bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Hap2-Ino80 facilitated transcription promotes de novo

establishment of CENP-A chromatin

Puneet P. Singh1, Manu Shukla1, Sharon A. White1, Pin Tong1,2, Tatsiana

Auchynnikava1, Christos Spanos1, Juri Rappsilber1,3, Alison L. Pidoux1, and

Robin C. Allshire1

1Wellcome Centre for Cell Biology, School of Biological Sciences, The University of

Edinburgh, Swann Building, King’s Buildings, Mayfield Road, Edinburgh EH9 3BF,

United Kingdom.

2Present address: MRC Human Genetics Unit, Institute of Genetics & Molecular

Medicine, University of Edinburgh, Edinburgh EH4 2XU, United Kingdom

3Bioanalytics, Institute of Biotechnology, Technische Universität Berlin, 13355 Berlin,

Germany

Running Title: Ino80 facilitates CENP-A chromatin establishment

Corresponding author: [email protected]

1 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUMMARY

Centromeres are maintained epigenetically by the presence of CENP-A, an evolutionarily- conserved histone H3 variant, which directs kinetochore assembly and hence, centromere function. To identify factors that promote assembly of CENP-A chromatin, we affinity selected solubilised fission yeast CENP-ACnp1 chromatin. All subunits of the Ino80 complex were enriched, including the auxiliary subunit Hap2. In addition to a role in maintenance of CENP-ACnp1 chromatin integrity at endogenous centromeres, Hap2 is required for de novo assembly of CENP-ACnp1 chromatin on naïve centromere DNA and promotes H3 turnover on centromere regions and other loci prone to CENP-ACnp1 deposition. Prior to CENP-ACnp1 chromatin assembly, Hap2 facilitates transcription from centromere DNA. These analyses suggest that Hap2-Ino80 destabilises H3 nucleosomes on centromere DNA through transcription-coupled histone H3 turnover, driving the replacement of resident H3 nucleosomes with CENP-ACnp1 nucleosomes. These inherent properties define centromere DNA by directing a program that mediates CENP-ACnp1 assembly on appropriate sequences.

2 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

INTRODUCTION

The accurate delivery of all chromosomes to both resulting nuclei during mitotic cell division is required for eukaryotic cell viability and to prevent aneuploidy, a hallmark of cancer (Kops et al., 2005). The centromere region of chromosomes mediates their attachment to spindle microtubules for normal mitotic chromosome segregation (Cleveland et al., 2003; Fukagawa and Earnshaw, 2014; Pidoux and Allshire, 2004). In many organisms, centromeres are assembled on repetitive elements such as -satellite repeats, minor satellite repeats, cen180/CentC/CentO repeats, and retroelements at human, mouse, plant, and Drosophila centromeres, respectively (Chang et al., 2019; Cheng et al., 2002; Grady et al., 1992; Kipling et al., 1991). Although such centromere repeats lack sequence similarity, in many cases their introduction as naked DNA into cells triggers de novo kinetochore assembly (Allshire and Karpen, 2008; McKinley and Cheeseman, 2016; Müller and Almouzni, 2017).

The underlying conserved feature at eukaryotic centromeres is the assembly of nucleosomes containing the histone H3 variant CENP-A (also generally known as cenH3; and specifically as CID in Drosophila, Cse4 in Saccharomyces cerevisiae, Cnp1 in Schizosaccharomyces pombe) in place of canonical H3 to direct kinetochore assembly on such repetitive elements. Moreover, it is known that following deletion of an endogenous centromere, CENP-A incorporation and neocentromeres can arise at novel non-centromeric DNA locations (Ishii et al., 2008; Ketel et al., 2009; Shang et al., 2013). CENP-A chromatin has also been shown to be sufficient to trigger kinetochore assembly (Barnhart et al., 2011; Chen et al., 2014; Hori et al., 2013; Mendiburo et al., 2011). Thus, CENP-A deposition and not the primary sequence of centromere DNA determines the position of centromere formation. However, centromere DNA itself may harbour properties that favour CENP-A and kinetochore assembly (Baum et al., 1994; Fachinetti et al., 2015; Logsdon et al., 2019).

Three fission yeast species possess complex regional centromeres in which CENP-ACnp1 and kinetochores are assembled over a non-repetitive central domain of approximately 10 kb in S. pombe, S. octosporus and S. cryophilus (Tong et al., 2019). Although flanking gene order is preserved, the central domain sequence is not conserved amongst these species. Despite this lack of similarity, central domain DNA from S. octosporus and S. cryophilus, as well as S. pombe, can direct de novo CENP-ACnp1 and kinetochore assembly in S. pombe (Catania et al., 2015; Folco et al., 2008; Tong et al., 2019). This suggests that these non-homologous centromere DNAs possess innate features that program events which preferentially trigger the assembly of CENP-ACnp1 in place of H3 nucleosomes.

3 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

During replication, parental CENP-A has been shown to distribute equally to nucleosomes on duplicated DNA of both sister centromeres, thus halving the amount of CENP-A at each centromere (Black and Cleveland, 2011; Jansen et al., 2007; Schuh et al., 2007). Replenishment by deposition of newly-synthesised CENP-A is temporally separated from DNA replication-coupled H3 chromatin assembly. The timing of new CENP-A deposition differs in various species; mitosis/late telophase/early G1 in human and Drosophila (Erhardt et al., 2008; Mellone et al., 2011; Schuh et al., 2007), S phase in S. cerevisiae (Jansen et al., 2007; Pearson et al., 2004; Wisniewski et al., 2014), and G2 in plants and S. pombe (Lando et al., 2012; Lermontova et al., 2006; Shukla et al., 2018).

Several studies have reported the association of RNA polymerase II (RNAPII) with, and/or transcription from CENP-A-associated DNA so that non-coding transcription has become an apparent integral feature of centromeres (Duda et al., 2017). RNAPII has been detected at human artificial chromosome (HAC; Bergmann et al., 2011), human metaphase (Chan et al., 2012), Drosophila (Bobkov et al., 2018), and S. cerevisiae (Ohkuni and Kitagawa, 2011) centromeres, and also the central domains of fission yeast centromeres (Catania et al., 2015). Disruption of centromere transcription appears to hinder CENP-A loading and/or maintenance (Bergmann et al., 2011; Cardinale et al., 2009; Chen et al., 2015; Ling and Yuen, 2019; McNulty et al., 2017; Nakano et al., 2008). Moreover, increased centromere transcription results in the rapid loss of CENP-A and centromere function (Bergmann et al., 2012; Hill and Bloom, 1987). The central CENP-ACnp1 domains from S. pombe centromeres contain numerous RNAPII transcriptional start sites and promoters (Catania et al., 2015; Choi et al., 2011). In addition, ectopically-located central domain DNA, that lacks CENP-ACnp1 chromatin, exhibits high rates of histone H3 turnover (Shukla et al., 2018). Such observations suggest that transcription-coupled chromatin remodelling events might drive the eviction of H3 and its replacement with CENP-ACnp1. Consistent with this view, the accumulation of elongating RNAPII on ectopic centromere DNA during G2 coincides with the eviction of H3 and deposition of new CENP-A (Shukla et al., 2018). However, it remains to be determined which transcription-associated chromatin remodelling factors provoke the replacement of H3 with CENP-A on naïve centromere DNA.

Various ATP-dependent chromatin remodelling complexes provide access to the underlying DNA of chromatin-coated templates. Their activities enable transcription by disassembling nucleosomes, sliding nucleosomes, or replacing nucleosomal histone subunits with transcription-promoting variants (Becker and Hörz, 2002; Clapier and Cairns, 2009). The Remodelling and Spacing Factor (RSF) interacts with CENP-A chromatin in mid-G1, its depletion reduces CENP-A levels at centromeres (Perpelescu et al., 2009) and tethering of RSF1 to centromere repeats promotes histone turnover/exchange resulting in both H3.3 and

4 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

CENP-A deposition (Ohzeki et al., 2016). In S. pombe, Hrp1 (ortholog of Chromo-Helicase DNA-binding protein 1, CHD1) is enriched at centromeres and is required to maintain normal CENP-ACnp1 levels at centromeres (Choi et al., 2011; Walfridsson et al., 2005). Loss of the histone chaperone FAcilitates Chromatin Transcription (FACT) results in promiscuous CENP- ACnp1 assembly at non-centromeric locations ACnp1 (Choi et al., 2012), suggesting that CENP- ACnp1 may be titrated away from centromeres by loss of such factors. Moreover, inducible ectopic centromeres in Drosophila requires FACT-mediated RNAPII-dependent transcription of underlying DNA, indicating a necessity for transcription during CENP-A assembly (Chen et al., 2015).

Ino80 is a Snf2-family ATPase evolutionarily conserved from yeast to humans, that participates in transcription, DNA replication and DNA repair (Bao and Shen, 2007; Conaway and Conaway, 2009; Shen et al., 2000). The Ino80 complex (Ino80C) can slide nucleosomes in an ATP-dependent manner (Chen et al., 2011; Shen et al., 2000; Willhoft et al., 2016) and can space multiple nucleosomes on longer DNA fragments (Udugama et al., 2011). Ino80C may also remove H2A.Z–H2B dimers from nucleosomes, replacing them with H2A–H2B dimers (Brahma et al., 2017; Papamichos-Chronakis et al., 2011). H2A.Z is enriched in +1 nucleosomes downstream of promoters of many active genes and loss of Ino80 function affects transcription (Gai et al., 2017; Hogan et al., 2010; Klopf et al., 2009; Xue et al., 2015). Individual Ino80C subunits make up three modules that associate with the main Ino80 ATPase subunit (Table S1; Chen et al., 2011; Tosi et al., 2013; Watanabe et al., 2015). S. pombe Ino80 has been shown to influence the maintenance of CENP-ACnp1 chromatin at centromeres (Choi et al., 2017). However, it is not known if Ino80C influences centromere DNA transcription or the establishment of CENP-A chromatin on naïve centromere DNA and thus centromere identity.

Here we utilize affinity selection of CENP-ACnp1 chromatin and mass spectrometry to identify proteins enriched in CENP-ACnp1 chromatin that may promote CENP-ACnp1 assembly. We identify Hap2 as an auxiliary subunit of Ino80C that is required for the conversion of H3 chromatin to CENP-ACnp1 chromatin on naïve centromere DNA. We show that loss of Hap2 function reduces transcription and histone H3 turnover on centromere DNA sequences. Our findings indicate that Hap2-Ino80 is required to promote transcription-associated chromatin remodelling events that drive H3 nucleosome eviction and the assembly of CENP-ACnp1 nucleosomes in their place.

5 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

RESULTS

Hap2 is an Ino80C subunit that is enriched in CENP-ACnp1 chromatin

To identify proteins involved in the assembly of CENP-ACnp1 chromatin, GFP-tagged CENP-ACnp1 chromatin was affinity purified from micrococcal nuclease (MNase) solubilized chromatin extracts (Figure 1A). Quantitative PCR (qPCR) analysis of the resulting enriched native chromatin revealed significant enrichment of centromeric DNA from the single copy central CENP-ACnp1 domain of cen2 (cc2) compared to the 18 copies of flanking outer repeat (dg) sequences (Figure S1A). In addition, SDS-PAGE analysis showed core histones to be prevalent in this affinity-selected GFP-CENP-ACnp1 material (Figure 1B and S1B). Label-free quantitative mass spectrometry detected strong enrichment of all known subunits of both the inner and outer kinetochore complexes (Figure 1C; Table S2). As our procedure also showed association of the chaperones Scm3 (HJURP) and Sim3 (NASP) that mediate CENP-ACnp1 deposition we reasoned that other enriched, but non-centromere specific, proteins might be involved in the incorporation of CENP-ACnp1 into centromeric chromatin.

It was notable that all subunits of the Ino80 chromatin remodelling complex (Ino80C) were enriched in our affinity-selected GFP-CENP-ACnp1 preparations (Figure 1C). Also enriched in these samples was the low molecular weight alpha-helical Hap2 protein. Hap2 has previously been reported to associate with Ino80C but no characterisation has been performed (Hogan et al., 2010). To confirm association of Hap2 with Ino80C, Hap2 was C-terminally tagged with GFP at its endogenous chromosomal locus (Hap2-GFP; Figure S2A). Affinity selection of Hap2-GFP followed by proteomic analysis revealed that all subunits of Ino80C, but not subunits of other remodelling complexes, are enriched with Hap2-GFP (Figure 1D). Western analysis confirmed that HA-tagged Ino80 (Ino80-HA) associates with immunoprecipitated Hap2-GFP (Figure S1C). Furthermore, affinity selection of Ino80-HA enriched all known Ino80C subunits along with Hap2 (Figure S1D). We conclude that Hap2 is a non-canonical subunit of the fission yeast Ino80 complex and that all Ino80C subunits are enriched in CENP-ACnp1 chromatin.

Hap2 associates with central domain DNA assembled in CENP-ACnp1 chromatin or H3 chromatin

Microscopic analysis showed that Hap2-GFP localizes in several prominent nuclear foci (Figure 2A). Quantitative chromatin immunoprecipitation (qChIP) assays revealed that Hap2-GFP associates with most chromatin regions analysed including the central CENP-ACnp1 domain of centromeres (cc2), the flanking pericentromeric outer repeats (dg) and on the highly

6 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

expressed act1+ gene (Figure 2B). When 8.5 kb of cen2 central domain DNA (cen2-cc2) is inserted at the ura4 locus on a chromosome arm (ura4:cc2), it is assembled in H3 instead of CENP-ACnp1 chromatin (Choi et al., 2012; Shukla et al., 2018). Replacement of 6.5 kb of endogenous cen2-cc2 DNA with 5.5 kb of cen1 central domain DNA (cc2Δ::cc1) allows analysis across the resulting unique ectopic copy of cen2 central domain DNA (ura4:cc2) in the absence CENP-ACnp1 and kinetochore proteins (Figure 2C Top; Choi et al. 2012; Catania et al. 2015; Shukla et al. 2018). qChIP analysis revealed that Hap2-GFP associates with this ectopic cc2 central domain chromatin (Figure 2C Bottom). A noticeably higher level of Hap2- GFP was consistently detected across ectopic ura4:cc2 central domain DNA assembled in H3 chromatin relative to the same DNA sequence at the native cen2 central domain assembled in CENP-ACnp1 chromatin (Figure 2D). Loss of Hap2 does not affect the association of Ino80- HA with these regions (Figure S2B). We conclude that the Ino80C subunit Hap2 is a nuclear protein which associates with non-centromeric loci and is preferentially recruited to centromeric central domain chromatin when assembled in H3 rather than CENP-ACnp1 chromatin.

