plate reader. Data CHO-K1/5-HT2C Serotonin 5-HT2C 2 Vials M00253 Quote reader. Data points represent the average +/- standard deviation of points represent the average +/- standard deviation of triplicate CHO-K1/SST3/Gα15 Somatostatin SST3 2 Vials M00285 Quote triplicate determinations. determinations. CHO-K1/SST5/Gα15 Somatostatin SST5 2 Vials M00286 Quote 1321N1/P2Y2 Purinergic P2Y2 2 Vials M00318 Quote Product Overview: 1321N1/P2Y4 Purinergic P2Y4 2 Vials M00297 Quote 1321N1/P2Y11 Purinergic P2Y11 2 Vials M00298 Quote Product Name Family Receptor Quantity Cat. No. Price HEK293/SPR Tachykinin NK1/SPR 2 Vials M00144 Quote CHO-K1/M5 Cells Ready-to-UseTM Acetylcholine (muscarinic) M5 1 Vial M00175 $280 CHO-K1/NK1 Tachykinin NK1/SPR 2 Vials M00199 Quote CHO-K1/BB2 Cells Ready-to-UseTM Bombesin BB2 1 Vial M00178 $280 CHO-K1/NK2 Tachykinin NK2 2 Vials M00200 Quote CHO-K1/BB3 Cells Ready-to-UseTM Bombesin BB3 1 Vial M00164 $280 CHO-K1/NK3 Tachykinin NK3 2 Vials M00201 Quote CHO-K1/EDNRA Cells Ready-to-UseTM Endothelin EDNRA 1 Vial M00157 $280 CHO-K1/TRH1 Thyrtropin-releasing Hormone TRH1 2 Vials M00202 Quote CHO-K1/EDNRB Cells Ready-to-UseTM Endothelin EDNRB 1 Vial M00158 $280 CHO-K1/V1A Vasopressin V1A 2 Vials M00181 Quote CHO-K1/GHSR Cells Ready-to-UseTM Ghrelin GHSR 1 Vial M00180 $280 CHO-K1/V1B Vasopressin V1B 2 Vials M00205 Quote HEK 293/H1 Cells Ready-to-UseTM Histamine H1 1 Vial M00162 $280 CHO-K1/V2/Gα15 Vasopressin V2 2 Vials M00170 Quote CHO-K1/EDG8/Gα15 Cells Ready-to-UseTM Lysophospholipid EDG8 1 Vial M00159 $280 CHO-K1/CRE/Luc Host Cell Line N/A 2 Vials M00187 Quote CHO-K1/NMUR1 Cells Ready-to-UseTM Neuromedin U NMU1 1 Vial M00165 $280 HEK293/CRE/Luc Host Cell Line N/A 2 Vials M00188 Quote CHO-K1/NTSR1 Cells Ready-to-UseTM Neurotensin NTS1 1 Vial M00168 $280 CHO-K1/OX1 Cells Ready-to-UseTM Orexin OX1 1 Vial M00267 $280 For more information on Stable Cell Lines, visit http://www.genscript.com/cell_lines.html CHO-K1/OXTR Cells Ready-to-UseTM Oxytocin OT/OXTR 1 Vial M00179 $280 CHO-K1/PTAFR Cells Ready-to-UseTM Platelet Activating Factor PAF/PTAFR 1 Vial M00265 $280 CHO-K1/NK1 Cells Ready-to-UseTM Tachykinin NK1/SPR 1 Vial M00161 $280 Ready-to-UseTM Frozen Cell Lines CHO-K1/NK2 Cells Ready-to-UseTM Tachykinin NK2 1 Vial M00171 $280 CHO-K1/NK3 Cells Ready-to-UseTM Tachykinin NK3 1 Vial M00266 $280 CHO-K1/TRH1 Cells Ready-to-UseTM Thyrtropin-releasing Hormone TRH1 1 Vial M00264 $280 • Reliability—Each batch of Ready-to-UseTM Frozen Cells is Cell-based assays can often be challenging and Cellular Analysis CHO-K1/V1B Cells Ready-to-UseTM Vasopressin V1B 1 Vial M00223 $280 validated according to stringent criteria to assure consistent time-consuming. To smooth and streamline this complicated CHO-K1/PAC1/Gα15 Cells Ready-to-UseTM VIP/PACAP PAC1 1 Vial M00231 $280 results. process, GenScript has developed a series of Ready-to-UseTM • Convenience—Ready-to-UseTM Frozen Cells Frozen Cells that can be conveniently employed in functional can trim time and aggravation out of functional testing. GPCR receptor assays. GenScript scientists culture and freeze For more information on Frozen Cell Lines, visit http://www.genscript.com/ready-to-use_frozen_cells.html Instead of engaging in a lengthy in-house culturing process, the cells using optimized protocols that can arrest cell growth to simply thaw the cells, plate them, and run the assays. reduce variability in cellular assays.
Cellular Analysis • Variability Arrest—Chemically treated cells with optimized protocol to alleviate biological variability. • Speed—Assays can be finished within 24 hours after thawing the cells. Cell Lines Cell Lines
Your Innovation Partner in Drug Discovery! - 227 - www.genscript.com - 228 - Reagents for Cell Analysis
GenScript provides abundant reagents and biological buffers for proliferation assays. An improved colorimetric assay for cell Product Quantity Cat. No. Price cell and biochemical assay. Monotetrazolium salts, which form proliferation and viability utilizing XTT has been reported. An 100 g $70 a water-soluble formazan upon reduction, are suitable for XTT-based colorimetric cellular cytotoxicity assay for melanoma DTAC 500 g C01653 $176 anti-HIV and anti-tumor drug testing as well as for cell and other tumor cells has been reported. 20000 g $2,106 100 g $88 103B 500 g C01652 $221 Product Overview: 20000 g $2,646 100 g $88 Product Quantity Cat. No. Price 103C 500 g C01651 $221 100 g $250 20000 g $2,646 BPTAB 500 g C01671 $625 1 g $175 MTT C01678 20000 g $7,500 10 g $1,138 100 g $250 1 g $510 XTT C01676 BETAB 500 g C01670 $625 10 g $3,600 20000 g $7,500 1 g $510 WST-8 C01675 100 g $70 10 g $3,600 DSAB 500 g C01669 $176 1 g $510 WST-3 C01673 20000 g $2,106 10 g $3,600 100 g $82 1 g $510 WST-1 C01672 DDAB 500 g C01667 $206 10 g $3,600 20000 g $2,466 100 g $77 100 g $82 500 g $270 TAPS Ultra C01648 Octyltrimethylammonium chloride 500 g C01665 $206 5000 g $1,887 20000 g $2,466 25000 g $6,603 100 g $70 100 g $45 HDBAC 500 g C01664 $176 500 g $158 TAPS C01647 20000 g $2,106 5000 g $1,103 100 g $88 25000 g $3,859 Ultra C14-alkylbenzyldimethylammonium chloride 500 g C01663 $221 100 g $71 20000 g $2,646 500 g $249 MES potassium salt C01632 100 g $88 5000 g $1,740 EHDAB 500 g C01662 $221 25000 g $6,088 20000 g $1,646 100 g $50 100 g $88 500 g $176 MES hemisodium salt C01630 EDDAB 500 g C01661 $221 5000 g $1,230 20000 g $2,646 25000 g $4,305 100 g $70 100 g $38 STAB 500 g C01660 $176 500 g $132 MES free water C01629 Cellular Analysis 20000 g $2,106 5000 g $926 100 g $70 25000 g $3,241 STAC 500 g C01659 $176 100 g $99 20000 g $2,106 500 g $345 BES Ultra C01612 100 g $38 5000 g $2,421 CTAB 500 g C01658 $94 25000 g $8,472 20000 g $1,128 100 g $49 Cellular Analysis 100 g $70 500 g $170 BES C01611 CTAC 500 g C01657 $176 5000 g $1,196 20000 g $2,106 25000 g $4,185
100 g $70 100 g $37 Reagents for Cell Analysis TTAB 500 g C01656 $176 500 g $129 ACES C01609 20000 g $2,106 5000 g $907 100 g $70 25000 g $3,173 DTAB 500 g C01654 $176 20000 g $2,106 Reagents for Cell Analysis Reagents for Cell
