Filamin a Regulates EGFR/ERK/Akt Signaling and Affects Colorectal Cancer Cell Growth and Migration

Molecular Medicine REPORTS 20: 3671-3678, 2019

Filamin A regulates EGFR/ERK/Akt signaling and affects colorectal cancer cell growth and migration

KUN WANG1*, TIE‑NIAN ZHU2,3* and RUI‑JING ZHAO2

1Department of Transfusion, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011; 2Department of Immunology, Hebei Medical University, Key Laboratory of Immune Mechanism and Intervention on Serious Disease in Hebei Province, Shijiazhuang, Hebei 050017; 3The 980th Hospital of the PLA Joint Logistics Support Force, Bethune International Peace Hospital, Shijiazhuang, Hebei 050011, P.R. China

Received January 6, 2019; Accepted July 18, 2019

DOI: 10.3892/mmr.2019.10622

Abstract. The metastasis and recurrence rate, and the overall signaling pathway could provide attractive therapeutic targets prognosis of colorectal cancer (CRC) remain unsatisfactory. for CRC. Filamin A (FLNa), as an actin‑binding protein, can interact with various signaling molecules and membrane receptors to Introduction affect cell signal transduction and function. However, whether FLNa is involved in the progression of CRC remains to be Colorectal cancer (CRC) is the third‑leading cause of cancer elucidated. The aim of the present study was to explore the role mortality in most countries, and there were an estimated of FLNa in CRC cell proliferation and migration, as well as 134,490 new cases and 49,190 deaths in the United States in in the regulation of epidermal growth factor receptor (EGFR) 2015 (1,2). Although the mortality rate from CRC has declined signaling. Following transfection with a FLNa‑targeting short by 3% over the past decade, 30‑40% of CRC patients still hairpin RNA plasmid to knockdown expression of FLNa in develop metastases and 50% die of CRC recurrence (3). CRC, the EGF‑treated SW480 cell line, it was found that decreased which is associated with poor prognosis, is usually diagnosed at expression of FLNa promoted cell proliferation and migra- a late stage (4‑7). Critical cancer hallmarks include the ability tion. Additionally, there was a negative correlation between of tumor cells to invade and migrate to distant tissues and to FLNa levels and the activation of EGFR and Akt signaling exhibit enhanced cell proliferation (8); therefore, elucidation pathways. Similarly, the expression of FLNa was significantly of these cancer‑promoting mechanisms may lead to drug lower in human CRC tissues compared with adjacent normal discoveries for novel therapies and subsequent improvement tissues and FLNa expression was negatively correlated with of survival rates of CRC patients. the expression of Ki‑67 in human CRC tissues. Although there Filamins (FLNs), a family of actin‑binding proteins, was no significant difference in the Kaplan‑Meier estimate of comprise FLNa, FLNb and FLNc. FLNa, also known as CRC between high expression and low expression of FLNa, filamin‑A, was identified in macrophages in 1975 and was there were significant negative associations between FLNa originally characterized as a protein that could cross‑link expression and TNM stage. The results suggested that FLNa actin filaments and form rigid gels (9‑11). Its contribution may participate in EGF‑induced cell proliferation and migra- to the formation of the actin cytoskeleton serves a vital role tion in CRC cells. Hence, interventions in the FLNa‑mediated in responses to extracellular stimulation. The function of FLNa has been revealed in studies that have collectively identified over 90 filamin‑binding proteins that are involved in cell migration, cell adhesion, phosphorylation, cell signaling, receptor activation and other important cellular Correspondence to: Dr Tie‑Nian Zhu or Mrs. Rui‑Jing Zhao, functions (12). Department of Immunology, Hebei Medical University, Key The cross‑linking structure of FLNa accompanies extra- Laboratory of Immune Mechanism and Intervention on Serious cellular signals to the cellular cytoskeleton. FLNa forms Disease in Hebei Province, 398 Zhongshan Road, Shijiazhuang, a homodimer and interacts with cortical actin to form a Hebei 050017, P.R. China dynamic three‑dimensional structure (13). By interacting with E‑mail: [email protected] E‑mail: [email protected] transmembrane receptor complexes, adaptor molecules and second messengers, FLNa regulates signaling events involved in *Contributed equally cell motility. The molecular function of FLNa in cell chemotaxis remains debatable and seems to vary according to the levels of Key words: colorectal cancer cell, proliferation, metastasis, FLNa and its interacting partners (14). Abnormal expression filamin A, epidermal growth factor receptor signaling pathway of FLNa is associated with a wide spectrum of human disorders (15‑17) that are caused by abnormal interactions between FLNa and its corresponding partners (18,19). Zhu et al (20) 3672 WANG et al: FLNa EXPRESSION AND COLORECTAL CANCER considered that FLNa regulated the activation of epidermal Subsequently, the two groups were untreated or treated with growth factor receptor (EGFR) in human melanoma cells. 