Hap2 is required to maintain CENP-ACnp1 chromatin across endogenous centromeres

Cells lacking Hap2 exhibit an elevated frequency of lagging chromosomes during mitosis, indicating that loss of Hap2 may affect centromere function (Figure 3A). Defective centromere function can result from reduced pericentromeric heterochromatin formation on dg/dh outer repeats or CENP-ACnp1 chromatin/kinetochore assembly and these can be sensitively detected by the use of silent ura4+ reporter genes inserted within outer repeat heterochromatin or central CENP-ACnp1 domain chromatin (Allshire et al., 1994, 1995; Partridge et al., 2000). No alleviation of heterochromatin-mediated silencing at otr1:ura4+ was detected in hap2∆ cells relative to wild-type as indicated by similar poor growth on selective plates lacking uracil (-URA) and good growth on counter-selective 5-FOA plates (Figure 3B and S3A). Consistent with this observation, no significant change was detected in the levels of the heterochromatin H3K9me2 mark or dg transcripts produced by the underlying outer repeats in hap2∆ relative wild-type cells (Figure 3C and D).

Central CENP-ACnp1 domain chromatin is also transcriptionally repressive (Allshire et al., 1994, 1995). Defects in CENP-ACnp1 chromatin assembly alleviates this transcriptional silencing (Jin et al., 2002; Partridge et al., 2000; Pidoux et al., 2003). To test if loss of Hap2 affects CENP-ACnp1-mediated silencing we examined silencing of ura4+ embedded in central CENP-ACnp1 chromatin at cen1 (cc1:ura4+). Reduced silencing in hap2∆ cells, indicated by reduced growth on counter-selective FOA plates, suggested a defect in CENP-ACnp1 chromatin

7 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

integrity (Figures 3E and S3B). qChIP analysis detected significantly lower levels of CENP-ACnp1 and a reciprocal increase in H3 levels across the central domain of centromeres in hap2∆ relative to wild-type cells (Figure 3F and G), consistent with the silencing defect. Importantly, loss of Hap2 does not affect the total cellular levels of GFP-CENP-ACnp1 or the expression of genes encoding proteins that are known to regulate CENP-ACnp1 loading at centromeres (Figure S3C and D). We conclude that loss of Hap2 specifically affects silencing through loss of CENP-ACnp1 and gain of H3 within the central domain of centromeres, thus Hap2 is required to maintain CENP-ACnp1 chromatin integrity at endogenous centromeres.

Hap2 is required for the de novo establishment of CENP-ACnp1 chromatin

Many factors are known to assist CENP-A maintenance but little is known about the factors required for the de novo establishment of CENP-A chromatin. De novo establishment of functional centromeres can occur following the introduction of naked centromere DNA into cells (Catania et al., 2015; Nakano et al., 2003). We first examined whether Hap2 and other subunits of Ino80 complex are required for the de novo establishment of centromeres on the pHcc2 minichromosome (Figure 4A). hap2Δ cells exhibited a complete failure to establish functional centromeres, similar to clr4Δ cells that lack heterochromatin, whilst iec1Δ, ies2Δ and ies4Δ were competent in establishing functional centromeres on pHcc2 (Figure 4B and S4A). In S. pombe, de novo CENP-ACnp1 chromatin establishment on circular plasmid-based minichromosomes requires a block of heterochromatin in close proximity to central domain DNA (Folco et al., 2008; Kagansky et al., 2009). Loss of centromere establishment could result from a failure to establish CENP-ACnp1 chromatin, and/or adjacent heterochromatin, on the minichromosome. To distinguish between these possibilities, CENP-ACnp1 levels on the plasmid-borne central domain cc2 DNA were analysed. All strains used have 6 kb of cen2 central domain DNA replaced with 5.5 kb of cen1 central domain DNA at endogenous centromeres (cc2Δ::cc1) so that the plasmid-borne cc2 is the only copy of this element. qChIP revealed that CENP-ACnp1 was not assembled over cc2 carried by pHcc2 in hap2∆ cells (Figure 4C). Reciprocally, a high level of H3 was detected across cc2 of pHcc2 in the absence of CENP-ACnp1 assembly in hap2∆ cells (Figure 4D). qChIP for H3K9me2 demonstrated that loss of Hap2 did not affect the establishment of heterochromatin on the plasmid-borne K”/dg repeat (Figure 4E). Interestingly, high levels of H3K9me2 were detected within the central domain of the pHcc2 minichromosome in hap2∆ but not wild-type cells (Figure 4E). This suggests that in the absence of CENP-ACnp1 chromatin establishment in hap2∆ cells heterochromatin may spread from the outer K”/dg repeat into the plasmid-borne central cc2 domain. To test if Hap2 is required for the de novo establishment of CENP-ACnp1 chromatin independently from the

8 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

requirement for adjacent heterochromatin, the plasmid pcc2 which carries 8.5 kb of cen2 central domain DNA, but no heterochromatin forming outer repeat sequences, was transformed into cells expressing additional GFP-CENP-ACnp1 which allows CENP-ACnp1 chromatin assembly (Catania et al. 2015; Figure 4F, Top). In contrast to wild-type, hap2Δ cells did not assemble high levels of CENP-ACnp1 over the central domain of the pcc2 minichromosome (Figure 4F, Bottom). This effect was not due to altered CENP-ACnp1 protein levels in hap2Δ compared to wild-type cells (Figure S4B). We conclude that Hap2 is critical for the de novo establishment of CENP-ACnp1 chromatin on naïve central domain centromere DNA.

Hap2 promotes histone turnover in genomic regions prone to CENP-ACnp1 assembly

Central domain DNA inserted at a non-centromeric location on the arm of a chromosome, such as the ura4 locus on chromosome 3 (ura4:cc2), remains assembled in H3 nucleosomes and exhibits a high rate of histone H3 turnover (Shukla et al., 2018). The inherent instability of H3 nucleosomes assembled on this ectopic ura4:cc2 centromere DNA has been proposed to aid the incorporation of CENP-ACnp1 when available (Shukla et al., 2018). In S. cerevisiae, Ino80 associates with promoter-associated nucleosome depleted regions and transcription start sites (TSS) where it mediates the turnover of +1 nucleosomes (Yen et al., 2013). The requirement for Hap2 in de novo CENP-ACnp1 assembly on central domain DNA may result from defective H3 nucleosome turnover on these centromeric sequences when assembled in H3 chromatin alone. We therefore used Recombination-Induced Tag Exchange (RITE; Verzijlbergen et al., 2010; Shukla et al., 2018) to measure replication-independent H3 turnover in G2-arrested wild-type and hap2∆ cells on ectopic ura4:cc2, heterochromatic repeats and highly-transcribed genes. This H3.2-HAT7 tag swap was induced in cdc25-22/G2-arrested cells and the incorporation of new histone H3.2-T7 was monitored (Figure 5A). Importantly, the H3.2-HAT7 tag swap efficiency was unaffected by hap2∆ relative to wild-type cells (Figure S5A). Compared to wild-type cells, a significant decrease in the level of H3 turnover was evident on ectopic ura4:cc2 centromere DNA in hap2∆ cells (Figure 5B). Similarly, H3 turnover within endogenous cen1-cc1 assembled in CENP-ACnp1 chromatin was also reduced in hap2∆ cells. In contrast, H3 turnover remained unchanged within heterochromatic outer repeats (dg) and over highly-transcribed genes (act1+ and spd1+). Ino80 may mediate nucleosome turnover through eviction of H2A.Z (Papamichos-Chronakis et al., 2011). However, the levels of H2A.ZPht1 associated with endogenous cc1 and ectopic ura4:cc2 were unaffected by loss of Hap2 (Figure S5B). We conclude that Hap2 is required to ensure H3

9 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

nucleosome instability on centromeric sequences by mediating a high frequency of H3 turnover which may consequently allow the incorporation of CENP-ACnp1 in place of H3.

Overexpression of CENP-ACnp1 results in low levels of promiscuous CENP-ACnp1 incorporation at non-centromeric locations (Castillo et al., 2013; Choi et al., 2012; Gonzalez et al., 2014). Fission yeast CENP-ACnp1 expression is known to increase prior to that of canonical histones in advance of replication. Consequently, even without overexpression, in early S phase this natural excess of CENP-ACnp1 results in low levels of newly synthesized CENP-ACnp1 being incorporated across many gene bodies (Shukla et al., 2018). ChIP-Nexus (a modified Exo-ChIP-seq protocol; He et al., 2015) analysis allowed detection of non-centromeric genomic regions where islands of CENP-ACnp1 are retained at low levels (Figure 5C and D). Hap2-GFP was found to associate with these Non-centromeric CENP-ACnp1 ISlands (NCIS), while loss of Hap2 significantly decreased CENP-ACnp1 incorporation within these islands (Figure 5E and S5C). Interestingly, qChIP also revealed reduced histone H3 turnover within these non-centromeric CENP-ACnp1 islands in hap2∆ cells whereas histone H3 turnover remained unchanged within the outer repeats, the act1+ gene or the repressed meiosis-specific mei4+ gene (Figure 5F). We conclude that Hap2 also promotes a high rate of H3 turnover at several non-centromeric NCIS loci prone to low level CENP-ACnp1 incorporation. This observation reinforces the involvement of Hap2-Ino80C in mediating histone H3 turnover and the exchange of histone H3 for CENP-ACnp1-containing nucleosomes.

Hap2 facilitates transcription of central domain chromatin

The central CENP-ACnp1 domain of S. pombe centromeres is transcribed from many TSS and the resulting RNAs are short-lived (Catania et al., 2015; Choi et al., 2011; Sadeghi et al., 2014). Transcription can provide the opportunity for histone exchange/remodeling of resident nucleosomes (Venkatesh and Workman, 2015), it is therefore feasible that transcription- coupled processes also promote the exchange of H3 for CENP-ACnp1 in chromatin assembled on centromere DNA. Relatively high levels of RNAPII are detected on central domain DNA when assembled in H3 chromatin at ectopic ura4:cc2 or on the pcc2 minichromosome, yet only low levels of RNAPII are detectable within endogenous centromeric central domain CENP-ACnp1 chromatin (Catania et al., 2015; Shukla et al., 2018). Since CENP-ACnp1 is primarily deposited during G2, we investigated whether Hap2 affects transcription from ectopic ura4:cc2 in mid-G2 cells from cdc25-22 synchronized cultures (Figure 6A). qChIP was employed to measure the levels of total RNAPII, initiating RNAPIIS5P and elongating RNAPIIS2P levels across ura4:cc2. RNAPIIS5P levels were significantly lower across this ectopic central domain DNA in hap2∆ compared to wild-type cells, but no obvious difference

10 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

was detected within the CENP-ACnp1 chromatin regions of endogenous centromeres (Figure 6B). These data suggest that Hap2 promotes efficient transcriptional initiation from central domain DNA assembled in H3 chromatin (ura4:cc2). In contrast, the levels of total and elongating RNAPIIS2P associated with ectopic central domain DNA remained unchanged in hap2∆ relative to wild-type cells (Figure S6A and B). Consistent with reduced transcriptional initiation, lower levels of central domain transcripts were produced from ectopic ura4:cc2 in hap2∆ cells (Figure 6C). Transcript levels from outer repeats and act1+ were unaffected. Thus, Hap2 is required for efficient transcriptional initiation and transcript production from ectopic central domain DNA assembled in H3 chromatin. The fact that no decrease in elongating RNAPIIS2P was detected across this ectopic central domain in hap2∆ cells suggests that RNAPII remains associated with the central domain template for longer when Hap2 is absent.

Regions upstream of TSS within the central domain of cen2 exhibit promoter activity (Catania et al., 2015). To determine if Hap2 affects the transcription from these central domain promoters, the production of β-galactosidase was assessed when 200 bp promoter-containing cc2 fragments were placed upstream of lacZ (Figure 6D Inset). Three central domain promoters exhibited significantly lower promoter activity in hap2∆ compared to wild-type cells, whereas the control nmt81 promoter was unaffected (Figure 6D; S6C and D). We conclude that Hap2 is required for efficient transcription from central domain promoters and that this facilitates transcription-coupled histone exchange, thereby providing an opportunity for replacement of H3 with CENP-ACnp1 to establish CENP-ACnp1 chromatin domains and assemble functional kinetochores.

11 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

DISCUSSION

The mechanisms that contribute to the maintenance and, especially, the establishment, of CENP-A chromatin remain poorly understood. To gain insight into how CENP-A chromatin is established on naïve centromere DNA, we applied proteomics to identify proteins associated with fission yeast CENP-ACnp1 chromatin. In addition to kinetochore proteins, all Ino80C subunits, including the small auxiliary subunit, Hap2, were found to be significantly enriched in solubilized CENP-ACnp1 chromatin. Hap2 was found to promote CENP-ACnp1 chromatin integrity at centromeres and to be required for the de novo establishment of CENP-ACnp1 chromatin on introduced naïve centromere DNA. The requirement for Hap2 in ensuring high histone H3 turnover on endogenous centromere DNA, ectopically-located centromere DNA, and non-centromeric CENP-ACnp1 islands indicates that Hap2-Ino80C drives H3 nucleosome turnover at these locations. The loss of CENP-ACnp1 incorporation from NCIS islands in the absence of Hap2 underscores the role for Hap2-Ino80C-mediated H3 turnover in stimulating CENP-ACnp1 incorporation. Strikingly, Hap2 is required for efficient transcription specifically from central domain promoters. We propose a mechanism in which Hap2-Ino80C drives the inherent instability of H3 nucleosomes on centromeric DNA via transcription-coupled nucleosome turnover, providing the opportunity for incorporation of CENP-ACnp1 in place of histone H3, when CENP-ACnp1 is available (Figure 7).

Studies in a variety of species have shown that Ino80C influences transcription (Cai et al., 2007; Hogan et al., 2010; Klopf et al., 2009; Neuman et al., 2014; Steger et al., 2003). The non-canonical human Yin Yang 1 (YY1) transcription factor is known to associate with Ino80 and facilitate both transcriptional activation and repression (Cai et al., 2007; Lee et al., 1995; Yao et al., 2001). It is also known that Ino80 suppresses anti-sense and other non-coding transcription (Alcid and Tsukiyama, 2014; Marquardt et al., 2014). The non-coding transcription of centromeric DNA by RNAPII has been implicated in CENP-A deposition in several systems (Bobkov et al., 2018; Chan et al., 2012; Chueh et al., 2009; Grenfell et al., 2016; McNulty et al., 2017; Rošić et al., 2014). However, both reduced and increased transcription of centromere DNA appears to be incompatible with CENP-A chromatin integrity and centromere function (Bergmann et al., 2012; Hill and Bloom, 1987; Nakano et al., 2008; Ohkuni and Kitagawa, 2011). Such observations suggest that an appropriate level and type of programmed transcription may be required to promote CENP-A assembly on centromere DNA.

Each fission yeast centromere contains a central domain of approximately 10 kb assembled in CENP-ACnp1 rather than H3 nucleosomes. Multiple transcriptional start sites are detected on both strands when central domain is assembled in H3, rather than CENP-ACnp1, chromatin at

12 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

an ectopic locus (Choi et al. 2011; Catania et al. 2015), indicating that these regions are pervasively transcribed. Distinct Ino80C modules undertake particular tasks such as nucleosome binding, sliding and ATPase activity (Zhou et al., 2016). The specific impact of Hap2 on Ino80C remains to be determined. However, a major activity of Ino80C is to slide nucleosomes relative to sizable lengths of flanking unoccupied DNA (Udugama et al., 2011). Thus, the generation of nucleosome free regions that facilitate RNAPII recruitment, and consequently transcription, are an intrinsic facet of Ino80C function. Consequently, the loss of Hap2-Ino80C is expected to occlude central domain promoters with nucleosomes and result in reduced transcriptional initiation.