Your Innovation Partner in Drug Discovery! - 229 - www.genscript.com - 230 - Custom Cell Line Services Ion Channel Assay Service
GenScript offers a wide selection of GPCR and ion channel functional expression of protein at the cell surface. All cell lines GenScript's proprietary assay techniques and novel expression stable cell lines. Proprietary codon optimization and vector have been optimized for S/N ratio in calcium flux assay or other technologies can circumvent two of the major challenges design technologies enable GenScript to overcome low assays and shown stability after over 16 passages. associated with the search for novel ion channel drugs: low protein expression levels and the limitations of traditional Service Cat. No. Price high-throughput screening (HTS). Our comprehensive ion Custom Stable Cell Line Service SC1394 Quote channel services include assay development, primary screening, secondary screening, specificity assay and HTS conversion. Equipped with state-of-the-art facilities, GenScript can offer various methodologies such as fluorometry, electrophysiology, and radioactivity to obtain top-quality and reliable data. Based on the methodologies, GenScript has gained extensive GPCR Assay Service expertise on ion channel assays covering a wide range of ion channel targets such as calcium channels, potassium channels, GPCR, G protein-coupled receptor, is the largest known GenScript not only provides a comprehensive collection of sodium channels, and chloride channels. category of molecular targets with verified therapeutic value. It GPCR and parental cell lines, but also is able to construct To expedite your drug discovery process, GenScript offers a is comprised of approximately 600 - 1,000 members. Currently, advanced instrumentation and versatile assay platforms, variety of stable cell line products in our catalog, and a a great percentage of pharmaceutical drugs targets GPCRs for GenScript brings a total solution for your biochemical and comprehensive collection of custom reagent services for gene, treatment of many diseases such as pain, asthma, hyperten- cell-based GPCR assays and speed up your drug discovery. protein, peptide, and antibody. sion, as well as immunological and neurological disorders. To meet the demands of GPCR screening and profiling, Assay Setup Showcases: Assay Setup Showcases:
Fig. 2. Dose-response relationship of P2X3 agonist and antagonist in membrane potential assay. Changes in relative fluorescence units (RFU) are shown in (A) Dose-response relationship of ATP to 293/P2X3 and 293 control cells. Cells were loaded with membrane potential sensitive dye (Molecular Devices) and then stimulated with the indicated concentrations of ATP. (B) Dose-response relationship of TN-ATP to Fig. 1. Shown above are intracellular calcium responses from CHO-K1 Fig. 2. Shown above are the intracellular calcium responses of CHO-K1 293/P2X3 cells. Cells were incubated with membrane potential sensitive cells stably expressing human NK3 Neurokinin receptors and from cells stably expressing human arginine vasopressin ( AVP) receptor 1B dye (Molecular Devices) and indicated concentrations of TN-ATP for 45 untransfected control cells. Cells were loaded with Calcium-4 and then and of untransfected control cells. Cells were loaded with Calcium-4 and minutes, then stimulated with 50 μM ATP. Calcium responses were stimulated with the indicated concentrations of Neurokinin B. Calcium then stimulated with the indicated concentrations of AVP. Calcium recorded on a FlexStationIII plate reader. Data represent the average +/- responses were recorded on a FlexStation plate reader. Data represent responses were recorded on a FlexStation plate reader. Data represent standard deviation of triplicate determinations. Cellular Analysis the average +/- standard deviation of triplicate determinations. the average +/- standard deviation of triplicate determinations.
Service Cat. No. Price Custom GPCR Assay Service SC1402 Quote Cellular Analysis Fig. 1. Dose-response relationship of TRPV1 agonist and antagonist in calcium influx assay. Changes in relative fluorescence units (RFU) are shown in (A)
Dose-response relationship of capsaicin to 293/TRPV1 and 293 control Custom Cell Line Services cells. Cells were incubated with Calcium-4 and then stimulated with the indicated concentrations of capsaicin. (B) Dose-response relationship of capsazepine to 293/TRPV1 cells. Cells were incubated with Calcium-4 and indicated concentrations of capsazepine for 1 hour, then stimulated with 50 μM capsaicin. Calcium responses were recorded on a FlexStationIII plate reader. Data represent the average +/- standard deviation of triplicate determinations. Custom Cell Line Services
Your Innovation Partner in Drug Discovery! - 231 - www.genscript.com - 232 - Product List
Cellular Analysis Kits List Service Cat. No. Price
Custom Ion Channel Assay Service SC1403 Quote Product Quantity Cat. No. Price Mitochondrial Apoptosis Detection Kit (JC-1) 1 Kit (100 Assays) L00291 $140 Quotations and Ordering: Double Stain Apoptosis Detection Kit (Hoechst 33342/PI) 1 Kit (100 Assays) L00309 $99 Cell Apoptosis DAPI Detection Kit 1 Kit (100 Assays) L00312 $199 Cell Apoptosis PI Detection Kit 1 Kit (100 Assays) L00311 $149 Quotations and orders may be placed by email, phone, or fax with either a formal PO (Purchase Order) or credit card. Please choose Caspase-2 Colorimetric Assay Kit 1 Kit (100 Assays) L00294 $275 the most convenient ordering method. Caspase-3 Colorimetric Assay Kit 1 Kit (100 Assays) L00289 $275 Caspase-6 Colorimetric Assay Kit 1 Kit (100 Assays) L00302 $275 Caspase-8 Colorimetric Assay Kit 1 Kit (100 Assays) L00303 $275 Quotation Form: Obtainable on our website Caspase-9 Colorimetric Assay Kit 1 Kit (100 Assays) L00304 $275 Annexin V-EGFP Apoptosis Detection Kit 1 Kit (100 Assays) L00288 $598 Email: [email protected] TUNEL Universal Apoptosis Detection Kit (Biotin-labeled POD) 1 Kit (100 Assays) L00290 $598 TUNEL Apoptosis Detection Kit (Adherent Cell, 1 Kit (100 Assays) L00296 $598 Phone: 1-877-436-7274 (Toll-Free); 1-732-885-9188 Biotin-labeled POD) TUNEL Apoptosis Detection Kit (Paraffin-embedded Tissue 1 Kit (100 Assays) L00297 $598 Fax: 1-732-210-0262; 1-732-885-5878 Section, Biotin-labeled POD) TUNEL Apoptosis Detection Kit (Cryopreserved Tissue 1 Kit (100 Assays) L00298 $598 Secured Web Server: https://www.genscript.com/ssl-bin/secure_data Section, Biotin-labeled POD) TUNEL Apoptosis Detection Kit (Adherent Cell, FITC-labeled 1 Kit (100 Assays) L00299 $598 POD) TUNEL Apoptosis Detection Kit (Paraffin-embedded Tissue 1 Kit (100 Assays) L00300 $598 Section, FITC-labeled POD) TUNEL Apoptosis Detection Kit (Cryopreserved Tissue 1 Kit (100 Assays) L00301 $598 Section, FITC-labeled POD) Cell Cycle Analysis Kit 1 Kit (50 Assays) L00287 $88 Quick Cell Proliferation Testing Solution 1,000 Assays L00235 $120 100 g $250 BPTAB 500 g C01671 $625 20000 g $7,500 100 g $250 BETAB 500 g C01670 $625 20000 g $7,500 100 g $70 DSAB 500g C01669 $176 20000 g $2,106 100 g $82
DDAB 500 g C01667 $206 Cellular Analysis 20000 g $2,466 100 g $82 Octyltrimethylammonium chloride 500 g C01665 $206 20000 g $2,466 100 g $70 HDBAC 500 g C01664 $176
Cellular Analysis 20000 g $2,106 100 g $88 Ultra C14-alkylbenzyldimethylammonium chloride 500 g C01663 $221 20000 g $2,646 Product List 100 g $88 EHDAB 500 g C01662 $221 20000 g $1,646 100 g $88 EDDAB 500 g C01661 $221 20000 g $2,646 Custom Cell Line Services
Your Innovation Partner in Drug Discovery! - 233 - www.genscript.com - 234 - Product Quantity Cat. No. Price Product Quantity Cat. No. Price 100 g $70 100 g $38 STAB 500g C01660 $176 500 g $132 MES free water C01629 20000 g $2,106 5000 g $926 100 g $70 25000 g $3,241 STAC 500 g C01659 $176 100 g $99 20000 g $2,106 500 g $345 BES Ultra C01612 100 g $38 5000 g $2,421 CTAB 500 g C01658 $94 25000 g $8,472 20000 g $1,128 100 g $49 100 g $70 500 g $170 BES C01611 CTAC 500 g C01657 $176 5000 g $1,196 20000 g $2,106 25000 g $4,185 100 g $70 100 g $37 TTAB 500 g C01656 $176 500g $130 ACES C01609 20000 g $2,106 5000 g $907 100 g $70 25000 g $3,173 DTAB 500 g C01654 $176 20000 g $2,106 100 g $70 DTAC 500 g C01653 $176 Cell Lines List 20000 g $2,106 100 g $88 Product Name Family Receptor Quantity Cat. No. Price 103B 500 g C01652 $221 CHO-K1/M1 Acetylcholine (muscarinic) M1 2 Vials M00185 Quote 20000 g $2,646 HEK293/M1 Acetylcholine (muscarinic) M1 2 Vials M00135 Quote 100 g $88 CHO-K1/M3 Acetylcholine (muscarinic) M3 2 Vials M00259 Quote 103C 500 g C01651 $221 CHO-K1/M5 Acetylcholine (muscarinic) M5 2 Vials M00186 Quote 20000 g $2,646 CHO-K1/A1/Gα15 Adenosine A1 2 Vials M00324 Quote 1 g $175 MTT C01678 CHO-K1/ADRA1A Adrenoceptors ADRA1A 2 Vials M00225 Quote 10 g $1,138 CHO-K1/ADRA1B Adrenoceptors ADRA1B 2 Vials M00260 Quote 1 g $510 XTT C01676 CHO-K1/ADRB1/Ga15 Adrenoceptors ADRAB1 2 Vials M00269 Quote 10 g $3,600 CHO-K1/ADRB2/Gα15 Adrenoceptors ADRB2 2 Vials M00308 Quote 1 g $510 WST-8 C01675 Quote 10 g $3,600 CHO-K1/BB2 Bombesin BB2 2 Vials M00182 1 g $510 CHO-K1/BB3 Bombesin BB3 2 Vials M00183 Quote WST-3 C01673 10 g $3,600 CHO-K1/B2/Gα15 Bradykinin B2 2 Vials M00184 Quote 1 g $510 CHO-K1/CALCR/Gα15 Calcitonin CALCR 2 Vials M00320 Quote WST-1 C01672 10 g $3,600 CHO-K1/CMKLR1/Gα15 Chemoattractant CMKLR1 2 Vials M00301 Quote Cellular Analysis 100 g $77 CHO-K1/CCKA/Gα15 Cholecystokinin CCKA 2 Vials M00271 Quote 500 g $270 CHO-K1/CCKB Cholecystokinin CCKB 2 Vials M00154 Quote TAPS Ultra C01648 5000 g $1,887 CHO-K1/CRF2/Gα15 Corticotropin Releasing Factor CRF2 2 Vials M00208 Quote 25000 g $6,603 HEK293/D1/CRE/β-Lac Dopamine D1 2 Vials M00128 Quote 100 g $45 CHO-K1/D2/Gα15 Dopamine D2 2 Vials M00152 Quote 500 g $158 TAPS C01647 HEK293/D2/Gα15 Dopamine D2 2 Vials M00129 Quote 5000 g $1,103 CHO-K1/D2s/Gα15 Dopamine D2s 2 Vials M00274 Quote Cellular Analysis 25000 g $3,859 HEK293/D5/CRE/β-Lac Dopamine D5 2 Vials M00130 Quote 100 g $71 CHO-K1/EDNRA Endothelin EDNRA 2 Vials M00149 Quote 500 g $249 MES potassium salt C01632 CHO-K1/EDNRB Endothelin EDNRB 2 Vials M00150 Quote
5000 g $1,740 Product List CHO-K1/GPR40-GFP Free Fatty Acid FFA1/GPR40 2 Vials M00263 Quote 25000 g $6,088 CHO-K1/GPR40/Gα15 Free Fatty Acid FFA1/GPR40 2 Vials M00273 Quote 100 g $50 HEK293/GPR40/NFAT/β-Lac Free Fatty Acid FFA1/GPR40 2 Vials M00137 Quote 500 g $176 MES hemisodium salt C01630 CHO-K1/GAL1/Gα15 Galanin GAL1 2 Vials M00277 Quote Product List 5000 g $1,230 25000 g $4,305 CHO-K1/GAL2 Galanin GAL2 2 Vials M00209 Quote CHO-K1/GHSR Galanin GAL1 2 Vials M00189 Quote CHO-K1/GLP2/Gα15 Glucagon GHSR 2 Vials M00307 Quote
Your Innovation Partner in Drug Discovery! - 235 - www.genscript.com - 236 - Product Name Family Receptor Quantity Cat. No. Price Product Name Family Receptor Quantity Cat. No. Price HEK293/GnRHR/NFAT/β-Lac Gonadotropin-Releasing Hormone GnRH 2 Vials M00136 Quote CHO-K1/GHSR Cells Ghrelin GHSR 1 Vial M00180 $280 HEK293/H1 Histamine H1 2 Vials M00131 Quote Ready-to-UseTM CHO-K1/H2/Gα15 Histamine H2 2 Vials M00306 Quote HEK 293/H1 Cells Ready-to-UseTM Histamine H1 1 Vial M00162 $280 HEK293/H2/CRE/Luc Histamine H2 2 Vials M00132 Quote CHO-K1/EDG8/Gα15 Cells M00133 Quote Lysophospholipid EDG8 1 Vial M00159 $280 HEK293/H3/Gα15 Histamine H3 2 Vials Ready-to-UseTM HEK293/H4/Gα16 Histamine H4 2 Vials M00134 Quote CHO-K1/NMUR1 Cells CHO-K1/H4/Gα15 Histamine H4 2 Vials M00289 Quote Neuromedin U NMU1 1 Vial M00165 $280 Ready-to-UseTM HEK293/MCH1 Melanin-concentrating Hormone MCH1 2 Vials M00211 Quote CHO-K1/NTSR1 Cells HEK293/MCH2 Melanin-concentrating Hormone MCH2 2 Vials M00127 Quote Neurotensin NTS1 1 Vial M00168 $280 Ready-to-UseTM CHO-K1/MCH2 Melanin-concentrating Hormone MCH2 2 Vials M00280 Quote CHO-K1/OX1 Cells Ready-to-UseTM Orexin OX1 1 Vial M00267 $280 CHO-K1/MC4/Gα15 Melanocortin MC4 2 Vials M00272 