Regulation of Androgen Signaling and Cholesterol

REGULATION OF ANDROGEN SIGNALING AND CHOLESTEROL

METABOLISM BY MIR-149-5P IN PROSTATE CANCER

SAVITA SINGH

Bachelor of Science in Industrial Chemistry

Aligarh Muslim University

2007

Master of Science in Biotechnology

Aligarh Muslim University

2009

Submitted in partial fulfillment of requirements for the degree

DOCTOR OF PHILOSOPHY IN REGULATORY BIOLOGY

Specialization in Cellular and Molecular Medicine

at the

CLEVELAND STATE UNIVERSITY

DECEMBER 2017 We hereby approve this dissertation for

Savita Singh

Candidate for the Doctor of Philosophy in Regulatory Biology degree for the

Department of Biological, Geological and Environmental Sciences and

CLEVELAND STATE UNIVERSITY College of Graduate Studies

______Date: ______

Dr. Girish C. Shukla, GRHD/BGES, Cleveland State University Dissertation Chairperson and Major Advisor

______Date: ______

Dr. Roman V. Kondratov, GRHD/BGES, Cleveland State University Advisory Committee Member

______Date: ______

Dr. Anton A. Komar, GRHD/BGES, Cleveland State University Advisory Committee Member

______Date: ______

Dr. Justin Lathia, Department of Cellular and Molecular Medicine, Lerner Research Institute Advisory Committee Member

______Date: ______

Dr. Crystal M. Weyman, GRHD/BGES, Cleveland State University Internal Examiner

______Date: ______

Dr. Bin Su, Department of Chemistry, Cleveland State University

External Examiner

Date of Defense: December 5th 2017

Dedication

This work is dedicated to every single person in the pursuit of knowledge who understands objectivism, and its implications in making a better society

Acknowledgements

When I started to think of writing acknowledgment, recent experiences came to mind, but

I would not have the current experiences if it weren't for the people who paved my way to this journey and helped at multiple steps before the graduate school began. I am very fortunate to have the right people at the right time in my life who mentored me selflessly as a young student and believed in me. It is my goal to be able to add enough value to the society, so I can prove them right and proud of their decision in helping me in my growth.

I would like to begin with thanking my teachers in school, who recognized the talent in me and always motivated the “introverted me” to do better and my very supportive family members who have trusted me all along in my pursuit for a better future. Like most Ph.D. students, my journey has been through ups and downs, but I have been fortunate to have supportive mentors here at CSU as well.

I am thankful to Dr. Crystal Weyman and Dr. Shukla, who has helped me during a difficult time of switching labs a few years ago. Dr. Shukla has motivated me at a very critical time during the graduate school. His wise suggestions about a smooth Ph.D. experience and beyond, regarding seeking employment and fulfillment in life are handy, though sometimes hard to understand until the student reaches a certain level of understanding. I am also thankful to Dr. Komar, his detail oriented understanding of scientific questions and enthusiasm about promoting the growth of the department are extraordinary and as a student, I have learned many things just by observing him as well. Dr. Kondratov has been very supportive, and his constructive criticism has helped me make advances in the project.

Dr. Lathia’s suggestions in committee meetings and help with TCGA data analysis was beneficial. Every visit to his lab inspires me to do better. I read this quote on this lab board

once, which goes like “success is not owned, its leased” it may look straightforward, but it was very inspiring to see it on a lab board. I am also thankful to the faculty members of the department, Dr. Mazumder and Dr. Severson for their insights in my work during GRHD presentations. I am grateful to my lab mates and fellow Ph.D. students for providing a collegial work environment and my good friend Sajina who has always been around for support and care.

REGULATION OF ANDROGEN SIGNALING AND CHOLESTEROL

METABOLISM BY MIR-149-5P IN PROSTATE CANCER

SAVITA SINGH

ABSTRACT

Prostate cancer growth and proliferation depend on androgen signaling mediated by transactivation of androgen receptor (AR). Androgen ablation remains the mainstay therapy for treatment of the disease. However, despite androgen ablation, the disease relapses to more aggressive form known as castration-resistant prostate cancer (CRPC).

Androgen Signaling Inhibitor (ASI) such as abiraterone and enzalutamide are the most effective treatment methods for CRPC. However, more than one-third of CRPC patients develop resistance to these treatments mostly due to the gain of function in the AR protein and increase in intratumoral dihydrotestosterone (DHT) synthesis. Intratumoral DHT synthesis from steroid precursors in tumors is augmented by up-regulation of intracellular cholesterol promoted by SREBP1, and its regulated genes together with an influx of cholesterol supported by SCARB1. Tumor-specific downregulation of microRNAs which control the AR and steroid biosynthesis appears to promote tumor growth and resistance to therapeutics in CRPC. We have investigated the role of miR-149-5p for its anti- proliferative potential in PCa. We have observed down-regulation of miR-149-5p in prostate tumors and discovered that it targets AR and key proteins involved in maintaining cholesterol homeostasis, such as SREBP1, HMGCR, HMGCS1, and SCARB1. Ectopic expression of miR-149-5p inhibits invasion and proliferation of PCa cells, alone as well as

vi in combination with AR antagonist enzalutamide. We further explored the regulation of

AR signaling and cholesterol metabolism by miR-149-5p in a PCa mice model. Our results indicate a significant suppression of intratumoral cholesterol, testosterone, and DHT in tumors treated with miR-149-5p, indicating its tumor suppressive function. This study provides evidence that miR-149-5p may serve as an adjuvant therapeutic agent for CRPC in combination with ASIs.

vii

TABLE OF CONTENT

ABSTRACT ...... vi

LIST OF TABLES ...... xii

LIST OF FIGURES ...... xiv

LIST OF ABBREVIATIONS ...... xvi

CHAPTER I ...... 1

INTRODUCTION ...... 1

1.1 Introduction to prostate cancer ...... 1

1.2 Prostate cancer diagnosis and biomarkers ...... 2

1.3 Molecular staging of PCa progression and role of the molecular drivers ...... 5

1.4 Role of androgen receptor and other molecular drivers in PCa progression ...... 7

1.5 Current therapeutics ...... 8

1.6 Regulation of cholesterol homeostasis and intratumoral androgen synthesis .. 10

1.7 Pathways of steroid biosynthesis and their modification in PCa ...... 12

1.8 microRNAs and their role in PCa therapeutics ...... 15

1.9 References ...... 18

CHAPTER II ...... 32

MIR-149-5P REGULATES AR FUNCTION, CELL PROLIFERATION AND

INVASIVE POTENTIAL OF PCA CELLS...... 32

2.1 Abstract ...... 32

viii

2.2 Introduction ...... 34

2.2.1 Androgen receptor signaling ...... 34

2.2.2 Alterations in AR signaling leading to resistance to ADT ...... 35

2.2.3 Androgen receptor amplification ...... 36

2.2.4 Mutations and splice variants of androgen receptor ...... 37

2.2.5 Androgen receptor regulation by cofactors...... 39

2.2.6 Non-genomic androgen receptor signaling ...... 39

2.2.7 Tumor suppressive role of miR-149-5p in PCa and perspective for bettering

PCa therapeutics...... 41

2.3 Materials and Methods ...... 43

2.3.1 Cell lines ...... 44

2.3.2 RNA extraction ...... 44

2.3.3 Reverse transcription and TaqMan microRNA assays ...... 44

2.3.4 In-silico analysis ...... 45

2.3.5 Reverse transcription and qPCR ...... 45

2.3.6 Quantitation of prostate specific antigen by qPCR ...... 46

2.3.7 Quantitation of prostate specific antigen in cell culture supernatant ...... 46

2.3.8 Western blotting ...... 47

2.3.9 Construction of reporter plasmids and luciferase assay ...... 47

2.3.10 Cell viability assay ...... 48

2.3.11 BrdU proliferation assay ...... 49

2.3.12 Colony formation assay ...... 49

2.3.13 Matrigel invasion assay...... 49

2.2.14 Statistical analysis ...... 50

2.4 Results ...... 50

2.4.1 Downregulation of miR-149-5p in PCa ...... 50

2.4.2 Functional annotation of the predicted targets of miR-149-5p indicates a

significant role in AR signaling, regulation by SREBP1 and steroid biosynthesis .. 52

2.4.3 miR-149-5p downregulates AR protein and mRNA in PCa cells ...... 53

2.4.4 miR-149-5p represses the transactivation function of AR ...... 55

2.4.5 miR-149-5p targets AR expression by binding to its 3’UTR ...... 57

2.4.6 miR-149-5p effects cell viability and proliferation of the PCa cells ...... 58

2.4.7 miR-149-5p controls PCa cell migration and invasion ...... 61

2.5 Discussion ...... 63

2.6 References ...... 66

CHAPTER III ...... 75

MIR-149-5P REGULATES INTRATUMORAL CHOLESTEROL AND

TESTOSTERONE IN PCA ...... 75

3.1 Abstract ...... 75

3.2 Introduction ...... 77

3.2.1 Role of SREBP1 in prostate cancer ...... 77

3.2.2 Cholesterol homeostasis and its implications in CRPC ...... 79

3.2.3 Potential role of miR-149-5p in maintaining cholesterol homeostasis ...... 83

3.3 Materials and Methods ...... 85

3.3.1 Cell lines ...... 85

3.3.2 Reverse transcription and qPCR ...... 85 x

3.3.3 Western blot analysis ...... 86

3.3.4 Construction of reporter plasmids and luciferase assay ...... 86

3.3.5 Xenograft studies ...... 87

3.3.6 Amplex™ red cholesterol assay ...... 88

3.3.7 ELISA for intratumoral testosterone ...... 88

3.3.8 Sample preparation for Liquid Chromatography-Tandem Mass Spectrometry

(LC-MS) assay ...... 88

3.3.9 LC/MS analysis of cholesterol and DHT ...... 89

3.3.10 Statistical analysis ...... 90

3.4 Results ...... 90

3.4.1 miR-149-5p downregulates the expression of SREBP1, HMGCS1, HMGCR

and SCARB1 in PCa cells...... 90

3.4.2 Target validation for SREBP1, HMGCS1, HMGCR and SCARB1 ...... 92

3.4.3 miR-149-5p suppresses 22Rv1 xenograft growth by downregulating AR,

HMGCS1, and SCARB1 ...... 94

3.4.4 miR-149-5p reduces intratumoral cholesterol and testosterone in 22Rv1

xenografts ...... 96

3.4.5 RNA sequencing analysis indicates miR-149-5p regulates genes involved in

steroid biosynthesis, oxidative phosphorylation, and PCa ...... 98

3.5 Discussion ...... 101

3.6 Summary and conclusion ...... 106

3.6.1 Summary of the major findings ...... 106

3.7 References ...... 109

APPENDIX ...... 122

A. List of Primers...... 123

xii

LIST OF TABLES Table Page

I. Stages of PCa as per Gleason score, clinical categories and recommended treatment

options ...... 4

II. List of microRNAs known to have tumor suppressive function and downregulated

in PCa progression ...... 16

III. List of primers ...... 123

xiii

LIST OF FIGURES

Figure Page

1. Representation of the step-wise progression of PCa ...... 6

2. The sequential staging of disease and therapies with the timeline of

development...... 10

3. Steroidogenic pathways for synthesis of testosterone from cholesterol ...... 14

4. Androgen receptor signaling ...... 35

5. Mechanism of AR signaling in prostate cancer cells, depicting different

mechanisms of acquired modifications ...... 36

6. Schematic representation of AR gene, protein, and various LBD truncated and LBD

mutant AR variants...... 38

7. Non-genomic AR signaling in PCa cells ...... 41

8. Schematic representation of precursor miR-149-5p and its alignment with various

vertebral pre-miR-149 transcripts ...... 42

9. Expression analysis of miR-149-5p in PCa tumor samples and PCa cell lines ..51

10. Functional annotation of predicted targets of miR-149-5p by

ConsensusPathDB ...... 52

11. miR-149-5p downregulates endogenous AR expression...... 54

12. miR-149-5p suppresses AR transactivation and downregulates PSA expression

both, at mRNA and protein levels in PCa cells ...... 56

13. AR is a direct target of miR-149-5p ...... 58

14. miR-149-5p regulates the growth of PCa cells ...... 60

15. miR-149-5p impairs cell migration and invasion ...... 62

xiv

16. Regulation cholesterol homeostasis by sterol regulatory element binding protein

(SREBP) ...... 79

17. de novo cholesterol synthesis from acetyl-CoA ...... 81

18. A model for miR-149-5p mediated regulation of AR signaling, and regulation of

intracellular cholesterol and androgen levels...... 84

19. miR-149-5p reduces mRNA and protein levels of SREBP1 and FASN, and

suppresses HMGCS1, SCARB1 and HMGCR expression in LNCaP cells...... 91

20. SREBP1, HMGCS1, SCARB1 and HMGCR are direct targets of

miR-149-5p...... 93

21. miR-149-5p suppresses 22Rv1 xenograft growth...... 95

22. miR-149-5p suppresses AR, HMGCS1 and SCARB1 expression and

regulates intratumoral cholesterol, testosterone and DHT levels

in 22Rv1 xenografts...... 97

23. miR-149-5p regulated pathways in 22Rv1 xenografts ...... 99

24. Model representing the therapeutics advantages of miR-149-5p over second-

generation ADT ...... 107

LIST OF ABBREVIATIONS

PCa Prostate Cancer

DHT Dihydrotestosterone

AR Androgen Receptor

ADT Androgen deprivation therapy

CRPC Castration-Resistant Prostate Cancer

PSA Prostate specific antigen

DRE Digital rectal examination

GnRH Gonadotropin-releasing hormone

LHRH Luteinizing hormone-releasing hormone miRNAs microRNAs

3’UTR 3’ Untranslated region

ARE Androgen response elements

NTD N-terminal transregulation domain

CTD C-terminal domain

DHEA Dehydroepiandrosterone

ENZ Enzalutamide

DMSO Dimethyl sulfoxide

TRUS Transrectal ultrasound

PSMA Prostate-specific membrane antigen

GSTP1 Glutathione S-transferase P1

RASSF1A Ras-association domain family protein isoform A

TGF-β1 Transforming growth factor β1 xvi

IL-6 Interleukin-6

PIN Prostatic intraepithelial neoplasia

PIA Proliferative inflammatory atrophy

DBD DNA binding domain

SREBPs Sterol regulatory element-binding proteins

LDL Low-density lipoprotein

HDL High-density lipoprotein

SCARB1 Scavenger receptor class B type 1

HMG-CoA 3-hydroxy-3-methylglutaryl-CoA

HMGCR HMG-CoA reductase

ACAT Acetyl-CoA aceyltransferase

SRD5A 1,2 5α reductases1 and 2

PI3K Phosphatidyl-inositol 3-kinase

ETS E26 transformation-specific

CDKN1B Cyclin-dependent kinase inhibitor 1B

PTEN Phosphatase and tensin homolog

BCL-2 B-cell lymphoma 2

RP Radical prostatectomy

EBRT External beam radiotherapy

HSD17B 17β-Hydroxysteroid dehydrogenases

3αHSD 3α hydroxysteroid dehydrogenases

xvii

CHAPTER I

INTRODUCTION

1.1 Introduction to prostate cancer

Prostate cancer (PCa) is a heterogeneous disease and the most commonly diagnosed non- cutaneous malignancy in men. The estimated cases of PCa for the current year exceed over

160,000. The alarmingly high incidence rate of 2.9 million current PCa cases has driven

PCa research in the area focused on molecular origin, prognosis, and risk assessment. Some of the common risk factors for PCa include age, race, and familial history (Bostwick, et al.

2004). Very few cases are reported in men less than 50 years of age, a majority of diagnosis is made in the population of 65 years and older age group (Nelen). This is one of the reasons

PCa is considered an aging-associated disease. The decline in metabolism, adaptive immunity and chronic inflammation with progressing age could explain the positive correlation between the risk of PCa and aging (Gomez, et al. 2008; Kazma, et al. 2012). A family history of multiple first-degree relatives affected with prostate cancer also increases the risk of PCa (Ghadirian, et al. 1997; Stanford and Ostrander 2001). Racial disparities in

PCa are attributed to genetic variations in androgen receptor (AR), RNase L, macrophage scavenger receptor 1 (MSR1) gene and socioeconomic factors. These factors lead to about

1 60% higher rates of PCa observed in African American men when compared to the white men (Singh, et al. 2017). It is essential to determine the risk factors, and molecular drivers of PCa as tumor progression and responsiveness to therapeutics largely varies due to these factors.

Prostate gland comprises several types of epithelial cells, which includes luminal, basal and endocrine cells (di Sant'Agnese 1998; McNeal 1988). PCa can originate from either the basal or luminal cells of origin (Goldstein, et al. 2010). Each cell-of-origin represents distinct molecular subtype as identified by genomic analyses and therefore impacts patient outcome. The heterogeneity imparted by multifocal nature of PCa is important to consider in the profiling of PCa tumors, which is performed by Gleason score. Gleason score is a highly accepted grading scheme for the classification of adenocarcinoma of the prostate.

Gleason score profiling includes classification based on two geographically distinct foci of differential histological type (Epstein, et al. 2016; Ojo, et al. 2015). As shown in table 1,

Gleason score profiling along with information about biomarkers, such as the Prostate specific antigen (PSA) helps in categorizing tumors for stage-specific treatment.

1.2 Prostate cancer diagnosis and biomarkers

Early diagnosis of PCa presents medical challenges as PCa is rarely symptomatic in the early stages, symptoms start to appear often when the disease has extended to localized tissues or when it has become metastatic. Urinary obstruction is usually one of the early symptoms. Symptoms of a metastatic disease involve bony pain, anemia, and obstruction of lymph nodes. In the past 15 years, because of the availability of PSA as one of the early markers, the percentage of people presenting symptoms has decreased compared to the

2 diagnosis made (Ablin, et al. 1970). PSA is a kallikrein 3 serine protease, it is secreted in seminal fluid and produced by ductal and acinar cells of the epithelium of prostate gland.

PSA is produced in healthy as well as in neoplastic conditions. PSA is not highly specific, increased concentrations have been reported in benign hyperplasia (BPH) patients as well

(Papsidero, et al. 1980), which resulted in 18-28% of false negative results observed in screening method which solely relied on PSA. Therefore, to enhance the specificity of PSA testing, a combination of other methods of testing is employed.

Other methods of screening for PCa include transrectal ultrasound (TRUS), digital rectal examination (DRE), and quantification of prostate-specific membrane antigen (PSMA) by protein biochip immunoassay. PSMA is a transmembrane glycoprotein expressed in prostate epithelial cells (Shariat, et al. 2002), higher expression of PSMA correlates with the grade of PCa tumor (Burger, et al. 2002). Other molecular markers include quantification of the methylation status of glutathione S-transferase P1 (GSTP1), ras- association domain family protein isoform A (RASSF1A) and retinoic acid receptor β2

(RARB) in urine samples (Hessels and Schalken 2013). Insulin growth factors-2 and -3

(IGF-2 and -3) have also been implicated in clinical diagnosis relating to the aggressiveness of PCa. Plasma concentrations of IGF-2 and -3 are known to be associated with disease progression. IGF-3 inversely correlates with the disease progression; it is expressed at a minimal level in bone metastatic PCa compared to the localized disease (Shariat, et al.

2002). Transforming growth factor β1 (TGF-β1) and interleukin-6 (IL-6) have also been identified as markers, with positive correlation to PCa progression (Giri, et al. 2001; Perry, et al. 1997). Better development of tumor stage and subtype-specific biomarker in PCa requires a detailed understanding of the molecular determinants of PCa progression. 3 Stage Clinical Gleason Tumor Treatment Recurrence Stage score characteristics option free 5-year survival rate I T1a, M0, 2-4 Small cancer that Active N0 grow very slowly and surveillance, 100% may never cause and radical symptoms or health prostatectomy, issues. Low risk, Radiation PSA < 10ng/mL therapy

II T1a, 5-10 Localized tumors in Repeat T1b-T2, prostate but larger observation, 88% N0, M0 than stage I. radical Intermediate risk, prostatectomy, PSA 10-20ng/mL Radiation therapy III T3, N0, 2-10 Tumors spread External beam M0 outside prostate radiation + 48% gland but yet not ADT, ADT spread to other alone, radical organs. High risk. prostatectomy, PSA > 20ng/mL clinical trial precipitation IV T4, M1, 2-10 Tumors spread to ADT alone, 26% N1 bladder, rectum, TURP, clinical lymph nodes and trial bone metastasis. precipitation Metastatic disease

Table 1: Stages of PCa as per Gleason score, clinical categories and recommended treatment options. Clinical staging of PCa into low-risk, intermediate risk and high-risk tumors based on characteristics of tumors and Gleason score profiling indicates androgen deprivation therapy (ADT) is often initiated post intermediate risk stage. ADT incurs 5- year survival rate of about 48% in regional metastatic stages and relatively low recurrence- free survival rate of 26% in metastatic cases.

