The Molecular Control of the Hypothalamic-
Pituitary-Testicular Axis in the Bull
Submitted in accordance with academic requirements to the Department of Biological Sciences, Faculty of Science and Engineering, University of Limerick in fulfilment of the requirements for the degree of
Doctor of Philosophy
By
Anne-Marie English, B.Sc.Ed. Student Number (09005064)
Thesis Supervisors: Dr. Seán Fair1, Prof. David Kenny2,3, Dr. Sineád Waters2
1Department of Biological Sciences, University of Limerick, Limerick 2Animal and Bioscience Research Department, Teagasc Grange, Dunsany, Co. Meath
3School of Agriculture and Food Science, University College Dublin, Belfield, Dublin
i
Table of Contents
Abstract ...... vi Declaration ...... vii Dedication ...... viii Acknowledgements ...... ix List of Figures ...... i List of Tables ...... iii List of Abbreviations ...... v CHAPTER 1: Literature Review ...... 1 1.1 Introduction ...... 2 1.2 Anatomy and Physiology of the Hypothalamus and Pituitary Gland ...... 4 1.2.1 Hypothalamus ...... 4 1.2.2 Arcuate Nuclei...... 5 1.2.3 Pre-optic Nuclei...... 6 1.2.4 Other Hypothalamic Nuclei ...... 6 1.2.5 Pituitary Gland ...... 7 1.2.6 Anterior Pituitary Gland ...... 7 1.3 The Effects of Nutrition on the Brain and Neuroplasticity ...... 9 1.4 Male Reproductive Anatomy and Physiology ...... 9 1.4.1 Testes ...... 10 1.4.2 Secondary Sex Organs ...... 11 1.4.3 Accessory Glands ...... 12 1.4.4 Sertoli Cells ...... 13 1.4.5 Leydig Cells ...... 14 1.5 Adipose...... 15 1.6 Metabolic Control of Reproduction ...... 17 1.7 Spermatogenesis ...... 18 1.8 Puberty ...... 21 1.9 Physiological Mechanisms controlling Pubertal Development ...... 23 1.9.1 Gonadotropin Releasing Hormone ...... 23 1.9.2 Luteinising Hormone and Follicle Stimulating Hormone...... 24 1.9.3 Testosterone ...... 25 1.9.4 Kisspeptin (KISS1) and G Protein – Coupled Receptor (GPR54) System...... 28
ii
1.9.5 Gonadotropin-Inhibitory Hormone (GnIH) ...... 30 1.9.6 Inhibin and Activin ...... 30 1.10 Nutritional Influences on Puberty through Metabolic Signalling Peptides and Metabolic Hormones...... 31 1.10.1 Neuropeptide Y (NPY) and Agouti-related Protein (AGRP) ...... 31 1.10.2 Pro-opiomelanocortin (POMC) and Alpha melanocortin stimulating hormone (α-MSH) . 32 1.10.3 Ghrelin ...... 33 1.10.4 Leptin ...... 34 1.10.5 Adiponectin (AdipoQ) ...... 36 1.10.6 Insulin / Insulin like growth factor 1 (IGF-I) ...... 37 1.11 Evolution of Technologies used to study Transcriptomics ...... 38 1.12 Rationale for this Thesis ...... 40 1.13 Objectives ...... 41 CHAPTER 2: Role of Early Life Nutrition on Regulating the Hypothalamic-Anterior Pituitary– Testicular Axis of the Bull...... 42 2.1 Abstract ...... 43 2.2 Introduction ...... 43 2.3 Material and methods...... 45 2.3.1 Experimental design and animal management ...... 45 2.3.2 Blood sampling ...... 47 2.3.3 Metabolite assays ...... 47 2.3.4 Metabolic hormones ...... 48 2.3.5 Reproductive hormones ...... 48 2.3.6 Testicular histology ...... 49 2.3.7 RNA isolation and purification ...... 50 2.3.8 Complementary DNA synthesis ...... 50 2.3.9 Primer design and reference gene selection ...... 51 2.3.10 Gene expression ...... 52 2.3.11 Immunohistochemical (IHC) analysis ...... 52 2.3.12 Statistical analysis ...... 54 2.4 Results ...... 54 2.4.1 Animal performance ...... 54 2.4.2 Metabolic hormones and metabolites ...... 55 2.4.3 Reproductive hormones ...... 56
iii
2.4.4 Testicular histology ...... 56 2.4.5 Gene expression...... 57 2.4.6 Immunohistochemistry ...... 58 2.5 Discussion ...... 58 2.6 Conclusion ...... 67 CHAPTER 3: Effect of Early Calf-Hood Nutrition on the Transcriptional Regulation of the Hypothalamic-Pituitary-Testicular axis in Holstein-Friesian Bull Calves ...... 89 3.1 Abstract ...... 90 3.2 Introduction ...... 91 3.2 Material and Methods ...... 93 3.2.1 Animal Model...... 93 3.2.2 Tissue Collection ...... 93 3.2.3 RNA isolation and purification ...... 94 3.2.4 RNA-Seq library preparation and sequencing ...... 94 3.2.5 RNASeq data analyses ...... 95 3.2.6 Pathway analysis ...... 95 3.3 Results ...... 96 3.3.1 Animal Performance ...... 96 3.3.2 Differential gene expression ...... 96 3.3.3 Pathway Analysis...... 97 3.4 Discussion ...... 98 3.4.1 Cholesterol Biosynthesis ...... 98 3.4.2 Androgen Biosynthesis ...... 100 3.4.3 Gametogenesis ...... 101 3.5 Conclusions...... 104 CHAPTER 4: Effect of Early Calf-Hood Nutrition on the Transcriptomic Profile of Subcutaneous Adipose Tissue in Holstein-Friesian Bulls ...... 112 4.1 Abstract ...... 113 4.2 Introduction ...... 114 4.3 Materials and methods ...... 115 4.3.1 Animal model ...... 116 4.3.2 Tissue collection ...... 116 4.3.3 Adipocyte cell number and diameter ...... 117 4.3.4 RNA isolation and purification ...... 117
iv
4.3.5 RNASeq library preparation and sequencing...... 117 4.3.6 RNASeq data analyses ...... 118 4.3.7 Pathway analysis ...... 118 4.3.8 Statistical analysis ...... 119 4.4 Results ...... 119 4.4.1 Animal performance and adipose tissue histology ...... 119 4.4.2 Differential gene expression ...... 119 4.4.3 Pathway analysis ...... 120 4.4.4 Lipogenesis and adipogenesis...... 121 4.5 Discussion ...... 121 4.5.1 Lipogenesis and adipogenesis...... 122 4.5.2 Endocrine regulatory networks ...... 124 4.5.3 Branched chain amino acid metabolism ...... 126 4.5.4 Energy production and mitochondrial dysfunction ...... 128 4.6 Conclusion ...... 129 CHAPTER 5: General Discussion ...... 137 CHAPTER 6: Publication List ...... 153 6.1 Published papers: ...... 154 6.2 Submitted papers: ...... 154 6.2 Conference publications ...... 154 Chapter 7: Bibliography ...... 157
v
Abstract
The objectives of this thesis were: 1) to understand the effect of early calf nutrition on the transcriptome of subcutaneous adipose tissue and their downstream effects on the hypothalamic-pituitary-testicular (HPT) axis in Holstein Friesian bulls, 2) to characterise the physiological, cellular and transcriptional response of the HPT to contrasting planes of nutrition during early calf-hood in Holstein Friesian bulls and 3) to describe key pathways in the HPT axis which are under nutritional control. Holstein Friesian bull calves with a mean (±S.D.) age and bodyweight of 19 (±8.2) days and 47.5 (±5.3) kg, respectively, were assigned to either a high (n=10) or low (n=10) plane of nutrition. Diets were designed in order to achieve a growth rate of 1.2 and 0.5 kg/day for the high and low planes of nutrition, respectively. At 126±1.1 days of age, the calves were euthanized. In the first study, animal performance and systemic concentrations of metabolic hormones and metabolites were measured. Testicular histology, targeted gene and protein expression of the arcuate nucleus, anterior pituitary and testes were also measured. Testes from adult bulls that were reared under similar conditions were also excised for gene expression comparison. The metabolites and metabolic hormones generally reflected the improved metabolic status of the calves on the high plane of nutrition (P<0.001). Only ghrelin receptor was upregulated in the anterior pituitary (P<0.05) and ARC (P<0.10) in the low plane of nutrition compared to high plane of nutrition. Calves offered a high plane of nutrition were heavier at slaughter, had larger testes, larger seminiferous tubule diameter, more mature spermatogenic cells and more Sertoli cells in accordance with both morphological and transcriptional data. This study suggests that a high plane of nutrition during the early calf-hood period alters gene expression within the HPT and testicular morphology which hastens spermatogenesis and testicular development. In the second study, arcuate nucleus from the hypothalamus, anterior pituitary and testes samples were harvested and RNASeq analysis was performed. There were 0, 49 and 1,346 genes differentially expressed in the arcuate nucleus, anterior pituitary and testicular tissue of bulls on the low relative to the high plane of nutrition, respectively (P<0.05; False Discovery Rate<0.05). Plane of nutrition had no effect on gene expression in the arcuate nucleus or anterior pituitary tissue with regard to the early onset of puberty. Low plane of nutrition down regulated the expression of genes involved in cholesterol and androgen biosynthesis in the testes. A low plane of nutrition also resulted in up-regulation of genes known to positively influence male fertility and formation of gonadal cells. This study aids in the detection of molecular based biomarkers for the selection of cattle with early pubertal onset. In the third study, subcutaneous adipose tissue samples were harvested and RNASeq analysis was performed. There were 674 genes differentially expressed in adipose tissue of calves on the low compared with the high plane of nutrition (P<0.05; FDR<0.05; fold change >2.0). Plane of nutrition altered the expression of genes across an array of putative biological processes but the most dominant cellular processes affected were cellular energy production and branched chain amino acid degradation. A high plane of nutrition caused upregulation of genes such as leptin (LEP) and adiponectin (ADIPOQ), which are known to directly affect reproductive function. These results provide an insight into the effect of augmenting the plane of nutrition of Holstein-Friesian bull calves in the prepubertal period on the transcriptome of adipose tissue.
vi
Declaration
I, hereby, declare that I am the sole author of this dissertation and that it has not been submitted to any other university or higher education institution, or for any other academic award within this University. Reference and acknowledgements have been made, where necessary, to identify the work of others.
Signature: ______Date: ______Anne-Marie English, B.Sc.Ed.
vii
Dedication
To my parents
Without your love and support, I would never have believed I was capable of such a feat.
viii
Acknowledgements
First and foremost, I would like to acknowledge and sincerely thank everyone who has assisted me during my research and contributed in any way to the completion of my thesis.
I would like to extend my gratitude and appreciation to both my Teagasc supervisor Prof.
David Kenny and Dr. Seán Fair for their excellent guidance, knowledge, patience and encouragement throughout the course of my PhD.
Sincere thanks to Dr. Sineád Waters who contributed her knowledge and input into the experimental work and writing of this thesis.
I am eternally grateful to Dr. Paul Cormican for his patience and assistance with the bioinformatics element of my PhD. Your door was always open no matter how busy you were.
I would also like to thank Teagasc and the Department of Agriculture, Food and the Marine
(DAFM) Research Stimulus Fund (RSF 11/S/16) and the Irish Research Council (Grant
Number GOIPG/2013/1391) for funding this work.
My PhD has enabled me to learn new skills and methodologies. I would like to thank the following people and institutes for without whom my research would not be what it is (in no particular order); Dr. Darragh Matthews (Teagasc Athenry), John Moriarty and Colm Brady
(Backweston), Dr. Joe Cassidy, Dr. Colm Reid, Dr. Khalid Alkhodair, Dr. Liz Matthews, Dr.
Mark Crowe, Sheila Ni Cheallaigh, Sheila Worrell, Joe Brady and Brian Cloak (UCD
Veterinary School), Prof. Pat Lonergan (UCD School of Agriculture), Prof. Aurelie Fabre and Janet McCormack (St. Vincent’s Hospital and Conway Institute, UCD), Tara Foley
(Department of Anatomy and Neuroscience, UCC), the late Dr. Marcel Amstalden (Texas
A&M), Dr. Christophe Staub (INRA), Dr. Helen Lambkin (DIT), Dr. Helga Sauerwein and
ix
Christiane Urh (University of Bonn), Eugene Vesey (Teagasc Ashtown), Robert, Catherine and Sarah (Kildare Chilling) and Ger Kennedy (Dawn Meats, Granagh).
I am grateful to all the technical laboratory staff including Joe Larkin, Margaret Murray,
Aiveen Marron, Michael Nolan and Ann Marley for their help in my countless adventures to locate equipment and chemicals etc. and their expertise, advice and general chat. I would also like to thank Dr. Matthew McCabe for this patience and extensive lab training, trouble shooting and organising the sending of my RNA libraries to Clinical Genomics Centre.
Thanks also to Ann Gilsenan, Mary Murphy and Mary Weldon for their administrative support. To Joe Gill and Peter Grimes in the stores who can get almost anything done or ordered even at short notice; your patience and logistical contributions are invaluable.
I would like to thank Francis Collier for providing help during my calf trials. I would like to thank all the farm staff and technicians especially, Eddie Mulligan, Hughie Mulligan and
Brian Duffy. Brian minded my calves as if they were his own and never thought any of my questions were silly, I will never forget that!
Thanks to all the UL gang past and present especially Craig, Shauna, Edel and Gillian who made Tours 2016 the best “craic”!
Thanks to David Kenny’s group, Colin, Clare, Emily, Eoin, Keelan and Natasha, for all the high and lows especially the factory and calving days. To the boys of 22 Manorlands
Crescent; Michael, Kevin and Declan for the gossip and tea, joining me in watching the Great
British Bake Off and Grey’s Anatomy and the endless soccer matches, thank you! To
Michelle, you bring fun and laughter with you everywhere, thank you for your friendship! To
Jenna, thank you for the tea breaks, the baking sessions and my only ever adventure in
Wales! To all the postgraduate and work experience students (especially Mathilde and
Darragh) who I have met during the last four years, thanks for all the help and assistance
x during my research and the good memories and laughter. To Claire Fitzsimons and Kate
Keogh, the master postdocs who are so generous with their time and knowledge, thank you so much! To my “work husband” Dr. Colin Byrne, thank you for the evening chats about bull fertility and life, for being my unpaid technician with the calves and for all the time and effort you spent in helping me with my work. Colin, without doubt you will go far!
To my best friend Maura O’Dea, I may have neglected you since I started this journey.
However, you are always there with hilarious stories to cheer me up when I need you and around for a night out when needed.
Finally, to my parents Catherine and TJ, brother Micheál, family and friends, thanks for all the encouragement and endless support during my time completing this thesis.
xi
List of Figures
Figure Title Page Figure 1.1. Diagrammatic representation of the nuclei arrangement 5 in the hypothalamus and the relationship between the hypothalamus and the pituitary gland Figure 1.2 The development of the pituitary gland and the 8 hypophyseal portal system connecting the hypothalamus and the anterior pituitary Figure 1.3 Diagram of the anatomy of the testis of the bull 11 Figure 1.4 Diagram of the reproductive tract of the bull 13 Figure 1.5 Stages of spermatogenesis 20 Figure 1.6 Illustration of the seminiferous tubule showing the 21 development of the germ cells and relationship to the adjacent Sertoli cells Figure 1.7 Mean (± s.e.m.) concentrations of luteinising hormone 25 (LH) and follicle stimulating hormone (FSH) in blood samples collected from young Hereford x Charolais bulls Figure 1.8 Scheme of testosterone metabolism 27 Figure 1.9 Mean (±s.e.m) of Testosterone concentration in young 28 Hereford x Charolais bulls Figure 1.10 Schematic representation of the effect of ghrelin on the 34 hypothalamic-pituitary-gonadal axis Figure 2.1 AMH (x400) and GATA4 (x100) staining in the testes 77 Figure 2.2 KI67, NPY and KISS1 nuclear staining in the arcuate 78 tissue (x400) Figure 2.3 Effect of a high compared to a low plane of nutrition 80 on the systemic concentrations of metabolites of Holstein Friesian bull calves Figure 2.4 Effect of a high compared to a low plane of nutrition 81 on the systemic concentrations of metabolic hormones of Holstein Friesian bull calves Figure 2.5 Effect of plane of nutrition high plane of nutrition and 82 low plane of nutrition on the systemic concentrations of reproductive hormones Figure 2.6 Effect of a high compared to a low plane of nutrition 83 on the lumen development of the seminiferous tubules Figure 2.7 Effect of a high compared to a low plane of nutrition 84 on GATA4 stained Sertoli cell number (x400); A: High plane of nutrition and B: Low plane of nutrition Supplementary Method used to calculate the volume density of 85 Figure 2.1 seminiferous tubules. Sections (5-µm thick) were stained using Haematoxylin and Eosin (H&E) Figure 3.1 Multidimensional scaling plot which shows the 105 measured similarity of the samples in 2-dimensions Figure 3.2 The top biochemical pathway significantly enriched in 106 the anterior pituitary of Holstein-Friesian dairy bulls
i
fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age Figure 3.3 Molecular and cellular function of differentially 107 expressed genes of the anterior pituitary of Holstein- Friesian dairy bulls fed on a low versus high plane of nutrition and slaughtered at 18 weeks of age Figure 3.4 The top biochemical pathway significantly enriched in 108 the testes of Holstein-Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age Figure 3.5 The top molecular and cellular function of 109 differentially expressed genes of the testes of Holstein- Friesian dairy bulls fed on a low versus high plane of nutrition and slaughtered at 18 weeks of age Figure 4.1 Multidimensional scaling plot which shows the 130 measured similarity of the samples in 2-dimensions Figure 4.2 Molecular and cellular function of differentially 131 expressed genes of the subcutaneous adipose tissue of Holstein-Friesian dairy bulls fed on a low versus high plane of nutrition and slaughtered at 18 weeks of age Figure 4.3 The top biochemical pathway significantly enriched in 132 the subcutaneous adipose tissue of Holstein-Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age Figure 4.4 Light micrograph of subcutaneous adipose tissue 133 stained with haematoxylin and eosin
ii
List of Tables
Table Title Page Table 2.1 Chemical composition of milk replacer 69 Table 2.2 Diet and chemical composition of concentrate diet 70 offered Table 2.3 Classification of seminiferous tubule development 71 Table 2.4 Effect of a high compared to a low plane of nutrition 72 on the pre-weaning average daily gain, post weaning average daily gain, total average daily gain and live weight at time of slaughter of Holstein Friesian bull calves Table 2.5 Effect of a high compared to a low plane of nutrition 73 on the paired testes weight and on morphological properties including seminiferous tubule diameter and stage of spermatogenesis Table 2.6 Effect of a high compared to a low plane of nutrition 74 on the expression of selected genes in the arcuate nucleus of the hypothalamus Table 2.7 Effect of a high compared to a low plane of nutrition 75 on the expression of genes in the anterior pituitary Table 2.8 Effect of a high and a low plane of nutrition compared 76 to mature bulls on the expression of genes in the parenchyma of the testes Table 2.9 Effect of low plane of nutrition and high plane of 79 nutrition on protein concentrations on the arcuate nucleus (NPY, KISS1 and KI67) and the testes (AMH and GATA4). Supplementary Gene ID, sequence and accession number for all 86 Table 2.1 arcuate genes Supplementary Gene ID, sequence and accession number for all 87 Table 2.2 anterior pituitary genes Supplementary Gene ID, sequence and accession number for testes 88 Table 2.3 genes examined in this study Table 3.1a Gametogenesis genes differentially expressed in the 110 testes tissue of the Holstein-Friesian dairy bulls feed on a low plane of nutrition in comparison to the high plane of nutrition and slaughtered at 18 weeks of age Table 3.1b Gametogenesis genes differentially expressed in the 111 testes tissue of the Holstein-Friesian dairy bulls feed on a low plane of nutrition in comparison to the high plane of nutrition and slaughtered at 18 weeks of age Table 4.1 Genes differentially expressed in the subcutaneous 134 adipose tissue of Holstein-Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition and slaughtered at 18 weeks of age returned by GOSeq Table 4.2 Network of biological interest generated through 135 network analysis using Ingenuity Pathway Analysis
iii
(IPA) of subcutaneous adipose tissue of Holstein- Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age Table 4.3 Oxidative Phosphorylation genes differentially 136 expressed in the subcutaneous adipose tissue of the Holstein-Friesian dairy bulls feed on a low plane of nutrition in comparison to a high plane of nutrition and slaughtered at 18 weeks of age.
iv
List of Abbreviations
A Spermatogonia A
ABAT (S)-3-amino-2-methylpropionate transaminase
ACACA Acetyl-CoA carboxylase-α
ACADSB 2-methylacyl-CoA dehydrogenase
ACAT1 Acetyl-CoA C-acetyltransferase
Acetyl CoA Acetyl coenzyme A
ACO1 Aconitase 1
ACO2 Aconitase 2
ADF Acid detergent fibre
ADG Average daily gain
ALDH6A1 Methylmalonate-semialdehyde dehydrogenase
AdipoQ Adiponectin
AdipoR1 Adiponectin receptor 1
AdipoR2 Adiponectin receptor 2
AgRP Agouti-related protein
AI Artificial Insemination
AMH Anti-Müllerian hormone
α-MSH Alpha melanocortin-stimulating hormone
ApoE Apolipoprotein E
AQP-8 Aquaporin-8
AR Androgen receptor
ARC Arcuate nucleus
v
ATP Adenosine triphosphate
AUC Area under the curve
B Spermatogonia B
BAT Brown adipose tissue
BCAA Branched chain amino acids
BCAT2 Branched chain amino acid transaminase 2
BCS Body condition score
BCV Biological Coefficient of Variation.
BDNF Brain-derived neurotropic factor bFGF Basic fibroblast growth factor
BHB Betahydroxybutyrate
BIC Bayesian information criteria
BLAST Basic Local Alignment Search Tool
BMP Bone morphogenetic proteins cAMP Cyclic adenosine monophosphate
CART Cocaine and amphetamine regulated transcript cDNA Complimentary Deoxyribonucleic acid
CLDN11 Claudin 11
CP Crude protein
CRF Corticotrophin-releasing factor
CRH Corticotropin-releasing hormone
CS Citrate synthase
CV Coefficients of variations
vi
CT Cycle threshold
D Diplotene
DEG Differentially expressed genes
DGAT2 Diacylglycerol acyltransferase 2
DHCR24 D24 sterol reductase
DHCR7 7- dehydrocholesterol reductase
DM Dry matter
DMN Dorsomedial nucleus
DNA Deoxyribonucleic acid
DPBS Dulbecco's phosphate-buffered saline
Dyn Dynorphin A
EBI Economic Breeding Index
EBP Cholesterol D-isomerase
ECHS1 Enoyl-CoA hydratase
EDTA Ethylenediamine tetra-acetate
EHHADH Enoyl-CoA hydratase
EIA Enzyme immunoassay
ELISA Enzyme-linked immunosorbent assay
FABP4 Fatty acid-binding protein 4
FADH2 Reduced flavin adenine dinucleotide
FASN Fatty acid synthetase
FDPS Dimethylallytranstransferase
FDR False discovery rate
vii
FGF1 Fibroblast growth factor 1
FGF2 Fibroblast growth factor 2
FH Fumarase
FSH Follicle stimulating hormone
FSHβ Follicle stimulating hormone β
FSHR Follicle stimulating hormone receptor g Gram g/L Grams per litre
GABAA Gamma-amino butyric acid type A
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
GATA2 GATA binding protein 2
GATA4 Transcription factor GATA-binding protein 4
GDF-10 Growth differentiation factor 10
GH (1) Growth hormone
GHRH Growth hormone receptor hormone
GHSR Ghrelin receptor
GHS-R1a Ghrelin receptor-1a
GLP-1 Glucagon-like peptide-1
GnIH Gonadotropin inhibiting hormone
GnRH Gonadotropin releasing hormone
GnRHR Gonadotropin releasing hormone receptors
GPR54 G protein-coupled receptor 54 h Hours
viii
H&E Haematoxylin and Eosin
HADHA Enoyl-CoA hydratase
HADHB Enoyl-CoA hydratase
HDL High density lipoprotein
HF Holstein Friesian
HH Hedgehog
HIBCH 3-hydroxyisobutyryl-CoA hydrolase
HMG-CoA 3-hydroxy-3-methylglutaryl-CoA
HPT Hypothalamic-Pituitary-Testicular
Hsd17b10 3-hydroxy-2-methybutyryl-CoA dehydrogenase
ICBF Irish Cattle Breeding Federation
IDH3B Isocitrate dehydrogenase
IGF-I Insulin-like growth factor-1
IGF-IR Insulin-like growth factor-1 receptor
IHC Immunohistochemistry
IL17 Interleukin 17
In Intermediate spermatogonia
INSIG-1 Insulin0induced gene 1
IPA Ingenuity Pathway Analysis
IPP Isopentenyl pyrophosphate
IRMA Immunoradiometric assay kDA Kilodalton
KEGG Kyoto Encyclopaedia of Genes and Genomes
ix
Kg Kilogram
KISS1 Kisspeptin
KNDy Kisspeptin, Neurokinin B and dynorphin A neurons
KO Knock out
Kp10 Kisspeptin 10
Kp13 Kisspeptin 13
Kp14 Kisspeptin 14
Kp54 Kisspeptin 54 l litre
L Leptotene
LDLR Low density lipoprotein receptors
LEP Leptin
LHβ Luteinizing hormone β
LHR Luteinizing hormone receptor
LSS Lanosterol synthase
LXR Liver X receptor
MAP Molecule Activity Predictor
MC4R Melanocortin-4- receptor
MDH1 Malate dehydrogenase
MDS Multi-dimensional scaling
Min minutes ml millilitre
x
MLXIPL MLX interacting protein-like mm2 millimetres squared
MR Milk replacer mRNA Messenger ribonucleic acid
MSC Mesenchymal stem cell
MVD Disphosphomevalonate decarboxylase
MVK Mevalonate kinase
MW Molecular weight
NADH Nicotinamide-adenine dinucleotide
NEFA Non-esterified fatty acids ng nanograms
NKB Neurokinin B
NPY Neuropeptide Y
Ob/LEP Leptin
Ob-R Leptin receptor
Ob-Rb Leptin receptor B
Oil B Acid hydrolysis
P Pachytene
PCNA Proliferating cell nuclear antigen
PCR Polymerase chain reaction
PEG Poly-ethylene glycol
PGE2 Prostaglandin E2
PLIN1 Perilipin 1
xi
PMVK Phosphomevalonate
POA Preoptic area
POMC Proopiomelanocortin
PPARGC1A/PGC-1α Peroxisome proliferator-activated receptor gamma coactivator 1-alpha
PTM Peritubular myoid
PVN Paraventricular nucleus
P450scc Cytochrome P450 side chain cleavage enzyme
RBI Relative Breeding Index
RLN3 Relaxin-3
RIA Radioimmunoassay
RNA Ribonucleic acid
RNASeq RNA sequencing
RP Rathke’s pouch
RPS9 Ribosomal protein S9
RFRP RF-amide related peptide
RFRP-3 RF-amide related peptide-3
RT-PCR Real-time PCR s Seconds
Sa Spermatids type Sa
SAS Statistical analysis software
SAT Subcutaneous adipose tissue
Sb1 Spermatids type Sb1
xii
Sb2 Spermatids type Sb2
Sc Spermatids type Sc
SCARB1 Scavenger receptor B1
SCC Somatic cell count
S.D. Standard Deviation
Sd1 Spermatids type Sd1
Sd2 Sperm s.e.m. Standard error of the mean
SHBG Sex hormone binding globulin
SREBF1 Sterol regulatory element binding factor 1
SREBP-c Sterol regulatory element binding protein-1c
SS Secondary spermatocytes
STAR Spliced Transcripts Alignment to a Reference
SUCLG1 Succinyl-CoA synthetase 1
SUCLG2 Succinyl-CoA synthetase 2
SVF Stromal vascular fraction
TCA Tricarboxylic acid
TDN Total digestible nutrients
TGFβ Transforming growth factor β
THY1 Thy-1 cell surface antigen
TM7SF2 D14 sterol reductase
TRH Thyrotropin-releasing hormone
UBQ Ubiquitin
xiii
UCHL1 Ubiquitin carboxyl-terminal esterase L1
µl Microlitre
µm Micrometer
µg Microgram
VAT Visceral adipose tissue
VFA Volatile fatty acids
WAT White adipose tissue
WNT2B Wnt family member 2B
VMN Ventromedial nucleus
YWHAZ Tyrosine 3-monooxygenase/tryptophan 5- monooxygenase activation protein, zeta
Z Zygotene
ZO1 Zonula occludens protein 1
2D 2-dimensional
Δ-4 Delta-4
Δ-5 Delta-5
°C Degrees Celsius
xiv
CHAPTER 1: Literature Review
1
1.1 Introduction
The Agricultural food and drink sector is Ireland’s largest indigenous industry with an annual output of over €10.8 billion (BordBia, 2016). The dairy industry is the most profitable farming enterprise with total dairy and ingredients exports in 2015 of €3.24 billion (BordBia, 2016) and the Food Wise 2025 report has set an ambitious target of a
60% increase in primary production to €10 billion in Ireland by the year 2025 (DAFM,
2015). To achieve this in the dairy sector, the industry requires an annual productivity improvement, mainly through better genetics, of 1.5 to 2 per cent per year (DAFM, 2011).
In 2002, the Irish Cattle Breeding Federation (ICBF) introduced the Economic Breeding
Index (EBI), a single figure profit index which aids in the identification of the most elite and profitable bulls to breed replacement heifers, in response to a decline in fertility in the national dairy herd over the previous two decades (Mee, 2004). The EBI replaced the
Relative Breeding Index (RBI) which valued animals based on milk production traits only such as fat and protein yield (Berry, 2007). The EBI is comprised of seven sub-indexes related to profitable milk production; production (fat and protein content), fertility
(calving interval and survival), calving performance (direct calving difficulty, maternal calving difficulty, gestation length and calf mortality), beef carcass (cull cow weight, carcass weight, carcass conformation and carcass fat), maintenance, management
(milking time and milking temperament) and health (lameness, somatic cell count (SCC) and mastitis). Through its use the next generation of replacement heifers will be genetically superior to their parents in terms of their increased ability to produce, from a mainly forage based diet, more milk solids (protein and fat) per cow per year while maintaining a high rate of fertility.
2
In 2009, Ireland began to select dairy bulls for use in artificial insemination (AI) programmes using genomic assisted selection technologies which has augmented the annual increase in genetic gain of the national dairy herd. Genomic selection increases the reliability of the breeding value for individual animals. The most elite bulls can now be identified, from their DNA (deoxyribonucleic acid) profile, within days/weeks of birth and are now entering AI stations as soon as they reach puberty (Schefers and Weigel,
2012). The age at which these young bulls attain puberty can range from 8-11 months
(Rawlings et al., 2008), although this is influenced by management. These young bulls invariably yield a low volume of semen with a high proportion of abnormal sperm
(Lunstra and Echternkamp, 1982). For example, a 10-12 month old bull typically produces 50-150 frozen insemination doses per ejaculate (compared to 500-1000 for a mature bull) and in addition, semen can normally only be collected once per week, compared to 3 times per week for a mature bull (R. Monaghan, National Cattle Breeding
Centre, Enfield, Co. Meath, Ireland; personal communication). This represents up to a 60 fold reduction in output from a young compared to a mature bull and given that these young bulls have the highest genetic merit, demand for semen far exceeds supply thus limiting genetic improvement (Ball and Peters, 2004) of the national dairy herd. Ireland’s dairy industry operate in a seasonal system to ensure compact calving to coincide with grass growth and therefore these young bulls are often only in high demand during this season. Therefore, it is imperative that we gain a greater understanding of the effect of early calf-hood nutrition on the molecular pathways controlling the hypothalamic- pituitary-testicular axis. This will advance the knowledge of the onset of puberty in
Holstein-Friesian bulls and the factors that affect sperm production in order to design the best rearing protocols to be used in specialised rearing units for these elite and valuable
3 bulls so as to hasten puberty and facilitate the collection of high volumes of good quality semen.
1.2 Anatomy and Physiology of the Hypothalamus and Pituitary Gland
1.2.1 Hypothalamus
The hypothalamus consists of a ten populations of neurons called nuclei (Figure 1.1). The hypothalamus is acknowledged as the homeostatic regulator of the body (Kandel and
Schwartz, 1991), as it receives information related to factors including salt and water levels and blood pressure. It also regulates metabolism through regulating glucose, free fatty acids and amino acids, circulating peptides such as as insulin like growth factor-1
(IGF-I), growth hormone (GH), leptin and insulin and gastro-intestinal hormones such as ghrelin and makes compensatory alterations designed to keep them within desirable parameters (Schwartz et al., 2000, Segal, 2006, Cota et al., 2006, Morton et al., 2006).
The hypothalamus communicates for the initiation and control of all bodily functions by signalling via axons to distal brain sites and by directing hormone release from the pituitary, via the infundibulum (Pocock et al., 2013).
When the body is in a severe energy deficit, metabolic signals in the form of hormones emanating from the gastrointestinal tract, adipose tissue and other peripheral organs are sent from hypothalamic neurons involved in satiety and energy homeostasis namely the arcuate nuclei (ARC) to the preoptic nuclei that stimulate gonadotropin release. The metabolic signals have a crucial effect on the reproductive axis as it has the capacity to respond to changing concentrations of metabolic signals (Hill et al., 2008). Therefore, the
ARC and preoptic nuclei in the hypothalamus manipulate the timing of sexual development via the regulation of gonadotropin-releasing hormone (GnRH) secretion in bulls (Brito et al., 2007a).
4
Figure 1.1: Diagrammatic representation of the nuclei arrangement in the hypothalamus and the relationship between the hypothalamus and the pituitary gland. The region encompassed by the curly brackets is the hypothalamus (BiologicalDiscussion.com,
2006).
1.2.2 Arcuate Nuclei
The ARC is located adjacent to the third ventricle and the median eminence which lacks a blood-brain barrier and its main function is in the regulation of both the metabolic and reproductive functions by communicating peripheral weight regulating signals to other regions of the brain (Filby et al., 2008, Allen et al., 2012, Schwartz et al., 2000). The
ARC consists of metabolic sensing neurons and reproductive related neurons (Redmond et al., 2011). Neuropeptide Y (NPY), agouti-related protein (AgRP) and proopiomelanocortin (POMC) neurons are known to respond to changes in metabolism
(McShane et al., 1993, Stanley et al., 2005) and mediate nutritional effects on reproduction in heifers (Amstalden et al., 2014). There are no leptin receptors on GnRH neurons and therefore, the effects of leptin are mediated via kisspeptin (KISS1). KISS1 is
5 mainly secreted in the ARC (Gottsch et al., 2004, Estrada et al., 2006) and has been shown to stimulate GnRH secretion in the hypothalamus. The ARC is known as the primary hypothalamic site of action for peripheral hormones and transmits these signals to secondary hypothalamic such as the preoptic nuclei area (POA), ventromedial nucleus
(VMN), dorsomedial nucleus (DMN) and paraventricular nucleus (PVN) (Stanley et al.,
2005).
1.2.3 Pre-optic Nuclei
The POA contains the majority of the cell bodies of GnRH secretory cells in the hypothalamus and thus has the most control of the reproductive axis by integrating both nutritional and hormonal responses (Maruska and Fernald, 2011). The GnRH nerve projections originating from the POA attach to the median eminence, where they secrete
GnRH hormones into the hypophyseal portal system (Fujioka et al., 2007). Atrial natriuretic peptide and other natriuretic peptides that contain oestrogen receptors are in abundance in the POA of the female rat and play a major role in stimulating the release of luteinising hormone (LH) and follicle stimulating hormone (FSH) from anterior pituitary cells (Watson et al., 1994). Kisspeptin neurons are also found in POA and mediate the metabolic signals effect on GnRH (Hassaneen et al., 2016).
1.2.4 Other Hypothalamic Nuclei
The VMN also plays a critical role in energy homeostasis. It comprises the neuron: gamma-amino butyric acid type A (GABAA) and anorexigenic brain-derived neurotropic factor (BDNF; Roth and Sathyanarayana, 2012) . It has been reported that BDNF interacts with leptin to aid in the regulation of appetite (Komori et al., 2006) and has been implicated in regulating energy homeostasis via the melanocortin system (Stanley et al.,
2005b(Stanley et al., 2005). The VMN obtains NPY, AgRP and alpha melanocortin-
6 stimulating hormone (α-MSH) projections from the ARC and the VMN transmits these signals via projections to the DMN (Stanley et al., 2005).
It has been found that NPY, AgRP and α-MSH projections from the ARC influence two neuron populations in the PVN (Stanley et al., 2005). Paraventricular nucleus has two types of cells that respond to NPY, AgRP and α-MSH which are tonically firing neurosecretory cells and preautonomic cells (Roth and Sathyanarayana, 2012). The PVN releases corticotrophin-releasing factor (CRF) and thyrotropin-releasing hormone (TRH), both appetite suppressing peptides (Morton et al., 2006, Berthoud and Morrison, 2008).
1.2.5 Pituitary Gland
This small gland is the master gland of the brain, situated beneath the hypothalamus in the sella turcica. The pituitary gland is segregated into two regions; the anterior pituitary
(adenohypophysis) and the posterior pituitary (neurohypophysis). The anterior and posterior lobes are divided by an intermediate lobe (Figure 1.1).
1.2.6 Anterior Pituitary Gland
The organogenesis of the anterior pituitary in the bovine has not been defined, whereas, the differentiation and development of the mouse anterior pituitary has. At embryonic
Day 8.5, cells in the oral ectoderm form the embryonic pituitary, otherwise known as the
Rathke’s pouch (RP; Figure 1.2; Treier et al., 1998) . By embryonic Day 16.5, all RP cells have been assigned a cell type and are expressing the specific mRNA (messenger ribonucleic acid) for that cell type (Denef, 2003). The assignment of RP cells to a specific anterior pituitary cell type occurs immediately after the cells emerge from proliferation
(Treier et al., 1998, Ericson et al., 1998). However, they will not progress to functioning
7 anterior pituitary cells until they have been activated or inhibited by various transcription factors (Lamolet et al., 2001, Zhao et al., 2001).
