Supplementary Material

SUPPLEMENTARY MATERIAL

Supplemental Methods

CNV validation

Validation by quantitative real-time polymerase chain reaction (qPCR) was performed using

TaqMan assays (ThermoFisher Scientific, Waltham, MA, USA). Genomic DNA was extracted from one 3-mm dried blood spot,1 diluted 1:10 in water, and amplified using TaqMan

Environmental Master Mix in 5 µl reaction volumes. A fragment of the RNaseP H1 RNA gene was co-amplified and used as an internal control (TaqMan Copy Number Reference Assay).

Assays were run in quadruplicate on either an Applied Biosystems (ABI) 7900HT or an ABI

QuantStudio PCR system (ThermoFisher Scientific). CopyCaller software version 2.0

(ThermoFisher Scientific) was used to analyze the real-time data using relative quantitation (2-

ΔΔCt method). The manual Ct threshold was set to 0.2 with the automatic baseline on.

CopyCaller software parameters were as follows: the median ΔCt for each experiment was used as the calibrator, wells with an RNaseP Ct > 38 were excluded and the zero copy ΔCt threshold was set to six. The average copy number and a software-generated confidence value were calculated for each subject. Copy-number results with confidence values ≥ 0.95 were considered valid; results with confidence values < 0.95 were re-run in quadruplicate.

Targeted sequencing of SHFM candidate genes

A custom panel targeting the coding regions and exon-intron boundaries of 49 SHFM candidate genes was designed using the Ion AmpliSeq Designer tool version 2.2.1 with the “standard DNA

(225-bp amplicon target sizes)” and “Gene + UTR” options. Two primer pools were used to 2 amplify 1068 amplicons, covering 49 target genes, totaling 174.12 kb. DNA was quantified using an RNaseP TaqMan assay on an ABI 7900HT PCR System (TaqMan RNaseP Control).

Libraries were constructed using 500 pg DNA for dried blood spot specimens or 1 ng for buccal specimens, one AmpliSeq primer pool (per reaction), and AmpliSeq library kit 2.0.

Amplification was carried out on a GeneAmp PCR System 9700 (ThermoFisher Scientific) for

21 cycles. Reaction-specific primers were removed using FuPa reagent. AmpliSeq PCR products from each subject were ligated to P1 adapters and barcodes using IonXpress Barcode

Adapter kits. Barcoded libraries were quantified by qPCR using the Ion Library Quantitation

Kit. Purified libraries were sequenced by the Applied Genomics Technologies Core at the

Wadsworth Center, New York State (NYS) Department of Health. Purified libraries were diluted to 100 pM and pooled. Template preparation was done on the Ion OneTouch system using the Ion OT 200 Template kit version 2, DL. Amplified Libraries were sequenced on Ion

318 or 318C chips using an Ion Personal Genome Machine sequencer (ThermoFisher Scientific).

Specimens were run in three batches. The total aligned output for each of the three runs was 451 megabases over 3.9 million reads (14 test specimens, 4 in duplicate, 318C chip), 1 gigabase over 6.9 million reads (13 test specimens, 318 chip), and 737 megabases over 5 million reads (14 test specimens, 1 in duplicate, 318C chip), respectively. Over all runs, coverage uniformity (defined as base coverage at > 20% mean coverage) was 83.7% and the proportion of on-target bases (proportion of bases mapping to target regions out of total mapped bases per run) was 70.4%, which is consistent with manufacturer specifications. Two NYS specimens from the first run failed (mean read depth 6.5 and 1.2) and were excluded from sequence data analysis and the statistics that follow. The mean (± standard deviation; range) value for number of mapped reads per specimen was 313,681 (±111 023; 122 454 – 808 721), for read depth was 191 X (± 94 3

X; 50 X-588 X), for percentage of bases that had ≥ 20 X coverage was 85.3% (± 12.5%; 41.9%-

92.6%), and for percentage of bases that had ≥ 100 X coverage was 64.2% (± 24.7%; 11.1%-

87.3%).

Panel information was imported into Torrent Suite software (version 4.2) for data analysis. Signal processing and base calling were carried out using the default base caller parameters. Sequence data were aligned and mapped to a reference human genome sequence file using the Torrent Mapping Alignment Program (version 2.18) which is optimized for Ion Torrent data. Variants were called using Ion Torrent Variant Caller (version 4.2-18) with selection of default parameters for “PGM - Germ Line - Low Stringency”. Also, the following parameter changes were applied: minimum coverage on either strand = 2 for SNP and INDEL; downsample_to_coverage = 400; do_snp_realignment = 0; mnp_min_cov_each_strand = 2; output_mnv = 1; allow_complex = 1. The variant call format (VCF) files generated for each

DNA specimen were merged using the bcftools merge function (bcftools_merge version1.2+htslib-1.2.1; https://github.com/samtools/bcftools). Prior to annotating variants with

ANNOVAR,2 variants were decomposed and left-aligned as recommended by ANNOVAR documentation. Multi-allelic variants were decomposed using the vcfbreakmulti function in the vcflib program (https://github.com/vcflib/vcflib), and variants were left-aligned using the normalize function in vt software (version vt-0.57; https://github.com/atks/vt). Variants were then annotated using the table_annovar function in ANNOVAR.

Validation of selected sequence variants

Sanger sequencing was used to validate the selected sequence variants, as previously described, with minor modifications.3 Primer sequences were selected using Primer Designer Tool 4

(Thermo Fisher Scientific). Primer identification numbers or sequences, and PCR conditions used, are provided in Supplementary Table S2. PCR reactions contained extracted DNA, DNA

Master HybProbe master mix (Roche Applied Science, Indianapolis, IN, USA), 1 unit Taq antibody (Clontech, Mountain View, CA, USA), 2.5 mM MgCl2, and 0.2 µM each primer, in a total volume of 25 µl. Standard cycling conditions included an initial denaturation at 95°C for 5 minutes, 35 cycles of denaturation at 95°C for 30 seconds, annealing at the specified annealing temperature for 30 seconds, elongation at 72°C for 30 seconds, and a final extension at 72°C for

5 minutes. PCR products were cleaned up using ExoSAP-IT (USB Corporation, Cleveland, OH,

USA), and sequenced using BigDye Terminator v.3.1 Cycle Sequencing chemistry kits (Thermo

Fisher Scientific) on an ABI 3730 DNA Analyzer (Thermo Fisher Scientific). Sequence chromatograms were analyzed using SeqScape version 2.1.1 (Thermo Fisher Scientific) and

FinchTV version 1.4.0 (Geospiza, Seattle, WA, USA). 5

Supplementary Figure S1 Infinium HumanOmni2.5-4 microarray results for the chromosome 10q24 region. Images of copy-gain region for patient 1, and image of the same 10q24 region for a control subject. Bottom panel: genes located in or near the copy-gain region. 6

Supplementary Figure S2 Infinium HumanOmni2.5-4 microarray results for the chromosome 17p13.3 region. Images of copy-gain regions for patients 2, 3, and 4, and image of the same 17p13.3 region for a control subject. Bottom panel: genes located in or near the copy-gain region.