1.3 Molecular staging of PCa progression and role of the molecular drivers

The research focused on providing a better understanding of the molecular progression of prostate carcinogenesis has led to the identification of multiple models of step-wise progression. One of the complete model in terms of the molecular determinants, though not fully validated by case studies is presented in figure 1. This model suggests that progression of PCa begins with proliferative inflammatory atrophy (PIA) stage. PIA leads to prostatic intraepithelial neoplasia (PIN) and the high-grade PIN (hgPIN) leads to prostate cancer. Inflammation contributes to the development of high-risk PIA lesions. These regions of PIA don’t yet acquire genetic mutations, however, show upregulation of Bcl-2 and GSTP1, and downregulation of phosphatase and tensin homolog (PTEN), NKX3.1

(Bethel, et al. 2006; De Marzo, et al. 1999) and cyclin-dependent kinase inhibitor 1B

(CDKN1B) (Ruska, et al. 1998) (shows in normal to PIA transition in Figure 1). PIA has been proposed to lead to PIN lesions, PIA lesions are reported in one-third of the PCa biopsy samples studied (Servian, et al. 2015). However, not much molecular or histological evidence is available to demonstrate a transition from PIA to PIN. The transition from PIN to the formation of a precancerous lesion is relatively well studied. The PIN is characterized by thickening of epithelial layer and loss of distinction between basal and secretory layers.

PIN exhibits similar aberrant differentiation as in PCa (Eminaga, et al. 2013) and a comparative expression profile of biologically connected genes (Tomlins, et al. 2007). For instance, E26 transformation-specific (ETS) family transcriptional targets were predominantly upregulated in the PIN and exhibited a similar pattern of expression in PCa

(Tomlins, et al. 2007). The excessive proliferation of cells in PCa begins due to

5 deregulation in apoptotic pathways, where AR plays a key role. AR signaling is active in both, PCa and PIN. The conversion rate of hgPIN into prostate cancer has also been investigated. Herawi, et al. repeated biopsies 1 year following the diagnosis of neoplasia and demonstrated that only ~13% of PIN lesions had progressed into cancer (Herawi, et al.

2006). This result indicates, despite the correlation in molecular details PIN doesn’t necessarily lead to PCa.

Figure 1: Representation of the step-wise progression of PCa. Progression from normal prostate tissues to PIA is regulated by the expression of Bcl2, GSTP1, PTEN, NKX3.1, and CDKN1B. Progression from PIA to PIN is mainly dependent on ETS transcription factor family dysregulation. Progression from PIN to cancer comprises of AR

6 amplification, ERG gene fusion, PTEN, NKX3.1 CDKN1B deletion and SPOP mutation as the most common mechanism. (adapted from Antonarakis, et al. 2017).

1.4 Role of androgen receptor and other molecular drivers in PCa progression

Each one of the genes presented in the model (Figure 1) acts as an independent driver of

PCa progression, contributing to different subtypes of tumors. For instance, amplification of the AR gene at rates varying from 20% to 58% is observed in multiple different studies in PCa. Prostate cancer growth and progression is stimulated by androgens, which activate transcription function of AR (Brinkmann, et al. 1989). Androgens and AR regulate genes involved in the development and maintenance of prostate gland and therefore serve as a key factor in prostate carcinogenesis as well. Besides androgens, intramolecular interactions between functional domains, phosphorylation, and interactions with cofactors also regulate AR activity (van Royen, et al. 2012).

ERG, an ETS family transcription factor drives PCa growth via gene fusion with

TMPRSS2. TMPRSS2-ERG gene fusion is observed in 60% of the PCa cases (Clark, et al.

2007). AR drives the expression of TMPRSS2 and promotes genome instability. Therefore,

ADT is a widely used therapeutic strategy for the majority of the PCa cases.

Other vital genes include PTEN and NKX3.1. Phosphorylation of AKT in response phosphoinositide-3 kinase (PI3K) signaling to promotes cellular proliferation and survival by regulating downstream targets is a critical mediator of prostate carcinogenesis. PTEN is tumor suppressor which inhibits AKT activity, loss of PTEN leads to hyperactive

PI3K/Akt pathway, promoting prostate cancer progression. NKX3.1 is a prostate-specific homeobox gene required for differentiation and growth of prostate epithelial cells (Bhatia-

7 Gaur, et al. 1999). Reduced levels of NKX3.1 are often identified in PCa tumors (Bowen, et al. 2000)

1.5 Current therapeutics

For patients with localized PCa in low Gleason score categories, either radical prostatectomy (RP) or external beam radiotherapy (EBRT) are recommended (Chen, et al.

2017). Localized and hormone-sensitive tumors are also treated by ADT which has been incorporated into the treatment regimen for PCa since 1940’s. First generation ADT consists of luteinizing hormone-releasing hormone (LHRH) agonist and antagonist to lower the circulating testosterone levels (Figure 2). LHRH agonist such as leuprolide and goserelin often cause a temporary tumor flare. Therefore antagonists have been a treatment of preference recently (Crawford and Hou 2009). Another treatment option in place of

LHRH agonist and antagonist includes gonadotropin-releasing hormone (GnRH) antagonist and agonist, which have been known to suppress testosterone levels equivalent to surgical castration, hence predicted to provide modest survival advantage (Lepor and

Shore 2012). However, a significant response to androgen deprivation doesn’t last very long, and a large number of tumors relapse to an aggressive disease known as the castration-resistant prostate cancer (CRPC). Non-metastasis metastatic CRPC is treated with docetaxel and cabazitaxel (for docetaxel irresponsive tumors). Chemotherapy- resistant tumors are further treated by next-generation androgen receptor targeting agents.

Over the past decade, a better understanding of the role or AR variants and mechanisms that drive resistance to castration has led to the development of next-generation androgen receptor targeting agents such as abiraterone and enzalutamide. Abiraterone, an oral agent,

8 is an irreversible inhibitor of cytochrome p450 complex CYP17A1. Abiraterone inhibits the synthesis of testosterone (Ryan, et al. 2010) compared with its predecessor ketoconazole, abiraterone is highly effective and selective. However, for tumors dominant in AR amplification, which may confer resistance to conventional anti-androgens, enzalutamide (AR antagonist) is the recommended line of treatment and has been prevalently used since its discovery. Enzalutamide has a higher affinity for AR; it also inhibits AR nuclear translocation (Tran, et al. 2009). Other second-generation targeting agents include apoptone, galeterone, ARN-509 and EP-001. Apoptone a novel synthetic analogue of 3β-androstanediol that has shown significant preclinical activity. It binds to

AR and results in decreased Bcl-2 expression and caspase-mediated apoptosis. Galeterone

(TOK-001) has multi-functional inhibitory effect on the AR signaling axis. TOK-001 inhibits CYP17 and adrenal androgen synthesis (Ahlem, et al. 2012). ARN-509 is an inhibitor of AR translocation, and EP1-001 is a small molecule inhibitor of AR transactivation (Tsao, et al. 2012). Some of the AR-targeted therapies currently in clinical trials include ODM203, seviteronel and niclosamide.

It is important to understand that ADT suppresses PCa growth in the beginning, however, the onset of CRPC and intratumoral androgen synthesis by resistant cells continues to lead to the growth of tumor despite ADT.

Figure 2: The sequential staging of disease and therapies with the timeline of development. Hormone-sensitive and clinically localized PCa is treated with LHRH agonist/antagonist and GnRH antagonist, in cases of continued elevation in PSA levels and progression to CRPC, chemotherapeutic interventions such as docetaxel and sipuleucel are provided. Abiraterone, enzalutamide, and cabazitaxel are used to treat chemotherapy- resistant CRPC.

1.6 Regulation of cholesterol homeostasis and intratumoral androgen synthesis

Over the last decade research focused on understanding the mechanisms of CRPC growth has shown that despite low levels of circulating testosterone, PCa microenviroment displays sufficiently elevated testosterone, and CRPC tumors contain testosterone levels comparable to benign prostatic hyperplasia (Mohler 2004; Montgomery, et al. 2008; Titus

2005) thus indicating an autocrine mechanism of androgen synthesis in the tumors

(Nishiyama, et al. 2004). Cholesterol is the natural precursor for androgen synthesis and a key molecule for many processes in the cell, including membrane formation. Healthy cells maintain a cholesterol homeostasis through a tight regulation of uptake, endogenous 10 synthesis, and metabolism (Baldán, et al. 2008; Brown and Goldstein 1986). However, in

PCa deregulation of cholesterol metabolism has been observed, and cholesterol levels have been reported to influence PCa progression. Effects of cholesterol on PCa tumors were reported in a xenograft study in which mice fed with a hypercholesterolemic diet developed larger tumors and reported higher intratumoral T levels when compared to mice on a low fat/no cholesterol diet (Krycer and Brown 2013).

Sterol regulatory element-binding proteins (SREBPs) are the transcription factors responsible for expression of numerous enzymes involved in cholesterol synthesis and uptake (Robichon and Dugail 2007; Yuan and Balk 2009). Once synthesized, cholesterol is transported to hepatic tissues for circulation in the form of low-density lipoprotein (LDL) and high-density lipoprotein (HDL) particles (Rhainds and Brissette 2004). Uptake of cholesterol by various cells is mediated by SREBPs regulated LDL-receptor (LDL-r)

(Soccio 2004) which has been documented to be upregulated during clinical PCa progression (Chen and Hughes-Fulford 2000). HDL cholesterol uptake is mediated by scavenger receptor class B type 1 (SCARB1) (Chen and Hughes-Fulford 2000; Rhainds and Brissette 2004; Werder, et al. 2001). Overexpression of the SCARB1 receptors

(Schorghofer, et al. 2015) allows increased uptake of cholesterol for intratumoral androgen synthesis. These lines of evidence indicate PCa tumor adopt alteration in cholesterol homeostasis to facilitate the accumulation of cholesterol and therefore androgen synthesis.

Another line of evidence in support of deregulation of cholesterol homeostasis comes from a next-generation sequencing study performed on localized primary tumors and CRPC, which revealed a unique pattern of a switch in the expression of downstream enzymes

11 involved in cholesterol synthesis. HMG-CoA synthase, squalene synthase, squalene monooxygenase, lanosterol synthase, and farnesyl diphosphate synthase were reported to be induced during progression to CRPC in this study (Ettinger, et al. 2004; Stanbrough, et al. 2006). SREBPs are known to be regulated by androgens in PCa (Heemers, et al. 2001;

Swinnen, et al. 2006; Swinnen, et al. 2004) suggesting that androgens exert their control of cholesterol synthesis via SREBPs, moreover, androgens also regulate the expression and activity of cholesterol synthesizing enzyme HMG-CoA reductase (HMGCR) and acetyl-CoA acetyltransferase (ACAT) (Locke, et al. 2007) . Therefore, both, cholesterol homeostasis and androgen synthesis form a feedback loop in which testosterone stimulate cholesterol synthesis (Garevik, et al. 2012) and cholesterol promotes steroidogenesis. This feedback loop is activated in PCa and could be the primary factor responsible for the enormous positive effects of simvastatin and other statins in PCa progression (Gordon, et al. 2016; Sun, et al. 2015).

1.7 Pathways of steroid biosynthesis and their modification in PCa

Besides deregulated cholesterol homeostasis, CRPC tumors also exhibit higher expression of steroidogenic enzymes (Labrie 2000; Stanbrough, et al. 2006). The major steroidogenic enzymes which regulate androgen synthesis are 17α-hydroxylase/17, 20-lyase (CYP17),

17β-Hydroxysteroid dehydrogenases (HSD17B) mainly type 2 and 4, 3 hydroxysteroid dehydrogenase (3 HSDs, HSD3B), 3α hydroxysteroid dehydrogenases (3αHSD), and 5α reductases1 and 2 (SRD5A1, 2) (Figure 3). These enzymes catalyze the conversion of cholesterol to testosterone and DHT via there different pathways, known as, the Δ4 pathway, the Δ5 pathway, and the backdoor pathway. CYP17A1 convert C21-steroids 12 (pregnenolone and progesterone) into 17α-hydroxypregnenolone and 17α- hydroxyprogesterone and then into C19-steroids dihydroepiandrosterone (DHEA) and androstenedione. HSD17B and HSD3B convert DHEA and androstenedione into testosterone, and then SRD5As convert testosterone to DHT. The backdoor pathways for

DHT synthesis from adrenal precursors in CRPC bypasses the need for testosterone and requires SRD5A1 to synthesis DHT from androstenedione (Chang, et al. 2011). The backdoor pathways have gained significant attention due to its dependence on adrenal precursors for DHT synthesis, therefore, facilitating abiraterone (CYP17A1 inhibitor) resistance. SRD5A1 and 2 both have been shown to be multifold upregulated in metastatic

PCa (Montgomery, et al. 2008)

Figure 3: Steroidogenic pathways for synthesis of testosterone from cholesterol.

Cholesterol is the precursor for DHT synthesis, enzymatic action of CYP11A1, CYP17A1,

HSD17B2, 4, and HSD3B leads to DHT synthesis by a 4 pathway (left). The other prominent pathway for DHT synthesis is 5 pathway (middle) which involves HSD3B1,

2, CYP17A1, HSD17B3, and SRD5A1, 2. PCa tumors often activate a backdoor pathway to utilize adrenal precursors such as androstenedione to synthesis DHT using SRD5A1 and

HSD17B (shown in the triangle) (adapted from Montgomery, et al. 2008).

14 1.8 microRNAs and their role in PCa therapeutics

MicroRNAs (miRNAs) are a class of small non-coding RNAs approximately 22 or longer nucleotides in length, microRNAs play an important role in development, differentiation and also in carcinogenesis by post-transcriptional regulation of their target genes (Bartel

2004). Bioinformatics predictions indicate that miRNAs regulate 30% of all protein-coding genes (Felekkis, et al. 2010). Deregulated microRNA expression is often a signature of carcinogenesis, study of which can be used to establish disease related unique microRNA expression pattern for bettering diagnosis. The understanding of the molecular pathways regulated by microRNAs in PCa reveals an understanding of the heterogeneity of the disease. A large number of studies indicate that miRNAs are differentially expressed in

CRPC compared to the healthy prostate (Massillo, et al. 2017; Pashaei, et al. 2017; Zedan, et al. 2017). Several microRNAs have been studied to contribute to CRPC development such as miR-2909, an androgen-regulated microRNA regulates TGF signaling in PCa

(Ayub, et al. 2017) and miR-138 regulates the -catenin signaling (Erdmann, et al. 2017),

Table 2 summarizes the remaining list of PCa relevant tumor-suppressive microRNAs studied so far. Previous studies have demonstrated global downregulation of microRNA in

PCa using microarray (Ozen, et al. 2008; Porkka, et al. 2007; Schaefer, et al. 2010), however, recently a global upregulation of miRNA has also been reported in an analysis of high and low-grade prostate cancer (Song, et al. 2015). This indicates the need to develop the unique microRNA signature for the different stages of the disease and a better understanding of alterations in microRNA profiles. AR also contributes to PCa progression via its control of microRNA expression, AR-regulated miRNAs such as miR-21, miR-32, miR-125b, miR-141, miR-148a have largely been shown to promote tumor growth and 15 found to be upregulated in CRPC and metastatic cancer (Jalava, et al. 2012; Murata, et al.

2010; Ribas, et al. 2009; Xiao, et al. 2012).

Tumor suppressor Function

miRNAs

miR-34a Targets AR, EZH2, known for tumor suppressive function (Liu, et

al. 2011; Patrawala, et al. 2006)

miR-145a Targets PCGEM1, low expression in PCa (He, et al. 2014)

miR-200a, b,c Inhibits EMT by targeting Zeb1, SLUG and SNAIL (Kim, et al.

2013; Liu, et al. 2012; Williams, et al. 2013)

miR-452 regulates cell cycle, cellular adhesion and motility. (Karatas, et al.

2014)

miR-135a Androgen regulated targets AR and SRC (Coarfa, et al. 2015;

Kumar, et al. 2016)

miR-382 inhibits PCa cell proliferation, migration, invasion and

metastasis. (Zhang, et al. 2016b)

miR-372 inhibits proliferation, migration and invasion of DU145

cells. (Kong, et al. 2016)

miR-17-92a decreases cell cycle regulatory proteins and the expression of

mesenchymal markers. (Ottman, et al. 2016)

miR-27a suppresses MAP2K4 in PCa cell. (Wan, et al. 2016)

miR-135-a-1 inhibits cell growth, cell cycle progression, migration, invasion, and

xenograft tumor formation. (Xu, et al. 2016)

16 miR-204-5p promotes apoptosis by targeting BCL2 in PCa cell. (Lin, et al. 2017)

miR-30b,d Downregulated in CRPC, targets AR (Zhang, et al. 2016a)

let-7c Targeting c-myc and inhibits AR activity. (Nadiminty, et al. 2011)

Table 2: list of microRNAs known to have tumor suppressive function and downregulated in PCa progression.

17 1.9 References

Ablin, R. J., et al.

1970 Precipitating antigens of the normal human prostate. J Reprod Fertil

22(3):573-4.

Ahlem, C., et al.

2012 17alpha-alkynyl 3alpha, 17beta-androstanediol non-clinical and clinical

pharmacology, pharmacokinetics and metabolism. Invest New Drugs 30(1):59-78.

Ayub, S. G., D. Kaul, and T. Ayub

2017 An androgen-regulated miR-2909 modulates TGFbeta signalling through

AR/miR-2909 axis in prostate cancer. Gene 631:1-9.

Baldán, Ángel, Dragana D. Bojanic, and Peter A. Edwards

2008 The ABCs of sterol transport: Fig. 1. Journal of Lipid Research

50(Supplement):S80-S85.

Bartel, D. P.

2004 MicroRNAs: genomics, biogenesis, mechanism, and function. Cell

116(2):281-97.

Bethel, C. R., et al.

2006 Decreased NKX3.1 protein expression in focal prostatic atrophy, prostatic

intraepithelial neoplasia, and adenocarcinoma: association with gleason score and

chromosome 8p deletion. Cancer Res 66(22):10683-90.

Bhatia-Gaur, R., et al.

18 1999 Roles for Nkx3.1 in prostate development and cancer. Genes Dev

13(8):966-77.

Bostwick, David G., et al.

2004 Human prostate cancer risk factors. Cancer 101(S10):2371-2490.

Bowen, C., et al.

2000 Loss of NKX3.1 expression in human prostate cancers correlates with

tumor progression. Cancer Res 60(21):6111-5.

Brinkmann, A. O., et al.

1989 The human androgen receptor: domain structure, genomic organization and

regulation of expression. J Steroid Biochem 34(1-6):307-10.

Brown, M., and J. Goldstein

1986 A receptor-mediated pathway for cholesterol homeostasis. Science

232(4746):34-47.

Burger, M. J., et al.

2002 Expression analysis of delta-catenin and prostate-specific membrane

antigen: their potential as diagnostic markers for prostate cancer. Int J Cancer

100(2):228-37.

Chang, K. H., et al.

2011 Dihydrotestosterone synthesis bypasses testosterone to drive castration-

resistant prostate cancer. Proc Natl Acad Sci U S A 108(33):13728-33.

Chen, L., et al.

19 2017 Comparison on efficacy of radical prostatectomy versus external beam

radiotherapy for the treatment of localized prostate cancer. Oncotarget

8(45):79854-79863.

Chen, Yunfei, and Millie Hughes-Fulford

2000 Human prostate cancer cells lack feedback regulation of low-density

lipoprotein receptor and its regulator, SREBP2. International Journal of Cancer

91(1):41-45.

Clark, J., et al.

2007 Diversity of TMPRSS2-ERG fusion transcripts in the human prostate.

Oncogene 26(18):2667-73.

Coarfa, C., et al.

2015 Comprehensive proteomic profiling identifies the androgen receptor axis

and other signaling pathways as targets of microRNAs suppressed in metastatic

prostate cancer. Oncogene 35(18):2345-2356.

Crawford, E. D., and A. H. Hou

2009 The role of LHRH antagonists in the treatment of prostate cancer. Oncology

(Williston Park) 23(7):626-30.

De Marzo, A. M., et al.

1999 Proliferative inflammatory atrophy of the prostate: implications for

prostatic carcinogenesis. Am J Pathol 155(6):1985-92. di Sant'Agnese, P. A.

20 1998 Neuroendocrine cells of the prostate and neuroendocrine differentiation in

prostatic carcinoma: a review of morphologic aspects. Urology 51(5A Suppl):121-

Eminaga, O., et al.

2013 High-grade prostatic intraepithelial neoplasia (HGPIN) and topographical

distribution in 1,374 prostatectomy specimens: existence of HGPIN near prostate

cancer. Prostate 73(10):1115-22.

Epstein, J. I., et al.

2016 A Contemporary Prostate Cancer Grading System: A Validated Alternative

to the Gleason Score. Eur Urol 69(3):428-35.

Erdmann, K., et al.

2017 Induction of alpha-methylacyl-CoA racemase by miR-138 via up-

regulation of beta-catenin in prostate cancer cells. J Cancer Res Clin Oncol

143(11):2201-2210.

Ettinger, Susan L., et al.

2004 Dysregulation of Sterol Response Element-Binding Proteins and

Downstream Effectors in Prostate Cancer during Progression to Androgen

Independence. Cancer Research 64(6):2212-2221.

Felekkis, K., et al.

2010 microRNAs: a newly described class of encoded molecules that play a role

in health and disease. Hippokratia 14(4):236-240.

Garevik, N., et al.

21 2012 Single dose testosterone increases total cholesterol levels and induces the

expression of HMG CoA reductase. Subst Abuse Treat Prev Policy 7:12.