20 nM EGF for 24 h. An inverted microscope (magnification Epidermal growth factor receptor (EGFR) is a tyrosine x10) was used to assess the width of the scratch; images of the kinase receptor, also known as ErbB1. EGFR is the prototype same field were captured every 8 h (31). of the ErbB family and is expressed in nearly all epithelial tissues (21,22). EGFR is a major regulator of cell prolifera- Transwell assay. After 4 h of starvation with SFM, SW480/KD tion, metabolism, survival and motility (23); its inappropriate and SW480/Ctrl cells were seeded in the top chamber (0.4 µm activation has an important role in several types of cancer (24). polycarbonate‑membrane inserts) with a concentration of Ligands that activate EGFR lead to receptor tyrosine kinase 106 cells per 200 µl in SFM. The bottom chamber was filled autophosphorylation and activate several important signaling with 600 µl of RPMI 1640/10% FBS medium. Cells were molecules, such as those within RAS/RAF/mitogen‑activated allowed to migrate for 24 h (untreated or treated with 20 nM protein kinase kinase (MEK)/ERK and PI3K/Akt path- EGF). Non‑migratory cells on the upper surface were then ways (25‑28); EGFR subsequently transmits signals through removed using a wet cotton swab. The migrated cells on these pathways (29). the surface of the lower membrane were stained by H&E The present study measured the proliferative and migratory and counted under a light microscope (magnification x200; abilities of the SW480 cell line after experimentally silencing Olympus Corporation) in 5 random fields to obtain the average FLNa expression. Then, the effects of FLNa silencing on the number (32). activation of EGFR and related signaling molecules were explored. Finally, the relationship between FLNa expression Western blotting. SW480 cells were treated with or without and the clinical pathology of CRC patients was determined EGF (20 nM) for 5, 10 and 30 min and then lysed with cold using immunohistochemical analysis. lysis buffer (Amyjet Scientific, Inc,). The protein concentration was quantified using a bicinchoninic acid assay kit. Materials and methods Proteins (20 µg/lane) were separated via 10% SDS‑PAGE and were transferred onto polyvinylidene difluoride membranes. Cell culture. The CRC cell line, SW480, was cultured Subsequently, PVDF membranes were blocked with 3% in RPMI 1640 medium containing 10% fetal bovine bovine serum albumin (Thermo Fisher Scientific, Inc.) at room serum (FBS) in a 5% CO2 incubator at 37˚C. SW480 temperature for 2 h and then were incubated with primary cells were obtained from Columbia University as a gift; antibodies in 4˚C for 12 h, followed by incubation with RPMI 1640 medium was purchased from Gibco (Thermo secondary antibodies at 25˚C for 1.5 h and visualization with Fisher Scientific, Inc.); FBS was purchased from Hyclone enhanced chemiluminescence reagent (Beyotime Institute of (GE Healthcare Life Sciences). Biotechnology). ImageJ software (v1.52; National Institutes of Health) was used to quantity proteins. Primary antibodies Transfection of short hairpin (sh)RNA plasmids. CRC included the following: Rabbit anti‑FLNa antibody (1:1,000; SW480 cells were seeded at a density of 4x105/ml, cultured cat. no. MAB1680; EMD Millipore), rabbit anti‑EGFR anti- for 24 h, transfected with pSIF1‑FLNa shRNA (SW480/KD body (1:1,000; cat. no. 18986‑1‑AP; ProteinTech Group, Inc.), group; 5'‑GTGACACTTGCCTCCCCACCCCCCA[G/A]G CC rabbit anti‑phosphorylated (p‑)EGFR antibody (Tyr1068; TGATGGTGAAACCGGAGTTTCC‑3') or control shRNA 1:2,000; cat. no. 3777; Cell Signaling Technology, Inc.), (SW480/Ctrl group; 5'‑GTGACTATGGAGTGAGCATTG rabbit anti‑Akt antibody (1:1,000; cat. no. 10176‑2‑AP; GGGT[G/A]CTTTACGGGTCAATGGCGACTTTCC‑3; both ProteinTech Group, Inc.), rabbit anti‑p‑Akt antibody (Ser473; Thermo Fisher Scientific, Inc.) containing pSIF1 plasmids 1:1,000; cat. no. 66444‑1‑Ig; ProteinTech Group, Inc.), (2 µg; from our laboratory) was used for transfection using rabbit anti‑ERK1/2 antibody (1:4,000; cat. no. 16443‑1‑AP; Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher ProteinTech Group, Inc.), rabbit anti‑p‑ERK1/2 antibody Scientific, Inc.), and selected with puromycin (2 µg/ml) for (Thr202/Tyr204; 1:3,000; cat. no. 4370, Cell Signaling 4 weeks. Protein expression was examined by western blot Technology.) and mouse anti‑β‑actin antibody (1:5,000; analysis as detailed below. cat. no. 60008‑1‑Ig; ProteinTech Group, Inc.). Horseradish peroxidase (HRP)‑conjugated anti‑mouse IgG (1:5,000; MTS assay. SW480/KD and SW480/Ctrl cells were placed cat. no. 7076) and anti‑rabbit IgG (1:5,000; cat. no. 7074; both in separate 96‑well plates (5x103/well). After starvation with Cell Signaling Technology) secondary antibodies were used. serum‑free 1640 medium (SFM) for 2 h, the cells were treated with various concentrations (0, 4, 20 and 100 nM) of EGF Xenograft experiments in vivo. A total of 20 BALB/c male nude (Miltenyi Biotec GmbH); after 48 h incubation, cell viability mice (age, 6‑8 weeks; weight, 15.3‑18.2 g) were purchased from was determined using MTS tetrazolium substrate (Cell Titer the Experimental Animal Center of Hebei Medical University. 96 Aqueous One Solution Cell Proliferation Assay; Promega Mice were housed at 20‑26˚C and 40‑60% humidity under Corporation). Subsequently, a spectrophotometer (Thermo a 12:12 h light/dark cycle, with access to food and water Fisher Scientific, Inc.) was used to determine the optical ad libitum. The present study was approved by the Laboratory density at 490 nm as previously described (30). Animal Ethical Committee of the Fourth Hospital of Hebei Medical University. Xenograft experiments were performed as Wound healing assay. SW480/KD and SW480/Ctrl cells were previously described (33). Cells (2x106) suspended in Hank's starved for 4 h with SFM and were then scratched with 10 µl balanced salt solution (HyClone; GE Healthcare Life Sciences) pipette tips and washed with PBS to remove the floating cells. were injected in the right thigh. After 2 weeks, this experiment Molecular Medicine REPORTS 20: 3671-3678, 2019 3673

