W&M ScholarWorks
VIMS Articles Virginia Institute of Marine Science
2004
Microcell parasites of oysters: Recent insights and future trends
Ryan Carnegie Virginia Institute of Marine Science
Nathalie Cochennec-Laureau
Follow this and additional works at: https://scholarworks.wm.edu/vimsarticles
Part of the Aquaculture and Fisheries Commons
Recommended Citation Carnegie, Ryan and Cochennec-Laureau, Nathalie, "Microcell parasites of oysters: Recent insights and future trends" (2004). VIMS Articles. 1684. https://scholarworks.wm.edu/vimsarticles/1684
This Article is brought to you for free and open access by the Virginia Institute of Marine Science at W&M ScholarWorks. It has been accepted for inclusion in VIMS Articles by an authorized administrator of W&M ScholarWorks. For more information, please contact [email protected]. Aquat. Living Resour. 17, 519-528 (2004) Aquatic © EDP Sciences, IFREMER, !RD 2004 DOI: I 0. 105 I/alr: 2004055 Living www.edpsciences.org/alr Resources
Microcell parasites of oysters: Recent insights and future trends
1 2 Ryan B. Carnegie ·a and Nathalie Cochennec-Laureau
'. Virginia In stitute of Marine Science, Coll ege of William and Mary, Gloucester Point, VA 23062, USA - IFREMER, Laboratoire Aq uaculture Tropicale, Unite de Pathologie, BP 7004, 98719 Taravao, Tahiti, French Pol ynesia
Abstract - Our understanding of the microcell oyster parasites of the genera Bonamia and Mikrocwos has expanded 111 recent years with the appli cation of ultrastructural and especiall y molecular biological research approaches. Molec ular phylogenetic analyses of SSU rRNA genes have united three species, Bonamia ostreae, Bonamia exitiosa, and Mikrocytos (now Bonamia) roughleyi, in a microcell clade within the Haplosporidia, supporting both earl y and recent ultrastructural observations. Ult rastructura l and molecular phylogeneti c ev idence has emerged that Mikrocytos mackini, on the other hand, is a unique protist with unusual adaptations for a parasitic existence. DNA probes and polymerase chain reaction (PCR) assays promise new insights into the life cycles, transmi ssion, and diversity of these organisms. The development of Ostrea eclulis lines selected for B. ostreae resistance wi ll increase the viability of aquaculture in dustri es for thi s species and, combined with rapidly developing biotechnological approaches for studying host defenses and host-parasite interactions, will all ow greater insight in to the nature of phenomena such as resistance and tol erance to disease in oysters.
Key words: Microcell / Bona111ia / Mi/,:rolTtos
1 Introduction and Bonamia exitiosa (Hine et al. 200 I a) , whi ch infects T chilensis in New Zealand (Dinamani et al. 1987). The genus Small, intracellular, protistan parasites caused serious mor Mikrocytos was proposed to include Denman Island disease tality in the 1960s in Pacific oysters, Crassostrea gigas, agent Mikrocytos mackini and Mikrocytos roughleyi, the cause at Denman Island, British Columbia, Canada (Bower 1988; of winter mortality in S. glomerata (Farley et al. l 988). Farley et al. l 988), and in fl at oysters, Ostrea edulis, in Similarity in appearance at the light microscope level (pre California, USA (Katkansky et al. l 969). Parasites similar dominant cell forms are small ( <5 µm) and roughly spher to the " microcell s" observed by Katkansky et al. ( 1969) in ical, with relatively large, somewhat eccentric nuclei that Cali fo rni a subsequently caused epizootic disease and mortal give them a "fried egg" appearance (Bower et al. 1994) in ity in 0 . edulis along the Atlantic coast of Europe (Comps histopathological secti ons), in cell specificity (most infect oys et al. 1980; Yan Banning 1986; Montes 1990; Hudson and ter hemocytes), and in transmission (all are directly transmitted Hill 1991; McArdle et al. 1991; Rogan et al. 199 1) and in among oyster hosts) led Farley et al. (1988) to conclude that dredge oysters Tio strea lutaria (syn. chilensis; 6 Foighil et al. these species were closely related. Indeed, we now know that 1999) in New Zealand , and were identified as the cause of B. ostreae, B. exitiosa, and M. roughleyi are (Carnegie et al. winter mortality (Roughl ey 1926) in the Sydney rock oys 2000; Cochennec-Laureau et al. 2003; Hine et al. 200 I a), but ter Saccostrea commercialis (syn. glomerata; Anderson and M. mackini is not obviously related to members of any de Ad lard 1994) in southeastern Australia (Farl ey et al. 1988). scribed taxon (Carnegie et al. 2003). The illumination of mi They are now recogni zed as major parasitic threats to oyster crocell interrelationships and phylogenetic affi nities has broad populations worldwide (0.I.E. 2000). implications, and with the development of molecular diag Two genera and four species of microcell s are currentl y nostic tools for these protists is a significant recent develop acknowledged. Bonamia species include Bonamia ostreae ment in microcell research. We review here the progress in (Pi chot et al. 1980), beli eved to have been first observed by microcell phylogenetics and molecular di agnostics, and revisit Katkansky et al. (Katkansky et al. 1969; Elston et al. 1986), several aspects of microcell-oyster pathobiology. Fin all y, we whi ch parasiti zes 0. edulis in Europe and in Washington, review early ._progress in a major area of current and future California, and Maine, USA (Barber and Davis 1994; Elston research: the breeding for resistance to bonamiasis, and th e et al. 1986; Fri ed man and Perkins 1994; Fri edman et al. 1989); use of bonamiasis as a model for illuminating cellular and molecul ar bases of host-parasite interacti ons. " Corresponding author: carn egie@vims .edu 520 R.B . Carnegie and N. Cochennec-Laureau: Aq uat. Livin g Resour. 17, 5 19-528 (2004) R.B. Carnegie and N. Cochennec-Laureau: Aquat. Living Resom. 17, 519-528 (2004) 52 1
2 Phylogenetics of the microcells B. roughleyi genus Bonamia (Cochennec-Laureau et al. 2003) . This po rivularis (syn. ariakensis) held in France were fo und to be in 100 sition is already embraced by the Office International des fected by one Bonamia sp . (likely ostreae; Cochennec et al. B. exitiosa Epizooties, which lists M. roughleyi among the causative 1998), and C. ariakensis in North Carolina, USA, with an The earliest ultrastructural study of B. ostreae revealed B. ostreae agents of bonamiasis (0.1.E. 2003). Mikrocytos roughleyi will other, novel Bonamia sp. (B urreson et al. 2004). Saccostrea dense cytoplasmic structures resembling haplosporosomes 77 be referred to as Bonamia roughleyi hereafter in this text. glomerata, the host fo r B. roughleyi, may be more closely (Pichot et al. 1980), features present in the Haplosporidia and ,--- M. teredinis 100 The earl y review by Grizel et al. (1988) of research con related to C. gigas and C. ariakensis than to Ostrea spp. Myxozoa (Perkin s 1979) as well as the Paramyxea (Morris cerning B. ostreae and bonamiasis is sti ll very relevant. Some (O'Foighil et al. 1999). Crassostrea gigas is refractory to B. et al. 2000). The presence of these structures in B. ostreae, an M. chitonis aspects of the biology of the microcell haplosporidians and ostreae in the field (Balouet et al. 1983; Katkansky et al. 1969; organism not displaying the cell- within-a-cell structure of the 89 and the di seases they cause are worth revisiting, Le Bee et al. 1991 ; Renault et al. 1994) or when challenged by --- M. tapetis M. mackini Paramyxea, argued for inclusion in the Haplosporidia (Perkins 91 however, in li ght of recent research and progress in microcell injection in the laboratory (Culloty et al. 1999). 