Ghadirian, P., et al.

1997 Family history of prostate cancer: a multi-center case-control study in

Canada. Int J Cancer 70(6):679-81.

Giri, D., M. Ozen, and M. Ittmann

2001 Interleukin-6 is an autocrine growth factor in human prostate cancer. Am J

Pathol 159(6):2159-65.

Goldstein, Andrew S., et al.

2010 Identification of a cell-of-origin for human prostate cancer. Science (New

York, N.Y.) 329(5991):568-571.

Gomez, Christian R., et al.

2008 Innate immunity and aging. Experimental Gerontology 43(8):718-728.

Gordon, J. A., et al.

2016 Oral simvastatin administration delays castration-resistant progression and

reduces intratumoral steroidogenesis of LNCaP prostate cancer xenografts. Prostate

Cancer Prostatic Dis 19(1):21-7.

He, Jin-Hua, et al.

2014 Reciprocal regulation of PCGEM1 and miR-145 promote proliferation of

LNCaP prostate cancer cells. Journal of Experimental & Clinical Cancer Research

33(1):72.

Heemers, Hannelore, et al.

22 2001 Androgens Stimulate Lipogenic Gene Expression in Prostate Cancer Cells

by Activation of the Sterol Regulatory Element-Binding Protein Cleavage

Activating Protein/Sterol Regulatory Element-Binding Protein Pathway. Molecular

Endocrinology 15(10):1817-1828.

Herawi, M., et al.

2006 Risk of prostate cancer on first re-biopsy within 1 year following a diagnosis

of high grade prostatic intraepithelial neoplasia is related to the number of cores

sampled. J Urol 175(1):121-4.

Hessels, Daphne, and Jack A. Schalken

2013 Urinary biomarkers for prostate cancer: a review. Asian Journal of

Andrology 15(3):333-339.

Jalava, S. E., et al.

2012 Androgen-regulated miR-32 targets BTG2 and is overexpressed in

castration-resistant prostate cancer. Oncogene 31(41):4460-71.

Karatas, Omer Faruk, et al.

2014 miR-1 and miR-133b Are Differentially Expressed in Patients with

Recurrent Prostate Cancer. PLoS ONE 9(6):e98675.

Kazma, Rémi, et al.

2012 Association of the Innate Immunity and Inflammation Pathway with

Advanced Prostate Cancer Risk. PLoS ONE 7(12):e51680.

Kim, J., et al.

2013 TMPRSS2–ERG gene fusions induce prostate tumorigenesis by modulating

microRNA miR-200c. Oncogene 33(44):5183-5192.

23 Kong, Xiangjie, et al.

2016 microRNA-372 Suppresses Migration and Invasion by Targeting p65 in

Human Prostate Cancer Cells. DNA and Cell Biology 35(12):828-835.

Krycer, J. R., and A. J. Brown

2013 Cholesterol accumulation in prostate cancer: a classic observation from a

modern perspective. Biochim Biophys Acta 1835(2):219-29.

Kumar, Binod, et al.

2016 Identification of miR-30b-3p and miR-30d-5p as direct regulators of

Androgen Receptor Signaling in Prostate Cancer by complementary functional

microRNA library screening. Oncotarget.

Labrie, F.

2000 Intracrinology: role of the family of 17 beta-hydroxysteroid dehydrogenases

in human physiology and disease. Journal of Molecular Endocrinology 25(1):1-16.

Lepor, Herbert, and Neal D. Shore

2012 LHRH Agonists for the Treatment of Prostate Cancer: 2012. Reviews in

Urology 14(1-2):1-12.

Lin, Yi-Chia, et al.

2017 Tumor suppressor miRNA-204-5p promotes apoptosis by targeting BCL2

in prostate cancer cells. Asian Journal of Surgery 40(5):396-406.

Liu, Can, et al.

2011 The microRNA miR-34a inhibits prostate cancer stem cells and metastasis

by directly repressing CD44. Nature Medicine 17(2):211-215.

Liu, Y. N., et al.

24 2012 MiR-1 and miR-200 inhibit EMT via Slug-dependent and tumorigenesis via

Slug-independent mechanisms. Oncogene 32(3):296-306.

Locke, Jennifer A., et al.

2007 Androgen-mediated cholesterol metabolism in LNCaP and PC-3 cell lines

is regulated through two different isoforms of acyl-coenzyme A: Cholesterol

Acyltransferase (ACAT). The Prostate 68(1):20-33.

Massillo, C., et al.

2017 Implications of microRNA dysregulation in the development of prostate

cancer. Reproduction 154(4):R81-r97.

McNeal, J. E.

1988 Normal histology of the prostate. Am J Surg Pathol 12(8):619-33.

Mohler, J. L.

2004 The Androgen Axis in Recurrent Prostate Cancer. Clinical Cancer Research

10(2):440-448.

Montgomery, R. B., et al.

2008 Maintenance of Intratumoral Androgens in Metastatic Prostate Cancer: A

Mechanism for Castration-Resistant Tumor Growth. Cancer Research

68(11):4447-4454.

Murata, T., et al.

2010 miR-148a is an androgen-responsive microRNA that promotes LNCaP

prostate cell growth by repressing its target CAND1 expression. Prostate Cancer

Prostatic Dis 13(4):356-61.

Nadiminty, Nagalakshmi, et al.

25 2011 MicroRNA let-7c Suppresses Androgen Receptor Expression and Activity

via Regulation of Myc Expression in Prostate Cancer Cells. Journal of Biological

Chemistry 287(2):1527-1537.

Nelen, Vera

Epidemiology of Prostate Cancer. In Prostate Cancer. Pp. 1-8: Springer

Berlin Heidelberg.

Nishiyama, T., Y. Hashimoto, and K. Takahashi

2004 The influence of androgen deprivation therapy on dihydrotestosterone

levels in the prostatic tissue of patients with prostate cancer. Clin Cancer Res

10(21):7121-6.

Ojo, D., et al.

2015 Prostate Cancer Stem-like Cells Contribute to the Development of

Castration-Resistant Prostate Cancer. Cancers (Basel) 7(4):2290-308.

Ottman, Richard, et al.

2016 The other face of miR-17-92a cluster, exhibiting tumor suppressor effects

in prostate cancer. Oncotarget.

Ozen, M., et al.

2008 Widespread deregulation of microRNA expression in human prostate

cancer. Oncogene 27(12):1788-93.

Papsidero, L. D., et al.

1980 A prostate antigen in sera of prostatic cancer patients. Cancer Res

40(7):2428-32.

Pashaei, E., et al.

26 2017 Meta-analysis of miRNA expression profiles for prostate cancer recurrence

following radical prostatectomy. PLoS One 12(6):e0179543.

Patrawala, L., et al.

2006 Highly purified CD44+ prostate cancer cells from xenograft human tumors

are enriched in tumorigenic and metastatic progenitor cells. Oncogene

25(12):1696-1708.

Perry, K. T., C. T. Anthony, and M. S. Steiner

1997 Immunohistochemical localization of TGF beta 1, TGF beta 2, and TGF

beta 3 in normal and malignant human prostate. Prostate 33(2):133-40.

Porkka, K. P., et al.

2007 MicroRNA expression profiling in prostate cancer. Cancer Res

67(13):6130-5.

Rhainds, David, and Louise Brissette

2004 The role of scavenger receptor class B type I (SR-BI) in lipid trafficking.

The International Journal of Biochemistry & Cell Biology 36(1):39-77.

Ribas, J., et al.

2009 miR-21: an androgen receptor-regulated microRNA that promotes

hormone-dependent and hormone-independent prostate cancer growth. Cancer Res

69(18):7165-9.

Robichon, Céline, and Isabelle Dugail

2007 De novo cholesterol synthesis at the crossroads of adaptive response to

extracellular stress through SREBP. Biochimie 89(2):260-264.

Ruska, K. M., J. Sauvageot, and J. I. Epstein

27 1998 Histology and cellular kinetics of prostatic atrophy. Am J Surg Pathol

22(9):1073-7.

Ryan, C. J., et al.

2010 Phase I clinical trial of the CYP17 inhibitor abiraterone acetate

demonstrating clinical activity in patients with castration-resistant prostate cancer

who received prior ketoconazole therapy. J Clin Oncol 28(9):1481-8.

Schaefer, A., et al.

2010 Diagnostic and prognostic implications of microRNA profiling in prostate

carcinoma. Int J Cancer 126(5):1166-76.

Schorghofer, D., et al.

2015 The HDL receptor SR-BI is associated with human prostate cancer

progression and plays a possible role in establishing androgen independence.

Reprod Biol Endocrinol 13:88.

Servian, P., et al.

2015 Clinical significance of proliferative inflammatory atrophy finding in

prostatic biopsies. Prostate 75(14):1669-75.

Shariat, S. F., et al.

2002 Association of preoperative plasma levels of insulin-like growth factor I and

insulin-like growth factor binding proteins-2 and -3 with prostate cancer invasion,

progression, and metastasis. J Clin Oncol 20(3):833-41.

Singh, S., A. Plaga, and G. C. Shukla

2017 Racial disparities: disruptive genes in prostate carcinogenesis. Front Biosci

(Schol Ed) 9:244-253.

28 Soccio, R. E.

2004 Intracellular Cholesterol Transport. Arteriosclerosis, Thrombosis, and

Vascular Biology 24(7):1150-1160.

Song, C., et al.

2015 Expression profile analysis of microRNAs in prostate cancer by next-

generation sequencing. Prostate 75(5):500-16.

Stanbrough, Michael, et al.

2006 Increased Expression of Genes Converting Adrenal Androgens to

Testosterone in Androgen-Independent Prostate Cancer. Cancer Research

66(5):2815-2825.

Stanford, J. L., and E. A. Ostrander

2001 Familial prostate cancer. Epidemiol Rev 23(1):19-23.

Sun, L. M., et al.

2015 Statin Use Reduces Prostate Cancer All-Cause Mortality: A Nationwide

Population-Based Cohort Study. Medicine (Baltimore) 94(39):e1644.

Swinnen, Johannes V., Koen Brusselmans, and Guido Verhoeven

2006 Increased lipogenesis in cancer cells: new players, novel targets. Current

Opinion in Clinical Nutrition and Metabolic Care 9(4):358-365.

Swinnen, Johannes V., et al.

2004 Androgens, lipogenesis and prostate cancer. The Journal of Steroid

Biochemistry and Molecular Biology 92(4):273-279.

Titus, M. A.

29 2005 Testosterone and Dihydrotestosterone Tissue Levels in Recurrent Prostate

Cancer. Clinical Cancer Research 11(13):4653-4657.

Tomlins, S. A., et al.

2007 Integrative molecular concept modeling of prostate cancer progression. Nat

Genet 39(1):41-51.

Tran, C., et al.

2009 Development of a second-generation antiandrogen for treatment of

advanced prostate cancer. Science 324(5928):787-90.

Tsao, C. K., et al.

2012 Targeting the androgen receptor signalling axis in castration-resistant

prostate cancer (CRPC). BJU Int 110(11):1580-8. van Royen, M. E., et al.

2012 Stepwise androgen receptor dimerization. J Cell Sci 125(Pt 8):1970-9.

Wan, Xuechao, et al.

2016 Androgen-induced miR-27A acted as a tumor suppressor by targeting

MAP2K4 and mediated prostate cancer progression. The International Journal of

Biochemistry & Cell Biology 79:249-260.

Werder, Moritz, et al.

2001 Role of Scavenger Receptors SR-BI and CD36 in Selective Sterol Uptake

in the Small Intestine†. Biochemistry 40(38):11643-11650.

Williams, LaTanya V., et al.

2013 miR-200b Inhibits Prostate Cancer EMT, Growth and Metastasis. PLoS

ONE 8(12):e83991.

30 Xiao, J., et al.

2012 miR-141 modulates androgen receptor transcriptional activity in human

prostate cancer cells through targeting the small heterodimer partner protein.

Prostate 72(14):1514-22.

Xu, Bin, et al.

2016 hsa-miR-135a-1 inhibits prostate cancer cell growth and migration by

targeting EGFR. Tumor Biology 37(10):14141-14151.

Yuan, Xin, and Steven P. Balk

2009 Mechanisms mediating androgen receptor reactivation after castration.

Urologic Oncology: Seminars and Original Investigations 27(1):36-41.

Zedan, A. H., et al.

2017 Heterogeneity of miRNA expression in localized prostate cancer with

clinicopathological correlations. PLoS One 12(6):e0179113.

Zhang, Lei, et al.

2016a miRNA-30a functions as a tumor suppressor by downregulating cyclin E2

expression in castration-resistant prostate cancer. Molecular Medicine Reports

14(3):2077-2084.

Zhang, Wei, et al.

2016b MicroRNA-382 inhibits prostate cancer cell proliferation and metastasis

through targeting COUP-TFII. Oncology Reports 36(6):3707-3715.

CHAPTER II

MIR-149-5P REGULATES AR FUNCTION, CELL PROLIFERATION AND INVASIVE POTENTIAL OF PCA CELLS

2.1 Abstract

Objective. miR-149-5p is a tumor suppressor microRNA studied in multiple malignancies, such as breast cancer and hepatocellular carcinoma; however, its roles in prostate cancer and expression have not been explored. We aim to investigate the regulation of androgen receptor function via miR-149-5p. Androgen receptor signaling is essential for growth and differentiation of prostate gland as well as in prostate carcinogenesis.

Methods. We investigated the differential expression of miR-149-5p in PCa tumor samples of different Gleason scores and matched normal samples as well as in PCa cell lines using

TaqMan qRT-PCR. Regulation of AR by miR-149-5p was studied by transfection of

LNCaP, 22Rv1, and LAPC4 with mature microRNA mimics. The transactivation function of AR was investigated by analyzing the expression of PSA mRNA and secreted PSA in those cells. To test the significance of the suppression of AR signaling, we studied the anti- proliferative effect of miR-149-5p via viability assays, BrdU incorporation, and soft agar colony formation assay. Furthermore, regulation of PCa cell migration and invasion was

32 studied by wound healing assay and matrigel invasion assays performed on LNCaP and

22Rv1 cells.

Results. miR-149-5p was discovered to be suppressed in PCa samples of higher Gleason score and metastatic tumors when compared to matched normal samples. We also found miR-149-5p to be downregulated in PCa cells of aggressive phenotype compared to normal prostate epithelial cells. Functional annotation of predicted miR-149-5p targets indicated regulation of AR signaling, apoptosis, and control of gene expression by SREBP1 signaling as significantly affected pathways. Our results from the restoration of has-miR-149-5p expression in PCa cells indicated that miR-149-5p significantly downregulated the expression of AR and AR activated PSA. The suppression of AR function and other potential targets of miR-149-5p resulted in reduced cell proliferation and invasion of the

PCa cells.

Conclusion. Our study indicates a potential tumor suppressive function of miR-149-5p in

PCa. miR-149-5p regulates AR signaling which controls PCa cell proliferation and invasion.

33 2.2 Introduction

2.2.1 Androgen receptor signaling

The AR is a transcription factor belonging to the nuclear receptor superfamily. The human

AR gene is located on the X chromosome and shows monoallelic expression (Figure 6).

AR gene consists of 8 exons. Exon 1 encodes the N terminal domain (NTD), exons 2 and

3 encode the DNA binding domain (DBD), exon 4 encodes the hinge region and exons 5–

8 encode the LBD (ligand binding domain)(Gao, et al. 2005). The NTD constitutes the significant part of the AR protein and contains the transcriptional regulatory region. It also contains FXXLF motif, which interacts with the ligand-bound LBD to form an N and C terminus interaction, which is required for the transcriptional activity of full-length (FL)

AR in response to ligand (He, et al. 1999; Schaufele, et al. 2005). The AF-1 (activation factor 1) region in the NTD can form protein-protein interactions with AR coactivators and recruits the general transcriptional machinery. Thus, NTD is the driver of AR transcriptional activity (Jenster, et al. 1991; Sadar 2011). Androgens, particularly DHT acts as ligand for AR and leads to its transactivation, androgens and anti-androgens bind to the

LBD of AR, facilitating translocation of the dimerized receptor to the nucleus where it binds to ARE DNA in the promoters of target genes, such as PSA and leads to transcriptional activation of genes involved in proliferation and differentiation (Gao, et al.

2005) (Figure 4).

Figure 4: Androgen receptor signaling. AR binds to DHT and translocate to the nucleus upon dimerization and phosphorylation by cyclin-dependent kinase family members,

CDK1, CDK9 and protein kinase B. AR together with coregulators, such as SRC, CBP,

Brm and SWI/SNF initiates transcription of genes containing ARE elements, including

PSA (adapted from (Lonergan and Tindall 2011)).

2.2.2 Alterations in AR signaling leading to resistance to ADT

Various modifications to AR signaling (Figure 5) lead to persistent AR signaling, these changes include AR gene amplification, AR point mutations, AR splice variants, intratumoral androgen synthesis, ligand-independent NTD mediated AR activation and upregulation of coactivators of AR. 35

Figure 5: Mechanism of AR signaling in prostate cancer cells, depicting different mechanisms of acquired modifications. Sustained AR transcription in CRPC is achieved by overexpression of AR protein enabling it to be activated by trace levels of androgens.

Constitutively active splice variants of AR, androgens produced by tumor, ligand- independent AR activation, overexpression of AR coactivators and gain of function mutation leading to activation of AR by anti-androgens and steroid precursors are the other mechanisms of acquired modifications in AR signaling (adapted from Imamura et, al.

2016)

2.2.3 Androgen receptor amplification

Amplification of the AR gene has been reported in 22% of prostate cancer metastases

(Spratt, et al. 2015) and 23–28% of primary tumors following androgen deprivation. The

36 amplified AR is activated by traces of androgen produced by the tumor itself, therefore drives AR signaling despite ADT. An average 2-fold increase in the level of both AR and

PSA proteins has been reported in prostate tumor samples post-ADT (Haapala, et al. 2007;

Miyoshi, et al. 2000), whereas untreated patients rarely showed AR amplification

(Bubendorf, et al. 1999). The mechanism of AR amplification is still unclear. It may include higher transcription rates and downregulation of AR targeting microRNAs.

2.2.4 Mutations and splice variants of androgen receptor

Point mutations in the LBD of AR are implicated in enzalutamide resistance, about 10-

30% of CRPC exhibit AR mutations (Waltering, et al. 2012) Many of these mutations result in a gain-of-function that utilizes anti-androgens as ligands. One example is the

F876L mutation (Figure 6) in the LBD of AR that uses enzalutamide as an AR agonist to sustain AR signaling during ADT (Korpal, et al. 2013). However, F876L mutant AR is responsive to bicalutamide and hydroxyﬂutamide (Balbas, et al. 2013). This reflects that the identification of mutant AR in CRPC patients is beneﬁcial in directing the therapy.

Several mutations confer responsiveness to other steroids, such as T877A which is progesterone responsive and therefore resistant to abiraterone (which only inhibits testosterone synthesis) (Cai, et al. 2011). AR splice variants (AR-Vs) that lack LBD (Haile and Sadar 2011; Sun, et al. 2010) are also detected in CRPC (Dehm, et al. 2007; Guo, et al. 2009; Hu, et al. 2009) and in PCa cell lines (VCaP, and 22Rv1). More than 20 AR-Vs have been identified (Hörnberg, et al. 2011), of which, the two most clinically relevant ones are ARv567es and AR-V7 (Hörnberg, et al. 2011). Enzalutamide resistance is associated with expression of AR-Vs (Li, et al. 2012; Zhang, et al. 2011), enzalutamide has 37 been shown to increase levels of AR-V7 in prostate cancer cells and xenografts (Hu, et al.

2012). AR-V7 variant was most frequently upregulated in CRPC, and it is constitutively active and confers ADT resistance in CRPC. 57% of tumors which exhibited resistance to enzalutamide within four months of treatment showed a presence of AR V7, tumors which didn’t develop resistance for the six months after the therapy didn’t show the expression of AR V7 variant. These studies demonstrate the ability of AR V7 in conferring drug resistance or its abundance only in resistant tumors (Antonarakis, et al. 2017), therefore, making it a marker of aggressive disease. AR-V7 also contributes to disease progression by reprogramming cellular metabolism and contributing to lipids, cholesterol, and steroid biosynthesis (Shafi, et al. 2015). Increase in expression of AR-Vs may also confer resistance to abiraterone, which inhibits CYP17A1 to reduce testosterone synthesis

(Mostaghel, et al. 2011)

Figure 6: Schematic representation of AR gene, protein, and various LBD truncated and LBD mutant AR variants. (A) Chromosomal location of AR gene shows monoallelic 38 expression. (B) Schematic of AR mRNA shows eight exons, a 6.8 kb 3’ UTR and a 1.1 kb

5’UTR. (C) Schematic showing domains of full-length AR protein. (D) AR splice variants produce truncated proteins which share a core structure composed of NTD encoded by exon 1 and the DBD encoded by exons 2 and 3. Splice variants lack the AR ligand-binding domain and consist of parts of the LBD of variable length. (E) AR protein consisting of mutations in LBD which confer resistance to enzalutamide, abiraterone and flutamide and mutation that leads to AR activation by glucocorticoids.