Figure 1. FLNa knockdown promotes proliferation and migration of SW480 cells. (A) Western blot analysis confirmed the shRNA‑mediated silencing of FLNa expression in SW480 cells transfected with shFLNa for 4 weeks compared with cells transfected with control. **P<0.01 vs. SW480/Ctrl, n=3. (B) SW480 cells were transfected with shFLNa or control shRNA for 24 h, then treated with EGF (0, 4, 20 and 100 nM) for 24 h. Cell viability was determined using the MTS assay at 0, 5, 10 and 30 min. Data are presented as the mean ± standard deviation. **P<0.01 and vs. control, n=3. (C) Representative photomicrographs of a scratch assay performed with EGF‑treated SW480 cells transfected with shFLNa or control after scratching at 0, 8, 16 and 24 h. Magnification x10. (D) Quantification of SW480 cells migrating into the scratch gap. The data are illustrated as the mean ± standard error of mean from three independent experiments. **P<0.01 vs. SW480/Ctrl EGF‑treatment or ##P<0.01 vs. SW480/KD EGF‑treatment. (E) Boyden‑chamber assay demonstrating that EGF‑treated SW480 cells transfected with shFLNa or control for 24 h traversed the filter to the other side and were stained by hematoxylin and eosin. Magnification x200. (F) Quantification of cells migrated to the lower side of the membrane. *P<0.05 or **P<0.01 vs. SW480/Ctrl EGF‑; #P<0.05 vs. SW480/KD EGF‑. FLNa, Filamin A; sh, short hairpin; EGF, epidermal growth factor; KD, knockdown; Ctrl, control. was ended. The isolated solid tumors were measured for size, rabbit anti‑Ki‑67 antibody (1:100; cat. no. 27309‑1‑AP; weight and volume. ProteinTech Group, Inc.) or anti‑FLNa antibody (1:100; cat. no. 67133‑1‑Ig; ProteinTech Group, Inc.). After washing Patients and specimens. A total of 82 patients with CRC with PBS, the sections were incubated with a secondary anti- (51.1±15.9 years old; range, 42‑74 years), who were admitted body at 37˚C for 30 min [HRP‑conjugated goat anti‑mouse to the general surgery department at the 980th Hospital of IgG (1:1,000; cat. no. SA00001‑1) and goat anti‑rabbit IgG the PLA Joint Logistics Support Force between November (1:1,000; cat. no. SA00001‑2), both ProteinTech Group, Inc.]. 2015 and May 2016, were included in the present study. All Sections were counterstained with hematoxylin and eosin at subjects provided written informed consent. Colorectal cancer room temperature for 4 min to visualize nuclei. Five different tissues were obtained from the 980th Hospital of the PLA fields were randomly selected per sample. Images were Joint Logistics Support Force (Bethune International Peace acquired using a Leica microscope (magnification x100; Hospital) with the approval of the Hospital Ethics Committee Leica DM6000B; Leica Microsystems GmbH) and were and were used according to ethical procedures. digitized with LAS version 4.4 (Leica Microsystems GmbH). The thresholds for dichotomizing FLNa IHC were set to the Immunohistochemical (IHC) staining. Immunohistochemical medians for each measurement. staining was conducted to determine the protein expression of FLNa and Ki‑67 by using of a diaminobenzidine kit Statistical analysis. All data are reported as mean ± standard (OriGene Technologies, Inc.) according to the manufacturer's deviation. All statistics and graphs were obtained using instructions. Tissues were fixed with 4% paraformaldehyde GraphPad Prism 5 (GraphPad Software, Inc.); SPSS 19.0 at room temperature for 48 h, embedded in paraffin and software (IBM Corp.) was used for Kaplan‑Meier plots and sectioned (5 µm). Briefly, after microwave‑antigen retrieval, ANOVA. Cell viability, cell number, band density and gene endogenous peroxidase activity was inhibited by incuba- expression were analyzed by ANOVA followed by Bonferroni tion with 3% H2O2. Sections were blocked with 5% goat post hoc test when making comparisons in datasets containing serum (Absin Bioscience, Inc.) at room temperature for multiple groups. Spearman's test was used for the correlation 40 min, then incubated overnight at 4˚C with a polyclonal analysis of FLNa and Ki67. The maximal log‑rank method 3674 WANG et al: FLNa EXPRESSION AND COLORECTAL CANCER