These anterior pituitary cell types included corticotropes, thyrotropes, somatotropes, lactotropes and gonadotropes; with each cell type secreting specific hormones, in a pulsatile manner (Yeung et al., 2006; Figure 1.2). The hormones secreted by the hypothalamus (TRH, GnRH, growth hormone-releasing hormone (GHRH), corticotropin- releasing hormone (CRH), somatostatin and dopamine) travel through the hypothalamic- hypophyseal portal system and act on G protein-coupled receptors. The level of responsiveness of the anterior pituitary cells to GnRH can be altered by GnRH level, negative testosterone feedback from the testes and circadian rhythm (Yeung et al., 2006).
The gonadotrophic cells in the anterior pituitary are responsible for the regulation of testicular function through secretion of gonadotropins, LH and FSH (Schanbacher, 1982) .
Figure 1.2: (A) The development of the pituitary gland. (B) The hypophyseal portal system connecting the hypothalamus and the anterior pituitary (Yeung et al., 2006).
8
1.3 The Effects of Nutrition on the Brain and Neuroplasticity
Undernutrition and over nutrition can cause temporary or critical effects to all organs especially the central nervous system depending on its duration of effect. The neurons in the central nervous system have the capability to disassemble and reassemble in response to changes in the physiological environment such as stress, malnutrition, sleep, hormones and drugs (Sodhi and Sanders-Bush, 2004). These adaptations include alterations in gene expression, changes in neurotransmitter release or changes in phenotype or behaviour
(Sodhi and Sanders-Bush, 2004). This action of adaptation is referred to as brain plasticity, which is present as two forms; neuronal plasticity and synaptic plasticity. There are two critical or vulnerable periods in brain development (Calikoglu et al., 2001); the initial development of the foetus and early in postnatal life; length depending on species.
For examples in rodents, the first 3 weeks of postnatal life are the most crucial to brain development and neuroplasticity (Bedi and Warren, 1988, Balasz et al., 1986, Dobbing,
1981). As the brain is developing it is thought that at this stage it overdevelops by producing more connections and cells than necessary. Unused connections are trimmed according to their level of activity which reflects the principle “use it or lose it” (Shors et al., 2012).
1.4 Male Reproductive Anatomy and Physiology
The reproductive tract of the bull consists of the testes, the secondary sex organs and the accessory sex glands. All the organs work in tandem for the formation, maturation and transportation of sperm. The secondary sex organs include the penis, the epididymis and the vas deferens, the urethra and the accessory glands include the ampullary glands, the seminal vesicles, the prostate gland and the bulbourethral or Cowper’s gland. In the bull
9 only the testes remain external to the body. The penis remains in the body protected by the prepuce until erection.
1.4.1 Testes
The main functions of the testes are the biosynthesis of androgens by the Leydig cells; and sperm production by the seminiferous tubules (Schanbacher, 1982). The testes vary in size, location and shape between species. In the bull, the testicles are located near the sigmoid flexure and are held exterior and perpendicular to the body in the scrotum.
Bovine testes must be kept between 4-5 °C below core body temperature for effective spermatogenesis (Thundathil et al., 2012). If the temperature of the testes drops below this defined temperature, the testes can be pulled closer to the body by the dartos tunic muscle at the bottom of the scrotum and/or by the cremaster muscle within the spermatic chord and vice versa in warm weather.
Each of the testes consists of convoluted seminiferous tubules which are divided into lobes by the septa or trabeculae. Within each lobule, there are between 1 to 4 seminiferous tubules embedded in tissue containing blood vessels, nerves and Leydig cells. The lobules are encapsulated by a layer of connective tissue called the tunica albuginea which itself is covered by a visceral and a parietal layer of tunica vaginalis. The seminiferous tubules consist of three cell types: peritubular myoid (PTM) cells, Sertoli cells and germ cells
(Smith and Walker, 2014). The Sertoli, Leydig and germ cells will be discussed later. The
PTM cells which surround the external wall of the seminiferous tubule in the testes of the bull resemble myofibroblasts and contract to transport sperm through the network of ducts in the testes. Adult bovine testis vary in size depending on breed but typically each testis weighs between 300-400g (Bearden et al., 2004).
10
1.4.2 Secondary Sex Organs
Once sperm are formed in the seminiferous tubules, they must make their way through the rete testis to the epididymis (Figure 1.3). The epididymis is attached to one side of the testicle and is divided into three regions, the caput (head), corpus (body) and cauda (tail).
The epididymis is purported to have four major functions including the transport of sperm from the testes to the vas deferens, the maturation of developing sperm, storage of viable sperm cells and the concentration of sperm by surplus fluid reabsorption (Whittier, 1993).
Immature sperm undergo a period of maturation in the epididymis, which involves the completion of differentiation and attainment of motility, lasting between 10-15 days before passing into the vas deferens.
Figure 1.3: Diagram of the anatomy of the testis of the bull (Hafez and Hafez, 2000)
11
1.4.3 Accessory Glands
The seminal vesicles are lobulated glands that lie laterally to the ends of both the vas deferens (Figure 1.4). The seminal vesicles are comprised of alveoli which are covered with secretory epithelium (Roberts, 2010) and provide approximately 70 % of the fluid volume of the ejaculate. The secretions from the seminal vesicles are composed of fructose, prostaglandins and numerous androgen-dependent secretory proteins that are needed for clotting of the ejaculate and protection of the sperm (Roberts, 2010).
The prostate gland is located at the neck of the bladder where it empties into the urethra.
It consists of lobes that originate from the primitive urethra and these lobes are composed of alveoli; constructed similar to those of the seminal vesicles (Roberts, 2010). It can be divided into two portions; the external portions (corpus prostatae) and the internal portion
(pars disseminate prostatae) (Dellman and Wrobel, 1976). The prostate is poorly developed in the bull and its secretions are low in volume.
The third accessory gland, the Cowper’s glands or bulbourethral glands are small, firm glands located on either side of the urethra. It is believed that one of the chief functions of their secretion is to cleanse the urethra of any residue of urine which might be harmful to sperm (Deutscher, 1980). The clear secretion that often drips from the penis during sexual excitement prior to service is largely produced by these glands (Deutscher, 1980).
12
Figure 1.4: Diagram of the reproductive tract of the bull (Whittier, 1993)
1.4.4 Sertoli Cells
Sertoli cells are somatic cells located in the seminiferous tubules (Tripathi et al., 2014).
Their cytoplasm, which holds the developing germ cells, extends from the lamina propia to the lumen of the seminiferous tubule (Amann and Schanbacher, 1983). Each Sertoli cell is bound together via tight junctions. In the bull in early postnatal life, undifferentiated Sertoli cells form and by approximately 30-40 weeks the adult Sertoli cells are in place (Rawlings et al., 2008). Sertoli cell number is fixed at puberty (Sharpe et al., 2003, Buzzard et al.,
2003) and is determined prior to the formation of the fully functional blood-testis barrier at puberty (Orth, 1993, Bardin et al., 1994) and Sertoli cell number does not change post pubertally. Proliferation of Sertoli cells during the peripubertal period have been linked with an increase in concentrations of LH, testosterone (Amann and Walker, 1983) and FSH
(Allan et al., 2004). Sertoli cells control the communication across the blood-testis barrier which provides a favourable environment for the development of the germ cells to sperm
13
(Amann and Schanbacher, 1983). The most critical role that these cells play is in the hormonal control of spermatogenesis which is induced by FSH. They secrete both inhibin and activin which feedback to the hypothalamus. These cytokines stimulate the Leydig cells to secrete testosterone via an autocrine pathway (Yao et al., 2011). Sertoli cells can also inhibit testosterone synthesis by releasing oestrogen and transforming growth factor-
α, in response to follicle-stimulating hormone (Yao et al., 2011).
1.4.5 Leydig Cells
Leydig cells are large, polyhedral cells with spherical nuclei and are located in the testes adjacent to the seminiferous tubules (Mendis-Handagama and Siril Ariyaratne, 2005).
Leydig cells form from mesenchymal cells and differentiate from fetal to mature Leydig cells (Chamindrani Mendis-Handagama and Siril Ariyaratne, 2001). Fetal Leydig cell number in bull calves declines during the early postnatal period (Hooker, 1970). The initiation of differentiation and maturation of adult Leydig cells in bulls begins around 12 to 16 weeks and lasts until 28 weeks of age (Amann and Schanbacher, 1983). Their main function is in the production of androgenic steroids, such as testosterone, androstenedione and dihydrotestosterone in males as well as oestrogen in the boar (Dellman and Wrobel,
1976). The anterior pituitary’s secretion of LH is critical to sustain the function and structure of the Leydig cells in the postnatal testis. The cytoplasm in Leydig cells contains smooth endoplasmic reticulum, mitochondria and peroxisomes. The metabolism of testosterone takes place in the mitochondria for the first step, which involves the cytochrome P450 enzyme, CYP17A1 (Amann and Schanbacher, 1983) and the second step takes place in the smooth endoplasmic reticulum (van der Molen, 1981).
Testosterone is then secreted by the smooth endoplasmic reticulum of the Leydig cells.
14
1.5 Adipose
Adipose tissue can be categorised into white and brown adipose tissue. White adipose tissue (WAT) can be divided into two classes; visceral adipose tissue (VAT) and subcutaneous adipose tissue (SAT). The SAT can be located around the gluteofemoral region (buttock and thigh). The omental region (deposit near the stomach and spleen and can expand into the ventral abdomen), mesenteric region (deposit is attached in a web- form to the intestine), retroperitoneal region (deposit are found along the dorsal wall of the abdomen and surrounding the kidney), pericardial (a regional fat deposit that surrounds the heart) and surrounding the gonads are all categorised as VAT (Bjorndal et al., 2011). Brown adipose tissue (BAT) is only located above the clavicle (collarbone) and in the subscapular (shoulder blade) region (Bjorndal et al., 2011). Both tissue types have different functions; BAT is critical in the process of transference of energy to heat through thermogenesis mediated by mitochondrial UCP1 (Cannon and Nedergaard,
2004), while WAT holds the energy reserve by storing triacylglycerol during periods of excess and mobilising these stores during periods of deprivation (Gregoire et al., 1998).
However, WAT also plays a major role as an endocrine organ. The function of WAT in metabolic and reproductive processes is complex. However, new reports have been published indicating a new type of recruitable brownish adipocytes named beige adipocytes, which are found among white adipocytes, especially in SAT (Wu et al.,
2012). Beige adipocytes are recruited after a short-term cold experience (Jiang et al.,
2017). They resemble WAT in having extremely low basal expression of UCP1, but like
BAT, they respond to cyclic AMP stimulation with high UCP1 expression and respiration rates (Wu et al., 2012).
15
Adipocytes are acutely sensitive to changes in nutritional status and therefore, are under the regulation of hormones such as insulin (Bjorndal et al., 2011). Hormones such as leptin and adiponectin (AdipoQ) which are secreted from adipocytes within WAT are understood to play a part in the regulation of reproduction. Leptin increases proportionally in line with an increase in body fat and signals energy abundance (Landry et al., 2013) and high AdipoQ levels has been found to negatively affect the reproductive network
(Campos et al., 2008).
There are several cell types that encompass WAT which can be divided into adipocytes and stromal vascular fraction (SVF) which includes: pre-adipocytes, fibroblasts, macrophages and vascular cells (Sorisky et al., 2013). Mesenchymal stem cells (MSC) are pluripotent and have the capacity to differentiate into adipocytes, osteoblast, chondrocytes and myocytes (Lowe et al., 2011). In the correct environment and gene expression signals,
MSC can differentiate into preadipocytes (Scott et al., 2011). There are many signals that influence MSC to form adipocytes, such as extracellular factors including bone morphogenetic proteins (BMP) (Huang et al., 2009), Transforming growth factor β
(TGFβ) (Zamani and Brown, 2011), IGF-I (Kawai and Rosen, 2010), interleukin 17
(IL17) (Zuniga et al., 2010), fibroblast growth factor 1 and 2 (FGF1, FGF2; (Widberg et al., 2009, Xiao et al., 2010), activin (Zaragosi et al., 2010) and WNT and hedgehog (HH)
(Marion et al., 2009). Once preadipocytes are committed to the path of adipocyte differentiation, it is critical for these committed cells to go through a period of growth arrest (Gregoire et al., 1998). The correct environmental gene expression cues are then necessary for post confluent mitosis and clonal expression to take place and the subsequent terminal differentiation into a mature adipocyte (Gregoire et al., 1998).
16
However, it must be noted that different precursors are needed for the development of
WAT and BAT.
Cellular hypertrophy (an increase in cell size) and hyperplasia (an increase in cell number) are both critical for adipose growth. Growth patterns of adipose depend on species, physiological or nutritional factors. Studies in Hereford x Angus and Holstein steers found that by 14 months of age hyperplasia was completed in all but the intermuscular adipose tissue (Hood and Allen, 1973). Nutritional restriction in Friesian bull calves from birth to 95 days of age resulted in a 40 % reduction in growth rate, a 68
% decrease in lipid deposition, a reduction in adipose cell hypertrophy but no effect on adipose cell number (Robelin and Chilliard, 1989). This demonstrates that nutritional restriction in early calf hood negatively effects adipose cell size but not number.
1.6 Metabolic Control of Reproduction
Even though, reproduction is essential for the survival of any species, it can be perturbed, if sufficient energy resources are not available for this energy demanding function (Roa and Tena-Sempere, 2014). There is no doubt that the fulfilment of the reproductive function, including oestrous cycle, pregnancy, milk production and nourishment of offspring is far more energy demanding for the female than the fulfilment of the reproductive function for the male. However, premating interactions such as searching for females in oestrus, fighting for territory and dominance over other males, and repeated copulations are energy consuming for the male. Energy costs of mating could be considerable, particularly during the breeding season for males of wild species, as reflected by a decline in time spent feeding resulting in weight loss. The reproductive axis has the ability to respond to shifting metabolic concentrations caused by restricted growth and body weight gain (Hill et al., 2008). This response is evident for not only the
17 deprivation of energy stores but also for consistent energy surpluses, such as obesity (Roa and Tena-Sempere, 2014).
Nutritional restriction during the postnatal period has the biggest impact on the timing of reproductive maturity by inhibiting GnRH release and therefore the release of LH (Day et al., 1986). Malnutrition constitutes a greater stress to spermatogenesis in prepubertal males than in post pubertal males (Brito et al., 2007b). Restricted feed during calf hood has been shown to impede the hypothalamic GnRH pulse generator and through its interaction with the anterior pituitary gland, impair steroidogenesis in the testes, delay puberty and decrease testicular weight at 70 weeks of age (Brito et al., 2007a). Studies have shown that a high plane of nutrition before 31 weeks of age leads to an earlier onset of puberty in Holstein-Friesian bulls (Dance et al., 2015, Byrne et al., 2017b). However, restricted feed during the prepubertal period (prior to 26 weeks) affects the early gonadotropin rise (which begins between 10-12 weeks) and age at which bulls reach puberty, regardless of the plane of nutrition fed from 27 weeks to 70 weeks of age (Brito et al., 2007a). There was a greater testosterone concentration at 16 weeks of age in
Holstein Friesian bulls on a high diet pre-six months which coincided with increase in scrotal circumference growth in these bulls (Byrne et al., 2017b). Holstein bulls fed a low, medium and high diet from 1 to 80 weeks of age reached puberty at 57, 49 and 43 weeks of age, respectively (Bratton et al., 1956).
1.7 Spermatogenesis
Spermatogenesis comprises of a series of cellular divisions and differentiations that result in a haploid male germ cell. The three stages of spermatogenesis are spermatocytogenesis, meiosis and spermiogenesis (Figure 1.5) and combined have a duration of approximately
18
61 days in the bull (Amann and Schanbacher, 1983, Amann, 1983). These stages take approximately 21, 23 and 17 days, respectively (Johnson et al., 2000).
Proliferation of the spermatogonia is carried out via mitosis. During the 21 days of spermatocytogenesis, spermatogonia A undergo mitotic divisions to produce intermediate
(In), spermatogonia B (Johnson et al., 2000). Tight junctions form behind the cells and the junctions relax in front of them so that they can progress through the compartments and not compromise the integrity of the blood-testes barrier (Figure 1.6). For the next 23 days, the primary leptotene spermatocytes go through stages of meiosis differentiating through zygotene (Z), pachytene (P) and diplotene (D) before going through the first meiotic division to form secondary spermatocytes (Johnson et al., 2000). In the final stage, spermiogenesis, which takes 17 days in the bull, the secondary spermatocytes go through a second meiotic division to produce spermatids. Spermatids mature into round spermatids and then progress onto long spermatids. Finally, long spermatids begin to develop flagella and acrosomes which denote them as mature sperm (Bagu et al., 2006,
Curtis and Amann, 1981, Wrobel, 2000, Rawlings et al., 2008, Abdel-Raouf, 1960).
19
Figure 1.5: Stages of spermatogenesis. The letters indicate the developmental step, and the numbers associated with each germ cell step indicate the developmental age of each cell type in the middle of each spermatogenic stage. A spermatogonia (A), intermediate
(In), B spermatogonia (B), leptotene primary spermatocytes (L), zygotene (Z), pachytene
(P), diplotene (D), secondary spermatocytes (SS), spermatids type Sa (Sa), spermatids type Sb1 (Sb1), spermatids type Sb2 (Sb2), spermatids type Sc (Sc), spermatids type Sd1
(Sd1), sperm (Sd2) (Johnson et al., 2000)
20
Figure 1.6: Illustration of the seminiferous tubule showing the development of the germ cells and relationship to the adjacent Sertoli cells (Amann and Schanbacher, 1983)
1.8 Puberty
There are a series of changes in the reproductive system from the new-born and infantile stage, to the eventual onset of puberty and the movement into adulthood (Fink, 2000,
Tena-Sempere and Huhtaniemi, 2003). The definition of puberty is defined as the age that a bull first produces an ejaculate yielding at least 50 x 106 spermatozoa with a minimum of 10% motility (Wolf et al., 1965).
21
As the spermatogonia progress and mature they move out from the basal membrane, towards the lumen of the tubule. Once the spermatogonia enter the adluminal compartment, spermatogonia B develop into leptotene primary spermatocytes at approximately 20 weeks of age (Abdel-Raouf, 1960, Curtis and Amann, 1981, Bagu et al.,
2006). In Holstein bulls, the spermatogonia stage of development predominates at approximately 16 weeks (Evans et al., 1996) and primary spermatogonia increase in concentration up until 44 weeks (Abdel-Raouf, 1960). Secondary spermatocytes numbers increase between 20-30 weeks of age (Abdel-Raouf, 1960, Curtis and Amann, 1981, Bagu et al., 2006). Primordial germ cells also known as gonocytes, the precursors of sperm can be found from birth up to approximately 30 weeks of age in the basal compartment of the seminiferous tubules (Bagu et al., 2006, Curtis and Amann, 1981, Wrobel, 2000,
Rawlings et al., 2008). In the final stage, the secondary spermatocytes mature into round spermatids which look like typical cells from 25-30 weeks of age and then progress onto long spermatids. Long spermatids begin to develop flagella and acrosomes which denote them as mature spermatozoa or sperm between 32 and 40 weeks of age (Abdel-Raouf,
1960, Curtis and Amann, 1981, Bagu et al., 2006).
Breeds differ in age and body weight at puberty. It is known that dairy bulls such as
Holstein bulls reach puberty earlier than beef breeds such as Aberdeen Angus and considerably earlier than Charolais (Jainudeen and Hafez, 2000). Crossbred beef animals reach puberty at an earlier age than purebred equivalents (Jainudeen and Hafez, 2000).
Well-fed Holstein bulls achieved puberty at a mean age of 39 to 41 week (Amann, 1983).
Holstein-Friesian bulls on a high diet pre-six months reached puberty approximately 30 days earlier than bulls on a low diet (283 ± 5.6 vs. 323 ± 6.5 days of age), respectively
(Byrne et al., 2017b).
22
1.9 Physiological Mechanisms controlling Pubertal Development
There are a number of key pathways that aid in the regulation of development of the reproductive axis. Some of the hormones involved will be discussed below.
1.9.1 Gonadotropin Releasing Hormone
Gonadotropin-releasing hormone is a vital peptide that mediates the neural control of reproductive physiology and fertility (Cohen-Tannoudji et al., 2012, Constantin, 2011,
Anjum et al., 2012). The structure of GnRH consists of a linear sequence of pyroGlu-His-
Trp-Ser-Tyr-Gly-Leu-Agr-Pro-Gly-amide (Schally et al., 1971), which is common across mammalian species (Schally et al., 1971, Conn et al., 1987); however, differences in this structure has being found in non-mammalian species such as the lamprey, chicken and salmon (Sherwood et al., 1986). Across the vertebrate species there are currently 23 identified GnRH analogues (Millar, 2005).
The main role of GnRH is in the modulation of the neuroendocrine control of the reproductive system by means of an episodic, pulsatile secretion stimulated by the hypothalamus; known as the “hypothalamic GnRH pulse-generator” (Chu et al., 2012).
From the hypothalamus, GnRH travels via neurons down the infundibulum to the anterior pituitary where it stimulates the synthesis and release of the gonadotropins, FSH and LH; these hormones act on the Sertoli and Leydig cells, respectively, to stimulate spermatogenesis and androgen production (Filby et al., 2008, Cohen-Tannoudji et al.,
2012).
The secretion of GnRH in bull calves is minimal in the juvenile period, however, pulsatile secretion begins at approximately 2 weeks of age, as shown when analysing blood from the hypophyseal portal system (Rodriguez and Wise, 1989).
23
1.9.2 Luteinising Hormone and Follicle Stimulating Hormone
The hormone GnRH binds to its receptor (GnRHR) on the surface of gonadotrophic cells within the anterior pituitary; which results in the production and secretion of LH and FSH
(Wolfe et al., 2014). Both hormones comprise of a mutual α subunit and a unique β subunit (Morgan et al., 1975). The β subunits give LH and FSH their functions.
Receptors on Leydig cells are bound by LH to stimulate androgen secretion (Jin and
Yang, 2014) and to activate adenyl cyclase. This enzyme catalyses the conversion of adenosine triphosphate (ATP) to cyclic adenosine monophosphate (cAMP), which serves as a secondary messenger to activate a cytoplasmic protein kinase which aids in the conversion of cholesterol to testosterone (Neaves, 1975). The discharge of LH is not continuous but occurs in pulses, that occur three to eight times throughout the day
(Amann and Schanbacher, 1983). In bull calves, during birth and 6 weeks of age, mean serum LH concentrations are low (Aravindakshan et al., 2000) at a concentration of approximately 0.1 ng/mL (Evans et al., 1996). There is a transient rise of LH which occurs between 8 and 20 weeks of age, with a peak at 12-15 weeks (0.8 ng/mL; Evans et al.,1996) , declines between 20 and 24 weeks of age and reaches a nadir between 25 and
35 weeks of age (Evans et al., 1996; Figure 1.7) . Subsequently, LH concentrations rise coinciding with puberty at approximately 42 weeks (Evans et al., 1996). The LH pulses are at a high frequency after 4 weeks of age and lead to differentiation and maturation of adult Leydig cells and a switch from androstenedione to testosterone secretion around 12 to 16 weeks of age, which gradually reaches peak testosterone concentration at approximately 42 weeks (Amann, 1983).
24
The FSH binds to its receptor on Sertoli cells to stimulate spermatogenesis. In the male,
FSH is required early in life for the determination of Sertoli cell number, and for induction and maintenance of normal sperm production post puberty (Simoni et al., 1999).
FSH levels are elevated postnatally and decrease to 25 weeks where they remain constant and begin to rise again after 40 weeks (Evans et al., 1995, Evans et al., 1996). However, another study has found a postnatal decline between 12-20 weeks of age and unchanging concentrations of FSH prepuberty (Bagu et al., 2006).
Weeks of age
Figure 1.7: Mean (± s.e.m.) concentrations of luteinising hormone (LH) and follicle stimulating hormone (FSH) in blood samples collected from young Hereford x Charolais bulls (Evans et al., 1996)
1.9.3 Testosterone
Testosterone is an androgenic steroid secreted by the smooth endoplasmic reticulum of the Leydig cells and is largely known for its role in the development of sex organs as well
25 as sexual maturation (Powers and Florini, 1975, Kasperk et al., 1989, Toppari and
Skakkebaek, 1998, Bhasin, 2000).
The metabolism of testosterone is a multi-step process stimulated by LH (Figure 1.8).
The first step takes place in the mitochondria and comprises of the formation of pregnenolone; which involves the cytochrome P450 enzyme, CYP17A1 (Amann and
Schanbacher, 1983). In a series of reactions, pregnenolone is converted to testosterone via either delta-4 (Δ-4) or delta-5 (Δ-5) pathway in the smooth endoplasmic reticulum (van der Molen, 1981). The Δ-4 pathway produces testosterone via the intermediates 17-alpha- hydroxypregnelonone, dehydroepiandrosterone and 4-androstene-3,17-dione (Yamazaki and Shimada, 1997). In the alternative pathway Δ-5, pregnenolone is catalysed by P450 enzyme CYP17A1 to produce testosterone via the intermediates progesterone, 17-alpha- hydroxyprogesterone and 4-androstene-3,17-dione (Rose et al., 1997).
Testosterone and oestrogen are carried in the blood bound to Sex Hormone Binding
Globulin (SHBG). In a healthy functioning adult, only a small concentration of the hormone is free in the blood to bind with the androgen receptor (Maruyama et al., 1987).
A decrease in SHBG binding capacity results in lower testosterone levels (Caminos et al.,
2008, Isidori et al., 1999, Caprio et al., 2003, Giagulli et al., 1994).
26
Figure 1.8: Scheme of testosterone metabolism (Durdiakova et al., 2011)
Testosterone is secreted in pulses; the timing and pattern of which are specific to each individual animal and are affected by age, reproductive status, health and external and environmental factors (Schanbacher and Ford, 1977). An early transient rise in serum LH concentrations occurs during 8 to 20 weeks of age (Evans et al., 1996) and concomitantly mean testosterone concentrations are low; however, testosterone increases markedly after
28 weeks of age and reaches adult concentrations (peak concentration: 9 ng/mL) by approximately 40 weeks of age (Amann and Walker, 1983; Evans et al., 1996; Figure
1.9). The increase of testosterone concentrations observed in bulls (Figure 1.9) coincides with a decrease in LH and FSH secretion at the same time-points (Rawlings and Evans,
1995) where androgens were shown to have a negative feedback on gonadotrophin release in bulls.
27
Figure 1.9: Mean (±s.e.m) of Testosterone concentration in young Hereford x Charolais bulls (Evans et al., 1996)
The pituitary of rams exposed to excess testosterone during their prenatal development had increased sensitivity to GnRH and therefore, increased LH secretion (Recabarren et al., 2013). However, in the same animals there was a decrease in testicular sensitivity to
LH secretion and consequently, no change in testosterone production. This manifested in a reduction in sperm concentration and motility as well as scrotal circumference
(Recabarren et al., 2008) and an increase in the number of Sertoli cells and FSHR (follicle stimulating hormone receptor)(Rojas-Garcia et al., 2010). There is no clear explanation for this response; however, one possibility is that the LH secreted in reaction to the GnRH stimulus may be a different isoform as was the case in females (Perera-Marin et al., 2007,
Olivares et al., 2009). Another contributory factor may be the reduction in LHR expression in testosterone exposed males.
1.9.4 Kisspeptin (KISS1) and G Protein – Coupled Receptor (GPR54) System
Kisspeptin otherwise known as metastin is an excitatory neuropeptide that stimulates the release of gonadotropins in numerous species including cattle (Messager et al., 2005).
Kisspeptin has a long chain 54 amino acid (Kp54) and can be cleaved into three short kisspeptins (Kp10, Kp13, Kp14); which are all biologically active and have a high affinity
28 ligand for G protein-coupled receptor 54 (GPR54) (Muir et al., 2001, Kotani et al., 2001,
Ohtaki et al., 2001, Clements et al., 2001). KISS1 neurons are found in the ARC and the preoptic nucleus of cattle (Hassaneen et al., 2016). The KISS1 neurons in the ARC are co- expressed with two other neuropeptides, neurokinin B (NKB) and dynorphin A (Dyn) which are collectively known as Kisspeptin, Neurokinin B and dynorphin A neurons
(KNDy) neurons (Navarro et al., 2009, Hassaneen et al., 2016). Studies have shown that
KNDy neurons control the KISS1 fibres in the median eminence that make direct contact with GnRH nerve terminals and control the release of GnRH in cattle (Hassaneen et al.,
2016). A decrease in KISS1 neurotransmission is thought to add to the age-related LH surge abnormalities (Lederman et al., 2010). Studies conducted in a variety of species and in both sexes e.g. male rats, ewes and men showed that administering of KISS1 centrally, by the ventricles in the brain or via the circulatory system led to an increase in both LH and FSH in peripheral circulation. KISS1 neurons relay metabolic status via its receptor
GPR54 on the GnRH neurons (Castellano et al., 2010, Kalamatianos et al., 2008,
Quennell et al., 2011, Wahab et al., 2011). Approximately 40% of kisspeptin neurons present in the mouse ARC were shown to express the active leptin receptor (Ob-Rb) mRNA, demonstrating that KISS1 neurons are direct targets for regulation by leptin
(Smith et al., 2006). Administration of IGF-I activates the KISS1 gene in the anteroventral periventricular and ARC of the hypothalamus in prepubertal female rats
(Hiney et al., 2009). Studies also have shown that KISS1 stimulates the secretion of GH from prepubertal Holstein heifers (Kadokawa et al., 2008).
It has been shown that GPR54 is essential for LH and FSH secretion to stimulate the onset of puberty (Seminara et al., 2003) and is located mainly in the hypothalamus and basal ganglia but also in the placenta, pituitary, spinal cord, pancreas, heart, muscle, kidney,
29 liver, intestines, thymus, lung and testis (Lee et al., 1999, Muir et al., 2001, Stafford et al.,
2002). There is a major cluster of GPR54 mRNA in the ARC, the lateral hypothalamic area and the dorsomedial nucleus in the rat (Lee et al., 1999).
1.9.5 Gonadotropin-Inhibitory Hormone (GnIH)
This hormone was first shown to inhibit GnRH in quails (Tsutsui et al., 2000). It has since being shown to exist in many avian and mammal species and regulates the synthesis and secretion of GnRH via GPR147 (Tsutsui, 2009, Tsutsui et al., 2010a, Tsutsui et al.,
2010b). The hormone GnIH and RF-amide related peptides (RFRPs) have been characterised in brain tissue of various mammals (Ukena et al., 2002, Ubuka et al., 2009,
Yoshida et al., 2003, Fukusumi et al., 2001). The importance of GnIH was demonstrated by the administration of GnIH and RF-amide related peptide-3 (RFRP-3) centrally and peripherally which inhibited LH secretion in both sexes of adult hamsters (Kriegsfeld et al., 2006), male adult rats (Johnson et al., 2007, Murakami et al., 2008) and adult ewes
(Clarke et al., 2008). It has been reported that GnIH immunostaining was increased in
Leydig cells in mice during the pubertal period and in sperm post puberty, which suggests a role in the regulation of steroid synthesis in the testes and in sperm maturation (Anjum et al., 2012). It may also be involved in the regulation of germ cell differentiation in the testes as GnIH has been shown to be expressed in spermatocytes and spermatids (Bentley et al., 2008).
1.9.6 Inhibin and Activin
Inhibin B is a glycoprotein that is synthesised in the Sertoli cells and its target is the gonadotrophic cells in the anterior pituitary, where it functions as a negative feedback regulator of FSH in bulls (Kaneko et al., 2001). The production of inhibin from the testes peaks at or before puberty and declines to adult levels; it is suggested that this is due to
30 the establishment of Sertoli cell number (Kaneko et al., 2001, Matsuzaki et al., 2001).
Also at puberty, the ram pituitary gland has sensitivity to feedback from inhibin (Tilbrook et al., 1999). Activin A is a member of the TGFβ family and its role is to stimulate the synthesis of FSH by the gonadotrophic cells and therefore, regulate spermatogenesis
(Hedger and Winnall, 2012). It has been found that activin A regulates spermatogenic cell and Sertoli cell proliferation and differentiation in the fetal and post-natal testes (Itman et al., 2006).
1.10 Nutritional Influences on Puberty through Metabolic Signalling Peptides and Metabolic Hormones
Metabolic signalling molecules mediate the secretion of GnRH by altering the afferent inputs to the GnRH neurons (Amstalden et al., 2014). Some of these peptides and hormones will be discussed below.
1.10.1 Neuropeptide Y (NPY) and Agouti-related Protein (AGRP)
Neuropeptide Y (NPY) is located on chromosome four in cattle (Thue and Buchanan,
2004) and codes for a strong orexigenic (appetite stimulator) and highly conserved peptide consisting of 36 amino acids (Bahar and Sweeney, 2008). Several biological pathways that regulate feeding behaviour, appetite and energy homeostasis in animals and humans are influenced by NPY (Tatemoto et al., 1982, Wynne et al., 2005, Arora and
Anubhuti, 2006, White, 1993). It also promotes the secretion of growth hormone in cattle
(Thomas et al., 1999), a rise in leptin expression in sheep (Chilliard et al., 2001) and the reduction in fatty acid secretion in adipocytes (Bradley et al., 2005). In bulls, NPY has been found to be abundant in the ARC and the cerebral and cerebellar regions of the brain, whereas, subcutaneous adipose tissue and small intestine have lower amounts
(Bahar and Sweeney, 2008). There was an increase in NPY expression (McShane et al.,
1992) along with NPY immunoreactivity (Chaillou et al., 2002) in the ARC of sheep that
31 were on restricted diets. In the prenatal stage of life, NPY is the dominant signal in stimulating positive energy balance to promote growth; however, in later development,
NPY levels decrease and melanocortin levels increase (Roth and Sathyanarayana, 2012).
This indicates that it works as a “developmental switch” in the monitoring of energy metabolism (Melnick et al., 2007). Studies have shown AGRP is composed of approximately 132 amino acids and is co-expressed with NPY in neurons found in the
ARC (Hahn et al., 1998). It has been shown that AGRP is not as potent as NPY; however, its effects last longer (Hagan et al., 2000). It has been reported that NPY act directly on
GnRH neurons and this may also be the case for AGRP as melanocortin agonists have direct action on GnRH neurons (Roa and Herbison, 2012). It has been reported that NPY has been linked to the mediation of leptin (Amstalden et al., 2000) as the administration of
NPY stimulated appetite, via the inhibition of leptin (Barb et al., 2006). The maintenance of high levels of NPY suppresses pubertal development in heifers (Amstalden et al.,
2014). Leptin receptor mRNA and NPY neurons are colocalised in the ARC of ewes
(Williams et al., 1999). Low leptin levels stimulate NPY and AGRP release, feed intake and inhibit POMC and Cocaine and amphetamine regulated transcript (CART) activity and energy expenditure (Schwartz et al., 2000).
1.10.2 Pro-opiomelanocortin (POMC) and Alpha melanocortin stimulating hormone (α-MSH)
Alpha melanocortin stimulating hormone (α-MSH) is a hormone formed following post transcriptional cleavage of the hypothalamic POMC. Food intake can be inhibited by α-
MSH via the activation of melanocortin-4-receptor (MC4R) (McMinn et al., 2000). The
POMC neurons are primarily located in the ARC and are colocalised with AGRP, a
POMC and α-MSH antagonist and leptin receptor (Ob-R) neurons (Hahn et al., 1998).
32
NPY/AGRP have opposing roles to that of POMC/ α-MSH in the control of feeding and energy expenditure (Stanley et al., 2005).
1.10.3 Ghrelin
Ghrelin is a 28 amino-acid peptide which is secreted mainly from the fundic region of the stomach (Valassi et al., 2008; Figure 1.10). As well as being an orexigenic peptide, ghrelin also controls growth hormone, adrenocorticotropic hormone and prolactin secretion, metabolism function, heart function, sleep and reproduction (Valassi et al.,
2008). Circulating ghrelin concentration decreases after food intake and when levels of nutrients such as glucose increase (Tschop et al., 2000, Sakata et al., 2002). It has been reported that ghrelin decreases in both plasma and gastric fluid after consumption of both fat and carbohydrate, however, carbohydrates suppress ghrelin expression longer than fat
(Sanchez et al., 2004). Ghrelin receptor (GHS-R1a) has been shown to be located on the
NPY and GHRH neurons in the hypothalamus (Lucidi et al., 2005). In the anterior pituitary, ghrelin has been found to inhibit LH pulse frequency in rams (Harrison et al.,
2008) and men (Lanfranco et al., 2008). Ghrelin has been shown to down regulate KISS1 expression in the medial preoptic area (Forbes et al., 2009), which delays pubertal onset in male rats (Fernandez-Fernandez et al., 2005).
33
Figure 1.10: Schematic representation of the effect of ghrelin on the hypothalamic- pituitary-gonadal axis (Dupont et al., 2010)
1.10.4 Leptin
Leptin is a 167 amino acid hormone product of the ob gene and is secreted by white adipose tissue (Williams et al., 2002). Although it is prominent in adipocytes it is also found in lesser intensities in other sites which are species-specific (Ingvartsen and
Boisclair, 2001), such as rat gastric epithelium (Bado et al., 1998), human placenta
(Masuzaki et al., 1997) and chicken liver (Taouis et al., 1998). It functions via endocrine, paracrine and autocrine means in homeostasis, metabolism, immune function and reproduction (Williams et al., 2002). Leptin production increases proportionally in line with an increase in WAT (Landry et al., 2013); evidently then, it is a signal of energy sufficiency (Sanchez-Garrido and Tena-Sempere, 2013). It signals energy abundance by
34 informing the different bodily systems including the reproductive axis of the status of energy reserves the body has via circulating leptin levels (Ahima et al., 2000).