Quote CHO-K1/OXTR Cells CHO-K1/MT2/Gα15 Melatonin MT2 2 Vials M00312 Quote Oxytocin OT/OXTR 1 Vial M00179 $280 Ready-to-UseTM CHO-K1/NMU1 Neuromedin U NMU1 2 Vials M00191 Quote Quote CHO-K1/PTAFR Cells CHO-K1/GPR103/Gα15 Neuropeptide GPR103 2 Vials M00321 Platelet Activating Factor PAF/PTAFR 1 Vial M00265 $280 TM CHO-K1/NTS1 Neurotensin NTS1 2 Vials M00194 Quote Ready-to-Use CHO-K1/FPRL1/Gα15 N-Formyl Peptide FPRL1 2 Vials M00305 Quote CHO-K1/NK1 Cells Ready-to-UseTM Tachykinin NK1/SPR 1 Vial M00161 $280 CHO-K1/OPRK1/Gα15 Opioid OPRK1 2 Vials M00290 Quote CHO-K1/NK2 Cells Ready-to-UseTM Tachykinin NK2 1 Vial M00171 $280 CHO-K1/OPRM1/Gα15 Opioid OPRM1 2 Vials M00304 Quote CHO-K1/NK3 Cells Ready-to-UseTM Tachykinin NK3 1 Vial M00266 $280 CHO-K1/OX1 Orexin OX1 2 Vials M00224 Quote CHO-K1/TRH1 Cells Thyrtropin-releasing Hormone TRH1 1 Vial M00264 $280 CHO-K1/OX2 Orexin OX2 2 Vials M00316 Quote Ready-to-UseTM CHO-K1/OXTR Oxytocin OT/OXTR 2 Vials M00195 Quote CHO-K1/V1B Cells Ready-to-UseTM Vasopressin V1B 1 Vial M00223 $280 CHO-K1/PTH1/Gα15 Parathyroid Hormone PTH1 2 Vials M00315 Quote CHO-K1/PAC1/Gα15 Cells VIP/PACAP PAC1 1 Vial M00231 $280 HEK293/PTHR1/CRE/β-Lac Parathyroid Hormone PTH1 2 Vials M00148 Quote Ready-to-UseTM HEK293/PTHR2/CRE/β-Lac Parathyroid Hormone PTH2 2 Vials M00141 Quote CHO-K1/PTAFR Platelet Activating Factor PTAFR 2 Vials M00262 Quote HEK293/PAFR/NFAT/β-Lac Platelet Activating Factor PTAFR 2 Vials M00147 Quote HEK293/FP/Gα15 Prostanoid FP 2 Vials M00155 Quote CHO-K1/IP1/Gα15 Prostanoid IP1 2 Vials M00310 Quote HEK293/PTGER1 Prostanoid PTGER1 2 Vials M00228 Quote CHO-K1/PTGER2/Gα15 Prostanoid PTGER2 2 Vials M00311 Quote HEK293/TP Prostanoid TP 2 Vials M00309 Quote CHO-K1/PAR4 Proteinase-activated Receptor PAR4 2 Vials M00206 Quote CHO-K1/5-HT2A Serotonin 5-HT2A 2 Vials M00251 Quote CHO-K1/5-HT2B Serotonin 5-HT2B 2 Vials M00249 Quote CHO-K1/5-HT2C Serotonin 5-HT2C 2 Vials M00253 Quote CHO-K1/SST3/Gα15 Somatostatin SST3 2 Vials M00285 Quote CHO-K1/SST5/Gα15 Somatostatin SST5 2 Vials M00286 Quote Cellular Analysis 1321N1/P2Y2 Purinergic P2Y2 2 Vials M00318 Quote 1321N1/P2Y4 Purinergic P2Y4 2 Vials M00297 Quote 1321N1/P2Y11 Purinergic P2Y11 2 Vials M00298 Quote HEK293/SPR Tachykinin NK1/SPR 2 Vials M00144 Quote CHO-K1/NK1 Tachykinin NK1/SPR 2 Vials M00199 Quote CHO-K1/NK2 Tachykinin NK2 2 Vials M00200 Quote CHO-K1/NK3 Tachykinin NK3 2 Vials M00201 Quote Cellular Analysis CHO-K1/TRH1 Thyrtropin-releasing Hormone TRH1 2 Vials M00202 Quote CHO-K1/V1A Vasopressin V1A 2 Vials M00181 Quote CHO-K1/V1B Vasopressin V1B 2 Vials M00205 Quote
CHO-K1/V2/Gα15 Vasopressin V2 2 Vials M00170 Quote Product List CHO-K1/CRE/Luc Host Cell Line N/A 2 Vials M00187 Quote HEK293/CRE/Luc Host Cell Line N/A 2 Vials M00188 Quote CHO-K1/M5 Cells Ready-to-UseTM Acetylcholine (muscarinic) M5 1 Vial M00175 $280
Product List CHO-K1/BB2 Cells Ready-to-UseTM Bombesin BB2 1 Vial M00178 $280 CHO-K1/BB3 Cells Ready-to-UseTM Bombesin BB3 1 Vial M00164 $280 CHO-K1/EDNRA Cells Ready-to-UseTM Endothelin EDNRA 1 Vial M00157 $280 CHO-K1/EDNRB Cells Ready-to-UseTM Endothelin EDNRB 1 Vial M00158 $280
Your Innovation Partner in Drug Discovery! - 237 - www.genscript.com - 238 - Appendix
Amino Acids Table 241 Atomic Weights of the Elements 242 Genetic Markers in E.coli 243 Genetic Code Table 245
Determining the Molar Mass Using S20, W Values 245 Spectrophotometric Quantitation of DNA or RNA 247 Agarose and Polyacrylamide Gels 248 Miscellaneous 248 Alphabetical Index 251 Amino Acids Table Middle Unit Residue (-H20) Hydrophobic Uncharged Hydrophilic Amino Acid Formula FW Charge at Formula FW pH 6.0-7.0 (non-polar) (polar) (polar) Alanine C H NO 89.1 C H NO 71.1 Neutral Single-Letter Charge at 3 7 2 3 5 Amino Acid Three-Letter Code Formula FW Structure Code pH 6.0-7.0 Arginine C6H14N4O2 174.2 C6H12N4O 156.2 Basic (+ve)
HOOC Asparagine C4H8N2O3 132.1 C4H6N2O2 114.1 Neutral
CH3 Alanine Ala A C3H7NO2 89.1 Neutral Aspartic Acid C4H7NO4 133.1 C4H5NO3 115.1 Acidic (-ve) H2 N Cysteine C3H7NO2S 121.2 C3H5NOS 103.2 Neutral HOOC NH2 CH CH CH NHC Glutamic Acid C5H9NO4 147.1 C5H7NO3 129.1 Acidic (-ve) Arginine Arg R C6H14N4O2 174.2 Basic (+ve) 2 2 2 H N NH 2 Glutamine C5H10N2O3 146.1 C5H8N2O2 128.1 Neutral HOOC Glycine C2H5NO2 75.1 C2H3NO 57.1 Neutral CH2 CONH2 Asparagine Asn N C4H8N2O3 132.1 Neutral Histidine C6H9N3O2 155.2 C6H7N3O 137.2 Basic (+ve) H2 N
HOOC Isoleucine C6H13NO2 131.2 C6H11NO 113.2 Neutral
CH2 COOH Aspartic Acid Asp D C4H7NO4 133.1 Acidic (-ve) Leucine C6H13NO2 131.2 C6H11NO 113.2 Neutral H2 N Lysine C6H14N2O2 146.2 C6H12N2O 128.2 Basic (+ve) HOOC 131.2 CH SH Methionine C5H11NO2S 149.2 C5H9NOS Neutral Cysteine Cys C C3H7NO2S 121.2 Neutral 2 H N 2 Phenylalanine C9H11NO2 165.2 C9H9NO 147.2 Neutral HOOC Proline C5H9NO2 115.1 C5H7NO 97.1 Neutral Glutamic Acid Glu E C H NO 147.1 Acidic (-ve) CH CH COOH 5 9 4 2 2 Serine C H NO 105.1 C H NO 87.1 Neutral H N 3 7 3 3 5 2 2 HOOC Threonine C4H9NO3 119.1 C4H7NO2 101.1 Neutral
CH2 CH22 CONH Glutamine Gln Q C5H10N2O3 146.1 Neutral Tryptophan C11H12N2O2 204.2 C11H10N2O 186.2 Neutral H N 2 Tyrosine C H NO 181.2 C H NO 163.2 Neutral HOOC 9 11 3 9 9 2
H Valine C5H11NO2 117.1 C5H9NO 99.1 Neutral Glycine Gly G C2H5NO2 75.1 Neutral 2 H 2N
HOOC HN CH Histidine His H C6H9N3O2 155.2 Basic (+ve) 2 H N N 2 Atomic Weights of the Elements HOOC
CH2 (CH3 )CH2 CH3 Isoleucine Ile I C6H13NO2 131.2 Neutral H2 N HOOC CH 3 Atomic Atomic Atomic Atomic Element Symbol Element Symbol CH2 CH Leucine Leu L C6H13NO2 131.2 Neutral Number Weight Number Weight H N CH 2 3 Actinium Ac 89 227.02 Curium Cm 96 (247.07) HOOC CH CH CH CH NH Aluminium Al 13 26.98 Dysprosium Dy 66 162.50 Lysine Lys K C6H14N2O2 146.2 Basic (+ve) 2 2 2 2 2 H2 N Americium Am 95 (243.06) Einsteinium Es 99 (252.08)
HOOC Antimony Sb 51 121.75 Erbium Er 68 167.26 Methionine Met M C H NO S 149.2 Neutral CH23 CH2 SCH 5 11 2 Argon Ar 18 39.94 Fluorine F 9 18.99 H2 N