Since RNAPII recruitment to central domain chromatin during G2 phase of the cell cycle is coincident with H3 eviction and CENP-ACnp1 incorporation (Shukla et al., 2018), it is likely that these events are somehow coupled. The conserved heptad repeat composing the C-terminal domain (CTD) of RNAPII undergoes S5 phosphorylation (S5P) at promoters upon transcription initiation and S2 phosphorylation (S2P) in coding regions during transcriptional elongation (Komarnitsky et al., 2000). RNAPII stalls when it encounters obstacles such as DNA damage or natural barriers (Poli et al., 2017). Despite relatively high levels of RNAPII being detected on H3-assembled ectopic central domain, meagre levels of transcripts are produced, consistent with transcriptional stalling (Catania et al., 2015; Choi et al., 2011). Analyses in S. cerevisiae show that Ino80 is required to release stalled RNAPII from chromatin and enable its proteasomal degradation (Lafon et al., 2015). Previously, we showed that mutants (ubp3∆, tfs1∆) expected to increase the levels of stalled RNAPIIS2P on central domain chromatin, promote CENP-A incorporation (Catania et al., 2015). Interestingly, cells lacking Hap2 display lower initiating RNAPIIS5P over ectopic H3-assembled central domain chromatin in G2 but the levels of total RNAPII and elongating RNAPII-S2P are unaltered (Fig. 6B, S6A and B). This indicates that, although lower levels of initiation and transcription take place within ectopic central domain chromatin in the absence of Hap2, elongating RNAPII is retained across the domain. We interpret these observations to indicate that Hap2-Ino80C is required to release elongating RNAPII that becomes trapped or stalled in central domain chromatin. We suggest that resident H3 nucleosomes are evicted by Hap2-Ino80C as part of the process involved in removing this stalled RNAPII. Thus, centromere DNA may be programmed to be pervasively transcribed and stall RNAPII over a relatively large 10 kb region in order to recruit Hap2-Ino80C and trigger H3 turnover throughout this extensive domain, thereby providing the opportunity for CENP-A incorporation. Stalling may result from collisions between converging RNAPII complexes or other obstacles such as the replication Origin Recognition Complex (ORC) which is bound to the many AT-rich tracts present within central domain regions (Hayashi et al., 2007). Alternatively, elongating RNAPII on central domain

13 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

DNA may be somehow earmarked for removal using cues analogous to those that allow Ino80 to suppresses anti-sense and cryptic unstable transcripts (Alcid and Tsukiyama, 2014). Thus, pervasive transcription across an extensive region such as the central domain may itself provoke Ino80C recruitment.

Histone turnover rates are generally higher for nucleosomes close to promoters (Dion et al., 2007; Jin and Felsenfeld, 2007; Zhang et al., 2005). The first +1 nucleosomes downstream of many eukaryotic promoters contain the H2A.Z variant (rather than canonical H2A) to aid transcription. These +1 nucleosomes exhibit high levels of turnover and Ino80C has been reported to mediate the exchange of H2A.Z for canonical H2A in such nucleosomes (Papamichos-Chronakis et al., 2011; Watanabe et al., 2013; Yen et al., 2013). However, H2A.Z turnover on transcribed genes has been shown to be not reliant on Ino80 activity (Tramantano et al., 2016). Moreover, Ino80 is also known to reduce transcription from some promoters, independently of its role in removing H2A.Z (Barbaric et al., 2007). The fact that no difference in the levels of H2A.ZPht1 was detected across the ectopic central domain in hap2∆ cells relative to wild-type (Figure S5B) suggests that Hap2-Ino80C does not mediate H2A.ZPht1 eviction from central domain chromatin and that it must affect some other aspect of centromere promoter function, perhaps through its known nucleosome sliding activity. Thus, Ino80C may be required to slide nucleosomes away from central domain promoters so that they are efficiently transcribed and the resulting transcriptional properties of this domain mediate H3 nucleosome turnover.

Previously we showed that CENP-ACnp1 competes with histone H3 for incorporation into centromeric chromatin and CENP-ACnp1 incorporation is promiscuous, replacing H3 when the opportunity arises (Castillo et al., 2007; Choi et al., 2011, 2012). Thus, high histone H3 nucleosome turnover, or low nucleosome occupancy, appears to be an underlying property of many sequences that are prone to CENP-ACnp1 assembly in fission yeast. As transcription appears to be widespread at centromeres in other organisms, high turnover of resident H3 nucleosomes, stimulated by Ino80C, may be a conserved attribute of centromeric DNA that stimulates CENP-A deposition.

14 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

MATERIALS AND METHODS

Cell growth and manipulation Standard genetic and molecular techniques were followed. Fission yeast methods were as described (Moreno et al., 1991). Fission yeast strains are listed in Table S3. YES (Yeast Extract with Supplements) was used as a rich medium or PMG (Pombe Minimal Glutamate) for growth of cells in liquid cultures. 4X-YES was used for experiments where higher cell numbers were required. H3.2 RITE strains containing HA/T7 RITE cassettes were as described (Shukla et al., 2018; Verzijlbergen et al., 2010). Plasmids used in this study are listed in Table S4.

Native immunoaffinity purification Cell were grown in 4X-YES and 2-4×1010 cells were used for immunoprecipitation. Cells were harvested by centrifugation at 3500×g, washed twice with water and flash frozen in liquid nitrogen. Frozen cell pellets were ground using Retsch MM400 mill. The grindate was resuspended in lyisis buffer (10 mM Tris pH7.4, 5 mM CaCl2, 5 mM MgCl2, 50 mM NaCl, 0.1% IGEPAL-CA630 and supplemented with protease inhibitor (P8215, Sigma) and 2 mM PMSF and thawed for 30 minutes on ice. Chromatin was solubilized by incubation with 4-20 units of Micrococcal nuclease (N3755, Sigma) for 10 minutes at 37° C. MNase digestion was stopped by adding EGTA to 20 mM and lysates were rotated at 4° C for 1 hour to ensure chromatin solubilization. Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP) or 20 µg of anti-HA antibody (ab9110, Abcam) (used for Ino80-3HA IP) coupled to 50 µl of Protein G Dynabeads (Life Technologies) using dimethyl pimelimidate (DMP; 21666, ThermoFisher Scientific). Bead-bound affinity-selected proteins were washed three times with lysis buffer. Elution was performed with 0.1% RapiGest SF (186001860, Waters) in 50mM Tris-HCl pH8 by incubating at 50o C for 10 minutes.

Co-immunoprecipitation The co-immunoprecipitation protocol is similar to native immunoaffinity purification described above with following modifications. Cell were grown in 4X-YES and 5×109 cells were used per IP. Chromatin was solubilized by incubation with 100 units of Micrococcal nuclease (Sigma, N3755) for 20 minutes at 37° C. Immunoprecipitation was performed using 10 µg of anti-GFP antibody (Roche, 11814460001) (used for Hap2-GFP IP) or 10 µg of anti-HA antibody (Abcam, ab9110) (used for Ino80-3HA IP) coupled to 25 µl of Protein G Dynabeads (Life Technologies)

15 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

using DMP. Bead-bound affinity-selected proteins were washed five times with lysis buffer for 5 minute and eluted with LDS loading buffer (ThermoFisher Scientific, 84788) by incubating at 75o C for 10 minutes. Western blotting detection was performed using anti-GFP (ThermoFisher Scientific, A11122) or anti-HA antibody (Abcam, ab9110) and HRP conjugated anti-Rabbit IgG HRP (Sigma, A6154)).

Mass spectrometry and analysis Proteins were digested with trypsin into peptides and analyzed by mass spectrometry. Proteins were denatured by adding final 25mM DTT to the immunoprecipitated proteins and incubated at 95o C for 5 minutes. Samples were cooled at room temperature and 200 µl of 8M Urea in 100mM Tris-HCl pH8 was added and passed through Vivacon 500 column (VN01H21, Sartorius Vivacon 500, 30,000 MWCO Hydrosart) by centrifugation at 14,000xg for 30 minutes. Cysteine residues were alkylated to prevent free sulfhydryls from reforming disulfide bonds by incubation with 100 µl of 0.05 M Iodoacetamide (Sigma) in 8 M urea for 20 minutes at 27o C in the dark and centrifuged at 14,000xg to remove the supernatant. Columns were then washed once with 100 µl of 8M urea and twice with 100 µl of 0.05 M ammonium bicarbonate (Sigma). Proteins were digested by addition of 100 µl of 0.05 M ABC containing 0.3 µg of trypsin (90057, Thermo Scientific) at 37o C for 16 hours. Columns were spun at 14,000xg to collect the digested peptides and washed again with 100 µl of 0.05 M ABC. Trypsinization was stopped by addition of 10 µl of 10% trifluoroacetic acid (TFA) to bring the pH to below 2. C18 reverse-phase resin (66883-U, Sigma) was used to desalt peptide samples prior to LC- MS/MS. StageTips were packed tightly with 2 layers of C18 resin. The resin was conditioned with 30 µl of 100% methanol, washed with 30 µl of 80% acetonitrile to remove impurities and finally equilibrated by passing 30 µl of 0.1% TFA. The trypsinized peptide solution was passed through the stage tip by centrifugation at 2600 rpm for binding. Following stage tip desalting, samples were diluted with equal volume of 0.1% TFA and spun onto StageTips as described (Rappsilber et al., 2003). Peptides were eluted in 40 μL of 80% acetonitrile in 0.1% TFA and concentrated down to 2 μL by vacuum centrifugation (Concentrator 5301, Eppendorf, UK). The peptide sample was then prepared for LC-MS/MS analysis by diluting it to 5 μL by 0.1% TFA. LC-MS-analyses were performed on an Orbitrap Fusion™ Lumos™ Tribrid™ Mass Spectrometer and on a Q Exactive (both from Thermo Fisher Scientific, UK) both coupled on-line, to an Ultimate 3000 RSLCnano Systems (Dionex, Thermo Fisher Scientific, UK). In both cases, peptides were separated on a 50 cm EASY-Spray column (Thermo Scientific, UK), which was assembled on an EASY-Spray source (Thermo Scientific, UK) and operated at 50o C. Mobile phase A consisted of 0.1% formic acid in LC-MS grade water and mobile

16 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

phase B consisted of 80% acetonitrile and 0.1% formic acid. Peptides were loaded onto the column at a flow rate of 0.3 μL min-1 and eluted at a flow rate of 0.2 μL min-1 according to the following gradient: 2 to 40% mobile phase B in 150 min and then to 95% in 11 min. Mobile phase B was retained at 95% for 5 min and returned back to 2% a minute after until the end of the run (190 min). For Fusion Lumos, FTMS spectra were recorded at 120,000 resolution (scan range 350-1500 m/z) with an ion target of 7.0×105. MS2 was performed in the ion trap with ion target of 1.0×104 and HCD fragmentation (Olsen et al., 2007) with normalized collision energy of 27. The isolation window in the quadrupole was 1.4 Thomson. Only ions with charge between 2 and 7 were selected for MS2. For Q Exactive, FTMS spectra were recorded at 70,000 resolution (scan range 350-1400 m/z) and the ten most intense peaks with charge ≥ 2 of the MS scan were selected with an isolation window of 2.0 Thomson for MS2 (filling 1.0×106 ions for MS scan, 5.0×104 ions for MS2, maximum fill time 60 ms, dynamic exclusion for 50 s). The MaxQuant software platform (Cox and Mann, 2008) version 1.5.2.8 was used to process the raw files and search was conducted against Schizosaccaromyces pombe complete/reference proteome set of PomBase database (released in July, 2015), using the Andromeda search engine (Cox et al., 2011). For the first search, peptide tolerance was set to 20 ppm while for the main search peptide tolerance was set to 4.5 pm. Isotope mass tolerance was 2 ppm and maximum charge to 7. Digestion mode was set to specific with trypsin allowing maximum of two missed cleavages. Carbamidomethylation of cysteine was set as fixed modification. Oxidation of methionine, phosphorylation of serine, threonine and tyrosine and ubiquitination of lysine were set as variable modifications. Label-free quantitation analysis was performed by employing the MaxLFQ algorithm as described by Cox et al. 2014. Absolute protein quantification was performed as described in Schwanhüusser et al. 2011. Peptide and protein identifications were filtered to 1% FDR. The Perseus software platform (Tyanova et al., 2016) version 1.5.5.1 was used to process LFQ intensities of the proteins generated by MaxQuant. The LFQ intensities were transformed to log2 scale and list was filtered for proteins with at least 2-3 valid values in any sample. Missing values were imputed from normal distribution for that IP.

Cytology Cells were fixed with 3.7% formaldehyde (Sigma) for 7 minutes at room temperature. Immunolocalization staining was performed as described (Shukla et al., 2018). The following antibodies were used at 1:100 dilution: Anti-CENP-ACnp1 (sheep in-house), anti-GFP (ThermoFisher Scientific, A11122), anti-TAT1 (mouse in-house); Alexa 594 and 488 labelled secondary antibodies at 1:1000 dilution (Life Technologies). Images were acquired with Zeiss LSM 880 confocal microscope equipped with Airyscan superresolution imaging module, using

17 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a 100X/1.40 NA Plan-Apochromat Oil DIC M27 objective lens and processed using ZEN Black image acquisition and processing software (Zeiss MicroImaging).

Establishment assay Minichromosomes used in this study were transformed using sorbitol electroporation method (Suga and Hatakeyama, 2001). Transformants were plated on PMG-uracil-adenine plates and incubated at 32oC for 5-10 days until medium-sized colonies had grown. Colonies were replica-plated to PMG low adenine (10 µg/ml) plates to determine the frequency of establishment of centromere function. These indicator plates allow minichromosome loss (red colony) or retention (white/pale pink colony) to be determined. Minichromosome retention indicates that centromere function has been established and that minichromosomes segregate efficiently in mitosis. In the absence of centromere establishment, minichromosomes behave as episomes that are rapidly lost. Minichromosomes occasionally integrate giving a false positive white phenotype. To assess the frequency of such integration events and to confirm establishment of centromere segregation function, colonies giving the white/pale-pink phenotype upon replica plating were re-streaked to single colonies on low-adenine plates. Sectored colonies are indicative of segregation function with low levels of minichromosome loss, whereas pure white colonies are indicative of integration into endogenous chromosomes and the establishment frequency was adjusted accordingly.

LacZ assay LacZ assay was performed as described (Guarente, 1983). Plasmids containing LacZ with upstream nmt81 promoter, 200 bp sequences from centromere 2 or no promoter were used as described (Catania et al., 2015). Plasmids were transformed into wild-type and hap2∆ strains and grown on minimal medium.