Supplementary Figure S3 Infinium HumanOmni2.5-4 microarray results for the chromosome 17q25 region. Images of copy-loss region for patient 16, and image of the same 17q25 region for a control subject. Bottom panel: genes located in or near the copy-loss region. 8

TP63 p.R225H TP63 p.R225L TP63 p.P417T EVX2 p.A472T HOXD12 p.N237T

HOXD11 p.G245D HOXD10 p.L57P HOXD3 p.G42S HOXD1 p.G218R FGFR1 p.P283S

ROR2 p.D895G POLL p.E498K CDH3 p.R175W CDH3 p.M269L

Supplementary Figure S4 Electropherograms from Sanger sequencing showing 14 validated, non-synonymous mutations in candidate genes for split hand/foot malformation. The mutations were detected in 11 cases with split hand/foot malformation. 10

Supplementary Figure S5 Evolutionary conservation of the tumor protein p63 (TP63) amino acid sequence. (a) The conserved R225 amino acid in the DNA-binding domain. (b) Proline-rich region showing conservation of the proline at position 417. Prolines at other positions are marked in blue.

Supplementary Figure S6 Expression of genes located in the chromosome 17q25 region (chr17:73105000-73428037; GRCh37/hg19 assembly) in human limb buds at embryonic day 44. Gene expression (RNA-seq) data were generated by Cotney et al.4 To view the gene expression data in the University of California at Santa Cruz (UCSC) Genome Browser,5 RNA-seq BAM files were converted to bigWig files using the Galaxy software platform.6-8

Supplementary Figure S7 Expression of genes located in the LBX1-FGF8 region (chr10:102900967-103550000; GRCh37/hg19 assembly) in human limb buds at embryonic day 44. Gene expression (RNA-seq) data were generated by Cotney et al.4 13

Supplementary Figure S8 Expression of genes located in the ABR-TUSC5 region (chr17:900000-1250000; GRCh37/hg19 assembly) in human limb buds at embryonic day 44. Gene expression (RNA-seq) data were generated by Cotney et al.4 14

Supplementary Figure S9 Alignment of predicted enhancers with peaks of histone H3K27ac modifications in the chromosome 10q24 region in human limb buds. The depicted region spans chr10:102900967-103550000 (GRCh37/hg19 assembly). Shaded areas 15 show the alignment of the predicted enhancers, previously determined to be conserved non-coding elements,9,10 with peaks of evolutionary conservation (based on multiple alignment of the genomes of 100 vertebrates using the PhyloP method) and peaks of histone H3K27ac modification detected by chromatin immunoprecipitation in human limb buds at embryonic day 33 (E33), E41, E44, and E47. Genomic coordinates for the predicted enhancers are provided in Supplementary Table S9. The histone H3K27ac modification (ChIP-seq) data were generated by Cotney et al.4

Supplementary Figure S10 Evolutionarily conserved gene order at the 17p13.3 region associated with split hand/foot malformation. The ABR, BHLHA9, and TUSC5 genes are depicted in blue, red, and green, respectively, in five vertebrates. The GenBank accession numbers of the genome assemblies used were GRCh38.p7 GCF_000001405.33 for Homo sapiens, GRCm38.p4 GCF_000001635.24 for Mus musculus, Bos_taurus_UMD_3.1.1 GCF_000003055.6 for Bos taurus, Gallus_gallus-5.0 GCF_000002315.4 for Gallus gallus, and Xtropicalis_v9.1 GCF_000004195.3 for Xenopus tropicalis.

Supplementary Figure S11 Putative regulatory elements located in the Abr-Tusc5 genomic region at chr11:76220000-76550000 (NCBI37/mm9 assembly) in mouse E11.5 limb buds. Data are presented for forelimb and hindlimb buds. The E11.5 stage was chosen because digit development occurs during this stage.11 The shaded areas indicate overlap of histone H3K27ac modification and peaks of evolutionary conservation (based on multiple alignment of the genomes of 30 vertebrates using the PhyloP method) in non-coding regions. The overlap with DNase I hypersensitivity sites (DNase I HS), representing open chromatin, is also presented. In addition, the expression of genes in the Abr-Tusc5 interval is shown. The histone H3K27ac modification (ChIP-seq) data and gene expression (RNA-seq) data were generated by Cotney et al.4 and DeMare et al.12 Data on DNase I hypersensitivity sites in mouse E11.5 limb buds (generated by the Mouse Encyclopedia of DNA Elements Consortium)13 were accessed through the UCSC Genome Browser.

Supplementary Table S1 Candidate split hand/foot malformation genes selected for targeted sequencing

% of targeted Reference for bases with 20x gene’s coverage Entrez Nature of gene’s association (mean ± SD; Gene Gene ID OMIM14 ID Gene name association with SHFM with SHFM min - max)1 BHLHA9 727857 615416 Basic helix-loop-helix Located in a CNV detected 0.00 ± 0.00; 15 family member a9 in SHFM cases 0.00 – 0.00 BMP2 650 112261 Bone morphogenetic Gene inactivation resulted in 83.62 ± 11.12; protein 2 reduced number of digits in 16 47.15 – 93.79 animal model BMP4 652 112262 Bone morphogenetic Gene inactivation resulted in 93.58 ± 12.61; protein 4 reduced number of digits in 16 56.48 – 100.00 animal model BMP7 655 112267 Bone morphogenetic Gene inactivation resulted in 77.35 ± 11.25; protein 7 reduced number of digits in 16 44.31 – 89.36 animal model BTRC 8945 603482 Beta-transducin repeat Located in a CNV detected 91.55 ± 7.33; containing E3 ubiquitin in SHFM cases 17 57.18 – 95.60 protein ligase CDH3 1001 114021 Cadherin 3 Mutations detected in SHFM 96.35 ± 9.43; 18 cases 51.19 – 100.00 DLX5 1749 600028 Distal-less homeobox 5 Chromosomal 92.80 ± 16.23; rearrangements near gene 19,20 36.94 – 100.00 detected in SHFM cases DLX6 1750 600030 Distal-less homeobox 6 Chromosomal 76.34 ± 13.69; rearrangements near gene 19,20 31.41 – 95.31 detected in SHFM cases