Leptin is essential for the onset of puberty; however, leptin alone cannot activate puberty
(Barash et al., 1996, Castellano et al., 2009, Cheung et al., 1997, Roa and Tena-Sempere,
2010). Leptin has been shown to increase LH secretion in the anterior pituitary and to increase GnRH in the hypothalamus of the pig (Barb et al., 2004). Although it may seem counterintuitive, high levels of leptin associated with obesity directly inhibit gonadal development via sex steroid secretion (Tena-Sempere et al., 1999, Caprio et al., 2001).
The normalization of body weight in ob/ob male mice due to leptin treatment has the ability to reverse the effects of overeating and body weight gain and to re-establish reproductive development (Chehab et al., 1996, Mounzih et al., 1997, Farooqi et al.,
1999). The decrease in LH from rats that were fasting for 48 h was prevented by leptin treatment. This effect was also recorded in underfed, post pubertal sheep (Morrison et al.,
2002). In humans, males exhibit a rise in leptin secretion during approximately 5-10 years of age followed by a steady decline (Tena-Sempere and Barreiro, 2002). Inherited leptin deficiency causes early onset of obesity, hyperphagia (abnormally increased appetite), hypogonadotropic hypogonadism (decreased functionality of the testes due to a GnRH deficiency) and delayed onset of puberty (Strobel et al., 1998, Ozata et al., 1999, Clement et al., 1998). Numerous studies on the effect of high and low plane of nutrition in bulls prior to six months of age found no difference in blood leptin concentration (Dance et al.,
2015, Brito et al., 2007c, Byrne et al., 2017c); however, plasma leptin concentration was found to be higher during the pre-pubertal period (6-7 months of age) in comparison to during puberty and post-puberty in Holstein bulls (Gholami et al., 2010). It has been
35 reported in ruminants that severe undernutrition is needed for leptin to influence gonadotrophin secretion (Zieba et al., 2005)
Leptin receptors (Ob-R) play the role of mediator of the biological effects of leptin
(Abavisani et al., 2011). There are many different isoforms of leptin receptor; one isoform
Ob-Rb is expressed principally in the ventromedial nuclei, ventral premammilliary nuclei and the ARC in the rodent brain (Guan et al., 1997, Mercer et al., 1996). The effect of leptin on food intake and energy homeostasis are mediated by a system of orexigenic neuropeptides including NPY, galanin, galanin-like peptide, melanin-concentrating hormone and AgRP and anorexigenic neuropeptides such as CRH, POMC, α-MSH and
CART (Ingvartsen and Boisclair, 2001). Approximately 60% of cells containing NPY also expressed leptin receptor (Ob-Rb) in the sheep hypothalamus (Iqbal et al., 2001).
1.10.5 Adiponectin (AdipoQ)
Adiponectin is an adipokine which predominantly secreted by adipocytes (Arita et al.,
1999). Its function is to regulate lipid and glucose metabolism, insulin sensitivity as well as inflammation (Kadowaki et al., 2006, Ahima and Lazar, 2008, Galic et al., 2010). The protein decreases in cases of insulin resistance, diabetes, atherosclerosis and coronary artery disease (Kawano and Arora, 2009). Plasma adiponectin concentrations are inversely correlated with the adipose tissue reservoir (Yamauchi et al., 2014). It has been reported that concentrations of adiponectin in the plasma were significantly lower in males than those in females in humans and rodents; which may be due to oestradiol and testosterone regulation of the plasma adiponectin concentration (Nishizawa et al., 2002).
Both ADIPOR1 and ADIPOR2, receptors of AdipoQ, are expressed in the anterior pituitary and the ARC in the hypothalamus of cows (Tabandeh et al., 2011). Feeding inhibits AdipoQ expression in WAT and therefore, inhibits adiponectin serum
36 concentration (Steinberg and Kemp, 2007). AdipoQ has been found to inhibit the secretion of GnRH via the inhibition of KISS1 and also can bypass this network and inhibit LH secretion directly (Wen et al., 2008). It has also been found in sperm along with its receptors, ADIPOR1 and ADIPOR2 in rams (Kadivar et al., 2016). Studies by the same group have found that serum adiponectin concentration, sperm AdipoQ and its receptors mRNA abundances were correlated with fertility (sperm structure, function and capacitation and steroidogenesis) in Holstein Friesian bulls (Kasimanickam et al., 2013).
1.10.6 Insulin / Insulin like growth factor 1 (IGF-I)
Insulin like growth factor, formally known as Somatomedin C, is a small peptide produced mainly in the liver but also in the hypothalamus (Noguchi et al., 1987, Daftary and Gore, 2003), which is similar to insulin both in structure and function. It plays a role in signalling the metabolic status to the GnRH pulse generator (Brito, 2006). In rats, the administration of IGF-I caused an increase in GnRH and LH secretion (Hiney et al.,
2004). Dairy bulls on a high level of nutrition from birth had an increased concentration of IGF-I at an earlier life stage than those fed a low plane of nutrition (Dance et al., 2014,
Byrne et al., 2017c). This result was also observed in beef bulls (Brito et al., 2007c, Brito et al., 2007b, Brito et al., 2007a). There is a relationship between IGF-I concentrations,
LH concentrations and testicular LH receptor number, which highlights the role of IGF-I in the regulation of the early gonadotropin rise and reproductive development (Dance et al., 2014). The concentration of GH was reduced with increased IGF-I during the sexual development in bulls (Brito, 2006). It appears that IGF-I is a mediator of the effect of nutrition on reproduction via the Hypothalamic-Pituitary-Testicular (HPT) axis (Brito et al., 2007b). IGF-I signals nutritional status to the hypothalamus via receptors in the NPY and POMC nuclei of the arcuate (Amstalden et al., 2014). Receptors for IGF-1 have also been found in the pre-optic area of the hypothalamus, suggesting a stimulatory role in
37
GnRH secretion (Daftary and Gore, 2003). Systemic IGF-I is produced in the liver as a consequence of GH binding to its specific receptors on the surface of the hepatocytes
(Breier et al., 1988). However, in nutritionally restricted animals, the liver becomes unaffected by the influence of GH which results in lower concentrations in IGF-I and greater concentrations of GH due to hypothalamic implementation of negative feedback on GnRH (Breier and Gluckman, 1991). There are six insulin-like growth factor binding proteins that regulate IGF-I activity by controlling the availability of IGF-I to their receptors (Clemmons, 2016).
Insulin is a polypeptide hormone produced by the β cells in the islets of Langerhans in the pancreas (Loomis et al., 1983, Squires, 2003). Insulin is a metabolically active hormone responsible for anabolic processes promoting growth, development, and nutrient homeostasis (Taniguchi et al., 2006, Cheng et al., 2010). Insulin regulates blood glucose concentrations by increasing the uptake of glucose into tissues to be stored as glycogen or lipid. Insulin acts as a metabolic signal that influences the release of GnRH from the hypothalamus. Insulin has been shown to act on hypothalamic neurons that express NPY and AGRP, as well as those expressing POMC (Könner et al., 2007). Peripheral insulin administration supresses the release of NPY in the paraventricular nucleus in rats (Sahu et al., 1995) and central administration decreases both NPY expression and NPY concentrations in the hypothalamus. Insulin plays a role in regulating the synthesis and secretion of leptin as WAT cultured with insulin increased the synthesis and secretion of leptin (Barr et al., 1997). However, leptin negatively affects the synthesis and secretion of insulin (Fehmann et al., 1997).
1.11 Evolution of Technologies used to study Transcriptomics
First developed in 1983 by Karl Mullis, polymerase chain reaction (PCR) allows the exponential amplification of fragments of DNA. This technique formed the cornerstone of
38 the human genome project and its fundamental to many molecular biology laboratory protocols (Mullis et al., 1986, Powledge, 2004, Saiki et al., 1985, Valasek and Repa,
2005, Whitney et al., 2004). Further discoveries were made to improve PCR and this led to the development of the next generation PCR, real-time PCR (RT-PCR) in 1996. This methodology enables the amplification and subsequent detection and quantification of one or more specific sequences in a DNA sample (Valasek and Repa, 2005, Kubista et al.,
2006). The fundamental difference between the two technologies was that PCR detects the DNA at the endpoint of the reaction, while RT-PCR allowed detection as the reaction progressed in real time.
In 1995, the first report on application of DNA microarrays to analyse gene expression was published (Brown et al., 1995). A microarray is a 2D array consisting of a collection of thousands of micro spots, each containing a specific RNA or DNA sequences, which are attached to a small glass or silicon slide (Gabig and Wegrzyn, 2001, Kapranov et al.,
2003). Microarrays can be used to measure DNA, through comparative genome hybridisation or RNA, via expression profiling using complimentary deoxyribonucleic acid (cDNA) as the template (Hegde et al., 2000, Schena et al., 1995). Microarrays can be broadly divided into two main types based on the nature of the probe attached to the array surface, cDNA arrays and oligonucleotide arrays (Hegde et al., 2000, Schena et al., 1995).
Two colour or cDNA microarrays are less commonly used nowadays due to gene bias and poor labelling efficiency (Rosenzweig et al., 2004). In contrast to cDNA arrays, oligonucleotide arrays or single-channel microarrays are hybridised with only one sample
(Jaluria et al., 2007), thus to obtain data of differential expression between test and control samples, two separate hybridisations, one for each chip, have to be performed. Like RT-
39 qPCR, microarrays provide us with a plethora of uses in the fields of basic biological sciences, translation medicine and diagnostics.
The RNA sequencing (RNASeq) approach to transcriptome profiling uses deep- sequencing technologies and has thus far revolutionised our view of the extent and complexity of the transcriptome (Wang et al., 2009b). RNASeq offers many novel advantages over earlier technologies, such as the identification of alternative splicing. It is not limited to detecting transcripts and also sequence variation on bases can be easily revealed (Oshlack and Wakefield, 2009). The main advantage of RNASeq is that the expression of thousands of genes can be detected simultaneously and reveal differentially expressed genes that may not be expected; whereas using RT-PCR, specific genes must be selected and analysed separately.
However, a change in gene expression in a given gene does not automatically mean that there is a change in the protein expression. Proteins carry out work in the cell, while mRNA is only a vehicle that transfers genetic information from the gene to be translated into a protein. Therefore, immunohistochemistry is an important tool that can be used to validate gene expression data outputted by techniquessuch as RT-PCR and RNASeq.
Immunohistochemistry (IHC) is the application of monoclonal or polyclonal antibodies to detect and quantify specific antigens in tissue sections (Duraiyan et al., 2012).
1.12 Rationale for this Thesis
Research recently carried out by our research group found bulls offered a high plane of nutrition pre-six months were younger at puberty and sexual maturation (Byrne et al.,
2017b). Effects of dietary restriction in early life cannot be mitigated by enhancing dietary intake post six-months of age nor will post six-month dietary restriction reduce the
40
advantages obtained from a high pre six-month diet. This therefore affects the transient
rise of LH which occurs between 8 and 20 weeks of age (Evans et al., 1996). Our
rationale was that sacrificing bull calves on two divergent planes of nutrition at 18 weeks
of age, which is still within the (arbitrary) 8-20 week window of influence, allowed the
animals’ sufficient time to express their respective growth performance potential. This
allowed us the opportunity to characterise the response of the HPT axis at a point in time
within this relevant window. Our hypothesis was that early calf nutrition would positively
impact the transcriptome of the HPT axis. This thesis will investigate holistically the
effect of early life enhanced nutritional status of bull calves on the molecular functionality
of the HPT axis. Data from this study will enable us to identify the key genes controlling
early development of the HPT axis. Ultimately, the results of this work, following
appropriate validation, will facilitate the targeting of genes and variants which could be
harnessed within the context of a genomic breeding programme.
1.13 Objectives
The objectives of this thesis were:
1. To understand the effect of early calf nutrition on the transcriptome of subcutaneous
adipose tissue and their downstream effects on the HPT axis.
2. To characterise the physiological, cellular and transcriptional response of the HPT axis to
contrasting planes of nutrition during early calf-hood in Holstein Friesian bulls.
3. To describe key pathways in the HPT axis which are under nutritional control.
41
CHAPTER 2: Role of Early Life Nutrition on Regulating the Hypothalamic-Anterior Pituitary–Testicular Axis of the Bull
English, A.M., Kenny, D.A., Byrne, C.J., Sauerwein, H., Urh, C., Crowe, M.A., Staub, C., Waters, S.M., Fair, S. “Role of early life nutrition on regulating the hypothalamic- anterior pituitary–testicular axis of the bull”, Reproduction (Submitted).
42
2.1 Abstract
The objective of this study was to examine the effect of nutrition during the first 18 weeks of life on the physiological and transcriptional functionality of the hypothalamic (ARC region), anterior pituitary and testes in Holstein Friesian bull calves. Holstein Friesian bull calves with a mean (±S.D.) age and bodyweight of 19 (±8.2) days and 47.5 (±5.3) kg, respectively, were assigned to either a high (n=10) or low (n=10) plane of nutrition. At 126±1.1 days of age, the calves were euthanized. Animal performance and systemic concentrations of metabolic and reproductive hormones were assessed. Testicular histology, targeted gene and protein expression of the ARC, anterior pituitary and testes were also assessed using qPCR and immunohistochemistry, respectively. Testicular tissue from post pubertal 19 month old
Holstein Friesian bulls (n=10) that were reared under similar conditions was also available for comparative gene expression analysis. The metabolites and metabolic hormones generally reflected the improved metabolic status of the calves on the high plane of nutrition (P<0.001).
Only ghrelin receptor was upregulated in the anterior pituitary (P<0.05) and ARC (P<0.10) in the low plane of nutrition compared to high. Calves offered a high plane of nutrition were heavier at slaughter, had larger testes, larger seminiferous tubule diameter, more mature spermatogenic cells and more Sertoli cells in accordance with both morphological and transcriptional data. This study indicates that a high plane of nutrition during early calf-hood alters gene expression which advances testicular development and hastens spermatogenesis.
Keywords: bull calves, plane of nutrition, HPT axis, reproduction, puberty
2.2 Introduction
Due to DNA based marker assisted selection, young genetically elite bulls are now being identified within weeks of birth as potential sires for use in artificial insemination
43 programmes. However, these bulls cannot produce ejaculates of sufficient quality for cryopreservation until they are approximately 9 to 10 months of age and demand for their semen often far exceeds supply. Hastening the onset of puberty and subsequent sexual maturation would therefore benefit the industry and make semen available at a younger age
(Harstine et al., 2015).
The HPT is a cohesive biological system that controls the secretion of male hormones and in turn spermatogenesis (Ramaswamy and Weinbauer, 2014). The hypothalamus is acknowledged as the homeostatic regulator of the body (Kandel and Schwartz, 1991). Signals from hormones including leptin, ghrelin, insulin and IGF-I are received by hypothalamic neurons located in the ARC region (Amstalden et al., 2011) and signal nutritional status to the preoptic nuclei region that are largely involved in the regulation of reproduction (Lechan and Toni, 2000). The GnRH nerve projections originating from the preoptic nuclei region attach to the median eminence, where they secrete GnRH into the hypophyseal portal system leading to the anterior pituitary (Fujioka et al., 2007).
Bull calves experience a transient rise in anterior pituitary derived systemic LH from approximately 8 to 20 weeks of age (Evans et al., 1996). Furthermore, studies have shown that bull calves offered a high plane of nutrition during the first six months had an earlier and greater rise of LH (Thundathil et al., 2016). Enhanced nutrition during this critical period has a direct effect on hypothalamic GnRH pulsatility, ultimately leading to enhanced LH pulsatility as well as testosterone synthesis and release (Byrne et al., 2017c, Brito et al.,
2007b), which leads to larger testes and attainment of puberty at a younger age (Dance et al.,
2015, Brito et al., 2007b). The negative effects of feed restriction during the prepubertal period cannot be mitigated in the peripubertal or pubertal period, regardless of the nutrition provided after this crucial period of development (Brito et al., 2007b, Byrne et al., 2017b).
44
The reproductive axis has the capacity to respond to changing concentrations of metabolic signals (Hill et al., 2008) and it is clear that a high plane of nutrition in the early calf hood period can advance puberty (Byrne, et al. 2016). However, the molecular mechanism by which this is mediated has not been investigated to-date in the bull. The objective of this study was to characterise the effect of nutrition during the first 18 weeks of life on aspects of physiological and transcriptional functionality of the hypothalamic (ARC region), anterior pituitary and testes in Holstein Friesian bull calves.
2.3 Material and methods
All procedures involving animals were approved by the Teagasc Animal Ethics Committee
(TAEC30/2013); licensed by the Irish Health Products Regulatory Authority (licence number
AE19132/P013) in accordance with the European Union Directive 2010/36/EU.
2.3.1 Experimental design and animal management
Twenty Holstein-Friesian bull calves with a mean (±S.D.) age and bodyweight of 19 (±8.2) days and 47.5 (±5.3) kg, respectively, were sourced from commercial dairy farms in spring time. These calves were assigned to two treatment groups (high plane of nutrition and low plane of nutrition) by blocking the calves on age, sire, live weight and farm of origin. Calves were group-housed indoors on sawdust-floored pens with a space allowance of 1.6 m2/calf as per EU regulations (S.I. No. 311 of 2010). Calves were individually fed milk replacer and concentrate (Table 2.1 and 2.2) using an electronic feeding system (Förster-Technik, Vario,
Engen, Germany); individual identification was facilitated by a neck collar incorporating a transponder on each calf. After five days acclimatisation, calves were assigned to either high or low plane of nutrition. Calves on the high plane of nutrition received 1200 g of milk replacer in 8 L of water daily, together with concentrate ad libitum. Calves on the low plane of nutrition were allocated 500 g of milk replacer in 4 L of water plus a maximum of 1 kg of
45 concentrates daily. Diets were designed based on National Research Council guidelines
(NRC, 2001). Calves were weaned when consuming a minimum of 1 kg of concentrate for 3 consecutive days, at a mean age (±S.D.) of 82 (±3.9) days. Following weaning, high calves were offered concentrates ad libitum, while the low plane of nutrition calves received 1 kg of concentrate daily. All calves had daily access to fresh water and approximately 0.5 kg of hay throughout the trial period. Calves were weighed weekly. At a mean age (±S.D.) of 126
(±1.1) days of age, all calves were euthanized following intravenous administration of sodium pentobarbitone (1mL/1.4kg bodyweight; Euthatal, Merial S.A.S, Toulouse, France).
Death was confirmed by lack of ocular response and was followed by exsanguination and decapitation. Calf health was monitored throughout the trial and vaccination for BVD and pneumonia.
The head was removed from the carcass and the skullcap was opened within 10 min of death.
The brain was then removed from the skull by severing the infundibulum, optic nerves and brain stem. The region of the hypothalamus containing the ARC tissue was dissected according to Komatsu et al. (2012). Two small triangular sections were harvested from either side of the bottom of the third ventricle of the hypothalamus, which contains the ARC. The pituitary gland was removed from the sella turcica following which anterior and posterior sections of the pituitary gland were separated. The testes were also excised, the tunica albuginea, epididymes and any excess connective tissue removed and the testes were weighed. Two portions of the testicular parenchyma were dissected from each testis. One section of each tissue was fixed in 10% neutral buffered formalin and then prepared for histological sectioning. The second section was snap-frozen in liquid nitrogen, and subsequently stored at −80°C for long term storage pending further processing.
For comparison purposes, sections of the parenchyma were taken from post-pubertal HF bulls
(n=10) that were slaughtered at a mean (±S.D.) age and bodyweight of 586 (±50) days and
46
532 (±48) kg, respectively. These mature bulls were reared under similar conditions at the same research facility as that of the high plane of nutrition calves described above.
2.3.2 Blood sampling
Blood samples were taken at 2, 6, 10, 14, and 18 weeks of age an hour after feeding. Blood samples were collected via jugular venepuncture to determine systemic concentrations of
IGF-I, insulin, leptin, adiponectin, albumin, urea, total protein, triglycerides, beta hydroxybutyrate (BHB), creatinine, globulin, glucose, non-esterified fatty acids (NEFA) as well as LH, FSH and testosterone. Blood was collected into a 9-mL evacuated tube containing lithium heparin as an anticoagulant (Greiner Vacuette, Cruinn Diagnostics,
Dublin, Ireland) for albumin, urea, total protein, BHB, glucose, NEFA, triglycerides, creatinine, adiponectin, IGF-1 and leptin. Blood was collected into a 6-mL K3 ethylenediaminetetraacetic acid (K3 EDTA; Vacuette, Cruinn Diagnostic) for insulin. Blood was centrifuged at 1750 g for 15 min; plasma was separated and stored at -20˚C until analysis. Blood samples for FSH, LH and testosterone were collected into a 9-mL evacuated serum separator tube (Becton Dickinson, Dublin, Ireland.). Blood was allowed to clot overnight and then centrifuged at 800 g for 10 min and serum was collected and stored at -
20˚C before analysis.
2.3.3 Metabolite assays
Concentrations of albumin, urea, total protein, triglycerides, BHB, creatinine, globulin, glucose and NEFA were analysed using commercial biochemical assay kits (Olympus
Diagnostics, Tokyo, Japan, and Randox Laboratories LTD, Co. Antrim, Northern Ireland) on a Beckmann Coulter AU 400 clinical analyser (Olympus Diagnostics, Tokyo, Japan). Intra- assay CVs were as follows for glucose (3.03, 1.88 and 2.48%), urea (5.59, 2.09 and 1.96%),
BHB (1.58, 0.88 and 0.72%), triglycerides (0.005, 0.77 and 0.52%), protein (2.34, 1.55 and
47
2.3%), albumin (2.44, 1.03 and 1.88%) and creatinine (3.02, 2.01 and 2.01%) for low, medium and high standards, respectively. Globulin concentration was calculated as the difference between total protein and albumin concentrations. All samples, within each metabolite, were analysed on a single assay.
2.3.4 Metabolic hormones
Insulin-like growth factor 1 was quantified by radioimmunoassay (RIA) after an acid-ethanol extraction and Tris neutralisation procedure, as described previously by Beltman et al.
(2010). The inter- and intra-assay CVs for the low, medium and high IGF-I were 10.8%,
4.36% and 4.05% and 6.7%, 1.57% and 2.77%, respectively. The sensitivity of IGF-I assay was 4 ng/mL. Insulin concentrations were measured by Immunoradiometric assay (IRMA;
INS-Irma, DIAsource ImmunoAssays SA, Louvain-la-Neuve, Belgium) as described by
Ochocińska et al. (2016). The inter- and intra-assay CVs for the low, medium and high insulin standards were for 0.09%, 7.16% and 2.93% and 6.58%, 9.23% and 6.62%, respectively. The sensitivity of insulin assays was 1 ng/mL. Leptin concentration was quantified using a competitive enzyme immunoassay as described by Sauerwein et al. (2004).
The ELISA was validated with this set of samples. The range of the assay was between 0.6-
9.0 ng/mL. The intra-assay CV was 5% as all samples were analysed on a single assay.
Adiponectin concentrations were analysed using an enzyme immunoassay described by
Heinz et al. (2015). The range of the assay was between 0.03-7.0 ng/mL and the intra-assay
CV was 5%.
2.3.5 Reproductive hormones
Serum samples were analysed for testosterone concentration using an RIA (Testo-RIA-CT,
DIAsource ImmunoAssays SA, Louvain-la-Neuve, Belgium) and assays were performed according to the manufacturer’s instructions. The sensitivity of the assay was 0.1 ng/mL.
48
Intra-assay CV for testosterone was 4.71%, 8.05% and 4.87% for low, medium and high testosterone quality controls, respectively, as testosterone was analysed on a single assay.
LH was quantified by RIA as previously described by Cooke et al. (1997) modified so that the separation step (second antibody) used a poly-ethylene glycol (PEG) method. Briefly, after assay incubation with primary antibody, 100µl of 1% normal mouse serum in assay buffer was added to assay tubes. This was followed by 1 mL of goat-anti-mouse antibody diluted (Equitech-Bio, INC, Kerrville, Texas, US) 1:100 in 5% PEG. Assay tubes were incubated for 1 h at room temperature, centrifuged for 20 min at 1600 g, followed by separation of the free fraction be decanting the supernatant. The intra- and inter-assay CV for
LH was 14.46% and 8.59% and 1.38%, 9.96% and 0.25% for low and high LH quality controls, respectively. The sensitivity of the assay was 0.05 ng/mL.
FSH was quantified using RIA as described by Crowe et al. (1997). The intra- and inter-assay
CV for FSH was 3.3%, 5.03% and 9.26% and 4.26%, 4.31% and 1.05% for low, medium and high FSH quality controls, respectively. The sensitivity of the assay was 0.05 ng/mL.
2.3.6 Testicular histology
Histology was employed in the testes to assess outer seminiferous tubule diameter, stage of spermatogenesis, lumen development and nuclear volume density of Sertoli cells. Sections
(5-µm thick) were stained using the periodic acid-Schiff method (Bancroft, 1996). For each section, the outer seminiferous tubule diameters were measured using a calibrated eyepiece micrometer at x400 magnification using a bright field light microscope. Measurements were made on 20 different round tubules selected at random from each testis, and mean diameter was calculated. The histological sections were also examined to determine the most mature stages of spermatogenesis at x1000 magnification, using oil immersion. In the cross-sections of 20 seminiferous tubules per testis, the most mature spermatogenic cell type in the course of
49 spermatogenesis was established using the methodology of Curtis and Amann (1981). The progression of seminiferous tubule development was classified using a modified version of the lumen scoring system reported by Rode (2015; Table 2.3). Measurements were conducted on 20 different tubules selected at random from each testis.
Sections (5-µm thick) were stained using Haematoxylin and Eosin (H&E). The point- counting method was carried out at x1000 magnification by bright field light microscope using a 50 point ocular grid (1250 points were evaluated per testes) to determine the nuclear volume density of Sertoli cells as previously described by Johnson (1985; Supplementary
Figure 2.1). The evaluator was blind to the treatments.
2.3.7 RNA isolation and purification
Total RNA was extracted using RNeasy Universal plus Kit (Qiagen, Manchester, UK). The quantity of the RNA isolated was determined by measuring the absorbance at 260 nm using a
Nanodrop spectrophotometer ND-1000 (Nanodrop Technologies, Wilmington, Germany).
RNA quality was assessed on the Agilent Bioanalyzer 2100 using the RNA 6000 Nano Lab
Chip kit (Agilent Technologies, Cork, Ireland). RNA was purified using the RNA Clean &
Concentrator (Zymo Research, Irvine, US) and RNA integrity values of greater than 8 were deemed to be of high quality.
2.3.8 Complementary DNA synthesis
Total RNA (2µg) was reverse transcribed into cDNA using a High Capacity cDNA Reverse
Transcription Kit (Applied Biosystems, Foster City, US) using Multiscribe reverse transcriptase according to manufacturer’s instructions. Samples were stored at -20°C pending further analysis.
50
2.3.9 Primer design and reference gene selection
All primers targeting reference and candidate genes were obtained from a commercial supplier (Sigma-Aldrich Ireland, Dublin, Ireland; Supplementary Table 2.2-2.4). Primer3
(http://primer3.ut.ee/) software were utilized to design primers (Koressaar and Remm, 2007).
Primer specificity was established using the Basic Local Alignment Search Tool (BLAST) from the National Centre for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/BLAST/). The genes examined in the ARC region of the hypothalamus included: KISS1, GPR54, GnRH, AGRP, NPY, POMC, melanocortin 4, IGF-I,
IGF-IR, leptin receptor (OBR) and growth hormone secretagogue receptor (ghrelin receptor;
GHSR); The genes examined in the anterior pituitary included: LHB, FHSB, GHSR, somatotropin precursor/growth hormone (GH1), GnRHR, IGF-IR and IGF-I. The genes examined in the testes included: proliferation cell nuclear antigen (PCNA), Thy-1 cell surface antigen (THY1), tight junction protein 1/zonula occludens protein 1 (ZO1), GATA binding protein 4 (GATA4), androgen receptor (AR), FSHR, aquaporin-8 (AQP8), ubiquitin carboxyl- terminal esterase L1 (UCHL1), anti-müllerian hormone (AMH), claudin 11 (CLDN11) and
LHR. In the current study, four reference genes were tested across all samples with RT-PCR including ribosomal protein S9 (RPS9), glyceraldehyde-3-phosphate dehydrogenase
(GAPDH), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta
(YWHAZ) and ubiquitin (UBQ). Data were analysed using GeNorm (GenEx 5.2.1.3; MultiD
Analyses, Gothenburg, Sweden). GeNorm is a software package that measures the total stability of the tested reference genes by calculating the intra- and intergroup CV and combining both CVs to give a stability value (M value) (Keogh et al., 2015). A lower M value indicated a greater stability in gene expression across all samples. In the current study, the M value scores in the testicular tissue for glyceraldehyde-3-phosphate dehydrogenase
(GAPDH), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta
51
(YWHAZ), ubiquitin (UBQ) and ribosomal protein S9 (RSP9) were 2.44, 1.23, 0.99 and 0.99, respectively. In anterior pituitary tissue, M value scores for YWHAZ, GAPDH, UBQ and
RSP9 were 0.9482, 0.6544, 0.5034 and 0.5034, respectively. The M value scores for the ARC region for GAPDH, YWHAZ, UBQ and RSP9 were 1.39, 0.50, 0.43 and 0.43 respectively. On this basis, UBQ and RSP9 were selected as suitably stable housekeeping genes for each of the tissues and results are presented relative to an average of both genes.
2.3.10 Gene expression
The RT-PCR assays were performed on an ABI 7500 Fast Real-Time PCR System (Applied
Biosystems, Warrington, UK) as per the protocol reported in Keogh et al. (2015). The formula E = 10^ (-1/slope)-1 was used where slope refers to the slope of the linear curve of cycle threshold (CT) values plotted against log dilution. Only primers with PCR efficiencies between 90% and 110% were used. Gene expression was analysed using GenEx software
(www.multid.se/genex.html) which allowed for compensation of PCR efficiencies, before averaging for RT-PCR replicates. A normalisation factor, calculated based on the geometric mean of the four reference genes, was used to normalise the expression of each gene of interest.
2.3.11 Immunohistochemical (IHC) analysis
Immunohistochemistry was used to assess cell proliferation in the ARC by assessing KI67 staining and to validate the specificity of the tissue using proteins KISS1 and NPY that are highly specific to the ARC; while Sertoli cell number and developmental stage was assessed in the testes using GATA4 and AMH. Antigen retrieval of the deparaffinised tissue sections was performed using a PT-Link module (DAKO, Santa Clara, US) at 95°–99°C for 20 min in a citric acid buffer (0.01M, pH 6.0). Slide staining was performed using a DAKO autostainer
Link 48 (DAKO, Santa Clara, US) according to the manufacturer’s instructions. The primary
52 antibodies used were anti-KI67 as a marker of cellular marker for proliferation (Ready-to- use, Dako; mouse polyclonal), anti-KISS1 (1:1000, ABIN672726, Antibodies-online; rabbit polyclonal) and anti-NPY (1:150, ABIN724475, Antibodies-online; rabbit polyclonal) on the
ARC sections and anti-GATA4 (1:1000, LS-C355535, Source Bioscience; rabbit polyclonal) and anti-AMH (1:75, ab84952, Abcam; rabbit polyclonal) on the testicular sections. The secondary antibody was a rabbit-anti-goat antibody and slides were counterstained with haematoxylin, dehydrated, cleared and mounted. Bovine kidney, human breast cancer and bovine cerebrum sections were used as positive controls for KI67, KISS1 and NPY staining of the ARC tissue, respectively. Bovine heart and ovary sections were used as positive controls for GATA4 and AMH staining of the testes, respectively. All procedures were performed at the Research Pathology Core Facility, of University College Dublin, Ireland
(http://www.ucd.ie/conway/research/coretechnologies/researchpathologycore/).
All stained slides were analysed using the software Aperio ImageScope (Leica Biosystems,
Dublin, Ireland). The cytoplasmic V2 algorithm was selected to calculate the number of cells containing stain within the nucleus and the cytoplasm per area (mm2) for GATA4 (Figure
2.2). The colour deconvolution algorithm was selected to analyse AMH staining as it separated a stained tissue image into two colour channels, corresponding to the actual colours of the stains used and allowed to measure intensity (weak, moderate and strong intensity) and provide the number of cells containing stain per area (mm2; Figure 2.2). The cytoplasmic V2 algorithm was selected to analyse DAB staining intensity (weak, moderate and strong intensity) and provide the number of cells containing stain within the nucleus and the cytoplasm per area (mm2) for KI67, NPY and KISS1 (Figure 2.3).
Each section stained with GATA4 (two per calf; n=10) was also examined at x 400 magnification and 10 round seminiferous tubules were randomly selected and assessed
53
(Harstine et al., 2017b). The number of stained Sertoli cell nuclei present in a circular monolayer at the wall of a round seminiferous tubule was recorded (Harstine et al., 2017b).
2.3.12 Statistical analysis
All PCR data analysed using GenEx were log transformed to obtain normal distribution prior to subsequent statistical analysis. Area under the curve (AUC) for FSH, LH and testosterone was determined using Sigma Plot, version 11 (Systat Software, San Jose, CA). All bodyweight, testicular measurements, histology, immunohistochemistry, PCR and monthly blood analysis data were analysed using the procedures of Statistical Analysis Software (SAS version 9.3, Cary, NC, USA). All data were tested for normality (UNIVARIATE procedure) and where appropriate, transformed to the power of lambda (TRANSREG procedure). Data were analysed using ANOVA (MIXED procedure). The covariance matrix was determined for each variable by examining the Bayesian Information Criteria (BIC; smaller is better) value. Animal was the experimental unit. Sampling time was included in the statistical models as a repeated measure for weights and monthly blood analysis. All results are presented as mean ± s.e.m.
2.4 Results
2.4.1 Animal performance
The pre-weaning average daily gain (ADG) was higher for calves on the high plane of nutrition in comparison with the low plane of nutrition (P<0.001; Table 2.4). The post weaning ADG was also higher for the high plane of nutrition (P<0.001) compared to the low plane of nutrition which resulted in pre-slaughter bodyweights being higher for the high plane of nutrition compared with the low plane of nutrition (P<0.001). Paired testicular weight at slaughter was also higher for the calves on the high plane of nutrition compared with those on the low plane of nutrition (P<0.001; Table 2.5).
54
2.4.2 Metabolic hormones and metabolites
Metabolic hormones and metabolite data are presented in Figures 2.3 and 2.4, respectively.
Overall, systemic concentrations of hormones and metabolites reflected the divergence in metabolic status of the animals. There was a treatment x week interaction for albumin
(P<0.0001). There was an effect of treatment (P<0.01) and week (P<0.01) for total protein.
There was no treatment x week interaction or no effect of either treatment or week on triglyceride concentrations (P>0.05). There was no effect of treatment on NEFA (P>0.05); however, there was an effect of week (P<0.01). There was a treatment x week interaction for glucose concentration (P<0.01). There was a tendency for a treatment x week interaction for globulin concentrations (P=0.06). There was no difference between treatments in globulin concentration at week 2 (P>0.05); subsequently calves on the low plane of nutrition had higher globulin for the remainder of the trial period (P<0.05). There was a treatment x week interaction for creatinine (P<0.01). Creatinine was not different between treatment groups from week 2 to 10 (P>0.05). At week 14, there was a tendency for creatinine to be higher on the low plane of nutrition (P=0.09); creatinine was higher in the low plane of nutrition at week 18 (P<0.05). There was a treatment x week interaction for BHB (P<0.001). At weaning,
BHB was lower on the low plane of nutrition (P<0.001). However, at week 14 the low plane of nutrition had a higher BHB concentration in comparison with the high plane of nutrition
(P<0.001). Thereafter, there was no difference between treatments (P>0.05).
There was both an effect of treatment and week represented by an increase in adiponectin over time (P<0.001). Adiponectin concentration were greater on the low plane of nutrition at week 2 (P=0.05). There was no difference in concentration (P>0.05) between treatments at any sampling thereafter, with the exception of week 10 (weaning), where there was a tendency for the low plane of nutrition to be greater than the high plane of nutrition (P=0.06).
There was no effect of treatment on leptin (P>0.05) but there was an effect of week. There
55 was a treatment x week interaction for IGF-I (P<0.001). There was no difference between treatments in IGF-I concentration at week 2 (P>0.05). Subsequently, calves on the high plane of nutrition had a greater concentration than the low plane of nutrition throughout the rest of the trial (week 6, 1.8 fold change; week 10, 2.5 fold change; week 14, 5 fold change; week
18, 2.9 fold change). The animals on the low plane of nutrition maintained a constant concentration throughout the trial. There was an effect of treatment (P<0.01) and an effect of week (P<0.05) for insulin. There was no difference in circulating concentrations of insulin during weeks 2, 6 or 10 (P>0.05). Insulin concentrations increased in the high plane of nutrition calves throughout the rest of the trial period (week 14, P<0.05; week 18, P<0.05).
2.4.3 Reproductive hormones
There was no effect of treatment on FSH, LH or testosterone (P>0.05; Figure 2.5) but there was an effect of week on all three (P<0.0001). There was a difference in AUC on LH as the high plane of nutrition had a greater area than the low plane of nutrition (P<0.01).
2.4.4 Testicular histology
Seminiferous tubule diameter was greater in the calves on the high plane of nutrition in comparison with low plane of nutrition (P<0.001; Table 2.5). There were only two groups found in the seminal chords namely, germ cells and prespermatogonia and spermatogonia.
There was a greater percentage of seminal chords with germ cells and prespermatogonia in the low plane of nutrition than the high plane of nutrition (P<0.001). Conversely, there were a greater percentage of seminal chords with spermatogonia in the high plane of nutrition than the low plane of nutrition (P<0.001).
The lumen scores for seminiferous tubules for both treatment groups ranged between 1 and 4
(Figure 2.6). There was no difference between the treatment groups in the number of tubules that had a lumen score of either 1 or 2 (P>0.05). There was a difference between treatments
56 for seminiferous tubules with a lumen score of 3 (P<0.001) as the calves on the low plane of nutrition had a greater number than those on the high plane of nutrition (P<0.001). There was a greater number of the calves on the high plane of nutrition with seminiferous tubules with a lumen score of 4 than those on the low plane of nutrition (P<0.001).