1987, 1988), a position further supported by the observation H. /usitanicum phylogenetics in particular. The natural host range for B. ostreae, currently 0. edulis that B. ostreae at least occasionally displays multinucleate alone, is potentially broader, as B. ostreae is known to in plasmodial forms (Brehelin et al. 1982). Because B. ostreae H. pickfordi fect C. angulata (Katkansky et al. 1969), T chilensis (B ucke spores have never been observed, however, placement of this 73 H. edule 2.1 Pathology and host range and Hepper 1987; Grizel et al. 1983), Ostrea denselamel parasite in a phylum whose members are defined by their losa (Le Borgne and Le Pennec 1983), 0. angasi (Bougrier spores (S prague 1979) is tenuous (Elston et al. 1986). Further 92 H. armoricanum Pathology and host range formed the initial basis for mi et al. 1986), Ostrea puelchana (Pascual et al. 1991 ), and more, B. ostreae was shown to pass directly between neigh crocell taxonomy: C. ariakensis (Cochennec et al. 1998). The documented host boring oysters (Elston et al. 1986; Poder et al. 1982). Direct H. costale "Mikrocytos g. n. is always associated with focal abscesses range of B. exitiosa is restricted to T chilensis in New Zealand transmission of Haplosporidium spp., except perhaps in the and occurs in crassostreid oysters. Bonamia is always asso (D inamani et al. 1987), and of B. roughleyi to S. glomerata in case of Haplosporidiumpickfordi (Barrow 1965), has not been ------H. ne/soni ciated with generalized infections and onl y occurs in ostreid eastern Australia (Farley et al. 1988). demonstrated. H. /ouisiana oysters (Farley et al. 1988)". The potential host range for M. mackini is broad. In labora Sequencing of the SSU rRNA gene of B. ostreae in the Bonamia roughleyi was ori ginally assigned to the genu s tory challenges (inoculation with a M. mackini cell suspension) U. crescens late 1990s made genetic analyses possible. The hybridi za Mikrocytos even though, like B. ostreae, it infected the and field trials at Denman Island, Bower et al. (1997) found tion of putatively B. ostreae-specific polynucleotide (300 bp) Fig. 1. Parsimony bootstrap tree of haplosporidi an SSU rDNA indi hemocytes of its oyster host (Farley et al. 1988). The that 0. edulis, 0. conchaphila, and C. virginica were perhaps in situ hybridization (ISH) probes to Haplosporidium nelsoni cating the position of Bonamia spp., including B. roughleyi, within phylogenetic affinity of B. roughleyi to the Bonamia spp. more susceptible to M. mackini than C. gigas was. They also was a fortuitous result that provided the first molecular the Haplosporidia. Numbers at nodes indicate percentage support (Cochennec-Laureau et al. 2003), however, shows tissue found that in C. gigas, C. virginica, and 0. edulis infection af genetic evidence that B. ostreae may be a haplosporidian of 1000 bootstrap repli cates. The austral mi crocell s B. exitiosa and tropism to be significant. Microcell haplosporidians gener ter inoculation with a parasite suspension developed at 9.2 °C (Cochennec et al. 2000). Parsimony phylogenetic analyses B. roughleyi, based on avail able sequence data, appear to be sister ally parasitize and proliferate in oyster hemocytes. Mikrocytos but not at 17 .9 °C. Considering the host species above and their species. using SSU rRNA genes then pl aced B. ostreae, with strong mackini also occurs in hemocytes (as well as heart and adduc relatives, M. mackini is a potential threat to a wide range of (100% bootstrap) support, in thi s phylum, with H. nelsoni, tor muscle myocytes; Hervio et al. 1996; Hine et al. 2001), but oyster species in cooler waters worldwide. Haplosporidium costale, and Minchinia teredinis its closest is more obviously associated with vesicular connective tissue relatives (Carnegie et al. 2000). cells (Farley et al. 1988) and does not appear to proliferate in Like B. ostreae, both B. exitiosa and M. roughleyi para A close relationship of M. mackini to other microcells hemocytes. The significance of a single record of B. ostreae 2.2 Cell forms and life cycles siti ze host hemocytes and display haplosporosorne-li ke struc was dubious. While Bonamia spp. and M. roughleyi primar infecting the gill epithelial cells of an unspecifi ed nu mber of tures and multinucleate plasrnodial cell forms (Dinamani et al. ily parasitize oyster hemocytes (Balouet et al. 1983; Dinamani very heavily infected oysters (Montes et al. 1994) is still un 1987; Farley et al. 1988; Hine 1991 , 1992; Hine and Wesney et al. 1987; Farley et al. 1988), M. mackini most obviously clear, though the gill epithelium may be portal of entry, as for Predominance of a small ( <5 µm), uninucleate cell form is 1992, 1994; Hine et al. 2001a; Cochennec-Laureau et al. infects vesicular connective ti ssue cell s (Farley et al. 1988), H. nelsoni (Ford and Tripp 1996), or a point of egress from characteristic of microcell haplosporidians (Pichot et al. 1980; 2003). Molecular phylogenetic analyses confirmed their close though also and heart and adductor muscle myocytes as well the host (Montes et al. 1994 ). More epitheliotropic microcell Dinamani et al. 1987; Cochennec-Laureau et al. 2003). These relationship to B. ostreae. Hine et al. (2001a) fo und that the as hemocytes (Hervio et al. 1996; Hine et al. 2001). While ad haplosporidians, on the other hand, may await discovery and cells may be more electron-dense (ribosome-rich) or electron SSU rDNA of B. exitiosa and B. ostreae were 96.6% sim vanced Bonamia spp. infections tend to become diffuse and description. Dr. P.M. Hine (pers. comm.) kindly suggests that, clear (Pichot et al. 1980; Dinamani et al. 1987; Hine 199l a,b), ilar over 1623 bp. Cochennec-Laureau et al. (2003) then systemic (Balouet et al. 1983 ; Dinamani et al. 1987; Hine in histopathological sections of Ostrea angasi from southern or, in the case of B. exitiosa, may or may not contain a large used parsimony analysis to place B. exitiosa and M. roughleyi 1991 a), with infected hemocytes to be found in every host tis Australia infected with a Bonamia sp. , "gill epithelial cell in vacuolar mitochondrion among their mitochondria (Hine et al. with B. ostreae in the Haplosporidia. Parsimony analysis sue (Elston et al. 1986), natural M. mackini infections always fections are as common as hemocyte infections, and within 2001a). Individual cells may be intermediate in appearance by these authors and Reece and Stokes (2003) supported remain strongly focal (Farley et al. 1988; Hervio et al. 1996). the digestive gland, infection of the digestive diverticular (Dinamani et al. 1987; Hine et al. 2001a), suggesting that the close relationship of these mi crocell s to H. costale and Mikrocytos mackini has the widest experimental host range of epithelial cells is the rule, rather than the exception". "dense" and "clear" may represent end points on continua. The M. teredinis, and Cochennec-Laureau et al. (2003) fo und the microcells, infecting not only C. gigas but Crassostrea vir Advanced microcell hapl osporidian infections indeed be signifi cance of these states is still not clear. The dense form of furthermore th at B. exitiosa and M. roughleyi, rather than ginica, 0. edulis, and Ostreola conchaphila as well (Bower come systemic (Bower 2001; Cochennec-Laureau et al. 2003; B. ostreae is more numerous in heavily infected oysters, and B. ostreae, might be sister species (bootstrap support for this et al. 1997). Most significantly, M. mackini alone possesses Farley et al. 1988), but early or light infections are focal the clear form is more common in li ght infections. The dense conclusion was a modest 69%) . Phylogenetic analyses per neither haplosporosomes nor mitochondria (Hine et al. 1991 ), (Balouet et al. 1983; Bucke 1988; Bucke and Feist 1985; form is presumed to be the infective stage (Pichot et al. 1980). formed for thi s review sup port th is rel ationship (Fig. 1); which led Hine et al. (200 l) to conclude that M. mackini "is not Dinamani et al. 1987; Elston et al. 1986; Friedman and Perkins In B. exitiosa, Hine (1991) observed seasonal changes in the indeed, a single I 0-nucleotide inserti on/deletion notwithstand a haplosporidian". Parsimony and evolutionary di stance phy 1994; Friedman et al. 1989; Hine 1991a; Zabaleta and Barber frequencies