2.2.5 Androgen receptor regulation by cofactors

In addition to alterations in AR expression and activity, transcriptional regulation by AR involves a large number of coactivators and repressors (McKenna 1999), such as cAMP response element binding protein (CBP)/p300, steroid receptor coactivator (SRC-1) and

SWI/SNF chromatin remodeling complex. Altered expression of the coregulators is known to regulate the transcriptional activity of AR (Aarnisalo, et al. 1998; Caira, et al. 2000;

Hsiao, et al. 1999). Overexpression of steroid receptor coactivator 2 has been known to enhance AR transcriptional activity (Gregory, et al. 1999). Besides, coregulators also modulate the effects of antiandrogens. For instance, hydroxyflutamide increases AR activity when CBP is overexpressed (Comuzzi, et al. 2003). Therefore, alterations in the expression of the coregulators may also promote the development and progression of prostate cancer (Balk 2002).

2.2.6 Non-genomic androgen receptor signaling

39 In addition to genomic AR signaling, non-genomic AR signaling induced by treatment with androgens but without the need for the import of the receptor to the nucleus has gained recent attention. PCa cells have been shown to rapidly alter proliferation on exposure to androgens, without the need for genomic AR signaling (Unni, et al. 2004). This proliferation response known as the non-genomic AR signaling is mediated by cytoplasmic

AR, which facilitates the activation of kinase-signaling cascades, including the Ras-Raf-1, phosphatidyl-inositol 3-kinase (PI3K)/Akt and protein kinase C (PKC), leading to activation of mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) activation (Sun, et al. 2016) ( Figure 7). PI3K activation is observed in PCa with loss of the PTEN function. Therefore, AR may indirectly promote the growth of PTEN deficient subpopulation of cells. Furthermore, activation of ERK creates a loop, as activated ERK may also phosphorylate AR and its coactivators. Therefore, non-genomic

AR signaling may also enhance AR genomic signaling. This concept has been validated in

PC-3 cells, where an absence of AR didn’t result in ERK activation. Non-genomic AR signaling can also occur via activation of mammalian target of rapamycin (mTOR) pathway, or via modulation of intracellular Ca2+ levels through plasma membrane G protein-coupled receptors (GPCRs)(Sun, et al. 2006). Therefore, therapeutic strategies aimed at preventing AR nuclear translocation and genomic AR signaling alone may not entirely abolish AR signaling and may be partially effective in inhibiting PCa proliferation.

Figure 7: Non-genomic AR signaling in PCa cells. AR in the presence of DHT promotes the activation of PI3K and PKC kinases leading to the activation of MAPK/ERK signaling.

Activated ERK phosphorylates transcription factors including AR to promote genomic AR signaling (Liao, et al. 2013).

With its diverse canonical and non-canonical functions, androgen receptor as a target for therapy has led to a considerable investigation into the role of microRNAs in developing better AR-targeted therapies.

2.2.7 Tumor suppressive role of miR-149-5p in PCa and perspective for bettering PCa therapeutics mir-149-5p is an intronic microRNA transcribed from intron 1 of glypican 1 (GPC1) gene located on chromosome 2 (Figure 8). GPC1 protein is a heparan sulfate proteoglycan 41 present as an integral membrane protein of 55-60 kDa (Briggs, et al. 1993). GPC-1 is mainly expressed in the prostate epithelial cells. In prostate cancer, reduced expression of

GPC1 in epithelial cells and increased expression in stromal cells has been observed.

Expression levels of GPC1 and miR-149-5p don’t correlate, as seen in the cohort of adenocarcinoma patient’s data obtained from TCGA (data not shown), indicating a possible post-transcriptional regulation imposed on miR-149-5p expression. One of the potential mechanism for regulation of miR-149-5p, which has been reported in breast cancer is the methylation of CpG island located 742 bp upstream of the miR-149-5p coding region (He, et al. 2014). Potential methylation of this CpG island in PCa could explain why despite sharing the promoter and transcription start site with GPC1, expression of miR-

149-5p have been shown to be independent of GPC1 (Chamorro-Jorganes, et al. 2014).

Figure 8: Schematic representation of precursor miR-149 and its alignment with various vertebral Pre-miR-149 transcripts. (A) A 2000 bp intronic region of GPC1 contains pre-miR-149, which is processed to mature miR-149-5p (shown in red). (B)

42 Sequence alignment of the vertebral pre-miR-149 transcript from humans, Maca mulatta

(mml), Pongo pygmaeus (ppy), Canis familiaris (cfa) and Equus caballus (eca) indicate perfect conservation of mature miR-149-5p sequence (shown in red).

Sequence alignment of pre-miR-149 indicates perfect conservation of miR-149-5p indicating its functional role in post-transcriptional regulation. miR-149-5p has been reported as a tumor suppressor miRNA in glioma (Shen, et al. 2016) and gastric cancer

(Wang, et al. 2012), it has also has been shown to target G-protein-coupled receptor kinase- interacting protein 1 (GIT1) in breast cancer and regulate metastasis (Bischoff, et al. 2014;

Chan, et al. 2014). Downregulation of miR-149-5p has been recently correlated with lower survival rate and higher invasive potential in colorectal cancer (Wang, et al. 2013).

However, thus far, functional analysis of miR-149-5p in PCa is still unavailable. In this study, we used a combination of bioinformatics, biochemical assays, and cellular assays to determine the role of miR-149-5p in PCa. Our target prediction analysis shows that the potential targets of miR-149-5p are involved in regulation of AR signaling, steroid biosynthesis pathways and gene regulation by SREBP1. Indicating that miR-149-5p might be required for regulating AR signaling in AR-dependent as well as in AR-independent

CRPC growth.

2.3 Materials and Methods

43 2.3.1 Cell lines

The androgen-dependent human PCa cell lines LNCaP, and androgen-independent PCa cell lines C4-2B, and AR-null cells PC-3 and DU145 were obtained from American Type

Culture Collection (Manassas, VA). LAPC4 cells were obtained from Dr. Sharifi’s lab.

LNCaP, C4-2B, 22Rv1, PC-3 and DU145 cells were cultured in RPMI 1640 medium supplemented with 10% FBS and pen step, LAPC4 were cultured in 10% FBS with pen- strep in IMDM medium. All cell lines were maintained in a humidified 5%

CO2 atmosphere at 37°C.

2.3.2 RNA extraction

Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) as per the manufacturer's instructions. RNA yield and purity were determined spectrophotometrically and the integrity of RNA was verified by denaturing agarose gel. RNA was DNAse treated to eliminate carryover DNA contamination using Promega DNAse kit.

2.3.3 Reverse transcription and TaqMan microRNA assays

Reverse transcription (RT) to obtain cDNA was performed using primers specific for mature miRNAs and small nucleolar RNA 66 (sno66). The miR-149-5p-specific primers were obtained from TaqMan MicroRNA Assays (Applied Biosystems Foster City, CA).

Reagents for cDNA synthesis were purchased from TaqMan MicroRNA Reverse

Transcription kit (Applied Biosystems). Manufacturer’s protocol was followed to perform cDNA synthesis using a thermal cycler (BIORAD PTC-100). The control for RT consisted of 'reverse transcriptase minus' reaction. In order to quantify the mature miRNAs and 44 sno66 in each sample, the cDNAs were amplified using TaqMan MicroRNA Assays obtained from Applied Biosystems Foster City, CA and manufacturers protocol was followed. Replicates were performed per RT reaction together with the 'reverse transcriptase minus'. The mean Ct was determined from the replicates. Sno66 expression was used a normalization control. The relative expression of each miR-149-5p was calculated using the 2-ΔCt method, where ΔCt represents the Ct value of miR-149-5p in a sample – Ct value of sno66 in that sample. All experiments were repeated at least thrice with three replicates and two independent RNA samples.

2.3.4 In-silico analysis

To investigate the significance of miR-149-5p downregulation in PCa progression, we pooled out the predicted target genes of miR-149-5p from miRecords (it integrates 11 microRNA prediction analysis tools) with selection criteria of a minimum of 4 prediction tools predicting the same targets. These genes were analyzed on http://consensuspathdb.org/ for the enrichment of genes involved in particular pathways.

2.3.5 Reverse transcription and qPCR

Total RNA isolated from cells for the relevant experiment was DNAse treated and then reverse transcribed using an ImProm-II Reverse Transcription System (Promega, Madison,

45 were run on a 7500 Real-time PCR System (Applied Biosystems). Replicates were performed per cDNA sample along with the 'reverse transcriptase minus' and 'no template' controls. Relative standard curve method was used for quantifying gene expression.

Different dilutions of cDNA synthesized from LNCaP cells were used to plot the standard curves for each gene and 18S RNA. 18S RNA expression was used as an internal control and the relative expression of each gene was normalized to 18S expression. All experiments were repeated thrice with three replicates per set.

2.3.6 Quantitation of prostate specific antigen by qPCR

LNCaP, LAPC4 and 22Rv1 cells were cultured for 24 hours and treated with 10% charcoal stripped serum (CSS) containing medium. After overnight incubation, fresh 10% CSS containing medium with 10mM DHT was added to the cells, control wells received DMSO

(Vehicle) and cells were transfected with 20nM miR-149-5p and negative control (NC) mimic. Total RNA was isolated from each set 24 hrs post-transfection and DNase treated

RNA was reverse transcribed and qPCR was performed as described previously (page 46, section 2.3.5). PSA mRNA expression was normalized to 18S mRNA expression.

2.3.7 Quantitation of prostate specific antigen in cell culture supernatant

(Vehicle) and cells were transfected with 20nM miR-149-5p and NC mimic. The supernatant was collected 24 hrs post transfection and filtered through 0.22 filter.

46 Secreted PSA protein in cell culture supernatants were determined by using the Quantikine human PSA kit (R&D Systems, Minneapolis, MN) according to the manufacturer's instructions. Serial dilutions of recombinant human PSA were used to plot the standard curve.

2.3.8 Western blotting

LNCaP, LAPC4 and 22Rv1 cells were seeded in six-well plates one day before transfection. Cells were transfected with miR-149-5p mimic or negative control (NC) miRNA mimic (Dharmacon, Chicago, IL) using Lipofectamine 2000 (Invitrogen,

Carlsbad, CA) and harvested 48 hr post-transfection for protein extraction. Protein was resolved on NuPAGE 4-12% Bis-Tris gels and mouse monoclonal anti-androgen receptor

(AR) antibody (from Santa Cruz Biotechnology, Santa Cruz, CA), mouse monoclonal anti-

β-actin antibody (from Santa Cruz Biotechnology) and horseradish peroxidase conjugated anti-mouse secondary antibody (cell signaling) were used. Bands were detected using the

ECL Plus Western blotting detection reagent (GE Healthcare). The signal intensities of bands were measured using ImageJ. The level of protein expression in each sample was determined by normalizing AR band intensity to β-actin band intensity.

2.3.9 Construction of reporter plasmids and luciferase assay

WT-3' UTR (WT: wild type) reporter plasmid was constructed by cloning 210 base pairs

(bp) fragment of AR 3' UTR spanning the predicted target site for miR-149-5p downstream of the firefly luciferase coding region in pMIR-REPORT vector (Ambion, Austin, TX).

Site-directed mutagenesis of the putative target site for miR-149-5p in WT-3' UTR

47 construct was carried out using a 5’ phosphate labeled mutagenesis primer (supplementary table 1) and USB site-directed mutagenesis kit to generate the MUT-3' UTR construct.

Top10 E. coli chemically competent cells were transformed using the mutant 3’UTR reporter constructs. The plasmids isolated by mini scale plasmid prep using Qiagen kit were sequenced to confirm the mutation. For luciferase assays, LNCaP cells (20,000 cells/well) were plated in 24-well plates one day before transfection. Cells were cotransfected using

Lipofectamine 2000 (Invitrogen), with 100 ng of WT-3' UTR or MUT-3' UTR firefly luciferase reporter construct, 10 ng of renilla luciferase reporter plasmid (Promega,

Madison, WI) and either miR-149-5p mimic (20 nM) or NC mimic (20 nM). Cell lysates were assayed for firefly and renilla luciferase activities 48 hrs post-transfection using the

Dual-Luciferase Reporter Assay System (Promega) and Victor 3 Multilabel Counter 1420

(PerkinElmer). Renilla luciferase activity served as a control for transfection efficiency.

Data are represented as the ratio of firefly luciferase activity to renilla luciferase activity.

2.3.10 Cell viability assay

LNCaP and PC-3 cells were plated in six-well plates one day before transfection. The cells were transiently transfected with either miR 149-5p mimic (20 nM) or NC mimic (20 nM) using Lipofectamine 2000. Cells were treated with 1M enzalutamide 6 hrs post transfection and incubated overnight. 24 hrs later cells were seeded into 96-well plates at

5,000 cells/well. Cell viability was determined on 2nd, 3rd, 4th and 5th day post-transfection using CellTiter-Glo luminescent cell viability assay (Promega) according to the manufacturer's protocol; each reading was normalized to the cell count in respective sample.

2.3.11 BrdU proliferation assay

LNCaP and PC-3 cells in 250,000 number were cultured in the 6 well plate and transfected with 20nM miR-149-5p mimic, NC mimic, miR-149-5p mimic and enzalutamide and enzalutamide alone at 1uM. 24 hrs post transfection each set was split into replicates in a

96 well plate in RPMI FBS medium. Control wells included RMPI medium and cells which were not treated with BrdU. BrdU was added to the appropriate wells, and the cells were incubated for an additional 24 hrs. Fixing solution was added to each well and incubated at room temperature for 30 minutes, followed by washing and detection with an antibody.

Reactions were incubated with peroxidase Goat Anti-Mouse IgG followed by addition of

TMB peroxidase substrate and Stop Solution. Plates were read at a dual wavelength of

450/550 nm.

2.3.12 Colony formation assay

LNCaP and 22Rv1 cells were transfected with 20nM miR-149-5p and NC mimic. Cells were split 24 hrs later and seeded in appropriate dilutions of agar for incubation at 37C for 3-4 weeks. Resultant colonies were fixed using Glutaraldehyde, stained with crystal violet, photographed and colonies were counted/quantified by image analysis using

Wimasis™ software (Masuzzo, et al. 2013).

2.3.13 Matrigel invasion assay

49 LNCaP and 22Rv1 cells were transfected with 20nM miR-149-5p and NC mimic and transferred to the top chamber of the 8.0 μm transwells coated with matrigel (growth factor reduced) in 1:3 dilution with RMPI (BD Biosciences). Cells were allowed to migrate towards a 10% FBS gradient provided in the bottom chamber for 48 hrs. Migrated cells on the underside of the membrane were fixed in methanol and stained with crystal violet and counted as explained previously (Chen, et al. 2014). Experiments were repeated twice and count included five independent microscopic fields at 20X magnification.

2.2.14 Statistical analysis

Statistical analysis was performed using GraphPad Prism and SPSS. Data are presented as mean ± SE from three independent experiments and independent sample t-test was performed to demonstrate statistical significance, with p  0.05 , p  0.01  and P 

0.001 .

2.4 Results

2.4.1 Downregulation of miR-149-5p in PCa

Our previous study on the expression profile of microRNAs in PCa (Singh, et al. 2016) revealed miR-149-5p is downregulated in normal prostate epithelial cells (PrEC).

Moreover, miR-149-5p was also proposed to be a prognostic marker in PCa (Schaefer, et al. 2009). These observations led us to examine the significance miR-149-5p in PCa and study its expression prolife. We, first validated miR-149-5p expression in PrEC and

LNCaP (androgen responsive), C4-2B (androgen irresponsive), DU-145 and PC-3 (AR

50 null) cells. Significant downregulation of miR-149-5p expression was observed in PCa cells compared to PrEC (Figure 9 B). Further, we also verified similar expression pattern in PCa tumors, miR-149-5p expression inversely correlated with tumors of higher Gleason score (Figure 9 A) similar suppression of miR-149-5p was observed in metastatic tumors samples, which consisted of tumors obtained from lymph nodes, liver and adrenal metastasis, suggesting a potential tumor suppressor role of miR-149-5p.

Figure 9: Expression analysis of miR-149-5p in PCa tumor samples and PCa cell lines.

(A) TaqMan assay based quantification of miR-149-5p expression shows miR-149-5p levels are significantly downregulated in PCa tumors of Gleason score (3+3), (4+3), and metastatic PCa samples as compared to matched normal samples. Expression levels are normalized to snRNA (small nuclear RNA) RNU66, and each set consists of 10 samples.

(B) TaqMan analysis of miR-149-5p levels in PrEC, LNCaP, C4-2B, DU-145 and PC-3

PCa cells shows significantly reduced expression of miR-149-5p in PCa cells compared to normal prostate epithelial cells (PrEC). Data are presented as mean ± SE from three

51 independent experiments and independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with P  0.001.

2.4.2 Functional annotation of the predicted targets of miR-149-5p indicates a significant role in AR signaling, regulation by SREBP1 and steroid biosynthesis

To gain insights into potential signaling pathways regulated by miR-149-5p, we obtained the predicted target genes of miR-149-5p from miRecords with selection criteria of a minimum of 4 prediction tools predicting the same targets. The robust selection of the target genes presented a list of about 800 unique targets; these genes were mapped on the

ConsescusPathDB to enable the annotation of genes and identify their key pathways. The enriched pathways set (Figure 10 B) indicates prostate cancer, AR signaling, coregulation of AR activity, apoptosis, activation of gene expression by SREBP1 and steroid biosynthesis pathways as highly significant pathways predicted to be regulated by miR-

149-5p targets. We, therefore, sought out to investigate the role of miR-149-5p in regulating these pathways by performing qRT-PCRs and western blot analysis of predicted target genes.

52 Figure 10: Functional annotation of predicted targets of miR-149-5p by

ConsensusPathDB. (A) The table presents the major predicted miR-149-5p target genes contribute to pathways associated with prostate cancer, steroid biosynthesis, gene expression by SREBF (SREBP), AR signaling pathways, coregulation of AR activity and apoptosis. The count represents the total number of genes integrated by pathways analysis tool (KEGG, Reactome or SMPDB) in the particular pathway, “%” represent the contribution by the predicted miR-149-5p targets and p-value represents the significance level of the contribution. (B) Functional gene set overlap graph of the predicted target genes indicating an overlap between genes regulating different pathways. The node size reflects the size of the gene set, and the node color density reflects p-value, edge width reflects the percentage of genes shared between two pathways.

2.4.3 miR-149-5p downregulates AR protein and mRNA in PCa cells

To analyze miR-149-5p mediated regulation of AR function. We ectopically expressed miR-149-5p in three different types of PCa cells, LNCaP, LAPC4 and 22Rv1 cells. LNCaP and LAPC4 are both androgen responsive cell lines. However, LNCaP contains a T877A

LBD mutant variant of AR while LAPC4 contains a WT AR protein. 22Rv1 is a castration- resistant PCa cell line, which contains FL AR and a truncated AR (AR-V7) variant that has been implicated in conferring resistance to enzalutamide (Dehm, et al. 2008). The study of

AR expression in different cell lines allows us to assess the significance of miR-149-5p expression in androgen-sensitive, castration resistance and drug resistance conditions, which are commonly presented in PCa. We observed that ectopic expression of miR-149-

5p significantly reduced AR mRNA levels as well as protein levels in LAPC4 (Figure 11

53 A), LNCaP (Figure 11 B) and 22Rv1 (Figure 11 C) cells. Furthermore, increasing concentration of miR-149-5p mimics markedly reduced AR protein levels in these three cell lines with almost 90% reduction in protein levels at a 100nM concentration. We were able to observe a significant reduction in both 110 kDa FL AR and 87 kDa AR-V7 in

22Rv1 cells, which indicates a distinct advantage of using miR-149-5p to regulate AR signaling compared to enzalutamide which cannot target the AR-V7 function. This result indicates that the therapeutic strategies focused on regulating AR transcripts could be more effective to overcome molecular adaptation observed in AR protein in the progression of

CRPC. Further, we sought out to examine the effect of AR suppression on genes regulated by AR.

Figure 11: miR-149-5p downregulates endogenous AR expression. (A, B, C) mRNA expression levels of AR in (A) LAPC4, (B) LNCaP and (C) 22Rv1 cells, as determined by

54 qRT-PCR upon transfection with 20nM of miR-149-5p, expression level normalized to

18S mRNA levels in respective samples. Bottom panels show Immunoblot analysis for AR protein expression in (A) LAPC4, (B) LNCaP and (C) 22Rv1 cells on transfection with multiple concentrations of miR-149-5p ranging from 20nM to 100nM, numbers represent the densitometry analysis of AR normalized to -actin expression. Data are presented as mean ± SE from three independent experiments and independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with p  0.05

, p  0.01 and P  0.001.

2.4.4 miR-149-5p represses the transactivation function of AR

Translocation of AR to nucleus activates expression of numerous target genes which contain androgen response elements (ARE). PSA is one of those genes and a biomarker for

AR activity. We determined the effect of repression of AR activity by measuring PSA expression in PCa cells both, at mRNA and protein levels with a qRT-PCR and PSA sandwich ELISA, respectively. miR-149-5p downregulated the expression of PSA at both mRNA (Figure 12 A, B) and protein levels (Figure 12 C, D) in the LAPC4 (Figure 12 A,

C) and 22Rv1 cells (Figure 12 B, D), restoring the secreted PSA levels to conditions similar to no DHT stimulation. This result indicates a therapeutic potential of miR-149-5p in targeting AR transactivation function. Similar experiments were also performed in LNCaP cells (data not shown), which showed significant suppression in mRNA levels for PSA but secreted PSA levels didn’t show a similar level of reduction; this was probably due to higher levels of PSA produced and accumulated in LNCaP cells at the given time point.