There was a greater number of Sertoli cells in the testes of the high plane of nutrition in comparison with their contemporaries on the low plane of nutrition (P<0.001; Table 2.5 and
Figure 2.7). There was a greater volume density of Sertoli cells in the low plane of nutrition compared with the high (P<0.05; Table 2.5); however, there was no difference in volume density of Sertoli cells between either plane of nutrition when testes weight was taken into account.
2.4.5 Gene expression
The ARC RT-PCR data are presented in Table 2.6. There was a tendency for an effect of treatment on GHSR (P=0.09), which was upregulated in the low plane of nutrition in comparison with the high plane of nutrition. There was no effect of plane of nutrition on
KISS1, GPR54, GnRH, AGRP, NPY, POMC, MC4R, IGF-I, IGF-IR and OBR expression in the arcuate tissue (P>0.05; Table 2.6).
Anterior Pituitary RT-PCR data are presented in Table 2.7. There was an effect of plane of nutrition on GHSR (P<0.05), which was upregulated in the low plane of nutrition in comparison with the high plane of nutrition. There was no effect of plane of nutrition on
FSHB, LHB, IGF-I, GH1, GnRHR or IGF-IR (P>0.05; Table 2.7).
In the testes, PCNA was upregulated in both groups of calves when compared with the mature bulls (P<0.001; Table 2.8). AR was upregulated in the mature bulls in comparison to both the high plane of nutrition (P<0.01) and the low plane of nutrition (P=0.06). FSHR was upregulated in the high plane of nutrition compared to the mature bulls (P<0.01). GATA4 was
57 upregulated in both the high and the low plane of nutrition (P<0.001) compared with the mature bulls. AMH in the low plane of nutrition was upregulated compared with both the high plane of nutrition (P<0.05) and the mature bulls (P<0.001). CLDN11 expression was upregulated in the high plane of nutrition (P<0.05) and the mature bulls (P<0.001) compared with the low plane of nutrition. Luteinising hormone receptor (LHR) expression was upregulated in both the high and the low plane of nutrition (P<0.01) in comparison with the mature bulls. There was no effect of plane of nutrition on the relative expression of APQ8,
THY1, UCHL1 or ZO1 (P>0.05; Table 2.8).
2.4.6 Immunohistochemistry
The ARC was stained using KI67, KISS1 and NPY. The staining for NPY was located cytoplasmically and there was no difference in the number of protein positive cells per area between treatments (P>0.05; Table 2.9). There were no differences in KI67 and KISS1 protein intensity or in the number of protein positive cells per area between treatments
(P>0.05; Table 2.9).
The testicular parenchyma was stained using AMH and GATA4. There was a higher percentage of weak AMH staining in the high plane of nutrition in comparison with the low plane of nutrition (P<0.05; Table 2.9). There were no differences found between overall
GATA4 expression within the testes (P>0.05; Table 2.9).
2.5 Discussion
Calves offered a high plane of nutrition were heavier at slaughter, had larger testes, larger seminiferous tubule diameter, more mature spermatogenic cells and more Sertoli cells. The weights of the calves at slaughter are comparable to that of Holstein Friesian bull calves employed in other studies on similar nutritional regimes (Byrne et al., 2017b, Dance et al.,
2015). Larger testes would suggest greater spermatogenic potential and is thought to reflect a
58 greater abundance of Sertoli cells and therefore, the capacity to support more sperm
(O'Donnell et al., 2000). These testicular morphological differences were validated by transcriptomic analysis and metabolites, metabolic as well as reproductive hormones broadly reflected the plane of nutrition offered (Byrne et al., 2017b). However, there were no clear differences between the two planes of nutrition with regard to targeted gene and protein expression in the ARC and anterior pituitary. The systemic concentrations of the various metabolites measured in this study were within the normal range for calves and, in general, reflected the divergent metabolic status of the animals on the two contrasting planes of nutrition employed, as well as the switch-over from mainly liquid to solid feed post-weaning at 10 weeks. For example, BHB concentrations pre-weaning were low for both groups reflecting the relatively low quantity of concentrate consumed (Overvest et al., 2016).
However, BHB concentrations increased as calves were transitioned to solid feed post- weaning, and were similar for both groups prior to slaughter, indicating normal rumen development (Khan et al., 2011). Glucose concentrations mapped, in general, the prevailing plane of nutrition, with concentrations markedly higher in the high plane of nutrition calves post-weaning, reflecting their much greater concentrate intake. Such conclusions have been drawn in previous studies in calves on a similar feeding regime (Byrne et al., 2017a).
Creatinine, decreased with age for both treatments, indicative of normal renal development and is consistent other recent reports in the literature (Byrne et al., 2017a). Plasma concentrations of urea were higher in the high plane of nutrition, reflecting their greater dietary protein consumption (Blome et al., 2003, Bartlett et al., 2006). Similar results for globulin and total protein concentrations have been observed where calves were offered restricted compared with unlimited milk (Hammon et al., 2002). A number of studies including a recent report by Schäff, et al. (2016) have shown that systemic concentrations of albumin increase steadily in the weeks after birth. In our study we observed a steady increase
59 in concentrations of albumin over time in calves on the high plane of nutrition, with concentrations higher than their contemporaries on the low plane of nutrition during the post- weaning period.
Systemic concentrations of leptin production increased proportionally with increases in body fat (Landry et al., 2013) and play an important role in energy homeostasis (Ahima et al.,
2000). However, in our study we did not find any difference between treatments with respect to leptin. This is in agreement with other studies using both dairy and beef bull calves (Dance et al., 2015, Brito et al., 2007b, Byrne et al., 2017c) and may be due to the low levels of subcutaneous fat in young growing calves. However, the subcutaneous adipose tissue from the high and low plane of nutrition was analysed using RNA sequencing technology and found that calves on the high plane of nutrition in our study had >4.5 log fold higher LEP expression compared with animals the low animals (Chapter 4). AdipoQ in contrast to leptin is inversely related to body fat in cattle (Sauerwein and Häußler, 2016) and thus we expected that calves on the high plane of nutrition would have lower concentrations. However, AdipoQ concentrations in our study increased in all calves over time with the exception of a tendency towards a higher concentration in the low plane of nutrition calves at 10 weeks of age. It has been widely suggested that IGF-I is a mediator of the effect of nutrition on the functionality of the HPT axis (Brito et al., 2007b). Consistent with this, we observed 1.5 to 3.5 fold higher concentrations of IGF-I in calves on the high plane of nutrition compared with the low plane of nutrition, throughout the experimental period.
The GH secretagogue receptor also known as GHSR has been found to have the greatest expression in the anterior pituitary and hypothalamus relative to any other tissue in cattle
(Komatsu et al., 2012). Thus ghrelin via GHSR can stimulate the direct release of GH from the somatotropic cells in the anterior pituitary or indirectly via the GHSR in the ARC in the hypothalamus (Reichenbach et al., 2012). Ghrelin concentrations in the systemic circulation
60 are regulated by food intake (Stanley et al., 2005). Our finding of an upregulation of GHSR in both the ARC and anterior pituitary in 18 week old bull calves on a low plane of nutrition is consistent with the inhibitory effect of ghrelin on GnRH pulsatility in heifers (Chouzouris et al., 2016). Despite the well documented relationship between GHSR and GH secretion (Sun et al., 2004) as well as the aforementioned positive effect of a high plane of nutrition on systemic concentrations of IGF-I, transcript abundance for GH in the anterior pituitary was not affected by diet in the current study.
Low systemic concentrations of leptin stimulate NPY/AGRP release and feed intake and inhibit POMC/CART/MC4R activity and energy expenditure (Schwartz et al., 2000).
NPY/AGRP have opposing roles to that of POMC/α-MSH in the control of feeding and energy expenditure (Stanley et al., 2005). It has been reported that NPY and AGRP were down regulated and POMC and α-MSH were upregulated in heifer calves fed on a high concentrate diet to achieve rapid bodyweight gain compared to contemporaries offered a high forage diet from three-seven months of age (Allen et al., 2012). As previously outlined, we failed to observe any effect of plane of nutrition on systemic concentrations of leptin, consistent with the lack of difference also observed for transcript abundance of NPY, AGRP,
POMC or MC4R between the two dietary treatment groups. Additionally, the lack of difference at the transcript level for NPY levels was validated using immunohistochemistry.
It has been reported that hypothalamic expression of KISS1 and GPR54 transcripts are at their lowest prior to puberty with maximal expression occurring at puberty in both male and female rats (Navarro et al., 2005). This suggests that although GPR54 expression may increase from pre- to post-puberty; the number of GnRH neurons remains unchanged (Ezzat
Ahmed et al., 2009). Short-term fasting of prepubertal female and male rats resulted in a decline in KISS1 mRNA expression and an increase in GPR54 mRNA expression in the hypothalamus (Castellano et al., 2005). A later study carried out by the same group found that
61 rats raised in large litters postnatally had reduced levels of KISS1 (Castellano et al., 2011).
These studies are contradictory of the results from our study. In addition, there were no differences observed in expression of GnRH either in the ARC region of either treatment group or in the expression of GnRHR, FSHB and LHB in the anterior pituitary gland in the current study. The lack of differences in KISS1 mRNA was further corroborated at the protein level by immunohistochemistry.
In the seminiferous tubules, fluid filled vacuoles multiply and aggregate to form the lumen, which is not fully functional in bulls until after 20 weeks of age (Wrobel et al., 1986). While previous studies have been carried out on stallions (Rode et al., 2015, Heninger et al., 2006), to the author’s knowledge, this is the first study to evaluate the effect of plane of nutrition on seminiferous tubule lumen development in bull calves. The high plane of nutrition had a more mature stage of lumen development and suggests that a more favourable metabolic status in early calf hood advances testicular functionality. Curtis and Amann (1981) reported outer seminiferous tubule diameter of 79 ± 2 μm and 110 ± 5 μm for Holstein Friesian bull calves at 16 weeks and 20 weeks of age, respectively and the diameters measured in the high plane of nutrition in our study were consistent with this range. Consistent with more mature seminiferous tubule development, there was a greater ratio of spermatogonia cells in the high plane of nutrition compared with the low plane of nutrition in the current study. This indicates that both treatment groups were within the stage of development appropriate for their age. Along with the advanced germ cell development, our results also show that a higher plane of nutrition had a positive influence on the rise of testosterone, which may stimulate an early onset of puberty (Chandolia et al., 1997). While directly related to spermatogenic potential (Johnson et al., 2000), there has been no information to-date on the effect of early life plane of nutrition on Sertoli cell number in calves. Harstine et al. (2017b) demonstrated that Angus calves treated with FSH from 1-3 months of age had a greater number of Sertoli
62 cell. In another study published by this group on the effect of FSH treatment on calves from
2-6 months of age, they reported an increase in activin A which is beneficial to spermatogenesis (Harstine et al., 2017a). Sertoli cells harbour a fixed number of germ cells and Sertoli cell number can only be influenced pre-pubertally (Johnson et al., 2000). Thus, our data, for the first time, indicates that calves offered a high plane of nutrition during the first four to five months of life may have the capacity to produce more sperm during their life time. Consistent with this we observed a strong tendency towards higher systemic concentrations of FSH on the high plane of nutrition calves at 10 weeks of age, which agrees with the positive relationship between Sertoli cell number and systemic FSH (Bagu et al.,
2004). Brito (2014) summarized work carried out on Angus and Angus x Charolais bulls receiving adequate nutrition and that FSH concentrations are at their highest between 10 and
14 weeks of age. This is similar to the pattern observed in the current study.
It has been reported that AMH controls the recession of müllerian ducts in the male foetus
(Rota et al., 2002) and is secreted from Sertoli cells from sexual differentiation until puberty
(Vigier et al., 1984). AMH secretion is at its maximum at birth and it declines thereafter, until puberty which results from the activation of the HPT axis, which gives rise to an increase in testicular testosterone and onset of spermatogenesis in mice and boys (Hero et al., 2012, Tan et al., 2005). This validates the results of the current study where transcript abundance for
AMH in the low plane of nutrition calves was upregulated compared with both the high plane of nutrition and mature bulls and was higher, in turn, for the high plane of nutrition calves than mature bulls. This again was corroborated by our IHC work. Sertoli cells proliferate until 6 months of age (Ortavant et al., 1977) and GATA4 is used as a specific marker for
Sertoli cell nuclei in bulls (McCoard et al., 2001) using IHC. This is consistent with the significantly higher GATA4 expression levels in the high and low plane of nutrition in comparison with the mature bulls in the current study, which is possibly due to the crossover
63 of presumptive Sertoli cells and mature Sertoli cells. As mentioned previously, there was a greater number of GATA4 stained Sertoli cells in the high compared with the low plane of nutrition. This reflects the work carried out by Harstine et al. (2017b) who found an increase in GATA4 stained Sertoli cells in FSH treated animals versus a control. However, no change in FSH concentration was observed in our study.
Testicular expression of FSHR has been found to decrease with testes development in bulls
(Dias and Reeves, 1982). The number of receptors have been shown to decrease quickly from birth to 2 months of age and from then decrease at a slower rate to 2-5 years of age in bulls
(Dias and Reeves, 1982). This is consistent with the significantly higher expression observed in the high and low plane of nutrition in comparison with the adult bulls in the current study.
Other studies have shown that there is a decline in FSHR levels in rats and mice testes as they age (Ketelslegers et al., 1978). However, this result may be affected by an increase in germ cell population causing an overall dilution of FSHR (Faucette et al., 2014). Given the absence of an effect of plane of nutrition on systemic FSH concentration or indeed FSHB transcript abundance in the anterior pituitary, in our study, it is not entirely surprising that there was no effect on testicular FSHR expression.
We did not observe any effect of diet on systemic concentrations of LH. Other studies have shown that circulating LH is highest in bull calves between 12 and 20 weeks of age, after which concentrations begin to decline (Evans et al., 1996, Rawlings et al., 2008) and our study corroborates these findings. Similarly, it has been reported that the concentration of LH receptors in Hereford x Charolais bulls is high postnatally but decreases from 13 to 25 weeks of age; which maybe be due to the decline in fetal Leydig and undifferentiated Leydig progenitor cell numbers (Bagu et al., 2006). These authors also found that testicular LHR number increased from 25 to 56 weeks in the same bulls, when the study concluded (Bagu et al., 2006). It is postulated that an increase in LHR at this stage may be due to Leydig cell
64 maturation or an increase in Leydig cell number (Amann, 1983). In our study, while no effect of diet was evident, we did observe greater LHR expression in the testicular tissue of calves when compared with adult bulls. Blood concentrations of testosterone have been shown to increase in beef bred bull calves following the early LH rise, which typically occurs between
10 and 18 weeks (Amann, 1983, Rawlings and Evans, 1995). Even though no significant differences were found in LH concentration between planes of nutrition, the numerically higher concentration at its peak at 12 weeks in the high plane of nutrition may have a knock on positive influence on testosterone concentration. Also there was a greater area under the curve for high plane of nutrition compared to the low for LH. The greater testosterone concentration in the high plane of nutrition is consistent with the aforementioned higher systemic concentrations of IGF-I in the high plane of nutrition. Given the well documented positive effects of IGF-I on testosterone (Dance et al., 2015), it is possible that the lower concentrations of IGF-I in the low plane of nutrition effected the peri-pubertal testosterone concentrations also; by influencing Leydig cells (Brito et al., 2007c). This may be a contributory factor for the lower rise in testosterone concentration in the low bulls. Ideally an intensive bleed would have been carried out to get more specific data on LH pulsatility; however, as these calves were very young and only on trial for a short period of time it was decided to take weekly blood samples to avoid any major stress that could have a long term effect on the calves.
It has been reported that AR are expressed at high levels in the peritubular cells from the fetal period onwards (Shapiro et al., 2005, Berensztein et al., 2006, Chemes et al., 2008, Boukari et al., 2009). In the human and rodent adult male, AR are maintained at a high level in Leydig and peritubular cells of the testes (Rey et al., 2009). While Sertoli cells, do not express AR during fetal and/or neonatal life (You and Sar, 1998), expression increases during postnatal and prepubertal phases of development in the testes of rodents (You and Sar, 1998, Al-Attar
65 et al., 1997, Tan et al., 2005), primates (McKinnell et al., 2001) and humans (Chemes et al.,
2008). In addition it has been reported that AR expression fluctuates cyclically in the Sertoli cells depending on stage of spermatogenesis in the seminiferous tubule (Smith and Walker,
2014). In part agreement with the aforementioned studies, we observed significant difference in expression of AR in testicular tissue of adult bulls compared with the high plane of nutrition only.
There was a higher expression of PCNA in the testes of mature bulls compared with the 18 month old calves in the current study. PCNA is required during DNA replication (Jaskulski et al., 1988), nucleotide excision repair (Nichols and Sancar, 1992) and cell cycling (Xiong et al., 1992). A study by Wrobel (2000) divided postnatal Simmental bull calves into groups based on their seminiferous tubule diameter and found that animals with a seminiferous tubule of 50-80 µm (5-15 weeks old) have an increased in PCNA staining at the pre-Sertoli stage, however, this decreased if the pre-Sertoli cells were differentiating. Whereas, in the 80-
120 µm (18-27 weeks old), the PCNA staining was restricted to all germ cells present as pre-
Sertoli cells have fully transformed into adult cells and no longer have proliferative ability. In accordance with this work, the low plane of nutrition should have had a down regulation of
PCNA compared with the high due to having less mature seminiferous tubules. Despite this obvious difference in seminiferous tubule development, however, we failed to detect a difference in PCNA expression between the groups. This highlights the discrepancies that can exist between transcript abundance, or lack there-off, at a point in time and biological function.
In the current study, the mature bulls and the high plane of nutrition had a similar level of testicular expression of CLDN11 with both groups having greater transcript abundance than low calves and could confer an important developmental benefit to the high plane of nutrition calves. In agreement, CLDN11 mRNA and protein levels were lower in the immature testes
66 of rabbits (postnatal Day 10) in comparison with those of adults (postnatal Day 180) (Park et al., 2011). Undernutrition of mature rams led to increased expression of CLDN11 and disorganisation of CLDN11 protein localisation in the testes (Guan et al., 2014) indicating a disruption of Sertoli cell tight junctions. Zonula occludens protein 1 (ZO1), also referred to as tight junction protein 1, is involved in blood-testis barrier function. Expression of ZO1 was found to be decreased in undernourished mature rams (Guan et al., 2014, Guan et al., 2015).
However, in contrast, we did not observe an effect of either stage of maturity or plane of nutrition (within calves) on transcript abundance for ZO1 in the current study.
The lack of differences in protein and gene expression could be due to the unavoidable differences in age of calves at the start. Calves had to be purchased from outside farms as there were no animals in calf to dairy calves on farm. Also it was important that the calves received adequate colostrum. This avoided any major health problems with the calves during the trial. Another point to consider is the mixed populations of cells in both the arcuate nucleus and the anterior pituitary. Further work is needed to isolate specific neurons and cell types in both tissues.
2.6 Conclusion
In summary, this is the first published study to investigate the effect of early life plane of nutrition on the molecular control and cross-talk of the HPT axis bulls. While there was no clear difference between the two planes of nutrition with respect to targeted gene and protein expression in the ARC nucleus region of the hypothalamus or in the anterior pituitary per se it is clear from the analyses conducted on testicular tissue that an improved metabolic state during early calf hood induces precocious testicular development. This is consistent with the advancements in the age at puberty onset observed by our group and others where a similar nutritional augmentation strategy was applied. The findings of this study will increase our
67 understanding of the early calf-hood nutritional control of the timing of pubertal onset in bulls; provide a platform for a more extensive investigation on the genes controlling puberty in bulls.
68
Table 2.1 Chemical composition of milk replacer
Milk Replacer Chemical composition (g/kg) ADF 12.0 ±1.98 Crude ash 65.7 ±2.22 CP 216.3 ±1.24 DM (%) 96.7 ±0.15 NDF 5.1 ±1.00 Oil B 235.0 ±44.10 ADF: Acid Detergent Fibre; CP: Crude Protein; DM: Dry Matter; NDF: Neutral Detergent Fibre; Oil B: Acid hydrolysis.
69
Table 2.2 Diet and chemical composition of concentrate diet offered
Concentrate
Diet composition (%) Rolled Barley 26.5 Soya bean meal 25 Maize 15 Beet pulp 12.5 Soya hulls 12.5 Molasses 5 Mineral and vitamins 2.51 Vegetable oil 1 Chemical composition (g/kg) ADF 103.1 ±6.76 Crude ash 68.8 ±0.91 CP 167.9 ±1.86 DM (%) 88.9 ±0.66 NDF 204.3 ±18.2 Oil B 30.8 ±0.72 1Mineral and vitamin composition: vitamin A (10 mIU/kg), vitamin D3, (2 mIU/kg), vitamin E (40 mg/kg), iodine (8 mg/kg), cobalt (40 mg/kg), copper (88 mg/kg), manganese (81 mg/kg), zinc (139 mg/kg) and selenium (11 mg/kg). Mineral and vitamin composition for concentrate post puberty is the same as above with the exception of copper (80 mg/kg). Oil B = Acid hydrolysis
70
Table 2.3 Classification of seminiferous tubule development. Adapted from Rode et al., (2015)
Lumen Score Morphology 1 Tubes lack a lumen (solid spermatic chords) 2 Tubules contain a single vacuole 3 Tubules contain several independent vacuoles 4 Tubules contain several aggregating vacuoles 5 Tubules have an open lumen but the seminiferous epithelium has only the height of one cell layer 6 Tubules have an open lumen – Germ cell population is still incomplete 7 Tubules have an open lumen –Full population of germ cells
71
Table 2.4 Effect of a high compared to a low plane of nutrition on the pre-weaning average daily gain, post weaning average daily gain, total average daily gain and live weight at time of slaughter of Holstein Friesian bull calves.
HIGH LOW SEM Significance
Pre-weaning ADG (kg) 0.73 0.43 0.02 ***
Post -weaning ADG (kg) 1.46 0.57 0.07 ***
Overall ADG to weaning (kg) 1.08 0.50 0.03 ***
Bodyweight at slaughter (kg) 160.9 107.1 3.59 *** ADG: Average Daily Gain, ***P<0.001, SEM = standard error of the mean.
72
Table 2.5 Effect of a high compared to a low plane of nutrition on the paired testes weight and on morphological properties including seminiferous tubule diameter and stage of spermatogenesis
HIGH LOW SEM Significance
Paired testes weight (g) 55.4 31.4 2.91 *** Seminiferous Tubule Diameter (µm) 85.4 72.5 1.76 *** % Gonocyte and Prespermatogonia 31.5 57 1.66 *** % Spermatogonia 68.5 43 1.66 *** No. of Sertoli cells 28 24 0.65 * Volume Density of Sertoli cells 9.4 8.4 0.35 *** ***P<0.001, *P<0.05, SEM = standard error of the mean.
73
Table 2.6 Effect of a high compared to a low plane of nutrition on the expression of selected genes in the arcuate nucleus of the hypothalamus. The results are relative to the average of the reference genes UBQ and RSP9.
Treatment
Gene HIGH LOW SEM Significance KISS1 3.8 3.2 1.5 NS GPR54 1.1 1.3 0.45 NS GnRH 1.4 1.7 0.57 NS AGRP 4.5 4.8 1.60 NS NPY 2.9 3.0 1.18 NS POMC 4.6 4.5 0.94 NS MC4R 3.8 4.8 0.82 NS IGF-I 2.0 1.7 0.46 NS IGF-IR 7.8 7.9 0.95 NS OBR 4.0 3.3 1.20 NS GHSR 4.3 5.5 1.04 P=0.09 NS = Non significant, SEM = standard error of the mean
74
Table 2.7 Effect of a high compared to a low plane of nutrition on the expression of genes in the anterior pituitary. The results are relative to the average of the reference genes UBQ and RSP9.
Treatment
Gene HIGH LOW SEM Significance FSHB 10.0 9.2 2.41 NS LHB 2.1 1.8 0.31 NS GHSR 2.4 3.6 0.33 P <0.05 GH1 1.9 2.6 0.34 NS GnRHR 2.3 2.7 0.35 NS IGF-IR 1.8 2.0 0.20 NS IGF-I 1.9 2.3 0.37 NS NS = Non significant, SEM = standard error of the mean
75
Table 2.8 Effect of a high and a low plane of nutrition compared to mature bulls on the expression of genes in the parenchyma of the testes. The results are relative to the average of the reference genes UBQ and RSP9.
Treatment Significance Gene MATURE HIGH LOW SEM M-H H-L M-L AMH 2.6 5.2 6.7 0.34 *** * *** PCNA 5.6 1.4 1.3 0.15 *** NS *** GATA4 14.6 31.7 27.1 1.47 *** NS *** ZO1 3.8 3.7 4.0 0.24 * NS NS CLAUDIN11 14.7 15.3 12.9 0.45 NS * ** THY1 4.8 5.1 5.5 0.52 NS NS NS AR 0.6 0.4 0.5 0.03 * P=0.06 NS FSHR 9.4 11.5 10.2 0.56 ** NS P=0.06 AQP8 12.4 14.5 12.2 1.11 NS NS NS UCHL1 4.8 5.8 5.6 0.49 NS NS NS LHR 0.7 5.4 2.6 0.78 *** NS ** M = Mature, H = High, L = Low, NS = Non significant, * P<0.05, ** P<0.01, *** P<0.001, SEM = standard error of the mean
76
A B C D
E F Figure 2.1 AMH (x400) and GATA4 (x100) staining in the testes. The images illustrate different staining intensities; (A) negative control, (B) AMH weak staining, (C) AMH moderate staining, (D) AMH strong staining, (E) GATA4 unstained cells and (F) GATA4 stained cells. In slide B, C and D the blue stained cells in a monolayer around the seminiferous tubules are Sertoli cells and any cells inside this monolayer are germ cells. The cytoplasm is expressing AMH, In slide F the dark brown cells are Sertoli cells that express GATA4.
77
A B C D
E F G H
I J Figure 2.2 KI67, NPY and KISS1 nuclear staining in the arcuate tissue (x400). The images illustrate different staining intensities; (A) KI67 negative staining, (B) KI67 weak staining, (C) KI67 moderate staining and (D) KI67 strong staining, (E) NPY unstained cells, (F) NPY stained cells, (G) KISS1 negative staining, (H) KISS1 weak staining, (I) KISS1 moderate staining and (J) KISS1 strong staining. The brown stained cells in slide B, C, and D indicate proliferating cells. In slide F the brown stained cells are NPY expressing cells. In slide H, I and J the cells with the brown cytoplasm and blue/ brown nucleus are KISS1 expressing cells.
78
Table 2.9 Effect of low plane of nutrition and high plane of nutrition on protein concentrations on the arcuate nucleus (NPY, KISS1 and KI67) and the testes (AMH and GATA4).
No. of cells containing stain % Weak % Moderate % Strong Tissue Protein Treatment per area (mm2) Positive Positive Positive LOW 928±228.1a 25.3±10.96a - - NPY HIGH 1156±176.1a 28.8±7.99a - - a a a a Arcuate LOW 26920±4537.0 23.1±8.10 7±3.19 2.1±1.36 KISS1 a a a Nucleus HIGH 27895±5331.8 30.9±6.14a 11.9±3.58 4.7±2.98 LOW 819±467.6a 3.9±2.89a 0.1±0.05a 0.01±0.007a KI67 HIGH 517±218.6a 1.5±0.51a 0.2±0.07a 0.1±0.05a a a a a AMH LOW 161±23.8 29.1 ± 2.12 22.5 ± 2.07 13.4 ± 2.71 HIGH 114±27.4a 35.6 ± 1.14b 22.7 ± 3.18a 11.2 ± 2.75a Testes LOW 1638±430.7a - - - GATA4 HIGH 1339±457.0a - - - AMH % Weak Positive was lower in the low plane of nutrition than the high (P<0.05).
79
0.35 T: NS 0.30 W: NS T*W: NS 0.25 (mmol/L)
Triglycerides, Triglycerides, 0.20
0.15 2 6 10 14 18 Age in Weeks Figure 2.3 Effect of a high compared to a low plane of nutrition on the systemic concentrations of metabolites of Holstein Friesian bull calves. Black full line: low plane of nutrition, Black dotted line: high plane of nutrition; T= Treatment, W=Week, T*W= Treatment by Week Interaction, NS= Non significant, * P<0.05, ** P<0.01, *** P<0.001, error bars represent standard error of the mean. P=0.07 shows a tendency for significance between the high and low planes of nutrition at week 6 for total protein.
80
Figure 2.4 Effect of a high compared to a low plane of nutrition on the systemic concentrations of metabolic hormones of Holstein Friesian bull calves. Black full line: low plane of nutrition, Black dotted line: high plane of nutrition; T= Treatment, W=Week, T*W= Treatment by Week Interaction, NS= Non significant, * P<0.05, ** P<0.01, *** P<0.001, error bars represent standard error of the mean, P=0.07 shows a tendency for significance between the high and low planes of nutrition at week 10 for adiponectin
81
Figure 2.5 Effect of high plane of nutrition versus low plane of nutrition on the systemic concentrations of reproductive hormones. Black full line: low plane of nutrition, Black dotted line: high plane of nutrition; T= Treatment, W=Week, T*W= Treatment by Week Interaction, NS= Non significant, * P<0.05, ** P<0.01, *** P<0.001, error bars represent standard error of the mean; P=0.08 shows a tendency for significance between the high and low planes of nutrition at week 10 for FSH.
82
20 *** 18 16 14 12 10 8 High 6 *** Low
each lumen each lumen score 4 2
Average number at tubules of number Average 0 1 2 3 4 Lumen Score
Figure 2.6 Effect of a high compared to a low plane of nutrition on the lumen development of the seminiferous tubules ***P<0.001; Lumen Score 1: Tubes lack a lumen (solid spermatic chords), Lumen Score 2: Tubules contain a single vacuole, Lumen Score 3: Tubules contain several independent vacuoles, Lumen Score 4: Tubules contain several aggregating vacuoles.
83
A B
Figure 2.7 Effect of a high compared to a low plane of nutrition on GATA4 stained Sertoli cell number (x400); A: High plane of nutrition and B: Low plane of nutrition. The number of stained Sertoli cell nuclei present in a circular monolayer at the wall of a round seminiferous tubule was recorded (Harstine et al., 2017b). There was a greater number of Sertoli cells in the testes of HIGH in comparison with their contemporaries on LOW (P<0.001). Any brown stained cells which are inside the monolayer are spermatogonia.
84
Supplementary Figure 2.1 Method used to calculate the volume density of seminiferous tubules. Sections (5-µm thick) were stained using Haematoxylin and Eosin (H&E). The point- counting method was carried out at x1000 magnification by bright field light microscope using a 50 point ocular grid (1250 points were evaluated per testes) to determine the nuclear volume density of Sertoli cells as previously described by Johnson (1985). The red circles indicate a Sertoli cell hitting a point on the grid.
85
Supplementary Table 2.1 Gene ID, sequence and accession number for all arcuate genes
Gene Primer Sequence (5’ to 3’) Accession number
Forward: TCCGCCTACAACTGGAACTC AB466319.1 KISS1 Reverse: TTCGGGACACAAATTGCAGG Forward: GGCCAGTTCATTGCCCATTA GU289736.1 GPR54 Reverse: GCCCTGAGTATCATTGCTGC Forward: AAGGCAGCTCTGGAAAGTCT NM_001078137.1 GnRH Reverse: CCCAGTACGAGCACTTCCAT Forward: GGCTGCATGAATCCTGTCTG NM_173983.1 AGRP Reverse: CAGGGGTTCGTGGTGGTAC Forward: CGCTGCGACACTACATCAAT NM_001014845.3 NPY Reverse: TTTCCCGTGCTTTCTCTCAT Forward: AAGGACTCGGGGCCCTATAA NM_174151.1 POMC Reverse: GTGGGCGTTCTTGATGATGG Forward: TTCGTTTGGGGCAAGTCAAG NM_174110.1 MC4R Reverse: GGGGCTGGGTAGAGTTCATT Forward: TGCACTTCAGAAGCAATGGG NM_001077828.1 IGF-I Reverse: GAGGAGGATGTGATGGGCAT Forward: GACAACCAGAACTTGCAGCA NM_001244612.1 IGF-I-R Reverse: CCCTTTAGTCCCCGTCACTT Forward: AACTGAGGAGGAGCAAGGAC NM_001012285.2 OBR Reverse: AGAACGGAAGGTGTGGTGAA Forward: TGTTTTCTGCCTCACTGTGC NM_001143736.2 GHSR Reverse: ACCACTACAGCCAGCATCTT Forward: CCTGCCCGTTCGACAGATA NM_001034034.2 GAPDH Reverse: GGCGACGATGTCCACTTTG Forward: TACAACAGTTGGTGGCCAAA NM_001015555.1 UBQ Reverse: GAAGACTGGGCTGACTGAGG Forward: CCTCGACCAAGAGCTGAAG NM_001101152.2 RPS9 Reverse: CCTCCAGACCTCACGTTTGTTC Forward: GCATCCCACAGACTATTTCC GU817014.1 YWHAZ Reverse: GCAAAGACAATGACAGACCA
KISS1, kisspeptin, GPR54, G Protein – Coupled Receptor, GnRH, gonadotropin releasing hormone; AGRP, agouti-related Protein; NPY, neuropeptide Y; POMC, pro-opiomelanocortin precursor; MC4R, melanocortin 4 receptor; IGF-I, insulin- like growth factor 1, IGF-I-R, insulin- like growth factor 1 receptor; OBR, leptin receptor; GHSR, growth hormone secretagogue receptor (ghrelin receptor); GAPDH, glyceraldehyde-3-phosphate dehydrogenase; UBQ, ubiquitin; RPS9, ribosomal protein S9; YWAHZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein,
86
Supplementary Table 2.2 Gene ID, sequence and accession number for all anterior pituitary genes Gene Primer Sequences (5’ to 3’) Accession number
Forward: AGCTGTCACTGTGGATCCTG M_10077.1 LHB Reverse: GAAGGGAGGGGAAGAGTGTC Forward: CCAGACTCAAGAGCCCTCAA NM_174060.1 FSHB Reverse: GCAGCCTCATCAGATAGCCT Forward: TGTTTTCTGCCTCACTGTGC XM_592014 GHSR Reverse: ACCACTACAGCCAGCATCTT Forward: ACTCCATCCAGAACACCCAG NM_180996.1 GH1 Reverse: GCTGTTGGTGAAGACTCTGC Forward: AACACGAGTCTTGAAGCTGC NM_177514.2 GnRHR Reverse: AGAGGGATGCTGCTGTTGAT Forward: GACAACCAGAACTTGCAGCA NM_001244612.1 IGF-IR Reverse: CCCTTTAGTCCCCGTCACTT Forward: TGCACTTCAGAAGCAATGGG NM_001077828.1 IGF-I Reverse: GAGGAGGATGTGATGGGCAT Forward: CCTGCCCGTTCGACAGATA NM_001034034.2 GAPDH Reverse: GGCGACGATGTCCACTTTG Forward: TACAACAGTTGGTGGCCAAA NM_001015555.1 UBQ Reverse: GAAGACTGGGCTGACTGAGG Forward: CCTCGACCAAGAGCTGAAG NM_001101152.2 RPS9 Reverse: CCTCCAGACCTCACGTTTGTTC Forward: GCATCCCACAGACTATTTCC GU_817014.1 YWHAZ Reverse: GCAAAGACAATGACAGACCA LHB, luteinising hormone beta; FSHB, follicle stimulating hormone beta; GHSR, growth hormone secretagogue receptor (ghrelin receptor); GH1, somatotropin precursor/growth hormone; GnRHR, gonadotropin releasing hormone receptor; IGF-IR, insulin- like growth factor 1 receptor; IGF-I, insulin- like growth factor 1, GAPDH, glyceraldehyde-3-phosphate dehydrogenase; UBQ, ubiquitin; RPS9, ribosomal protein S9; YWAHZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta;
87
Supplementary Table 2.3 Gene ID, sequence and accession number for testes genes examined in this study Gene Primer Sequence (5’ to 3’) Accession number
Forward: GGCGTTCATAGTCGTGTTCC PCNA NM_001034494.1 Reverse: CTTCAAGATGGAGCCCTGGA Forward: CCTCACCTCTGCCAATACCA THY1 NM_001034765.1 Reverse: ACGGAAGCAGCTCTGGAATA Forward: ATAGCCCTGCAGCCAAAGAA ZO1 XM_015468497.1 Reverse: AGGTCAAGCAGGAAGAGGAC Forward: TGTAGGGCCAGTGTTACCAG GATA4 NM_001192877.1 Reverse: CGAGCAGAATCACCAAGAGC Forward: AGCCTCAATGAACTGGGTGA AR NM_001244127.1 Reverse: AACACCATAAGCCCCATCCA Forward: GTGCCAACCCCTTCCTCTAT FSHR NM_174061.1 Reverse: ATAGGTCTGGGCTTGCACTT Forward: ACCACAGACCAGACAGCTTT AQP8 NM_001206607.3 Reverse: AGGACCTAGCACCTCTGAGA Forward: GCTTCTCTGGGTTGTGTTCG UCHL1 NM_001046172.2 Reverse: GGTCAGCACTTTGTTCAGCA Forward: CCGGTCCATCTCTCTCTCTG AMH NM_173890.1 Reverse: AAGGCTGAGGTGCTGAAGAC Forward: GCCTCTCTGTTCCCTCTCTC CDN11 NM_001035055.2 Reverse: CCCACCCCACATTCCCTATT Forward: GGGAAATCAGCGTTGTCCCATTGA LHR U20504.1 Reverse: GCATCCACAAGCTTCCAGATGTTACGA Forward: CCTGCCCGTTCGACAGATA GAPDH NM_001034034.2 Reverse: GGCGACGATGTCCACTTTG Forward: TACAACAGTTGGTGGCCAAA UBQ NM_001015555.1 Reverse: GAAGACTGGGCTGACTGAGG Forward: CCTCGACCAAGAGCTGAAG RPS9 NM_001101152.2 Reverse: CCTCCAGACCTCACGTTTGTTC Forward: GCATCCCACAGACTATTTCC YWHAZ GU817014.1 Reverse: GCAAAGACAATGACAGACCA PCNA, proliferation cell nuclear antigen; THY1, Thy-1 cell surface antigen; ZO1, tight junction protein 1/zonula occludens protein 1; GATA4, GATA binding protein 4; AR, androgen receptor; FSHR, follicle stimulating hormone receptor; AQP8, aquaporin-8; UCHL1, ubiquitin carboxyl- terminal esterase L1; AMH, anti-müllerian hormone; CLDN11, claudin 11; LHR, luteinising hormone receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; UBQ, ubiquitin; RPS9, ribosomal protein S9; YWAHZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta.