ChIP-qPCR Cells were grown at appropriate temperature and medium. Cultures were fixed with 3.7% formaldehyde for 15 min at room temperature. ChIP was performed as previously described (Castillo et al., 2007). Cells were lysed by bead-beating (Biospec Products) and sonicated in a Bioruptor (Diagenode) (20 min, 30 s On and 30 s Off at ‘High’ (200 W). 10 µl anti-CENP-ACnp1 (sheep in-house antiserum) and 25 µl Protein-G-Agarose beads (Roche) or 2 µl of anti-GFP (A11122, ThermoFisher Scientific), 2 µl of anti-H3 (ab1791, Abcam), 2 µl of anti-T7 (69522, Millipore), 2 µl of anti-myc (2276, Cell Signaling Technology), 1 µl of anti-H3K9me (m5.1.1), 2 µl of anti-RNAPII (ab817, Abcam), 2 µl of RNAPII S2P (Abcam, ab5095) and 2 µl of RNAPII S5P (61085, Actif motif) and 20 µl Protein-G-Dyna beads (Life Technologies) were used per ChIP. qPCR was performed using Light Cycler 480 SybrGreen Master Mix (Roche,

18 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

04887352001) and analysed using Light Cycler 480 Software 1.5 (Roche). Primers used in qPCR are listed in Supplementary Table S5.

qRT-PCR RNA was isolated with RNeasy mini kit (Qiagen) according to the manufacturer’s protocol. A total of 10 µg RNA isolated by RNeasy Mini kit (Qiagen) was treated with 1 µl of Turbo DNase (AM2238, Invitrogen) for 30 minutes at 37°C. A second digestion was followed by adding additional 1 µl of Turbo DNase for 30 minutes at 37°C. RNA was then cleaned up according to RNeasy Mini Protocol for RNA Cleanup (Qiagen) and dissolved in nuclease free water. For qRT-PCR analysis, first strand cDNA synthesis was performed using 100 ng of random hexamer (Invitrogen), 1 µg of DNA-free RNA template and 1 µl of Superscript III (Invitrogen) reverse transcriptase according to the manufacturer’s instruction. As a negative control (-RT), the same reaction was performed without SuperScript III.

ChIP-Nexus ChIP-Nexus was prepared essentially as described (Shukla et al., 2018). Cells were grown in 4X-YES at 32oC. Briefly, cell pellets corresponding to 7.5X108 cells were lysed by four 1 minute cycles of bead beating in 500 µl of lysis buffer (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate). Insoluble chromatin fraction was isolated by centrifugation at 6000×g. The pellet was washed with 1 ml lysis buffer and gently resuspended in 300 µl lysis buffer containing 0.2% SDS and sheared by sonication with Bioruptor (Diagenode) for 30 minutes (30s On, 30s off at high setting). 900 µl of lysis buffer (without SDS) was added and samples were clarified by centrifugation at 17000×g for 20 minutes. Supernatants were used for ChIP. Supernatants were incubated with 6 µl anti-HA (12CA5, in-house preparation) or 6 µl anti-T7 (69522, Millipore) and protein G-dynabeads (ThermoFisher Scientific) for ChIP. ChIP-Nexus libraries were prepared essentially as described (He et al., 2015). DNA was end repaired using T4 DNA polymerase (NEB, M0203S), DNA polymerase I large fragment (NEB, M0210S) and T4 polynucleotide kinase (NEB, M0201S). A single 3'-A overhang was added using Klenow exo- polymerase. Adapters were ligated and blunted again by Klenow exo- polymerase to fill in the 5’ overhang first and then by T4 DNA polymerase to trim possible 3’ overhangs. Blunted DNA was then sequentially digested by lambda exonuclease (NEB, M0262S) and RecJf (NEB, M0264L). Digested single strand DNA was then eluted, reverse cross-linked and phenol-chloroform extracted. Fragments were then self-circularized by Circligase (Epicentre, CL4111K). An oligonucleotide was hybridized to circularized single DNA for subsequent BamHI digestion in order to linearize the DNA. This linearized single strand DNA was then PCR-amplified using adapter sequences and libraries were purified and size

19 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

selected using Ampure XP beads. The libraries were sequenced following Illumina HiSeq2500 work flow. More than 20 million 50bp long single end reads were generated for each sample in this experiment. All reads first 15bp were trimmed, then aligned on S.pombe v2.20 genome build with bowtie2 (Langmead and Salzberg, 2012). Alignment analysis were used by samtools (Li et al., 2009) and bedtools (Quinlan and Hall, 2010). Genome wide enrichment visualization was use deeptools (Ramírez et al., 2014) and IGV browser. ChIP peak were called by MACE 1.2 (Wang et al., 2014).

DATA AND SOFTWARE AVAILABILITY The accession number for the sequencing data reported in this paper is GEO: GSE136305. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (Vizcaino et al., 2013) partner repository with the dataset identifier PXD015222.

ACKNOWLEDGEMENTS

We thank members of the Allshire lab for advice and useful suggestions. We thank Dominik Hoelper for critical reading of the manuscript. This research was supported by award of a Darwin Trust of Edinburgh Studentship to P.P.S, a Wellcome Senior Research Fellowship 103139) and Wellcome Instrument grant to J.R. (108504), a Wellcome Principal Research Fellow to R.C.A. (095021; 200885), and core funding for the Wellcome Centre for Cell Biology (203149).

AUTHOR CONTRIBUTIONS

P.P.S. and R.C.A. jointly conceived the study. P.P.S., M.S., and S.A.W. performed experiments. P.P.S. and P.T. analysed data. T.A. provided guidance in sample preparation for mass spectrometry. C.S. and J.R. performed mass spectrometry and MaxQuant analysis. P.P.S., A.L.P., and R.C.A. wrote the manuscript with input from other authors.

20 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

REFERENCES Alcid, E.A., and Tsukiyama, T. (2014). ATP-dependent chromatin remodeling shapes the long noncoding RNA landscape. Genes Dev. 28, 2348-60.

Allshire, R.C., and Karpen, G.H. (2008). Epigenetic regulation of centromeric chromatin: Old dogs, new tricks? Nat. Rev. Genet. 9, 923-37.

Allshire, R.C., Javerzat, J.P., Redhead, N.J., and Cranston, G. (1994). Position effect variegation at fission yeast centromeres. Cell 76, 157-69.

Allshire, R.C., Nimmo, E.R., Ekwall, K., Javerzat, J.P., and Cranston, G. (1995). Mutations derepressing silent centromeric domains in fission yeast disrupt chromosome segregation. Genes Dev. 9, 218-33.

Bao, Y., and Shen, X. (2007). INO80 subfamily of chromatin remodeling complexes. Mutat. Res. 618, 18-29

Barbaric, S., Luckenbach, T., Schmid, A., Blaschke, D., Hörz, W., and Korber, P. (2007). Redundancy of Chromatin Remodeling Pathways for the Induction of the Yeast PHO5 Promoter in Vivo. J. Biol. Chem. 282, 27610–27621.

Barnhart, M.C., Kuich, P.H.J.L., Stellfox, M.E., Ward, J.A., Bassett, E.A., Black, B.E., and Foltz, D.R. (2011). HJURP is a CENP-A chromatin assembly factor sufficient to form a functional de novo kinetochore. J. Cell Biol. 194, 229-43.

Baum, M., Ngan, V.K., and Clarke, L. (1994). The centromeric K-type repeat and the central core are together sufficient to establish a functional Schizosaccharomyces pombe centromere. Mol. Biol. Cell 5, 747-61.

Becker, P.B., and Hörz, W. (2002). ATP-Dependent Nucleosome Remodeling. Annu. Rev. Biochem. 71, 247-73.

Bergmann, J.H., Rodríguez, M.G., Martins, N.M.C., Kimura, H., Kelly, D.A., Masumoto, H., Larionov, V., Jansen, L.E.T., and Earnshaw, W.C. (2011). Epigenetic engineering shows H3K4me2 is required for HJURP targeting and CENP-A assembly on a synthetic human kinetochore. EMBO J. 30, 328-40.

Bergmann, J.H., Jakubsche, J.N., Martins, N.M., Kagansky, A., Nakano, M., Kimura, H., Kelly, D.A., Turner, B.M., Masumoto, H., Larionov, V., et al. (2012). Epigenetic engineering: histone H3K9 acetylation is compatible with kinetochore structure and function. J. Cell Sci. 125, 411-21.

Black, B.E., and Cleveland, D.W. (2011). Epigenetic centromere propagation and the nature of CENP-A nucleosomes. Cell 144, 471-9.

Bobkov, G.O.M., Gilbert, N., and Heun, P. (2018). Centromere transcription allows CENP-A to transit from chromatin association to stable incorporation. J. Cell Biol. 217, 1957-1972.

Brahma, S., Udugama, M.I., Kim, J., Hada, A., Bhardwaj, S.K., Hailu, S.G., Lee, T.H., and Bartholomew, B. (2017). INO80 exchanges H2A.Z for H2A by translocating on DNA proximal to histone dimers. Nat. Commun. 8, 15616.

Cai, Y., Jin, J., Yao, T., Gottschalk, A.J., Swanson, S.K., Wu, S., Shi, Y., Washburn, M.P., Florens, L., Conaway, R.C., et al. (2007). YY1 functions with INO80 to activate transcription. Nat. Struct. Mol. Biol. 14, 872-874.

21 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Cardinale, S., Bergmann, J.H., Kelly, D., Nakano, M., Valdivia, M.M., Kimura, H., Masumoto, H., Larionov, V., and Earnshaw, W.C. (2009). Hierarchical Inactivation of a Synthetic Human Kinetochore by a Chromatin Modifier. Mol. Biol. Cell. 20, 4194-204.

Castillo, A.G., Mellonea, B.G., Partridgeb, J.F., Richardsonc, W., Hamilton, G.L., Allshire, R.C., and Pidoux, A.L. (2007). Plasticity of fission yeast CENP-A chromatin driven by relative levels of histone H3 and H4. PLoS Genet. 3, e121.

Castillo, A.G., Pidoux, A.L., Catania, S., Durand-Dubief, M., Choi, E.S., Hamilton, G., Ekwall, K., and Allshire, R.C. (2013). Telomeric Repeats Facilitate CENP-ACnp1 Incorporation via Telomere Binding Proteins. PLoS One 8, e69673.

Catania, S., Pidoux, A.L., and Allshire, R.C. (2015). Sequence Features and Transcriptional Stalling within Centromere DNA Promote Establishment of CENP-A Chromatin. PLoS Genet. 11, e1004986.

Chan, F.L., Marshall, O.J., Saffery, R., Won Kim, B., Earle, E., Choo, K.H.A., and Wong, L.H. (2012). Active transcription and essential role of RNA polymerase II at the centromere during mitosis. Proc. Natl. Acad. Sci. 109, 1979-84.

Chang, C.-H., Chavan, A., Palladino, J., Wei, X., Martins, N.M.C., Santinello, B., Chen, C.-C., Erceg, J., Beliveau, B.J., Wu, C.-T., et al. (2019). Islands of retroelements are major components of Drosophila centromeres. PLoS Biol. 17, e3000241.

Chen, C.C., Dechassa, M.L., Bettini, E., Ledoux, M.B., Belisario, C., Heun, P., Luger, K., and Mellone, B.G. (2014). CAL1 is the Drosophila CENP-A assembly factor. J. Cell Biol. 204, 313-29.

Chen, C.C., Bowers, S., Lipinszki, Z., Palladino, J., Trusiak, S., Bettini, E., Rosin, L., Przewloka, M.R., Glover, D.M., O’Neill, R.J., et al. (2015). Establishment of Centromeric Chromatin by the CENP-A Assembly Factor CAL1 Requires FACT-Mediated Transcription. Dev. Cell. 34, 73-84.

Chen, L., Cai, Y., Jin, G., Florens, L., Swanson, S.K., Washburn, M.P., Conaway, J.W., and Conaway, R.C. (2011). Subunit organization of the human INO80 chromatin remodeling complex: An evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling. J. Biol. Chem. 286, 11283-9.

Cheng, Z., Dong, F., Langdon, T., Ouyang, S., Buell, C.R., Gu, M., Blattner, F.R., and Jiang, J. (2002). Functional Rice Centromeres Are Marked by a Satellite Repeat and a Centromere-Specific Retrotransposon. Plant Cell 14, 1691-704.

Choi, E.S., Strålfors, A., Castillo, A.G., Durand-Dubief, M., Ekwall, K., and Allshire, R.C. (2011). Identification of noncoding transcripts from within CENP-A chromatin at fission yeast centromeres. J. Biol. Chem. 286, 23600-7.

Choi, E.S., Strålfors, A., Catania, S., Castillo, A.G., Svensson, J.P., Pidoux, A.L., Ekwall, K., and Allshire, R.C. (2012). Factors That Promote H3 Chromatin Integrity during Transcription Prevent Promiscuous Deposition of CENP-ACnp1 in Fission Yeast. PLoS Genet. 8, e1002985.

Choi, E.S., Cheon, Y., Kang, K., and Lee, D. (2017). The Ino80 complex mediates epigenetic centromere propagation via active removal of histone H3. Nat. Commun. 8, 1–9.

Chueh, A.C., Northrop, E.L., Brettingham-Moore, K.H., Choo, K.H.A., and Wong, L.H. (2009). LINE retrotransposon RNA is an essential structural and functional epigenetic component of

22 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a core neocentromeric chromatin. PLoS Genet. 5, e1000354.

Clapier, C.R., and Cairns, B.R. (2009). The Biology of Chromatin Remodeling Complexes. Annu. Rev. Biochem. 78, 273-304.

Cleveland, D.W., Mao, Y., and Sullivan, K.F. (2003). Centromeres and kinetochores: From epigenetics to mitotic checkpoint signaling. Cell 112, 407-21.

Conaway, R.C., and Conaway, J.W. (2009). The INO80 chromatin remodeling complex in transcription, replication and repair. Trends Biochem. Sci. 34, 71–77.

Cox, J., and Mann, M. (2008). MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367-72.

Cox, J., Neuhauser, N., Michalski, A., Scheltema, R.A., Olsen, J. V., and Mann, M. (2011). Andromeda: A peptide search engine integrated into the MaxQuant environment. J. Proteome Res. 10, 1794-805.

Cox, J., Hein, M.Y., Luber, C.A., Paron, I., Nagaraj, N., and Mann, M. (2014). Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol. Cell. Proteomics 13, 2513-26.

Dion, M.F., Kaplan, T., Kim, M., Buratowski, S., Friedman, N., and Rando, O.J. (2007). Dynamics of replication-independent histone turnover in budding yeast. Science 315, 1405-8.

Duda, Z., Trusiak, S., and O’Neill, R. (2017). Centromere Transcription: Means and Motive BT - Centromeres and Kinetochores: Discovering the Molecular Mechanisms Underlying Chromosome Inheritance. Prog Mol Subcell Biol. 56, 257-281.

Erhardt, S., Mellone, B.G., Betts, C.M., Zhang, W., Karpen, G.H., and Straight, A.F. (2008). Genome-wide analysis reveals a cell cycle-dependent mechanism controlling centromere propagation. J. Cell Biol. 183, 805-18.

Fachinetti, D., Han, J.S., McMahon, M.A., Ly, P., Abdullah, A., Wong, A.J., and Cleveland, D.W. (2015). DNA Sequence-Specific Binding of CENP-B Enhances the Fidelity of Human Centromere Function. Dev. Cell 33, 314-27.