HOOC Arsenic As 33 74.92 Francium Fr 87 (223.01) CH Phenylalanine Phe F C9H11NO2 165.2 Neutral 2 Astatine At 85 (209.98) Gadolinium Gd 64 157.25 H N 2 Barium Ba 56 137.32 Gallium Ga 31 69.72 Berkelium Bk 97 (247.07) Germanium Ge 32 72.61 Proline Pro P C5H9NO2 115.1 Neutral HOOC NH Beryllium Be 4 9.01 Gold Au 79 196.96 HOOC Bismuth Bi 83 208.98 Hafnium Hf 72 178.49 Serine Ser S C H NO 105.1 Neutral CH2 OH 3 7 3 Boron B 5 10.81 Helium He 2 4.00 H2 N HOOC Bromine Br 35 79.90 Holmium Ho 67 164.93 CHCH Threonine Thr T C4H9NO3 119.1 Neutral 3 Cadmium Cd 48 112.41 Hydrogen H 1 1.00 H2 N OH
Calcium Ca 20 40.07 Indium In 49 114.82 Appendix HOOC CH Californium Cf 98 (251.07) Iodine I 53 126.90 Tryptophan Trp W C11H12N2O2 204.2 Neutral 2 H2 N Carbon C 6 12.01 Iridium Ir 77 192.22 NH HOOC Cerium Ce 58 140.11 Iron Fe 26 55.84 CH OH
Appendix Tyrosine Tyr Y C H NO 181.2 Neutral 9 11 3 2 Cesium Cs 55 132.90 Krypton Kr 36 83.80 H2 N HOOC Chlorine Cl 17 35.45 Lanthanum La 57 138.90 CH (CH ) Valine Val V C5H11NO2 117.1 Neutral 3 2 Chromium Cr 24 51.99 Lawrencium Lr 103 (262.11) H N 2 Cobalt Co 27 58.93 Lead Pb 82 207.2 Cellular Analysis Copper Cu 29 63.54 Lithium Li 3 6.94
Your Innovation Partner in Drug Discovery! - 241 - www.genscript.com - 242 -
Atomic Atomic Atomic Atomic Element Symbol Element Symbol Symbol Description Effect of Mutation Number Weight Number Weight dut1 Mutation of deoxyuridine triphosphatase, which Mutants are impaired in conversion of dUTP to dUMP, leading to higher Lutetium Lu 71 174.96 Samarium Ru 62 150.36 catalyzes the conversion of dUTP to dUMP and PPi dUTP pools, which can lead to misincorporation of uracil instead of Magnesium Mg 12 24.30 Scandium Sm 21 44.95 thymidine. Stable incorporation of dUTP needs mutation in ung gene. Manganese Mn 25 54.93 Selenium Sc 34 78.96 endA1 DNA-specific endonuclease I mutation Improves quality of plasmid DNA isolations. Mendelevium Md 101 (258.10) Silicon Se 14 28.08 galE Part of the galETK operon that encodes UDP Mutant is more resistant to bacteriophage P1 infection. Mercury Hg 80 200.59 Neptunium Np 93 (237.04) galactose -4- epimerase Molybdenum Mo 42 95.94 Nickel Ni 28 58.69 galk Galactokinase mutation Blocks catabolism of galactose. Neodymium Nd 60 144.24 Silver Ag 47 107.86 galT Galactose-1-phosphate uridylyltransferase mutation Blocks catabolism of galactose. Neon Ne 10 20.17 Sodium Na 11 22.98 DNA gyrase mutation Confers resistance to nalidixic acid. Europium Eu 63 151.96 Strontium Sr 38 87.62 gyrA96 Protease mutation that leads to stabilization of Leads to high frequency of lysogeny by λ phages(1). Fermium Fm 100 (257.09) Sulfur S 16 32.06 hflA150 cll gene products Niobium Nb 41 92.90 Tantalum Ta 73 180.94 Gene encodes a possible protease component Mutations lead to high frequency fo bacteriophage lambda Nitrogen N 7 14.00 Technetium Tc 43 (97.90) hflB lysogenization. Nobelium No 102 (259.10) Tellurium Te 52 127.60 Host DNA restriction and methylation system mutation. Allows cloning without cleavage of transformed DNA by endogenous Osmium Os 76 190.2 Terbium Tb 65 158.92 hsdR Restriction minus,modification positive for the E.coli K restriction endonucleases. DNA prepared from this strain can be used to Oxygen O 8 15.99 Thallium Tl 81 204.38 (r -, m +) strain methylation system transform rk+E.coli strains. Palladium Pd 46 106.42 Thorium Th 90 232.03 k k Mutation of specificity determinant for host DNA Allows cloning without cleavage of transformed DNA by endogenous Phosphorus P 15 30.97 Thulium Tm 69 168.93 hsdS20 restriction and methylation system.Restriction restriction endonucleases. DNA prepared from this strain is Platinum Pt 78 195.08 Tin Sn 50 118.71 (r -, m -) minus,modification minus for the E.coli B strain unmethylated by the hsdS20 methylases. Plutonium Pu 94 (244.06) Titanium Ti 22 47.88 B B methylation system Polonium Po 84 (208.98) Tungsten W 74 183.85 Overproduction of the lac repressor protein Leads to high levels of the lac repressor protein, inhibiting Potassium K 19 39.09 Unnilhexium Unh 106 (263.11) laclq transcription from the lac promoter. Praseodymium Pr 59 140.90 Unnilquadium Unq 104 (261.11) Galactoside permease mutation Blocks lactose utilization. Promethium Pm 61 (144.91) Unnilpentium Unp 105 (262.11) lacY Partial deletion of β-D-galactosidase gene Allows complementation of β-galactosidase activity by α-complementation Protactinium Pa 91 (231.03) Unnilseptium Uns 107 (262.12) lacZΔM15 sequence in pGEM®-Z Vectors. Allows blue/white selection for recombinant Radium Ra 88 (226.02) Uranium U 92 238.02 colonies when plated on X-Gal. Radon Rn 86 (222.01) Vanadium V 23 50.94 leuB β-isopropylmalate dehydrogenase mutation Requires leucine for growth on minimal media. Rhenium Re 75 186.20 Xenon Xe 54 131.29 Δ(lon) Deletion of lon protease Reduces proteolysis of expressed proteins. Rhodium Rh 45 102.90 Ytterbium Yb 70 173.04 LysS pLyS plasmid is integrated into the host genome Strains carrying this plasmid will be tet resistant and produce T7 lysozyme, Rubidium Rb 37 85.46 Yttrium Y 39 88.90 a natural inhibitor of T7RNA polymerase, thus lowering background Ruthenium Si 44 101.07 Zinc Zn 30 65.39 transcription of sequecnces under the control of the T7 RNA polymerase promoter(2). mcrA Mutation in methylcytosine restriction system Blocks restriction of DNA methylated at the sequence 5’…GmCGC…3’. Genetic Markers in E.coli mcrB Mutation in methylcytosine restriction system Blocks restriction of DNA methylated at the sequence 5’…AGmCT…3’. metB Cystathionine γ-synthase mutation Requires methionine for growth on minimal media. Symbol Description Effect of Mutation metC Cystathionine beta-lyase mutation; involved in Requires methionine for growth on minimal media. ara-14 Mutation in arabinose metabolism Blocks arabinose catabolism. methionine biosynthesis araD L-ribulose phosphate 4-epimerase mutation;part of an Blocks arabinose catabolism. mtl Mutation in mannitol metabolism Blocks catabolism of mannitol. inducible operon araBAD repressed by L-arabinose mutS Methyl-directed mismatch repair mutation Prevents repair of the newly synthesized, unmethylated strand. argA N-Acetylglutamate synthas mutation; inhibited by the Arginine required from growth inminimal media. ompT Mutation of protease VII, an outer membrane protein Reduces proteolysis of expressed proteins. presence of arginine