Supplementary Table S1 – continued % of targeted Reference for bases with 20x gene’s coverage Entrez Nature of gene’s association (mean ± SD; Gene Gene ID OMIM14 ID Gene name association with SHFM with SHFM min - max)1 DPCD 25911 616467 Deleted in primary Located in a CNV detected 91.9 ± 15.45; ciliary dyskinesia in SHFM cases 17 26.25 – 100.00 homolog (mouse) DYNC1I1 1780 603772 Dynein cytoplasmic 1 Chromosomal 87.81 ± 8.55; intermediate chain 1 rearrangements near gene 19,20 54.75 – 94.80 detected in SHFM cases EVX2 344191 142991 Even-skipped homeobox Chromosomal 65.18 ± 9.29; 2 rearrangements near gene 21 44.94 – 70.00 detected in SHFM cases FBXW4 6468 608071 F-box and WD repeat Located in a CNV detected 87.55 ± 5.50; 17 domain containing 4 in SHFM cases 61.04 – 89.87 FGF8 2253 600483 Fibroblast growth factor Chromosomal 74.50 ± 15.99; 8 rearrangements near gene 22 28.60 – 81.77 detected in SHFM cases FGFR1 2260 136350 Fibroblast growth factor Mutations detected in SHFM 82.96 ± 9.18; 23 receptor 1 cases 52.45 – 90.03 HOXD1 3231 142987 Homeobox D1 Chromosomal 59.83 ± 13.91; rearrangements near gene 21 25.04 – 75.11 detected in SHFM cases HOXD3 3232 142980 Homeobox D3 Chromosomal 87.90 ± 12.91; rearrangements near gene 21 41.95 – 96.36 detected in SHFM cases HOXD4 3233 142981 Homeobox D4 Chromosomal 65.22 ± 12.99; rearrangements near gene 21 27.25 – 85.00 detected in SHFM cases 21

Supplementary Table S1 – continued % of targeted Reference for bases with 20x gene’s coverage Entrez Nature of gene’s association (mean ± SD; Gene Gene ID OMIM14 ID Gene name association with SHFM with SHFM min - max)1 HOXD8 3234 142985 Homeobox D8 Chromosomal 59.06 ± 8.78; rearrangements near gene 21 33.60 – 63.91 detected in SHFM cases HOXD9 3235 142982 Homeobox D9 Chromosomal 73.51 ± 7.02; rearrangements near gene 21 54.15 – 79.12 detected in SHFM cases HOXD10 3236 142984 Homeobox D10 Chromosomal 89.73 ± 9.96; rearrangements near gene 21 57.63 – 100.00 detected in SHFM cases HOXD11 3237 142986 Homeobox D11 Chromosomal 62.49 ± 8.47; rearrangements near gene 21 35.48 – 66.25 detected in SHFM cases HOXD12 3238 142988 Homeobox D12 Chromosomal 79.68 ± 7.44; rearrangements near gene 21 53.34 – 82.89 detected in SHFM cases HOXD13 3239 142989 Homeobox D13 Chromosomal 78.24 ± 12.47; rearrangements near gene 21 32.75 – 84.60 detected in SHFM cases LBX1 10660 604255 Ladybird homeobox 1 Located in a CNV detected 46.99 ± 2.57; 17 in SHFM cases 35.46 – 50.21 LRP6 4040 603507 LDL receptor-related Gene inactivation resulted in 94.70 ± 8.49; protein 6 reduced number of digits in 24 62.01 – 98.60 animal model POLL 27343 606343 Polymerase (DNA) Located in a CNV detected 91.46 ± 8.92; 17 lambda in SHFM cases 51.58 – 95.43 22

Supplementary Table S1 – continued % of targeted Reference for bases with 20x gene’s coverage Entrez Nature of gene’s association (mean ± SD; Gene Gene ID OMIM14 ID Gene name association with SHFM with SHFM min - max)1 ROR2 4920 602337 Receptor tyrosine Mutations detected in patient 88.94 ± 7.43; kinase-like orphan with autosomal recessive 53.01 – 91.51 receptor 2 Robinow syndrome (MIM 25 268310); patient’s phenotype included congenitally missing digits SHFM1 7979 183600 Split hand/foot Chromosomal 97.61 ± 5.54; malformation rearrangements near gene 19,20 82.30 – 100.00 (ectrodactyly) type 1 detected in SHFM cases SHH 6469 600725 Sonic hedgehog Gene inactivation resulted in 58.03 ± 4.14; reduced number of digits in 26 42.76 – 62.26 animal model SLC25A13 10165 603859 Solute carrier family 25 Chromosomal 85.97 ± 9.65; member 13 rearrangements near gene 19,20 51.74 – 92.97 detected in SHFM cases SNX3 8724 605930 Sorting nexin 3 Mutations detected in SHFM 85.69 ± 10.98; 27 cases 55.54 – 91.41 TP63 8626 603273 Tumor protein p63 Mutations detected in SHFM 95.17 ± 6.87; 28 cases 63.76 – 98.08 TUSC5 286753 612211 Tumor suppressor Located in a CNV detected 94.77 ± 9.77; 15 candidate 5 in SHFM cases 63.60 – 100.00 TWIST1 7291 601622 Twist family bHLH Gene inactivation resulted in 62.01 ± 2.10; transcription factor 1 failure of maintenance of the 50.97 – 62.48 29 apical ectodermal ridge in the limb bud in animal model 23

Supplementary Table S1 – continued % of targeted Reference for bases with 20x gene’s coverage Entrez Nature of gene’s association (mean ± SD; Gene Gene ID OMIM14 ID Gene name association with SHFM with SHFM min - max)1 WNT5A 7474 164975 Wnt family member 5A Mutations detected in 88.95 ± 10.46; patients with autosomal 54.72 – 93.68 dominant Robinow syndrome (MIM 180700); 30,31 some patient phenotypes included congenitally missing or shortened digits WNT10B 7480 601906 Wnt family member Mutations detected in SHFM 81.50 ± 6.10; 32 10B cases 66.25 – 94.05 Abbreviations: CNV, copy-number variant; max, maximum; min, minimum; OMIM; Online Mendelian Inheritance in Man; SHFM, split hand/foot malformation; SD, standard deviation. 1Coverage for sequencing of coding regions and exon-intron boundaries. Coverage excludes two failed samples and duplicates.

Supplementary Table S2 Conditions used for Sanger sequencing of selected variants

Annealing Amplicon temperatue PCR reagents or cycling Gene Exon Primer identification number or sequence1 size (bp) (°C) condition differences F - 5' GCCCTTTTAGGAGGAAGCGT 3' TP63 5 R- 5' AGCACAAAGGACAAGCTCTC 3' 355 65 N/A F - 5' GGCTGGTAGTTTAGGCCCTT 3' TP63 10 R- 5' GAAGGCGAGGGAAACAGACA 3' 508 65 N/A 50 cycles, 1:2 diluted DNA, EVX2 3 Hs00485092_CE 491 68 1M betaine & 5% DMSO F - 5' GAAGCGGAAACCCTACACGA 3' HOXD12 2 R- 5' AGCAGAGAAGGAACCGAAGG 3' 313 63 N/A 40 cycles, HOXD11 1 Hs00201799_CE 523 68 1M betaine & 5% DMSO HOXD10 1 Hs00201803_CE 507 60 N/A HOXD3 2 Hs00761460_CE 266 TD-PCR TD-PCR HOXD1 1 Hs00721702_CE 266 60 N/A FGFR1 8 Hs00829019_CE 244 60 N/A ROR2 9 Hs00380790_CE 500 68 40 cycles & 1M betaine POLL 9 Hs00323151_CE 495 68 40 cycles & 1M betaine F - 5' TTGCTACTGAATGTGGGGGC 3' CDH3 5 R- 5' GGGCTTGTGGTCATTCTGGT 3' 504 65 0.1 µM each primer CDH3 7 Hs00700333_CE 262 68 40 cycles & 1M betaine Abbreviations: DMSO, dimethyl sulfoxide; N/A, not applicable; PCR, polymerase chain reaction; TD-PCR, touchdown polymerase chain reaction. 1Identification numbers are for proprietary assays from ThermoFisher Scientific.