Folco, H.D., Pidoux, A.L., Urano, T., and Allshire, R.C. (2008). Heterochromatin and RNAi are required to establish CENP-A chromatin at centromeres. Science 319, 94-7.

Fukagawa, T., and Earnshaw, W.C. (2014). The centromere: Chromatin foundation for the kinetochore machinery. Dev. Cell 30, 496–508.

Gai, K., Cao, X., Dong, Q., Ding, Z., Wei, Y., Liu, Y., Liu, X., and He, Q. (2017). Transcriptional repression of frequency by the IEC-1-INO80 complex is required for normal Neurospora circadian clock function. PLoS Genet. 13, e1006732.

Gonzalez, M., He, H., Dong, Q., Sun, S., and Li, F. (2014). Ectopic centromere nucleation by CENP-A in fission yeast. Genetics 198, 1433-46.

Grady, D.L., Ratliff, R.L., Robinson, D.L., McCanlies, E.C., Meyne, J., and Moyzis, R.K. (1992). Highly conserved repetitive DNA sequences are present at human centromeres. Proc. Natl. Acad. Sci. 89, 1695–1699.

23 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Grenfell, A.W., Heald, R., and Strzelecka, M. (2016). Mitotic noncoding RNA processing promotes kinetochore and spindle assembly in Xenopus. J. Cell Biol. 214, 133-41.

Guarente, L. (1983). Yeast Promoters and lacZ Fusions Designed to Study Expression of Cloned Genes in Yeast. Methods Enzymol. 101, 181-91.

Hayashi, M., Katou, Y., Itoh, T., Tazumi, M., Yamada, Y., Takahashi, T., Nakagawa, T., Shirahige, K., and Masukata, H. (2007). Genome-wide localization of pre-RC sites and identification of replication origins in fission yeast. EMBO J. 26, 1327-39.

He, Q., Johnston, J., and Zeitlinger, J. (2015). ChIP-nexus enables improved detection of in vivo transcription factor binding footprints. Nat. Biotechnol. 33, 395-401.

Hill, A., and Bloom, K. (1987). Genetic manipulation of centromere function. Mol. Cell. Biol. 7, 2397–2405.

Hogan, C.J., Aligianni, S., Durand-Dubief, M., Persson, J., Will, W.R., Webster, J., Wheeler, L., Mathews, C.K., Elderkin, S., Oxley, D., et al. (2010). Fission Yeast Iec1-Ino80-Mediated Nucleosome Eviction Regulates Nucleotide and Phosphate Metabolism. Mol. Cell. Biol. 30, 657–674.

Hori, T., Shang, W.H., Takeuchi, K., and Fukagawa, T. (2013). The CCAN recruits CENP-A to the centromere and forms the structural core for kinetochore assembly. J. Cell Biol. 200, 45-60.

Ishii, K., Ogiyama, Y., Chikashige, Y., Soejima, S., Masuda, F., Kakuma, T., Hiraoka, Y., and Takahashi, K. (2008). Heterochromatin integrity affects chromosome reorganization after centromere dysfunction. Science 321, 1088-91.

Jansen, L.E.T., Black, B.E., Foltz, D.R., and Cleveland, D.W. (2007). Propagation of centromeric chromatin requires exit from mitosis. J. Cell Biol. 176, 795-805.

Jin, C., and Felsenfeld, G. (2007). Nucleosome stability mediated by histone variants H3.3 and H2A.Z. Genes Dev. 21, 1519-29.

Jin, Q.-W., Pidoux, A.L., Decker, C., Allshire, R.C., and Fleig, U. (2002). The Mal2p Protein Is an Essential Component of the Fission Yeast Centromere. Mol. Cell. Biol. 22, 7168-83.

Kagansky, A., Diego Folco, H., Almeida, R., Pidoux, A.L., Boukaba, A., Simmer, F., Urano, T., Hamilton, G.L., and Allshire, R.C. (2009). Synthetic heterochromatin bypasses RNAi and centromeric repeats to establish functional centromeres. Science 324, 1716-9.

Ketel, C., Wang, H.S.W., McClellan, M., Bouchonville, K., Selmecki, A., Lahav, T., Gerami-Nejad, M., and Berman, J. (2009). Neocentromeres form efficiently at multiple possible loci in candida albicans. PLoS Genet. 5, e1000400.

Kipling, D., Ackford, H.E., Taylor, B.A., and Cooke, H.J. (1991). Mouse minor satellite DNA genetically maps to the centromere and is physically linked to the proximal telomere. Genomics 11, 235-41.

Klopf, E., Paskova, L., Sole, C., Mas, G., Petryshyn, A., Posas, F., Wintersberger, U., Ammerer, G., and Schuller, C. (2009). Cooperation between the INO80 Complex and Histone Chaperones Determines Adaptation of Stress Gene Transcription in the Yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 29, 4994–5007.

24 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Komarnitsky, P., Cho, E.J., and Buratowski, S. (2000). Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14, 2452-60.

Kops, G.J.P.L., Weaver, B.A.A., and Cleveland, D.W. (2005). On the road to cancer: Aneuploidy and the mitotic checkpoint. Nat. Rev. Cancer 5, 773-85.

Lafon, A., Taranum, S., Pietrocola, F., Dingli, F., Loew, D., Brahma, S., Bartholomew, B., and Papamichos-Chronakis, M. (2015). INO80 Chromatin Remodeler Facilitates Release of RNA Polymerase II from Chromatin for Ubiquitin-Mediated Proteasomal Degradation. Mol. Cell 60, 784–796.

Lando, D., Endesfelder, U., Berger, H., Subramanian, L., Dunne, P.D., McColl, J., Klenerman, D., Carr, A.M., Sauer, M., Allshire, R.C., et al. (2012). Quantitative single-molecule microscopy reveals that CENP-A Cnp1 deposition occurs during G2 in fission yeast. Open Biol. 2, 120078.

Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357-9.

Lee, J.S., Galvin, K.M., See, R.H., Eckner, R., Livingston, D., Moran, E., and Shi, Y. (1995). Relief of YY1 transcriptional repression by adenovirus E1A is mediated by E1A-associated protein p300. Genes Dev. 9, 1188-98.

Lermontova, I., Schubert, V., Fuchs, J., Klatte, S., Macas, J., and Schubert, I. (2006). Loading of Arabidopsis Centromeric Histone CENH3 Occurs Mainly during G2 and Requires the Presence of the Histone Fold Domain. Plant Cell 18, 2443-51.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., and Durbin, R. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-9.

Ling, Y.H., and Yuen, K.W.Y. (2019). Point centromere activity requires an optimal level of centromeric noncoding RNA. Proc. Natl. Acad. Sci. U. S. A. 116, 6270-6279.

Logsdon, G.A., Gambogi, C.W., Liskovykh, M.A., Barrey, E.J., Larionov, V., Miga, K.H., Heun, P., and Black, B.E. (2019). Human Artificial Chromosomes that Bypass Centromeric DNA. Cell 178, 624-639.e19. Marquardt, S., Escalante-Chong, R., Pho, N., Wang, J., Churchman, L.S., Springer, M., and Buratowski, S. (2014). A chromatin-based mechanism for limiting divergent noncoding transcription. Cell 157, 1712-23.

McKinley, K.L., and Cheeseman, I.M. (2016). The molecular basis for centromere identity and function. Nat. Rev. Mol. Cell Biol. 17, 16-29.

McNulty, S.M., Sullivan, L.L., and Sullivan, B.A. (2017). Human Centromeres Produce Chromosome-Specific and Array-Specific Alpha Satellite Transcripts that Are Complexed with CENP-A and CENP-C. Dev. Cell 42, 226-240.e6.

Mellone, B.G., Grive, K.J., Shteyn, V., Bowers, S.R., Oderberg, I., and Karpen, G.H. (2011). Assembly of drosophila centromeric chromatin proteins during mitosis. PLoS Genet. 7, e1002068.

Mendiburo, M.J., Padeken, J., Fülöp, S., Schepers, A., and Heun, P. (2011). Drosophila CENH3 is sufficient for centromere formation. Science 334, 686-90.

25 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Moreno, S., Klar, A., and Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795-823.

Müller, S., and Almouzni, G. (2017). Chromatin dynamics during the cell cycle at centromeres. Nat. Rev. Genet. 18, 192-208.

Nakano, M., Okamoto, Y., Ohzeki, J., and Masumoto, H. (2003). Epigenetic assembly of centromeric chromatin at ectopic -satellite sites on human chromosomes. J. Cell Sci. 116, 4021-34.

Nakano, M., Cardinale, S., Noskov, V.N., Gassmann, R., Vagnarelli, P., Kandels-Lewis, S., Larionov, V., Earnshaw, W.C., and Masumoto, H. (2008). Inactivation of a Human Kinetochore by Specific Targeting of Chromatin Modifiers. Dev. Cell 14, 507-22.

Neuman, S.D., Ihry, R.J., Gruetzmacher, K.M., and Bashirullah, A. (2014). INO80-dependent regression of ecdysone-induced transcriptional responses regulates developmental timing in Drosophila. Dev. Biol. 387, 229-39.

Ohkuni, K., and Kitagawa, K. (2011). Endogenous transcription at the centromere facilitates centromere activity in budding yeast. Curr. Biol. 21, 1695-703.

Ohzeki, J. ichirou, Shono, N., Otake, K., Martins, N.M.C., Kugou, K., Kimura, H., Nagase, T., Larionov, V., Earnshaw, W.C., and Masumoto, H. (2016). KAT7/HBO1/MYST2 Regulates CENP-A Chromatin Assembly by Antagonizing Suv39h1-Mediated Centromere Inactivation. Dev. Cell. 37, 413-27.

Olsen, J. V., Macek, B., Lange, O., Makarov, A., Horning, S., and Mann, M. (2007). Higher-energy C-trap dissociation for peptide modification analysis. Nat. Methods. 4, 709-12.

Papamichos-Chronakis, M., Watanabe, S., Rando, O.J., and Peterson, C.L. (2011). Global regulation of H2A.Z localization by the INO80 chromatin-remodeling enzyme is essential for genome integrity. Cell 144, 200–213.

Partridge, J.F., Borgstrøm, B., and Allshire, R.C. (2000). Distinct protein interaction domains and protein spreading in a complex centromere. Genes Dev. 14, 783-91.

Pearson, C.G., Yeh, E., Gardner, M., Odde, D., Salmon, E.D., and Bloom, K. (2004). Stable kinetochore-microtubule attachment constrains centromere positioning in metaphase. Curr. Biol. 14, 1962-7.

Perpelescu, M., Nozaki, N., Obuse, C., Yang, H., and Yoda, K. (2009). Active establishment of centromeric cenp-a chromatin by rsf complex. J. Cell Biol. 185, 397-407.

Pidoux, A.L., and Allshire, R.C. (2004). Kinetochore and heterochromatin domains of the fission yeast centromere. Chromosom. Res. 12, 521-34.

Pidoux, A.L., Richardson, W., and Allshire, R.C. (2003). Sim4: A novel fission yeast kinetochore protein required for centromeric silencing and chromosome segregation. J. Cell Biol. 161, 295-307.

Poli, J., Gasser, S.M., and Papamichos-Chronakis, M. (2017). The INO80 remodeller in transcription, replication and repair. Philos. Trans. R. Soc. B Biol. Sci. 372.

Quinlan, A.R., and Hall, I.M. (2010). BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-2.

26 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Ramírez, F., Dündar, F., Diehl, S., Grüning, B.A., and Manke, T. (2014). DeepTools: A flexible platform for exploring deep-sequencing data. Nucleic Acids Res. 42, W187-91.

Rošić, S., Köhler, F., and Erhardt, S. (2014). Repetitive centromeric satellite RNA is essential for kinetochore formation and cell division. J. Cell Biol. 207, 335-49.

Sadeghi, L., Lee, S., Svensson, J.P., and Ekwall, K. (2014). Centromeric histone H2B monoubiquitination promotes noncoding transcription and chromatin integrity. Nat. Struct. Mol. Biol. 21, 236-43.

Schuh, M., Lehner, C.F., and Heidmann, S. (2007). Incorporation of Drosophila CID/CENP-A and CENP-C into Centromeres during Early Embryonic Anaphase. Curr. Biol. 17, 237-43.

Schwanhüusser, B., Busse, D., Li, N., Dittmar, G., Schuchhardt, J., Wolf, J., Chen, W., and Selbach, M. (2011). Global quantification of mammalian gene expression control. Nature 473, 337-42.

Shang, W.H., Hori, T., Martins, N.M.C., Toyoda, A., Misu, S., Monma, N., Hiratani, I., Maeshima, K., Ikeo, K., Fujiyama, A., et al. (2013). Chromosome Engineering Allows the Efficient Isolation of Vertebrate Neocentromeres. Dev. Cell 24, 635-48.

Shen, X., Mizuguchi, G., Hamiche, A., and Wu, C. (2000). A chromatin remodelling complex involved in transcription and. DNA Process. Nature 406, 541–544.

Shukla, M., Tong, P., White, S.A., Singh, P.P., Reid, A.M., Catania, S., Pidoux, A.L., and Allshire, R.C. (2018). Centromere DNA Destabilizes H3 Nucleosomes to Promote CENP-A Deposition during the Cell Cycle. Curr. Biol. 28, 3924-3936.e4.

Steger, D.J., Haswell, E.S., Miller, A.L., Wente, S.R., and O’Shea, E.K. (2003). Regulation of chromatin remodeling by inositol polyphosphates. Science 299, 114–116.

Suga, M., and Hatakeyama, T. (2001). High efficiency transformation of Schizosaccharomyces pombe pretreated with thiol compounds by electroporation. Yeast 18, 1015-21.

Tong, P., Pidoux, A.L., Toda, N.R.T., Ard, R., Berger, H., Shukla, M., Torres-Garcia, J., Müller, C.A., Nieduszynski, C.A., and Allshire, R.C. (2019). Interspecies conservation of organisation and function between nonhomologous regional centromeres. Nat. Commun. 10, 2343.

Tosi, A., Haas, C., Herzog, F., Gilmozzi, A., Berninghausen, O., Ungewickell, C., Gerhold, C.B., Lakomek, K., Aebersold, R., Beckmann, R., et al. (2013). XStructure and subunit topology of the INO80 chromatin remodeler and its nucleosome complex. Cell 154, 1207.

Tramantano, M., Sun, L., Au, C., Labuz, D., Liu, Z., Chou, M., Shen, C., and Luk, E. (2016). Constitutive turnover of histone H2A.Z at yeast promoters requires the preinitiation complex. Elife 5, e14243.

Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M.Y., Geiger, T., Mann, M., and Cox, J. (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 13, 731-40.

Udugama, M., Sabri, A., and Bartholomew, B. (2011). The INO80 ATP-Dependent Chromatin Remodeling Complex Is a Nucleosome Spacing Factor. Mol. Cell. Biol. 31, 662-73.

Venkatesh, S., and Workman, J.L. (2015). Histone exchange, chromatin structure and the

27 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

regulation of transcription. Nat. Rev. Mol. Cell Biol. 16, 178-89.