cycA Mutation of a gene product involved in D-alanine, Mutants cannot use D-alanine as a carbon source. P2 P2 bacteriophage lysogen present in host λ phages containing the red and gam genes of λ aregrowth inhibited by P2 glycine,D-serine and D-cyloserine transport, and an
lysogens(3). Appendix L-alanine carrier proA γ-glutamyl phosphate reductase mutation proA/argD mutant will not block proline synthesis but will be repressed by dam DNA adenine methylase mutation Blocks methylation of adenine residues in the sequence 5’…GmATC…3’. arginine. Mutants excrete proline on minimal media and are resistant to dapD Succinyl-diaminopimelate aminotransferase mutation Mutant reflects impaired synthesis of succinyl CoA and needs to be proline analogs. proA/argD/argR triple mutant grows slowly on minimal supplemented with succinate or lysine+methionine. Appendix media+arginine. Blocks methylation of cytosine in the sequence 5’…CmCAGG…3’or 5’… dcm DNA cytosine methylase mutation proAB Mutations in proline metabolism Requires proline for growth in minimal media. CmCTGG…3’. deoC Deoxyribose-phosphate aldolase mutation recA1, Mutation in recombination Minimizes recombination of introduced DNA with host DNA, increasing recA13 stability of inserts. Inserts are more stable in recA1 than recA13 hosts.
Cellular Analysis deoR Regulatory gene mutation allowing constitutive expression of genes for deoxyribose synthesis Allows efficient propagation of large plasmids.
Your Innovation Partner in Drug Discovery! - 243 - www.genscript.com - 244 - Genetic Code Table For RNA
The relationship between the sedimentation velocity (S20,W) of sodium RNAs and molar masses (m) for solutions in 1 M sodium salt is 5'-OH Terminal Middle Base 3'-OH Terminal 5'-OH Terminal Middle Base 3'-OH Terminal expressed in the formula: Base U C A G Base Base U C A G Base
U Phe Ser Tyr Cys U A Ile Thr Asn Ser U Native, Single-Stranded RNA Phe Ser Tyr Cys C Ile Thr Asn Ser C S20,W = 0.030 m0.459 [Average of two equations (2, 3)]
Leu Ser STOP STOP A Ile Thr Lys Arg A Log m = 2.179 (log S20,W+1.523) Leu Ser STOP Trp G Met Thr Lys Arg G C Leu Pro His Arg U G Val Ala Asp Gly U Leu Pro His Arg C Val Ala Asp Gly C Leu Pro Gln Arg A Val Ala Glu Gly A The chart below is derived from the above equations: Leu Pro Gln Arg G Val* Ala Glu Gly G Approx. Base Length S m (g/mol) 20,w (Avg. FW=361)* 4 42,658 118 5 69,502 193 Determining Molar Masses Using S20,w Values 6 103,276 286 7 144,544 400
An S20,W value for many of our polynucleotides is printed on the Certificate of Analysis that accompanies the product. This value may be 8 195,147 535 used to determine the average molecular mass and average length of the polymer. Our polynucleotides consist of molecules with a 9 249,459 691
distribution of varying lengths, therefore, only an average length can be calculated from an S20,W value. 10 314,775 872 11 386,367 1,070 For DNA 12 467,735 1,296 13 557,186 1,543
The relationship between the sedimentation velocity (S20,W) of sodium DNAs and molar masses (m) for solutions in 1 M sodium salt is 14 654,636 1,813 expressed in the formulae (1):
* Average Formula Weight (Avg. FW) is obtained by averaging the following formula weights of the sodium salts of A, C, G and U: A=371, C=344, G=384, Native, dsDNA Neutral, Denatured ssDNA U=345. 0.346 0.549 S20,W= 0.0882 m S20,W = 0.0105 m Log m = 2.89 (log S +1.055) Log m = 1.82 (log S +1.979) 20,W 20,W References
The chart below is derived from the above equations and may be used for quick estimates of the average molar masses and average 1. Studier FW.J. Mol. Biol. 1967; 11(373). lengths of our polynucleotides: 2. Eisenberg H, Felsenfeld G. J. Mol. Biol. 1967; 30(17). 3. Inners LD, Felsenfeld G. J. Mol. Biol. 1970; 50(373).
S20,w Native dsDNA Neutral ssDNA Value m (g/mol) bp m (g/mol) Bases Concentration of DNA in Solution* 1.1 1,474 2 4,754 14 Double-Stranded DNA Molar Concentration 2.0 8,297 12 14,114 43 Molecules/ml Moles/ml Molar Concentration (50 μg/ml) of Termini 3.0 26,781 41 29,521 90 Bacteriophage (48,502 bp) 9.78×1011 1.62×10-12 1.62 nM 3.24 nM 4.0 26,781 94 49,834 152 pBR322(4,361 bp) 1.09×1013 1.81×10-11 1.81 nM 36.2 nM 5.0 198,521 179 74,800 229 13 -11 6.0 309,944 304 104,235 319 pUC18/pUC19 (2,686 bp) 1.77×10 2.94×10 29.4 nM 58.8 nM 13 -11 7.0 455,910 475 137,993 423 Segment of DNA (1 kb) 4.74×10 7.87×10 78.7 nM 157.4 nM 15 -9 8.0 640,782 699 175,955 539 Octameric double-stranded linker 5.92×10 9.83×10 9.83 μM 19.7 μM 9.0 868,860 982 218,022 668
10.0 1,144,392 1,332 264,107 810 A solution containing 50 μg/ml of dsDNA has an absorbance of 1.0 at 260 nm, i.e. A260=1.0=50 μg/ml of dsDNA. A solution containing 37 μg/ml of ssDNA Appendix
11.0 1,471,579 1,755 314,133 963 has absorbance of 1.0 at 260 Nm, i.e. A260=1.0=37 μg/ml of ssDNA. These values are calculated assuming that the mass of a nucleotide pair in DNA is 12.0 1,854,583 2,257 368,035 1,128 660 g/mol. 13.0 2,297,523 2,844 425,752 1,305 14.0 2,804,488 3,523 487,228 1,494 Appendix 15.0 4,301 552,415 1,694 Cellular Analysis
Your Innovation Partner in Drug Discovery! - 245 - www.genscript.com - 246 - Spectrophotometric Quantitation of DNA or RNA Agarose and Ployacrylamide Gels
Spectrophotometric measurements of nucleic acid solutions are typically taken at wavelengths of 260 nm and 280 nm. The A260 Dye Migration: Polyacrylamide Denaturing Gels
reading is used to determine the concentration of nucleic acid in solution. For a solution with an A260=1.0, the following approximations hold: Dyes will migrate to the same point as double-stranded DNA of the indicated size in a denaturing polyacrylamide gel.