of dense and clear forms, with infective dense ing, the SSU rDNA sequences of B. exitiosa and M. roughleyi logenetic analyses supported this contention (Carnegie et al. 1996). Gross surface lesions may be common (e.g., B. rough forms occurring in more oysters in every month except August are 99.5% similar over the 962 positions included in an 2003). These analyses also excluded M. mackini, however, leyi; Farley et al. 1988), occasional (e.g., B. ostreae; Comps and September, when clear forms occurred more frequently. ali gnment of the sequences deposited in the National (USA) from every other protistan phylum for which SSU rDNA se et al. 1980; Pichot et al. 1980), or rare (e.g. , B. exitiosa; Multinucleate plasmodial forms are expressed by all Center for Biotechnology Information database (GenBank). quences are avail able. The true phylogenetic position and Dinamani et al. 1987). known micro cell haplosporidians but make a questionable SSU rDNA sequence data suggest therefore that the austral affi nities of M. mackini are unknown. The host range of microcell haplosporidians is not limited contribution to disease transmission. Only B. exitiosa plas microcells, B. exitiosa and M. roughleyi, shared a common Mikrocytos was revealed to be a polyphyletic genus, to ostreid oysters. In the early 1960s microcell epizootic in modia oc'2ur regularly (Hine 199 1; Hine et al. 2001 a). ancestor fo ll owin g divergence of their lineage from that of and "microcell" a term with no phylogenetic signifi cance. 0. edulis in Californ ia (almost certainly caused by B. ostreae; Bonamia ostreae plasmodia have been observed very rarely B. ostreae-and possibl y fo ll ow ing divergence of the mi cro Mikrocytos roughleyi is, like B. ostreae and B. exitiosa, a Elston et al. 1986), Crassostrea angulata were also fo und to be and onl y in moribund or post-mortem oysters (B rehelin cell s into northern and southern hemispheric forms. microcell haplospori dian, and should be reassigned to the infected (Katkansky et al. 1969); more recently, Crassostrea et al. 1982); B. roughleyi plasmodia are rare as well 522 R.B . Carnegie and N. Cochennec-Laureau: Aquat. Li ving Resour. J 7, 519-528 (2004) R.B. Carnegie and N. Cochennec-Laureau: Aquat. Living Resour. J 7, 519-528 (2004) 523
(Cochennec-Laureau et al. 2003). The hypothesis that devel Carolina, USA (Burreson et al. 2004) await definitive identifi equivalent, the two assays might reasonably be compared. opment of multiple infective cells from multinucleate plas cation. Microcells observed in C. gigas in Hawaii and Ostrea Both assays detected every "heavy" and " moderate" infection modia in even relatively few dead oysters is a means by Lurie/a ( = 0. conchaphila) in Oregon (Farley et al. 1988) may (Carnegie et al. 2000: 8/8 and 16/ 16, respectively; Diggles which B. ostreae proliferates explosively in an oyster popu have been M. mackini (or a relative), as vesicular connective et al. 2003: 2/2 and 4/4). Both detected most "light" and lation (Brehelin et al. 1982) remains to be tested. Infrequently tissue cells were infected. "scarce" infections (Carnegie et al. 2000: 13/ 15 and 20/30; occurring plasmodia may simply be a vestige of an ancestral Diggles et al. 2003: 6/6 and 2/4). Dividing the number of in haplosporidian sporogenic pathway (Hine 1991) obviated in fections detected by PCR alone by the number detected by microcell haplosporidians with the evolution of directly infec 3 Molecular diagnostics histocytology alone generates an index of sensitivity. The tive dense forms. Carnegie et al. (2000) assay detected 3.7 times more B. ostreae Few generalizations can be made regarding seasonal infec The development of microcell-specific molecular diagnos infections than histocytology. The assay validated by Diggles tion cycles of microcell haplosporidians. Bonamia exitiosa in tic tools was imperative because the small size of these para et al. (2003) detected 4.0 times more B. exitiosa infections than fections di splay a strong seasonality tied closely to T chilensis sites makes them difficult to detect using standard histopathol histocytology. While these assays still need to be validated di gametogenesis and reproduction (Hine 199la,b). Infection in ogy and hi stocytology. Immunoassays for B. ostreae (Boulo rectly against one another, they appear to be roughly equivalent tensity peaks from January to April, parasites proliferating et al. 1989; Mialhe et al. 1988; Cochennec et al. 1992) held in sensitivity. when hemocytes migrate into the gonad to resorb unspawned great early promise. The monoclonal antibodies designed for PCR-restriction fragment length polymorphism gametes (Dinamani et al. 1987; Hine 199la,b). Mortality and B. ostreae from France (Mialhe et al. 1988) reacted only (PCR-RFLP) assays introduced to distinguish B. ostreae transmission of B. exitiosa occur primarily from January weakly with B. ostreae from Maine (Zabaleta and Barber from B. exitiosa (Hine et al. 2001) and to distinguish August, in the months following proliferation in the gonad 1996), however, suggesting that serological differences be B. roughleyi from the other Bonamia spp. (Cochennec (Hine 199 la). Accumulating evidence for B. ostreae, on the tween B. ostreae strains could limit the usefulness of antibody Laureau et al. 2003) may provide the most straightforward other hand, offers no support for a close association with go based techniques. The first DNA-based diagnostic assay for a molecular means for distinguishing among microcell hap nad (contrary to Van Banning 1990) or for strong seasonality microcell was designed for B. roughleyi. Adlard and Lester losporidians. Both assays rely upon the PCR described by of infections. Prevalence and intensity in general are greatest ( 1995) used universal primers to amplify the internal tran Cochennec et al. (2000) for amplification of B. ostreae. The in warmer months, but infections and mortality occur year scribed spacer (ITS) region between the SSU rRNA and PCR reaction mixture should include PCR buffer at lX con round (Balouet et al. 1983; Tige and Grizel 1984; Montes LSU rRNA genes, producing amplicons that differed in size centration, 2.5 mM MgCh, 0.2 mM dNTP's, 1.0 µM primers and Melendez 1987; Montes et al. l 994; Culloty and Mulcahy between B. roughleyi (680 bp) and S. glomerata (1500 bp). (forward, BO: CATTTAATTGGTCGGGCCGC; reverse, Fig. 2. Detecti on of microcell s by fluorescent in situ hybridization. 1996) and are unrelated to gonadal development (Caceres Questions of specificity and sensitivity, however, limit the use 1 BOAS: CTGATCGTCTTCGATCCCCC), 0.02 units µ1 - 2A. Numerous Bonamia ostreae in hemocytes infiltrating Ostrea Martfnez et al. 1995). The seasonality of M. roughleyi infec fulness of this PCR. Because the primers were not specific, 1 Taq DNA polymerase, and 0.2 ngµ1- template DNA. The edulis gill tissue. A larger 8. ostreae is indicated by an arrow, and tions is uncharacterized, but gross signs of infection and win they might amplify the rDNA not only of B. roughleyi or reaction should begin with template DNA denaturation for a cluster of small er cells by an arrowhead. Scale bar = IO µm. 2B. ter mortality occur primarily in August and September (Adlard S. glomerata but of contaminant organisms too. The 680-bp 5 min at 94 °C, followed by 30 cycles of94 °C for 1 min/55 °C Mikrocytos mackini cell s in the adductor muscle of experimentall y and Lester 1995). product characteristic of B. roughleyi could also be charac for 1 min/72 °C for l min, and followed finally by a final infected 0. edulis. Scale bar = IO µm. In M. mackini, Hine et al. (200 I) identified three di stinct teristic of other protists, or contaminating bacteria or fungi. extension for 10 min at 72 °C. A 300-bp B. ostreae product cell types based on ultrastructural characteristics and tissue The sensitivity of the assay relates to its specificity. Both for would be digested by both Hae II (producing