Figure 12: miR-149-5p suppresses AR transactivation and downregulates PSA expression both, at mRNA and protein levels in PCa cells. (A, B) qRT-PCR analysis of

PSA mRNA expression in (A) LAPC4, (B) 22Rv1 cells. Cells treated with 10nM DHT to stimulate PSA expression were transfected with 20nM miR-149-5p and NC mimic, each bar represents the PSA mRNA expression normalized to 18S mRNA. (C, D) Analysis of secreted PSA expression by PSA ELISA in (C) LAPC4, (D) 22Rv1 cells transfected with miR-149-5p and NC mimic, with and without 10nM DHT. Data are presented as mean ±

SE from three independent experiments and independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with p  0.05 , p  0.01.

2.4.5 miR-149-5p targets AR expression by binding to its 3’UTR

To verify the predicted target site of miR-149-5p in the 3’UTRS of AR, we performed

Firefly Luciferase (FFLuc) expression analysis by cloning a 210 bp fragment of AR 3’UTR consisting of the predicted miR-149-5p binding site downstream of the FFLuc gene. A seed mutant of miR-149-5p was generated by mutating the seed binding region of miR-149-5p

(Figure 13 A). FFLuc expression was downregulated when miR-149-5p was co-expressed with WT AR 3’UTR construct, this effect was not observed with NC mimic transfection, indicating the specificity of miR-149-5p in regulating FFLuc AR 3’UTR construct (Figure

13 B). Also, significant miR-149-5p mediated FFLuc repression was observed in WT AR

3’UTR compared to the seed mutant construct, therefore validating the predicted site

57 (Figure 13 B). Both, WT AR 3’UTR and AR 3’UTR seed mutant construct were expressed at similar levels.

Figure 13: AR is a direct target of miR-149-5p. (A) Schematic representation of the WT and miR-149-5p seed mutant (8 nucleotides of seed region mutated to complementary bases) luciferase reporter construct showing the potential binding site of miR-149-5p in the

AR 3’UTR. (B) Co-expression of miR-149-5p with WT AR 3’UTR or with AR 3’UTR seed mutant reporter construct in LNCaP cells significantly downregulated the expression of FFluc WT AR 3’UTR construct and the FFluc expression remains unaffected in the AR

3’UTR seed mutant construct. Restoration of luciferase activity is observed in cells transfected with seed mutant constructs compared to the WT 3’ UTR construct. Data are presented as mean ± SE from three independent experiments and independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with p 

0.05 , p  0.01.

2.4.6 miR-149-5p effects cell viability and proliferation of the PCa cells

58 Downregulation of AR expression and predicted role of miR-149-5p in the regulation of apoptosis and SREBP1 signaling indicate its functional role in the regulation of cell proliferation. Moreover, previous studies on miR-149-5p in gastric cancer have identified its role in inhibiting cell proliferation by regulation of ZBTB2 expression (Wang, et al.

2012). Therefore, we performed cell viability assays and proliferation assays to interrogate the effects of miR-149-5p in PCa cells. miR-149-5p reduced the viability of cells significantly five days post-treatment (Figure 14 A and B), further enhancement in the reduction of cell viability was observed in LNCaP cells treated with a combination of miR-

149-5p mimic and enzalutamide (Enz), suggesting a strong therapeutic effect of the combinatorial treatment. It is also clearly evident from BrdU ELISA assay (Figure 14 C), which measured the amount of BrdU incorporation over 24 hrs time point, that miR-149-

5p significantly reduced cell proliferation in LNCaP cells, however proliferation was not effected by miR-149-5p and Enz combination as profoundly as cell viability, this difference might have resulted due to the difference in time point in measuring BrdU incorporation and cell viability. Similar results on cell proliferation were obtained in soft agar colony formation assay (Figure 14 D) performed on 22Rv1 cells, which determined the ability of

22Rv1 cells to proliferate indefinitely in a soft agar medium. 22Rv1 treated with miR-149-

5p before plating on a soft agar medium formed much fewer colonies compared to NC mimic transfected cells.

Figure 14: miR-149-5p regulates the growth of PCa cells. (A, B) miR-149-5p inhibits the viability of (A) LNCaP and (B) PC-3 cells as measured by CellTiter-Glow assay in cells transfected with 20nM miR-149-5p mimic alone and in combination with

60 enzalutamide. (C) Cell proliferation assay using BrdU incorporation as measured using

BrdU ELISA assay on LNCaP cells transfected with 20nM miR-149-5p mimic alone and in combination with enzalutamide shows a decrease in proliferation in miR-149-5p, miR-

149-5p+Enz, and Enz treated cells. (D) Soft agar colony formation assay in 22Rv1 cells transfected with 20nM miR-149-5p and NC mimics. Quantification of a total number of colonies obtained from replicates indicates a significantly lower number of colonies formed in miR-149-5p transfected cells. Data are presented as mean ± SE from three independent experiments and independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with p  0.05 , p  0.01.

2.4.7 miR-149-5p controls PCa cell migration and invasion

Previous studies have reported miR-149-5p as a regulator of migration and invasion in breast cancer cells by regulation of Src and Rac activation (Bischoff, et al. 2014) and by regulation of G-protein-coupled receptor kinase-interacting protein 1 (GIT1) (Chan, et al.

2014). We investigated whether similar regulation of cell migration by miR-149-5p would be a function in PCa. We performed a wound healing assay in LNCaP cells. Cells were transfected with miR-149-5p and NC mimic and the migration of cells at multiple time points was recorded by image analysis (Figure 15 B). miR-149-5p substantially inhibited the migration and hampered the healing of the wound in LNCaP cells when compared to

NC mimic. To determine whether differences in wound healing assay are attributed to reduced cell migration or it is merely an effect of reduced cell proliferation, we performed matrigel invasion assay and investigated if miR-149-5p expression influences the migration of LNCaP and 22Rv1 cells towards a FBS gradient. Matrigel invasion assay 61 results in LNCaP and 22Rv1 cells transfected with miR-149-5p mimic (Figure 15 A) suggest miR-149-5p was capable of impeding the invasive behavior of PCa cells when compared to the NC mimic at a 48 hours’ time point (at a similar time point as for the wound healing assay), when the invaded cells were stained and counted. LNCaP cells

(Figure 15A bottom panel) showed similar inhibition of invasion as 22Rv1 cells (Figure

15 A top panels). A much higher percentage of 22Rv1 cells showed invasion compared to the LNCaP cells, this is due to the higher invasive potential of 22Rv1 cells.

Figure 15: miR-149-5p impairs cell migration and invasion. (A) Matrigel invasion assay shows that transient expression of miR-149-5p in LNCaP and 22Rv1 cells inhibited the invasion towards the FBS gradient. The number of cells in five random fields (20X) were counted for each group and plotted. (B) The wound healing assay shows the suppression of migration in miR-149-5p transfected LNCaP cells as compared to the negative control. Data are presented as mean ± SE from three independent experiments and

62 independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with p  0.05 , p  0.01.

2.5 Discussion

Since the discovery of AR as the key regulator of PCa growth, multiple methods of inhibiting AR function, ranging from clinical castration to the latest second generation AR targeting therapeutics have been developed. Despite androgen ablation AR signaling is active in a vast range of CRPC cases (Spratt, et al. 2015), this confers resistance to drugs such as AR antagonist enzalutamide and abiraterone (Sun, et al. 2010). Therefore, conventional and newly developed treatment regimens often fail due to the heterogeneous nature of prostate carcinogenesis and selective growth of tumor cells which show sustained canonical and non-canonical AR signaling (Buchanan, et al.). microRNAs orchestrate fundamental biological processes such as apoptosis, proliferation, and differentiation.

Regulation of gene expression by microRNAs in cancer have been studied since a decade

(Farazi, et al. 2013), however, due to the wide range of genes targeted by microRNAs, the specificity and efficacy of these molecules as viable therapeutics has not gained considerable attention. A large number of tumor-suppressive microRNAs in prostate cancer have been demonstrated to target AR protein (Ostling, et al. 2011). However, whether suppression of androgen receptor alone can unquestionably reduce tumor burden is doubtful and necessitates the investigation for suppressing AR together with controlling tumor growth via regulating other key pathways.

We have investigated the role of miR-149-5p in this study, miR-149-5p is a widely conserved microRNA among multiple species, and we had initially observed 63 downregulation of miR-149-5p in deep sequencing profile of microRNAs from PrEC,

PrSC, LNCaP and C4-2B cells (Singh, et al. 2016). This lead to the identification of miR-

149-5p as a potential tumor suppressive microRNA in PCa. Bioinformatics analysis of predicted targets of miR-149-5p indicated pathways in PCa such as AR signaling pathways, steroid biosynthesis pathways and regulation of PCa as most significantly regulated pathways. miR-149-5p has been known as a tumor suppressive microRNA in the previous studies. It has been known for its role in inhibiting metastasis in breast cancer (Chan, et al.

2014), renal cell carcinoma (Jin, et al. 2016) and hepatocellular carcinoma (Luo, et al.

2015) previously. Following the previous studies and our observation from deep sequencing data, we tested the expression of miR-149-5p in PCa tumor samples and PCa cells. We confirmed a global downregulation of miR-149-5p in PCa. In the meta-analysis of prostate adenocarcinoma samples obtained from TCGA for a cohort of 550 patients, miR-149-5p showed a negative correlation with overall patient survival.

AR has been a predicted target of miR-149-5p including other proteins as indicated by in- silico analysis. We, therefore, tested the direct interaction of miR-149-5p with AR 3’UTR and confirmed that it suppresses AR expression and its transactivation function, this result was obtained in LBD T877A mutant carrying LNCaP cells, WT-AR carrying LAPC4 and

AR-V7 variant carrying 22Rv1 cells, indicating the universal effect of miR-149-5p function regardless of the alterations present in AR. Results obtained in 22Rv1 are particularly interesting as we can to suppress the expression of drug-resistant AR V7 variant with the ectopic expression of miR-149-5p. This observation indicates that miR-

149-5p might be able to suppress carcinogenesis originating from resistance to ADT and hence downregulation of miR-149-5p confers a selective advantage. Downregulation of

64 AR also resulted in reduced cell proliferation and miR-149-5p enhanced the efficacy of enzalutamide treatment in LNCaP cells. PC-3 showed similar effects on cell viability indicating that miR-149-5p may exert it anti-proliferative effects via pathways independent of AR signaling and the effect of miR-149-5p probably corresponds to the net effect of regulating a broad set of predicted target genes. We also observed inhibition of cell migration and invasion in LNCaP and 22Rv1 cells on ectopic expression of miR-149-5p, this is in accordance with the observations made previously where suppression of FOXM1 by miR-149-5p led to inhibition of epithelial-mesenchymal transition in Non-Small-Cell

Lung Cancer (Ke, et al. 2013). Overall, our study provides an increased understanding of miR-149-5p function in PCa which has a potential for bettering future therapeutics.

65 2.6 References

Aarnisalo, P., J. J. Palvimo, and O. A. Janne

1998 CREB-binding protein in androgen receptor-mediated signaling.

Proceedings of the National Academy of Sciences 95(5):2122-2127.

Antonarakis, E. S., et al.

2017 Clinical Significance of Androgen Receptor Splice Variant-7 mRNA

Detection in Circulating Tumor Cells of Men With Metastatic Castration-Resistant

Prostate Cancer Treated With First- and Second-Line Abiraterone and

Enzalutamide. J Clin Oncol 35(19):2149-2156.

Balbas, Minna D., et al.

2013 Overcoming mutation-based resistance to antiandrogens with rational drug

design. eLife 2.

Balk, Steven P.

2002 Androgen receptor as a target in androgen-independent prostate cancer.

Urology 60(3):132-138.

Bischoff, A., et al.

2014 miR149 functions as a tumor suppressor by controlling breast epithelial cell

migration and invasion. Cancer Res 74(18):5256-65.

Briggs, M. R., et al.

1993 Nuclear protein that binds sterol regulatory element of low density

lipoprotein receptor promoter. I. Identification of the protein and delineation of its

target nucleotide sequence. J Biol Chem 268(19):14490-6.

66 Bubendorf, L., et al.

1999 Survey of gene amplifications during prostate cancer progression by high-

throughout fluorescence in situ hybridization on tissue microarrays. Cancer Res

59(4):803-6.

Buchanan, Grant, et al.

Contribution of the androgen receptor to prostate cancer predisposition and

progression. In Prostate Cancer: New Horizons in Research and Treatment. Pp. 71-

87: Kluwer Academic Publishers.

Cai, C., et al.

2011 Intratumoral De Novo Steroid Synthesis Activates Androgen Receptor in

Castration-Resistant Prostate Cancer and Is Upregulated by Treatment with

CYP17A1 Inhibitors. Cancer Research 71(20):6503-6513.

Caira, Françoise, et al.

2000 Cloning and Characterization of RAP250, a Novel Nuclear Receptor

Coactivator. Journal of Biological Chemistry 275(8):5308-5317.

Chamorro-Jorganes, A., et al.

2014 Autoregulation of glypican-1 by intronic microRNA-149 fine tunes the

angiogenic response to FGF2 in human endothelial cells. J Cell Sci 127(Pt 6):1169-

78.

Chan, S. H., et al.

2014 MicroRNA-149 targets GIT1 to suppress integrin signaling and breast

cancer metastasis. Oncogene 33(36):4496-507.

Chen, L., et al.

67 2014 miR-1207-5p and miR-1266 suppress gastric cancer growth and invasion

by targeting telomerase reverse transcriptase. Cell Death Dis 5:e1034.

Comuzzi, Barbara, et al.

2003 The Transcriptional Co-Activator cAMP Response Element-Binding

Protein-Binding Protein Is Expressed in Prostate Cancer and Enhances Androgen-

and Anti-Androgen-Induced Androgen Receptor Function. The American Journal

of Pathology 162(1):233-241.

Dehm, S. M., et al.

2007 Selective Role of an NH2-Terminal WxxLF Motif for Aberrant Androgen

Receptor Activation in Androgen Depletion Independent Prostate Cancer Cells.

Cancer Research 67(20):10067-10077.

Dehm, S. M., et al.

2008 Splicing of a Novel Androgen Receptor Exon Generates a Constitutively

Active Androgen Receptor that Mediates Prostate Cancer Therapy Resistance.

Cancer Research 68(13):5469-5477.

Farazi, T. A., et al.

2013 MicroRNAs in human cancer. Adv Exp Med Biol 774:1-20.

Gao, Wenqing, Casey E. Bohl, and James T. Dalton

2005 Chemistry and Structural Biology of Androgen Receptor. Chemical

Reviews 105(9):3352-3370.

Gregory, Christopher W., et al.

68 1999 EVIDENCE FOR ANDROGEN RECEPTOR-MEDIATED GROWTH OF

ANDROGEN-INDEPENDENT PROSTATE CANCER. The Journal of

Urology:124.

Guo, Z., et al.

2009 A Novel Androgen Receptor Splice Variant Is Up-regulated during Prostate

Cancer Progression and Promotes Androgen Depletion-Resistant Growth. Cancer

Research 69(6):2305-2313.

Haapala, K., et al.

2007 Androgen receptor amplification is associated with increased cell

proliferation in prostate cancer. Hum Pathol 38(3):474-8.

Haile, Simon, and Marianne D. Sadar

2011 Androgen receptor and its splice variants in prostate cancer. Cellular and

Molecular Life Sciences 68(24):3971-3981.

He, Bin, et al.

1999 Activation Function 2 in the Human Androgen Receptor Ligand Binding

Domain Mediates Interdomain Communication with the NH2-terminal Domain.

Journal of Biological Chemistry 274(52):37219-37225.

He, D. X., et al.

2014 Methylation-regulated miR-149 modulates chemoresistance by targeting

GlcNAc N-deacetylase/N-sulfotransferase-1 in human breast cancer. Febs j

281(20):4718-30.

Hörnberg, Emma, et al.

69 2011 Expression of Androgen Receptor Splice Variants in Prostate Cancer Bone

Metastases is Associated with Castration-Resistance and Short Survival. PLoS

ONE 6(4):e19059.

Hsiao, Pei-Wen, et al.

1999 The Linkage of Kennedy’s Neuron Disease to ARA24, the First Identified

Androgen Receptor Polyglutamine Region-associated Coactivator. Journal of

Biological Chemistry 274(29):20229-20234.

Hu, R., et al.

2009 Ligand-Independent Androgen Receptor Variants Derived from Splicing of

Cryptic Exons Signify Hormone-Refractory Prostate Cancer. Cancer Research

69(1):16-22.

Hu, R., et al.

2012 Distinct Transcriptional Programs Mediated by the Ligand-Dependent Full-

Length Androgen Receptor and Its Splice Variants in Castration-Resistant Prostate

Cancer. Cancer Research 72(14):3457-3462.

Jenster, Guido, et al.

1991 Domains of the Human Androgen Receptor Involved in Steroid Binding,

Transcriptional Activation, and Subcellular Localization. Molecular

Endocrinology 5(10):1396-1404.

Jin, L., et al.

2016 Tumor suppressor miR-149-5p is associated with cellular migration,

proliferation and apoptosis in renal cell carcinoma. Mol Med Rep 13(6):5386-92.

Ke, Y., et al.

70 2013 miR-149 Inhibits Non-Small-Cell Lung Cancer Cells EMT by Targeting

FOXM1. Biochem Res Int 2013:506731.

Korpal, M., et al.

2013 An F876L Mutation in Androgen Receptor Confers Genetic and Phenotypic

Resistance to MDV3100 (Enzalutamide). Cancer Discovery 3(9):1030-1043.

Li, Y., et al.

2012 Androgen Receptor Splice Variants Mediate Enzalutamide Resistance in

Castration-Resistant Prostate Cancer Cell Lines. Cancer Research 73(2):483-489.

Liao, R. S., et al.

2013 Androgen receptor-mediated non-genomic regulation of prostate cancer cell

proliferation. Transl Androl Urol 2(3):187-96.

Lonergan, Peter E., and Donald J. Tindall

2011 Androgen receptor signaling in prostate cancer development and

progression. Journal of Carcinogenesis 10:20.

Luo, G., et al.

2015 miR-149 represses metastasis of hepatocellular carcinoma by targeting

actin-regulatory proteins PPM1F. Oncotarget 6(35):37808-23.

Masuzzo, P., et al.

2013 CellMissy: a tool for management, storage and analysis of cell migration

data produced in wound healing-like assays. Bioinformatics 29(20):2661-3.

McKenna, N. J.

1999 Nuclear Receptor Coregulators: Cellular and Molecular Biology. Endocrine

Reviews 20(3):321-344.

71 Miyoshi, Y., et al.

2000 Fluorescence in situ hybridization evaluation of c-myc and androgen

receptor gene amplification and chromosomal anomalies in prostate cancer in

Japanese patients. Prostate 43(3):225-32.

Mostaghel, E. A., et al.

2011 Resistance to CYP17A1 Inhibition with Abiraterone in Castration-Resistant

Prostate Cancer: Induction of Steroidogenesis and Androgen Receptor Splice

Variants. Clinical Cancer Research 17(18):5913-5925.

Ostling, P., et al.

2011 Systematic analysis of microRNAs targeting the androgen receptor in

prostate cancer cells. Cancer Res 71(5):1956-67.

Sadar, Marianne D.

2011 Small Molecule Inhibitors Targeting the “Achilles' Heel” of Androgen

Receptor Activity: Figure 1. Cancer Research 71(4):1208-1213.

Schaefer, Annika, et al.

2009 Diagnostic and prognostic implications of microRNA profiling in prostate

carcinoma. International Journal of Cancer:NA-NA.

Schaufele, F., et al.

2005 The structural basis of androgen receptor activation: Intramolecular and

intermolecular amino-carboxy interactions. Proceedings of the National Academy

of Sciences 102(28):9802-9807.

Shafi, A. A., et al.

72 2015 Differential regulation of metabolic pathways by androgen receptor (AR)

and its constitutively active splice variant, AR-V7, in prostate cancer cells.

Oncotarget 6(31):31997-2012.

Shen, X., et al.

2016 microRNA-149 targets caspase-2 in glioma progression. Oncotarget

7(18):26388-99.

Singh, S., et al.

2016 Deep sequencing of small RNA libraries from human prostate epithelial and

stromal cells reveal distinct pattern of microRNAs primarily predicted to target

growth factors. Cancer Lett 371(2):262-73.

Spratt, Daniel E., et al.

2015 Androgen receptor upregulation mediates radioresistance after ionizing

radiation. Cancer research 75(22):4688-4696.

Sun, M., et al.

2016 Activation of phosphatidylinositol 3-kinase/Akt pathway by androgen

through interaction of p85alpha, androgen receptor, and Src. J Biol Chem

291(43):22841.

Sun, Shihua, et al.