Supplementary Table S3 Comparison of characteristics between New York State split hand/foot malformation cases and live births in 1998-2005

Split hand/foot New York State live malformation cases births (n = 25) (n = 2 023 049) Characteristic n (%) n (%) P1 Maternal age (years) 0.99 < 20 2 (8.0) 157 085 (7.8) 20-34 18 (72.0) 1 480 911 (73.2) ≥ 35 5 (20.0) 384 744 (19.0) Unknown 0 (0.0) 309 (0.0)

Maternal race 0.31 White, non-Hispanic 12 (48.0) 1 051 561 (52.0) African-American 8 (32.0) 361 836 (17.9) Hispanic 4 (16.0) 437 846 (21.6) Asian 0 (0.0) 135 374 (6.7) Other 1 (4.0) 31 220 (1.5) Unknown 0 (0.0) 5 212 (0.3)

Maternal education (years) 0.91 < 12 years 4 (16.0) 384 781 (19.0) 12 years 8 (32.0) 594 659 (29.4) > 12 years 13 (52.0) 1 017 827 (50.3) Unknown 0 (0.0) 25 782 (1.3)

Parity 0.67 Nulliparous 12 (48.0) 846 801 (41.9) Multiparous 13 (52.0) 1 176 248 (58.1)

Maternal smoking during pregnancy 0.11 Yes 5 (20.0) 180 292 (8.9) No 20 (80.0) 1 842 757 (91.1)

Infant sex 0.68 Male 15 (60.0) 1 036 825 (51.3) Female 10 (40.0) 986 210 (48.7) Unknown 0 (0.0) 14 (0.00)

1Chi-squared test used to compare characteristics between New York State split hand/foot malformation cases and live births.

Supplementary Table S4 Results of qPCR for validation of copy-number variants at chromosome 10q24, 17p13.3, and 17q25

Copy- Copy-number at target locus2 number Assay Target locus variant Gene or intergenic identification (GRCh37/hg19 Patient Patient 26 Patient Patient Patient Patient 1 region region number assembly) 1 (Iowa case) 2 3 4 16 10q24 LBX1 Hs02211191_cn chr10:102987070 3 3 2 2 2 2 Intergenic region Hs03765366_cn chr10:103055355 3 3 2 2 2 2 between LBX1 and BTRC BTRC Hs03748645_cn chr10:103193075 3 3 2 2 2 2 Intergenic region Hs03750581_cn chr10:103322115 3 3 2 2 2 2 between BTRC and POLL POLL Hs03739501_cn chr10:103341087 3 3 2 2 2 2 FBXW4 Hs03759550_cn chr10:103374091 3 3 2 2 2 2 17p13.3 Intergenic region Hs03963258_cn chr17:1132429 2 2 3 3 3 2 between ABR and BHLHA9 TUSC5 Hs00205983_cn chr17:1183567 2 2 3 2 3 2 YWHAE Hs03975636_cn chr17:1249076 2 2 3 3 2 2 17q25 SUMO2 Hs04471442_cn chr17:73164615 2 2 2 2 2 1 GGA3 Hs03964609_cn chr17:73243973 2 2 2 2 2 1 GRB2 Hs04466046_cn chr17:73398602 2 2 2 2 2 1 Abbreviation: qPCR, quantitative polymerase chain reaction. 1Identification number of proprietary assay from ThermoFisher Scientific. 2Copy-number values are shown in bold for patients with copy-number variation at the target locus.

Supplementary Table S5 Genes located within the breakpoints of the chromosome 17q25 microdeletion

Gene Entrez OMIM encodes Gene function Gene Gene ID ID Gene name protein? (Reference) ARMC7 79637 NA Armadillo repeat containing Yes Unknown 7 NT5C 30833 191720 5', 3'-nucleotidase, cytosolic Yes Nucleotidase that dephosporylates 5' deoxyribonucleotides and 2'(3')- deoxyribonucleotides and ribonucleotides 33 HN1 51155 NA Hematological and Yes Unknown neurological expressed 1 SUMO2 6613 603042 Small ubiquitin-like Yes Binds target proteins to facilitate post- modifier 2 translational modification and regulation of the functions of target proteins; targets are a wide variety of proteins involved in different cellular processes 34 NUP85 79902 170285 Nucleoporin 85 Yes Component of the nuclear pore complex that allows exchange of macromolecules between the cytoplasm and nucleus 35 GGA3 23163 606006 Golgi associated, gamma Yes Mediates intracellular trafficking of proteins adaptin ear containing, ARF from the trans-Golgi network to the binding protein 3 endosome/lysosome system 36 MRPS7 51081 611974 Mitochondrial ribosomal Yes Component of the 28S subunit of protein S7 mitochondrial ribosomal proteins that function in protein synthesis 37 MIF4GD 57409 612072 MIF4G domain containing Yes Interacts with the stem-loop binding protein and the 3’ end of histone mRNA to promote 28

histone mRNA translation 38 LOC100287042 100287042 NA Uncharacterized No Unknown LOC100287042 SLC25A19 60386 606521 Solute carrier family 25 Yes Transports thiamine pyrophosphates into member 19 mitochondria 39 GRB2 2885 108355 Growth factor receptor Yes Interacts with receptor tyrosine kinase bound protein 2 complexes to facilitate signal transduction by those complexes 40 Abbreviations: NA, Not Available; OMIM, Online Mendelian Inheritance in Man.

Supplementary Table S6 Predicted functional effects of protein coding variants in patients with split hand/foot malformation

Prediction algorithms (References) Likelihood Mutation Mutation Logistic Protein SIFT POLYPHEN2 Ratio Test Taster Assessor FATHMM RadialSVM Regression Gene change 41 42 43 44 45 46 47 47 TP63 p.R225H Deleterious Probably Deleterious Disease Medium Deleterious Deleterious Deleterious damaging causing functional impact TP63 p.R225L Deleterious Probably Deleterious Disease Medium Deleterious Deleterious Deleterious damaging causing functional impact TP63 p.P417T Deleterious Probably Deleterious Disease Low Deleterious Deleterious Deleterious damaging causing functional impact EVX2 p.A472T Tolerated Benign Neutral Polymorphism Neutral Deleterious Tolerated Tolerated HOXD12 p.N237T Deleterious Probably Deleterious Disease Neutral Deleterious Tolerated Tolerated damaging causing HOXD11 p.G245D Tolerated Probably Unknown Polymorphism Neutral Deleterious Tolerated Deleterious damaging HOXD10 p.L57P Tolerated Benign Deleterious Disease Medium Tolerated Tolerated Tolerated causing functional impact HOXD3 p.G42S Tolerated Benign Neutral Polymorphism Neutral Deleterious Tolerated Tolerated HOXD1 p.G218R Tolerated Benign Neutral Disease Low Deleterious Tolerated Deleterious causing functional impact FGFR1 p.P283S Tolerated Benign Deleterious Disease Low Tolerated Tolerated Tolerated causing functional impact ROR2 p.D895G Tolerated Benign Neutral Disease Neutral Tolerated Tolerated Tolerated causing POLL p.E498K Deleterious Possibly Deleterious Disease Medium Tolerated Tolerated Tolerated 30

damaging causing functional impact CDH3 p.R175W Deleterious Probably Neutral Disease Medium Tolerated Deleterious Tolerated damaging causing functional impact CDH3 p.M269L Tolerated Benign Deleterious Disease Neutral Tolerated Tolerated Tolerated causing