Figure 2. FLNa knockdown promotes EGF‑induced EGFR/Akt/ERK phosphorylation in SW480 cells. SW480 cells were transfected with shFLNa or control shRNA for 24 h. Then cells were treated with or without EGF (20 nM) for 0, 5, 10 and 30 min. (A) Total proteins were extracted and subjected to western blotting with antibodies against FLNa, EGFR, p‑EGFR, p‑Akt, Akt, p‑ERK and ERK; β‑actin is shown here as a loading control. (B) Band intensities for the ratio of FLN/β‑actin were measured. (C) Band intensities for the ratio of p‑EGFR/EGFR, (D) p‑Akt/Akt and (E) p‑ERK/ERK were measured and normalized to β‑actin. **P<0.01 vs. SW480/Ctrl. FLNa, Filamin A; EGF, epidermal growth factor; sh, short hairpin; EGFR, epidermal growth factor receptor; p‑, phosphorylated.

Figure 3. FLNa knockdown promotes tumor growth in vivo. (A) Representative image of xenograft tumors isolated from nude mice. Scale bar, 5 mm. (B) Tumor‑growth curves. (C) Tumor weights at 21 days. (D) Western blot analysis of FLNa protein expression levels in xenograft tumors derived from SW480/KD and SW480/Ctrl cells. Data are presented as mean ± standard deviation. *P<0.05 or **P<0.01 vs. SW480/Ctrl (n=6 for each group). Molecular Medicine REPORTS 20: 3671-3678, 2019 3675

Table I. Relationship between FLNa and clinical‑pathological features.

FLNa expression (%) ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ Characteristic N (%) Low (n=40) High (n=42) P‑value

Age 0.3928 ≤60 38 (46.3) 20 (50.0) 18 (42.8) >60 44 (53.7) 20 (50.0) 24 (57.1) Sex 0.9913 Female 43 (52.4) 21 (52.5) 22 (52.4) Male 39 (47.6) 19 (47.5) 20 (47.6) Diameter of tumor, cm 0.6414 ≤4 42 (51.2) 20 (50.0) 22 (52.4) >4 40 (48.8) 20 (50.0) 20 (47.6) Degree of differentiation 0.9827 Low 37 (45.1) 18 (45.0) 19 (45.2) Moderate or high 45 (54.9) 22 (55.0) 23 (54.8) TNM stage 0.0008 I‑II 36 (43.9) 10 (25.0) 26 (61.9) III‑IV 46 (56.1) 30 (75.0) 16 (38.1) Lymph node metastasis 0.0007 Yes 48 (58.5) 31 (77.5) 17 (40.5) No 34 (41.5) 9 (22.5) 25 (59.5)

FLNa, Filamin A; TNM, Tumor, Node, Metastasis.