2010 Castration resistance in human prostate cancer is conferred by a frequently

occurring androgen receptor splice variant. Journal of Clinical Investigation

120(8):2715-2730.

Sun, Y. H., et al.

73 2006 Androgens induce increases in intracellular calcium via a G protein-coupled

receptor in LNCaP prostate cancer cells. J Androl 27(5):671-8.

Unni, E., et al.

2004 Changes in androgen receptor nongenotropic signaling correlate with

transition of LNCaP cells to androgen independence. Cancer Res 64(19):7156-68.

Waltering, Kati K., Alfonso Urbanucci, and Tapio Visakorpi

2012 Androgen receptor (AR) aberrations in castration-resistant prostate cancer.

Molecular and Cellular Endocrinology 360(1-2):38-43.

Wang, F., et al.

2013 SP1 mediates the link between methylation of the tumour suppressor miR-

149 and outcome in colorectal cancer. J Pathol 229(1):12-24.

Wang, Y., et al.

2012 MicroRNA-149 inhibits proliferation and cell cycle progression through the

targeting of ZBTB2 in human gastric cancer. PLoS One 7(10):e41693.

Zhang, Xiaotun, et al.

2011 Androgen Receptor Variants Occur Frequently in Castration Resistant

Prostate Cancer Metastases. PLoS ONE 6(11):e27970.

CHAPTER III

MIR-149-5P REGULATES INTRATUMORAL CHOLESTEROL AND TESTOSTERONE IN PCA

3.1 Abstract

Objective. Sterol regulatory element binding protein 1 (SREBP1) regulates multiple genes involved in cholesterol uptake and biosynthesis. Accumulation of cholesterol in PCa tumors facilitates sustained androgen synthesis despite ADT. We sought to investigate the regulatory function of miR-149-5p in maintaining cholesterol homeostasis in PCa via its predicted targets, which involve SREBP1 HMGCS1, HMGCR, and SCARB1 and studied the tumor suppressive potential of miR-149-5p in a 22Rv1 xenograft model.

Methods. We ectopically expressed miR-149-5p in LNCaP and PC-3 cells to investigate the expression of SREBP1 HMGCS1, HMGCR and SCARB1 by qPCR and western blot analysis and validated the target binding site of miR-149-5p in the 3’ UTR of these genes by luciferase reporter assay performed in LNCaP cells. We also investigated the tumor suppressive role of miR-149-5p in a 22Rv1 xenograft model. The harvested tumors were homogenized and the expression of AR, HMGCS1, SCARB1 was analyzed together with a quantification of intratumoral cholesterol, testosterone, and DHT. RNA sequencing was performed on RNA extracted from 22 RV1 xenografts to analysis the gene downregulated 75 by miR-149-5p.

Results. SREBP1 was downregulated by miR-149-5p in both LNCaP and PC-3 cells; this resulted in a downregulation of FASN, which is transcriptionally regulated by SREBP1.

HMGCR, HMGCS1, and SCARB1 were also downregulated by miR-149-5p. In the xenograft mice model, miR-149-5p suppressed tumor growth and negatively regulated the intratumoral cholesterol and testosterone, indicating its regulatory role in CRPC. Pathway analysis and functional annotation of miR-149-5p targets obtained from RNA sequencing demonstrated steroidogenesis, cholesterol synthesis, and genes involved in PCa growth as significantly suppressed pathways in miR-149-5p treated tumors.

Conclusion. We demonstrate regulation of intratumoral cholesterol and testosterone by miR-149-5p mediated regulation of SREBP1, HMGCS1, and SCARB1. Reduction in intracellular cholesterol also correlated with a decrease in DHT levels in the miR-149-5p treated tumors, suggesting its role in regulating AR signaling and intratumoral DHT synthesis.

76 3.2 Introduction

3.2.1 Role of SREBP1 in prostate cancer

Cholesterol is an essential component of lipid rafts, it provides directionality and allows assembly of lipid rafts required for signal transduction (Simons and Toomre 2000). Rapidly proliferating cells impose higher cholesterol demand; therefore, cholesterol has been shown to mediate survival signaling in prostate cancer cells (Zhuang, et al. 2002). SREBPs are the transcription factors which regulate the expression of gene containing sterol- regulatory elements (SRE) (Briggs, et al. 1993; Kim, et al. 1995), a large number of SREBP target genes, such as HMG CoA reductase (HMGCR) (Vallett, et al. 1996), HMG CoA synthase1 (HMGCS1) (Smith, et al. 1988), fatty acid synthase (FASN) (Magana and

Osborne 1996), squalene synthase (Guan, et al. 1997) and farnesyl diphosphate synthase

(Ericsson, et al. 1996) are involved in regulating the lipogenic and cholesterogenic biosynthetic pathways. SREBP1 activates gene expression in response to cholesterol levels

(Figure 16). Under conditions of low sterol levels, SREBP1 is transported to Golgi and cleaved by SREBP1 cleavage-activating protein (SCAP) for translocation to the nucleus, where it leads to the activation of SRE containing genes. Higher sterol concentration inhibits the transportation of SREBP1 however, this regulation is impaired in prostate tumors which overexpress SREBP1. Overexpression of SREBP1 in transgenic mice presented a huge fatty liver phenotype with an accumulation of cholesteryl ester (Shimano, et al. 1996), which also led to an overexpression of HMGCS1, HMGCR, squalene synthase and consequently enormously high cholesterol and fatty acid synthesis. The study suggested a probable link between higher expression of SREBPs in PCa and accumulation

77 of intracellular cholesterol. Another mechanism of SREBP1 mediated regulation includes its role in controlling AR expression in PCa cells. Overexpression or knockdown of SREBP-1 in prostate cancer cells has been shown to correlate with an increase or decrease in AR expression (Huang, et al. 2012), demonstrating the significance of SREBP1 and AR crosstalk in regulating PCa growth. Additionally, SREBP1 inhibitor, fatostatin has been shown to reduce AR and PSA expression in androgen-responsive and androgen- insensitive cell culture system. These studies indicate a beneficial effect of regulating

SREBP1 signaling (Li, et al. 2014). Inhibition of SREBP1 activity is a viable strategy for regulating PCa tumors driven by mutant P53 (Li, et al. 2015a) as well. P53 is mutated in

3-20% PCa cases (Agell, et al. 2008; Schlomm, et al. 2008; Taylor, et al. 2010) and mutant

P53 enables activation of SREBP1 expression and therefore, targeting SREBP1 in subtypes of tumors driven by AR and P53 both may give significant results. Besides regulating cholesterol homeostasis, SREBP1 also regulates fatty acid synthesis via FASN expression.

Overexpression of SREBP1 induces overexpression of FASN (Ettinger, et al. 2004;

Swinnen, et al. 2004) and tumors with increased FASN levels also promote aggressive growth when compared with tumors with normal FASN expression (Amemiya-Kudo, et al. 2002). All of these evidence suggest SREBP1 regulates PCa growth my regulating cholesterol metabolism, lipid biosynthesis and AR expression (Di Vizio, et al. 2008;

Freeman, et al. 2005) in AR as well as P53 driven tumors. Hence, therapeutics aimed at suppressing SREBP1 expression can provide broader clinical impact then androgen deprivation therapy alone.

Figure 16: Regulation of cholesterol homeostasis by sterol regulatory element binding proteins (SREBPs). The abundance of sterol in the endoplasmic reticulum (ER) leads to binding of cholesterol to sterol-sensing domain (SSD) of SCAP and insulin-induced gene

1 (INSIG) proteins, which prevents transportation of SREBP1 to Golgi. Transport of

SREBP1 to the Golgi and cleavage by SCAP is essential for its transcriptional function.

Under no-sterol conditions, SREBP1 is transported to Golgi in COPII vesicles, and its proteolytic release by SCAP leads to import into the nucleus where it activates SRE elements containing genes such as HMGCR (Ikonen 2008)

3.2.2 Cholesterol homeostasis and its implications in CRPC

A major proportion of cholesterol is obtained by de novo synthesis by the mevalonate pathway using acetyl-CoA as a precursor. About one-third of the total cholesterol comes

79 from dietary intake (Grundy 1983). Cholesterol modulates the functions of membrane proteins, participates in membrane trafficking, transmembrane signaling processes

(Simons and Ikonen 2000; Simons and Vaz 2004), and forms precursors for the synthesis of steroid hormones (Leon, et al. 2010). Therefore, cholesterol content of cells is very tightly regulated and kept unperturbed by the variations in serum cholesterol level. Multiple mechanisms regulate cholesterol homeostasis, which includes uptake, synthesis, and conversion to cholesteryl esters. Synthesis of cholesterol begins with HMGCS1 catalyzing the first reaction to condense acetyl-CoA with acetoacetyl-CoA (Figure 17). The second step of the catalysis of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) to mevalonic acid is a rate-limiting step catalyzed by HMGCR (Krisans 1996; Reinhart, et al. 1987), which is also a target of statins. Through a sequence of reaction, lanosterol, the first sterol intermediate is formed. Lanosterol is further trimmed by 19 enzymatic reactions to form cholesterol.

Figure 17: de novo cholesterol synthesis from acetyl-CoA. The Mevalonate pathway shows the stages of cholesterol biosynthesis from acetyl-CoA and acetoacetyl-CoA to

HMG-CoA. Through the sequences of reactions, which include the rate-limiting step catalyzed by HMG-CoA reductase (targeted by statins) and Farnesyl-PP-synthase (targeted by bisphosphonates) HMG-CoA leads to the synthesis of cholesterol (adapted from (Porter and Herman 2011))

It is important to understand the multi-step cholesterol synthesis process because, besides gene regulation by SREBP1, genetic modifications and overexpression of the enzymes

81 involved in the biosynthetic pathway can substantially deregulate cholesterol synthesis. For instance, squalene monooxygenase (SQLE), one of the rate-limiting enzymes for the formation of cholesterol precursor is overexpressed in lethal PCa case (Stopsack, et al.

2017) and certain allelic forms of farnesyl diphosphate farnesyltransferase (FDFT1) with increased promoter activity correlate with the risk of prostate cancer (Fukuma, et al. 2012).

Moreover, loss of cholesterol efflux protein ABCA1 by hypermethylation leads to dysregulation of cholesterol homeostasis in PCa cells (Lee, et al. 2013).

Cholesterol uptake is facilitated by Scavenger Receptor B type I (SCARB1), which helps in uptake of cholesterol from HDL (Silver, et al. 2000; Trigatti, et al. 2000) and also helps in elimination of excess cholesterol by biliary cholesterol secretion (Harder, et al. 2007;

Wiersma, et al. 2009). SCARB1 contains SRE elements, and its expression is controlled by SREBP2 as well as SREBP1 (Treguier, et al. 2004). Overexpression of SCARB1 has been linked to tumor growth in transgenic adenocarcinoma of mouse prostate model

(Llaverias, et al. 2010). Multiple lines of evidence suggest that higher expression of

SCARBI in metastatic prostate cancer almost always leads to resistance to ADT (Gutierrez-

Pajares, et al. 2016; Schorghofer, et al. 2015). Higher levels of SCARBI possibly promote the transport of cholesterol into the tumor cell which can be utilized by the tumor cells as a means to facilitate androgen synthesis (Azhar, et al. 2003). This explanation also supports the reported decrease in plasma HDL cholesterol levels found in a wide range of malignancies (Fiorenza, et al. 2000; Li, et al. 2016; Muntoni, et al. 2009; Rose, et al. 1974;

Yuan, et al. 2016). Additionally, diets consisting of high-fat content were shown to promote prostate cancer cell growth and aggressiveness (Kolonel, et al. 1999; Strom, et al. 2008),

82 and drugs that interfere with fatty acid and cholesterol metabolism and absorption, such as statins are known to reduce prostate cancer growth, angiogenesis, and progression

(Murtola, et al. 2008; Solomon, et al. 2009; Yokomizo, et al. 2011). One more line of evidence in support of role of cholesterol in PCa progression comes from the epidemiologic studies where a direct correlation between PCa incidences (Bravi, et al. 2006; Kok, et al.

2011; Mondul, et al. 2010) aggressiveness (Batty, et al. 2011; Platz, et al. 2009) and total cholesterol was observed. Alteration in cholesterol homeostasis is therefore contributed by deregulated uptake, upregulation of the gene expression by SREBPs and overexpression of proteins involved in de novo cholesterol synthesis. Given the key role of cholesterol in steroidogenesis (Dillard, et al. 2008a) (Montgomery, et al. 2008a), it is vital to regulate tumor cholesterol levels.

3.2.3 Potential role of miR-149-5p in maintaining cholesterol homeostasis

Selective growth of tumor cells with sustained AR signaling facilitated by de novo androgen synthesis is one of the major causes of resistance to ADT (Dillard, et al. 2008a).

As discussed in the previous sections, deregulation of cholesterol homeostasis leads to reasonably higher cholesterol and testosterone in PCa tumors (Mostaghel, et al. 2012). A very few microRNAs have been studied to regulate cholesterol homeostasis (Hsu, et al.

2012; Rayner, et al. 2010; Ru and Guo 2017) and, no study regarding the role of microRNAs in regulating cholesterol homeostasis in PCa is available. Our computational prediction indicated SREBP1, HMGCR, HMGCS1, and SCARB1 as targets of miR-149-

5p, based on which we aim to investigate the role of miR-149-5p in maintaining cholesterol homeostasis and steroid biosynthesis. We propose that the regulation of SREBP1

83 expression by miR-149-5p together with downregulation of HMGCS1, HMGCR and

SCARB1 may control cholesterol synthesis and influx. The regulation of cholesterol homeostasis along with suppression of AR signaling (Figure 18) is expected to have a significant effect on the growth of PCa cells.

Figure 18: A model for miR-149-5p mediated regulation of AR signaling, and control of intracellular cholesterol and androgen levels. miR-149-5p suppresses canonical AR signaling. Predicted targets of miR-149-5p include SREBP1, HMGCS1, HMGCR and

SCARB1, which facilitate cholesterol accumulation and intratumoral androgen synthesis.

Regulation of the expression of these predicted targets by miR-149-5p may significantly reduce influx and synthesis of cholesterol and therefore intratumoral androgen synthesis.

84 3.3 Materials and Methods

3.3.1 Cell lines

The androgen-dependent human PCa cell lines LNCaP, androgen-insensitive 22Rv1, and

AR null PC-3 cell lines were obtained from American Type Culture Collection (Manassas,

VA). All cell lines were cultured in RPMI 1640 medium supplemented with 10% FBS, pen-strep.

3.3.2 Reverse transcription and qPCR

Total RNA isolated from cells for the relevant experiment was DNAse treated and then reverse transcribed using an ImProm-II Reverse Transcription System (Promega, Madison,

WI). Primers (relevant for the particular experiment are shown in table 2) were designed using NCBI primer blast tool. Each set of primers was verified to generate specific product by performing a PCR and analyzing the product on a 3% agarose gel. The SYBR Green- based qPCR was performed using SuperMix obtained from Invitrogen, and qPCR reactions were run on a 7500 Real-time PCR System (Applied Biosystems. Replicates were performed per cDNA sample along with the 'reverse transcriptase minus' and 'no template' controls. The specificity of amplification was confirmed by melting curve analysis. Gene expression was quantified using the relative standard curve method. Different dilutions of cDNA synthesized from LNCaP cells were used to plot the standard curves for each gene and 18S RNA. 18S RNA expression was used as an internal control and the relative expression of each gene was normalized to 18S expression. All experiments were repeated thrice with three replicates per set.

3.3.3 Western blot analysis

LNCaP and PC-3 cells were seeded in 6 well plates 24 hrs before transfection. Cells were transfected with 20nM miR-149-5p mimic or negative control (Dharmacon, Chicago, IL) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) and harvested 48 hr post-transfection for protein extraction. 20 micrograms of protein were resolved on NuPAGE 4-12% Bis-

Tris gels and electro-transferred to nitrocellulose membranes. Anti-SREBP1, FASN,

HMGCR and SCARB1 antibodies were obtained from Santa Cruz and anti-HMGCS1 from cell signaling and the horseradish peroxidase conjugated anti-mouse secondary antibody from cell signaling. Bands were detected using the ECL Plus Western blotting detection reagent (GE Healthcare). The level of protein expression in each sample was determined by normalizing band intensity to β-actin in the respective sample.

3.3.4 Construction of reporter plasmids and luciferase assay

WT-3' UTR (WT: wild type) reporter plasmids were constructed by cloning 214 bp fragment of SREBP1 3' UTR, 219 bp of HMGS1 3’UTR, 265 bp of SCARB1 3’UTR and

207 bp of HMGCS1 3’UTR, spanning the predicted target site for miR-149-5p downstream of firefly luciferase coding region in pMIR-REPORT vector (Ambion, Austin, TX). Site- directed mutagenesis of the putative target site for miR-149-5p in WT-3' UTR constructs was carried out to generate the MUT-3' UTR construct. Top10 E. coli chemically competent cells were transformed using the mutant 3’UTR reporter constructs. The plasmids isolated by mini scale plasmid prep using Qiagen kit were sequenced to confirm the mutation. For luciferase assays, LNCaP cells (20,000 cells/well) were plated in 24-well

86 plates one day before transfection. Cells were cotransfected using Lipofectamine 2000

(Invitrogen), with 100 ng of WT-3' UTR or MUT-3' UTR firefly luciferase reporter construct, 10 ng of renilla luciferase reporter plasmid (Promega, Madison, WI) and either miR-149-5p mimic (20 nM) or NC mimic (20 nM). Cell lysates were assayed for firefly and renilla luciferase activities 48 hr after transfection using the Dual-Luciferase Reporter

Assay System (Promega) and Victor 3 Multilabel Counter 1420 (PerkinElmer). Renilla luciferase activity served as a control for transfection efficiency. Data are represented as ratio of firefly luciferase activity to renilla luciferase activity.

3.3.5 Xenograft studies

Castration-resistant 22Rv1 cells were used to establish PCa tumors in the mice model. 5-

6-week-old athymic nude male mice nu/nu (NCR strain) were used per group (n=5/group), a total of 20 animals were used. Cells were implanted subcutaneously, 5x106 cells with matrigel (BD Biosciences) into both flanks to produce ten tumors/ treatment set. When solid tumors of approximately 3 mm diameter were established, the animals were divided into four groups, and the groups were treated with intratumoral injections of miR-149-5p mimic complexed with siPORT transfection reagents or NC mimic, enzalutamide (Enz), miR-149-5p+Enz, as described earlier (Majid, et al. 2013). Treatment was delivered every

3 days for up to 21 days or until the tumor volume reached 17 mm in diameter. Tumor size measurement and weight of the animals was recorded every time the treatment was given.

Animals were sacrificed using CO2, and cervical dislocation and tumors were measured, extracted and frozen in liquid nitrogen followed by storage at -80C.

87 3.3.6 Amplex™ red cholesterol assay

The Amplex™ red cholesterol assay was performed as per manufacturer’s instructions for

Amplex™ red cholesterol assay Kit from Thermo fisher (A12216). Briefly, tumor extracts were aliquoted into a 96-well plate, and Amplex™ Red reaction buffer was added. Aliquots of the Amplex™ red working solution with cholesterol esterase were added to the wells, and for determination of free cholesterol, working solution without cholesterol esterase was added in duplicates to the remaining wells. Plates were incubated for half an hour at

37C protected from light. Fluorescence was measured using an excitation wavelength of

560 nm and an emission wavelength of 590 nm. A cholesterol standard curve was also created using the provided cholesterol reference standard. The standard plot was used to estimate the cholesterol content in each sample. Cholesterol content was corrected by the amount of protein present in the lysate.

3.3.7 ELISA for intratumoral testosterone

The tumors were minced and homogenized the cells were pelleted down, and the supernatant was collected. Testosterone ELISA was performed using Enzo ELISA kit and results were normalized to the total protein level in each sample.

3.3.8 Sample preparation for Liquid Chromatography-Tandem Mass Spectrometry (LC-MS) assay

Tumors were thawed, weighed and equal amounts of each sample were homogenized.

Homogenates were extracted as explained previously (Kalhorn, et al. 2007). Briefly, 300

gs of protein were used for extraction of cholesterol and DHT, 450 l MeOH, and 50 l

88 1M NaOH was added and samples were vortexed followed by further extraction with1.5 ml Methyl tert-Butyl ether. Phase separation was performed using 400 l water and the organic layer was collected. Extraction was repeated with 200 l MeOH, 800 l of MTBE, and 400 l water. Extracts were pooled, then split into two fractions 9:1 for a steroid: lipid analysis. Each sample was dried, and the larger steroid fractions were dissolved in 0.5 l acetonitrile, centrifuged, and the clear supernatant transferred to fresh tubes and dried again. The residue was dissolved in 50% MeOH, centrifuged, and the resulting supernatant extract was derivatized with 4X dilution with 0.2 M Hydroxylamine followed by incubation for 1 hr at 650 C as explained by (Liebisch, et al. 2006). The smaller fraction was dissolved in 400 l of AC: CHCl3 1:5 and processed as per the method by Liebisch, et al. Similar method was adopted to produce standards for cholesterol and DHT.