Verzijlbergen, K.F., Menendez-Benito, V., van Welsem, T., van Deventer, S.J., Lindstrom, D.L., Ovaa, H., Neefjes, J., Gottschling, D.E., and van Leeuwen, F. (2010). Recombination-induced tag exchange to track old and new proteins. Proc. Natl. Acad. Sci. 107, 64-8.

Vizcaino, J.A., Cote, R.G., Csordas, A., Dianes, J.A., Fabregat, A., Foster, J.M., Griss, J., Alpi, E., Birim, M., Contell, J., O'Kelly, G., Schoenegger, A., Ovelleiro, D., Perez-Riverol, Y., Reisinger, F., Rios, D., Wang, R., and Hermjakob, H. (2013) The PRoteomics IDEntifications (PRIDE) database and associated tools: status in 2013. Nucleic Acids Res. 41, D1063-9.

Walfridsson, J., Bjerling, P., Thalen, M., Yoo, E.J., Park, S.D., and Ekwall, K. (2005). The CHD remodeling factor Hrp1 stimulates CENP-A loading to centromeres. Nucleic Acids Res. 33, 2868-79.

Wang, L., Chen, J., Wang, C., Uusküla-Reimand, L., Chen, K., Medina-Rivera, A., Young, E.J., Zimmermann, M.T., Yan, H., Sun, Z., et al. (2014). MACE: model based analysis of ChIP- exo. Nucleic Acids Res. 42, e156.

Watanabe, S., Radman-Livaja, M., Rando, O.J., and Peterson, C.L. (2013). A histone acetylation switch regulates H2A.Z deposition by the SWR-C remodeling enzyme. Science 340, 195–199.

Watanabe, S., Tan, D., Lakshminarasimhan, M., Washburn, M.P., Hong, E.J.E., Walz, T., and Peterson, C.L. (2015). Structural analyses of the chromatin remodelling enzymes INO80-C and SWR-C. Nat. Commun. 6, 1–10.

Willhoft, O., Bythell-Douglas, R., McCormack, E.A., and Wigley, D.B. (2016). Synergy and antagonism in regulation of recombinant human INO80 chromatin remodeling complex. Nucleic Acids Res. 44, 8179-88.

Wisniewski, J., Hajj, B., Chen, J., Mizuguchi, G., Xiao, H., Wei, D., Dahan, M., and Wu, C. (2014). Imaging the fate of histone Cse4 reveals de novo replacement in S phase and subsequent stable residence at centromeres. Elife 3, e02203.

Xue, Y., Van, C., Pradhan, S.K., Su, T., Gehrke, J., Kuryan, B.G., Kitada, T., Vashisht, A., Tran, N., Wohlschlege, J., et al. (2015). The ino80 complex prevents invasion of euchromatin into silent chromatin. Genes Dev. 29, 350-5.

Yao, Y.L., Yang, W.M., and Seto, E. (2001). Regulation of transcription factor YY1 by acetylation and deacetylation. Mol. Cell. Biol. 21, 5979-91.

Yen, K., Vinayachandran, V., and Pugh, B.F. (2013). XSWR-C and INO80 chromatin remodelers recognize nucleosome-free regions near +1 nucleosomes. Cell 154, 1246-56.

Zhang, H., Roberts, D.N., and Cairns, B.R. (2005). Genome-wide dynamics of Htz1, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 123, 219-31.

Zhou, B., Wang, L., Zhang, S., Bennett, B.D., He, F., Zhang, Y., Xiong, C., Han, L., Diao, L., Li, P., et al. (2016). INO80 governs superenhancer-mediated oncogenic transcription and tumor growth in melanoma. Genes Dev. 30, 1440-53.

28 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

FIGURE LEGENDS

Figure 1. Hap2 is associated with CENP-ACnp1 chromatin and is a subunit of Ino80 complex (A) Scheme for enrichment of CENP-ACnp1 chromatin associated proteins and identification by mass spectrometry. (B) Silver-stained SDS-PAGE of proteins enriched in IPs from GFP-CENP-ACnp1 or untagged control cells. (C) Volcano plot comparing label free quantification (LFQ) intensity of proteins enriched in affinity selected GFP-CENP-ACnp1 (anti-GFP) versus untagged control. Inner and outer kinetochore proteins detected (Red). Ino80 complex subunits (Blue). CENP-ACnp1 chaperones Scm3 and Sim3 (Purple). (D) Volcano plot comparing label free quantification of proteins enriched in affinity selected Hap2-GFP (anti-GFP) versus untagged control. Ino80 complex subunits (Blue). Swr1 complex subunits, SWI/SNF complex, RSC complex and CHD family members (Red).

Figure 2. Hap2 is distributed throughout the nucleus and associates with endogenous and ectopic central core chromatin (A) Immunolocalization of Hap2-GFP in cells. Representative images of wild-type and Hap2-GFP cells stained with anti-CENP-ACnp1 (red), anti-GFP (green) and DAPI (blue). Scale bar, 5 μm. (B) qChIP for Hap2-GFP at four locations within endogenous centromeres (cc1/3, cc2-a, cc2-b and cc2-c), outer repeat heterochromatin (dg) and non-centromere locus (act1+). Error bars indicate mean ± SD (n = 3). (C) Top: Diagram indicating strain with endogenous cen2-cc2 replaced with cen1 central domain DNA (cc1) with insertion of 8.5 kb of cc2 DNA at the non-centromeric ura4 locus (ura4:cc2) on Chr III. Bottom: qChIP for Hap2-GFP at three locations within ectopic central domain H3 chromatin (cc2-a, cc2-b and cc2-c), endogenous centromeres (cc1/3), outer repeat heterochromatin (dg) and non-centromere locus (act1+). Error bars indicate mean ± SD (n = 3). (D) Comparison of Hap2-GFP association with central domain sequence assembled in CENP-ACnp1 chromatin or H3 chromatin (data from B and C). Error bars indicate mean ± SD (n = 3). Significance of the differences observed between cells containing endogenous centromeres and ectopic central domain DNA was evaluated using Student's t-test; * p < 0.05, * p < 0.005 ***, p < 0.005 and n.s., not significant.

29 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 3. Hap2 is required to maintain CENP-ACnp1 chromatin but not the adjacent pericentric heterochromatin (A) Frequency of lagging chromosomes in anaphase cells. Representative images of wild-type and hap2∆ cells stained with DAPI (red) and anti-tubulin (green). Percentage of anaphase cells (n=100) displaying lagging chromosomes is indicated. Scale bar, 5 μm. (B) Top: Diagram indicating position otr1:ura4+ marker gene inserted in outer repeat heterochromatin of cen1. Bottom: Growth assay for central domain silencing at otr1:ura4+. 5-fold serial dilution of cell cultures were spotted on non-selective (N/S), selective (−URA) or counter-selective (FOA) plates as indicated and incubated at 30°C for 3 days. (C) qChIP for H3K9me2 at outer repeat heterochromatin (dg). Error bars indicate mean ± SD (n = 3). (D) qRT-PCR of pericentric dg repeats performed on total RNA extracted from indicated strains. Transcript levels are shown relative to act1+ and normalized to wild-type (n = 3). (E) Top: Diagram indicating position cc1:ura4+ marker gene within the central CENP-ACnp1 domain cen1 (cnt1) relative to the outer repeat (otr) and innermost repeats (imr). Bottom: Growth assay for central domain silencing at cen1:ura4+ as in B. (F and G) qChIP for CENP-ACnp1 (F) and histone H3 (G) at five locations within endogenous centromeres (cc1, cc1/3, cc2-a, cc2-b and cc2-c), outer repeat heterochromatin (dg) and non-centromere locus (act1+). Error bars indicate mean ± SD (n = 3). Significance of the differences observed between wild-type and hap2∆ was evaluated using Student's t-test in C, D, F and G; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant.

30 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 4. Hap2 is required for the de novo establishment of CENP-ACnp1 chromatin (A) Schematic representation of pHcc2 minichromosome containing 5.5 kb K”/dg repeat adjacent to 6.8 kb central domain 2 DNA. Position of the primer pair at the edge of K”/dg repeat (K”-mini and K”-imr) and within central domain 2 DNA (cc2-a, cc2-b and cc2-c) are indicated. (B) S. pombe transformants containing pHcc2 minichromosome plasmids were replica-plated to low adenine non-selective plates: colonies retaining pHcc2 minichromosome plasmid have established centromere function are white/pale-pink, those that lose it are red. Centromere establishment frequency with representative plate showing colonies with established centromere function and those that have failed to establish centromere function in wild-type (n = 515), hap2∆ (n = 390) and strains lacking heterochromatin clr4∆ (n = 870). (C and D) qChIP for CENP-ACnp1 and histone H3 at plasmid-borne central domain 2 DNA (cc2-a) on pHCC2 minichromosome. Error bars indicate mean ± SD (n = 3). (E) qChIP for H3K9me2 at plasmid-borne K”/dg repeat (K”-mini and K”-imr) and plasmid-borne central domain 2 DNA (cc2-a) on pHcc2 minichromosome. Error bars indicate mean ± SD (n = 3). (F) Top: Schematic representation of pcc2 minichromosome without K”/dg repeat transformed in cells overexpressing CENP-ACnp1. OE, overexpression. Bottom: qChIP for CENP-ACnp1 at non-centromere locus (act1+), outer repeat heterochromatin (dg) and ribosomal DNA (rDNA) and three locations within plasmid-borne central core 2 DNA (cc2-a, cc2-b and cc2-c) on pcc2 minichromosome relative to CENP-ACnp1 levels at endogenous centromeres (cc1/3). Error bars indicate mean ± SD (n = 3). Significance of the differences observed between wild-type and hap2∆ was evaluated using Student's t-test in C, D, E and F; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant.

31 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 5. Hap2 is required for high histone H3 turnover on central domain centromere DNA and islands of non-centromeric CENP-A incorporation (A) Experimental setup to assess replication-independent H3 turnover. The cdc25-22 temperature sensitive mutation was used to block wild-type and hap2∆ cells in G2, after 2.5 hours at 36oC, the HA tag on H3 was swapped for the T7 tag by β-estradiol induced Cre/loxP mediated recombination. Samples were collected at 0 and 2 hours and analyzed by qChIP. (B) qChIP analysis of new H3.2-T7 incorporated in cdc25-22/G2 arrested cells at pericentromeric outer repeat heterochromatin (dg), the central CENP-ACnp1 domain of cen1 (cc1), highly transcribed genes (act1+ and spd1+) and three locations within ectopically located ura4:cc2 lacking CENP-ACnp1 (cc2-a, cc2-b and cc2-c). y axis: H3.2-T7 %IP values normalized to the respective total H3 %IP values represents normalized turnover for each sample. Error bars indicate mean ± SD (n = 3). (C) ChIP-seq analysis of HA and T7 tagged CENP-ACnp1 reveals consistent Non-centromeric CENP-ACnp1 ISlands (NCIS) of incorporation above background at 14 locations in the genome. (D) Four CENP-ACnp1 islands are shown: NCIS1, NCIS2, NCIS3 and NCIS4 (data from C). (E) qChIP for GFP-CENP-ACnp1 at non-centromeric CENP-ACnp1 islands using indicated primer pairs (yellow boxes in D for NCIS1, 2, 3 and 4) and meiotic-specific gene (mei4+). Error bars indicate mean ± SD (n = 3). (F) qChIP analysis of new H3.2-T7 incorporation (turnover as in B) in cdc25-22/G2 arrested cells at NCIS1, 2, 3 and 4. Error bars indicate mean ± SD (n = 3). Error bars indicate mean ± SD (n = 3). Significance of the differences observed between wild-type and hap2∆ was evaluated using Student's t-test in B, E and F; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant.

32 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 6. Transcription from centromeric DNA is reduced in the absence of Hap2. (A) cdc25-22 synchronized cell populations were used to assess levels of RNAPIIS5P and central core transcripts during G2 in B and C. The septation index for wild-type and hap2∆ were measured and cells were collected in G2 (Time point: 140) for further analysis in B and C. (B) qChIP for initiating RNAPIIS5P at two locations within endogenous centromeres (cc1, cc1/3) and three locations within ectopically located ura4:cc2 lacking CENP-ACnp1 (cc2-a, cc2-b and cc2-c) in wild-type and hap2∆. Error bars indicate mean ± SD (n = 3). (C) qRT-PCR to quantify transcripts from three locations within ectopically located ura4:cc2 lacking CENP-ACnp1 (cc2-a, cc2-b and cc2-c) and from pericentromeric outer repeat heterochromatin (dg) on total RNA extracted from in wild-type and hap2∆. Transcript levels are shown relative to act1+, error bars indicate mean ± SD (n = 3). (D) Measurement of LacZ expression driven by three 200bp cc2 fragments with promoter activity (cc2-200a, cc2-200b and cc2-200c), the nmt81 promoter and no promoter following transformation of plasmids into wild-type and hap2∆ using the ONPG substrate/absorbance at 420 nm, error bars indicate mean ± SD (n = 3). Inset: Diagram of plasmids with different 200 bp fragments from central domain region of cen2 (cc2) placed upstream the LacZ reporter. Significance of the differences observed between wild-type and hap2∆ was evaluated using Student's t-test in B-D; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant.

Figure 7. Hap2-Ino80 mediated transcription facilitates de novo establishment of CENP- ACnp1 chromatin Model for the establishment of CENP-ACnp1 chromatin in S. pombe. Left: Hap2 is required for transcription initiation events to maintain high H3 turnover thus renders H3 nucleosomes unstable on centromeric sequences allowing its replacement with CENP-ACnp1 nucleosomes. Right: Cells lacking Hap2 have lower transcription initiation events that stabilize the H3 nucleosomes on centromeric sequences thus lowering its propensity to establish CENP-ACnp1 chromatin.