was used for optimal cut‑point determination and adjusted required for cell proliferation and migration (34), the effect P‑values. Cut‑points within the central 80% of ordered FLNa of shRNA‑mediated FLNa knockdown on EGF‑stimulated protein expression were considered. P<0.05 was considered to SW480 cells was evaluated via western blotting. The protein indicate a statistically significant difference. expression levels of EGFR, Akt and ERK, and their activated phosphorylated forms, were detected in SW480/KD and Results SW480/Ctrl cells treated with EGF for 0, 5, 10 and 30 min. FLNa expression in the SW480/KD group was significantly FLNa knockdown accelerates EGF‑induced cell proliferation decreased at every tested time point compared with the and migration in SW480 cells. To elucidate the role of FLNa SW480/Ctrl group (Fig. 2A and B). Furthermore, FLNa knock- in colon carcinoma cells, EGF‑treated SW480 cells were down significantly increased the p‑EGFR/EGFR (Fig. 2C), transfected with shFLNa to knockdown FLNa expression. p‑Akt/Akt (Fig. 2D) and p‑ERK/ERK (Fig. 2E) protein ratios The efficacy of the knockdown was confirmed via western compared with the control (P<0.01), indicating that FLNa blotting. FLNa expression was significantly downregulated knockdown activated the EGFR, Akt and ERK signaling in the SW480/KD group (0.48±0.01) compared with that of pathways. These data suggested that FLNa regulated cell the SW480/Ctrl group (1.13±0.03; P<0.01; Fig. 1A). A cell proliferation and migration via EGFR, Akt and ERK signaling viability assay demonstrated that FLNa knockdown promoted in colon carcinoma cells. EGF‑induced cell proliferation in a dose‑dependent manner in the SW480/KD group (P<0.01; Fig. 1B). Cell scratch migration FLNa silencing promotes SW480 cell growth in vivo. To assays demonstrated that FLNa knockdown significantly accel- further confirm the oncogenic efficiency of FLNa knock- erated cell migration rates, and this effect was independent of down, SW480/KD or SW480/Ctrl were subcutaneously EGF treatment (Fig. 1C and D). A Transwell assay also indicated inoculated into the left flank (SW480/KD) and right flank that the number of migrated cells in the SW480/KD group was (SW480/Ctrl in nude mice, respectively; n=8). After 14 days, greater compared with the SW480/Ctrl group (76±3 vs. 21±5; the tumors were larger in the SW480/KD group compared P<0.05) and the migration ability was even further increased in with the SW480/Ctrl group (0.613±0.114 vs. 0.378±0.068 cm3, the SW480/KD group compared with those in the EGF‑treatment P<0.05; Fig. 3A and B). In addition, the tumor weight at group (Fig. 1E and F). the end of the experiment was increased in the SW480/KD group (0.512±0.031 g) compared with the SW480/Ctrl group Effects of FLNa on EGFR phosphorylation in CRC cells. (0.371±0.044 g; P<0.05; Fig. 3C). Western blotting confirmed Because the activation of EGFR, Akt and ERK signaling is that the FLNa levels were significantly decreased in the 3676 WANG et al: FLNa EXPRESSION AND COLORECTAL CANCER

Table II. Relationship between the expression of FLNa and Ki‑67.

Ki‑67 expression (%) ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ FLNa expression Negative (n=38) Positive (n=44) rs P‑value

Negative (n=40) 12 (31.6) 28 (63.6) ‑0.32 0.004 Positive (n=42) 26 (68.4) 16 (36.4)

FLNa, Filamin A.

Figure 4. Expression of FLNa in CRC tissues and patient survival. (A) Representative photographs of hematoxylin and eosin and (B) immunohistochemical staining for FLNa and Ki‑67 in CRC tissues and adjacent normal tissues (magnification, x100). (C) Bar graph showing significantly higher expression of Ki‑67 and lower expression of FLNa in CRC tissues compared with adjacent normal tissues. Data are presented as mean ± standard deviation. *P<0.05 vs. normal. (D) Patients were divided into two groups, low or high FLNa expression, based on the minimum observed P‑value. The overall survival of CRC patients with low and high FLNa expression was evaluated using Kaplan‑Meier survival analysis (log‑rank P=0.056). FLNa, Filamin A; CRC, colorectal cancer.

SW480/KD tumor tissues compared with those in the Representative photographs of hematoxylin and eosin and control (Fig. 3D). These results further indicated that FLNa immunohistochemical staining for FLNa and Ki‑67 in adja- knockdown accelerated CRC tumor growth. cent normal tissues and CRC tissues (Fig. 4A and B) revealed significantly higher expression of Ki‑67 and lower expression Expression of FLNa in CRC tissues from patients and corre‑ of FLNa in CRC tissues compared with adjacent normal lation with Ki‑67 expression. The characteristics of the 82 tissues (P<0.05; Fig. 4C). FLNa expression had a significant CRC patients (median, 51.1±15.7 years; range, 42‑74 years old) negative correlation with Ki‑67 expression (Table II), which enrolled in the present study are listed in Table I. The expression may explain how FLNa knockdown promoted tumor growth. levels of FLNa exhibited a significant association with TNM By contrast, low expression of FLNa did not influence the stage and lymph node metastasis in CRC, but not with gender, overall survival time for the patients with CRC, as evidenced age, diameter of tumor, or degree of differentiation (Table I). by Kaplan‑Meier survival analysis (Fig. 4D). Molecular Medicine REPORTS 20: 3671-3678, 2019 3677