3.3.9 LC/MS analysis of cholesterol and DHT

Cholesterol and d-DHT were analyzed by the LC/MS method using a Shimadzu LCMS-

8050. Standard solution or sample was injected onto a C18 column (Prodigy, 3 m, 2x150 mm, Phenomenex) for separation. Mobile phase A consisted of a water/formic acid

(100/0.2 by volume); mobile phase B consisted of a methanol/formic acid (100/0.2 by volume). A linear gradient was generated at 0.2 ml/min: 0-2 min, 50% B; 2-8 min, 50%B to 100%B; 8-18 min, 100%B; 1-18.1 min, 100%B to 50%B, 18.1-26 min, re-equilibrate with 50% B. the injection volume was 5 ul. The column was controlled a 25C, and the auto sampler compartment was set to 10C. The HPLC eluent was injected on to the triple quadrupole mass spectrometer and ionized with electrospray ionization at positive mode.

89 Both the cholesterol and d-DHT were monitored using selected reaction monitoring (SRM) mode. The SRM transitions (m/z) were 369147 for cholesterol and 30691 for d-DHT.

The standard plot for cholesterol and derivatized DHT was produced using a range of standard from 5 ng/ml to 5000 ng/ml.

3.3.10 Statistical analysis

.

3.4 Results

3.4.1 miR-149-5p downregulates the expression of SREBP1, HMGCS1, HMGCR and SCARB1 in PCa cells

Our target prediction analysis identified putative binding sites for miR-149-5p in the

3’UTR of SREBP1, HMGCS1, HMGCR, and SCARB1, suggesting miR-149-5p may coordinate cholesterol homeostasis through these proteins. Therefore, to determine the regulation of the predicted target protein, we transfected LNCaP and PC-3 cells with miR-

149-5p and NC mimic. We observed significant downregulation of SREBP1 transcript and protein expression in miR-149-5p treated cells compared to NC mimic (Figure 19 A, B).

Downregulation of SREBP1 also led to the suppression of FASN, which is transcriptionally regulated by SREBP1, hence validating the functional significance of SREBP1.

90 miR-149-5p also showed significant suppression of mRNA and protein levels of

HMGCS1, HMGCR, and SCARB1 (Figure 19 C, D), which were also predicted to be direct targets of miR-149-5p.

Figure 19: miR-149-5p reduces mRNA and protein levels of SREBP1 and FASN, and

91 suppresses HMGCS1, SCARB1 and HMGCR expression in LNCaP cells. (A) Western blot analysis shows suppression of SREBP1 and FASN protein in LNCaP and PC-3 cells.

(B) Ectopic expression of miR-149-5p leads to a reduction in SREBP1 and FASN mRNA in miR-149-5p treated LNCaP and PC-3 cells. (C) Western blot analysis and (D) qRT-PCR analysis shows downregulation of protein and mRNA levels of HMGCS1, SCARB1, and

HMGCR in miR-149-5p treated LNCaP cells. Numbers on western blot panels represent the densitometry analysis of protein expression normalized to -actin expression. Data are presented as mean ± SE from three independent experiments and independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with p 

0.05 , p  0.01.

3.4.2 Target validation for SREBP1, HMGCS1, HMGCR and SCARB1

To verify the predicted target site of miR-149-5p in the 3’UTRs of SREBP1, HMGCS1,

SCARB1, and HMGCR, we performed a Firefly Luciferase (FFLuc) expression analysis by cloning a fragment of the 3’UTR of these genes consisting of the predicted miR-149-5p binding site downstream of FFLuc. A seed mutant of miR-149-5p was generated by mutating the seed binding region of miR-149-5p (Figure 20 A & C). FFLuc expression was downregulated when miR-149-5p was co-expressed with the WT 3’UTR construct of

SREBP1, HMGCS1, SCARB1, and HMGCR (Figure 20 B & D), this effect was not observed with NC mimic transfection or in the in the 3’UTR seed mutant construct. All constructs were expressed at almost similar levels.

Figure 20: SREBP1, HMGCS1, SCARB1, and HMGCR are direct targets of miR-

149-5p. (A) Representation of the WT and miR-149-5p seed mutant of SREBP1 (6 nucleotides of seed region mutated to complementary bases) luciferase reporter construct shows the potential binding site of miR-149-5p in the 3’UTR. (B) Co-expression of miR-

149-5p downregulated the expression of WT 3’UTR FFluc construct of SREBP1 compared to the NC and seed mutant construct of 3’UTR of SREBP1. (C) Representation of the WT 93 3’UTR and miRNA duplex for HMGCS1, SCARB1, and HMGCR. (D) Co-expression of miR-149-5p downregulated the expression of WT 3’UTR FFluc construct of HMGCS1,

SCARB1, and HMGCR when compared to the NC and seed mutant construct of the respective target. Data are presented as mean ± SE from three independent experiments and independent sample t-test was performed to demonstrate statistical significance

(indicated by the asterisks), with p  0.05 , p  0.01.

3.4.3 miR-149-5p suppresses 22Rv1 xenograft growth by downregulating AR, HMGCS1, and SCARB1

Silencing of SREBP1, HMGCS1, SCARB1, and HMGCR may attenuate cholesterol synthesis and efflux, thereby inhibiting tumor growth. Hence, we evaluated the tumor suppressive function of miR-149-5p in the 22Rv1 xenografts produced in athymic nude mice (Figure 21). Xenograft tumors were treated with intratumoral injection of miR-149-

5p alone and in combination with oral gavage administration of enzalutamide at the indicated time points (Figure 21), tumor volume and weight the animals were recorded at every treatment point. Tumors treated with miR-149-5p grew at a much slower rate when compared to the NC treated group. The effect was further enhanced in tumors treated with a combination of miR-149-5p and enzalutamide; this result was as per the data obtained in

LNCaP cells (Figure 15, page 60). At Day 19, miR-149-5p and Enz treated tumors showed significantly reduced growth and at day 23, miR-149-5p and the combination of miR-149-

5p and Enz both treatment groups showed a significant reduction in tumor volume.

However, we didn’t see a significant difference between miR-149-5p treated and miR-149-

5p + Enz treated group; this is probably because of the reduced sensitivity of 22Rv1 cells

94 to enzalutamide due to the presence of AR V7 variant. There was no significant difference in weight of the animal at any time point during the treatment. We observed significant overexpression of miR-149-5p in both, the miR-149-5p treated as well as miR-149-5p and enzalutamide treated tumors (Figure 22 A) indicating efficient delivery of miR-149-5p to the tumors. miR-149-5p also inhibited the expression of AR in the xenograft tumors

(Figure 22 B), therefore, recapitulating the results obtained in the in-vitro studies performed in PCa cell lines.

Figure 21: miR-149-5p suppresses 22Rv1 xenograft growth. Mice representing 22Rv1 xenograft growth in miR-149-5p, enzalutamide, miR-149-5p + Enz and NC mimic treated animals. The tumor regressed significantly in miR-149-5p, and miR-149-5p + Enz treated animals. Relative tumor growth is shown in the quantitative plot (arrow indicates the beginning of treatment and days indicate the time points measurements were taken and treatment was given) and tumor images taken after the termination of the treatment are

95 shown in the panel on the right. At the termination of experiment (day 23) both, miR-149-

5p and miR-149-5p+Enz treatment groups showed significantly reduced tumor growth, significant regression of tumor growth was also observed between NC and miR-149-

5p+Enz treated group at day 19. Data are presented as mean ± SE from ten tumors in each treatment group. Data were analyzed using 2way ANNOVA significance, with p  0.05 , p  0.01 and P  0.001.

3.4.4 miR-149-5p reduces intratumoral cholesterol and testosterone in 22Rv1 xenografts

To study the functional role of validated targets of miR-149-5p in the in vivo model, we analyzed the expression of SCARB1 and HMGCS1 in the four sets of treatment groups. miR-149-5p significantly reduced HMGCS1 and SCARB1 expression in miR-149-5p and miR-149-5p+Enz treated tumors (Figure 22 B), we were unable to obtain HMGCR expression in the xenograft tumors. We further analyzed the intratumoral cholesterol in the treated tumors using Amplex™ red cholesterol assay (Figure 22 C) and observed a significant reduction in cholesterol levels in both, miR-149-5p and miR-149-5p + Enz treatment group; similar results were also obtained by the LC-MS analysis for cholesterol

(data not shown). Reduction in cholesterol levels also correlated with lower testosterone and DHT levels in those tumor samples (Figure 22 D, E). The correlation between cholesterol and testosterone levels suggest that intratumoral cholesterol influences intratumoral androgen levels, an observation which has previously been validated in xenograft studies (Mostaghel, et al. 2012). We also observed accumulation of DHT in enzalutamide treated tumors, suggesting a deregulation in DHT metabolism which could

96 explain poor therapeutic effects of enzalutamide treatment observed in our xenograft study.

We reason that the effect of enzalutamide on DHT levels likely also influenced the DHT levels in miR-149-5p+Enz treated group, which resulted in no significant difference in

DHT concentrations between miR-149-5p+Enz and NC treated groups.

Figure 22: miR-149-5p suppresses AR, HMGCS1 and SCARB1 expression and regulates intratumoral cholesterol, testosterone and DHT levels in the 22Rv1 xenografts: (A) TaqMan assay for analysis of miR-149-5p expression in the 22Rv1 xenografts given various treatments. (B) Western blot analysis for the expression of AR,

97 HMGCS1, and SCARB1 in xenograft tumors shows suppression of AR, HMGCS1 and

SCARB1 in the miR-149-5p and miR-149-5p + Enz treated animals. (C) Analysis of total cholesterol in xenograft tumors using Amplex™ red cholesterol assay shows reduced cholesterol levels in miR-149-5p and miR-149-5p + Enz treated tumors. (D) Quantitative

ELISA for total intratumoral testosterone in xenograft tumor shows reduced testosterone levels in miR-149-5p and miR-149-5p + Enz treated tumors. (E) LC-MS quantitation of total intratumoral DHT in the xenograft tumors shows a reduction in DHT concentration in miR-149-5p, no significant difference was observed in the miR-149-5p+Enz treated tumors. Numbers on western blot panels represent the densitometry analysis of protein expression normalized to -actin expression. Data are presented as mean ± SE from two independent experiments and independent sample t-test was performed to demonstrate statistical significance (indicated by the asterisks), with p  0.05 , p  0.01 and “ns” indicates no significant difference observed.

3.4.5 RNA sequencing analysis indicates miR-149-5p regulates genes involved in steroid biosynthesis, oxidative phosphorylation, and PCa

The RNA extracted from 22Rv1 xenograft tumors was sequenced for studying the differential expression of genes in miR-149-5p, and NC control treated tumors. Analysis of RNA sequencing data indicated that miR-149-5p downregulated gene comprised of genes involved in metabolic pathways, cell cycle, carbon metabolism, oxidative phosphorylation, steroid biosynthesis and prostate cancer (Figure 23 A). Metabolic pathways were further examined into subcategories which identified oxidative phosphorylation, TCA cycle, metabolism of lipids and lipoproteins, activation of genes by

98 SREBP1 and Warburg effect as closely related sets (Figure 23 B). Regulation of metabolism and oxidative phosphorylation by miR-149-5p is critical for regulating PCa growth because tumor cells often demonstrate enhanced respiratory phenotype to gain resistance to chemotherapy (Ippolito, et al. 2016). Several of the miR-149-5p target genes are involved in regulating lipid metabolism. Lipid metabolism is highly altered in PCa by overexpression of enzymes involved in de novo lipogenesis, which allows accumulation of lipids and cell proliferation providing survival advantage to PCa tumors (Deep and

Schlaepfer 2016).

Figure 23: miR-149-5p regulated pathways in 22Rv1 xenografts. (A) The pie chart representing the mapping of 333 genes downregulated in miR-149-5p treated xenografts and the contribution percentage of these genes in the respective pathway. (B) Functional annotation of genes downregulated by miR-149-5p in 22Rv1 xenograft tumors and the associated network of the pathways. Highly downregulated genes involved in regulation of

PCa, steroid biosynthesis and cholesterol biosynthesis are indicated in the list.

100 Upon close observation of the downregulated genes involved in PCa, cholesterol and steroid biosynthesis, we discovered that many of the key genes implicated in the progression of PCa to CRPC were downregulated by miR-149-5p. These genes included, squalene epoxidase (SQLE), the second rate-limiting enzyme in cholesterol synthesis, which has been associated with increased de novo cholesterol synthesis in CRPC

(Stopsack, et al. 2017). Acetyl-CoA acetyltransferase 2 (ACAT2), which promotes cholesterol accumulation in the form of cholesteryl esters (Rogers, et al. 2015). Sterol 5- reductase (SRD5A1), which converts testosterone to DHT and therefore overexpression of this enzyme has been linked to activation of backdoor pathways of DHT synthesis

(Montgomery, et al. 2008b). CYP17A1 and farnesyl-diphosphate farnesyltransferase 1

(FDFT1) were the other significantly downregulated genes in miR-149-5p treated tumors, both the enzymes are key components of steroid biosynthesis, and combinatorial downregulation of these genes may have contributed to a decrease in intratumoral androgens observed in our assays. Our results from gene set enrichment analysis also indicate that targets of miR-149-5p are also involved in hypercholesterolemia, which is a common disorder in men aged over 50 years of age and shows a positive correlation with the risk of development of PCa (Friesen and Rodwell 1997; Holdgate, et al. 2003)

3.5 Discussion

More than one-third of CRPC patients develop resistance to the second-generation ADT treatments, mostly due to the gain-of-function in the AR protein and enhanced levels of intratumoral androgens (Sun, et al. 2010; Waltering, et al. 2012). It has been shown that

CRPC tumor and PCa cells express all of the necessary enzymes required for de novo 101 androgen synthesis from cholesterol (Dillard, et al. 2008b). Tumor-specific downregulation of microRNAs which may regulate cholesterol homeostasis and steroid biosynthesis could promote tumor growth and resistance to ADT in CRPC. We observed in the in-silico analysis that miR-149-5p target genes, SREBP1, HMGCR, HMGCS1, and

SCARB1 are the key proteins involved in metabolic pathways, we anticipated that by regulating the expression of these target genes, miR-149-5p might regulate cholesterol homeostasis and inhibit PCa growth.

SREBP1, HMGCR and HMGCS1 and SCARB1 have been well studied for their role in cholesterol homeostasis. SREBP1 regulates the transcription of HMGCR and HMGCS1

(Shimano 2001) both of which regulate de novo cholesterol synthesis. Interestingly, transcriptional activity of SREBP1 is regulated by androgens (Swinnen, et al. 2002). This indicates that PCa tumors activate a loop in which SREBP1 promote androgen synthesis and androgens activate SREBP1, this could be a possible explanation for anti-cancer effects of fatostatin (SREBP1 inhibitor) in PCa (Li, et al. 2014). We discovered that miR-149-5p downregulated the expression of SREPB1, HMGCR, HMGCS1 and SCARB1 by binding to their 3’UTR. This observation signifies the therapeutic potential of miR-149-5p could be compared to statins and bisphosphonates, which target the rate-limiting step of cholesterol synthesis by inhibiting the enzymatic action of HMGCR and FDFT1, respectively. Statins and bisphosphonates have also been investigated for their anti-cancer effects (Hutchinson and Marignol 2017; Karlic, et al. 2017; Murtola, et al. 2007). Inhibition of mevalonate synthesis has been known to cause cell cycle arrest and quiescence (Silber, et al. 1992), which suggest inhibition of cholesterol biosynthetic pathway (mevalonate synthesis) by miR-149-5p might have contributed to the inhibition of cell viability in PC-

102 3 cells. In our xenograft experiment, we observed the suppression of tumor growth my miR-149-5p, the effects were further enhanced in the xenograft tumors which received miR-149-5p together with oral administration of enzalutamide, indicating the potential of miR-149-5p as an adjuvant therapy. We also observed suppression of AR, HMGCS1 and

SCARB1 expression in the xenograft tumors treated with miR-149-5p and a combination of miR-149-5p with enzalutamide, suggesting the regulation of cholesterol homeostasis in the in-vivo system.

On investigation of intracellular cholesterol, testosterone, and DHT in the tumors obtained from the 22Rv1 xenograft, we observed significantly reduced levels of cholesterol, testosterone and DHT in miR-149-5p treated tumors. NC mimic treated tumors showed accumulation of cholesterol, suggestive of excessive cell proliferation. Enzalutamide treated tumors showed no significant difference in cholesterol levels when compared to

NC mimic treated tumors, however, an accumulation of DHT was observed in these tumors when compared to NC. This may indicate the development of therapeutic resistance to enzalutamide, which may have been suppressed in the tumors treated with miR-149-5p and enzalutamide. Reduced intratumoral cholesterol by suppression of HMGCS1 and SCARB1 might have led to reduced testosterone and DHT concentration as well, this result is in accordance with previous studies where lower levels of total cholesterol in CRPC tumors correlated with a similar decrease in testosterone levels (Leon, et al. 2010). Regulation of cholesterol homeostasis also regulates the androgen-independent growth of cells by controlling cholesterol mediation activation of Akt signaling pathway (Youlin, et al. 2017), this lends another supports to our observation regarding anti-proliferative effects of miR-

149-5p in PCa cells and suppression of tumor growth in 22Rv1 xenografts. RNA

103 sequencing analysis provided further validation to the observations that were made in the cell culture experiment. We were able to confirm more than 2-fold downregulation of transcript levels of HMGCS1and HMGCR in the xenograft tumors.

RNA sequencing analysis also indicated that miR-149-5p downregulated multiple other key enzymes involved in biosynthesis of cholesterol and steroids. The identified genes in cholesterol biosynthesis and metabolism included Sterol-O-acyl transferase 1 (SOAT1),

FDFT1, SQLE, acyl Co-A cholesterol acyltransferase 2 (ACAT2), sterol-C5-desaturase

(SC5D), and 24 dehydroxy cholesterol reductase (DHCR24). SOAT1 is responsible for utilizing dietary cholesterol and esterification of cholesterol, inhibition of SOAT1 reduces steroidogenesis (Sbiera, et al. 2015). FDFT1 catalyzes the conversion of farnesyl pyrophosphate to squalene, allelic variants of FDFT1 have been associated with PCa risk

(Fukuma, et al. 2012). Higher expression of SQLE has been associated with the lethality of PCa (Stopsack, et al. 2016). ACAT2 is an androgen regulated gene involved in synthesis of cholesteryl esters for accumulation of cholesterol in the cell (Locke, et al. 2008).

Significantly higher expression of DHCR24 has also been reported in PCa compared to normal tissues (Bonaccorsi, et al. 2008). The enzymes involved in steroid biosynthesis included CYP17A1, SRD5A1. CYP17A1 is also a target of abiraterone and PCa tumors often demonstrate resistance to abiraterone via activation of a backdoor pathways and reliance on the adrenal precursors for the synthesis of the DHT using SRD5A1 (Chang, et al. 2011; Li, et al. 2015b). Silencing of both these enzymes by miR-149-5p indicates its superior therapeutic potential.

Additionally, we identified a broader set of miR-149-5p targets which are implicated in

PCa, such as beta-catenin (CTNNB1) and Glycogen synthase kinase 3 (GSK3B).

104 CTNNB1 activates Wnt signaling and coactivates AR signaling (Yang, et al. 2006).

GSK3B controls autophagy in PCa (Sun, et al. 2016). Overall, our RNA sequencing analysis provides support to the in-silico predictions which led the foundation for studying the role of miR-149-5p in PCa and provides evidence that miR-149-5p targets multiple key enzymes involved in cholesterol homeostasis, PCa, and steroid biosynthesis.

105 3.6 Summary and conclusion

3.6.1 Summary of the major findings

The studies in this work are focused on understanding the functional role of miR-149-5p in prostate cancer and investigating the key cellular pathways regulated by it. We emphasize on AR signaling and role of cholesterol homeostasis in regulating steroid biosynthesis and thereby regulating AR signaling. As shown in the model presented in figure 24, our results from cell culture system and in vivo studies can be summarized as follows:

1- miR-149-5p is significantly down-regulated in PCa tumor samples and cell lines.

2- miR-149-5p downregulates AR, SREBP1, FASN, HMGCS1, HMGCR and

SCARB1.

3- It inhibits migration and viability of PCa cells, and enhances the therapeutic effect

of enzalutamide.

4- miR-149-5p reduces PCa tumor growth in the xenograft mice model system.

5- miR-149-5p negatively regulates intratumoral cholesterol, testosterone and DHT in

22Rv1 xenografts.

6- RNA sequencing analysis indicates that the regulation of tumor growth and

cholesterol homeostasis by miR-149-5p is a result of a set of genes targeted by miR-

149-5p, which include, AR, SREBP1, FASN, HMGCS1, HMGCR, SCARB1

SOAT1, FDFT1, SQLE, IDI1, GGPS1, ACAT2, SC5D, 24 DHCR24, MSMQ1,

SRD5A1 and CYP17A1.

106 Figure 24: Model representing the therapeutics advantages of miR-149-5p over second-generation ADT: Abiraterone acetate and enzalutamide provide marginal improvement patient survival in metastatic CRPC by inhibiting AR signaling axis, in contrast miR-149-5p targets AR signaling axis as well as proteins involved in maintaining cholesterol homeostasis. Regulation of cholesterol homeostasis by miR-149-5p controls intratumoral androgen synthesis, thereby effectively controlling androgen dependent CRPC growth.