88
CHAPTER 3: Effect of Early Calf-Hood Nutrition on
the Transcriptional Regulation of the Hypothalamic-
Pituitary-Testicular axis in Holstein-Friesian Bull
Calves
A.M. English, P. Cormican, S. Fair, C. J. Byrne, S.M. Waters, and D.A. Kenny. “Effect of Early Calf-Hood Nutrition on the Transcriptional Regulation of the Hypothalamic- Pituitary-Testicular axis in Holstein-Friesian Bull Calves”, Scientific Reports (Submitted).
89
3.1 Abstract
The aim of this study was to investigate the effect of divergent early calf-hood nutrition on the transcriptomic profile of the arcuate nucleus region of the hypothalamus, anterior pituitary and testes in Holstein-Friesian bulls. Holstein-Friesian bull calves with a mean
(±S.D.) age and bodyweight of 19 (±8.2) days and 47.5 (±5.3) kg, respectively, were assigned to either a high (n=10) or low (n=10) plane of nutrition. At 126 (±3) days of age, calves were euthanized, tissues samples were harvested and RNASeq analysis was performed. There were
0, 49 and 1,346 genes differentially expressed in the arcuate nucleus, anterior pituitary and testicular tissue of bull calves on the low relative to the high plane of nutrition, respectively
(P<0.05; False Discovery Rate <0.05). Plane of nutrition had no effect on gene expression in the arcuate nucleus. Cell cycle processes such as mitotic roles of polo-like kinase and cell cycle:G2/M DNA damage checkpoint regulation were down regulated in the low relative to the high plane of nutrition in the anterior pituitary; however there was no evidence for differential expression of genes with a known function in the modulation of reproductive processes. The expression of genes involved in cholesterol and androgen biosynthesis in the testes were down regulated in animals on the low plane of nutrition. This study provides insight into the role of early life metabolic status in regulating the HPT axis and may provide putative candidate molecular biomarkers for early onset of puberty in the bull.
Keywords: Gene Expression, RNASeq, Androgen Biosynthesis, Spermatogenesis, Puberty
90
3.2 Introduction
Dairy bulls are now selected as potential AI sires within weeks of birth using genomic selection (Schefers and Weigel, 2012). There is increasing evidence for a positive effect of the plane of nutrition during calf hood on the early onset of puberty in the bull (Byrne et al.,
2017b, Brito et al., 2007c, Dance et al., 2015). It is desirable not only for such bulls to reach puberty earlier but also that they have the capability of producing high volumes of good quality semen early in life, particularly within the context of seasonal dairy production systems. It is critically important, therefore, to gain a better understanding of the effect of early calf-hood nutrition on the biochemical pathways and key factors affecting sperm production to facilitate the design of improved rearing protocols for such genetically elite and valuable bulls.
Enhanced nutrition in the early calf-hood period has been shown to positively impact the hypothalamic GnRH pulse generator and its action on the anterior pituitary gland; thereby advancing the age of onset of puberty in bulls (Brito et al., 2007b). The hypothalamus is widely acknowledged as the homeostatic regulator of the body (Coll and Yeo, 2013).
Metabolic signals are sent from organs such as the liver (IGF-1), pancreas (insulin) and adipose tissue (leptin, adiponectin) and received by metabolic sensing neurons involved in satiety and energy homeostasis within the ARC. Such biochemical signals are mediated by neurons including NPY, AGRP (Stanley et al., 2005b(McShane et al., 1993, Stanley et al.,
2005) as well as KISS1 (Gottsch et al., 2004, Estrada et al., 2006). These neurons stimulate
GnRH release thereby affecting reproductive function.
The anterior pituitary is the principal regulator for growth, metabolism and reproduction via the synthesis and/or release of an array of hormones that control these functions in multiple peripheral organs (Musumeci et al., 2015). The gonadotrophic cells in the anterior pituitary are characterised by the expression of GnRH receptors; which are responsible for the
91 regulation of testicular function through secretion of gonadotropins, LH and
FSH(Schanbacher, 1982). The age at which bulls of dairy breeds attain puberty can range from 8-11 months (Rawlings et al., 2008), although this is influenced by management. There is a transient rise of LH which occurs between 8 and 20 weeks of age, with a peak at 12-15 weeks, declines between 20 and 24 weeks of age (Evans et al., 1996). Restricted nutrition during calf hood has been reported to affect steroidogenesis in the testes via inhibition of the magnitude of the hypothalamic GnRH pulse and therefore, the response of the anterior pituitary (Brito et al., 2007b).
The effect of level of nutrition offered to calves’ during the first six months of life on the early gonadotropin rise and the age at which puberty is reached cannot be rectified by the level of nutrition received thereafter (Dance et al., 2015, Byrne et al., 2017b, Brito et al.,
2007b). Recent work by our group has demonstrated that Holstein-Friesian bulls fed a high plane of nutrition for the first six months of life reached puberty approximately one month earlier than bulls on a lower plane irrespective of their plane of nutrition during the subsequent months (Byrne et al., 2017b).
Studies have been carried out in heifers using microarray, in situ hybridisation and immunohistochemical technologies to investigate the effect of early life nutrition on the molecular control of the hypothalamus and its knock on effects on age at onset of puberty but there is a lack of information on the nutritional influence on the molecular control of the HPT axis of the bull calf (Allen et al., 2012, Alves et al., 2017, Cardoso et al., 2015). Recent advances in deep-sequencing technology provides the opportunity for in-depth insight into the global transcriptome of key biologically important tissues. The hypothesis under investigation in this study was that the global transcriptomic profiles of hypothalamic- pituitary-testicular tissues would be affected by plane of nutrition during the early calf-hood period in Holstein-Friesian bulls.
92
3.2 Material and Methods
All procedures involving animals were approved by the Teagasc Animal Ethics
Committee (TAEC30/2013) licensed by the Health Products Regulatory Authority (licence number AE19132/P013) in accordance with the European Union Directive 2010/36/EU.
3.2.1 Animal Model
This experiment was conducted as part of a larger study designed to examine the effect of early calf hood nutrition on the molecular control of the HPT axis. The animal model and management has previously been described in Chapter 2. Briefly, Holstein-Friesian bull calves (n = 20) were assigned to either a high or low plane of nutrition at a mean live weight
(± S.D.) of 47.5 (± 5.3) kg and an age of 19 (± 8.2) days. Calves on the high and low planes of nutrition were individually fed milk replacer and concentrates. After five days acclimatisation, calves on the high plane of nutrition were offered 1,200 g of milk replacer in
8 L of water daily, together with concentrate ad libitum, while those on the low plane of nutrition received 500 g of milk replacer in 4 L of water plus a maximum of 1 kg of concentrates daily. Calves on both treatments were weaned when consuming a minimum of 1 kg of concentrate for three consecutive days, at a mean age of 82 (± 3.9) days. Following weaning, the high plane of nutrition group was offered ad libitum concentrates, while the low plane of nutrition group was offered 1 kg of concentrate, daily. All calves had daily access to approximately 0.5 kg of straw each and a constant supply of fresh water throughout the trial.
3.2.2 Tissue Collection
The calves were euthanized at a mean age of 126 (±1.1) days of age, using an intravenous overdose of sodium pentobarbitone. The timing of slaughter was chosen as all calves at this stage would have been expected to have experienced an endogenous transient LH rise
(Rawlings et al., 2008) and the timing and magnitude of this rise affects would have affected
93 testicular testosterone synthesis. Death was confirmed by exsanguination followed by decapitation. The skullcap was opened and the brain was removed from the skull by severing the infundibulum, optic nerves and brain stem. Tissue enclosing the ARC nucleus region of the hypothalamus was dissected according to Komatsu et al. (2012). Two small triangular sections containing the arcuate nucleus were taken from either side of the bottom of the third ventricle. The pituitary gland was removed from the sella turcica and anterior and posterior sections of the pituitary gland were separated. The testes were excised and the tunica albuginea, epididymides and any excess connective tissue removed. Two sections of the parenchyma were dissected from the middle region of each testis. All samples were washed in sterile Dulbecco's phosphate-buffered saline (DPBS), snap-frozen in liquid nitrogen, and subsequently stored at −80°C pending further processing.
3.2.3 RNA isolation and purification
Total RNA was extracted from each tissue sample using RNeasy Universal plus Kit (Qiagen,
Manchester, UK). The quantity of the RNA isolated was determined by measuring the absorbance at 260 nm using a Nanodrop spectrophotometer ND-1000 (Nanodrop
Technologies, Wilmington, Delaware, US). RNA quality was assessed on the Agilent
Bioanalyzer 2100 using the RNA 6000 Nano Lab Chip kit (Agilent Technologies, Ireland).
RNA was purified using the RNA Clean and Concentrator kit (Zymo Research, Irvine, CA) and the RNA integrity number (RIN) for all samples was greater than 8.
3.2.4 RNA-Seq library preparation and sequencing
Sixty (20 calves x 3 tissues) cDNA libraries were prepared from high quality RNA using an
Illumina TruSeq RNA Sample Preparation kit v2 following the manufacturer’s instructions
(Illumina, San Diego, CA, USA). For each sample, 1μg of total RNA was used for cDNA preparation. All libraries were validated on the Agilent Bioanalyzer 2100 using the DNA
94
1000 Nano Lab Chip kit (Agilent Technologies Ireland Ltd, Dublin, Ireland). Individual
RNASeq libraries were pooled based on their respective sample-specific-6 bp adaptors and sequenced at 100 bp/sequence single-end reads using an Illumina HiSeq 2500 sequencer.
3.2.5 RNASeq data analyses
Raw sequence reads were checked for quality using FASTQC software (version 0.10.0)
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Two testes samples from the low plane of nutrition and one anterior pituitary sample from the high plane of nutrition were removed from the study due to low sequence reads. All reads passed the quality statistics and input reads were then aligned to the bovine reference genome (UMD4.0) using Spliced
Transcripts Alignment to a Reference (STAR) aligner. Reads were only aligned if they contained fewer than two mismatches with the reference genome and uniquely mapped to the reference genome. The software package HTSeq (v0.5.4p5) was used to calculate the number of sequence reads overlapping all protein coding genes from the ENSEMBLv74 annotation of the bovine genome. The number of read counts mapping to each annotated gene from HTSeq was then collated into a single file and used for calculation of subsequent differential gene expression. Genes with low read counts across all libraries were excluded from subsequent analysis. Reads were filtered out if they contained fewer than five counts per million in nine samples out of the total sample number. Only uniquely mapped reads were used for subsequent differential gene expression analysis. The R (v 3.01) Bioconductor package
EdgeR (v3.2.4), was applied to identify statistically significant differentially expressed genes
(DEGs).
3.2.6 Pathway analysis
Biological pathways were identified using GOSeq software (v1.14.0)(Young et al., 2010) and
Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway annotations (Kanehisa and
95
Goto, 2000) were used to identify biological pathways that were over-expressed among
DEGs. GOSeq is an application for executing gene ontology analysis on RNASeq data while accounting for biases (Young et al., 2010). The online tool BioMart
(www.ensembl.org/biomart/martview) was used to convert the bovine gene IDs, extracted from GOSeq, into human orthologs. These human orthologs were inputted into KEGG
(http://www.genome.jp/kegg/pathway.html). To examine the molecular functions and biological pathways, the RNASeq data were also analysed using Ingenuity Pathway Analysis
(IPA) (Ingenuity Systems, Redwood City, CA; http://www.ingenuity.com).
3.3 Results
3.3.1 Animal Performance
Weight gain and other indicators of animal performance were outlined previously. In brief, calves on a high plane of nutrition had larger testes, greater seminiferous tubule diameter, more mature spermatogenic cells and more Sertoli cells. The benefits of high plane of nutrition on the testes were validated transcriptionally in this study.
3.3.2 Differential gene expression
The RNASeq data have been deposited in NCBI’s Gene Expression Omnibus and are accessible via GEO series accession number GSE97673. The average number of raw reads for arcuate, anterior pituitary and testes samples were 16.3 million (mean ± SD; 16,319,326 ±
7,160,418), 16.3 million (16,346,430 ± 5,094,647) and 18.3 million (18,324,101 ±
7,135,544), respectively. There were 0, 49 and 1,346 DEG identified in ARC, anterior pituitary and testes tissues between animals on the two divergent planes of nutrition (P<0.05;
False Discovery Rate<0.05), respectively. A multi-dimensional scaling (MDS) plot was created in Edge-R which measured the similarity between samples from the two planes of nutrition the high and low. The MDS plot showed a lack of separation between samples from
96 the two planes of nutrition with regard to the arcuate nucleus and anterior pituitary tissue but generally good separation between samples from animals on the high compared with the low planes of nutrition in the testes tissue (Figure 3.1).
3.3.3 Pathway Analysis
There were 45 DEG out of the original 49 anterior pituitary genes (seven genes with increased expression and 38 genes with decreased expression in the low compared to the high plane of nutrition groups; Supplementary Table 1) and 1,315 DEGs out of the original 1,346 testes genes (1,049 genes with increased expression and 266 genes with decreased expression in the low compared to the high plane of nutrition; Supplementary Table 2) that mapped successfully to a molecular/biological pathway using IPA. These DEG were then analysed and allocated to a biological function within IPA. The pathways and processes most affected within anterior pituitary tissue of the calves on the low, compared to the high plane of nutrition were all related to cycle cell processes such as mitotic roles of polo-like kinase
(P<0.0001) and cell cycle: G2/M DNA damage checkpoint regulation (P<0.0001). Those pathways and processes identified as most differentially expressed within testicular tissue were super pathway of cholesterol biosynthesis (P<0.0001) and androgen biosynthesis
(P<0.0001). Information on the effect of plane of nutrition on the molecular and cellular functions and on the biochemical pathways of the anterior pituitary and testes are presented in
Figures 3.2-3.5, respectively. Gametogenesis was predicted to be increased (z-score: 2.279) in testicular tissue of the low compared to the high plane of nutrition calves (Table 3.1). Male infertility function was predicted to be decreased (z-score: -2.236) in the low compared to the high plane of nutrition group.
97
3.4 Discussion
This is the first study to investigate the effect of plane of nutrition during the early calf-hood period on the transcriptomic profile of the HPT axis in young bulls. Despite large differences in animal growth rate, metabolic status and testicular development between the nutritional treatments groups employed in the study, no DEG were detectable within tissue from the arcuate nucleus region of the hypothalamus. Offering calves a low plane of nutrition caused down regulation of processes involved in cell cycle in the anterior pituitary. The high plane of nutrition induced an increase in DEG in the testes, affecting processes involved in hormone production including androgen and cholesterol biosynthesis in comparison to the low plane of nutrition. Surprisingly, the function of ‘gametogenesis’ was predicted to be upregulated in testicular tissue of calves on the low compared with the high plane of nutrition.
3.4.1 Cholesterol Biosynthesis
Cholesterol is the precursor for all steroid hormones and its availability is vital for their optimal production (Hu et al., 2010). Additionally, cholesterol is essential for sperm cell membrane as it regulates membrane fluidity, aiding in its stabilization (Keber et al., 2013).
Cholesterol can be synthesised de novo from acetate, cholesterol ester stores in intracellular lipid droplets or the uptake of cholesterol from low density lipoprotein receptors
(LDLR)(Miller, 2007). There are five major stages in the process of cholesterol synthesis.
Firstly, two acetyl CoA molecules are converted to 3-hydroxy-3-methylglutaryl-CoA (HMG-
CoA) and HMG-CoA is converted to mevalonate. Mevalonate is converted to isopentenyl pyrophosphate (IPP), which is then converted to squalene and the final step is the transformation of squalene to cholesterol. Genes encoding for the enzymes catalysing the biosynthesis of cholesterol including mevalonate kinase (MVK), phosphomevalonate
(PMVK), disphosphomevalonate decarboxylase (MVD), dimethylallytranstransferase (FDPS),
98 lanosterol synthase (LSS), D24 sterol reductase (DHCR24), D14 sterol reductase (TM7SF2), cholesterol D-isomerase (EBP) and 7- dehydrocholesterol reductase (DHCR7) were all found to be down regulated in the low compared to the high plane of nutrition group in testicular tissue. This is of interest as under normal physiological conditions, de novo cholesterol synthesis replenishes cholesterol stores in Leydig cells (Hu et al., 2010).
The low plane of nutrition had a negative effect on genes that mediate the transport of cholesterol. Interestingly, the uptake of high density lipoprotein (HDL) cholesteryl esters via binding Apolipoprotein E (HDL-ApoE)(Fofana et al., 2000), the selective uptake pathway of
HDL cholesterol to the testes via SCARB1 (Acton et al., 1996) and the LDLR pathway(Miller, 2007) were downregulated in calves on the low plane of nutrition. Liver X receptor (LXR) has been reported to be crucial for maintaining cholesterol homeostasis in murine Sertoli cells (Robertson et al., 2005). In our study plane of nutrition had no effect on
LXR gene expression; however, the low plane of nutrition did affect its target genes such as
Apolipoprotein E (APOE; log fold expression: -2.274) which is expressed in both Sertoli cells and germ cells of sexually immature rats and the Leydig cells of sexually mature rats (Olson et al., 1994) and Scavenger receptor B1 (SCARB1; log fold expression: -1.816) which is expressed in murine Leydig cells (Casado et al., 2012). The expression of LDLR was down regulated (log fold expression: -1.789) in calves on the low compared to the high plane of nutrition, indicating that this source of cholesterol inhibited testosterone synthesis as testicular Leydig cells under certain conditions obtain plasma lipoprotein-derived cholesterol for steroid synthesis (Azhar and Reaven, 2002). In an associated study we analysed blood from the animals employed here and found greater serum testosterone concentrations in the calves on the high compared to the low plane of nutrition (Chapter 2). Therefore, down regulation of cholesterol biosynthesis will likely negatively affect androgen biosynthesis.
99
3.4.2 Androgen Biosynthesis
Androgens are crucial for optimal male reproductive function, playing important roles in maintaining spermatogenesis and sexual function. The rate of testosterone and oestradiol production is controlled by gonadotropins, LH and FSH (Hu et al., 2010). In our study we observed that FSHR (follicle stimulating hormone receptor) was down regulated in the high compared to the low plane of nutrition in the testes (log fold expression: -1.021). In the male,
FSH stimulates Sertoli cell proliferation, as well as the induction and maintenance of normal spermatogenesis (Simoni et al., 1999). Expression of FSHR mRNA and number of FSH receptors has been found to decrease with testes development as bulls mature (Dias and
Reeves, 1982). It has been reported that steroidogenic acute regulatory protein (StAR) is the primary determinant in the process of steroid synthesis (Christenson and Strauss, 2001). The expression of StAR mRNA has previously been shown to be expressed in bull testes (Pilon et al., 1997) and it regulates the transport of cholesterol from the outer into the inner mitochondrial membrane. Treating bulls with GnRH agonist caused increased testosterone biosynthesis and StAR protein in the testes (Aspden et al., 1998). In our study, calves offered the low plane of nutrition had a lower expression of StAR (log fold change: -1.914) compared to their contemporaries on the high plane of nutrition. The expression of StAR has been reported to be stimulated by IGF-1 in fetal and adult mice Leydig cells (Manna et al., 2006,
Villalpando and Lopez-Olmos, 2003). This is consistent with previous reports from our group showing greater plasma IGF-1 concentrations when the same animals in this study were offered a high compared with a low plane of nutrition (Chapter 2).
There are two pathways involved in the conversion of pregnenolone to testosterone in the
Leydig cells, Δ4 or Δ5. In the Δ5 pathway, pregnenolone is converted to 17α- hydroxypregnenolone then to dehydroepiandrosterone and finally to testosterone through
100 either androstenediol or androstenedione. Our data show that this pathway was negatively affected by the low plane of nutrition. The conversion of cholesterol to pregnenolone is catalysed by cytochrome P450 side chain cleavage enzyme (P450scc) located in the inner mitochondrial membrane (Stocco, 2001). The transcription of CYP11A1 gene encoding
P450scc regulates the quantity of P450scc and therefore, the steroidogenic function (Miller,
2007). In the current study, CYP11A1 was down regulated in the low compared to the high plane of nutrition. Genes encoding for the enzymes catalysing the formation of testosterone including 3-β-hydroxysteroid dehydrogenase (HSD3B7 and HSD3B2) and steroid D- isomerase (HSD3B2 and EBP) were down regulated in the low compared to the high plane of nutrition, which led to decreased production of testosterone. However, reducing dietary nutrient intake did not down regulate all genes related to testosterone production as 17β-HSD, which codes for the enzyme responsible for the conversion of androstenedione to testosterone, was not altered by plane of nutrition.
3.4.3 Gametogenesis
There were 11 of 87 genes displaying upregulated expression in the low plane of nutrition animals consistent with a predicted increase in gametogenesis (spermatogenesis). These genes included SIAH1, RNF2, MCM9, CTCFL, FSHR, AGFG1, DDX25, MCM8 and
KDM3A, which have all been reported to be involved in aiding gametogenesis (Garikapati et al., 2017, Lindgren et al., 2012, Kang-Decker et al., 2001). This was surprising and may be due to the low plane of nutrition calves experiencing a late spurt of early stage gametogenesis such as the development of spermatogonia whereas the high plane of nutrition calves could be at a more advance stage of spermatogenesis as indicated in the morphological data in
Chapter 2. Male infertility function was predicted to be decreased in the low plane of nutrition compared to the high. There were five genes out of 11 genes which had an
101 expression consistent with an increase in male infertility. These genes including KMT2E
(MLL5), SETX, GMCL1, SIRT1 and TDRD5; which have all been reported to be involved in aiding spermatogenesis in adult mice and humans (Yap et al., 2011, Becherel et al., 2013,
Kleiman et al., 2003, Bell et al., 2014, Yabuta et al., 2011). Gonadotropin regulated testicular
RNA helicase (GRTH/DDX25) is regulated by gonadotropin in Leydig cells and germ cells and is necessary for completion of spermatogenesis (Tsai-Morris et al., 2012). In Leydig cells, GRTH is a negative regulator of the expression of genes involved in cholesterol synthesis and transfer (SREBP2, HMG-CoA and StAR) and therefore, exhibiting control over androgen synthesis (Fukushima et al., 2011). However, as referred to earlier, we found that testosterone concentrations were significantly higher for the calves on the high compared with the low plane of nutrition from 10 weeks of age until their slaughter at 18 weeks of age and the high calves had larger testes (Brito, 2014), a greater seminiferous tubule diameter, a greater number of more spermatogenic cells and a greater number of Sertoli cells. Our research group has also reported on the effect of plane of nutrition on systemic concentrations of testosterone in Holstein Friesian bulls calves at 16 and 32 weeks of age, following an exogenous GnRH challenge (Byrne et al., 2017b). Additionally we have shown Holstein
Friesian bulls calves offered a high plane of nutrition pre six months to reach puberty (the age that a bull first produces an ejaculate yielding at least 50 x 106 spermatozoa with a minimum of 10% motility) approximately 30 days earlier that their counterparts on a lower dietary allowance (Byrne et al., 2017b). Although both functions were predicted to be upregulated in the calves on the low compared to the high treatment, the testes from the high plane of nutrition calves were at a more mature stage with regard to testes weight, seminiferous tubule diameter, stage of spermatogenesis and Sertoli cell number and lumen development at slaughter.
102
Differences in metabolic function in the ARC using microarray technologies were reported in heifer calves fed on a high concentrate diet to achieve rapid bodyweight gain, compared to contemporaries offered a high forage diet, from three-seven months of age (Allen et al.,
2012). This study found that key genes involved in satiety such as NPY and AGRP were down regulated and POMC and α-MSH were upregulated in the high concentrate heifers. The genes NPY/AGRP are well documented in have opposing roles to that of POMC/α-MSH in the control of feeding and energy expenditure(Stanley et al., 2005b (Stanley et al., 2005). It has been reported that NPY acts directly on GnRH neurons and that this may also be the case for AGRP as melanocortin agonists have direct action on GnRH neurons (Roa and Herbison,
2012). A study also carried out by the same research group using in-situ hybridisation and immunohistochemical technologies reported that increased rates of growth during the juvenile period in heifers alter the methylation pattern of genomic DNA from the ARC and such alterations may be linked to advanced age at puberty (Alves et al., 2017). Our study however, found no DEG within ARC tissue between treatments. However, the studies reported above involved animals of a different sex, age, nutritional treatment and analytical technologies compared to our study which may have contributed to the difference in findings between studies. Our study is the first to date to utilize next generation sequencing technology to examine the effect of early calf hood nutrition on the global transcriptome of
HPT tissue in Holstein-Friesian bull calves. The transcriptional profile of the ARC nucleus and anterior pituitary found in this study does not reflect the phenotype, in that the only DEG found in the anterior pituitary related to cell cycle and not specifically to metabolism or reproductive processes, as might be expected. This may be due to the transitory nature of gene transcripts in the brain (Bondy and Lee, 1993). However, while we did not detect DEG in either ARC or the anterior pituitary tissues which were specific to reproductive processes, gene expression profiles for testicular tissue were indicative of prior influence of plane of
103 nutrition on the functionality of the hypothalamic-anterior pituitary axis, upon which testicular development depends. This lack of effect on the high plane of nutrition on the arcuate nucleus and anterior pituitary gene expression may be related to the fact that the relevant neurons and cell types represent a minority of the total cell population found in this areas.
3.5 Conclusions
In conclusion, this study has demonstrated that plane of nutrition offered to young dairy bulls during the first 18 weeks of life has a significant effect on the transcriptional functionality of the testes. A low plane of nutrition during early calf hood led to a down regulation of the expression of genes affecting production of precursor cholesterol (systemic cholesterol was not measured in this study) and also the transport of both high and low density lipoprotein cholesterol transportation to the inner mitochondria from androgen biosynthesis.
Surprisingly, genes purported to be involved in gametogenesis were significantly upregulated in the low plane of nutrition in comparison to that of the high. This directly contradicts our observations on the phenotype of the low calves that had small testes, a lower number of
Sertoli cells and less mature spermatogenic cells than their counterparts offered the high plane of nutrition. Overall, our data contribute to the understanding of the molecular responsiveness of the HPT axis to early life plane of nutrition which undoubtedly affects the timing of puberty. The molecular signatures observed here, particularly in relation to testicular transcripts, could aid in the future identification of biomarkers of precocious puberty in young bulls.
104
Figure 3.1 Multidimensional scaling plot which shows the measured similarity of the samples in 2-dimensions. The samples labelled in yellow are the Holstein-Friesian dairy bulls fed on a low plane of nutrition and slaughtered at 18 weeks of age and those labelled in red are the Holstein-Friesian dairy bulls fed on a high plane of nutrition and slaughtered at 18 weeks of age. Arc=Arcuate nucleus, Pit=Anterior Pituitary, Tes=Testes. BCV = Biological Coefficient of Variation.
105
Figure 3.2 The top biochemical pathway significantly enriched in the anterior pituitary of Holstein-Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age. Greens bars represent genes down regulated and red bars up regulated genes as percentages of the overall number of genes in each pathway. The significance of each pathway is represented by the yellow line describing –log(p-value). The P-value is calculated by the number of genes from our dataset of differentially expressed genes that participate in a particular pathway and dividing it by the total number of genes in the Canonical Pathway in IPA analysis.
106
Figure 3.3: The top molecular and cellular function of differentially expressed genes of the anterior pituitary of Holstein-Friesian dairy bulls fed on a low versus high plane of nutrition and slaughtered at 18 weeks of age. The bars indicate the likelihood [-log (P-value)] that the specific molecular and cellular function was affected by a high plane of nutrition. The threshold line in the bar chart represents a p-value of 0.05.
107
Figure 3.4: The top biochemical pathway significantly enriched in the testes of Holstein- Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age. Greens bars represent genes down regulated and red bars up regulated genes as percentages of the overall number of genes in each pathway. The significance of each pathway is represented by the yellow line describing –log(p-value). The P-value is calculated by the number of genes from our dataset of differentially expressed genes that participate in a particular pathway and dividing it by the total number of genes in the Canonical Pathway in IPA analysis.
108
Figure 3.5 The top molecular and cellular function of differentially expressed genes of the anterior pituitary of Holstein-Friesian dairy bulls fed on a low versus high plane of nutrition and slaughtered at 18 weeks of age. The bars indicate the likelihood [-log (P-value)] that the specific molecular and cellular function was affected by a high plane of nutrition. The threshold line in the bar chart represents a p-value of 0.05.
109
Table 3.1a Gametogenesis genes differentially expressed in the testes tissue of the Holstein-Friesian dairy bulls feed on a low plane of nutrition in comparison to the high plane of nutrition and slaughtered at 18 weeks of age
Genes Predicted affect Expr Log Ratio SIAH1 Increased 0.545 RNF2 Increased 0.662 MCM9 Increased 0.49 CTCFL Increased 0.937 NUP153 Increased 0.48 COIL Increased 0.616 FSHR Increased 1.021 AGFG1 Increased 0.503 DDX25 Increased 0.781 MCM8 Increased 0.8 KDM3A Increased 0.615 FADS2 Decreased -1.09 TSC22D3 Decreased -0.675 ADAD1 Affected 1.456 NUP210L Affected 1.015 TSGA10 Affected 0.839 ADAMTS2 Affected -0.951 SFMBT1 Affected 0.771 TDRKH Affected 0.507 RGN Affected -1.595 ZMYND15 Affected -1.51 TEX14 Affected 0.761 HORMAD1 Affected 1.121 TDRD1 Affected 1.197 ICA1L Affected 0.913 TOPAZ1 Affected 1.329 ASZ1 Affected 0.975 CCT6B Affected 0.772 TDRD5 Affected 1.073 MORC1 Affected 1.425 SYCP2 Affected 1.255 TEX15 Affected 0.835 TEX11 Affected 0.748 AK7 Affected 0.627 SPATA22 Affected 1.32 SETX Affected 0.515 TDRD6 Affected 1.246 ZNF35 Affected 0.517 PIWIL4 Affected 1.223 GMCL1 Affected 0.808 TEX12 Affected 1.329 GATM Affected 0.764 IQCG Affected 0.943 CCNYL1 Affected 0.72 SHCBP1L Affected 1.21 MNS1 Affected 0.851
110
Table 3.1b Continuation of gametogenesis genes differentially expressed in the testes tissue of the Holstein-Friesian dairy bulls feed on a low plane of nutrition in comparison to the high plane of nutrition and slaughtered at 18 weeks of age Genes Predicted affect Expr Log Ratio ADGRG2 Affected 1.234 CYP11A1 Affected -1.772 STAR Affected -1.914 SCARB1 Affected -1.816 WDR48 Affected 0.567 INSL3 Affected -1.78 NEK1 Affected 0.514 ACVR2A Affected 0.769 SYCP3 Affected 1.301 CLIP1 Affected 0.481 CREM Affected 0.94 KHDRBS3 Affected 0.831 MAEL Affected 1.035 TIAL1 Affected 0.633 ETV5 Affected 0.551 SMC1B Affected 1.254 CLOCK Affected 0.489 MLH1 Affected 0.362 FANCD2 Affected 0.82 BRCA2 Affected 0.724 FANCC Affected 0.561 RPS6 Affected 0.629 TDRD7 Affected 0.645 DAZL Affected 1.002 ARID4A Affected 0.656 HSPA4L Affected 1.012 SIRT1 Affected 0.804 UBE2J1 Affected 0.541 DDX4 Affected 1.304 YY1 Affected 0.552 SYCP1 Affected 1.16 RNF17 Affected 1.294 PIWIL2 Affected 0.892 FOS Affected -1.124 BRCA1 Affected 0.671 CCNB1IP1 Affected 0.808 HSF2 Affected 0.905 NR6A1 Affected 0.803 CCDC169-SOHLH2 Affected 0.86 TBPL1 Affected 0.635 HOOK1 Affected 0.694
111
CHAPTER 4: Effect of Early Calf-Hood Nutrition on
the Transcriptomic Profile of Subcutaneous Adipose
Tissue in Holstein-Friesian Bulls
Anne-Marie English, Sineád M. Waters, Paul Cormican, Colin J. Byrne, Seán Fair, David A. Kenny. “Effect of Early Calf-Hood Nutrition on the Transcriptomic Profile of Subcutaneous Adipose Tissue in Holstein-Friesian Bulls”, BMC Genomics (Submitted).
112
4.1 Abstract
Adipose tissue is a major endocrine organ and is thought to play a central role in the metabolic control of reproductive function in cattle. Plane of nutrition during early life has been shown to influence the timing of puberty in both male and female cattle, though the exact biological mechanisms involved are currently unknown. The aim of this study was to investigate the effect of early calf-hood nutrition on the transcriptomic profile of subcutaneous adipose tissue in Holstein-Friesian bulls to identify possible downstream effects on reproductive physiology. Holstein-Friesian bull calves with a mean (±S.D.) age and bodyweight of 19 (±8.2) days and 47.5 (±5.3) kg, respectively, were assigned to either a high
(n=10) or low (n=10) plane of nutrition. At 126 days of age, the bulls were euthanized, subcutaneous adipose tissue samples were harvested and RNASeq analysis was performed.
There were 674 genes differentially expressed in adipose tissue of calves on the low compared with the high plane of nutrition (P<0.05; FDR<0.05; fold change >2.0). High plane of nutrition positively altered the expression of genes across an array of putative biological processes but the most dominant cellular processes affected were cellular energy production and branched chain amino acid degradation. A high plane of nutrition caused upregulation of genes such as leptin (LEP) and AdipoQ, which are known to directly affect reproductive function. These results provide an insight into the effect of augmenting the plane of nutrition of Holstein-Friesian bull calves in the prepubertal period on the transcriptome of adipose tissue.
Keywords: Gene Expression, Reproduction, Adipogenesis, Amino Acids, Mitochondrial
Dysfunction, Puberty
113
4.2 Introduction
The advent of genomic selection in the dairy industry has resulted in the identification of sires for use in artificial insemination within weeks of birth and semen from these young bulls is in high demand once they reach puberty. Studies have shown that plane of nutrition in early calf-hood plays a critical role in the timing of the onset of puberty in bulls (Brito et al.,
2007b, Dance et al., 2015, Byrne et al., 2017b). Recently, our research group has demonstrated that a high plane of nutrition prior to, but not after six months of age can accelerate puberty in Holstein-Friesian bulls by approximately one month (Byrne et al.,
2017b). This has been associated with the advancement of a transient rise in systemic concentrations of LH, which normally occurs between approximately 8 and 20 weeks of age
(Rawlings et al., 2008). There are many organs implicated in signalling nutritional status to the hypothalamus and anterior pituitary to stimulate GnRH and LH secretion, respectively, with white adipose tissue (WAT) key amongst these.
White adipose tissue has traditionally been known for its role in energy storage and release when energy expenditure is greater than energy intake; however, WAT is metabolically active and can therefore influence many bodily systems. The function of WAT in metabolic and reproductive processes is complex but it has been postulated that there is cross-talk between adipokines and the HPT axis. Adipogenesis and fat development are influenced by genetics, diet, body depot location and age (Jin et al., 2012, Romao et al., 2014). There is evidence that offering calves high starch diet during early calf hood induces precocious adipogenesis and lipid filling (Graugnard et al., 2010). It is postulated that the period of potential for stem cells to differentiate into adipocytes is very limited during early life development (Wang et al., 2009a). Adipose hormones such as leptin production increases proportionally in line with an increase in body fat (Landry et al., 2013); evidently then, it is a signal of energy sufficiency (Sanchez-Garrido and Tena-Sempere, 2013). It has been reported
114 that subcutaneous adipose tissue has a higher concentration of both leptin and AdipoQ protein than that of visceral adipose (Ouchi et al., 2011). Leptin signals various bodily systems, including the HPT axis, of metabolic energy status and reserves (Ahima et al.,
2000). Studies have shown that while there is an absence of leptin receptors on some key reproductively related cells such as GnRH neurons (Quennell et al., 2009); the effects of leptin on GnRH release have been shown to be mediated by kisspeptin in some species
(Smith et al., 2006). AdipoQ, another adipokine hormone, has been shown to have its receptors, ADIPOR1 and ADIPOR2, expressed in the anterior pituitary and the ARC in the hypothalamus of cows (Tabandeh et al., 2011); therefore, AdipoQ employs two potential pathways to signal to the HPT axis.
It has been reported in children that consistent excessive energy intake during early life development can contribute to precocious puberty (Aksglaede et al., 2009). In bull calves of dairy breeds early pubertal onset is advantageous to facilitate early semen collection. The exact metabolic mechanisms are unknown; hence this study aimed to examine the effect of early life plane of nutrition on global gene expression profiles of adipose tissue in Holstein-
Friesian bulls within the particular context of potential latent implications for HPT function.
Much of the published work to-date on this topic has focused on the effect of bbody condition score (BCS) on adipose tissue hormone signalling in post pubertal animals and there is a dearth of information on the role of adipose tissue in stimulating the HPT axis and its potential as a key regulator of the timing of puberty onset in cattle.
4.3 Materials and methods
All procedures involving animals were approved by the Teagasc Animal Ethics Committee and were licensed by the Health Products Regulatory Authority, Ireland in accordance with the European Union Directive 2010/36/EU.
115
4.3.1 Animal model
This experiment was conducted as part of a larger study designed to examine the effect of early calf-hood nutrition on the physiological control of the HPT axis. Holstein-Friesian bull calves (n=20) with a mean (±S.D.) age and bodyweight of 19 (±8.2) days and 47.5 (±5.3) kg, were purchased from commercial dairy farms and blocked based on sire, initial weight, farm of origin and age and assigned to either a high (n=10) or low (n=10) plane of nutrition.
Calves were individually fed milk replacer and concentrates using an electronic feeding system (Forster-Tecknik Vario, Engen, Germany). After five days of acclimatisation, the high treatment were offered 1200 g of milk replacer in 8 L of water daily, together with concentrate ad libitum. Animals in the low treatment group were allocated 500 g of milk replacer in 4 L of water and a further allocation of a maximum of 1 kg of concentrate daily.