Supplementary Table S7 Chromosome 10q24 copy-number gains reported in patients with SHFM phenotypes

Human genome SHFM patient/family CNV breakpoints assembly Reference Dimitrov 2010, Family F1 chr10:102965299-103498069 hg18 48 Dimitrov 2010, Family F2 chr10:102969344-103498069 hg18 48 Dimitrov 2010, Family F3 chr10:102900770-103498069 hg18 48 Dimitrov 2010, Family F4 chr10:102870153-103528589 hg18 48 Filho 2011, Family chr10:102942925-103481863 hg18 49 Dai 2013, Patient II:5 chr10:102911736-103169477 hg18 50 chr10:103334900-103449414 Dai 2013, Patient III:9 chr10:102911736-103170849 hg18 50 chr10:103324414-103449414 Dai 2013, Patient III:10 chr10:102911736-103169477 hg18 50 chr10:103332499-103449414 Dai 2013, Patient IV:3 chr10:102911736-103159334 hg18 50 chr10:103334900-103449414 Ockeloen 2013, Child chr10:102840000-103440000 hg18 51 Chen 2014, Patient chr10:102955122-103348688 hg19 52 Li 2015, Patient 1 chr10:102962134-103476346 hg19 53 This report, Patient 1 chr10:102969972-103452645 hg19 This report DECIPHER 249450 chr10:101711724-104823513 hg19 DECIPHER database1 DECIPHER 249514 chr10:101711724-104823513 hg19 DECIPHER database1 DECIPHER 249629 chr10:101711724-103398603 hg19 DECIPHER database1 DECIPHER 259243 chr10:102936862-103431400 hg19 DECIPHER database1 DECIPHER 261018 chr10:102969339-103407534 hg19 DECIPHER database1 DECIPHER 261574 chr10:102948861-103428862 hg19 DECIPHER database1 DECIPHER 283763 chr10:102969369-103454514 hg19 DECIPHER database1 DECIPHER 323950 chr10:102964512-103392503 hg19 DECIPHER database1 Abbreviations: CNV, copy-number variant; SHFM, split hand/foot malformation. 1Patients were selected from the DECIPHER database 54 if they had a copy-number variant in the chromosome 10q24 region and their phenotype description included congenitally missing digits or SHFM.

Supplementary Table S8 Chromosome 17p13.3 copy-number variants reported in patients with SHFM phenotypes

Human genome SHFM patient/family CNV breakpoints assembly Reference Armour 2011, Family 1 chr17:956201-1210473 hg18 55 Armour 2011, Family 2 chr17:629839-1156497 hg18 55 Armour 2011, Family 3 chr17:698753-1128916 hg18 55 Klopocki 2012, Family 1 chr17:745486-1340012 hg19 15 Klopocki 2012, Family 2 chr17:743947-1179687 hg19 15 Klopocki 2012, Family 3 chr17:850433-1197718 hg19 15 Klopocki 2012, Family 4 chr17:879173-1148448 hg19 15 Klopocki 2012, Family 5 chr17:1104999-1203282 hg19 15 Klopocki 2012, Family 6 chr17:904273-1172214 hg19 15 Klopocki 2012, Family 7 chr17:904273-1170156 hg19 15 Klopocki 2012, Family 8 chr17:919063-1134823 hg19 15 Klopocki 2012, Family 9 chr17:951149-1214380 hg19 15 Klopocki 2012, Family 10 chr17:984289-1163868 hg19 15 Klopocki 2012, Family 11 chr17:997565-1126676 hg19 15 Klopocki 2012, Family 12 chr17:1068785-1144275 hg19 15 Klopocki 2012, Family 13 chr17:1077326-1170156 hg19 15 Klopocki 2012, Family 14 chr17:1084390-1219310 hg19 15 Klopocki 2012, Family 15 chr17:1101066-1245760 hg19 15 Klopocki 2012, Family 16 chr17:1092185-1203023 hg19 15 Klopocki 2012, Family 17 chr17:1117153-1186524 hg19 15 Petit 2013, Patient 1 chr17:908011-1195508 hg18 56 Petit 2013, Patient 2 chr17:849124-1195508 hg18 56 Curry 2013, Patient 6 chr17:1039126-1491785 hg18 57 Petit 2014, Family 12 chr17:1073830-1292325 hg19 58 Petit 2014, Family 13 chr17:1130573-1270478 hg19 58 Al Kaissi 2014, Child chr17:959647-1223259 hg19 59 Nagata 2014, 27 Families chr17:1069645-1279669 hg19 60,61 and Child Gu 2016, Family chr17:1108991-1287852 hg19 62,63 chr17:2311706-2427035 This report, Patient 2 chr17:1087227-1267395 hg19 This report This report, Patient 3 chr17:1098724-1263590 hg19 This report This report, Patient 4 chr17:1114910-1211121 hg19 This report DECIPHER 273517 chr17:1061693-1333308 hg19 DECIPHER database1 DECIPHER 2827512 chr17:87009-1113161 hg19 DECIPHER database1 DECIPHER 288871 chr17:1053878-1159220 hg19 DECIPHER database1

Abbreviations: CNV, copy-number variant; SHFM, split hand/foot malformation. 1Patients were selected from the DECIPHER database 54 if they had a copy-number variant in the chromosome 17p13.3 region and their phenotype description included congenitally missing digits or SHFM. 2Patient had a copy-number loss. All other patients had copy-number gains.