To summarize, we have revealed a significant functional role of miR-149-5p in

PCa. Metastatic PCa responds initially to ADT, followed by progression to CRPC within 3 years of treatment. CRPC tumors use diverse means for sustained androgen-receptor signaling. Two major mechanisms involve, modifications in AR protein enabling it to be activated by steroid precursors or antiandrogens and elevated levels of DHT. Tumor cells acquire DHT by de novo steroidogenesis

107 starting from cholesterol or by metabolism of abundant adrenal precursors.

Moreover, previous studies have reported that tumors may shift the pathways of steroidogenesis in order to evade the effect of androgen signaling inhibitors. The switching between steroidogenic pathways allows tumors to synthesize DHT from cholesterol. Over expression of the enzymes involved in cholesterol synthesis and uptake continuously drives various steroidogenic pathways. Development of drugs which can target multiple pathways to abolish androgen signaling is challenging. microRNAs have the potential to fine-tune the expression of multiple genes and downregulation of microRNAs is one of the mechanism which allows disease progression. We have uncovered a tumor suppressive function of miR-149-5p in

PCa. Our studies reveal a unique advantage of using miR-149-5p for therapeutics.

We have shown that miR-149-5p suppresses xenograft tumor growth by its ability to suppress AR signaling as well as the key proteins involved in cholesterol metabolism. We have also observed miR-149-5p downregulates the expressions of enzymes involved in de-novo steroidogenesis. By regulation of CYP17A1, it likely inhibits testosterone synthesis. We also identified SRD5A1 as a miR-149-5p target gene. These results indicate that the therapeutic effects of miR-149-5p may even be more significant than abiraterone or enzalutamide which are only capable of regulating single pathway of steroidogenesis.

108 3.7 References

Agell, L., et al.

2008 KLF6 and TP53 mutations are a rare event in prostate cancer: distinguishing

between Taq polymerase artifacts and true mutations. Mod Pathol 21(12):1470-8.

Amemiya-Kudo, M., et al.

2002 Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different

target promoters of lipogenic and cholesterogenic genes. J Lipid Res 43(8):1220-

35.

Azhar, S., S. Leers-Sucheta, and E. Reaven

2003 Cholesterol uptake in adrenal and gonadal tissues: the SR-BI and 'selective'

pathway connection. Front Biosci 8:s998-1029.

Batty, G. D., et al.

2011 Modifiable risk factors for prostate cancer mortality in London: forty years

of follow-up in the Whitehall study. Cancer Causes Control 22(2):311-8.

Bonaccorsi, L., et al.

2008 Androgen receptor regulation of the seladin-1/DHCR24 gene: altered

expression in prostate cancer. Lab Invest 88(10):1049-56.

Bravi, F., et al.

2006 Self-reported history of hypercholesterolaemia and gallstones and the risk

of prostate cancer. Ann Oncol 17(6):1014-7.

Briggs, M. R., et al.

109 1993 Nuclear protein that binds sterol regulatory element of low density

lipoprotein receptor promoter. I. Identification of the protein and delineation of its

target nucleotide sequence. J Biol Chem 268(19):14490-6.

Chang, K. H., et al.

2011 Dihydrotestosterone synthesis bypasses testosterone to drive castration-

resistant prostate cancer. Proc Natl Acad Sci U S A 108(33):13728-33.

Deep, G., and I. R. Schlaepfer

2016 Aberrant Lipid Metabolism Promotes Prostate Cancer: Role in Cell

Survival under Hypoxia and Extracellular Vesicles Biogenesis. Int J Mol Sci 17(7).

Di Vizio, D., K. R. Solomon, and M. R. Freeman

2008 Cholesterol and cholesterol-rich membranes in prostate cancer: an update.

Tumori 94(5):633-9.

Dillard, P. R., M. F. Lin, and S. A. Khan

2008a Androgen-independent prostate cancer cells acquire the complete

steroidogenic potential of synthesizing testosterone from cholesterol. Mol Cell

Endocrinol 295(1-2):115-20.

Dillard, Paulette R., Ming-Fong Lin, and Shafiq A. Khan

2008b Androgen-independent prostate cancer cells acquire the complete

steroidogenic potential of synthesizing testosterone from cholesterol. Molecular

and Cellular Endocrinology 295(1-2):115-120.

Ericsson, J., et al.

110 1996 Sterol regulatory element binding protein binds to a cis element in the

promoter of the farnesyl diphosphate synthase gene. Proc Natl Acad Sci U S A

93(2):945-50.

Ettinger, S. L., et al.

2004 Dysregulation of sterol response element-binding proteins and downstream

effectors in prostate cancer during progression to androgen independence. Cancer

Res 64(6):2212-21.

Fiorenza, A. M., A. Branchi, and D. Sommariva

2000 Serum lipoprotein profile in patients with cancer. A comparison with non-

cancer subjects. Int J Clin Lab Res 30(3):141-5.

Freeman, M. R., B. Cinar, and M. L. Lu

2005 Membrane rafts as potential sites of nongenomic hormonal signaling in

prostate cancer. Trends Endocrinol Metab 16(6):273-9.

Friesen, Jon A., and Victor W. Rodwell

1997 Identification of Elements Critical for Phosphorylation of 3-Hydroxy-3-

methylglutaryl Coenzyme A Reductase by Adenosine Monophosphate-Activated

Protein Kinase: Protein Engineering of the Naturally Nonphosphorylatable 3-

Hydroxy-3-methylglutaryl Coenzyme A Reductase fromPseudomonas mevalonii†.

Biochemistry 36(5):1157-1162.

Fukuma, Y., et al.

2012 Role of squalene synthase in prostate cancer risk and the biological

aggressiveness of human prostate cancer. Prostate Cancer Prostatic Dis 15(4):339-

45.

111 Grundy, S. M.

1983 Absorption and metabolism of dietary cholesterol. Annu Rev Nutr 3:71-96.

Guan, G., et al.

1997 Multiple sequence elements are involved in the transcriptional regulation of

the human squalene synthase gene. J Biol Chem 272(15):10295-302.

Gutierrez-Pajares, J. L., et al.

2016 SR-BI: Linking Cholesterol and Lipoprotein Metabolism with Breast and

Prostate Cancer. Front Pharmacol 7:338.

Harder, C. J., et al.

2007 SR-BI undergoes cholesterol-stimulated transcytosis to the bile canaliculus

in polarized WIF-B cells. J Biol Chem 282(2):1445-55.

Holdgate, G. A., W. H. J. Ward, and F. McTaggart

2003 Molecular mechanism for inhibition of 3-hydroxy-3-methylglutaryl CoA

(HMG-CoA) reductase by rosuvastatin. Biochemical Society Transactions

31(3):528-531.

Hsu, S. H., et al.

2012 Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of

miR-122 in liver. J Clin Invest 122(8):2871-83.

Huang, W. C., et al.

2012 Activation of androgen receptor, lipogenesis, and oxidative stress

converged by SREBP-1 is responsible for regulating growth and progression of

prostate cancer cells. Mol Cancer Res 10(1):133-42.

Hutchinson, J., and L. Marignol

112 2017 Clinical Potential of Statins in Prostate Cancer Radiation Therapy.

Anticancer Res 37(10):5363-5372.

Ikonen, E.

2008 Cellular cholesterol trafficking and compartmentalization. Nat Rev Mol

Cell Biol 9(2):125-38.

Ippolito, L., et al.

2016 Metabolic shift toward oxidative phosphorylation in docetaxel resistant

prostate cancer cells. Oncotarget 7(38):61890-61904.

Kalhorn, T. F., et al.

2007 Analysis of testosterone and dihydrotestosterone from biological fluids as

the oxime derivatives using high-performance liquid chromatography/tandem mass

spectrometry. Rapid Commun Mass Spectrom 21(19):3200-6.

Karlic, H., et al.

2017 Statin and Bisphosphonate Induce Starvation in Fast-Growing Cancer Cell

Lines. Int J Mol Sci 18(9).

Kim, J. B., et al.

1995 Dual DNA binding specificity of ADD1/SREBP1 controlled by a single

amino acid in the basic helix-loop-helix domain. Mol Cell Biol 15(5):2582-8.

Kok, D. E., et al.

2011 Blood lipid levels and prostate cancer risk; a cohort study. Prostate Cancer

Prostatic Dis 14(4):340-5.

Kolonel, L. N., A. M. Nomura, and R. V. Cooney

113 1999 Dietary fat and prostate cancer: current status. J Natl Cancer Inst 91(5):414-

28.

Lee, B. H., et al.

2013 Dysregulation of cholesterol homeostasis in human prostate cancer through

loss of ABCA1. Cancer Res 73(3):1211-8.

Leon, C. G., et al.

2010 Alterations in cholesterol regulation contribute to the production of

intratumoral androgens during progression to castration-resistant prostate cancer in

a mouse xenograft model. Prostate 70(4):390-400.

Li, J., et al.

2016 Up-regulated expression of scavenger receptor class B type 1 (SR-B1) is

associated with malignant behaviors and poor prognosis of breast cancer. Pathol

Res Pract 212(6):555-9.

Li, X., et al.

2014 Fatostatin displays high antitumor activity in prostate cancer by blocking

SREBP-regulated metabolic pathways and androgen receptor signaling. Mol

Cancer Ther 13(4):855-66.

Li, X., et al.

2015a Anti-cancer efficacy of SREBP inhibitor, alone or in combination with

docetaxel, in prostate cancer harboring p53 mutations. Oncotarget 6(38):41018-32.

Li, Z., et al.

2015b Conversion of abiraterone to D4A drives anti-tumour activity in prostate

cancer. Nature 523(7560):347-51.

114 Liebisch, G., et al.

2006 High throughput quantification of cholesterol and cholesteryl ester by

electrospray ionization tandem mass spectrometry (ESI-MS/MS). Biochim

Biophys Acta 1761(1):121-8.

Llaverias, G., et al.

2010 A Western-type diet accelerates tumor progression in an autochthonous

mouse model of prostate cancer. Am J Pathol 177(6):3180-91.

Locke, J. A., et al.

2008 Androgen Levels Increase by Intratumoral De novo Steroidogenesis during

Progression of Castration-Resistant Prostate Cancer. Cancer Research

68(15):6407-6415.

Magana, M. M., and T. F. Osborne

1996 Two tandem binding sites for sterol regulatory element binding proteins are

required for sterol regulation of fatty-acid synthase promoter. J Biol Chem

271(51):32689-94.

Majid, S., et al.

2013 miRNA-34b inhibits prostate cancer through demethylation, active

chromatin modifications, and AKT pathways. Clin Cancer Res 19(1):73-84.

Mondul, A. M., et al.

2010 Association between plasma total cholesterol concentration and incident

prostate cancer in the CLUE II cohort. Cancer Causes Control 21(1):61-8.

Montgomery, R. B., et al.

115 2008a Maintenance of intratumoral androgens in metastatic prostate cancer: a

mechanism for castration-resistant tumor growth. Cancer Res 68(11):4447-54.

—

2008b Maintenance of Intratumoral Androgens in Metastatic Prostate Cancer: A

Mechanism for Castration-Resistant Tumor Growth. Cancer Research

68(11):4447-4454.

Mostaghel, E. A., et al.

2012 Impact of circulating cholesterol levels on growth and intratumoral

androgen concentration of prostate tumors. PLoS One 7(1):e30062.

Muntoni, S., et al.

2009 Serum lipoproteins and cancer. Nutr Metab Cardiovasc Dis 19(3):218-25.

Murtola, T. J., et al.

2007 Cholesterol-Lowering Drugs and Prostate Cancer Risk: A Population-based

Case-Control Study. Cancer Epidemiology Biomarkers & Prevention 16(11):2226-

2232.

Murtola, T. J., et al.

2008 Statins and prostate cancer prevention: where we are now, and future

directions. Nat Clin Pract Urol 5(7):376-87.

Platz, E. A., et al.

2009 Men with low serum cholesterol have a lower risk of high-grade prostate

cancer in the placebo arm of the prostate cancer prevention trial. Cancer Epidemiol

Biomarkers Prev 18(11):2807-13.

Porter, F. D., and G. E. Herman

116 2011 Malformation syndromes caused by disorders of cholesterol synthesis. J

Lipid Res 52(1):6-34.

Rayner, Katey J., et al.

2010 MiR-33 Contributes to the Regulation of Cholesterol Homeostasis. Science

(New York, N.Y.) 328(5985):1570-1573.

Rogers, Maximillian A., et al.

2015 Acyl-CoA:cholesterol acyltransferases (ACATs/SOATs): enzymes with

multiple sterols as substrates and as activators. The Journal of steroid biochemistry

and molecular biology 151:102-107.

Rose, G., et al.

1974 Colon cancer and blood-cholesterol. Lancet 1(7850):181-3.

Ru, P., and D. Guo

2017 microRNA-29 mediates a novel negative feedback loop to regulate

SCAP/SREBP-1 and lipid metabolism. RNA Dis 4(1).

Sbiera, S., et al.

2015 Mitotane Inhibits Sterol-O-Acyl Transferase 1 Triggering Lipid-Mediated

Endoplasmic Reticulum Stress and Apoptosis in Adrenocortical Carcinoma Cells.

Endocrinology 156(11):3895-908.

Schlomm, T., et al.

2008 Clinical significance of p53 alterations in surgically treated prostate

cancers. Mod Pathol 21(11):1371-8.

Schorghofer, D., et al.

117 2015 The HDL receptor SR-BI is associated with human prostate cancer

progression and plays a possible role in establishing androgen independence.

Reprod Biol Endocrinol 13:88.

Shimano, H.

2001 Sterol regulatory element-binding proteins (SREBPs): transcriptional

regulators of lipid synthetic genes. Prog Lipid Res 40(6):439-52.

Shimano, H., et al.

1996 Overproduction of cholesterol and fatty acids causes massive liver

enlargement in transgenic mice expressing truncated SREBP-1a. J Clin Invest

98(7):1575-84.

Silber, J. R., et al.

1992 The effect of mevalonic acid deprivation on enzymes of DNA replication in

cells emerging from quiescence. Biochem J 288 ( Pt 3):883-9.

Silver, D. L., et al.

2000 Receptors and lipid transfer proteins in HDL metabolism. Ann N Y Acad

Sci 902:103-11; discussion 111-2.

Simons, K., and E. Ikonen

2000 How cells handle cholesterol. Science 290(5497):1721-6.

Simons, K., and D. Toomre

2000 Lipid rafts and signal transduction. Nat Rev Mol Cell Biol 1(1):31-9.

Simons, K., and W. L. Vaz

2004 Model systems, lipid rafts, and cell membranes. Annu Rev Biophys Biomol

Struct 33:269-95.

118 Smith, J. R., et al.

1988 Multiple sterol regulatory elements in promoter for hamster 3-hydroxy-3-

methylglutaryl-coenzyme A synthase. J Biol Chem 263(34):18480-7.

Solomon, K. R., et al.

2009 Ezetimibe is an inhibitor of tumor angiogenesis. Am J Pathol 174(3):1017-

26.

Stopsack, K. H., et al.

2017 Cholesterol uptake and regulation in high-grade and lethal prostate cancers.

Carcinogenesis 38(8):806-811.

Stopsack, K. H., et al.

2016 Cholesterol Metabolism and Prostate Cancer Lethality. Cancer Res

76(16):4785-90.

Strom, S. S., et al.

2008 Saturated fat intake predicts biochemical failure after prostatectomy. Int J

Cancer 122(11):2581-5.

Sun, A., et al.

2016 GSK-3beta controls autophagy by modulating LKB1-AMPK pathway in

prostate cancer cells. Prostate 76(2):172-83.

Sun, Shihua, et al.

2010 Castration resistance in human prostate cancer is conferred by a frequently

occurring androgen receptor splice variant. Journal of Clinical Investigation

120(8):2715-2730.

Swinnen, J. V., et al.

119 2002 Androgen regulation of lipogenesis. Adv Exp Med Biol 506(Pt A):379-87.

Swinnen, J. V., et al.

2004 Androgens, lipogenesis and prostate cancer. J Steroid Biochem Mol Biol

92(4):273-9.

Taylor, B. S., et al.

2010 Integrative genomic profiling of human prostate cancer. Cancer Cell

18(1):11-22.

Treguier, M., et al.

2004 Transcription factor sterol regulatory element binding protein 2 regulates

scavenger receptor Cla-1 gene expression. Arterioscler Thromb Vasc Biol

24(12):2358-64.

Trigatti, B., A. Rigotti, and M. Krieger

2000 The role of the high-density lipoprotein receptor SR-BI in cholesterol

metabolism. Curr Opin Lipidol 11(2):123-31.

Vallett, S. M., et al.

1996 A direct role for sterol regulatory element binding protein in activation of

3-hydroxy-3-methylglutaryl coenzyme A reductase gene. J Biol Chem

271(21):12247-53.

Waltering, Kati K., Alfonso Urbanucci, and Tapio Visakorpi

2012 Androgen receptor (AR) aberrations in castration-resistant prostate cancer.

Molecular and Cellular Endocrinology 360(1-2):38-43.

Wiersma, H., et al.

120 2009 Scavenger receptor class B type I mediates biliary cholesterol secretion

independent of ATP-binding cassette transporter g5/g8 in mice. Hepatology

50(4):1263-72.

Yang, X., et al.

2006 Complex regulation of human androgen receptor expression by Wnt

signaling in prostate cancer cells. Oncogene 25(24):3436-44.

Yokomizo, A., et al.

2011 Statins reduce the androgen sensitivity and cell proliferation by decreasing

the androgen receptor protein in prostate cancer cells. Prostate 71(3):298-304.

Youlin, K., et al.

2017 Liver X receptor activation inhibits PC-3 prostate cancer cells via the beta-

catenin pathway. Pathol Res Pract 213(3):267-270.

Yuan, B., et al.

2016 High scavenger receptor class B type I expression is related to tumor

aggressiveness and poor prognosis in breast cancer. Tumour Biol 37(3):3581-8.

Zhuang, L., et al.

2002 Cholesterol-rich lipid rafts mediate akt-regulated survival in prostate cancer

cells. Cancer Res 62(8):2227-31.

121

APPENDIX

122 A. List of Primers

PCR Product Primer sequence product size AR 101bp Forward GGCCAGGAAAGCGACTTGA

Reverse CCCATTTCGCTTTTGACACA

AR 210bp Forward primer for cloning in pMIR REPORT vector 3’UTR AAAACTTGGCGACTTCCACAGAAAAG

Reverse primer for cloning in pMIR REPORT vector GTTTTCTGCCAAACTCCGTGAAGCCACAAGCACCTTATG

Mutagenesis TGTGAGTCAGGGAGGAGCTCGTCGGTCTGGAGAAGAAAA

18S 100bp Forward CTTTCGCTCTGGTCCGTCTT

Reverse CTTTCGCTCTGGTCCGTCTT

SREBP1 188bp Forward GCAAGGCCATCGACTACATT

Reverse GGTCAGTGTGTCCTCCACCT

SREBP1 214bp Forward primer for cloning in pMIR REPORT vector 3’UTR CAGTTGCACTAGTTGTGTGCCTTCGCGGTGGAAG

Reverse primer for cloning in pMIR REPORT vector GCATTCAAGCTTTTGGCTTCCGTCAGCACAGGG

Mutagenesis Primer GATCGGGGCACTGCAGGGGCCGAGCCATTTTGGGGGGCCC

FASN 131bp Forward CTTCCGAGATTCCATCCTACGC

Reverse TGGCAGTCAGGCTCACAAACG

HMGCS1 160bp Forward CATTAGACCGCTGCTATTCTGTC

Reverse TTCAGCAACATCCGAGCTAGA

123 HMGCS1 219bp 3’ UTR Forward primer for cloning in pMIR REPORT vector AGTGCTACTAGTACATTTCTAGCTTGGGG

Reverse primer for cloning in pMIR REPORT vector TCGCATAAGCTTCATGTTTTTCTATACC

Mutagenesis Primer CAGAGCCAGTGTTTTATTGTAGACCGAGTTTTCTTCCTCTTT AGG

HMGCR 101bp Forward CGTGGAATGGCAATTTTAGGTCC

Reverse ATTTCAAGCTGACGTACCCCT

HMGCR 207bp 3’UTR Forward primer for cloning in pMIR REPORT vector AGTGCTACTAGTGTGCTTTACATGCTGTGC

Reverse primer for cloning in pMIR REPORT vector TCGCATAAGCTTCAGTATAATTTAAAAATCC

Mutagenesis Primer CACCTCTGAAGGCAAATATAACGGTCTAAAAAAGTTTTGAT GAA

SCARB1 175bp Forward ACTTCTGGCATTCCGATCAGT

Reverse ACGAAGCGATAGGTGGGGAT

SCARB1 265bp Forward primer for cloning in pMIR REPORT vector 3’UTR AGT GCTACTAGTGGTCCTGAGGACACCGT

Reverse primer for cloning in pMIR REPORT vector TCGCATAAGCTTCGAGCCTCTCCCTACAAG

Mutagenesis Primer CAGCGGCCAGGCCTGGGACCGAGACGGTGTCCTCAGGACC PSA 100bp Forward GGCCAGGAAAGCGACTTGA

Reverse CCCATTTCGCTTTTGACACA

124