All calves were weaned when consuming a minimum of 1 kg of concentrate for 3 consecutive days, at a mean age (±S.D.) of 82 (±3.9) days. Following weaning, the high treatment group was offered ad libitum concentrates, while the low treatment group received 1 kg of concentrate daily. All calves had individual daily access to approximately 0.5 kg of straw as well as ad libitum access to fresh water.
4.3.2 Tissue collection
The calves were euthanized at a mean age (±S.D.) of 126 (±1.1) days, using an intravenous overdose of sodium pentobarbitone. Death was confirmed by lack of ocular response.
Subcutaneous adipose samples were obtained from the flank of the carcass following slaughter and subsamples were either (i) snap-frozen in liquid nitrogen and subsequently stored at -80°C for long term storage pending further analysis or (ii) fixed in 10% neutral buffered formalin (Sigma-Aldrich, Wicklow, Ireland) and embedded in paraffin in accordance to the standard procedures. Sections (5 µm thick) were dehydrated in ascending
116 concentrations grades of alcohol, followed by clearing with xylene and were stained for gross anatomy using H&E stain.
4.3.3 Adipocyte cell number and diameter
Adipocyte cell number and cell size were analysed using Aperio ImageScope (v12; Leica
Biosystems, Wetzlar, Germany). Five square sections (0.25 mm2) were electronically generated and randomly assigned on each slide and every adipocyte within these square sections was counted manually. The diameter of 200 adipocytes per animal, selected at random, within these square sections was measured at the widest point for each cell, using the ruler tool from the ImageScope software.
4.3.4 RNA isolation and purification
Total RNA was extracted using RNeasy Lipid Tissue Mini kit (Qiagen, Manchester, UK).
RNA was purified using the RNA Clean & Concentrator kit (Zymo Research, Irvine, CA,
USA). The quantity of the RNA isolated was determined by measuring the absorbance at 260 nm using a Nanodrop spectrophotometer ND-1000 (Nanodrop Technologies, Wilmington,
DE, USA). RNA quality was assessed on the Agilent Bioanalyzer 2100 (Agilent
Technologies Ireland Ltd, Dublin, Ireland) using the RNA 6000 Nano Lab Chip kit (Agilent
Technologies Ireland Ltd, Dublin, Ireland). Samples had an RNA Integrity Number (RIN) of mean (±SD) of 7.6 (±0.77).
4.3.5 RNASeq library preparation and sequencing
Twenty cDNA libraries were prepared from high quality RNA using an Illumina TruSeq
RNA Sample Preparation kit v2 following the manufacturer’s instructions (Illumina, San
Diego, CA, USA). For each sample, 1μg of total RNA was used for cDNA preparation. All libraries were validated on the Agilent Bioanalyzer 2100 using the DNA 1000 Nano Lab
Chip kit (Agilent Technologies Ireland Ltd, Dublin, Ireland). Individual RNASeq libraries
117 were pooled (10 libraries per lane) based on their respective sample-specific-6 bp adaptors and sequenced at 100 bp/sequence single-end reads using an Illumina HiSeq 2500 sequencer.
4.3.6 RNASeq data analyses
Raw sequence reads were checked for quality using FASTQC software (version 0.10.0)
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Input reads were then aligned to the bovine reference genome (UMD3.1) using Spliced Transcripts Alignment to a
Reference (STAR) aligner. Reads were only aligned if they contained fewer than two mismatches with the reference genome and uniquely mapped to the reference genome. The software package HTSeq (v0.5.4p5) was used to calculate the number of sequence reads overlapping all protein coding genes from the ENSEMBLv74 annotation of the bovine genome. The number of read counts mapping to each annotated gene from HTSeq was then collated into a single file and used for calculation of subsequent differential gene expression.
Only uniquely mapped reads were used for subsequent differential gene expression analysis.
Genes with low read counts across all libraries were excluded from subsequent analysis. The
R (v 3.01) Bioconductor package EdgeR (v3.2.4), was applied to identify statistically significant differentially expressed genes (DEG).
4.3.7 Pathway analysis
Biological pathways were identified using GOSeq software (v1.14.0; Young et al., 2010) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway annotations (Kanehisa and Goto, 2000) were used to identify biological pathways that were over-expressed among
DEG. GOSeq is an application for executing gene ontology analysis on RNASeq data while accounting for biases (Young et al., 2010). The online tool BioMart
(www.ensembl.org/biomart/martview) was used to convert the bovine gene IDs, extracted from GOSeq, into human orthologs. These human orthologs were inputted into KEGG
118
(http://www.genome.jp/kegg/pathway.html). To examine the molecular functions and biological pathways, the RNASeq data was also analysed using Ingenuity Pathway Analysis
(IPA) (Ingenuity Systems, Redwood City, CA; http://www.ingenuity.com).
4.3.8 Statistical analysis
Data for adipocyte cell size and number were analysed using Statistical Analysis Software
(SAS v9.3) and were tested for normality of distribution (UNIVARIATE procedure). Data were found to be normally distributed and were statistically analysed using ANOVA
(MIXED procedure). Block was included as a variable. Animal was the experimental unit in all analysis and was included as a random effect. All results are presented as mean ± s.e.m.
4.4 Results
4.4.1 Animal performance and adipose tissue histology
Average daily bodyweight gain from the start to the end of the study was 1.08 (± 0.03) and
0.57 (± 0.03) for high and low plane of nutrition groups, respectively and this translated into a bodyweight difference of 53.8 kg at slaughter between the bulls of the high compared to the low treatment group (160.9 ± 3.98 kg versus 107.1 ± 3.19 kg, respectively; P<0.001).
Adipocyte cell number (291 ± 47.2 cells/1.25 mm2 versus 7.5 ± 4.0 cells/1.25 mm2,
P<0.001; Figure 4.4) and cell diameter (36.9 ± 2.89 µm versus 3.7 ± 1.94 µm, P<0.001) were both greater in the high compared with the low plane of nutrition animals, respectively.
4.4.2 Differential gene expression
The mean ± SD number of raw reads per sample was; 18,670,029 ± 4,093,759.
Approximately 89 % of the reads were uniquely mapped to the reference bovine genome after alignment. A multi-dimensional scaling (MDS) plot was created in Edge-R which estimated the degree of similarity between samples from the high compared to the low nutritional treatments. The MDS plot showed a separation between the two treatments (Figure 4.1).
119
There were 745 differentially expressed genes (DEG) between the two nutritional treatments
(P<0.05; False Discovery Rate<0.05; fold change >2.0). One hundred and sixty four genes had increased expression, while 581 had decreased expression. The RNASeq data have been deposited in NCBI’s Gene Expression Omnibus and area accessible via GEO series accession number GSE97674.
4.4.3 Pathway analysis
There were 678 DEG from the original 745 that mapped successfully to a molecular/biological pathway using IPA and these DEG were analysed and allocated to a biological function within IPA. Information on the effect of nutritional treatment on the molecular and cellular functions and on the biochemical pathways affected are presented in
Figures 4.2 and 4.3, respectively. Results of KEGG pathway analysis using GOSeq (FDR
<0.05) indicated that 23 KEGG pathways were over-represented among DEG in the low treatment compared to the high treatment at 18 weeks of age (Table 4.1). These enriched pathways included metabolic pathways, valine, leucine and isoleucine degradation and citrate cycle. After analysis using IPA, the following pathways and processes were identified as the most influenced by the differential nutritional regimen at the level of subcutaneous adipose tissue: energy production via mitochondrial dysfunction (P<0.0001), oxidative phosphorylation (P<0.0001), and tricarboxylic acid (TCA) cycle II (P<0.0001), amino acid metabolism via valine and isoleucine metabolism (P<0.0001). The directionality of the DEG relating to mitochondrial dysfunction, oxidative phosphorylation, TCA, valine and isoleucine degradation suggest upregulation of these pathways in the high treatment in comparison to the low treatment.
A total of 25 networks, regarded as having biological significance were identified (Table
4.2). Particular networks of interest including energy production, lipid metabolism and small
120 molecule biochemistry (Network 4) were identified as being enriched in the high compared to the low treatment. This network highlighted 28 associated molecules, 24 of which were upregulated, and 4 of which were down regulated in the high compared to the low treatment.
Of particular interest, ADIPOQ (-1.62 log fold change) and its receptor ADIPOR2 (-1.772 log fold change) and LEP (leptin; -4.541 log fold change) were upregulated in the high compared to the low treatment. Using the Molecule Activity Predictor (MAP) function in IPA insulin has been predicted to be inhibited in the low compared to the high treatment .
4.4.4 Lipogenesis and adipogenesis
Animals on the low plane of nutrition had a lower of expression of MLXIPL (MLX interacting protein-like, also known as ChREBP; -1.375 log fold change), a transcription factor that regulates lipogenesis and adipogenesis, in comparison to the high plane of nutrition. Target genes linked with adipocyte differentiation were down regulated in the low treatment in comparison to the high treatment, such as DGAT2 (diacylglycerol acyltransferase 2; -5.215 log fold change), FASN (fatty acid synthetase; -5-184 log fold change), ACACA (acetyl-CoA carboxylase-α; -3.432 log fold change), LPL (lipoprotein lipase; -3.241 log fold change), PLIN1 (Perilipin 1; -2.279 log fold change) and FABP4 (fatty acid-binding protein 4; -2.273 log fold change), INSIG-1 (insulin-induced gene 1; -3.216 log fold change) and GDF-10 (growth differentiation factor 10; -2.014). Genes that act as inhibitors for adipogenesis such as GATA2 (GATA binding protein 2; 1.151 log fold change) and WNT2B (Wnt family member 2B; 1.672 log fold change) were up regulated in the low plane of nutrition compared to the high.
4.5 Discussion
This is the first study to apply next generation sequencing technology to examine the effect of early calf-hood nutrition on the transcriptomic profile of subcutaneous adipose in calves. The
121 histological and mRNA expression data indicate much lower adiposity (number and size of adipocytes) and greater number of preadipocytes in the calves subjected to the low plane of nutrition. This was consistent with evidence for the high plane of nutrition inducing an increase in both energy production and amino acid metabolic pathways in comparison to the low treatment. The ‘energy production, lipid metabolism and small molecule biochemistry network’ was also found to be enriched in the high compared to the low group with certain genes of particular interest within this network, including ADIPOQ, ADIPOR2 and LEP all consistent with increased adipogenesis and all upregulated in the high treatment group.
4.5.1 Lipogenesis and adipogenesis
It has been postulated that rapid growth during the post weaning period in humans can cause preadipocytes to enter terminal differentiation (Hausman et al., 2009). Some transcription factors have been highlighted as regulators of lipogenesis and adipogenesis at a transcriptional level, including sterol regulatory element binding factor 1 (SREBF1) and
MLXIPL (Loor, 2010). The calves on the low plane of nutrition in our study had lower expression of MLXIPL in comparison to their contemporaries on the high plane of nutrition, which was supported by the complementary histology data. It has been reported that
MLXIPL expression levels increase during preadipocyte differentiation in humans, mice and rats; however, there was a dramatic decrease in MLXIPL expression when cell differentiation took place in the absence of insulin (Hurtado del Pozo et al., 2011, He et al., 2004). It is well accepted that insulin is a metabolically active hormone responsible for anabolic processes promoting growth, development, and nutrient homeostasis (Taniguchi et al., 2006, Cheng et al., 2010). Indeed we recorded greater plasma concentrations of insulin in the high compared with the low treatment groups at the time of slaughter (data not presented), although no differences were observed at the mRNA level. Insulin-induced gene-1 (INSIG-1) has been reported to mediate sterol regulatory element binding protein-1c (SREBP-c) which is a
122 transcription factor involved in the regulation of the effect of insulin on lipid metabolism and adipogenesis (Dong and Tang, 2010). Studies have indicated that INSIG-1 increases in the fat tissue of mice developing diet induced obesity and also in differentiating 3T3-L1 preadipocytes (Li et al., 2003). This highlights the importance of insulin in lipogenesis.
In a recent study (Ambele et al., 2016) the authors reported a transcriptomic analysis of adipogenesis in human adipocyte tissue and identified a variety of genes as general adipocyte markers such as FABP4, PLIN1, LPL and ADIPOQ. These genes had increased expression during adipogenic differentiation consistent with the findings of others (Ullah et al., 2013).
Upregulation of FABP4, FASN, ACACA and DGAT2 mRNA, which are target genes of
PPARγ, are required for fatty acid biosynthesis and adipocyte differentiation (Obregon, 2008,
Hausman et al., 2009). FASN is critical in the process of synthesising long chain saturated fatty acids and its function is inhibited by fasting (Wakil, 1989). Down regulation of ACACA has been reported in calorie restriction in adipose and liver tissue in pigs (Lkhagvadorj et al.,
2010) and muscle in cattle (Keogh et al., 2016). It has been hypothesised that leptin controls adipocyte size via influencing DGAT expression (Suzuki et al., 2005). Even though, no difference in PPARγ expression was determined in our study, downstream genes affected by
PPARγ were downregulated in tissue from the animals on the low plane of nutrition. There was no evidence of BMP (bone morphogenic protein) expression being affected by plane of nutrition. However, GDF10 which is linked to BMP3 was found to downregulated on the low plane of nutrition. As well as a down regulation in genes that stimulate adipogenesis, in our study we found an upregulation in a key gene found to inhibit adipogenesis in the low plane of nutrition compared to the high plane of nutrition. It has been reported that GATA2 is expressed in preadipocytes and is down-regulated during terminal differentiation (Tong et al.,
2000). Studies in mouse preadipocytes show that GATA2 inhibits adipogenesis and traps cells at preadipocyte stage by direct suppression of PPARγ (Tong et al., 2000). In addition,
123 the histological data showing much lower adiposity (number and size of adipocytes) and greater number of preadipocytes in the animals on the low plane of nutrition corroborates the transcriptomic data aforementioned.
4.5.2 Endocrine regulatory networks
Insulin plays a role in regulating the synthesis and secretion of leptin, as adipocytes cultured in the presence of insulin increased the synthesis and secretion of leptin (Kim et al., 1998,
Barr et al., 1997). It is therefore unsurprising that IPA predicted, when applied to our data, the stimulation of insulin as well as the known upregulation of LGALS12, BCAT2 and
ADIPOQ, which are all located upstream of LEP and likely resulted in LEP to be upregulated in the high treatment. Plasma leptin is positively correlated with body fat in growing cattle (Ehrhardt et al., 2000) where it has been shown to signal energy abundance by informing the various bodily systems, including the HPT axis, of the prevailing metabolic status and energy reserves via circulating leptin protein concentrations (Ahima et al., 2000).
For example, in adult animals, studies which examined the adipose tissue transcriptome of pre-partum dairy cows have shown that cows with greater BCS had greater expression of
LEP (Vailati-Riboni et al., 2016). Consistent with this we found that calves on the high plane of nutrition in our study had >4.5 log fold higher LEP expression compared with animals the low animals. Despite this, when plasma concentrations were assayed, we failed to find any difference in leptin protein concentrations between the two groups (Chapter 2). This is in agreement with studies in young dairy and beef bulls (Brito et al., 2007b, Byrne et al., 2017c,
Dance et al., 2015). The lack of differences in plasma leptin concentrations may be due to the minute quantity of adipose tissue laid down in calves at this stage of development and/or the relative insensitivity of protein immunoassays compared with transcript based molecular approaches.
124
Leptin does not directly affect GnRH neurons of the hypothalamus and knocking out of leptin receptors on the GnRH neurons does not apparently delay the onset of puberty nor indeed affect subsequent fertility (Quennell et al., 2009). However, leptin has been found to indirectly influence the timing of puberty via the regulation of the hypothalamic KISS1 neurons’ stimulation of GnRH (Sanchez-Garrido and Tena-Sempere, 2013). Leptin can also bypass the hypothalamus and act on the pituitary gland and the testes; with leptin modestly stimulating gonadotropin secretion at a pituitary level and both direct stimulatory and inhibitory actions of leptin been reported in the gonads (Tena-Sempere, 2007). At high leptin concentrations, it has been reported to inhibit testosterone secretion in vitro in adult rats but to have no effect in pubertal rats (Tena-Sempere et al., 1999). This is possibly due to the fact that pubertal testes produce more 5α-reduced androgens than testosterone (Corpéchot et al.,
1981). In research carried out by Byrne et al. (2017b) bulls which had experienced dietary restriction prior to six months of age and an increase in plane of nutrition post six months of age leading to an increase in leptin concentration, were older at puberty than their contemporaries offered a high plane of nutrition; highlighting the importance of early life nutrition on age at puberty.
AdipoQ functions in the regulation of lipid and glucose metabolism, insulin sensitivity as well as inflammation (Kadowaki et al., 2006, Ahima and Lazar, 2008, Galic et al., 2010). Its concentration in blood has been shown to be negatively correlated to adipocyte size (Hammes et al., 2012). Food intake inhibits ADIPOQ mRNA expression in WAT and therefore, inhibits
AdipoQ concentration in serum (Steinberg and Kemp, 2007). Globular AdipoQ protein has been found to inhibit the secretion of GnRH in GT1-7 cells derived from mouse hypothalamic GnRH neurons via the mediation of adenosine monophosphate-activated protein kinase (AMPK; Wen et al., 2008) . However, high doses of adiponectin in MA-10 mouse Leydig cells has been reported to advance progesterone production through an
125 increase in StAR and the CYP11A1 steroidogenesis enzyme, suggesting that AdipoQ could stimulate testosterone production from the Leydig cells (Landry et al., 2015). It has also been shown that adiponectin reduces LH secretion directly from the gonadotropes in the anterior pituitary via AMPK (Lu et al., 2008). Pre-pubertal children with increased body mass index
(BMI), though not classified as obese, had lower AdipoQ concentration in subcutaneous adipose (Sabin et al., 2006). Similarly, postpartum cows, in negative energy balance had decreased ADIPOR1 and ADIPOR2 abundance in subcutaneous adipose compared to antepartum cows (Lemor et al., 2009) which is in agreement with our findings with calves where we found AdipoQ and its receptor ADIPOR2 were downregulated in the low compared to the high treatment groups. It has been reported that ADIPOR2 null mice demonstrated seminiferous tubules with aspermia but had normal testosterone concentration
(Bjursell et al., 2007). It has also been found that the abundance of AdipoQ, ADIPOR1 and
ADIPOR2 is greater in high fertility compared to that of medium and low fertility Holstein bulls (Kasimanickam et al., 2013). There was no difference in serum concentrations of
AdipoQ between the two groups in the current study (Chapter 2), which like leptin may be due to the overall low adipose deposition in young bull calves. Using a very similar animal model and the same assays as those employed here, Byrne et al. (2017b) similarly observed in leptin and AdipoQ concentrations during the same development as reported here.
However, from eight months on age onwards, bull calves offered a high plane of nutrition had greater leptin compared to their contemporaries on a moderate plane of nutrition (ADG c.0.65 kg/day)
4.5.3 Branched chain amino acid metabolism
Branched chain amino acids (BCAAs), leucine, isoleucine and valine are essential amino acids and, unlike other amino acids which are catabolized by the liver, BCAAs are catabolized mainly in the muscle, adipose, kidney and the brain; as the liver does not contain
126 the branched amino acid transferase enzyme (BCAT2), necessary for BCAA catabolism
(Herman et al., 2010). The isoleucine/valine degradation pathway enters the TCA cycle either directly or via an acetyl derived intermediate and in this study we found that genes involved in the valine degradation pathway encoding BCAT2, 2-oxoisovalerate dehydrogenase
(BCKDHB and DLD), 2-methylacyl-CoA dehydrogenase (ACADSB), enoyl-CoA hydratase
(ECHS1, EHHADH, HADHA and HADHB), 3-hydroxyisobutyryl-CoA hydrolase (HIBCH), methylmalonate-semialdehyde dehydrogenase (ALDH6A1) and (S)-3-amino-2- methylpropionate transaminase (ABAT) were all down regulated in the low in contrast to the high treatment. Similarly, within the isoleucine degradation pathway, genes encoding for branched-chain-amino-acid transaminase (BCAT2), branched-chain α-keto acid dehydrogenase complex (DLD), 2-methylacyl-CoA dehydrogenase (ACADSB), enoyl-CoA hydratase (ECHS1, EHHADH, HADHA and HADHB), 3-hydroxy-2-methybutyryl-CoA dehydrogenase (HSD17B10) and acetyl-CoA C-acetyltransferase (ACAT1) were down regulated in the low compared to the high treatment. Expression of genes involved in branched chain amino acids metabolism were upregulated during 3T3-L1 adipocyte differentiation (Frerman et al., 1983, Kedishvili et al., 1994) suggesting that BCAA are involved in fatty acid synthesis (Crown et al., 2016). It has also been shown that BCCA, especially leucine, systemic concentrations increase leptin secretion in vitro in murine (Lynch et al., 2006) and decreases food intake in vitro in rats (Cota et al., 2006). Systemic concentrations of branched chain amino acid are elevated in response to over nutrition in children and adolescents (McCormack et al., 2013). Therefore, it is reasonable to suggest that the evidence for a decline in BCAA degradation may be a result of the moderate restriction in dietary allowance experienced by our low plane of nutrition calves. The BCAA catabolic by- products mentioned in this study are intended for integration into the TCA cycle and
127 therefore, any down regulation of the BCAA degradation pathway would cause a decrease in mitochondrial respiration in existing adipocytes (Pietiläinen et al., 2008).
4.5.4 Energy production and mitochondrial dysfunction
Mitochondria are key organelles in cellular energetics as they catabolise carbohydrates, lipids and proteins to synthesise ATP and metabolites for not only growth but also adipocyte differentiation and maturation (De Pauw et al., 2009). There are four stages involved in aerobic respiration. Glycolysis occurs in the cytoplasm and the remaining steps, pyruvate oxidation, the TCA cycle and electron transport chain and chemiosmosis (as employed in oxidative phosphorylation) take place within the inner membrane of the mitochondria
(Goldenthal and Marin-Garcia, 2004). The two pyruvate molecules, the products of glycolysis, enter the mitochondrion and are converted to acetyl CoA. Acetyl CoA enters the
TCA cycle which drives the cycle to produce nicotinamide-adenine dinucleotide (NADH),
ATP and reduced flavin adenine dinucleotide (FADH2). Genes encoding for citrate synthase
(CS) namely, aconitase (ACO1 and ACO2), isocitrate dehydrogenase (IDH3B), α- ketoglutarate dehydrogenase (OGDH and DLD), succinyl-CoA synthetase (SUCLG1), fumarase (FH) and malate dehydrogenase (MDH1), were all found to be down regulated in the low compared to the high treatment. NADH and FADH2 donate electrons to the electron transport chain, which powers ATP synthesis via oxidative phosphorylation. Genes associated with NADH dehydrogenase Complex I, succinate dehydrogenase Complex II, ubiquinol-cyt c oxidoreductase Complex III, cytochrome c oxidase Complex IV and ATP synthase Complex V were down regulated in the low plane of nutrition compared to the high plane of nutrition (Table 4.3). It has been reported that there is an increase in mRNA expression of nucleus-encoded mitochondrial genes for enzymes such as pyruvate carboxylase and pyruvate dehydrogenase complex during differentiating 3T3-L1 adipocytes
(Wilson-Fritch et al., 2003). Pyruvate carboxylase has been found to be overexpressed upon
128 conversion of preadipocytes to adipocytes (Owen et al., 2002). This is consistent with the results of our study where the high plane of nutrition calves were at a more advanced stage of adipocyte differentiation, at tissue recovery, as indicated by the significant number of adipocytes following histological investigation when compared with their lower nutrition counterparts.
4.6 Conclusion
This study clearly demonstrates that the prevailing plane of nutrition of bull calves during the first 18 weeks of life can have a significant effect on the transcriptional and morphological functionality of subcutaneous adipose tissue. A high plane of nutrition during early calf hood has been shown to positively affect adipokines, leptin and AdipoQ whose functions include signalling metabolic status to the reproductive system. The data generated in this study broaden our knowledge base around the potential molecular processes underlying the biological cross-talk between peripheral tissues that may be metabolic mediators of important events such as timing of puberty onset etc. Furthermore, global differential gene expression patterns provide data which may have implications for the selection of robust biomarkers to identify animals with superior genetic potential for early pubertal onset, greater carcass adiposity and other economically important traits, shown to be latently affected by early life plane of nutrition.
129
Figure 4.1: Multidimensional scaling plot which shows the measured similarity of the samples in 2-dimensions. The samples labelled in yellow are the subcutaneous adipose tissue of Holstein-Friesian dairy bulls fed on a low plane of nutrition and slaughtered at 18 weeks of age and those labelled in red are the subcutaneous adipose tissue of Holstein-Friesian dairy bulls fed on a high plane of nutrition and slaughtered at 18 weeks of age. BCV = Biological
Coefficient of Variation.
130
Figure 4.2: Top molecular and cellular function of differentially expressed genes of the subcutaneous adipose tissue of Holstein-Friesian dairy bulls fed on a low versus high plane of nutrition and slaughtered at 18 weeks of age. The bars indicate the likelihood [-log (P-value)] that the specific molecular and cellular function was affected by a high plane of nutrition. The threshold line in the bar chart represents a p-value of 0.05
131
Figure 4.3: Top biochemical pathway significantly enriched in the subcutaneous adipose tissue of Holstein-Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age. Greens bars represent genes down regulated and red bars up regulated genes as percentages of the overall number of genes in each pathway. The significance of each pathway is represented by the orange line describing –log(p-value). The numbers along the right hand side indicate the number of genes in total involved in each pathway. The P-value is calculated by the number of genes from our dataset of differentially expressed genes that participate in a particular pathway and dividing it by the total number of genes in the Canonical Pathway in Ingenuity Pathways Analysis (IPA) analysis.
132
Adipocytes Preadipocytes Blood vessel Adipocytes Preadipocytes
es
Figure 4.4: Light micrograph of subcutaneous adipose tissue stained with haematoxylin and eosin. A; High plane of nutrition had large areas of adipocytes (400x), B; Low plane of nutrition had small pockets of adipocytes (400x).
133
Table 4.1: Genes differentially expressed in the subcutaneous adipose tissue of Holstein- Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition and slaughtered at 18 weeks of age returned by GOSeq (P<0.05; False Discovery Rate<0.05: fold change>2.0).
134
Table 4.2: Network of biological interest generated through network analysis using Ingenuity Pathway Analysis (IPA) of subcutaneous adipose tissue of Holstein-Friesian dairy bulls fed on a low plane of nutrition in comparison to a high plane of nutrition, slaughtered at 18 weeks of age.
Network Top Functions Affected Molecules in Network Score Focus ID Molecules 4 Energy ABLIM2, ACAT1, ADIPOQ, ADIPOR2, 39 28 Production, ALDOA, BCAT2, CISD1, CKB, FABP4, Lipid FITM2, GPD1, HOMER2, LEP, Metabolism, LGALS12, MT-ND1, MT-ND6, Small NDUFB5, NDUFB8, NDUFS2, Molecule NDUFV1, NNAT, NR4A1, SNCA, Biochemistry SORBS1, SYNE2, TUSC5 Molecules highlighted in bold are downregulated in the low plane of nutrition in comparison to the high plane of nutrition
135
Table 4.3: Oxidative Phosphorylation genes differentially expressed in the subcutaneous adipose tissue of the Holstein-Friesian dairy bulls feed on a low plane of nutrition in comparison to a high plane of nutrition and slaughtered at 18 weeks of age.
Symbol Gene Name Log Fold Change Complex I NDUFA4 NDUFA4, mitochondrial complex associated -1.472 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 -1.117 NDUFA8 NADH:ubiquinone oxidoreductase subunit A8 -1.134 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 -1.202 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 -1.221 NDUFB3 NADH:ubiquinone oxidoreductase subunit B3 -1.401 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 -1.269 NDUFB8 NADH:ubiquinone oxidoreductase subunit B8 -1.137 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 -1.711 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 -1.464 NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 -1.196 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 -1.494 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 -1.328 NDUFV1 NADH:ubiquinone oxidoreductase core subunit V1 -1.703 MT-ND1 NADH dehydrogenase, subunit 1 (complex I) -1.058 MT-ND2 MTND2 -1.182 MT-ND3 NADH dehydrogenase, subunit 3 (complex I) -1.035 MT-ND4 NADH dehydrogenase, subunit 4 (complex I) -1.522 MT-ND5 NADH dehydrogenase, subunit 5 (complex I) -1.848 MT-ND4L NADH dehydrogenase, subunit 4L (complex I) -1.552 Complex III UQCR10 ubiquinol-cytochrome c reductase, complex III subunit X -1.629 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI -1.217 UQCRB ubiquinol-cytochrome c reductase binding protein -1.498 UQCRC1 ubiquinol-cytochrome c reductase core protein I -1.479 UQCRC2 ubiquinol-cytochrome c reductase core protein II -1.532 MT-CYB cytochrome b -1.647 Complex IV COX5A cytochrome c oxidase subunit 5A -1.567 COX5B cytochrome c oxidase subunit 5B -1.566 COX6B1 cytochrome c oxidase subunit 6B1 -1.049 Cox6c cytochrome c oxidase subunit VIc -1.115 COX7A2 cytochrome c oxidase subunit 7A2 -1.061 CYB5A cytochrome b5 type A -1.559 CYC1 cytochrome c1 -1.072 CYCS cytochrome c, somatic -1.169 MT-CO1 cytochrome c oxidase subunit I -1.695 MT-CO2 cytochrome c oxidase subunit II -1.39 MT-CO3 cytochrome c oxidase III -1.161 Complex V ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, -1.339 cardiac muscle ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide -1.205 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 -1.186 ATP5D ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit -1.246 ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) -1.183 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) -1.548 ATP5J2 ATP synthase, H+ transporting, mitochondrial Fo complex subunit F2 -1.205 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit -1.073 MT-ATP6 ATP synthase F0 subunit 6 -1.22
136
CHAPTER 5: General Discussion
137
The experiments described in this thesis involved a multi-disciplinary approach to examine the effects of early life nutritional management of bull calves on the molecular control of the
HPT axis (Chapters two to four). This necessitated the establishment of an experimental animal model where Holstein Friesian bull calves were managed in order to create either a high or low growth trajectory from two to eighteen weeks of life, as the nutritional regimen employed resulted in considerable divergence in calf growth rate which was mirrored in metabolic hormone and metabolite status. High throughput mRNA transcriptional profiling technology (RNASeq) was employed to assess the effect of prevailing nutritional status during the early calf hood period (pre and early post-weaning) on the biochemical response of key tissues regulating reproductive function in the bull. Specifically we studied the arcuate nucleus region of the hypothalamus, the anterior pituitary, parenchymal tissue of the testes as well as subcutaneous adipose tissue. To verify these results histological and immunohistological analysis of these tissues was also conducted. The main results from the work undertaken demonstrate that a high plane of nutrition has a positive effect on gametogenesis and testicular development at both a structural and transcriptomic and proteomic level.
Recently work by our research group found bulls offered a high plane of nutrition pre-six months were younger at puberty (approx. 1 month) and at sexual maturation (Byrne et al.,
2017b). This work also demonstrated that the effects of dietary restriction in early life cannot be mitigated by enhancing nutrient intake after six-months of age nor will post six-month dietary restriction reduce the advantages obtained from a high plane of nutrition pre six- months (Byrne et al., 2017b). It has been shown that the high plane of nutrition in the early calf-hood period advances the transient rise of LH (Evans et al., 1996) and the sensitivity of
LH release to GnRH (Byrne et al., 2017a) which occurs between 8 and 20 weeks of age
138
(Evans et al., 1996). Therefore in this study we sacrificed bull calves’ on two divergent planes of nutrition at 18 weeks of age, which is still within the (arbitrary) 8-20 week window of influence and allowed the animals’ sufficient time to express their respective growth performance potential. This allowed us the opportunity to characterise the response of the
HPT at a point in time within this relevant window. Therefore our hypothesis was that early calf nutrition would impact the transcriptome of the HPT.
Ideally an intensive bleed would have been carried out to get more specific data on the reproductive and metabolic hormone pulsatility; however, as these calves were very young and only on trial for a short period of time it was decided to take weekly blood samples to avoid any major stress that could have a long term effect on the calves.
Early Life Nutritional effects on Arcuate Nucleus and Anterior Pituitary
This is the first published study to investigate the effect of nutrition on the transcriptome of the HPT axis in bull calves using any technology. The effect of plane of nutrition during the first 18 weeks of life on the transcriptomic and immunohistochemical profile of the ARC and anterior pituitary of Holstein Friesian bull calves was characterised in chapters two and three of this thesis. The neurons in the central nervous system have the capability to alter gene expression in response to changes in the genetics and/or physiological environment such as stress, malnutrition, sleep, hormones and drugs (Sodhi and Sanders-Bush, 2004). There are two critical or vulnerable periods in brain development (Calikoglu et al., 2001); the initial development of the foetus and early in postnatal life, with the duration of these critical periods being species dependent. The ARC was chosen for study in the experiments in this thesis as its main function is in the regulation of both metabolic and reproductive processes and functions by communicating peripheral metabolic signals including those relating to
139 bodyweight and appetite to other regions of the brain such as the anterior pituitary gland
(Filby et al., 2008, Allen et al., 2012, Schwartz et al., 2000). Previous studies have reported evidence for differences in metabolic function in the ARC of heifer calves fed a high concentrate diet and achieving a high ADG from three-seven months of age, when compared with contemporaries offered a predominantly forage based diet and growing at a lower rate
(Allen et al., 2012). A recent study carried out by the same research group reported that increased rates of growth during the period of 4.5 to 8.5 months of age in heifers altered the
DNA methylation pattern in the ARC and these alterations may be linked to more precocious puberty (Alves et al., 2017). In contrast to the aforementioned studies there were no significant differences in gene expression found in this study in ARC tissue of calves offered divergent planes of nutrition. However, the studies reported above involved animals of a different sex, age, nutritional treatment and analytical technologies compared to our work. As well as all the above differences, these studies nutritional treatments commenced much later than our study and therefore, may not be fair comparison. Despite calves on the low plane of nutrition in our study only achieving a growth rate of approximately 50% of that of their contemporaries on the high plane of nutrition, leading to these calves being only 66% of the calves on the high plane of nutrition treatment at 18 weeks of age. The transcriptomic signature of the ARC nucleus and anterior pituitary tissues found in this study did not reflect the major differences in phenotype for the two dietary groups employed, in that the DEG observed within the RNASeq analysis within anterior pituitary tissue only related to cell cycle and not specifically to metabolism or reproductive processes. However, the rate of cell cycle activity was related to the prevailing metabolic status. The lack of DEG in either the
ARC region of the hypothalamus or anterior pituitary could be the result of a number of possibilities. First, the unavoidable differences in age of calves at the start. Calves had to be purchased from outside farms as there were no animals in calf to dairy calves on farm. Also it
140 was important that the calves received adequate colostrum. This avoided any major health problems with the calves during the trial. Secondly, the transient nature of gene transcription, particularly in brain tissue may have contributed to the difficulty in observing DEG between the divergent nutritional treatments employed (Bondy and Lee, 1993). Thirdly, the timing of
18 weeks of age for tissue recovery was chosen as it was within the developmental window during which bull calves, on average, experience a gonadotrophin rise weeks (Evans et al.,
1996). This would allow an examination of the relative physiological maturity of the HPT between the two treatments, at least at a transcriptional level. However, as described in
Chapter two, no statistically significant difference in systemic concentrations of LH was evident between the two nutritionally divergent treatment groups. This is in contrast to the findings of Byrne et al. (2017b) who reported greater concentrations of LH and testosterone between Holstein Friesian and Jersey calves on a high lane of nutrition subjected to an exogenous GnRH challenge at 16 weeks of age. However, had tissues been harvested at an earlier age it is possible that greater difference in DEG for both ARC and adenohypophyseal tissue between our treatment groups may have been observed. For example, while LH concentrations were not different at the time of tissue harvest, we did observe higher concentrations of LH in the systemic concentration of calves offered the high plane of nutrition at 12 weeks of age. Notwithstanding this, the large number of DEG observed in testicular tissue at 18 weeks of age is testament, no doubt, to major biochemical differences between the treatments in hypothalamic and hypophyseal activity at an earlier stage of development. Additionally, while numerous studies have investigated the effect of intravenous GnRH agonists on systemic gonadotrophin response, this is the first study to the author’s knowledge of the effect of nutrition on the global transcriptome of the anterior pituitary in calves.
141
The anatomical location of the ARC region lends itself to more easy identification and dissection than other nuclear regions within the hypothalamus. The method used to dissect out the ARC from the rest of the hypothalamus in the studies described in this thesis was based on the report of Komatsu et al. (2012). While this method is relatively precise and enables the collection of tissue with high quality RNA, the method of sectioning the tissue using a cryostat and selecting the exact location of the ARC using cresyl violet staining as per
Allen et al. (2012) or using laser capture microdissection as per Lee et al. (2012) would have been more specific. However, these methods have technical difficulties in obtaining enough high quality and quantity of mRNA for transcriptomic analysis, due to the high level of processing increasing the likelihood mRNA degradation, thus compromising the primary outcome of interest. Although, our study did not employ these methods, immunohistochemistry was carried out to corroborate that the ARC region was captured from each animal. Two proteins, NPY and KISS1 were selected as NPY has been found to be particularly abundant in the ARC of the bovine brain (Bahar and Sweeney, 2008). KISS1 neurons are found in the ARC and the preoptic nucleus of cattle (Hassaneen et al., 2016) and as these nuclei are not close in proximity, it was deemed a good biomarker for the ARC.
While both proteins were found to be abundant within the tissue which we harvested, surprisingly though there were no differences between protein expression and intensity for calves on either plane of nutrition.