Supplementary Table S9 Predicted enhancers located at chromosome 10q24 and shown to drive reproducible patterns of reporter gene expression in transgenic mouse embryos

Enhancer identification Enhancer location number (GRCh37/hg19 assembly)1 Reference CE1 chr10:102978710-102979710 10 CE14 chr10:103082206-103083110 10 CE38 chr10:103243510-103248845 10 CE46 chr10:103266131-103267978 10 CE49 chr10:103317923-103322010 10 CE54 chr10:103340594-103341510 10 CE58 chr10:103372320-103375910 10 CE59 chr10:103377031-103378121 10 CE60 chr10:103379512-103380521 10 CE61 chr10:103385752-103386910 10 CE62 chr10:103389098-103391256 10 CE63 chr10:103403137-103404326 10 CE64 chr10:103408591-103412557 10 CE66 chr10:103419826-103420748 10 CE68 chr10:103418424-103420653 10 CE69 chr10:103418424-103419410 10 CE71 chr10:103427910-103429199 10 CE72 chr10:103442052-103443986 10 CE73 chr10:103445864-103449913 10 CE75 chr10:103467310-103468710 10 CE76 chr10:103469376-103470776 10 CE77 chr10:103484671-103486280 10 CE78 chr10:103492110-103493610 10 CE79 chr10:103508510-103510010 10 CE80 chr10:103527010-103528710 10 CE81 chr10:103538010-103541585 9,10 CE83 chr10:103532874-103534481 9,10 AS071 chr10:103356749-103357337 64 1For predicted enhancers reported by Marinić et al.,10 we used the LiftOver tool in the UCSC Genome Browser5 to convert genomic coordinates from the NCBI36/hg18 assembly to the GRCh37/hg19 assembly.

Supplementary Table S10 Conserved non-coding elements that coincide with histone H3K27ac chromatin immunoprecipitation peaks in the 17p13.3 chromosomal region in human limb buds

DNase I Genomic PhastCons hyper- Transcription coordinates of Genomic Location of conservation sensitivity factor binding Element conserved non- coordinates of conserved non- score (100 site in site in number coding element1 H3K27ac peak1 coding element vertebrates) Conservation ENCODE2,4 ENCODE3,4 1 chr17:922833- chr17:922135- ABR intron 581-584 Mammals Yes MEF2A 922987 923464 2 chr17:934833- chr17:934189- ABR intron 316-505 Frog to No No binding 934975 935618 Mammals 3 chr17:950839- chr17:950168- ABR intron 413-570 Mammals Yes No binding 950987 951657 4 chr17:982046- chr17:981396- ABR intron 255-596 Fish to Yes POL2A 982256 982905 Mammals 5 chr17:991161- chr17:990751- ABR intron 407-544 Mammals Yes POLR2A, 991271 991770 TBP, ATF3, MAX, SMARCC1, ZNF263, GTF2F1, TFAP2A, TFAP2C, MYC, ZNF217, ESR1, GATA3, EP300, REST, JUN, FOXA1 6 chr17:1012132- chr17:1011310- ABR intron 408-647 Mammals Yes E2F1, 1012358 1013279 POLR2A, TFAP2X, 36

YY1, MAZ, ELF1 7 chr17:1057187- chr17:1056809- ABR intron 501-517 Frog to Yes RFX5, 1057281 1057800 Mammals ZNF263, TAF1, MXI1, USF1, RCOR1, REST, CEBPB, MYC, MAX, EGR1 8 chr17:1080436- chr17:1079756- ABR intron 511-592 Mammals Yes No binding 1080586 1081065 9 chr17:1130761- chr17:1129592- Intergenic 552-595 Mammals No No binding 1130927 1132080 between ABR and BHLHA9 10 chr17:1132407- chr17:1132087- Intergenic 527 Frog to Yes EZH2, 1132477 1132725 between ABR Mammals POLR2A, and BHLHA9 SUZ12, ELF1 11 chr17:1155572- chr17:1155474- Intergenic 316-578 Mammals Yes KAP1 1155815 1156313 between ABR and BHLHA9 12 chr17:1173635- chr17:1173266- Intergenic 586 Chicken to Yes EZH2 1173716 1173985 between ABR Mammals and BHLHA9 Abbreviations: ENCODE, Encyclopedia of DNA elements; H3K27ac, acetylation of lysine 27 of the H3 histone protein. 1GRCh37/hg19 assembly. 2DNase I hypersensitivity detected at conserved, non-coding site based on assays in 125 human cell types from ENCODE.65 These cell types were not derived from the developing limb. 3Transcription factors binding at the conserved, non-coding site based on chromatin immunoprecipitation (ChIP-seq) data for 161 transcription factors in 91 human cell types from ENCODE. These cell types were not derived from the developing limb. 4Data were accessed using the UCSC Genome Browser.

SUPPLEMENTARY REFERENCES

1. Saavedra-Matiz, C.A., Isabelle, J.T., Biski, C.K., Duva, S.J., Sweeney, M.L., Parker, A.L., et al. Cost-effective and scalable DNA extraction method from dried blood spots. Clin. Chem. 59, 1045-1051 (2013).

2. Wang, K., Li, M. & Hakonarson, H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 38, e164 (2010).

3. Rigler, S.L., Kay, D.M., Sicko, R.J., Fan, R., Liu, A., Caggana, M., et al. Novel copy-number variants in a population-based investigation of classic heterotaxy. Genet. Med. 17, 348-357 (2015).

4. Cotney, J., Leng, J., Yin, J., Reilly, S.K., DeMare, L.E., Emera, D., et al. The evolution of lineage-specific regulatory activities in the human embryonic limb. Cell 154, 185-196 (2013).

5. Rosenbloom, K.R., Armstrong, J., Barber, G.P., Casper, J., Clawson, H., Diekhans, M., et al. The UCSC Genome Browser database: 2015 update. Nucleic Acids Res. 43, D670-681 (2015).

6. Giardine, B., Riemer, C., Hardison, R.C., Burhans, R., Elnitski, L., Shah, P., et al. Galaxy: a platform for interactive large-scale genome analysis. Genome Res. 15, 1451-1455 (2005).

7. Goecks, J., Nekrutenko, A. & Taylor, J. Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol. 11, R86 (2010).

8. Blankenberg, D., Von Kuster, G., Coraor, N., Ananda, G., Lazarus, R., Mangan, M., et al. Galaxy: a web-based genome analysis tool for experimentalists. Curr. Protoc. Mol. Biol. Chapter 19, Unit 19 10 11-21 (2010).

9. Beermann, F., Kaloulis, K., Hofmann, D., Murisier, F., Bucher, P. & Trumpp, A. Identification of evolutionarily conserved regulatory elements in the mouse Fgf8 locus. Genesis 44, 1-6 (2006).

10. Marinic, M., Aktas, T., Ruf, S. & Spitz, F. An integrated holo-enhancer unit defines tissue and gene specificity of the Fgf8 regulatory landscape. Dev. Cell 24, 530-542 (2013).

11. Taher, L., Collette, N.M., Murugesh, D., Maxwell, E., Ovcharenko, I. & Loots, G.G. Global gene expression analysis of murine limb development. PLoS One 6, e28358 (2011).

12. DeMare, L.E., Leng, J., Cotney, J., Reilly, S.K., Yin, J., Sarro, R., et al. The genomic landscape of cohesin-associated chromatin interactions. Genome Res. 23, 1224-1234 (2013).

13. Stamatoyannopoulos, J.A., Snyder, M., Hardison, R., Ren, B., Gingeras, T., Gilbert, D.M., et al. An encyclopedia of mouse DNA elements (Mouse ENCODE). Genome Biol. 13, 418 (2012). 38

14. Hamosh, A., Scott, A.F., Amberger, J.S., Bocchini, C.A. & McKusick, V.A. Online Mendelian Inheritance in Man (OMIM), a knowledgebase of human genes and genetic disorders. Nucleic Acids Res. 33, D514-517 (2005).