33 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 1 A C Sample Control IP: GFP-CENP-ACnp1

GFP-CENP-A Untagged 8 7 7

Fta7 Wip1 Cnp20 Fta2 Cell Lysis & MNase Digestion 6 Tfg3 Mis17 Mal2 Mhf1 Sim4 Fta1 Fta4 Mis15

5 5 Mhf2 Affinity Purification Fta3 Cnp3 Cnl2 Fta6 Mis6

4 4 Ies2 Rvb2 Ies4 Scm3 Rvb1 Ies6

Log Log p value Alp5 Ino80 - 3 3 Arp5 Arp8 Mis13 Nuf2 Ndc80 Enzymatic Digest Spc24 CENP-ACnp1 Iec1 Iec5 2 2 Mis12Iec3 Nht1 Nnf1 Sim3 Mis14 Hap2 Sos7Spc7 1 1 Spc25 0 LC MS/MS Analysis -4 -2 0 2 4 6 8 10 12 Difference in LFQ intensity in CENP-ACnp1 chromatin vs untagged control B D

8 IP: Hap2-GFP Rvb1 Untagged GFP-CENP-ACnp1 7 Rvb2 - -

188 kDa -

6 6 Iec1 98 kDa - Tfg3 Iec3 Hap2 Iec5 62 kDa - 5 Swc4 Ies4 Arp8 Yaf9 Snf2 Nht1 49 kDa - Ies2 Alp5 GFP- 4 Rsc9 Arp5 Ino80 Cnp1 38 kDa - CENP-A Ssr2 Ssr3 Ies6 Log Log p value 3 3 - Ssr1 Hrp1 28 kDa - Ssr4 Rsc58 Msc1 Sfh1 17 kDa - 2 Hrp3 Arp9 Rsc1 14 kDa - Histones Snf22 Rsc7 1 1 Sol1 Rsc4 Swr1 6 kDa - Snf5

0 0 Bdf1

-15 -10 -5 0 5 10 15 Difference in LFQ intensity in Hap2-GFP vs untagged control bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 2

A CENP-ACnp1 GFP DAPI Merge

wt

Hap2-GFP

B C qChIP: GFP untagged Hap2-GFP 20 Chr I 1 15 Chr II 1 10 mat Chr III 3 2 5 Normalized %IP Normalized 0 Ectopic cc2 DNA cc1/3 cc2-a cc2-b cc2-c dg act1 (ura4:cc2) qChIP: GFP Endogenous central domain chromatin D untagged Hap2-GFP qChIP: Hap2-GFP 30 endogenous cc2 ectopic cc2 40 20 30 *** * ns ** 20 ns %IP Normalized 10 ns 10 Normalized %IP Normalized 0 0 cc1/3 cc2-a cc2-b cc2-c dg act1 cc1/3 cc2-a cc2-b cc2-c dg act1 Ectopic central domain chromatin bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 3 A B otr1L imr1L cnt1 imr1R otr1R DAPI α-tubulin Merge cen1 wt ura4+ 0% N/S -URA 5-FOA hap2Δ ura4+ 3.4% ura4-

otr1:ura4+ C D hap2∆ otr1:ura4+ qChIP: qRT-PCR H3K9me2 (dg) (dg) E otr1L imr1L cnt1 imr1R otr1R cen1 dg

- ns + 1 act1 10 ura4 octo vs N/S -URA 5-FOA

0.5 5 ura4+

ns -

mRNA level level mRNA ura4 Normalized to Normalized 0 0 cc1:ura4+ wt hap2∆ wt hap2∆ clr4∆ hap2∆ cc1:ura4+ F qChIP: CENP-ACnp1 G qChIP: H3

wt hap2∆ 0.8 wt hap2∆ cc2 * act1 - - ** ns 0.2 ** octo octo 0.6 * ** ** * 0.4 * 0.1 **** 0.2 ns * Normalized to Normalized Normalized to Normalized 0 0 cc1 cc1/3 cc2-a cc2-b cc2-c act1 cc1 cc1/3 cc2-a cc2-b cc2-c act1 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 4 A B wt clr4∆ hap2∆

K”-mini K”-imr K”/dg cc2

pHcc2 cc2-a cc2-b cc2-c

10.1% 0% 0% C D E F qChIP: qChIP: qChIP: cc2 pcc2 CENP-ACnp1 (cc2-a) H3 (cc2-a) H3K9me2 cc2-a cc2-b cc2-c (OE CENP-ACnp1) wt hap2∆ ** qChIP: 50 6 ** ** CENP-ACnp1 9 5 cc1 1.2 wt hap2∆ ** 40 4 30 6 0.8 * %IP %IP %IP 3 20 ns ns 2 * 3 0.4 ns 10 1 ns ns

0 0 0 over enrichment Relative 0 wt hap2∆ wt hap2∆ K"-mini K"-imr cc2-a act1 dg rDNA cc2-a cc2-b cc2-c bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 5

A LoxP LoxP cdc25-22 H3 HA HYG T7 (G2/M block) Un-switched + β-estradiol 36oC HA tagged releases Cre-EBD

o into nucleus 25 C 2.5 hr 0 hr 2 hr LoxP H3 T7 β-estradiol addition Switched B T7 tagged qChIP: New H3-T7/Total H3 0 hour 2 hour * 0.4 * * 0.3 total H3 H3 total ns vs * ns 0.2 T7 -

H3 0.1 ns ns 0 wt hap2∆ wt hap2∆ wt hap2∆ wt hap2∆ wt hap2∆ wt hap2∆ wt hap2∆ wt hap2∆ dg cc1 act1 spd1-5' spd1-cds cc2-a cc2-b cc2-c

Heterochromatin CENP-ACnp1 Highly transcribed genes Ectopic central domain chromatin chromatin C D Chr I Non-centromeric CENP-ACnp1 islands 0-10 Chromosome Start End Length(bp) ChrI : NCIS1 3710401 3710900 499

ChrI 3711001 3711350 349 NCIS1 ppk3 ChrI 3723451 3723650 199 Chr I

ChrI 3745201 3745700 499 0-10 ChrI 3751801 3752150 349 ChrI 3795451 3795800 349

ChrI : NCIS2 3844351 3844550 199 SPAC4H3.09 NCIS2 pyk1 ChrI 3897151 3897350 199 Chr II ChrII 1598551 1598900 349 0-10 ChrII 1650601 1650800 199 ChrII : NCIS3 1684501 1684700 199 NCIS3 ChrIII 814801 815000 199 pat1 mug124 Chr III ChrIII 1065001 1065950 949 0-10 CENP-ACnp1-HA ChrIII : NCIS4 1211551 1211750 199 CENP-ACnp1-T7

nmd5 NCIS4 arp6 E F qChIP: GFP-CENP-ACnp1 qChIP: New H3-T7/Total H3 untagged wt 0 hour 2 hour hap2∆ * act1 0.6 ** 4 * ** * * 0.4 ** * 2 ns 0.2 ns Normalized to Normalized

0 turnover Normalized 0 mei4 NCIS1 NCIS2 NCIS3 NCIS4 wtwt hap2∆hap2∆ wtwt hap2∆hap2∆ wtwt hap2∆hap2∆ wtwt hap2∆hap2∆ wtwt hap2∆hap2∆ Meiotic-specific Non-centromeric mei4 NCIS1 NCIS2 NCIS3 NCIS4 gene CENP-ACnp1 islands bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 6 A B Cell cycle block and release qChIP: RNAPIIS5P 90 wt hap2Δ wt hap2Δ 0.4 ns 60 G2 0.3 0.2 ns ** 30 *

% septation% 0.1 ** 0 0 0 20 40 60 80 100 120 140 160 180 200 to total Relative RNAPII cc1 cc1/3 cc2-a cc2-b cc2-c Time after releaseTime after from release G2/M block (minutes) CENP-ACnp1 Ectopic central domain chromatin chromatin C D qRT-PCR LacZ expression assay (ONPG) wt hap2∆ ns wt hap2∆ LacZ

act1 0.015 * 20 promoter vs * 0.01 ** * ns 10 ** **

0.005 units Arbitrary

mRNA level level mRNA ns 0 0 cc2-a cc2-b cc2-c dg no cc2-200a cc2-200b cc2-200c nmt81 promoter promoter Ectopic central domain transcripts bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 7

wild type hap2∆ A A RNAPII RNAPII

A H3 H3 A H3 H3 H3 H3 Hap2-Ino80C Ino80C

H3 H3 H3 H3 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Supplemental Information

Hap2-Ino80 facilitated transcription promotes de novo establishment of CENP-A chromatin bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S1. Compositions of S. pombe, S. cerevisiae and H. sapiens Ino80-related chromatin remodeling complex

Module S. S. H. Comments (Chen et pombe cerevisiae sapiens al. 2011) Module I Ino80 INO80 hINO80 SNF2-like helicase Rvb1 RVB1 RVBL1 DNA helicases (also a subunit of Nu4A Rvb2 RVB1 RVBL2 complex, Swr1 complex and ASTRA complex)

Ies2 IES2 INO80B Ino80 complex subunit Arp5 ARP5 ACTR5 Actin-related protein Ies6 IES6 INO80C Ino80 complex subunit Module II Arp8 ARP8 ACTR8 Actin-related protein Alp5 ARP4 ACTL6 Actin-related protein (Alp5 is also a subunit of A NuA4 complex and Swr1 complex) Act1 ACT1 β-Actin Actin (also part of NuA4 complex and Swr1 complex) Iec1 - YY1 YY1 transcription factor Module III - - INO80D FLJ20309 (metazoan - - INO80E FLJ90652 specific - - TFPT TCF3 fusion partner subunits) - - NFRKB nuclear factor related to kappa binding protein - - MCRS1 FHA domain in the C terminus - - UCHL5 ubiquitin C-terminal hydrolase L5 Yeast Ies4 IES4 - Ino80 complex subunit specific Nhp1 NHP10 - HMG-type domain; DNA binding subunits Tfg3 TAF14 - TATA binding protein-Associated Factor ( also a subunit of SWI/SNF complex, TFIID and TFIIF complex) S. pombe Iec3 - - Ino80 complex subunit specific Iec5 - - Ino80 complex subunit subunits Hap2 - - - S. - IES1 - Ino80 complex subunit cerevisiae - IES3 - Ino80 complex subunit specific - IES5 - Ino80 complex subunit subunits bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S2. Orthologous S. pombe, S. cerevisiae and H. sapiens kinetochore proteins

S. pombe S. cerevisiae H. sapiens Cnp1 Cse4 CENP-A Cnp3 Mif2 CENP-C Fta1 Iml3 CENP-L Mis15 Chl4 CENP-N Mal2 Mcm21 CENP-O Fta2 Ctf19 CENP-P Fta7 Okp1 CENP-Q Mis17 Ame1 CENP-U Inner kinetochore Fta3 Mcm16 CENP-H Mis6 Ctf3 CENP-I Sim4 Mcm22 CENP-K Mhf1 Mhf1 CENP-S Cnp20 Cnn1 CENP-T Mhf2 Mhf2 CENP-X Wip1 Wip1 CENP-W Cnl2 Nkp2 - Fta4 Nkp1 - Fta6 - - Ndc80 Ndc80 NDC80 Nuf2 Nuf2 NUF2 Spc24 Spc24 SPC24 Spc25 Spc25 SPC25 Mis12 Mtw1 MIS12 Outer kinetochore Mis13 Dsn1 DSN1 Mis14 Nsl1 NSL1 Nnf1 Nnf1 PMF1 Spc7 Spc105 KNL1 Sos7 Bbp1 - bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A B qChIP: Native GFP-CENP-ACnp1 IP: GFP Untagged GFP-CENP-ACnp1 act1 2000 - - - - GFP- CENP-ACnp1 1000

Western 0 Enrichment over over Enrichment dg cc2-a dg cc2-a Untagged GFP-CENP-ACnp1

C D IP: Ino80-3HA Alp5

Ino80-3HA - + - + 6 Hap2-GFP - - + + Arp5 Rvb2 Ino80 5 Rvb1 -HA Arp8 IP: Nht1 Ies6 GFP 4 Hap2 Tfg3 -GFP 3 3 Log Log p value - Ies2 Ino80 Iec5 -HA Ies4

2 2 Ino80 Iec3 Hap2 Hap2 Total -GFP Iec1 1 1

H3 0 0

Western -6 -4 -2 0 2 4 6 Difference in LFQ intensity in Ino80-3HA vs untagged control

Figure S1. Purification of CENP-ACnp1 and Ino80 complex

(A) Native qChIP for GFP-CENP-ACnp1 at outer repeat heterochromatin (dg) and within endogenous centromeres (cc2-a). (B) Anti-GFP IP from lysates of cells expressing GFP-CENP-ACnp1 or untagged control cells, followed by anti-GFP western analysis. (C) Western analysis of anti-GFP IPs to enrich Hap2-GFP from lysates of cells expressing Ino80‐3HA, Hap2-GFP or both, or untagged tagged control. Western analysis to detect Ino80‐3HA or Hap2-GFP in anti-GFP IPs and total extracts. Loading control anti-histone H3. (D) Volcano plot comparing LFQ intensity of proteins enriched in affinity selected Ino80-3HA (anti‐HA) versus untagged control. Ino80 complex subunits (Blue). bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A B qChIP: Ino80-HA wt Hap2-GFP untagged wt hap2∆ 0.015 ns ns ns ns 0.01

% IP % ns ns 0.005 9.27% 9.06% 0 cc1 cc1/3 cc2-a cc2-b cc2-c act1 CENP-ACnp1 Ectopic central chromatin domain chromatin

Figure S2. C-terminal tagging of Hap2 is functional Ino80 localization at central domain chromatin is independent of Hap2

(A) S. pombe transformed with pHcc2 minichromosome DNA were replica-plated to low adenine non-selective plates. Colonies where CENP-ACnp1 chromatin and functional centromeres have established retain pHcc2 and exhibit a white/pale-pink colour. Those that do not establish centromeres lose pHcc2 and form red colonies. Representative plates of such establishment assay are shown for wild type (n = 539) and Hap2-GFP (n = 342) cells. The percentage of transformants exhibiting functional centromere establishment are indicated. (B) qChIP for Ino80-HA at two locations within endogenous centromeres (cc1 and cc1/3), three locations within ectopically inserted central domain 2 DNA (cc2-a, cc2-b and cc2-c) and non‐centromere locus (act1+), in wild type and hap2∆. Error bars indicate mean ± SD (n = 3). Significance of the differences observed between wild type and hap2∆ was evaluated using Student's t-test; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant. bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A B otr1L imr1L cnt1 imr1R otr1R otr1L imr1L cnt1 imr1R otr1R cen1 cen1 ura4+ ura4+

N/S -URA 5-FOA N/S -URA 5-FOA ura4+ ura4+ ura4- ura4- otr1:ura4+ cc1:ura4+ hap2∆ otr1:ura4+ hap2∆ cc1:ura4+ iec1∆ otr1:ura4+ iec1∆ cc1:ura4+ ies2∆ otr1:ura4+ ies2∆ cc1:ura4+ ies4∆ otr1:ura4+ ies4∆ cc1:ura4+

C D qRT-PCR hap2 wt wt D qRT-PCR wt hap2∆ GFP-CENP-ACnp1 ⎯ + + Cnp1,ns Cnp3,ns nsScm3,ns Sim3,ns ns Sim4,ns eic1,ns nseic2,ns mis6,ns ns Cnp1 GFP-CENP-A act1 100mis15, mis16, mis17, mis18 vs

H3 H4 50 mRNA level level mRNA Bip1 0 Western

Figure S3. Loss of Hap2 does not affect cellular levels of CENP-ACnp1 or mRNA levels of CENP-ACnp1 chromatin-related genes

(A and B) Growth assay for at cnt1-otr1:ura4+ (A) or cnt1-cc1:ura4+ (B) in cells lacking the indicated Ino80 subunits. (C) Western analysis of GFP-CENP-ACnp1, histone H3, histone H4 and Bip1 (loading control) in whole cell lysates of wild-type and hap2∆ cells expressing GFP-CENP-ACnp1 or untagged CENP‐ACnp1. (D) qRT-PCR analysis to measure expression levels of the indicated genes which are known to affect CENP-ACnp1 loading at fission yeast centromeres when mutated. Transcript levels are shown relative to the act1+ gene (n = 3). Significance of the differences observed between wild type and hap2∆ was evaluated using Student's t-test; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant. bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A wt iec1∆ B

hap2 wt wt D oeGFP-CENP-ACnp1 ⎯ + +

GFP-CENP-ACnp1 10.1% 3.52%

ies2∆ ies4∆ H3

Bip1

27.27% 2.87% Western

Figure S4. Cells lacking different Ino80 subunits show variable centromere establishment frequency Overexpression of CENP-ACnp1 is unaffected by the loss of Hap2