1 A260 unit of dsDNA = 50 μg/ml Gel % Bromophenol Blue Xylene Cyanol 1 A260 unit of ssDNA = 37 μg/ml 5.0 35 bp 140 bp 1 A260 unit of dsDNA = 40 μg/ml 6.0 26 bp 106 bp *For oligonucleotides, an A260 of 1.0 represents anywhere from 20 to 33 μg/ml with the actual conversion factor dependent on the length and base sequence of the oligonucleotides(1). 8.0 19 bp 75 bp
The ratio between measurements at A260/A280 nm and provides an indicaton of the purity of a nucleic acid. In solution, pure DNA and 10.0 12 bp 55 bp RNA typically have ratios of 1.8 and 2.0, respectively. If the absorbance ratio is significantly less than the values above, the nucleic 20.0 8 bp 28 bp acid is probably contaminated with protein or phenol. Accurate quantification of a contaminated nucleic acid is not feasible without prior purification, and the efficacy of this can be established by the A /A ratio. 260 280 Dye Migration: Polyacrylamide Nondenaturing Gels Most of the lyophilized polynucleotides are sold are sold as A260 units (2). For an approximation of quantity, use the conversion factors provided above to convert the A units into micrograms 3/4 which must be known if a certain concentration is desired. 260 Dyes will migrate to the same point as double-stranded DNA of the indicated size in a nondenaturing polyacrylamide gel. 1. For a more accurate approximation, refer to Borer in the handbook of Biochemistry and Molecular Biology, 3rd edition (G.D.Fasman, ed.) CRC Press, Cleve land, OH Page 589 (1975). Gel % Bromophenol Blue Xylene Cyanol 2. Unit definition: One unit is that quantity of oligonucleotide or polynucleotide which has an absorbance of 1.0 at given wavelength 3.5 100 bp 460 bp when dissolved in 1 ml of buffer and measured in a 1 cm cuvette at 20°C. The wavelength at which the absorbance is measured is printed on the Certificate of Analysis which accompanies the product. For nucleic acids, typically an absorbance is taken at 260 nm 5.0 65 bp 260 bp in 20 mM sodium phosphate (pH7.0), 0.1 M NaCl. 8.0 45 bp 160 bp 12.0 20 bp 70 bp 15.0 15 bp 60 bp Molar Masses of Nucleic Acids 20.0 12 bp 45 bp
Average molar mass of a deoxynucleotide base 330 g/mol Average molar mass of a deoxynucleotide base pair 660 g/mol Miscellaneous Average molar mass of a ribonucleotide base 340 g/mol 1 kb of dsDNA (sodium salt) 6.6×105 g/mol Nucleotide Physical Properties 1 kb of ssDNA (sodium salt) 3.3×105 g/mol 1 kb of ssRNA (sodium salt) 3.4×105 g/mol Compound Molecular Weight Lambda Max (pH7.0) Absorbance at Max 1 M Solution (pH7.0) 1×106 g/mol of dsDNA (sodium salt) 1.54 kb ATP 507.2 259 15,400 Lambda DNA 3.1×107 g/mol (1) CTP 483.2 271 9,000 pBR322 DNA 2.8×106 g/mol (1) GTP 523.2 253 13,700 fX-174 DNA 3.6×106 g/mol (1) UTP 484.2 262 10,000 E. coli DNA 3.1×109 g/mol (1) dATP 491.2 259 15,200 dCTP 467.2 271 9,300 dGTP 507.2 253 13,700 Mass-to Mole Conversions dTTP 482.2 267 9,600
1 μg/ml of DNA 3.08 μM/ml phosphate Protein data 1 μg/ml of a 1 kb DNA fragment 3.08 nM/ml 5’-end 1 μg of a 1 kb DNA fragment 1.5 pmol=9.0×1011 molecules Bacterial Cells: E. coli or Salmonella typhimurium 1 μg of a 1 kb DNA fragment 3.0 pmol 5’-end 1 pmol of a 1 kb DNA fragment 0.66 μg Cell Data per Cell per liter at 109 Cells per ml
1 μg of pUC18/19 DNA (2,686 bp) 0.57 pmol=3.4×1011 molecules Wet Weight 9.5×10-13 0.95 g Appendix 1 pmol of pUC 18/19 DNA 1.77 μg Dry Weight 2.8×10-13 0.28 g -13 1 μg of pBR322 DNA (4,361 bp) 0.35 pmol=2.1×1011 molecules Total Protein 1.55×10 0.15 g 3 1 μg of linear pBR 322 DNA 0.70 pmol 5’-end Volume 1.15 μm =1 femtoliter Appendix 1 pmol of pBR322 DNA 2.8 μg 1 pmol of 5’-ends of linear pBR322 1.4 μg Protein Conc. in the cell: 135 mg/ml 9 1 μg of M13mp 18/19 DNA (7,249 bp) 0.21 pmol=1.3×1011 molecules Theoretical maximum yield for a 1 liter culture (10 cells/ml) if protein of interest is: 0.1 % of total protein: 150 μg/liter, 2.0 % of total protein: 30 mg/liter, 50.0 % of total protein: 75 mg/liter Cellular Analysis 1 pmol of M13mp 18/19 DNA 4.78 μg 1 μg of Lambda DNA (48,502 bp) 0.031 pmol=1.9×1010 molecules 1 pmol of Lambda DNA 32.01 μg
Your Innovation Partner in Drug Discovery! - 247 - www.genscript.com - 248 - Isotope Data Acid and Bases
Isotope Particle Emitted Half Life Molecular Specific % by Conc. Reagent Compound Formula 14C beta 5,730 years 1 Ci = 1,000 mCi Weight Gravity Weight Molarity 3H beta 12.4 years 1 mCi = 1,000 μCi Acetic acid, glacial CH3COOH 60.0 1.05 99.5 17.4 125I Beta, gamma X-ray 59.6 days 1 μCi = 2.2×106 disintegration/second Formic acid HCOOH 46.0 1.20 90 23.4 32P beta 14.3 days 1 Becquerel = 1 disintegration/second Hydrochloric acid HCl 36.5 1.18 36 11.6 33P beta 25.4 days 1 μCi = 3.7×104 Becquerels Nitric acid HNO3 63.0 1.42 71 16.0 35S beta 87.4 days 1 Becquerel = 2.7×10-5 μCi Perchloric acid HClO4 100.5 1.67 70 11.6
Phosphoric acid H3PO4 98.0 1.70 85 18.1
Sulfuric acid H2SO4 98.1 1.84 96 18.0
Ammonium hydroxide NH4OH 35.0 0.90 28 14.8 Potassium hydroxide KOH 56.1 1.52 50 13.5 Resolution of Linear DNA on Agarose Gels Sodium hydroxide NaOH 40.0 1.53 50 19.1
β-mercaptoethanol HSCH2CH2OH 78.1 1.11 100 14.3 Recommended %Agarose Optimum Resolution for linear DNA (Size of fragments in base pairs) 0.5 1,000—30,000 0.7 800—12,000 1.0 500—10,000 1.2 400—7,000 1.5 200—3,000 2.0 50—2,000
pH vs Temperature for Tris Buffer
pH of Tris Buffer (0.05 M) 5 0C 25 0C 37 0C 7.76 7.20 6.91 7.89 7.30 7.02 7.97 7.40 7.12 8.07 7.50 7.22 8.18 7.60 7.30 8.26 7.70 7.40 8.37 7.80 7.52 8.48 7.90 7.62 8.58 8.00 7.71 8.68 8.10 7.80 8.78 8.20 7.91 8.88 8.30 8.01 8.98 8.40 8.10 9.09 8.50 8.22 9.18 8.60 8.31 9.28 8.70 8.42 Appendix Appendix Cellular Analysis