15. Klopocki, E., Lohan, S., Doelken, S.C., Stricker, S., Ockeloen, C.W., Soares Thiele de Aguiar, R., et al. Duplications of BHLHA9 are associated with ectrodactyly and tibia hemimelia inherited in non-Mendelian fashion. J. Med. Genet. 49, 119-125 (2012).

16. Choi, K.S., Lee, C., Maatouk, D.M. & Harfe, B.D. Bmp2, Bmp4 and Bmp7 are co-required in the mouse AER for normal digit patterning but not limb outgrowth. PLoS One 7, e37826 (2012).

17. de Mollerat, X.J., Gurrieri, F., Morgan, C.T., Sangiorgi, E., Everman, D.B., Gaspari, P., et al. A genomic rearrangement resulting in a tandem duplication is associated with split hand-split foot malformation 3 (SHFM3) at 10q24. Hum. Mol. Genet. 12, 1959-1971 (2003).

18. Kjaer, K.W., Hansen, L., Schwabe, G.C., Marques-de-Faria, A.P., Eiberg, H., Mundlos, S., et al. Distinct CDH3 mutations cause ectodermal dysplasia, ectrodactyly, macular dystrophy (EEM syndrome). J. Med. Genet. 42, 292-298 (2005).

19. Lango Allen, H., Caswell, R., Xie, W., Xu, X., Wragg, C., Turnpenny, P.D., et al. Next generation sequencing of chromosomal rearrangements in patients with split-hand/split-foot malformation provides evidence for DYNC1I1 exonic enhancers of DLX5/6 expression in humans. J. Med. Genet. 51, 264-267 (2014).

20. Tayebi, N., Jamsheer, A., Flottmann, R., Sowinska-Seidler, A., Doelken, S.C., Oehl- Jaschkowitz, B., et al. Deletions of exons with regulatory activity at the DYNC1I1 locus are associated with split-hand/split-foot malformation: array CGH screening of 134 unrelated families. Orphanet J. Rare Dis. 9, 108 (2014).

21. Theisen, A., Rosenfeld, J.A., Shane, K., McBride, K.L., Atkin, J.F., Gaba, C., et al. Refinement of the Region for Split Hand/Foot Malformation 5 on 2q31.1. Mol. Syndromol. 1, 262-271 (2010).

22. Lyle, R., Radhakrishna, U., Blouin, J.L., Gagos, S., Everman, D.B., Gehrig, C., et al. Split- hand/split-foot malformation 3 (SHFM3) at 10q24, development of rapid diagnostic methods and gene expression from the region. Am. J. Med. Genet. A 140, 1384-1395 (2006).

23. Simonis, N., Migeotte, I., Lambert, N., Perazzolo, C., de Silva, D.C., Dimitrov, B., et al. FGFR1 mutations cause Hartsfield syndrome, the unique association of holoprosencephaly and ectrodactyly. J. Med. Genet. 50, 585-592 (2013).

24. Pinson, K.I., Brennan, J., Monkley, S., Avery, B.J. & Skarnes, W.C. An LDL-receptor- related protein mediates Wnt signalling in mice. Nature 407, 535-538 (2000).

25. Schwarzer, W., Witte, F., Rajab, A., Mundlos, S. & Stricker, S. A gradient of ROR2 protein stability and membrane localization confers brachydactyly type B or Robinow syndrome phenotypes. Hum. Mol. Genet. 18, 4013-4021 (2009). 39

26. Lewis, P.M., Dunn, M.P., McMahon, J.A., Logan, M., Martin, J.F., St-Jacques, B., et al. Cholesterol modification of sonic hedgehog is required for long-range signaling activity and effective modulation of signaling by Ptc1. Cell 105, 599-612 (2001).

27. Vervoort, V.S., Viljoen, D., Smart, R., Suthers, G., DuPont, B.R., Abbott, A., et al. Sorting nexin 3 (SNX3) is disrupted in a patient with a translocation t(6;13)(q21;q12) and microcephaly, microphthalmia, ectrodactyly, prognathism (MMEP) phenotype. J. Med. Genet. 39, 893-899 (2002).

28. van Bokhoven, H., Hamel, B.C., Bamshad, M., Sangiorgi, E., Gurrieri, F., Duijf, P.H., et al. p63 Gene mutations in eec syndrome, limb-mammary syndrome, and isolated split hand-split foot malformation suggest a genotype-phenotype correlation. Am. J. Hum. Genet. 69, 481-492 (2001).

29. O'Rourke, M.P., Soo, K., Behringer, R.R., Hui, C.C. & Tam, P.P. Twist plays an essential role in FGF and SHH signal transduction during mouse limb development. Dev. Biol. 248, 143- 156 (2002).

30. Kantaputra, P.N., Gorlin, R.J., Ukarapol, N., Unachak, K. & Sudasna, J. Robinow (fetal face) syndrome: report of a boy with dominant type and an infant with recessive type. Am. J. Med. Genet. 84, 1-7 (1999).

31. Roifman, M., Marcelis, C.L., Paton, T., Marshall, C., Silver, R., Lohr, J.L., et al. De novo WNT5A-associated autosomal dominant Robinow syndrome suggests specificity of genotype and phenotype. Clin. Genet. 87, 34-41 (2015).

32. Ugur, S.A. & Tolun, A. Homozygous WNT10b mutation and complex inheritance in Split- Hand/Foot Malformation. Hum. Mol. Genet. 17, 2644-2653 (2008).

33. Hoglund, L. & Reichard, P. Cytoplasmic 5'(3')-nucleotidase from human placenta. J. Biol. Chem. 265, 6589-6595 (1990).

34. Gareau, J.R. & Lima, C.D. The SUMO pathway: emerging mechanisms that shape specificity, conjugation and recognition. Nat. Rev. Mol. Cell Biol. 11, 861-871 (2010).

35. Bui, K.H., von Appen, A., DiGuilio, A.L., Ori, A., Sparks, L., Mackmull, M.T., et al. Integrated structural analysis of the human nuclear pore complex scaffold. Cell 155, 1233-1243 (2013).

36. Ghosh, P. & Kornfeld, S. The GGA proteins: key players in protein sorting at the trans-Golgi network. Eur. J. Cell Biol. 83, 257-262 (2004).

37. Cavdar Koc, E., Burkhart, W., Blackburn, K., Moseley, A. & Spremulli, L.L. The small subunit of the mammalian mitochondrial ribosome. Identification of the full complement of ribosomal proteins present. J. Biol. Chem. 276, 19363-19374 (2001). 40

38. Cakmakci, N.G., Lerner, R.S., Wagner, E.J., Zheng, L. & Marzluff, W.F. SLIP1, a factor required for activation of histone mRNA translation by the stem-loop binding protein. Mol. Cell Biol. 28, 1182-1194 (2008).