fragments of tropism, and proposed a developmental cycle in which the par ward primer (a perfect match to the target sequence in the con 115 and 189 bp) and Bgl I (120 and 180 bp). A 304-bp B. generic oyster species Saccostrea cucullata, GenBank acc. no. asite is transformed from one cell type to another while cycling exitiosa product would be digested by Hae II (producing 115- many as three gross pustules per individual; 15 times as many AJ389634; the S. glomerata sequence is unknown) and reverse between vesicular connective tissue and myocytes via hemo and 189-bp fragments) but not by Bgl I. A 304-bp B. roughleyi oysters were M. mackini-positive by PCR alone as by mi primer (87 .5 % identical to the target sequence in S. glomerata, cytes. Their most striking observation was the frequent close PCR product would not be digested by either enzyme. croscopy alone. SSU rDNA from Bonamia ostreae was not association of M. mackini with host cell nuclei (M. mackini acc. no. Z29552) should hybridize to oyster DNA template Specific in situ hybridization (ISH) assays for the microcell amplified. sometimes occurred within host cell nuclear membranes) and in the PCR reaction. Even if not producing amplification, haplosporidians await development. Cochennec et al. (2000) mitochondria (M. mackini itself is amitochondriate). A physi such interactions can reduce the efficiency of parasite-specific detected B. ostreae in situ with a digoxigenin-labeled, polynu cal affinity for host cell mitochondria in particular could only PCR. Adlard and Lester (1995) did, however, detect one cleotide (300 bp) probe. However, H. nelsoni was detected have evolved after these organelles had already been acquired B. roughleyi cell among about 400 host cells. too, indicating that this assay might be phylum-specific. The by eukaryotes. Conceivably, this could be the first evidence Cochennec et al. (2000) and Carnegie et al. (2000) pre 4 Future trends cocktail of three fluorescein-labeled oligonucleotide probes that M. mackini, like the Microspora, is a derived organism sented as "B. ostreae-specific" PCR assays that are now known that Carnegie et al. (2003a) used to detect B. ostreae in situ that has lost its mitochondria in adapting to a parasitic exis to be broader in specificity. Based on target DNA sequence (Fig. 2a) did not hybridize to H. nelsoni, suggesting that tence. Alternatively, M. mackini may be an ancient, amitochri similarity, the Cochennec et al. (2000) assay should detect Selective breeding for resistance to bonamiasis and the this assay was more specific. However, the target sites for ate protist that has more recently evolved a facultative parasitic the SSU rDNA of all microcell haplosporidians. The Carnegie use of bonamiasis as a model for illuminating cellular and at least two of the oligonucleotides used by Carnegie et al. relation hip with oyster hosts. et al. (2000) assay should detect B. ostreae and B. exitiosa but molecular bases of host-parasite interactions are major areas (2003a) were strongly conserved in at least one other microcell The annual life cycle of M. mackini is still unknown. How perhaps not B. roughleyi, which has a three-nucleotide dele of current work that hold great promise for the future. These (8. exitiosa), suggesting that this ISH assay may not be more lines of research are also closely related. The use of crosses ever, while M. mackini is typically detectable histopathologi tion in the target site for the forward primer (the B. roughleyi than microcell haplosporidian-specific. With at least partial se between lines selectively bred for a performance trait such as cally only between March and June, polymerase chain reaction sequence at the reverse primer binding site is not known). Neither assay amplifies oyster DNA. Both assays have under quences available now in GenBank for B. ostreae, B. exitiosa, resistance to bonamiasis can be useful in mapping quantitative (PCR) experiments have shown it to be associated with oysters and B. roughleyi, the probes for the Carnegie et al. (2003a) as year-round (Carnegie et al. 2002). gone some validation against histocytological diagnosis, the trait loci (QTLs) and ultimately identifying the genes underly light microscopic screening of fixed and stained hemolymph say can be redesigned for species specificity. In the meantime, ing this trait - providing a window into the molecular basis of smears (n = 185 (Carnegie et al. 2000); n = 28 (Diggles et al. the assay as currently designed is most useful for distin guish a host-parasite interaction. Genes found responsible for resis 2003). (Histocytology is no less sensitive than histopathol ing microcell haplosporidi ans as a group from M. mackini. tance to bonamiasis may then be used as biomarkers - in their 2.3 Undescribed microcells ogy for detecting B. ostreae (Culloty and Mulcahy 1996; PCR and fluorescent ISH assays for M. mackini (Fig. 2b) allelic states or expression levels - for resistant stocks. Genes Zabaleta and Barber 1996) and perhaps more sensitive for de were also recently developed (Carnegie et al. 2003). The or proteins in volved in host-parasite interactions may also be Microcell haplosporidians in T chilensis in Chile tecting B. exitiosa (Diggles et al. 2003), but more rapid and prevalence of M. mackini in 1056 C. gigas was estimated to used as biomarkers for the physiological (or infection) state (Campalans et al. 2000), 0. angasi in southern and western less expensive.) Assuming that the histocytologically deter be 3.5 times hi gher by PCR than by microscopic methods, of an individual animal. The following is a sy nopsis of recent Australia (Hine and Jones 1994 ), and C. ariakensis in North mined infection intensity scores between species are roughly including standard histopathology plus stained imprints of as progress in these areas. 524 R.B. Carnegie and N. Cochennec-Laurea u: Aq uat. Li ving Resour. 17, 519-528 (2004) R.B . Carnegie and N. Cochennec-Laureau: Aq uat. Li ving Resour. 17, 519-528 (2004) 525
4.1 Selective breeding for disease-resistant 4.2 Bonamiasis as an experimental model respiratory burst activities, measured by chemiluminescence, addition, B. ostreae appears capable of inhibiting the post or -tolerant oysters for host/pathogen interactions of the hemocytes from each species of oyster. phagocyti c respi ratory burst, further enhancing survival (Hine Additi onal investi gations on Iysosomal acti vities and enzy and Wesney 1994). The microsatellite markers developed in French laborato In oysters selected fo r apparent resistance to bonami asis, Genetic improvement has been achieved with many sig matic cellular characterisati on using API-ZYM galleries, how ries (Naciri -Graven et al. 2000; Launey et al. 2001 ) should survival of the parasite seems to be compromised by the more nificant oyster di seases through selection of individuals that ever, revealed significant di ffe rences between the hemocytes of find a usefulness beyond the marker-assisted selection pro the two oyster species (Xue 1998). Enzymatic activities were acti ve non-specific esterase acti vities of the large agranul ar appear more resistant to the disease as broodstock. Examples grams in which they are currently employed. Microsatellites cells, compared with that of the granulocytes. This esterase have been reported, for example, for H. nelsoni (Haskin and higher in the hemolymph of C. gigas than in the hemolymph and then QTLs may be mapped onto 0. edulis chromosomes, of O. edulis. Moreover, the di stribution of the acti vities among acti vity does not seem to be specific to infecti on by the para Ford 1978; Haski n and Ford 1979; Paynter et al. 1997) and and genes subsequently identified that underlie the tolerance si te B. ostreae. These cytological parameters are quantifia ble, Ju venile Oyster Disease (JOD) (Barber et al. 2000; Davis et al. the total hemolymph, cell-free plasma, and the hemocytes was (or susceptibility) to