Discussion Notably, FLNa expression was demonstrated to be negatively correlated with the expression of Ki‑67, which is a reliable As a large cytoplasmic protein, FLNa mainly crosslinks index of cancer progression. The present data suggested that actin filaments, membrane receptors and signaling interme- FLNa may have protective roles as a negative regulator in CRC diates (35). The specific role of FLNa in cancer metastasis SW480 cells by promoting proliferation via the activation of has remained elusive. Through MTS, wound healing and many signaling pathways. Hence, FLNa may represent a novel Transwell assays in the present study, it was identified that prognostic marker and therapeutic target for treating CRC. FLNa knockdown increased the proliferative and migratory abilities of CRC cells in vitro. In addition, FLNa knockdown Acknowledgements was demonstrated to promote tumor growth in vivo. These findings are in accord with an earlier report on breast cancer Not applicable. cells that overexpressed ErbB2, in which knockdown of FLNa promoted division and metastasis of tumor cells (36). Funding CRC cells invade and metastasize to distant sites and these phenomena are accompanied by aberrant activation of This work was supported by the National Natural Science cell signaling (37). A number of studies have reported filamin Foundation of China (grant no. 81071846 to TNZ), the Natural structures and filamin‑binding proteins that are involved Science Foundation of Hebei Province of China (grant in cell signaling and other important cellular functions. For no. H2013505059 to TNZ), the Department of Science and example, FLNa is involved in the organization of the actin Technology of Hebei Province of China (grant no. 12396107D network (10,38), acts as a ‘molecular switch’ to convert to RJZ, and grant nos. 14397707D, 09966114D and 092461102D mechanical stimuli to chemical signals (39). These multiple to TNZ) and the Wu Jieping Medical Foundation (grant interactions suggest that FLNa is a key component of a vari- nos. 320.6750.12604, 320.6750.14063 and 320.6799.15005 to able signaling‑scaffold complex (10). In addition, EGFR is TNZ). an actin‑binding protein and has become an indispensable molecular target for cancer therapy. EGFR is activated by Availability of data and materials certain ligands (such as EGF) and provokes various cellular signaling events resulting in increased cell proliferation, inva- All data generated or analyzed during this study are included sion and metastasis (29). EGFR carries out these functions in this published article. through activating multiple signaling cascades, including RAS/RAF/MEK/ERK and PI3K/Akt pathways (40). The Authors' contributions present study demonstrated that the phosphorylation levels of EGFR, ERK and Akt were significantly increased in the KW performed the experiments and data analysis. KW and TZ FLNa‑knockdown group compared with the control, whereas participated in the design and coordination of experimental no difference was observed in the total EGFR, ERK and work. KW and RZ were involved in data acquisition. KW and Akt expression levels between these two groups. The present TZ drafted the manuscript. results indicated that lower expression of FLNa promoted the proliferative and migratory ability of CRC cells by activating Ethics approval and consent to participate EGFR and its downstream signaling proteins. Under certain circumstances, this aberrantly activated pathway may lead to The present study was approved by the Laboratory Animal abnormal cell growth and invasion, which could subsequently Ethical Committee of the Fourth Hospital of Hebei Medical result in drug resistance or metastasis to distant sites (41). An University (Shijiazhuang, China). Experimental procedures important limitation of the present study was that only one cell were implemented in accordance with the guidelines and regu- line was used; therefore, future studies are required to confirm lations of the Hospital Ethics Committee and were performed the findings of the present study by using additional cell lines. according to ethical procedures of the 980th Hospital of the PLA Accumulating evidence suggests that FLNa participates in Joint Logistics Support Force (Bethune International Peace the development of multiple tumors. Xu et al (42) demonstrated Hospital). that FLNa regulates focal‑adhesion disassembly and inhibits breast cancer cell migration and invasion. A previous study Patient consent for publication showed that there is a positive relationship between FLNa and VEGF in patients with lung cancer (43). However, a separate Not applicable. study emphasized that FLNa interacting with other proteins inhibits CRC progression (44), indicating that FLNa may Competing interests represent a novel cancer‑suppressor gene for treating colorectal adenocarcinoma. Thus, the current literature suggests a dual The authors declare that they have no competing interests. role for FLNa and complex underlying mechanisms in various types of cancer. The present study found that FLNa knockdown References correlated with TNM stage and lymph node metastasis in patients with CRC, which is in accordance with a previous study 1. Ferlay J, Steliarova‑Foucher E, Lortet Tieulent J, Rosso S, Coebergh JW, Comber H, Forman D and Bray F: Cancer incidence on gastric cancer (45). A possible mechanism for the down- and mortality patterns in Europe: Estimates for 40 countries in regulation of the FLNa gene in CRC cells may be mutagenesis. 2012. Eur J Cancer 49: 1374‑1403, 2013. 3678 WANG et al: FLNa EXPRESSION AND COLORECTAL CANCER