KISS1 neurons relay metabolic status to the GnRH neurons (Castellano et al., 2010,
Kalamatianos et al., 2008, Quennell et al., 2011, Wahab et al., 2011). Approximately 40% of
KISS1 neurons present in the ARC region of the mouse brain were shown to express the active leptin receptor (Ob-Rb) mRNA, demonstrating that, at least in mice, KISS1 neurons are direct targets for regulation by leptin (Smith et al., 2006). This study carried out in situ
142 hybridisation on cryostat cut tissue only from the diagonal band of Broca to the mammillary bodies which contained the ARC. IGF-I is widely associated as a mediator of the effect of nutrition on reproduction via the HPT axis (Brito et al., 2007b) and its binding proteins regulate IGF-I activity by controlling the availability of IGF-I to their receptors.
Administration of IGF-I activates the KISS1 gene in the anteroventral periventricular and
ARC of the hypothalamus in prepubertal female rats (Hiney et al., 2009). Therefore, it was surprising that there was not differences in expression at either the transcriptomic or proteomic level between either plane of nutrition given the significantly higher systemic concentrations of IGF-I in calves on the high plane of nutrition. As mentioned above, leptin targets both KISS1 and NPY neurons. Leptin receptor mRNA and NPY neurons are co- localised in the ARC of ewes (Williams et al., 1999). Low leptin concentrations stimulate
NPY and AgRP release, feed intake and inhibit POMC and CART activity as well as energy expenditure (Schwartz et al., 2000). However, other studies (Brito et al., 2007a, Dance et al.,
2015, Byrne et al., 2017b) have reported no difference between treatments with respect to leptin which is in agreement with our study.
In Chapter two, a qPCR study was carried out on the ARC and anterior pituitary focusing on genes involved in metabolic and reproductive signalling. Unlike any of the previous reported studies (Allen et al., 2012, Cardoso et al., 2015, Alves et al., 2017), no difference was found in the expression of any of the candidate genes examined in ARC tissue between either plane of nutrition with the exception of GHSR. This is despite the fact that in the aforementioned studies, nutritional treatments commenced much later in the life of the calves employed than in our study. Ghrelin concentrations in blood plasma are regulated by food intake (Stanley et al., 2005) and therefore, it was not unexpected that overall GHSR expression was higher for calves on the low compared to the high plane of nutrition in the current study. Gene
143 expression levels are commonly analysed as relative expression values; however, this doesn’t allow for determination of actual expression levels. Also the SEM values reported in the
ARC are large and this could have been improved by using laser capture microdissection technology.
Early Life Nutritional effects on the Testes
Restricted feed during calf hood has been shown to impede the hypothalamic GnRH pulse generator and its interaction with the anterior pituitary gland can impair steroidogenesis in the testes, delay puberty and decrease testicular weight at 70 weeks of age (Brito et al., 2007a). In the study described in Chapter two, a high plane of nutrition resulted in heavier paired testicular weights, greater number of more mature spermatogenic cells and Sertoli cells, greater seminiferous tubule diameter and a more mature lumen at slaughter than for those calves offered the low plane of nutrition. In the early postnatal life of the bull calf, undifferentiated Sertoli cells form and by approximately 30-40 weeks of age the adult Sertoli cells, which each support a set number of germ cells, are established (Rawlings et al., 2008).
Sertoli cell number is fixed at puberty and cannot change post puberty (Sharpe et al., 2003,
Buzzard et al., 2003). Therefore, larger testes would suggest more Sertoli cells and more advanced spermatogenesis and, therefore, the capacity to produce more sperm (O'Donnell et al., 2000). These results indicate greater nutrient intake positively influence the onset of puberty via advancing germ cell development (Chandolia et al., 1997). Additionally as referred to earlier, a number of studies have shown that a high plane of nutrition before 31 weeks of age leads to an earlier onset of puberty in Holstein-Friesian bulls (Dance et al.,
2015, Byrne et al., 2017b). Although rapid growth in sheep due to over nutrition can lead to health problems in later life and early culling (Johnsen et al., 2013) however; stud bulls have
144 a very short working life as each breeding season new genetic superior bulls enter the stud farm and therefore, are culled long before joint problems arise.
In Chapter two of this thesis we focused on the genes that are reported as markers for Sertoli cell development, namely, transcription factor GATA4 (Jimenez-Severiano et al., 2005) and
AMH (Vigier et al., 1984). Our rationale for including the adult testes dimension into our study was to investigate if the calves benefiting from the high plane of nutrition had any similarities in gene expression to the adult bulls in comparison to the calves on the low plane of nutrition. It has been reported that Sertoli cells proliferate until 6 months of age (Ortavant et al., 1977) and data from our study reflects this; with the significantly higher GATA4 and
AMH expression levels in the prepubertal calves in comparison to the adult bulls. For spermatogenesis to function properly, tight junctions need to form between Sertoli cells; two genes that regulate this are CLDN11 and ZO1. There was a greater expression of CLDN11 in both the adult and the calves on the high nutrition treatment when compared with those on the low treatment. This suggests that calves on the high treatment were at a more mature physiological stage of development than those on the low treatment. Similarly in the rabbit,
CLDN11 mRNA and protein content was lower in immature testes (postnatal Day 10) in comparison to those of adult animals (postnatal Day 180; Park, et al. 2011). It has been reported that an increase in Sertoli cell number is linked to an increase in endogenous FSH
(Bagu et al., 2004). In agreement Harstine et al. (2017b) demonstrated that Angus calves treated with FSH from 1-3 months of age had a greater number of Sertoli cells when castrated at 3 months. In another study published by that group on the effect of FSH treatment on calves from 2-6 months of age, they reported an increase in activin A in the blood which has a beneficial role in spermatogenesis (Harstine et al., 2017a). However, in the study reported in Chapter 2 we failed to observe any difference in systemic concentrations of FSH between
145 the calves on the divergent planes of nutrition employed which corresponds with other studies with animals at a similar stage of development (Brito, 2014, Byrne et al., 2017c).
Expression of FSHR has been found to decrease with testes development in bulls (Dias and
Reeves, 1982). The numbers of receptors in the testes have been shown to decrease quickly from birth to 2 months of age and then decrease at a slower rate from 2 months to 2-5 years of age in bulls (Dias and Reeves, 1982). This agrees with the significantly higher expression for calves on both treatment groups compared to that of the adult bulls. No difference was seen in FSHR abundance between the nutrition treatments; however, the RNASeq data in
Chapter 3 showed that FSHR was down regulated in the high compared to the low plane of nutrition in the testes. This discrepancy between techniques is likely due to the slight decrease in the number of animals used in the RNASeq study due to a low number of reads compared to that examined for PCR. Studies have shown that there is a decline in FSHR number in rats and mice which is linked to a decrease in Sertoli cell interaction with FSH; due to having reached maturity (Ketelslegers et al., 1978).
It has been reported that an increase in systemic FSH, testosterone and especially LH in early life is positively related to larger and more mature testes (Brito et al., 2007b). Our study found that there was a peak in systemic concentrations of LH at 12 weeks, however, unexpectedly; there was not a statistically significant difference in LH concentration between the treatment groups. This was further corroborated with LHR expression while no difference was evident between the calves on the high and low planes of nutrition; it was significantly greater than the adult bulls. This early rise is reported to induce responsiveness of testicular
Leydig cells to LH, leading to an increase in testosterone production and sexual maturation
(Schanbacher, 1979, Amann and Walker, 1983). However, even though there was no difference in LH concentration between the treatment groups, there was a greater rise in
146 testosterone in the calves on the high compared to those on the low plane of nutrition. This indicates that the divergent planes of nutrition were effective and there is a high probability that there were differences in both the frequency and amplitude of LH pulsatility earlier but the high animal to animal variation combined with the pulsatile nature of LH makes it difficult to characterise differences between treatments with only one blood sample per time point. The lower concentration of IGF-I in calves on the low plane of nutrition may also have played a role in negatively affecting the peri-pubertal testosterone concentrations and therefore, negatively influencing Leydig cells (Brito et al., 2007c).
The high plane of nutrition induced an increase in DEGs in the testes affecting hormone production including androgen and cholesterol biosynthesis in comparison to the low plane of nutrition. Genes encoding for the enzymes catalysing the biosynthesis of cholesterol were found to be down regulated in calves on the low compared to the high plane of nutrition in the testes. This is of interest as under normal physiological conditions, de novo cholesterol synthesis replenishes cholesterol stores in Leydig cells (Hu et al., 2010). The low plane of nutrition had a negative effect on the expression of genes that mediate the transport of cholesterol. Interestingly, the uptake of HDL cholesteryl esters via binding HDL-ApoE
(Fofana et al., 2000), the selective uptake pathway of HDL cholesterol to the testes via the
SCARB1 (Acton et al., 1996) and the LDLR pathway (Miller, 2007) are negatively affected by the low plane of nutrition. In the Δ5 pathway, pregnenolone is converted to 17α- hydroxypregnenolone then to dehydroepiandrosterone and then to testosterone through either androstenediol or androstenedione. Our data shows that this pathway was negatively affected by the low plane of nutrition which corroborates the significant lower testosterone concentrations of these calves.
147
It has been reported that StAR is the primary determinant in the process of steroid synthesis
(Christenson and Strauss, 2001). The expression of StAR has previously been shown to be expressed in the testes of the bull (Pilon et al., 1997) and has been reported to regulate the transport of cholesterol from the outer into the inner mitochondrial membrane (Aspden et al.,
1998). Calves offered the low plane of nutrition had a lower expression of StAR compared to the high plane of nutrition. The expression of StAR has been reported to be stimulated by
IGF-I in fetal and adult mice Leydig cells (Manna et al., 2006). This is consistent with previous reports from our group showing greater plasma IGF-I concentrations when the same animals in this study were offered a high versus a low plane of nutrition (Byrne et al., 2017b).
Surprisingly, genes purported to be involved in gametogenesis were upregulated in testis tissue of calves on the low in comparison to that of those calves on the high plane of nutrition, which may be due to the low plane of nutrition calves experiencing a late spurt of gametogenesis. Despite this the testes from the calves on the high plane of nutrition showed a more mature spermatogenic profile with regard to testes weight, seminiferous tubule diameter, stage of spermatogenesis, Sertoli cell number and lumen development at slaughter.
Early Life Nutritional effects on the Subcutaneous Adipose
Adipocytes are acutely sensitive to changes in nutritional status (Bjorndal et al., 2011).
Hormones such as leptin and adiponectin, which are secreted from adipocytes are understood to play a part in the regulation of reproductive processes. Leptin increases proportionally in line with an increase in body fat and signals energy abundance (Landry et al., 2013) and high systemic concentrations of adiponectin have been found to negatively affect the reproductive axis (Campos et al., 2008). Much of the published work to-date on this topic has focused on the effect of body lipid status on adipose tissue hormone signalling in post pubertal heifers and cows and there is a dearth of information on the role of adipose tissue status in
148 stimulating the HPT axis and its potential as a key regulator of the timing of puberty onset in male cattle.
The histological and mRNA expression data in this thesis indicate much lower adiposity
(number and size of adipocytes) and greater number of preadipocytes in the calves subjected to the low plane of nutrition. It has been reported that MLXIPL expression levels increase during preadipocyte differentiation in humans, mice and rats (Hurtado del Pozo et al., 2011,
He et al., 2004). The calves on the low plane of nutrition had lower expression of MLXIPL in comparison to their contemporaries on the high plane of nutrition. Genes required for adipogenic differentiation such as FABP4, FASN, ACACA and DGAT2 were upregulated on the high plane of nutrition compared to the low. As well as an upregulation of genes that stimulate adipogenesis in the high plane of nutrition, in our study we found an upregulation in a key gene, GATA2, found to inhibit adipogenesis in the calves on the low compared to the high plane of nutrition. It has been reported that GATA2 is expressed in preadipocytes and is down-regulated during terminal differentiation (Tong et al., 2000). It has been reported that there is an increase in mRNA expression of nucleus-encoded mitochondrial genes for enzymes such as pyruvate carboxylase and pyruvate dehydrogenase complex during differentiating 3T3-L1 adipocytes (Wilson-Fritch et al., 2003). Pyruvate carboxylase has been found to be overexpressed upon conversion of preadipocytes to adipocytes (Owen et al.,
2002). All data in our study are consistent with evidence that offering calves a high starch diet during early calf hood induces precocious adipogenesis and lipid filling (Graugnard et al., 2010) and therefore, theoretically advances puberty.
Leptin has been found to indirectly influence the timing of puberty via the regulation of the hypothalamic KISS1 mediated neuronal stimulation of GnRH release (Sanchez-Garrido and
149
Tena-Sempere, 2013). Leptin can also bypass the hypothalamus and act directly on the pituitary gland and the testes; with leptin modestly stimulating gonadotropin secretion at a pituitary level and both direct stimulatory and inhibitory actions of leptin been reported in the gonads (Tena-Sempere, 2007). The high plane of nutrition calves had a heavier slaughter weight than those on the low plane of nutrition and the RNASeq data found that calves on the high plane of nutrition in our study had >4.5 log fold higher LEP expression compared with calves on the low plane of nutrition. Despite this, when plasma concentrations were assessed, we failed to find any difference in leptin concentrations between the two groups. This is in agreement with studies in both young dairy and beef bulls (Dance et al., 2015, Brito et al.,
2007a, Byrne et al., 2017b). The lack of differences in plasma leptin concentrations may be due to the minute quantity of subcutaneous adipose tissue laid down in calves at this stage of development, the relative insensitivity of protein immunoassays compared with transcript based molecular approaches or most likely because leptin is produced primarily by mature adipocytes (Diakonova, 2015).
Postprandial activity reduces ADIPOQ mRNA expression in WAT and has knock on effects on adiponectin concentration in serum (Steinberg and Kemp, 2007). It has been shown that adiponectin reduces LH secretion directly from the gonadotropes in the anterior pituitary via
AMPK (Lu et al., 2008). Similarly, postpartum cows, in negative energy balance had decreased ADIPOR1 and ADIPOR2 abundance in subcutaneous adipose compared to cows just prior to calving (Lemor et al., 2009) which is in agreement with our findings with calves where we found ADIPOQ and its receptor ADIPOR2 were down regulated in the low compared to the high treatment groups. However, there was no difference in serum concentrations of adiponectin between the two groups in the current study, which like leptin may be due to the overall low adipose deposition in young bull calves. It has been reported
150 that leptin concentration was greater in the high plane of nutrition in Holstein Friesians post six months of age (Byrne et al., 2017b).
The high plane of nutrition induced an increase in both energy production and amino acid metabolic pathways in adipose tissue in the high in comparison to the low nutrition treatment.
Branched chain amino acid concentrations are elevated in response to over nutrition in children and adolescents (McCormack et al., 2013). Therefore, it is reasonable to suggest that the evidence for a decline in BCAA degradation may be a result of the moderate restriction in dietary allowance experienced by our low plane of nutrition calves.
The main findings of this thesis were:
(i) 18 week old bull calves offered a high plane of nutrition from two weeks of age
were heavier at slaughter, had larger testes, larger seminiferous tubule diameter,
more mature spermatogenic cells, more Sertoli cells and a greater Sertoli cell
volume density as well as more advanced seminiferous tubule lumen
development.
(ii) From a selected panel of genes involved in both metabolic and reproductive
signalling in the ARC region of the hypothalamus and the anterior pituitary,
GHSR was the only gene affected by plane of nutrition, while when a RNASeq
approach was taken plane of nutrition had no significant effect on gene
expression in the ARC or anterior pituitary tissue
(iii) Offering bull calves a low plane of nutrition down regulated the expression of
genes involved in cholesterol and androgen biosynthesis in the testes,
(iv) Histological and mRNA expression data from subcutaneous adipose tissue
indicated much lower adiposity (number and size of adipocytes) and a greater
151
number of pre-adipocytes in subcutaneous adipose tissue of calves offered a low
compared with a high plane of nutrition. This was consistent with evidence for
altered expression of genes involved in cellular energy production and branched
chain amino acid degradation in subcutaneous adipose tissue in these calves.
Calves offered a high plane of nutrition had greater abundance of transcripts from
adipokines such as leptin (LEP) and adiponectin (ADIPOQ) in subcutaneous
adipose tissue, both of which are known to play direct roles in regulating aspects
of reproductive function.
Suggestions for Future Direction of Research in this Area
It would be informative to replicate the experiment with a larger cohort of calves
and sample the HPT at various time points between 4-20 weeks of age and at
puberty (39-41 weeks of age); to characterise the transcriptomic and proteomic
response of the effect of nutrition at key time points.
Further work should be carried out to examine the effect of early life metabolic
status on the microRNA transcriptome, given the importance of the latter in
regulating spermatogenesis.
Additionally, comprehensive proteomic characterisation of subcutaneous adipose
would yield valuable insights into the effects of early life nutrition on the
hyperplasia and heterotrophy of adipose tissue and its downstream effects on the
HPT axis.
152
CHAPTER 6: Publication List
153
6.1 Published papers:
I was involved in the performing of experiments, analysing the data and editing and revising of each manuscript.
Johnson, G.P., English, A.M., Cronin, S., Hoey, D.A., Meade, K.G., Fair, S. (2017) Genomic identification, expression profiling and functional characterisation of CatSper channels in the bovine. Biology of Reproduction. In Press
Byrne, C. J., Fair, S., English, A. M., Holden, S. A., Dick, J. R., Lonergan, P., Kenny, D. A. (2017) Dietary polyunsaturated fatty acid supplementation of young post-pubertal dairy bulls alters the fatty acid composition of seminal plasma and spermatozoa but has no effect on semen volume or sperm quality. Theriogenology. 90: 289-300.
Byrne, C.J., Fair, S., English, A.M. Johnston, D., Lonergan, P., Kenny, D.A. (2017) Effect of milk replacer and concentrate intake on growth rate, feeding behaviour and systemic metabolite concentrations of pre-weaned bull calves of two dairy breeds. Animal 20:1-8.
Byrne, C.J., Fair, S., English, A.M., Urh, C., Sauerwein, H., Crowe, M.A., Lonergan, P., Kenny D.A. (2017) Effect of breed, plane of nutrition and age on growth, scrotal development, metabolite concentrations and on systemic gonadotropin and testosterone concentrations following a GnRH challenge in young dairy bulls. Theriogenology 96: 58-68.
Murphy, C., English, A.M., Holden, S., Fair, S., (2014) Cholesterol-loaded-cyclodextrins improve the post-thaw quality of stallion sperm. Animal Reproduction Science 145(3): 123- 129.
6.2 Submitted papers:
English, A.M., Waters, S.M., Cormican, P., Byrne, C.J., Fair, S., Kenny D.A. Effect of Early Calf-Hood Nutrition on the Transcriptomic Profile of Subcutaneous Adipose Tissue in Holstein-Friesian Bulls (Submitted)
Byrne, C.J., Fair, S., English, A.M., Lonergan, P., Kenny D.A. Plane of nutrition during pre and post-six months of age in Holstein-Friesian bulls: I. Effect on performance, body composition, age at puberty and post-pubertal semen production (Submitted)
Byrne, C.J., Fair, S., English, A.M., Urh, C., Sauerwein, H., Crowe, M.A., Lonergan, P., Kenny D.A. Plane of nutrition during pre- and post-six months of age in Holstein-Friesian bulls: II. Effect on metabolic and reproductive endocrinology and identification of physiological markers of puberty and sexual maturation (Submitted)
6.2 Conference publications
English A.M., Fair, S., Byrne C.J., Waters, S.M., Kenny, D.A. 2017. Effect of plane of nutrition on the transcriptomic profile of subcutaneous adipose tissue in Holstein-Friesian
154 bull calves. International Society of Animal Genetics (ISAG), Dublin, Ireland, 18th June 2017. (Poster)
English A.M., Fair, S., Byrne C.J., Waters, S.M., Kenny, D.A. 2017. Effect of Early Calf- Hood Nutrition on the Hypothalamic-Pituitary axis in Holstein-Friesian Bulls. American Society of Animal Science (ASAS), Baltimore, Maryland, USA, 11th June 2017. (Talk)
English A.M., Byrne C.J., Waters, S.M., Fair, S., Kenny, D.A. 2016. The effect of early calf- hood nutrition and age on the expression of genes associated with testicular development of Holstein-Friesian bulls. International Congress of Animal Reproduction, Tours, France, 27th June 2016. (Poster)
English A.M., Byrne C.J., Waters, S.M., Fair, S., Kenny, D.A. 2016. The effect of early life plane of nutrition on blood metabolites and testicular development of Holstein Friesian bull calves. Association of Applied Animal Andrology, Tours, France, 27th June 2016. (Poster)
Johnson, G.P., English, A.M., Hoey, D.A., Meade, K., Fair, S. 2016 Comparative genomic identification and expression profiling of CatSper genes in the reproductive tract of the bull. International Congress of Animal Reproduction, Tours, France, 27th June 2016. (Talk)
English, A.M., Byrne, C.J., Cassidy, J., Fair, S., Kenny, D.A. 2016. The effect of early life plane of nutrition on testicular development of Holstein Friesian bull calves. British Society of Animal Science, Chester, UK, United Kingdom 6th April 2016 (Talk)
Byrne, C.J., English, A.M., Fair, S., Lonergan, P., Crowe, M., Kenny, D.A. 2015. Effect of breed, plane of nutrition and age on systemic gonadotropins and testosterone concentrations, following a GnRH challenge in young dairy bulls. Agricultural Research Forum, Ireland 10th March 2015. (Talk)
Byrne, C.J., English, A.M., Fair, S., Lonergan, P., Kenny, D.A. 2015. The effect of dietary polyunsaturated fatty acid supplementation on semen volume and quality in young post- pubertal dairy bulls. Agricultural Research Forum, Ireland 10th March 2015. (Talk)
Byrne, C.J., Johnson, D.A., English, A.M., Fair, S., Lonergan, P., Kenny, D.A. 2015. Effect of plane of nutrition on growth rate, feeding behaviour and systemic metabolite concentrations in pre-weaned bull calves of two contrasting dairy breeds. British Society of Animal Science event - Science with Impact - Annual Conference 20th April 2015. (Talk)
Byrne, C.J., English, A.M., Fair, S., Lonergan, P., Kenny, D.A. 2016. Effect of altering plane of nutrition during the first and second six months of life on age at puberty onset in Holstein Friesian bulls. British Society of Animal Science event - Science with Impact - Annual Conference 6th April 2016. (Talk)
Byrne, C.J., English, A.M., Fair, S., Lonergan, P., Kenny, D.A. 2016. The effect of dietary omega-6 and omega-3 fatty acid supplementation on semen volume and quality in young post-pubertal dairy bulls. British Society of Animal Science event - Science with Impact - Annual Conference 6th April 2016. (Talk)
155
Byrne, C.J., English, A.M., Fair, S., Lonergan, P., Kenny, D.A. 2016 Plane of nutrition affects scrotal skin thickness and scrotal temperature in pre-pubertal Holstein-Friesian bulls. Association for Applied Animal Andrology (AAAA), 10th Biennial Conference, Tours, France. 26th June 2016 (Poster)
Byrne, C.J., English, A.M., Fair, S., Lonergan, P., Kenny, D.A. 2016. Effect of plane of nutrition during the first and second six months of life on age at puberty and subsequent semen production in Holstein Friesian bulls. 18th International Congress on Animal Reproduction, Tours, France. 27th June 2016 (Poster)
Byrne, C.J., English, A.M., Fair, S., Lonergan, P., Kenny, D.A. 2016 Effect of plane of nutrition during the first and second six months of life on age at puberty and blood metabolites in Holstein Friesian bulls. 67th Annual Meeting of European Association of Animal Production. 29th August 2016. (Poster)
156
Chapter 7: Bibliography
157
ABAVISANI, A., BAGHBANZADEH, A., SHAYAN, P. & DEHGHANI, H. 2011. Leptin mRNA in bovine spermatozoa. Research in Veterinary Science, 90, 439-442. ABDEL-RAOUF, M. 1960. The postnatal development of the reproductive organs in bulls with special reference to puberty (incluing growth of the hypophysis and the adrenals). Acta Endocrinol Suppl (Copenh), 34(Suppl 49), 1-109. ACTON, S., RIGOTTI, A., LANDSCHULZ, K. T., XU, S., HOBBS, H. H. & KRIEGER, M. 1996. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science, 271, 518-20. AHIMA, R. S. & LAZAR, M. A. 2008. Adipokines and the peripheral and neural control of energy balance. Mol Endocrinol, 22, 1023-31. AHIMA, R. S., SAPER, C. B., FLIER, J. S. & ELMQUIST, J. K. 2000. Leptin Regulation of Neuroendocrine Systems. Front Neuroendocrin, 21, 263-307. AKSGLAEDE, L., JUUL, A., OLSEN, L. W. & SØRENSEN, T. I. 2009. Age at puberty and the emerging obesity epidemic. PloS One, 4, e8450. AL-ATTAR, L., NOËL, K., DUTERTRE, M., BELVILLE, C., FOREST, M. G., BURGOYNE, P. S., JOSSO, N. & REY, R. 1997. Hormonal and cellular regulation of Sertoli cell anti-Müllerian hormone production in the postnatal mouse. J Clin Inves, 100, 1335-1343. ALLAN, C. M., GARCIA, A., SPALIVIERO, J., ZHANG, F. P., JIMENEZ, M., HUHTANIEMI, I. & HANDELSMAN, D. J. 2004. Complete Sertoli cell proliferation induced by follicle-stimulating hormone (FSH) independently of luteinizing hormone activity: evidence from genetic models of isolated FSH action. Endocrinology, 145, 1587-93. ALLEN, C. C., ALVES, B. R., LI, X., TEDESCHI, L. O., ZHOU, H., PASCHAL, J. C., RIGGS, P. K., BRAGA- NETO, U. M., KEISLER, D. H., WILLIAMS, G. L. & AMSTALDEN, M. 2012. Gene expression in the arcuate nucleus of heifers is affected by controlled intake of high- and low-concentrate diets. Journal of Animal Science, 90, 2222-32. ALVES, B. R. C., CARDOSO, R. C., DOAN, R., ZHANG, Y., DINDOT, S. V., WILLIAMS, G. L. & AMSTALDEN, M. 2017. Nutritional programming of accelerated puberty in heifers: alterations in DNA methylation in the arcuate nucleus. Biol Reprod, 96, 174-184. AMANN, R. P. 1983. Endocrine changes associated with onset of spermatogenesis in Holstein bulls. J Dairy Sci, 66, 2606-22. AMANN, R. P. & SCHANBACHER, B. D. 1983. Physiology of male reproduction. Journal of Animal Science, 57 Suppl 2, 380-403. AMANN, R. P. & WALKER, O. A. 1983. Changes in the pituitary-gonadal axis associated with puberty in Holstein bulls. J Anim Sci, 57, 433-42. AMANN, R. P., WISE, M. E., GLASS, J. D. & NETT, T. M. 1986. Prepubertal changes in the hypothalamic-pituitary axis of Holstein bulls. Biology of reproduction, 34, 71-80. AMBELE, M. A., DESSELS, C., DURANDT, C. & PEPPER, M. S. 2016. Genome-wide analysis of gene expression during adipogenesis in human adipose-derived stromal cells reveals novel patterns of gene expression during adipocyte differentiation. Stem Cell Res, 16, 725-34. AMSTALDEN, M., ALVES, B. R., LIU, S., CARDOSO, R. C. & WILLIAMS, G. L. 2011. Neuroendocrine pathways mediating nutritional acceleration of puberty: insights from ruminant models. Front Endocrinol (Lausanne), 2, 109. AMSTALDEN, M., CARDOSO, R. C., ALVES, B. R. & WILLIAMS, G. L. 2014. Hypothalamic neuropeptides and the nutritional programming of puberty in heifers. Journal of Animal Science, 92, 3211- 3222. ANJUM, S., KRISHNA, A., SRIDARAN, R. & TSUTSUI, K. 2012. Localization of gonadotropin-releasing hormone (GnRH), gonadotropin-inhibitory hormone (GnIH), kisspeptin and GnRH receptor and their possible roles in testicular activities from birth to senescence in mice. Journal of experimental zoology. Part A, Ecological genetics and physiology, 317, 630-44. ARAVINDAKSHAN, J., HONARAMOOZ, A., BARTLEWSKI, P., BEARD, A., PIERSON, R. & RAWLINGS, N. 2000. Gonadotrophin secretion in prepubertal bull calves born in spring and autumn. Journal of Reproduction and Fertility, 120, 159-167.
158
ARITA, Y., KIHARA, S., OUCHI, N., TAKAHASHI, M., MAEDA, K., MIYAGAWA, J., HOTTA, K., SHIMOMURA, I., NAKAMURA, T., MIYAOKA, K., KURIYAMA, H., NISHIDA, M., YAMASHITA, S., OKUBO, K., MATSUBARA, K., MURAGUCHI, M., OHMOTO, Y., FUNAHASHI, T. & MATSUZAWA, Y. 1999. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun, 257, 79-83. ARORA, S. & ANUBHUTI 2006. Role of neuropeptides in appetite regulation and obesity--a review. Neuropeptides, 40, 375-401. ASPDEN, W. J., RODGERS, R. J., STOCCO, D. M., SCOTT, P. T., WREFORD, N. G., TRIGG, T. E., WALSH, J. & D'OCCHIO, M. J. 1998. Changes in testicular steroidogenic acute regulatory (STAR) protein, steroidogenic enzymes and testicular morphology associated with increased testosterone secretion in bulls receiving the luteinizing hormone releasing hormone agonist deslorelin. Domest Anim Endocrinol, 15, 227-38. AZHAR, S. & REAVEN, E. 2002. Scavenger receptor class BI and selective cholesteryl ester uptake: partners in the regulation of steroidogenesis. Mol Cell Endocrinol, 195, 1-26. BADO, A., LEVASSEUR, S., ATTOUB, S., KERMORGANT, S., LAIGNEAU, J. P., BORTOLUZZI, M. N., MOIZO, L., LEHY, T., GUERRE-MILLO, M., LE MARCHAND-BRUSTEL, Y. & LEWIN, M. J. 1998. The stomach is a source of leptin. Nature, 394, 790-3. BAGU, E. T., COOK, S., GRATTON, C. L. & RAWLINGS, N. C. 2006. Postnatal changes in testicular gonadotropin receptors, serum gonadotropin, and testosterone concentrations and functional development of the testes in bulls. Reproduction, 132, 403-11. BAGU, E. T., MADGWICK, S., DUGGAVATHI, R., BARTLEWSKI, P. M., BARRETT, D. M., HUCHKOWSKY, S., COOK, S. J. & RAWLINGS, N. C. 2004. Effects of treatment with LH or FSH from 4 to 8 weeks of age on the attainment of puberty in bull calves. Theriogenology, 62, 861-73. BAHAR, B. & SWEENEY, T. 2008. Mapping of the transcription start site (TSS) and identification of SNPs in the bovine neuropeptide Y (NPY) gene. BMC Genetics, 9, 91. BALASZ, R., JORDAN, T., LEWIS, P. D. & PATEL, A. J. 1986. Undernutrition and brain development. In: F., F. & TANNER, J. M. (eds.) Human Growth. New York: Plenum Press. BALL, P. J. H. & PETERS, A. R. 2004. Reproduction in Cattle, Oxford, UK, Blackwell Publishing. BANCROFT, J. D. 1996. Theory and practice of histological technique., New York, Churchill Livingstone Publications. BARASH, I. A., CHEUNG, C. C., WEIGLE, D. S., REN, H., KABIGTING, E. B., KUIJPER, J. L., CLIFTON, D. K. & STEINER, R. A. 1996. Leptin is a metabolic signal to the reproductive system. Endocrinology, 137, 3144-7. BARB, C. R., BARRETT, J. B. & KRAELING, R. R. 2004. Role of leptin in modulating the hypothalamic- pituitary axis and luteinizing hormone secretion in the prepuberal gilt. Domestic Animal Endocrinology, 26, 201-214. BARDIN, C. W., CHENG, C. Y., MUSTOW, N. A. & GUNSALUS, G. L. 1994. The Sertoli cells. In: KNOBIL, E. & NEILL, J. D. (eds.) The Physiology of Reproduction. 2 ed. New York: Raven Press. BARR, V. A., MALIDE, D., ZARNOWSKI, M. J., TAYLOR, S. I. & CUSHMAN, S. W. 1997. Insulin stimulates both leptin secretion and production by rat white adipose tissue. Endocrinology, 138, 4463- 72. BARTLETT, K. S., MCKEITH, F. K., VANDEHAAR, M. J., DAHL, G. E. & DRACKLEY, J. K. 2006. Growth and body composition of dairy calves fed milk replacers containing different amounts of protein at two feeding rates. J Anim Sci, 84, 1454-67. BEARDEN, H. J., FUQUAY, J. W. & WILLARD, S. T. 2004. Applied Animal Reproduction, Prentice Hall. BECHEREL, O. J., YEO, A. J., STELLATI, A., HENG, E. Y. H., LUFF, J., SURAWEERA, A. M., WOODS, R., FLEMING, J., CARRIE, D., MCKINNEY, K., XU, X., DENG, C. & LAVIN, M. F. 2013. Senataxin Plays an Essential Role with DNA Damage Response Proteins in Meiotic Recombination and Gene Silencing. PLOS Genetics, 9, e1003435. BEDI, K. S. & WARREN, M. A. 1988. Effects of nutrition on cortical development. In: PETERS, A. & JONES, E. G. (eds.) Celebral Cortex. New York: Plenum Press.
159
BELL, E. L., NAGAMORI, I., WILLIAMS, E. O., DEL ROSARIO, A. M., BRYSON, B. D., WATSON, N., WHITE, F. M., SASSONE-CORSI, P. & GUARENTE, L. 2014. SirT1 is required in the male germ cell for differentiation and fecundity in mice. Development, 141, 3495-504. BELTMAN, M. E., FORDE, N., FURNEY, P., CARTER, F., ROCHE, J. F., LONERGAN, P. & CROWE, M. A. 2010. Characterisation of endometrial gene expression and metabolic parameters in beef heifers yielding viable or non-viable embryos on Day 7 after insemination. Reprod Fertil Dev, 22, 987-99. BENTLEY, G. E., UBUKA, T., MCGUIRE, N. L., CHOWDHURY, V. S., MORITA, Y., YANO, T., HASUNUMA, I., BINNS, M., WINGFIELD, J. C. & TSUTSUI, K. 2008. Gonadotropin-inhibitory hormone and its receptor in the avian reproductive system. General and Comparative Endocrinology 156, 34- 43. BERENSZTEIN, E. B., BAQUEDANO, M. S., GONZALEZ, C. R., SARACO, N. I., RODRIGUEZ, J., PONZIO, R., RIVAROLA, M. A. & BELGOROSKY, A. 2006. Expression of aromatase, estrogen receptor alpha and beta, androgen receptor, and cytochrome P-450scc in the human early prepubertal testis. Pediatr Res, 60, 740-4. BERRY, D. P., SHALLOO, L., CROMIE, A.R., VEERKAMP, R.F, AM, P.R., KEARNEY, J.F., EVANS, R.D., AND WICKHAM, B. 2007. The Economic Breeding Index: A Generation On. Irealnd: Technical report to the Irish Cattle Breeding Federation. BERTHOUD, H. R. & MORRISON, C. 2008. The brain, appetite, and obesity. Annu Rev Psychol, 59, 55- 92. BHASIN, S. 2000. The dose-dependent effects of testosterone on sexual function and on muscle mass and function. Mayo Clinic Proceedings, 75 Suppl, S70-5; discussion S75-6. BIOLOGICALDISCUSSION.COM. 2006. Hypothalamus: Connection and Functional Aspect (With Diagram) [Online]. Available: http://www.biologydiscussion.com/human- physiology/nervous-system-human-physiology/hypothalamus-connection-and-functional- aspect-with-diagram/62942 [Accessed 31/03/2017]. BJORNDAL, B., BURRI, L., STAALESEN, V., SKORVE, J. & BERGE, R. K. 2011. Different adipose depots: their role in the development of metabolic syndrome and mitochondrial response to hypolipidemic agents. J Obes, 2011, 490650. BJURSELL, M., AHNMARK, A., BOHLOOLY-Y, M., WILLIAM-OLSSON, L., RHEDIN, M., PENG, X.-R., PLOJ, K., GERDIN, A.-K., ARNERUP, G., ELMGREN, A., BERG, A.-L., OSCARSSON, J. & LINDÉN, D. 2007. Opposing Effects of Adiponectin Receptors 1 and 2 on Energy Metabolism. Diabetes, 56, 583. BLOME, R. M., DRACKLEY, J. K., MCKEITH, F. K., HUTJENS, M. F. & MCCOY, G. C. 2003. Growth, nutrient utilization, and body composition of dairy calves fed milk replacers containing different amounts of protein. J Anim Sci, 81, 1641-55. BONDY, C. A. & LEE, W.-H. 1993. Patterns of Insulin-like Growth Factor and IGF Receptor Gene Expression in the Brain: Functional Implications. Ann NY Acad Sci, 692, 33-43. BORDBIA 2016. Annual Report and Accounts 2015. Dublin 2: BordBia. BOUKARI, K., MEDURI, G., BRAILLY-TABARD, S., GUIBOURDENCHE, J., CIAMPI, M. L., MASSIN, N., MARTINERIE, L., PICARD, J. Y., REY, R., LOMBES, M. & YOUNG, J. 2009. Lack of androgen receptor expression in Sertoli cells accounts for the absence of anti-Mullerian hormone repression during early human testis development. J Clin Endocrinol Metab, 94, 1818-25. BRADLEY, R. L., MANSFIELD, J. P. & MARATOS-FLIER, E. 2005. Neuropeptides, including neuropeptide Y and melanocortins, mediate lipolysis in murine adipocytes. Obesity Research & Clinical Practice, 13, 653-61. BRATTON, R. W., MUSGRAVE, S. D., DUNN, H. O., FOOTE, R. H. & HENDERSON, C. R. 1956. Semen production and fertility of young bulls raised on three different energy levels of feed intake. Journal of Animal Science, 1296-1297.