bonamiasis. Already, however, bonamia and thus may be markers useful for selection programs aimed 1997; Farley et al. 1997) in C. virg inica. di fferent between both oyster species. Enzy me activities were sis has emerged as a model for study of molluscan intracellular at selecti on for tolerance to bonamias is. By the mid-l 980s there was strong evidence that 0. edulis hi gher in the total hemolymph and the plasma fraction of parasitism that is particularly interesting because of the dou C. gigas, while higher in the total hemolymph and hemocytes might be capable of developing resistance to B. ostreae. Elston ble role played by the hemocytes in pathogenesis. Hemocytes et al. ( l 987) showed that members of a "carrier" 0. edulis pop in 0 . edulis. Si x post-phagocytic enzymati c activities (es function in non-specific defense at the same time that they are terase, aminopeptidase, galactosidase, cathepsines, myeloper 5 Conclusion ul ation (30% B. ostreae prevalence) descended from the ori gi infected by B. ostreae. nal B. ostreae-challenged 0 . edulis population from California oxydase and production of H20 2) were evaluated for each Development of purification techniques for isolating The combination of selective bred, B. ostreae-resistant (Katkansky et al. 1969) exhibited dramati cally better sur hemocyte fraction. All activities were hi gher in granular cell s B. ostreae (Mialhe et al. 1988) and of primary, short term O. edu lis lines and an ex panding arsenal of molecul ar tools vival (74%) than members of a presumably naive popula than in agranular, large and small cells, confirming signifi hemocyte cell culture methods (Mourton et al. 1992) have promises significant advances in our understanding of bonami tion from Maine (1 %). Since 1985, scientists at IFREMER cant role of granular cell s in the degradati on of particles after facilitated in vitro analyses of the earl y stages of para asis. Not insignificantl y, thi s may expand our understanding of (France) have selectively bred 0 . edulis for resistance to B. phagocytosis (Cochennec 2001). site detecti op and host cell penetration and of the phago enigmati c haplosporidians such as H. nelsoni too. While sig ostreae. Contrary to the programs developed for resistance to Irish research has focused recently on enzymati c and pro cytic mechanisms applied to destroy the parasites. Hemo nifi cant diffe rences may exist between the as yet unresolved H. nelsoni or B. ro ughleyi, experimental infections were used tein concentration differences between B. ostreae-infec ted and cytes of both 0 . edulis and C. gigas phagocytosed B. ostreae, but likely indirect life cycles of farniliar haplosporidians such to increase and control the pressures of selecti on (Cochennec -uninfected 0. edulis. Cronin et al. (2001 ) found hemolymph but C. gigas hemocytes were capable of destroying the as H. nelsoni and the directl y transmi ssion of microcell hap 2001 ; Culloty and Mulcahy 1992; Hervio 1992; Mialhe et al. protein levels to be highl y variable between season, site, parasite. Cytochalasin B reduced penetration by the par losporidians, large components of the biochemistries of these 1988). Mass selecti on all owed suffi cient numbers of oysters and oyster strain , no correlati on between infection level and asite, suggesting that penetration is indeed active phago organi sms must surely be conserved. Discoveries concerning to survive to permit selection and compari son with natural lysozyme concentration, and no difference in total hemolymph cytosis directed by the host (Chagot et al. 1992). Addi B. ostreae, therefore, may be relevant not onl y to B. exitiosa oyster survival levels (Baud et al. 1997; Martin et al. 1993; protein levels between infected and uninfected oysters (though tional active involvement by the parasites in pen_etrating and B. roughleyi but to other haplosporidians as well. Naciri 1994; Naciri-Graven et al. 1999). In 1992, the program hi ghly infected oysters had slightly depressed protein levels). the host hemocytes was investigated using flow cytome Mikrocytos mackini is a unique organism with unusual was reorgani zed to evaluate the heritability of resistance and Culloty et al. (2002) found no differences in amylase or aspar try. Live and heat-killed parasites confirmed the existence adaptations fo r a parasitic existence. Its true phylogeneti c to reduce the risk of inbreeding (Naciri-Graven et al. 1998). tate aminotransferase between infected and uninfected oysters. of such a mechanism, as live parasites were internalised at affiniti es and distribution should soon become more clear. Third generation selected oysters showed significantl y higher a greater rate than heat-kill ed parasites. Internalisation of Resistant oyster strains offer new opportunities for the survival rates than non-selected oysters (52.3% versus 2.5%). B. ostreae thus uses two pathways, one directed by host phago study of cellular defense mechanisms. Analyses of the distri Moreover, the survival rates were cmrelated with B. ostreae cytosis and the other directed by the parasite itself (Cochennec bution of hemocyte types showed that the large agranular cell s Acknowledgem.ents. N. Cochennec-Laureau's contribution has been prevalence (Bedi er et al. 2001 ). Resistance to B. ostreae in 2001). were significantly less abundant, and that granulocytes were funded by European Co mmi ss ion (Program FAIR DISENV fections is clearl y heritable, and mainly (but not entirely) ad Mixing sugars (mannose, glucose, fu cose, N-acetyl glu significantly more abundant, in oysters selected for their resis CT98-4 l 29). We thank Sharon McGl addery fo r ass istance with the ditive (Naciri-Graven et al. 1998). The nature of resistance to cosamine and galactosamine) with hemocytes does not affect tance compared with control susceptible oysters. Although it manuscri pt. bonamiasis appears to be increased tolerance of B. ostreae in phagocytosis of B. ostreae by oyster hemocytes, so lectin re is not yet clearl y established that the reducti on in the propor fections (Naciri-Graven et al. 1998); management of infecti ons ceptors on the surface of the hemocytes play a questionable ti on of large agranular cells is the consequence, or the cause, such that they remain light and, to a point, have a minimal im role in B. ostreae internalisation (Chagot et al. 1992). Incuba of proliferation of the parasite, these results show the impor References pact on growth and reproductive output. tion of B. ostreae with similar sugars, before exposure to oyster tance of the proportion of each hemocyte type and their poten The French 0. edulis selection program has focused on im hemocytes, decreased infection rates of both large and small ti al respecti ve roles in the susceptibility of oysters B. ostreae Adlard R.D. , Lester R.J.G. , 1995 , Development of a di agnostic test proving growth performance as well as di sease resistance. The agranular cell s of C. gigas, and granulocytes and small agran (Cochennec 1997, 2001 ). The search for possible functi onal fo r Mikrocytos roughleyi, the aeti ological agent of Australi an economic impact of the disease can be reduced by improving ular cell s of 0. edulis, suggesting that lectin-like receptors may differences between hemocyte types showed that the large wi nter morta li ty of the commercial rock oyster, Saccostrea com survival during the second and third year of growth , as well as be operative on the surface of the parasites (Chagot 1989). agranular cells had lower enzymatic properties than granular mercialis (Iredale & Roughl ey). J. Fish Di s. 18, 609-6 14. by obtaining oysters of commercial size more quickly. Using fl ow cytometry it was possible to di scriminate granu cell s (Cochennec 1997, 200 l ; Cochennec-Laureau et al. 2003). Anderson T.J. , Adl ard R.D ., 1994, Nucl eotide sequence of a rDNA in tern al tra nscribed spacer supports sy nonomy of Saccostrea com Selection for bonamiasis-resistant