2. Siegel RL, Naishadham D and Jemal A: Cancer statistics, 2016. 26. Navolanic PM, Steelman LS and McCubrey JA: EGFR family CA Cancer J Clin 66: 7‑30, 2016. signaling and its association with breast cancer development and 3. Sinclair P, Singh A, Riaz AA and Amin A: An unsolved conun- resistance to chemotherapy. Int J Oncol 22: 237‑252, 2003. drum: The ideal follow up strategy after curative surgery for 27. Park OK, Schaefer TS and Nathans D: In vitro activation of Stat3 colorectal cancer. Gastrointest Endosc 75: 1072‑1079, 2012. by epidermal growth factor receptor kinase. Proc Natl Acad Sci 4. Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, USA 93: 13704‑13708, 1996. Leppert M, Nakamura Y, White R, Smits AM and Bos JL: 28. Bowman T, Garcia R, Turkson J and Jove R: STATs in oncogen- Genetic alterations during colorectal‑tumor development. N Engl esis. Oncogene 19: 2474‑2488, 2013. J Med 319: 525‑532, 1988. 29. Mclendon RE, Turner K, Perkinson K and Rich J: Second 5. Fan N, Kang R, Ge X, Li M, Liu Y, Chen HM and Gao CF: messenger systems in human gliomas. Arch Pathol Lab Med 131: Identification of alpha‑2‑HS‑glycoprotein precursor and tubulin 1585‑1590, 2007. beta chain as serology diagnosis biomarker of colorectal cancer. 30. Wang CZ, Xie JT, Zhang B, Ni M, Fishbein A, Aung HH, Diagn Pathol 12: 53, 2014. Mehendale SR, Du W, He TC and Yuan CS: Chemopreventive 6. Thomson DM, Krupey J, Freedman SO and Gold P: The radio- effects of Panax notoginseng and its major constituents on immunoassay of circulating carcinoma bryonic antigen of the SW480 human colorectal cancer cells. Int J Oncol 31: 1149‑1156, human digestive system. Proc Natl Acad USA 64: 161‑167, 1969. 2007. 7. Duffy MJ: Role of tumor markers in patients with solid cancers: 31. Kaleağasıoğlu F and Berger MR: Differential effects of erufo- A critical review. Eur J Intern Med 18: 175‑184, 2007. sine on proliferation, wound healing and apoptosis in colorectal 8. Hanahan D and Weinberg RA: Hallmarks of cancer: The next cancer cell lines. Oncol Rep 31: 1407‑1416, 2014. generation. Cell 144: 646‑674, 2011. 32. LI K, Zhou ZY, JI PP and Luo HS: Knockdown of β‑catenin by 9. Hartwig JH and Stossel TP: Isolation and properties of actin, siRNA influences proliferation, apoptosis and invasion of the myosin and a new actin‑binding protein in rabbit alveolar macro- colon cancer cell line SW480. Oncol Lett 11: 3896‑3900, 2016. phages. J Biol Chem 250: 5696‑5705, 1975. 33. Nakano H, Miyazawa T, Kinoshita K, Yamada Y and Yoshida T: 10. Stossel TP, Condeelis J, Cooley L, Hartwig JH, Noegel A, Functional screening identifies a microRNA, miR‑491 that Schleicher M and Shapiro SS: Filamins as integrators of cell induces apoptosis by targeting Bcl‑X(L) in colorectal cancer mechanics and signalling. Nat Rev Mol Cell Biol 2: 138‑145, 2001. cells. Int J Cancer 127: 1072‑1080, 2010. 11. Gomer RH and Lazarides E: Switching of filamin polypeptides 34. Cardoso AP, Pinto ML, Pinto AT, Oliveira MI, Pinto MT, during myogenesis in vitro. J Cell Biol 96: 321‑329, 1983. Gonçalves R, Relvas JB, Figueiredo C, Seruca R, Mantovani A, 12. Savoy RM and Ghosh PM: The dual role of filamin a in cancer: et al: Macrophages stimulate gastric and colorectal cancer Can't live with (too much of) it, can't live without it. Endocr Relat invasion through EGFR Y(1086), c‑Src, Erk1/2 and akt phos- Cancer 20: R341‑R356, 2013. phorylation and smallGTPase activity. Oncogene 33: 2123‑2133, 13. Djinovic‑Carugo K and Carugo O: Structural portrait of filamin 2014. interaction mechanisms. Cur Protein Pept Sci 11: 639‑650, 2010. 35. Begonja AJ, Hoffmeister KM, Hartwig JH and Falet H: FlnA‑null 14. Xu YJ, Bismar TA, Su J, Xu B, Kristiansen G, Varga Z, Teng L, megakaryocytes prematurely release large and fragile platelets Ingber DE, Mammoto A, Kumar R and Alaoui‑Jamali MA: that circulate poorly. Blood 118: 2285‑2295, 2011. Filamin a regulates focal adhesion disassembly and suppresses 36. Popowicz GM, Schleicher M, Noegel AA and Holak TA: breast cancer cell migration and invasion. J Exp Med 207: Filamins: Promiscuous organizers of the cytoskeleton. Trends 2421‑2437, 2010. Biochem Sci 31: 411‑419, 2006. 