39. Lindhurst, M.J., Fiermonte, G., Song, S., Struys, E., De Leonardis, F., Schwartzberg, P.L., et al. Knockout of Slc25a19 causes mitochondrial thiamine pyrophosphate depletion, embryonic lethality, CNS malformations, and anemia. Proc. Natl. Acad. Sci. U. S. A. 103, 15927-15932 (2006).

40. Lowenstein, E.J., Daly, R.J., Batzer, A.G., Li, W., Margolis, B., Lammers, R., et al. The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Cell 70, 431-442 (1992).

41. Kumar, P., Henikoff, S. & Ng, P.C. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat. Protoc. 4, 1073-1081 (2009).

42. Adzhubei, I.A., Schmidt, S., Peshkin, L., Ramensky, V.E., Gerasimova, A., Bork, P., et al. A method and server for predicting damaging missense mutations. Nat. Methods 7, 248-249 (2010).

43. Chun, S. & Fay, J.C. Identification of deleterious mutations within three human genomes. Genome Res. 19, 1553-1561 (2009).

44. Schwarz, J.M., Rodelsperger, C., Schuelke, M. & Seelow, D. MutationTaster evaluates disease-causing potential of sequence alterations. Nat. Methods 7, 575-576 (2010).

45. Reva, B., Antipin, Y. & Sander, C. Predicting the functional impact of protein mutations: application to cancer genomics. Nucleic Acids Res .39, e118 (2011).

46. Shihab, H.A., Gough, J., Cooper, D.N., Stenson, P.D., Barker, G.L., Edwards, K.J., et al. Predicting the functional, molecular, and phenotypic consequences of amino acid substitutions using hidden Markov models. Hum. Mutat. 34, 57-65 (2013).

47. Dong, C., Wei, P., Jian, X., Gibbs, R., Boerwinkle, E., Wang, K., et al. Comparison and integration of deleteriousness prediction methods for nonsynonymous SNVs in whole exome sequencing studies. Hum. Mol. Genet. 24, 2125-2137 (2015).

48. Dimitrov, B.I., de Ravel, T., Van Driessche, J., de Die-Smulders, C., Toutain, A., Vermeesch, J.R., et al. Distal limb deficiencies, micrognathia syndrome, and syndromic forms of split hand foot malformation (SHFM) are caused by chromosome 10q genomic rearrangements. J. Med. Genet. 47, 103-111 (2010).

49. Filho, A.B., Souza, J., Faucz, F.R., Sotomaior, V.S., Dupont, B., Bartel, F., et al. Somatic/gonadal mosaicism in a syndromic form of ectrodactyly, including eye abnormalities, documented through array-based comparative genomic hybridization. Am. J. Med. Genet. A 155A, 1152-1156 (2011). 41

50. Dai, L., Deng, Y., Li, N., Xie, L., Mao, M. & Zhu, J. Discontinuous microduplications at chromosome 10q24.31 identified in a Chinese family with split hand and foot malformation. BMC Med. Genet. 14, 45 (2013).

51. Ockeloen, C.W., Cobben, J.M., Marcelis, C.L. & Koolen, D.A. A rare complex malformation of the hand in split hand foot malformation type 3 (SHFM3). Clin. Dysmorphol. 22, 106-108 (2013).

52. Chen, Y., Li, H., Tang, S., Hu, T. & Du, J. [Analysis of genomic copy number variation for a Chinese patient with split hand/split foot malformation]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 31, 774-777 (2014).

53. Li, C.F., Angione, K. & Milunsky, J.M. Identification of Critical Region Responsible for Split Hand/Foot Malformation Type 3 (SHFM3) Phenotype through Systematic Review of Literature and Mapping of Breakpoints Using Microarray Data. Microarrays (Basel) 5, (2015).

54. Firth, H.V., Richards, S.M., Bevan, A.P., Clayton, S., Corpas, M., Rajan, D., et al. DECIPHER: Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources. Am. J. Hum. Genet. 84, 524-533 (2009).

55. Armour, C.M., Bulman, D.E., Jarinova, O., Rogers, R.C., Clarkson, K.B., DuPont, B.R., et al. 17p13.3 microduplications are associated with split-hand/foot malformation and long-bone deficiency (SHFLD). Eur. J. Hum. Genet. 19, 1144-1151 (2011).

56. Petit, F., Andrieux, J., Demeer, B., Collet, L.M., Copin, H., Boudry-Labis, E., et al. Split- hand/foot malformation with long-bone deficiency and BHLHA9 duplication: two cases and expansion of the phenotype to radial agenesis. Eur. J. Med. Genet. 56, 88-92 (2013).

57. Curry, C.J., Rosenfeld, J.A., Grant, E., Gripp, K.W., Anderson, C., Aylsworth, A.S., et al. The duplication 17p13.3 phenotype: analysis of 21 families delineates developmental, behavioral and brain abnormalities, and rare variant phenotypes. Am. J. Med. Genet. A 161A, 1833-1852 (2013).

58. Petit, F., Jourdain, A.S., Andrieux, J., Baujat, G., Baumann, C., Beneteau, C., et al. Split hand/foot malformation with long-bone deficiency and BHLHA9 duplication: report of 13 new families. Clin. Genet. 85, 464-469 (2014).

59. Al Kaissi, A., Ganger, R., Rotzer, K.M., Klaushofer, K. & Grill, F. A child with split- hand/foot associated with tibial hemimelia (SHFLD syndrome) and thrombocytopenia maps to chromosome region 17p13.3. Am. J. Med. Genet. A 164A, 2338-2343 (2014).

60. Nagata, E., Kano, H., Kato, F., Yamaguchi, R., Nakashima, S., Takayama, S., et al. Japanese founder duplications/triplications involving BHLHA9 are associated with split-hand/foot malformation with or without long bone deficiency and Gollop-Wolfgang complex. Orphanet J. Rare Dis. 9, 125 (2014). 42

61. Nagata, E., Haga, N., Fujisawa, Y., Fukami, M., Nishimura, G. & Ogata, T. Femoral-tibial- digital malformations in a boy with the Japanese founder triplication of BHLHA9. Am. J. Med. Genet. A 167A, 3226-3228 (2015).

62. Luk, H.M., Wong, V.C., Lo, I.F., Chan, K.Y., Lau, E.T., Kan, A.S., et al. A prenatal case of split-hand malformation associated with 17p13.3 triplication - a dilemma in genetic counseling. Eur. J. Med. Genet. 57, 81-84 (2014).

63. Gu, S., Posey, J.E., Yuan, B., Carvalho, C.M., Luk, H.M., Erikson, K., et al. Mechanisms for the Generation of Two Quadruplications Associated with Split-Hand Malformation. Hum. Mutat. 37, 160-164 (2016).

64. Nakanishi, A., Kobayashi, N., Suzuki-Hirano, A., Nishihara, H., Sasaki, T., Hirakawa, M., et al. A SINE-derived element constitutes a unique modular enhancer for mammalian diencephalic Fgf8. PLoS One 7, e43785 (2012).

65. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012).