oysters has also been lar fro m agranular cell s on the basis of hemocyte lectin di s In order to defin e the possible relati onshi p between enzymati c mercialis and S. glomerata. J. Mollusc Stud. 60, 196-1 97 . achieved in Ireland (Hugh Jones 1999; Cull oty et al. 2001 ). tributions (Auffret, pers.comm.). Granular cell s had mannose, parameters and resistance to bonamiasis, various susceptible Balouet G. , Poder M ., Cahour A., 1983 , Haemocy ti c parasitosis: mor In Cork Harbour, oysters alive after fo ur years of B. ostreae glucose, galactose, fu cose, N-acetyl glucosamine residues on and resistant oyster populations were compared. A hypothesis phology and path ology of lesions in the French fl at oyster, Ostrea ex posure have been used as broodstock. The progeny of these their cytoplasmic membranes, while agranul ar cells had man for the development of bonami asis was proposed (Cochennec edulis L. Aqu aculture 34, 1- 14. oysters developed fewer B. ostreae infections of lower inten nose residues onl y. The presence of similar lectins on the sur 200 I): B. ostreae is intern alised by the three hemocyte types. Barber B.J ., Davis C., I 994, Prevalence of Bonamia ostreae in Ostrea sity relative to nai" ve oysters of a similar age, and exhibited face of B. ostreae suggests that these lectin s may play a signif Phagocytosis is directed by the hemocytes, but B. ostreae takes edulis popul ati ons in Main e. J. Shellfis h Res. 13, 298 . reduced mortality in Cork Harbour. Culloty et al. (2001 ) found icant role in hemocyte-parasite recognition and internalisati on. an active part in its internali sation. Similarity between mem Barber B.J ., Davis C.V., Carnegie R.B. , Boettcher K.J. , 2000, no relationship between B. ostreae resistance and growth rate. It is possible th at the parasite may mimic granular cell mem brane lectins suggests that B. ostreae acti vely targets agranu Management of juvenil e oyster di sease (JOD) in Maine. J. (Naciri-Graven et al. 1999, on the other hand , fo und in France branes in order to evade ph agocytosis by granular hemocytes lar cells which present relatively lower lytic enzymati c activ Shell fi sh Res. 19, 641 -645 . that oysters selected for resistance did tend to grow fas ter. ) (Cochennec 2001 ). ity. Moreover, B. ostreae seems to influence the distribution Barrow J.H. , 1965, Observati ons on Minchinia pickfordae (Barrow, In the Sydney rock oyster S. glomerata, no progress has Intern ali sati on of B. ostreae by hemocytes of both of hemocyte types, in particul ar reducing the number of cir 196 1 fo und in snail s of the Great Lakes region. Trans. Am. been made as yet in breeding for resistance to B. ro ughleyi 0 . edulis and C. gigas suggests that the barrier of speci culating granulocytes (Cochennec-Laureau et al. 2003); this Mi croscop. Soc. 84, 587-593. (Nell et al. 2000). Triploid S. glomerata, however, show re fic ity is not located onl y at the level of the hemocyte mem phenomenon requires further clarification. Once internali sed, Baud J.P. , Gerard A., Nac iri -Graven Y. , 1997 , Co mparati ve growth duced winter mortality relative to diploid animals (Hand et al. brane. Hemocytes of C. gigas appear capable of eliminating B. ostreae is "hidden" within the large agranular cell s and and mortality of Bonamia ostreae-res ista nt and wil d oysters 1998). the parasite. Chagot (1 989) fo und no difference between the can survive the relatively lower enzymati c activity levels. In Ostrea edulis in an intensive system. Mar. Biol. 130, 71-79 . 526 R.B. Carnegie and N. Cochennec-Laureau : Aquat. Li ving Resour. 17, 51 9-528 (2004) R.B. Carnegie and N. Cochenn ec-Laureau: Aquat. Livin g Resour. 17, 5 19-528 (2004) 527
Bedier E., Cochennec-Laureau N., Langlade A., Kopp J., Goyard E. , Chagot D., 1989, Caracteri sati on morphologique et fo ncti onnell e des Davis C. Y. , Crosby M.A., Barber B .J ., Hawes R.O ., 1997, Geneti c Hine P.M ., I 992, Ultrastructu ral and ultracytochemi cal observations Gerard A., 200 I, Recovery of the European fl at oyster Ostrea hemocytes cl ' Ostrea edulis et de Crassostrea gigas, mollusques selecti on in oysters fo r growth and resistance to juvenile oyster on Bonamia sp. in oysters (Tiostrea chi!e11Sis) , with a considera edulis (L. ): new development. Proceedings of the European bi va lves. Etude in vitro de leurs interacti ons avec le protozoaire di sease (JOO). J. Shell fis h Res. 16, 328-33 1. ti on of organe ll e fu ncti on. Aquaculture 107, 175-1 83. Aquaculture Society annual meeting 200 I. Bonamia ostreae (Ascetospora). These EPHE Sciences de la Vie Diggles B.K., Cochennec-Laureau N., Hine P.M. , 2003, Compari son Hine P. M., 1996, The ecology of B011 a1nia and decli ne of bivalve mol Bougri er S., Ti ge G., Bachere E., Grizel H ., 1986, Ostrea angasi ac et de la Terre, Uni v. Montpelli er, France. of diagnosti c techniques fo r Bonamia exitiosa from fl at oysters luscs. N.Z. J. Ecol. 20, 109- 11 6. climati sation to French coasts. Aquaculture 58, I 51-154. Chagot D., Boul o Y. , Hervio D. , Mialhe E., Mourton C., Grizel Ostrea chilensis in New Zealand. Aquaculture 220, 145- 156. Hine P. M. , Jones J.B., 1994, B01wmia and other aquati c parasites of Boulo Y. , Mialhe E., Rogier H., Paolucci F. , Grizel H., 1989, H. , 1992, Interacti ons between Bonamia ostreae (Protozoa: Dinamani P. , Hine P.M ., Jones J.B., 1987, The occurrence and char importance to New Zeal and. N.Z. J. Zool. 2 1, 49-56. Immunodi agnosis of Bonamia osrreae (Acetospora) infecti on of Ascetospora) and hemocytes of Osr rea edulis and Crassostrea acteri sti cs of the hemocyte parasite Bonamia sp. in New Zealand Hine P.M., Wesney B., 1992, Interrelati onshi ps of cytopl asmi c struc Osrrea edu lis L. and subcellular identificati on of epitopes by gigas (Mollusca: Bival via): entry mechani sms. J. Invert. Path ol. dredge oyster, Tiosrrea haaria . Dis. Aquat. Org. 3, 37-44. tures in Bonamia sp. (Haplosporicli a) infecting oysters Tiostrea monoclonal antibodi es. J. Fish Dis. 12, 257-262. 5 1, 207-2 14. Elston R. , Farl ey C.A., Kent M .L. , 1986, Occurrence and signi fica nce chilensis: An in terpretati on. Di s. Aquat. Org. 14, 59-68. of bonamiasis in European fl at oysters in North Bower S.M ., 1988, Circumventi on of mortalities caused by Denman Cochennec N., 1997, La Bonami ose: caracteri sation du parasite Ostrea edulis Hine P.M., Wesney B., 1994, Interacti on of phagocytosecl Bonamia Ameri ca. Dis. Aquat. Org. 2, 49-54. Island oyster di sease during mari culture of Pacific oysters. Am. Bo11 amia ostreae et etude de ses interactions avec l' hote, l' hu1tre sp. (Hapl osporidia) with haemocytes of oysters Tiosrrea chilen Elston R. A., Kent M.L. , Wilkinson M.T. , 1987, Resistance of Osrrea Fish. Soc. Spec. Pub!. 18, 246-248. pl ate Ostrea edulis. Memoire Ecole Pratique des Hautes Etucles. sis. Dis. Aquat. Org. 20, 2 19-229. edulis to Bonamia ostreae in fecti on. Aquaculture 64, 237-242. Bower S.M ., 200 I, Synopsis of infecti ous di seases and par Sciences de la Vi e et de la Terre. Montpelli er, France. Hine P.M., Wesney B., 1994, The functi onal cytology of Bonamia sp. Farley C.A., Wolf P.H., Elston R., 1988, A long-term study of " mi as ites of commerciall y expl oited shellfi sh: Mikrocytos Cochennec N., 200 I, Bonamia ostreae, parasite de l' hu1tre pl ate, (Hapl osporidi a) infecting oysters Tiostrea ch ilensis: An ul tracy crocell " di sease in oysters with a description of a new genus, roughleyi (Australian Winter Di sease) of oysters, Ostrea edulis, sa positi on taxonomique parmi Jes parasites tochemi cal study. D is. Aquat. Org. 20, 207-2 17. Mikrocytos (g. n.), and two new species, Mikrocytos mackini (sp. http: //www - sci .pac.dfo-mpo . gc. ca/ shelldis/ pages/ du groupe "Microce ll ," analyses des interacti ons ha te/parasite Hine P.M., Cochennec-Laureau N., Berthe F.C. , 200 I, Bonamia exi n. ) and Mikrocyros rough/eyi (sp. n.). Fish. Bull. 86, 58 1-593 . tiosa n. sp. (Hapl