15. Feng Y, Chen MH, Moskowitz IP, Mendonza AM, Vidali L, 37. Martin GS: Cell signaling and cancer. Cancer Cell 4: 167‑174, Nakamura F, Kwiatkowski DJ and Walsh CA: Filamin a 2003. (FLNA) is required for cell‑cell contact in vascular develop- 38. Wang K, Ash JF and Singer SJ: Filamin, a new high‑molecular‑ ment and cardiac morphogenesis. Proc Natl Acad Sci USA 103: weight protein found in smooth muscle and nonmuscle cells. 19836‑19841, 2006. Proc Natl Acad Sci USA 72: 4483‑4486, 1977. 16. Wang Y, Kreisberg JI, Bedolla RG, Mikhailova M, 39. Ehrlicher AJ, Nakamura F, Hartwig JH, Weitz DA and Stossel TP: deVere White RW and Ghosh PM: A 90 kDa fragment of Mechanical strain in actin networks regulates FilGAP and inte- filamin A promotes casodex‑induced growth inhibition in grin binding to filamin a. Nature 478: 260‑263, 2011. Casodex‑resistant and rogen receptor positive C4‑2 prostate 40. Yi WY, Hong W, Kang HJ, Kim HJ, Zhao W, Wang A, Seong YS cancer cells. Oncogene 26: 6061‑6070, 2006. and Bae I: Inhibition of the PI3K/Akt pathway potentiates 17. Kyndt F, Gueffet JP, Probst V, Jaafar P, Legendre A, Le Bouffant F, cytotoxicity of EGFR kinase inhibitors in triple‑negative breast Toquet C, Roy E, McGregor L, Lynch SA, et al: Mutations in the cancer cells. J Cell Mol Med 17: 648‑656, 2013. gene encoding filamin a as a cause for familial cardiac valvular 41. Abrams SL, Steelman LS, Shelton JG, Wong EW, Chappell WH, dystrophy. Circulation 115: 40‑49, 2007. Bäsecke J, Stivala F, Donia M, Nicoletti F, Libra M, et al: The 18. Nakamura F, Heikkinen O, Pentikainen OT, Osborn TM, Raf/MEK/ERK pathway can govern drug resistance, apoptosis Kasza KE, Weitz DA, Kupiainen O, Permi P, Kilpeläinen I, and sensitivity to targeted therapy. Cell Cycle 9: 1781‑1791, Ylänne J, et al: Molecular basis of filamin A‑FilGAP interac- 2010. tion and its impairment in congenital disorders associated with 42. Xu Y, Bismar TA, Su J, Xu B, Kristiansen G, Varga Z, Teng L, filamin a mutations. PLoS One 4: e4928, 2009. Ingber DE, Mammoto A, Kumar R and Alaoui‑Jamali MA: 19. Zhou AX, Hartwig JH and Akyurek LM: Filamins in cell Filamin a regulates focal adhesion disassembly and suppresses signaling transcription and organ development. Trends Cell breast cancer cell migration and invasion. J Exp Med 207: Biol 20: 113‑123, 2010. 2421‑2437, 2010. 20. Zhu TN, He HJ, Kole S, D'Souza T, Agarwal R, Morin PJ and 43. Uramoto H, Akyurek LM and Hanagirl T: A positive relation- Bernier M: Filamin A‑mediated downregulation of the exchange ship between Filamin and VEGF in patiens with lung cancer. factor Ras‑GRF1 correlates with decreased matrix metallopro- Anticancer Res 30: 3939‑3944, 2010. teinase‑9 expression in human melanoma cells. J Biol Chem 282: 44. Park YL, Park SY, Lee SH, Kim RB, Kim JK, Rew SY, 14816‑14826, 2007. Myung DS, Cho SB, Lee WS, Kim HS and Joo YE: Filamin 21. Yarden Y and Sliwkowski MX: Untangling the ErbB signalling a interacting protein 1‑like expression inhibits progression in network. Nat Rev Mol Cell Biology 2: 127‑137, 2001. colorectal cancer. Oncotarget 7: 72229‑72241, 2016. 22. Roskoski R: The ErbB/HER family of protein‑tyrosine kinases 45. Sun GG, Sheng SH, Jing SW and Hu WN: An antiproliferative and cancer. Pharmacol Res 79: 34‑74, 2014. gene FLNA regulates migration and invasion of gastric carci- 23. Yewale C, Baradia D, Vhora I, Patil S and Misra A: Epidermal noma cell in vitro and its clinical significance. Tumor Biol 3: growth factor receptor targeting in cancer: A review of trends 2641‑2648, 2014. and strategies. Biomaterials 34: 8690‑8707, 2013. 24. David II, Gallo RM and Settleman J: Mutational activation of ErbB family receptor tyrosine kinases: Insights into mechanisms This work is licensed under a Creative Commons of signal transduction and tumorigenesis. Bioessays 29: 558‑565, Attribution-NonCommercial-NoDerivatives 4.0 2007. International (CC BY-NC-ND 4.0) License. 25. Lo HW: EGFR targeted therapy in malignant Glioma: Novel aspects and mechanisms of drug resistance. Curr Mol Pharmacol 3: 37‑52, 2010.