(A) S. pombe transformants containing pHcc2 minichromosome plasmids were replica-plated to low adenine non-selective plates: colonies retaining pHcc2 minichromosome plasmid have established centromeres are white/pale-pink, those that lose it are red. Representative plate showing established and non-established colonies and establishment frequency in wild type (n = 515), iec1∆ (n = 795), ies2∆ (n = 660) and ies4∆ (n = 802). (B) Western analysis of GFP-CENP-ACnp1, histone H3, histone H4 and Bip1 (loading control) in whole cell lysates of wild-type and hap2∆ cells over-expressing GFP-CENP-ACnp1 or untagged CENP-ACnp1. bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A B qPCR: H3-HA→T7 tag switching efficiency qChIP: H2A.ZPht1-myc untagged wt hap2∆ 0.16 ns ns

act1 1 0.12 % IP % 0.08 ns 0.5 ns ns ns

Normalized to Normalized 0.04 ns

0 0 wt hap2∆ cc1 cc1/3 cc2-a cc2-b cc2-c act1 CENP-ACnp1 Ectopic central chromatin domain chromatin

C qChIP: GFP untagged Hap2-GFP

10

5 Normalized %IP Normalized

0 NCIS1 NCIS2 NCIS3 NCIS4 NCIS5 mei4

Figure S5. H3-HA→T7 switching efficiency is not affected in cells lacking Hap2 H2A.ZPht1 localization at central domain chromatin is independent of Hap2 Hap2-GFP associates with non-centromeric CENP-ACnp1 islands

(A) qPCR for H3-HA→T7 switching efficiency of H3 tagged with HA and switched to T7 tag by β‐estradiol induced Cre/loxP mediated recombination during cdc25-22/G2 block in 2 hours. Error bars indicate mean ± SD (n = 3). (B) qChIP for H2A.ZPht1 at two locations within endogenous centromeres (cc1 and cc1/3), three locations within ectopically inserted central domain 2 DNA (cc2-a, cc2-b and cc2-c) and non‐centromere locus (act1+), in wild type and hap2∆. Error bars indicate mean ± SD (n = 3). (C) qChIP for Hap2-GFP at ectopic CENP-ACnp1 islands (NCIS1, 2, 3 and 4) and meiotic-specific gene (mei4+) in untagged and Hap2-GFP. Error bars indicate mean ± SD (n = 3). Error bars indicate mean ± SD (n = 3). Significance of the differences observed between wild type and hap2∆ was evaluated using Student's t-test in A; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant. bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A B qChIP: RNAPII qChIP: RNAPIIS2P wt hap2∆ wt hap2Δ

act1 0.8 3 ns ns ns 0.6 2 ns ns S. octosporus S. octosporus 0.4 ns ns 1 ns ns 0.2 ns Relative to total Relative RNAPII

Normalized to Normalized 0 0 cc1 cc1/3 cc2-a cc2-b cc2-c cc1 cc1/3 cc2-a cc2-b cc2-c CENP-ACnp1 Ectopic central domain CENP-ACnp1 Ectopic central domain chromatin chromatin chromatin chromatin C D LacZ expression assay (X-gal) LacZ expression assay (X-gal) wt hap2∆ wt hap2∆ no promoter 0.9 ***

cc2-200a 0.6 cc2-200b ** *** ns

cc2-200c (630nm) OD 0.3 ns nmt81- promoter 0 no cc2-200a cc2-200b cc2-200c nmt81 promoter promoter

Figure S6. Transcription from centromeric DNA is reduced in the absence of Hap2

(A and B) qChIP for total RNAPII and RNAPIIS2P at two locations within endogenous centromeres (cc1 and cc1/3) and three locations within ectopically-inserted central core 2 DNA (cc2-a, cc2-b and cc2-c) in wild type and hap2∆ in G3 (T140). Error bars indicate mean ± SD (n = 3). (C) Analysis of promoter activity from cc2 fragments (cc2-200a, cc2-200b and cc2-200c). The level of LacZ expression was assessed by measuring absorbance at 630 nm of cell lysates incubated with X-gal. nmt81: positive control with nmt81 promoter. (D) Quantification of levels of LacZ expression as assessed by measuring absorbance at 630 nm in samples shown in C (n = 3). Error bars indicate mean ± SD (n = 3). Significance of the differences observed between wild type and hap2∆ was evaluated using Student's t-test in A, B and D; * p < 0.05, ** p < 0.005; *** p < 0.005 and n.s., not significant. bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S3. List of strains used in the study

Strain no. Genotype Reference 1646 h- ade6-210 arg3-D4 his3-D1 leu1-32 ura4-D18 Lab stock 4841 h- otr1R Sph::ura4 leu1-32 ura4DSE his3D1 arg3D4 Allshire et al., ade6‐210 1995 A2549 h- leu1-32 ura4-D18 lys1 GFP-cnp1-NAT Takayama et al., 2008 A7373 h- ade6-704-HYGMX6 his3-D1 leu1-32 ura4-DSE/D18? Catania et al., arg3? cc2D6kb:cc1 2015 A7377 clr4::NAT ade6-704-HYGMX6 his3-D1 leu1-32 Catania et al., ura4‐DSE/D18? arg3? cc2D6kb:cc1 2015 A7408 h- cc2D6kb:cc1 ars1:nmt41-GFP-cnp1-NAT Catania et al., ade6‐704‐HYGMX6 his3-D1 leu1-32 ura4-DSE/D18 2015 A8240 h- kanMX6-Pcnp1-mEGFP-cnp1 ade6-M210 leu1-32 JW2595. Gift ura4‐D18 from Jian‐qiu Wu. A8545 h+ ade6-210 arg3-D4 his3-D1 leu1-32 ura4-D18 This study cnp1:cnp1‐loxP-HA-HYG-loxP-T7 A8548 h+ ade6-210 arg3-D4 his3-D1 leu1-32 ura4-D18 This study cnp1:cnp1‐loxP-T7-HYG-loxP-HA A8985 Ura4-DSE-sup3e-cc2-ura4+ cc2D6kb:cc1 ade6-704-HYG Lab stock ura4-DSE/D18? B0324 cc2Δ6Kb:cc1 Ura4-DSE-sup3e-cc2-ura4+ Shukla et al., H3.2‐lox‐HA‐HYG-loxT7 ars1:pRAD11-Cre-EBD-LEU2+ 2018 cdc25-22 ade6‐704-NAT ura4D18/DSE leu1-32 B1700 iec1::Kan TM1::ura ade6-210/216 ura-D18 leu1-35 This study B1713 ies2::Kan TM1::ura ade6-210/216 ura-D18 leu1-48 This study B1715 ies4::Kan TM1::ura ade6-210/216 ura-D18 leu1-50 This study B1718 hap2::Kan TM1::ura ade6-210/216 ura-D18 leu1-53 This study B1819 h+ ade6-M210/M216 ura4-D18 leu1-32 hap2::KanMX6 This study B1863 cc2D6kb:cc1 ars1:nmt41-GFP-cnp1-NAT This study ade6‐704‐HYGMX6 leu1-32 ura4-DSE/D18 iec1::KanMX6 B1884 cc2D6kb:cc1 ars1:nmt41-GFP-cnp1-NAT This study ade6‐704‐HYGMX6 leu1-32 ura4-DSE/D18 ies2::KanMX6 B1887 cc2D6kb:cc1 ars1:nmt41-GFP-cnp1-NAT This study ade6‐704‐HYGMX6 leu1-32 ura4-DSE/D18 ies4::KanMX6 B1890 cc2D6kb:cc1 ars1:nmt41-GFP-cnp1-NAT This study ade6‐704‐HYGMX6 leu1-32 ura4-DSE/D18 hap2::KanMX6 B1929 ade6-704-HYGMX6 leu1-32 cc2D6kb:cc1 hap2∆::KanMX6 This study B2132 h+ ura4-D18 leu1-32 GFP-cnp1-NAT hap2∆::Kan This study B2871 hap2::Kan cc2?6Kb:cc1 Ura4-DSE-sup3e-cc2-ura4+ This study H3.2‐lox-HA-HYG-loxT7 ars1:pRAD11-Cre-EDB-LEU2+ cdc25-22 ade6-704-NAT ura4D18/DSE leu1-32 B3109 h- hap2-GFP-Kan ade6-210 arg3-D4 his3-D1 leu1-32 This study ura4‐D18 B3646 leu1-32 ura4-D18 Ino80-HA-NAT This study bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S3. List of strains used in the study (continued)

Strain no. Genotype Reference B3993 h- pht1-myc-KanMX ura4-D18/DS-E This study Ura4-DSE-sup3e-cc2-ura4+ cc2D6kb:cc1 ade6-704-HYG B4079 Ino80-3HA-Nat ura4-D18/DS-E? This study Ura4-DSE-sup3e-cc2-ura4+ cc2D6kb:cc1 ade6-704-HYG B3854 iec1∆::Kan otr1R Sph::ura4 ura4-D18/DSE leu1-32 This study ade6‐M210/M216 B3856 ies2∆::Kan otr1R Sph::ura4 ura4-D18/DSE leu1-32 This study ade6‐M210/M216 B3858 ies4∆::Kan otr1R Sph::ura4 ura4-D18/DSE leu1-32 This study ade6‐M210/M216 B3860 hap2∆::Kan otr1R Sph::ura4 ura4-D18/DSE leu1-32 This study ade6‐M210/M216 B4282 hap2-GFP-KanMX ura4-D18/DS-E cc2D6kb:cc1 This study ade6‐704‐HYG B4283 hap2-GFP-KanMX ura4-D18/DS-E This study Ura4-DSE-sup3e-cc2-ura4+ cc2D6kb:cc1 ade6-704-HYG B4285 hap2-GFP-KanMX ura4-D18/DS-E cdc25-22 This study Ura4-DSE-sup3e-cc2-ura4+ cc2D6kb:cc1 ade6-704-HYG B4286 hap2∆::KanMX Ino80-3HA-Nat ura4-D18/DS-E This study Ura4-DSE-sup3e-cc2-ura4+ cc2D6kb:cc1 ade6-704-HYG B4287 hap2∆::Kan pht1-myc-KanMX ura4-D18/DS-E This study Ura4-DSE-sup3e-cc2-ura4+ cc2D6kb:cc1 ade6-704-HYG bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S4. List of plasmids used in the study

Plasmid name Reference pHcc2 Folco et al., 2008 pcc2 Folco et al., 2008 pLacZ (no promoter) Catania et al., 2015 pLacZ-POP-N13-200bp (cc2-200a) Catania et al., 2015 pOP-1c-LacZ-200bp (cc2-200b) Catania et al., 2015 pLM-14A-LacZ-200bp (cc2-200c) Catania et al., 2015 pREP81X-LacZ (nmt81 promoter) Catania et al., 2015 bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S5. List of primers used in the study

Locus Primer name Sequence WW186-F GTTGGTATTAGTTCATCGTCCTCCGT cc1 WW187-R GGGACGTGAGTGTTCGGTCA WB3-F CAGACAATCGCATGGTACTATC cc1/3 WB4-R AGGTGAAGCGTAAGTGAGTG PP76-F CGTGCACATTTGTGAAAAGG cc2-a PP77-R TATGTGTTTCGTATACACCC PP78-F CTAGACTTTAAGTTCTACCC cc2-b PP79-R GCACATATTAGTTTATTCAAGC PP89-F TGCTGAACTATTTGTGGTGG cc2-c PP90-R ATGATTTGAGCCTTCAGCTT PP36-F AATTGTGGTGGTGTGGTAATAC dg PP37-R GGGTTCATCGTTTCCATTCAG WB9-F CCCAAATCCAACCGTGAGAAGATG act1 WB10-R CCAGAGTCCAAGACGATACCAGTG PP355-F GTTGTCCGAGTTGTAATTTC rDNA PP356-R CCAATCGACCAAAGACGGGG ST625-F GCCGAAGTCTCAAACGATGC mei4 ST626-R AAGGGGGAAGAGGGGGTTTA WB473-F AATACGACTCACTATAGGGCGAATTG K"-mini WB474-R ATCGTCACAGTTTACAAATTCGGT WB471-F ATCATTCAGAAAATCACCGGAGCAAT K"-imr WB472-R CACTTTGCAACGATTACCGGTTTA q-spd1-5'-F AGTAGCAAACGCTCCCACAA spd1-5' q-spd1-5'-R GGTCATAACTCGCTTGCTGC q-spd1-GB-F CTGCCTATAACCCACCGCTT spd1-cds q-spd1-GB-R TGCTCGAATGGACGCTTAGT q3.2-F TACCAATCTTTGCGCTATCC H3-T7 qT7-R GTCCACCAGTCATGCTTGCC PP446-F AAGCTTACCCAAGTACATGCCA NCIS1 PP447-R CAGCCGCCGCTAGTATGATTA PP468-F TTGAGAGACAGGAAACGGCA NCIS2 PP469-R TCTCAGCAATTGGAAAAATAGTCGT PP450-F AGTTTAGAGCATGAAGCATGCAG NCIS3 PP451-R TCGTATTCCAAAAGCTTAGTTTGCT PP456-F GGGAAAGTCGGTGTTTATGAATGG NCIS4 PP457-R CCAACCCCTAAACTAGCCGT cnp1-1-F TGAAGCGTTCTTGGTTCATCTA cnp1 cnp1-1-R ACGAATCCTCCTGGCTAATTG cnp3-1-F GGAAGATGAAGGAACCGCTG cnp3 cnp3-1-R ATCATCCTTGGGCGTAGAGG PP490-F GACGCCATATTGAAACGACTGG eic1 PP491-R CGCGAAATCGCAGTACAAGT PP494-F GTGAATCGCACGCGTTCATAA eic2 PP495-R GCTTCTTCAGCTCGCAATGG PP508-F ACAGATCAGCGTGGTTTGGAT scm3 PP509-R AGGGTTCCTTCTTCTCGGTG bioRxiv preprint doi: https://doi.org/10.1101/778639; this version posted September 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S5. List of primers used in the study (continued)

Locus Primer name Sequence PP488-F TGCCTTAGGAGCATGGCAAA sim3 PP489-R GTGCTATCCGCAATGAGGGA PP482-F TTGGAGGCTGTACTCAAGGAAG sim4 PP483-R CCTGCTGTTTTTGCCGTTCA PP514-F AGCTCGTCATATTCGCTTGAAGA mis6 PP515-R GCTTTTAAGAACGGCCGCAA PP498-F TGCCTTAGGAGCATGGCAAA mis15 PP499-R GTGCTATCCGCAATGAGGGA PP478-F TCGCTACCATGGGAGAAGGA mis16 PP479-R TGGCCCTTCAAAACTGCTTG PP502-F AGGCTGTCATCTCTCGACTCA mis17 PP503-R AGCAATTCGCTCTTCAGGGG PP512-F ACGGAAACTAGTCATTCGGGC mis18 PP513-R AACCCAAGCATTAGAATCACCAAC