osporidi a) infecting fl at oysters, Ostrea chilen mi krouoy _ e . h tm. chez plusieurs populations cl' hu1tres plates. These de Doctoral. Farl ey C.A., Lewis E.J ., Relyea D ., Zahtila J. , Ri vara G ., 1997, sis, in New Zealand . Di s. Aquat. Org. 47, 63-72. Bower S.M ., Hervio D. , Meyer G.M., 1997, Infecti vity of Mikrocyros Bi ologie cellulaire, Universite de la Rochell e, F rance. Juvenile oyster di sease resistance studies continued: 1994-1 996. Hine P.M., Bower S.M., Meyer G .R. , Cochenn ec-Laureau N., Berthe mackini, the causati ve agent of Denman Island di sease in Pac ifi c Cochennec-Laureau N. , Au/fret M ., Renault T. , Langlade A. , 2003, J. Shellfish Res. 16, 286-29 1. F. C .J ., 200 l , Ul trastructure of Mikrocyros mackini, the cause of oysters Crassosrrea gigas, to va ri ous species of oysters. Dis. Changes in' circul ating and ti ssue-infiltrating hemocyte param Ford S.E., Tripp M.R., 1996, Diseases and defense mechani sms. Denman Island di sease in oysters Crassostrea spp. and Ostrea Aquat. Org. 29, 111-11 6. eters of European fl at oysters, Osrrea edulis, natura lly infected In: Kennedy Y. S., Newell R.I. E., Ebl e A.F. (Eds.), The Eastern spp. in British Columbia, Canada. Dis. Aquat. Org. 45, 2 15-227. Bower S.M., McGl addery S.E., Price J. M., 1994, Synopsis of infec with Bonamia ostreae. J. Invertebr. Pathol. 83, 23-30. Oyster Crassosrrea virginica. Maryland Sea Grant Coll ege, Hudson E.B., Hill B.J ., 199 1, Impact and spread of bonami asis in the ti ous di seases and parasites of commerciall y expl oited shellfish. Cochenn ec N. , Le Roux F. , Berthe F. , Gerard A., 2000, Detecti on Coll ege Park, MD. Ann . Rev. Fish Dis. 4, 1-1 99. of Bonamia ostreae based on small subunit ribosomal probe. J. Friedman C.S., Perkins F.O., 1994, Range extension of Bonamia os UK, Aquaculture 93, 279-285. Brehelin M., Bonami J.R. , Cousserans F., Vi va res C., 1982, Existence lnvertebr. Pathol. 76, 26-32. treae to Maine, USA J. Invertebr. Pathol. 64, 179- 18 1. Hugh Jones, D., 1999, Breeding ponds as a basis for flat oyster de fo rmes pl asmodiales vraies chez Bonamia ostreae parasite de Cochenn ec-Laureau N. , Reece K.S., Berthe F. C.J. , Hine P.M ., 2003, Friedman C.S., McDowell T. , Groff J.M., Hollibaugh J.T., Manzer D., (Ostrea edulis) culture and their use to develop resistance to the l' hu1tre pl ate Ostrea edulis. L.C.R. Acad. Sc., Pari s, Ser. III, 295, Mikrocyros roughleyi taxonomi c affili ati on leads to the genus Hedrick R.P., 1989, Presence of Bonamia osrreae among popu di sease Bonamia ostreae. J. Shellfish Res. 18, 7 18. 45-48. Bonamia (Haplosporicli a) . Di s. Aquat. Org. 54, 209-2 17 . lations of the Euro pean fl at oyster, Ostrea edulis, in Cali fornia, Katkansky S .C. , Dahl strom WA., Warner R.W. , 1969, Observations Bucke D. , 1988, Pathology of bonami asis. Parasit. Today 4, 174-176. Cochennec N. , Renault T. , Bouclry P., Choll et B. , Gerard A., 1998, USA. J. Shellfi sh Res. 8, 133-1 37. on survival and growth of the European flat oyster, Osrrea edulis, Bucke D., Feist S., 1985, Bonami asis in th e fl at oyster, Ostrea Bonamia-like para site in the Suminoe oyster, Crassosrrea rivu Grizel H. , Mialhe E., Chagot D., Boul o Y. , Bachere E., 1988, in Cali forni a. Calif. Fish Game 55, 69-74. edulis, with comments on hi stological techniques. In: Ellis, A.E. /aris (Gould) reared in France. Di s. Aquat. Org. 34, I 03-107. Bonami asis: A model study of di seases in marine molluscs. Am. Launey S., Barre M., Gerard A., Naciri-Graven Y. , 200 l, Populati on (Ed.), Fish and Shellfi sh Path ology, Academi c Press, London, Cochennec N., Hervio D., Panati er B., Boul o Y. , Mialhe E. , Rogier Fi sh. Soc. Spec. Pub!. 18, 1-4. bottl eneck and effecti ve size in Bonamia ostreae-res istant pop pp. 387-392. H., Grizel H ., Paolucci M., 1992, A direct monoclonal anti Grizel H ., Comps M ., Raguenes D ., Le Borgne Y., Tige G., Martin ul ati ons of Osrrea edulis as inferred by mi crosatellite markers. Bucke D., Hepper B., 1987, B011 amia ostreae infecting Ostrea /uraria body sandwich immunoassay for detecti on of Bonamia ostreae A.G. , 1983, Bilan des essais d'acclimatati on d'Ostrea chilen Gen. Res. 78, 259-270. in the U.K. Bull. Eur. Assoc. Fi sh Pathol. 7, 79-80. (Ascetospora) in hemolymph samples of the fl at oyster Osrrea sis sur Jes cotes de Bretagne. Rev. Trav. Inst. Peches Marit. 46, Le Bee C., Mazurie J., Cochennec N., Le Cogui c Y. , 199 1, Influence Burreson E.M., Stokes N.A., Carnegie R.B., Bishop M .J., 2004, edulis (Mollusca: Bivalvia). Dis. Aquat. Org. 12, 129-1 34. 209-225. of Crassostrea gigas mj xecl with Ostrea edulis on the incidence Bonamia sp. (Haplosporidi a) Foun d in Nonnative Oysters Comps M., Ti ge G. , Grizel H., 1980, Etucle ultrastructu ra le cl ' un pro Hanel R. E., Nell J. A., Smith I.R., Maguire G.B., 1998, Studies on of Bonamia di sease. Aquaculture 93, 263-27 1. triploicl oysters in Australia. XI. Survival of cliploicl and triploicl Crassostrea ariakensis in Bogue Sound, North Carolina. J. ti ste de l' hu1tre Ostrea edulis L. C. R. Acacl . Sc. Pari s, Ser. D, 290. Le Borgne Y. , Le Pennec M., 1983, Elevage experimental de l' hu1tre Aquat. Anim. Health 16, 1-9. 383-384. Sydney rock oysters (Saccostrea commercialis (Iredale and asiatique Ostrea denselamellosa (Li schke). Vi e Marine 5, 23-28. Roughley)) through outbreaks of winter mortality caused by Caceres-Martinez J. , Robledo J .A.F. , Figueras A. , 1995 , Presence of Cronin M.A., Culloty S. C., Mulcahy M .F. , 200 I, Lysozyme acti vity Martin A.G. , Gerard A., Cochennec N. , Langlade A., 1993, Selecting Mikrocytos roughleyi infestation. J. Shellfish Res. 17 , 334-336. Bonamia and its relati on to age, growth rates and gonadal de and protein concentration in the haemolymph of the fl at oyster flat oysters, Ostrea edulis, for survival against the parasite Haskin H.H., Ford S.E., 1978, Mortality patterns and di sease velopment of the fl at oyster, Osrrea edulis, in the Ri a de Vi go, Ostrea edulis (L. ). Fish Shellfi sh Imm. 11 , 6 11-622. Bonamia ostreae: assessment of the resistance of a fi rst selected resistance in Delaware Bay oysters. Proc. Natl. Shellfi sh Gali cia (NW Spain ). Aquaculture 130, I 5-23. Cull oty S.C., Mulcahy M.F., 1992, An evalu ation of anaestheti cs fo r generati on. Eur. Aquac. Soc. Spec. Pub!. 18, 545-554. Assoc. 68, 80. Campalans M ., Rojas P., Gonzalez M ., 2000, Haemocyti c parasito L. 4th Intern al. Coll oq. Marine Aquaculture, Vi go McArdle J. F., McKj ern an F. , Foley H., Hugh Jones D., 199 1, The cur Osrrea edulis Haskin H.H., Ford S.E., 1979, Development of resistance to sis in the fa rmed oyster Tiostrea chilensis. Bull. Eur. Assoc. Fish (Pontevedra), Spain . rent statu s of Bonamia di sease in Ireland . Aquaculture 93, 273- Minchinia ne/soni (MSX) mortalities in laboratory-reared and na Pathol. 20, 3 1-33. 