Your Innovation Partner in Drug Discovery! - 249 - www.genscript.com - 250 - Alphabetical Index A D P Apoptosis 219 Direct PCR 17 Plasmid DNA Purification 3 Other Antibodies 176 Annexin V-EGFP Kit 222 QuickClean 5M MiniPrep Kit 3 Phospho-Specific Antibodies 98 Caspase Activity Assay Kits 221 QuickClean 96-well Plasmid Miniprep Kit 4 Signal Transduction Antibodies 125 Cell Apoptosis DAPI Detection Kit 220 E PCR Purification 5 Stem Cell Antibodies 174 Cell Apoptosis PI Detection Kit 221 Endotoxin Detection and Removal System 47 QuickClean 5M PCR Purification Kit 5 Pharmaceuticals 191 Double Stain Apoptosis Detection Kit ToxinSensorTM Chromogenic LAL Endotoxin QuickClean 96-well PCR Purification Kit 5 Peptide Building Blocks 191 (Hoechst 33342/PI) 220 Assay Kit 47 PCR Cloning 22 Mitochondrial Apoptosis Detection Kit 219 ToxinSensorTM Gel Clot Endotoxin Assay Kit 47 CloneEZ® PCR Cloning System 22 TUNEL (TdT-Mediated dUTP Nick-End Labeling) ToxinEraserTM Endotoxin Removal Kit 48 PCR Related Products 21 R Apoptosis Detection Kits 223 dNTPs 21 Routine PCR 16 Primers 34 2X Taq Master Mix 17 F Protein Expression 37 Taq DNA Polymerase 15 B Featured Products v Protein Expression Vectors 37 Related Reagents for Protein Analysis 61 β-Amyloid Peptides 185 Easy Self-Induction Medium 39 Immunology Reagents 63 Blocking Peptides 186 Protein Isolation and Purification 39 Related Biology Reagents 208 G Magnetic Beads for Protein Isolation 41 Reagents for Cell Analysis 229 Green PCR 15 Protein Purification Resins 39 C Green Taq DNA polymerase 15 Protein Purification Kits 43 Catalog Proteins 65 High-stability PCR kit 16 Easy BacLysis Protein Extraction Solution 42 S Cytokines & Growth Factors 65 Stablized dNTP mix 21 Protein Electrophoresis 43 siRNA Expression Vectors 24 Enzymes & Inhibitors 68 GenPoolTM ORF Clones 23 ExpressTM PAGE Gel System 43 Adenoviral siRNA Shuttle Vectors 26 Hormones 68 Pre-Stained and Unstained Protein Standards 45 Inducible siRNA Expression Vectors 25 Kinases 67 Protein Detection and Immunoassay 49 Lentiviral siRNA Expression Vectors 27 Other Catalog Proteins 70 M Cell Lysates 59 Plasmid siRNA Expression Vectors 24 Virus Antigens 69 MiniFresh® Antibodies 77 eStainTM Protein Staining System 49 Retroviral siRNA Expression Vectors 28 Cell Cycle Analysis Kit 224 ExpressTM ELISA Kits 56 siRNA Positive Controls 29 Cell Proliferation Assay Kit 224 ONE-HOUR WesternTM Detection System 51 siRNA Negative Controls 30 Cell Lines 225 N ONE-HOUR WesternTM Standard Kit 52 Secondary Antibodies 179 GPCR Stable Cell Lines 225 Nucleic Acid Electrophoresis 6 ONE-HOUR WesternTM Advanced Kits 53 Ready-to-UseTM Frozen Cell Lines 227 Nucleic Acid Markers 8 ONE-HOUR WesternTM Fluorescent Kits 55 Cosmetic Peptides 191 DNA Ladders 8 ONE-HOUR WesternTM Multiplex Fluorescent Kit 55 T Custom Services Ready-to-UseTM Ladders 9 ONE-HOUR IP-Western Kits 54 THETM Elite Antibodies 75 Antibody Services 180 KB Plus DNA Logical Ladders 9 ONE-HOUR WesternTM Kit Accessories 58 THETM Anti-α-Tubulin mAb Molecular Biology Services 31 Western QuickBlock Kits 57 THETM Anti-β-Actin mAb Peptide Services 215 Primary Antibodies 89 THETM Anti-c-Myc mAb Plasmid DNA Preparation Services Cell Marker/Cell Surface Antigen Antibodies THETM Anti-DYKDDDDK mAb 11 O 97 Appendix Protein Services 71 Other Peptides 195 Control Antibodies/Loading Control Antibodies 175 THETM Anti-GST-tag mAb Related Custom Cell Line Services 231 Epitope Tag Antibodies 89 THETM Anti-His-tag mAb GPCRs Antibodies 173 THETM Anti-HA-tag mAb Appendix Neuroscience Antibodies 92 Cellular Analysis
Your Innovation Partner in Drug Discovery! - 251 - www.genscript.com - 252 - Note: CONTACT US
USA HEADQUARTERS JAPAN BRANCH OFFICE FRANCE BRANCH OFFICE
GenScript USA Inc. GenScript USA Inc. GenScript USA Inc. 120 Centennial Ave. 7F,Kanda-Central Building B, 2 Rue de Fontarabie, Piscataway, NJ 08854 1-7, Suda-cho, Kanda, Chiyoda-ku, 75020 Paris, USA Tokyo 101-0041 France Tel: 1-732-885-9188 / 1-732-885-9688 Japan Toll-Free Tel: 08-05-10-22-28 Toll-Free Tel: 1-877-436-7274 Tel: 81-3-6206-8985 Fax: 1-732-210-0262 / 1-732-885-5878 Fax: 81-3-6206-8987 Email: [email protected]
BUSINESS DEVELOPMENT ACCOUNTS PAYABLE/RECEIVABLE
Tel: 1-732-317-5088 Accounting Department Email: [email protected] GenScript USA Inc. 120 Centennial Ave. Piscataway, NJ 08854 USA
REGIONAL CONTACT NUMBERS
Australia Japan Toll-Free Tel: 1-800-172-605 Tel: 81-3-6206-8985
Belgium Netherlands Tel: 32-27-470-921 Tel: 31-20-890-5456
Denmark Norway Toll-Free Tel: 8088-7617 Toll-Free Tel: 800-19-172
France Portugal Toll-Free Tel: 08-05-10-22-28 Toll-Free Tel: 800-815-627
Finland Singapore Toll-Free Tel: 0800-913-020 Toll-Free Tel: 800-120-4549
Germany Spain Toll-Free Tel: 0-800-0006-320 Toll-Free Tel: 800-098-920
Hong Kong Sweden Toll-Free Tel: 800-964-684 Toll-Free Tel: 0200-884-573
Ireland Switzerland Toll-Free Tel: 1800-932-547 Toll-Free Tel: 0800-369-254
Israel United Kingdom Toll-Free Tel: 1-809-216-068 Toll-Free Tel: 08082-380203
CONTACT LIST
For Sales: [email protected] For siRNA Services: [email protected] For General Inquiry: [email protected] For Peptide Services: [email protected] For Informatics Support: [email protected] For Protein Services: [email protected] For Technical Support: [email protected] For Antibody Services: [email protected] For Catalog Products: [email protected] For Bio Process Services: [email protected] For Molecular Biology Services: [email protected] For Bio Assay Services: [email protected]