278. Cull oty S.C., Mulcahy M.F., 1996, Season-, age- and sex-related va ri ti ve oyster stocks in Delaware Bay. Mar. Fish. Rev. 4 1, 54-63. Mialhe E., Bachere E., Chagot D., Grizel H. , 1988, Isolation and pu Carnegie R.B. , Barber B.J., Di stel D.L. , 2003, Detecti on of th e oys ati on in the prevalence of bonami asis in fl at oyster (Ostrea edulis) Hervio D. , 1992, Contribution a l'etude de Bonamia ostreae rificati on of the protozoan Bonamia ostreae (Pichot et al. 1980), ter parasi te Bonamia osrreae by flu orescent in siru hybridization. L. on th e south coast of Ireland . Aquaculture 144, 53-63. (Ascetospora), protozoaire parasite de l' hu1tre pl ate Ostrea edit/is a parasite affecting the fl at oyster Ostrea edulis L. Aquaculture Di s. Aquat. Org. 55, 247-252. Cull oty S.C., Cronin M.A., Mulcahy M.F. , 2001 , An investigati on (Bival via), et a ]'analyse des interacti ons ha te-parasite. These de 71 , 293-299. Carnegie R.B., Barber B.J., Cull oty S.C., Fi gueras A.J., Distel D.L., into the relati ve resistance of Irish fl at oysters Ostrea edulis, L. 3eme cycle en Biologie foncl amentale et appliquee (Specialite: Mialhe E., Boul o Y. , Elston R. , Hill B., Hine M ., Montes J. , Van 2000, Development of a PCR assay for detecti on of the oyster to the parasite Bonamia ostreae (Pi chot et al. 1980). Aquac ulture Protistologie), Universite de Clermont Ferrand, France. Banning P., G ri zel H ., 1988, Serological analysis of in path ogen Bonamia ostreae and support for its inclusion in th e 199, 229-244. Hervio D. , Bower S.M ., Meyer G.R., 1996, Detection, isolation, Bonamia Haplosporidia. Di s. Aquat. Org. 42, 199-206. Cull oty S.C., Duggan P.F. , Quishi X., Mulcahy M.F., 2002, Amylase and experimental transmi ssion of Mikrocytos mackini, a mi cro Ostrea edulis and Tiostrea lutaria usin g polyclonal and mono clonal antibodi es. Aquat. Li ving ResoUI·. I, 67-69. Carnegie R.B., Meyer G.R. , Blackbourn J., Cochennec-Laureau N., and aspartate aminotra nsferase in the haemolymph of the cell parasite of Pacifi c oysters Crassosrrea gigas (Thunberg). J. Montes P. , 1990, Development of parasitosis of fl at Bower S. M., 2002, Development and appli cati on of a PCR fo r Euro pean fl at oyster Ostrea edulis. Fish Shellfi sh Immunol. 12. Invertebr. Pathol. 67, 72-79. Boncunia ostreae Mikrocyros mackini, the causative agent of Denman Island di s 367-369. Hine P.M., 199 1, The annual pattern of infecti on by Boncunia sp. oyster, Osrrea edulis, from Galicia, Northwest Spain . In: Perkins ease in oysters. J. She ll fis h Res. 2 1, 387. Cull oty S.C., Novoa B., Pern as M ., La ngshaw M., Mulcahy M.F.. in New Zealand fl at oysters, Tiostrea chilensis. Aquaculture 93, F. O., Cheng T.C. (Eels.), Pathology in Marine Science. Academic Carnegie R.B., Meyer G.R., Bl ackbourn J., Cochennec-Laureau N., Feist S. W. , Figueras A., 1999, Susceptibility of a number of bi 24 1-25 I . Press)nc., San Diego, CA. Berthe F.C.J ., Bower S.M., 2003, Molecul ar detecti on of the oys va lve species to the protozoan parasite Bonamia ostreae and thei r Hine P.M., 199 1, Ul trastructu ral observati ons on the annual infec Montes J., Melendez I., 1987, Donnes sur la parasitose de Bonamia ter parasite Mikrocytos mackini, and a preliminary phylogeneti c abili ty to act as vectors fo r thi s parasite. Di s. Aquat. Org. 37. ti on pattern of Bonamia sp. in fl at oysters Tiostrea chilensis. Dis. osrreae chez l' huitre pl ate de Gali ce, Cote Norcl-Ouest de analys is. Di s. Aquat. Org. 54, 2 19-227. 73-80. Aquat. Org. 11 , 163- I 7 1. l'Espagne. Aquaculture 67, 195- 198. 528 R.B. Carnegie and N. Cochennec-Laureau: Aquat. Living Resour. 17, 51 9-528 (2004)
Montes J., Anandon R., Azevedo C. , 1994, A possi bl e li fe cycle for Perki ns F.O., 1979, Cell structure of shellfi sh pathogens and Bonamia ostreae on the basis of electron microscopy stu dies. J. hyperparasites in the genera Minchinia, Urosporidium, Invertebr. Pathol. 63, 1-6. Haplosporidium, and Marteilia: Taxonomi c im plications. Morri s D.J., Adams A., Richards R.H., 2000, Observations on the Mar. Fish. Rev. 4 1, 25-37. electron-dense bodies of the PKX parasite, agent of proliferative Perkins F.O., 1987, Protistan parasites of commerciall y signifi kidney disease in salmoni ds. Dis. Aquat. Org. 39, 201-209. cant marine biva lves, life cycles, ul trastructure, and phylogeny. Mourton C., Boul o V. , Chagot D ., Hervio D., M ialhe E., Grizel Aquacul ture 67, 240-243. H., 1992, Interactions between Bonamia ostreae (Protozoa: Perkins F.O., 1988, Structure of protistan parasi tes found in biva lve Ascetospora) and haemocytes of Ostrea edulis and Crassostrea molluscs. Am. Fish. Soc. Spec. Pub!. 18, 93 -111 . gigas (Mollusca: Biva lvia): in vitro system establi shment. J. Pichot Y. , Comps M., Grizel H., Raboui n M.A., 1980, Recherches sur Invertebr. Pathol. 59, 235-240. Bonamia ostreae, gen. n. sp. n., parasite nouveau de l' huitre plate Naciri Y. , 1994, Selection des mollusques: Bil an et nouvell es per Ostrea edulis L. Rev. Trav. Inst. Peches Mari t. 43, 13 1-140. specti ves concernant la croissance, la qualite et les res istances Poder M., Cahour A., Balouet G. , 1982, Hemocytic parasitosis in aux maladies. Bordeaux Aquacul ture, pp. 54-6 1. European oyster Ostrea edulis L. : pathology and contamina Naciri-Graven Y. , Haure J., Gerard A., Baud P., 1999, Comparative tion. Proceedings of the 15th annual meeting of the Society for growth of Bonamia ostreae resistant and wil d fl at oyster Ostrea Invertebrate Pathology, Brighton, UK, pp. 254-257. edulis in an intensive system. II. Second year of the experiment. Reece K.S ., Stokes N .A., 2003, Molecul ar analysis of a haplosporid Aquacul ture 17 1, 195-208. ian parasite from cul tured New Zealand abalone (Haliotis iris Naci ri-Graven Y. , Launey S., Lebayon N., Gerard A., Baud J.-P., Martyn, 1784). Dis. Aquat. Org. 53, 6 1-66. 2000, In fl uence of parentage upon growth in Ostrea edulis: ev Renault T. , Cochennec N ., Gri zel H. , 1994, Bonamia ostreae, para idence for inbreeding depression. Gen. Res. 76, 159-1 68. site of the ,E uropean fl at oyster, Ostrea edulis, does not experi Naciri-Graven Y., Martin A.G., Baud J.P. , Renaul t T. , Gerard A., mentall y infect the Japanese oyster, Crassostrea gigas. Bull. Eur. 1998, Selecting the fl at oyster Ostrea edulis (L.) for surviva l Assoc. Fish Pathol. 15, 78-80. when infected with the parasite Bonamia ostreae. J. Exp. Mar. Rogan E. , Cull oty S.C., Cross T.F., Mul cahy M.F. , 199 1, The detec Biol. Ecol. 224, 9 1-1 07. tion of Bonamia ostreae (Pichot et al. 1980) in frozen oysters Nell J.A., Smith I. R. , McPhee C.C. , 2000, The Sydney rock oys (Ostrea edulis L.) and the effect of the parasite on condition. te r Saccostrea glomerata (Gould, 1850) breeding programme: Aquacul ture 97, 3 11-3 15. progress and goals. Aqu ac. Res. 31, 45-49. Roughl ey TC., 1926, An investigation of the cause of an oyster mor 6 Foighil D., Taylor D.J., 2000, Evolution of parental care and ovu tality on the Georges Ri ver, New South Wa les, 1924-25. Proc. lation behavior in oysters. Mo!. Phylog. Evol. 15, 30 1-3 13. Linn . Soc. N.S.W. 5 1, 446-49 1. 6 Foighil D., Marshall B.A. , Hilbi sh T. J., Pino M.A., 1999, Trans Sprague V., 1979, Classification of the Hapl osporidia. Mar. Fish. Rev. Pacifi c range extension by rafting is inferred for the flat oyster 4 1, 40-44. Ostrea chilensis. Biol. Bull. 196, 122- 126. Tige G. , Gri zel H. , 1984, Essai de contamination ct 'Ostrea edulis Office In tern ati onal des Epizooti es (O.I.E.), 2000, Intern ational Linne par Bonamia ostreae (Pichot et al. 1979) en Riviere de aq uatic animal health code, fis h, molluscs, and cru staceans. 3rd Crach (Morbihan). Rev. Trav. Inst. Peches Marit. 46, 307-3 17. edition, Pari s, France. Van Banning P., 1986, Case-history of the Bonamia ostreae control in Offi ce Intern ati onal des Epizooties (0.I.E.), 2003, the Dutch oyster cul ture. E ur. Aquac. Soc. Spec. Pub !. 9, 23-27. International aquatic animal health code 2003, Van Banning P., 1990, The li fe cycle of the oyster pathogen Bonamia http ://www. oie.int/ eng/ normes/f code/ A_©©©4 5 .htm. ostreae with a presumptive phase in the ovari an ti ssue of the Pascual M., Marti n A.G., Zampatt i E., Coatanea D ., Defossez European fla t oyster, Ostrea edulis. Aquacul ture 84, 189- 192. J. , Robert R., 199 1, Testing of the Argenti na oyster, Ostrea Xue Q. , 1998, Caracteri sati on morphologique et fo nctionnell e des he puelchana, in several French oyster farming sites. Intern ational mocytes chez l' huitre plate, Ostrea edulis. These de Doctorat de Coun c. for the Exploration of the Sea, Shell fis h Comm., l'Institut Uni versitaire Europeen de la Mer, Brest, France. Copenhagen, Denmark. Zabaleta A., Barber B.J., 1996, Prevalence, intensity and detecti on of Paynter K.T., Gaffney P.M., Meri tt D.W., 1997, Evaluation of Bonamia ostreae in Ostrea edulis L. in the Damariscotta River Ameri can oyster stocks: Disease resistance and genetics. J. area, Maine. J. Shell fis h Res. 15, 395-400. Shell fis h Res. 16, 329-332.