160
BREIER, B. H. & GLUCKMAN, P. D. 1991. Physiological Principles of Animal Production The regulation of postnatal growth: nutritional influences on endocrine pathways and function of the somatotrophic axis. Livestock Production Science, 27, 77-94. BREIER, B. H., GLUCKMAN, P. D. & BASS, J. J. 1988. Plasma concentrations of insulin-like growth factor-I and insulin in the infant calf: ontogeny and influence of altered nutrition. J Endocrinol, 119, 43-50. BRITO, L. F., BARTH, A. D., RAWLINGS, N. C., WILDE, R. E., CREWS, D. H., JR., BOISCLAIR, Y. R., EHRHARDT, R. A. & KASTELIC, J. P. 2007a. Effect of feed restriction during calfhood on serum concentrations of metabolic hormones, gonadotropins, testosterone, and on sexual development in bulls. Reproduction, 134, 171-81. BRITO, L. F., BARTH, A. D., RAWLINGS, N. C., WILDE, R. E., CREWS, D. H., JR., MIR, P. S. & KASTELIC, J. P. 2007b. Effect of improved nutrition during calfhood on serum metabolic hormones, gonadotropins, and testosterone concentrations, and on testicular development in bulls. Domest Anim Endocrin, 33, 460-9. BRITO, L. F., BARTH, A. D., RAWLINGS, N. C., WILDE, R. E., CREWS, D. H., JR., MIR, P. S. & KASTELIC, J. P. 2007c. Effect of nutrition during calfhood and peripubertal period on serum metabolic hormones, gonadotropins and testosterone concentrations, and on sexual development in bulls. Domest Anim Endocrin, 33, 1-18. BRITO, L. F. C. 2006. Nutrition, metabolic hormones and sexual development in bulls. . PhD University of Saskatchewan. BRITO, L. F. C. 2014. Endocrine Control of Testicular Developement and Initiation of Spermatogenesis in Bulls. Bovine Reproduction. John Wiley & Sons, Inc. BUZZARD, J. J., WREFORD, N. G. & MORRISON, J. R. 2003. Thyroid hormone, retinoic acid, and testosterone suppress proliferation and induce markers of differentiation in cultured rat sertoli cells. Endocrinology, 144, 3722-31. BYRNE, C. J., FAIR, S., ENGLISH, A. M., JOHNSTON, D., LONERGAN, P. & KENNY, D. A. 2017a. Effect of milk replacer and concentrate intake on growth rate, feeding behaviour and systemic metabolite concentrations of pre-weaned bull calves of two dairy breeds. Animal, 1-8. BYRNE, C. J., FAIR, S., ENGLISH, A. M., LONERGAN, P. & KENNY, D. A. 2017b. Plane of nutrition pre and post-six months of age in Holstein-Friesian bulls: I. Effect on performance, body composition, age at puberty and post-pubertal semen production. Journal of Dairy Science. BYRNE, C. J., FAIR, S., ENGLISH, A. M., URH, C., SAUERWEIN, H., CROWE, M. A., LONERGAN, P. & KENNY, D. A. 2017c. Effect of breed, plane of nutrition and age on growth, scrotal development, metabolite concentrations and on systemic gonadotropin and testosterone concentrations following a GnRH challenge in young dairy bulls. Theriogenology, 96, 58-68. CALIKOGLU, A. S., KARAYAL, A. F. & D'ERCOLE, A. J. 2001. Nutritional regulation of IGF-I expression during brain development in mice. Pediatric Research, 49, 197-202. CAMINOS, J. E., NOGUEIRAS, R., GAYTAN, F., PINEDA, R., GONZALEZ, C. R., BARREIRO, M. L., CASTANO, J. P., MALAGON, M. M., PINILLA, L., TOPPARI, J., DIEGUEZ, C. & TENA-SEMPERE, M. 2008. Novel expression and direct effects of adiponectin in the rat testis. Endocrinology, 149, 3390-402. CAMPOS, D. B., PALIN, M. F., BORDIGNON, V. & MURPHY, B. D. 2008. The 'beneficial' adipokines in reproduction and fertility. Int J Obes (Lond), 32, 223-31. CANNON, B. & NEDERGAARD, J. A. N. 2004. Brown Adipose Tissue: Function and Physiological Significance. Physiological Reviews, 84, 277. CAPRIO, M., FABBRINI, E., ISIDORI, A. M., AVERSA, A. & FABBRI, A. 2001. Leptin in reproduction. Trends in Endocrinology & Metabolism, 12, 65-72. CAPRIO, M., FABBRINI, E., RICCI, G., BASCIANI, S., GNESSI, L., ARIZZI, M., CARTA, A. R., DE MARTINO, M. U., ISIDORI, A. M., FRAJESE, G. V. & FABBRI, A. 2003. Ontogenesis of leptin receptor in rat Leydig cells. Biology of Reproduction, 68, 1199-207.
161
CARDOSO, R. C., ALVES, B. R. C., SHARPTON, S. M., WILLIAMS, G. L. & AMSTALDEN, M. 2015. Nutritional Programming of Accelerated Puberty in Heifers: Involvement of Pro- Opiomelanocortin Neurones in the Arcuate Nucleus. Journal of Neuroendocrinology, 27, 647- 657. CASADO, M. E., HUERTA, L., ORTIZ, A. I., PÉREZ-CRESPO, M., GUTIÉRREZ-ADÁN, A., KRAEMER, F. B., LASUNCIÓN, M. Á., BUSTO, R. & MARTÍN-HIDALGO, A. 2012. HSL-knockout mouse testis exhibits class B scavenger receptor upregulation and disrupted lipid raft microdomains. Journal of Lipid Research, 53, 2586-2597. CASTELLANO, J., NAVARRO, V., FERNANDEZ-FERNANDEZ, R., NOGUEIRAS, R., TOVAR, S., ROA, J., VAZQUEZ, M., VIGO, E., CASANUEVA, F. & AGUILAR, E. 2005. Changes in hypothalamic KiSS-1 system and restoration of pubertal activation of the reproductive axis by kisspeptin in undernutrition. Endocrinology, 146, 3917-3925. CASTELLANO, J. M., BENTSEN, A. H., MIKKELSEN, J. D. & TENA-SEMPERE, M. 2010. Kisspeptins: bridging energy homeostasis and reproduction. Brain Research, 1364, 129-38. CASTELLANO, J. M., BENTSEN, A. H., SÁNCHEZ-GARRIDO, M. A., RUIZ-PINO, F., ROMERO, M., GARCIA- GALIANO, D., AGUILAR, E., PINILLA, L., DIÉGUEZ, C., MIKKELSEN, J. D. & TENA-SEMPERE, M. 2011. Early Metabolic Programming of Puberty Onset: Impact of Changes in Postnatal Feeding and Rearing Conditions on the Timing of Puberty and Development of the Hypothalamic Kisspeptin System. Endocrinology, 152, 3396-3408. CASTELLANO, J. M., ROA, J., LUQUE, R. M., DIEGUEZ, C., AGUILAR, E., PINILLA, L. & TENA-SEMPERE, M. 2009. KiSS-1/kisspeptins and the metabolic control of reproduction: physiologic roles and putative physiopathological implications. Peptides, 30, 139-45. CHAILLOU, E., BAUMONT, R., CHILLIARD, Y. & TILLET, Y. 2002. Several subpopulations of neuropeptide Y-containing neurons exist in the infundibular nucleus of sheep: an immunohistochemical study of animals on different diets. Journal of Comparative Neurology, 444, 129-43. CHAMINDRANI MENDIS-HANDAGAMA, S. M. L. & SIRIL ARIYARATNE, H. B. 2001. Differentiation of the Adult Leydig Cell Population in the Postnatal Testis. Biology of Reproduction, 65, 660- 671. CHANDOLIA, R. K., HONARAMOOZ, A., BARTLEWSKI, P. M., BEARD, A. P. & RAWLINGS, N. C. 1997. Effects of treatment with LH releasing hormone before the early increase in LH secretion on endocrine and reproductive development in bull calves. J Reprod Fertil, 111, 41-50. CHEHAB, F. F., LIM, M. E. & LU, R. 1996. Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nature Genetics, 12, 318-20. CHEMES, H. E., REY, R. A., NISTAL, M., REGADERA, J., MUSSE, M., GONZALEZ-PERAMATO, P. & SERRANO, A. 2008. Physiological androgen insensitivity of the fetal, neonatal, and early infantile testis is explained by the ontogeny of the androgen receptor expression in Sertoli cells. J Clin Endocrinol Metab, 93, 4408-12. CHENG, Z., TSENG, Y. & WHITE, M. F. 2010. Insulin signaling meets mitochondria in metabolism. Trends Endocrin Meta, 21, 589-598. CHEUNG, C. C., THORNTON, J. E., KUIJPER, J. L., WEIGLE, D. S., CLIFTON, D. K. & STEINER, R. A. 1997. Leptin is a metabolic gate for the onset of puberty in the female rat. Endocrinology, 138, 855-8. CHILLIARD, Y., BONNET, M., DELAVAUD, C., FAULCONNIER, Y., LEROUX, C., DJIANE, J. & BOCQUIER, F. 2001. Leptin in ruminants. Gene expression in adipose tissue and mammary gland, and regulation of plasma concentration. Domestic Animal Endocrinology, 21, 271-95. CHOUZOURIS, T. M., DOVOLOU, E., DAFOPOULOS, K., GEORGOULIAS, P., VASILEIOU, N. G., FTHENAKIS, G. C., ANIFANDIS, G. & AMIRIDIS, G. S. 2016. Ghrelin suppresses the GnRH- induced preovulatory gonadotropin surge in dairy heifers. Theriogenology, 86, 1615-1621. CHRISTENSON, L. K. & STRAUSS, J. F., 3RD 2001. Steroidogenic acute regulatory protein: an update on its regulation and mechanism of action. Arch Med Res, 32, 576-86.
162
CHU, Z., TOMAIUOLO, M., BERTRAM, R. & MOENTER, S. M. 2012. Two types of burst firing in gonadotrophin-releasing hormone neurones. Journal of Neuroendocrinology, 24, 1065-77. CLARKE, I. J., SARI, I. P., QI, Y., SMITH, J. T., PARKINGTON, H. C., UBUKA, T., IQBAL, J., LI, Q., TILBROOK, A., MORGAN, K., PAWSON, A. J., TSUTSUI, K., MILLAR, R. P. & BENTLEY, G. E. 2008. Potent action of RFamide-related peptide-3 on pituitary gonadotropes indicative of a hypophysiotropic role in the negative regulation of gonadotropin secretion. Endocrinology, 149, 5811-21. CLEMENT, K., VAISSE, C., LAHLOU, N., CABROL, S., PELLOUX, V., CASSUTO, D., GOURMELEN, M., DINA, C., CHAMBAZ, J., LACORTE, J.-M., BASDEVANT, A., BOUGNERES, P., LEBOUC, Y., FROGUEL, P. & GUY-GRAND, B. 1998. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature, 392, 398-401. CLEMENTS, M. K., MCDONALD, T. P., WANG, R., XIE, G., O'DOWD, B. F., GEORGE, S. R., AUSTIN, C. P. & LIU, Q. 2001. FMRFamide-Related Neuropeptides Are Agonists of the Orphan G-Protein- Coupled Receptor GPR54. Biochemical and Biophysical Research Communications, 284, 1189-1193. CLEMMONS, D. R. 2016. Role of IGF Binding Proteins in Regulating Metabolism. Trends in Endocrinology & Metabolism, 27, 375-391. COHEN-TANNOUDJI, J., AVET, C., GARREL, G., COUNIS, R. & SIMON, V. 2012. Decoding high Gonadotropin-releasing hormone pulsatility: a role for GnRH receptor coupling to the cAMP pathway? Frontiers in Endocrinology, 3, 107. COLL, A. P. & YEO, G. S. H. 2013. The hypothalamus and metabolism: integrating signals to control energy and glucose homeostasis. Curr Opin Pharmacol, 13, 970-976. CONN, M. P., HUCKLE, W. R., ANDREWS, W. V. & MCARDLE, C. A. 1987. Molecular mechanism of action of Gondaotropin releasing hormone (GnRH) in the Pituitary. In: CLARK, J. H. (ed.) Recent progress in hormone research. Florida: Academic Press. CONSTANTIN, S. 2011. Physiology of the gonadotrophin-releasing hormone (GnRH) neurone: studies from embryonic GnRH neurones. Journal of neuroendocrinology, 23, 542-53. COOKE, D. J., CROWE, M. A. & ROCHE, J. F. 1997. Circulating FSH isoform patterns during recurrent increases in FSH throughout the oestrous cycle of heifers. J Reprod Fertil, 110, 339-45. CORPÉCHOT, C., BAULIEU, E.-E. & ROBEL, P. 1981. Testosterone, dihydrotestosterone and androstanediols in plasma, testes and prostates of rats during development. Acta Endocrinol-COP, 96, 127-135. COTA, D., PROULX, K., SMITH, K. A., KOZMA, S. C., THOMAS, G., WOODS, S. C. & SEELEY, R. J. 2006. Hypothalamic mTOR signaling regulates food intake. Science, 312, 927-30. CROWE, M. A., PADMANABHAN, V., HYNES, N., SUNDERLAND, S. J., ENRIGHT, W. J., BEITINS, I. Z. & ROCHE, J. F. 1997. Validation of a sensitive radioimmunoassay to measure serum follicle- stimulating hormone in cattle: correlation with biological activity. Anim Reprod Sci, 48, 123- 36. CROWN, S. B., MARZE, N. & ANTONIEWICZ, M. R. 2016. Catabolism of Branched Chain Amino Acids Contributes Significantly to Synthesis of Odd-Chain and Even-Chain Fatty Acids in 3T3-L1 Adipocytes. PLOS ONE, 10, e0145850. CURTIS, S. K. & AMANN, R. P. 1981. Testicular development and establishment of spermatogenesis in Holstein bulls. J Anim Sci, 53, 1645-57. DAFM 2011. Roadmap for Implementation of Food Harvest 2020 in the Dairy Sector. Dublin. DAFM 2015. Food Wise 2025. Dublin: Department of Agriculture, Food and the Marine. DAFTARY, S. S. & GORE, A. C. 2003. Developmental changes in hypothalamic insulin-like growth factor-1: relationship to gonadotropin-releasing hormone neurons. Endocrinology, 144, 2034-45. DANCE, A., THUNDATHIL, J., WILDE, R., BLONDIN, P. & KASTELIC, J. 2014. 261 HIGH NUTRITION DURING EARLY LIFE IMPROVES REPRODUCTIVE POTENTIAL OF HOLSTEIN BULLS. Reproduction, Fertility and Development, 27, 220-220.
163
DANCE, A., THUNDATHIL, J., WILDE, R., BLONDIN, P. & KASTELIC, J. 2015. Enhanced early-life nutrition promotes hormone production and reproductive development in Holstein bulls. J Dairy Sci, 98, 987-998. DAY, M. L., IMAKAWA, K., ZALESKY, D. D., KITTOK, R. J. & KINDER, J. E. 1986. Effects of restriction of dietary energy intake during the prepubertal period on secretion of luteinizing hormone and responsiveness of the pituitary to luteinizing hormone-releasing hormone in heifers. J Anim Sci, 62, 1641-8. DE PAUW, A., TEJERINA, S., RAES, M., KEIJER, J. & ARNOULD, T. 2009. Mitochondrial (dys)function in adipocyte (de)differentiation and systemic metabolic alterations. Am J Pathol, 175, 927-39. DELLMAN, H. D. & WROBEL, K. H. 1976. Male Reproductive System. In: DELLMAN, H. D. & BROWN, E. H. (eds.) Text book of Veterinary Histology. Philadelphia: Lea & Febiger. DENEF, C. 2003. Paracrine control of lactotrope proliferation and differentiation. Trends Endocrinol Metab, 14, 188-95. DEUTSCHER, G. H. 1980. G80-536 Reproductive Trace Anatomy and Physiology of the Bull [Online]. Available: http://digitalcommons.unl.edu/extensionhist/316 [Accessed]. DIAKONOVA, M. 2015. Recent Advances in Prolactin Research, New York, Springer. DIAS, J. A. & REEVES, J. J. 1982. Testicular FSH receptor numbers and affinity in bulls of various ages. J Reprod Fertil, 66, 39-45. DOBBING, J. 1981. The later development of the brain and its vulnerability. In: DAVIS, J. A. & DOBBING, J. (eds.) Scientific Foundation of Pediatrics. Baltimore: University Park Press. DONG, X. Y. & TANG, S. Q. 2010. Insulin-induced gene: a new regulator in lipid metabolism. Peptides, 31, 2145-50. DUPONT, J., #235, LLE, MAILLARD, V., COYRAL-CASTEL, S., #233, PHANIE, RAM, #233, , C. & FROMENT, P. 2010. Ghrelin in Female and Male Reproduction. International Journal of Peptides, 2010. DURAIYAN, J., GOVINDARAJAN, R., KALIYAPPAN, K. & PALANISAMY, M. 2012. Applications of immunohistochemistry. Journal of Pharmacy & Bioallied Sciences, 4, S307-S309. DURDIAKOVA, J., OSTATNIKOVA, D. & CELEC, P. 2011. Testosterone and its metabolites--modulators of brain functions. Acta Neurobiologiae Experimentalis (Wars), 71, 434-54. EHRHARDT, R., SLEPETIS, R., SIEGAL-WILLOTT, J., VAN AMBURGH, M., BELL, A. & BOISCLAIR, Y. 2000. Development of a specific radioimmunoassay to measure physiological changes of circulating leptin in cattle and sheep. J Endocrinol, 166, 519-528. ERICSON, J., NORLIN, S., JESSELL, T. M. & EDLUND, T. 1998. Integrated FGF and BMP signaling controls the progression of progenitor cell differentiation and the emergence of pattern in the embryonic anterior pituitary. Development, 125, 1005-15. ESTRADA, K. M., CLAY, C. M., POMPOLO, S., SMITH, J. T. & CLARKE, I. J. 2006. Elevated KiSS-1 expression in the arcuate nucleus prior to the cyclic preovulatory gonadotrophin-releasing hormone/lutenising hormone surge in the ewe suggests a stimulatory role for kisspeptin in oestrogen-positive feedback. Journal of Neuroendocrinology, 18, 806-9. EVANS, A. C., DAVIES, F. J., NASSER, L. F., BOWMAN, P. & RAWLINGS, N. C. 1995. Differences in early patterns of gonadotrophin secretion between early and late maturing bulls, and changes in semen characteristics at puberty. Theriogenology, 43, 569-78. EVANS, A. C., PIERSON, R. A., GARCIA, A., MCDOUGALL, L. M., HRUDKA, F. & RAWLINGS, N. C. 1996. Changes in circulating hormone concentrations, testes histology and testes ultrasonography during sexual maturation in beef bulls. Theriogenology, 46, 345-57. EZZAT AHMED, A., SAITO, H., SAWADA, T., YAEGASHI, T., YAMASHITA, T., HIRATA, T.-I., SAWAI, K. & HASHIZUME, T. 2009. Characteristics of the Stimulatory Effect of Kisspeptin-10 on the Secretion of Luteinizing Hormone, Follicle-Stimulating Hormone and Growth Hormone in Prepubertal Male and Female Cattle. J Reprod Dev, 55, 650-654. FAROOQI, I. S., JEBB, S. A., LANGMACK, G., LAWRENCE, E., CHEETHAM, C. H., PRENTICE, A. M., HUGHES, I. A., MCCAMISH, M. A. & O'RAHILLY, S. 1999. Effects of recombinant leptin
164
therapy in a child with congenital leptin deficiency. The New England Journal of Medicine, 341, 879-84. FAUCETTE, A. N., MAHER, V. A., GUTIERREZ, M. A., JUCKER, J. M., YATES, D. C., WELSH, T. H., AMSTALDEN, M., NEWTON, G. R., NUTI, L. C., FORREST, D. W. & ING, N. H. 2014. Temporal changes in histomorphology and gene expression in goat testes during postnatal development12. J Anim Sci, 92, 4440-4448. FEHMANN, H. C., PEISER, C., BODE, H. P., STAMM, M., STAATS, P., HEDETOFT, C., LANG, R. E. & GOKE, B. 1997. Leptin: a potent inhibitor of insulin secretion. Peptides, 18, 1267-73. FERNANDEZ-FERNANDEZ, R., TENA-SEMPERE, M., NAVARRO, V. M., BARREIRO, M. L., CASTELLANO, J. M., AGUILAR, E. & PINILLA, L. 2005. Effects of ghrelin upon gonadotropin-releasing hormone and gonadotropin secretion in adult female rats: in vivo and in vitro studies. Neuroendocrinology, 82, 245-55. FILBY, A. L., VAN AERLE, R., DUITMAN, J. & TYLER, C. R. 2008. The kisspeptin/gonadotropin-releasing hormone pathway and molecular signaling of puberty in fish. Biology of reproduction, 78, 278-89. FINK, G. 2000. Neuroendocrine regulation of pituitary function: general principles. In: CONN, P. M. & FREEMAN, M. E. (eds.) Neuroendocrinology in physiology and medicine. New Jersey: Humana Press. FOFANA, M., TRAVERT, C., CARREAU, S. & LE GOFF, D. 2000. Evaluation of cholesteryl ester transfer in the seminiferous tubule cells of immature rats in vivo and in vitro. J Reprod Fertil, 118, 79- 83. FORBES, S., LI, X. F., KINSEY-JONES, J. & O'BYRNE, K. 2009. Effects of ghrelin on Kisspeptin mRNA expression in the hypothalamic medial preoptic area and pulsatile luteinising hormone secretion in the female rat. Neuroscience letters, 460, 143-7. FRERMAN, F. E., SABRAN, J. L., TAYLOR, J. L. & GROSSBERG, S. E. 1983. Leucine catabolism during the differentiation of 3T3-L1 cells. Expression of a mitochondrial enzyme system. J Biol Chem, 258, 7087-93. FUJIOKA, H., YAMANOUCHI, K., AKEMA, T. & NISHIHARA, M. 2007. The Effects of GABA on embryonic gonadotropin-releasing hormone neurons in rat hypothalamic primary culture. J Reprod Dev, 53, 323-31. FUKUSHIMA, M., VILLAR, J., TSAI-MORRIS, C.-H. & DUFAU, M. L. 2011. Gonadotropin-regulated Testicular RNA Helicase (GRTH/DDX25), a Negative Regulator of Luteinizing/Chorionic Gonadotropin Hormone-induced Steroidogenesis in Leydig Cells CENTRAL ROLE OF STEROIDOGENIC ACUTE REGULATORY PROTEIN (StAR). Journal of Biological Chemistry, 286, 29932-29940. FUKUSUMI, S., HABATA, Y., YOSHIDA, H., IIJIMA, N., KAWAMATA, Y., HOSOYA, M., FUJII, R., HINUMA, S., KITADA, C., SHINTANI, Y., SUENAGA, M., ONDA, H., NISHIMURA, O., TANAKA, M., IBATA, Y. & FUJINO, M. 2001. Characteristics and distribution of endogenous RFamide-related peptide-1. Biochimica et Biophysica Acta, 1540, 221-32. GABIG, M. & WEGRZYN, G. 2001. An introduction to DNA chips: principles, technology, applications and analysis. Acta Biochim Pol, 48, 615-22. GALIC, S., OAKHILL, J. S. & STEINBERG, G. R. 2010. Adipose tissue as an endocrine organ. Mol Cell Endocrinol, 316, 129-39. GARIKAPATI, K. R., PATEL, N., MAKANI, V. K. K., CILAMKOTI, P., BHADRA, U. & BHADRA, M. P. 2017. Down-regulation of BORIS/CTCFL efficiently regulates cancer stemness and metastasis in MYCN amplified neuroblastoma cell line by modulating Wnt/β-catenin signaling pathway. Biochemical and Biophysical Research Communications, 484, 93-99. GHOLAMI, H., TOWHIDI, A., ZARE SHAHNEH, A. & DIRANDEH, E. 2010. The relationship of plasma leptin concentration and puberty in Holstein bull calves (Bos taurus). Journal of Animal Physiology and Animal Nutrition, 94, 797-802.
165
GIAGULLI, V. A., KAUFMAN, J. M. & VERMEULEN, A. 1994. Pathogenesis of the decreased androgen levels in obese men. Journal of Clinical Endocrinology and Metabolism, 79, 997-1000. GOLDENTHAL, M. J. & MARIN-GARCIA, J. 2004. Mitochondrial signaling pathways: a receiver/integrator organelle. Mol Cell Biochem, 262, 1-16. GOTTSCH, M. L., CUNNINGHAM, M. J., SMITH, J. T., POPA, S. M., ACOHIDO, B. V., CROWLEY, W. F., SEMINARA, S., CLIFTON, D. K. & STEINER, R. A. 2004. A role for kisspeptins in the regulation of gonadotropin secretion in the mouse. Endocrinology, 145, 4073-7. GRAUGNARD, D. E., BERGER, L. L., FAULKNER, D. B. & LOOR, J. J. 2010. High-starch diets induce precocious adipogenic gene network up-regulation in longissimus lumborum of early- weaned Angus cattle. Brit J Nutr, 103, 953-63. GREGOIRE, F. M., SMAS, C. M. & SUL, H. S. 1998. Understanding adipocyte differentiation. Physiol Rev, 78, 783-809. GUAN, X. M., HESS, J. F., YU, H., HEY, P. J. & VAN DER PLOEG, L. H. 1997. Differential expression of mRNA for leptin receptor isoforms in the rat brain. Molecular and Cellular Endocrinology, 133, 1-7. GUAN, Y., LIANG, G., HAWKEN, P. A., MALECKI, I. A., COZENS, G., VERCOE, P. E., MARTIN, G. B. & GUAN LE, L. 2015. Roles of small RNAs in the effects of nutrition on apoptosis and spermatogenesis in the adult testis. Sci Rep, 5, 10372. GUAN, Y., LIANG, G., HAWKEN, P. A. R., MEACHEM, S. J., MALECKI, I. A., HAM, S., STEWART, T., GUAN, L. L. & MARTIN, G. B. 2014. Nutrition affects Sertoli cell function but not Sertoli cell numbers in sexually mature male sheep. Reprod Fert Develop, 28, 1152-1163. HAFEZ, B. & HAFEZ, E. S. E. 2000. Reproduction in Farm Animals, Lippincott Williams & Wilkins. HAGAN, M. M., RUSHING, P. A., PRITCHARD, L. M., SCHWARTZ, M. W., STRACK, A. M., VAN DER PLOEG, L. H., WOODS, S. C. & SEELEY, R. J. 2000. Long-term orexigenic effects of AgRP-(83--- 132) involve mechanisms other than melanocortin receptor blockade. Am J Physiol Regul Integr Comp Physiol, 279, R47-52. HAHN, T. M., BREININGER, J. F., BASKIN, D. G. & SCHWARTZ, M. W. 1998. Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nature Neuroscience, 1, 271-2. HAMMES, T. O., COSTA CDOS, S., ROHDEN, F., MARGIS, R., DE ALMEIDA, J. C., PADOIN, A. V., MOTTIN, C. C. & GUARAGNA, R. M. 2012. Parallel down-regulation of FOXO1, PPARgamma and adiponectin mRNA expression in visceral adipose tissue of class III obese individuals. Obes Facts, 5, 452-9. HAMMON, H. M., SCHIESSLER, G., NUSSBAUM, A. & BLUM, J. W. 2002. Feed intake patterns, growth performance, and metabolic and endocrine traits in calves fed unlimited amounts of colostrum and milk by automate, starting in the neonatal period. J Dairy Sci, 85, 3352-62. HARRISON, J. L., MILLER, D. W., FINDLAY, P. A. & ADAM, C. L. 2008. Photoperiod influences the central effects of ghrelin on food intake, GH and LH secretion in sheep. Neuroendocrinology, 87, 182-92. HARSTINE, B. R., CRUPPE, L. H., ABREU, F. M., RODRIGUES, A. D., DEJARNETTE, J. M. & DAY, M. L. 2017a. Impact of a timed-release FSH treatment from 2 to 6 months of age in bulls II: Endocrinology, puberty attainment, and mature sperm production in Holstein bulls. Theriogenology, 105, 135-141. HARSTINE, B. R., CRUPPE, L. H., ABREU, F. M., UTT, M. D., CIPRIANO, R. S., LEMES, A., PREMANANDAN, C., DEJARNETTE, J. M. & DAY, M. L. 2017b. Impact of a timed-release follicle-stimulating hormone treatment from one to three months of age on endocrine and testicular development of prepubertal bulls. J Anim Sci, 95, 1669-1679. HARSTINE, B. R., MAQUIVAR, M., HELSER, L. A., UTT, M. D., PREMANANDAN, C., DEJARNETTE, J. M. & DAY, M. L. 2015. Effects of dietary energy on sexual maturation and sperm production in Holstein bulls. J Anim Sci, 93, 2759-2766. HASSANEEN, A., NANIWA, Y., SUETOMI, Y., MATSUYAMA, S., KIMURA, K., IEDA, N., INOUE, N., UENOYAMA, Y., TSUKAMURA, H., MAEDA, K.-I., MATSUDA, F. & OHKURA, S. 2016.
166
Immunohistochemical characterization of the arcuate kisspeptin/neurokinin B/dynorphin (KNDy) and preoptic kisspeptin neuronal populations in the hypothalamus during the estrous cycle in heifers. The Journal of Reproduction and Development, 62, 471-477. HAUSMAN, G. J., DODSON, M. V., AJUWON, K., AZAIN, M., BARNES, K. M., GUAN, L. L., JIANG, Z., POULOS, S. P., SAINZ, R. D., SMITH, S., SPURLOCK, M., NOVAKOFSKI, J., FERNYHOUGH, M. E. & BERGEN, W. G. 2009. Board-invited review: the biology and regulation of preadipocytes and adipocytes in meat animals. J Anim Sci, 87, 1218-46. HE, Z., JIANG, T., WANG, Z., LEVI, M. & LI, J. 2004. Modulation of carbohydrate response element- binding protein gene expression in 3T3-L1 adipocytes and rat adipose tissue. Am J Physiol Endoc M, 287, 424-30. HEDGER, M. P. & WINNALL, W. R. 2012. Regulation of activin and inhibin in the adult testis and the evidence for functional roles in spermatogenesis and immunoregulation. Mol Cell Endocrinol, 359, 30-42. HEGDE, P., QI, R., ABERNATHY, K., GAY, C., DHARAP, S., GASPARD, R., HUGHES, J. E., SNESRUD, E., LEE, N. & QUACKENBUSH, J. 2000. A concise guide to cDNA microarray analysis. Biotechniques, 29, 548-50, 552-4, 556 passim. HEINZ, J. F. L., SINGH, S. P., JANOWITZ, U., HOELKER, M., TESFAYE, D., SCHELLANDER, K. & SAUERWEIN, H. 2015. Characterization of adiponectin concentrations and molecular weight forms in serum, seminal plasma, and ovarian follicular fluid from cattle. Theriogenology, 83, 326-333. HENINGER, N. L., STAUB, C., JOHNSON, L., BLANCHARD, T. L., VARNER, D., ING, N. H. & FORREST, D. W. 2006. Testicular germ cell apoptosis and formation of the sertoli cell barrier during the initiation of spermatogenesis in pubertal stallions. Animal Reproduction Science, 94, 127- 131. HERMAN, M. A., SHE, P., PERONI, O. D., LYNCH, C. J. & KAHN, B. B. 2010. Adipose Tissue Branched Chain Amino Acid (BCAA) Metabolism Modulates Circulating BCAA Levels. The Journal of Biological Chemistry, 285, 11348-11356. HERO, M., TOMMISKA, J., VAARALAHTI, K., LAITINEN, E. M., SIPILA, I., PUHAKKA, L., DUNKEL, L. & RAIVIO, T. 2012. Circulating antimullerian hormone levels in boys decline during early puberty and correlate with inhibin B. Fertil Steril, 97, 1242-7. HILL, J. W., ELMQUIST, J. K. & ELIAS, C. F. 2008. Hypothalamic pathways linking energy balance and reproduction. Am J Physiol Endocrinol Metab, 294, E827-32. HINEY, J. K., SRIVASTAVA, V., DEARTH, R. K. & DEES, W. L. 2004. Influence of estradiol on insulin-like growth factor-1-induced luteinizing hormone secretion. Brain Research, 1013, 91-7. HINEY, J. K., SRIVASTAVA, V. K., PINE, M. D. & LES DEES, W. 2009. Insulin-like growth factor-I activates KiSS-1 gene expression in the brain of the prepubertal female rat. Endocrinology, 150, 376-84. HOOD, R. L. & ALLEN, C. E. 1973. Cellularity of bovine adipose tissue. Journal of Lipid Research, 14, 605-610. HOOKER, C. W. 1970. The intertubular tissue of the testis. Life history of the Leydig cells. In: JOHNSON, A. D., GOMES, W. R. & VANDENMARK, N. L. (eds.) The Testis. 1 ed. New York: Academic Press. HU, J., ZHANG, Z., SHEN, W.-J. & AZHAR, S. 2010. Cellular cholesterol delivery, intracellular processing and utilization for biosynthesis of steroid hormones. Nutrition & Metabolism, 7, 47-47. HUANG, H., SONG, T. J., LI, X., HU, L., HE, Q., LIU, M., LANE, M. D. & TANG, Q. Q. 2009. BMP signaling pathway is required for commitment of C3H10T1/2 pluripotent stem cells to the adipocyte lineage. Proc Natl Acad Sci U S A, 106, 12670-5. HURTADO DEL POZO, C., VESPERINAS-GARCÍA, G., RUBIO, M.-Á., CORRIPIO-SÁNCHEZ, R., TORRES- GARCÍA, A. J., OBREGON, M.-J. & CALVO, R. M. 2011. ChREBP expression in the liver, adipose
167
tissue and differentiated preadipocytes in human obesity. BBA-Mol Cell Bio L, 1811, 1194- 1200. INGVARTSEN, K. L. & BOISCLAIR, Y. R. 2001. Leptin and the regulation of food intake, energy homeostasis and immunity with special focus on periparturient ruminants. Domestic Animal Endocrinology, 21, 215-50. IQBAL, J., POMPOLO, S., MURAKAMI, T., GROUZMANN, E., SAKURAI, T., MEISTER, B. & CLARKE, I. J. 2001. Immunohistochemical characterization of localization of long-form leptin receptor (OB-Rb) in neurochemically defined cells in the ovine hypothalamus. Brain Res, 920, 55-64. ISIDORI, A. M., CAPRIO, M., STROLLO, F., MORETTI, C., FRAJESE, G., ISIDORI, A. & FABBRI, A. 1999. Leptin and androgens in male obesity: evidence for leptin contribution to reduced androgen levels. The Journal of clinical endocrinology and metabolism, 84, 3673-80. ITMAN, C., MENDIS, S., BARAKAT, B. & LOVELAND, K. L. 2006. All in the family: TGF-beta family action in testis development. Reproduction, 132, 233-46. JAINUDEEN, M. R. & HAFEZ, E. S. E. 2000. Cattle and Buffalo. In: HAFEZ, E. S. E. & HAFEZ, B. (eds.) Reproduction in Farm Animals. 7th ed. Baltimore: Blackwell Publishing. JALURIA, P., KONSTANTOPOULOS, K., BETENBAUGH, M. & SHILOACH, J. 2007. A perspective on microarrays: current applications, pitfalls, and potential uses. Microb Cell Fact, 6, 4. JASKULSKI, D., DERIEL, J. K., MERCER, W. E., CALABRETTA, B. & BASERGA, R. 1988. Inhibition of cellular proliferation by antisense oligodeoxynucleotides to PCNA cyclin. Science, 240, 1544- 6. JIANG, Y., BERRY, D. C. & GRAFF, J. M. 2017. Distinct cellular and molecular mechanisms for β3 adrenergic receptor-induced beige adipocyte formation. eLife, 6, e30329. JIMENEZ-SEVERIANO, H., MUSSARD, M. L., FITZPATRICK, L. A., D'OCCHIO, M. J., FORD, J. J., LUNSTRA, D. D. & KINDER, J. E. 2005. Testicular development of Zebu bulls after chronic treatment with a gonadotropin-releasing hormone agonist. J Anim Sci, 83, 2111-22. JIN, J. M. & YANG, W. X. 2014. Molecular regulation of hypothalamus-pituitary-gonads axis in males. Gene, 551, 15-25. JIN, W., OLSON, E. N., MOORE, S. S., BASARAB, J. A., BASU, U. & GUAN, L. L. 2012. Transcriptome analysis of subcutaneous adipose tissues in beef cattle using 3' digital gene expression-tag profiling. J Anim Sci, 90, 171-83. JOHNSEN, L., KONGSTED, A. H. & NIELSEN, M. O. 2013. Prenatal undernutrition and postnatal overnutrition alter thyroid hormone axis function in sheep. Journal of Endocrinology, 216, 389-402. JOHNSON, L., VARNER, D. D., ROBERTS, M. E., SMITH, T. L., KEILLOR, G. E. & SCRUTCHFIELD, W. L. 2000. Efficiency of spermatogenesis: a comparative approach. Anim Reprod Sci, 60-61, 471- 80. JOHNSON, M. A., TSUTSUI, K. & FRALEY, G. S. 2007. Rat RFamide-related peptide-3 stimulates GH secretion, inhibits LH secretion, and has variable effects on sex behavior in the adult male rat. Hormones and Behaviour, 51, 171-80. KADIVAR, A., HEIDARI KHOEI, H., HASSANPOUR, H., GOLESTANFAR, A. & GHANAEI, H. 2016. Correlation of Adiponectin mRNA Abundance and Its Receptors with Quantitative Parameters of Sperm Motility in Rams. International Journal of Fertility & Sterility, 10, 127- 135. KADOKAWA, H., MATSUI, M., HAYASHI, K., MATSUNAGA, N., KAWASHIMA, C., SHIMIZU, T., KIDA, K. & MIYAMOTO, A. 2008. Peripheral administration of kisspeptin-10 increases plasma concentrations of GH as well as LH in prepubertal Holstein heifers. J Endocrinol, 196, 331-4. KADOWAKI, T., YAMAUCHI, T., KUBOTA, N., HARA, K., UEKI, K. & TOBE, K. 2006. Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J Clin Invest, 116, 1784-92. KALAMATIANOS, T., GRIMSHAW, S. E., POORUN, R., HAHN, J. D. & COEN, C. W. 2008. Fasting reduces KiSS-1 expression in the anteroventral periventricular nucleus (AVPV): effects of fasting on
168
the expression of KiSS-1 and neuropeptide Y in the AVPV or arcuate nucleus of female rats. Journal of Neuroendocrinology, 20, 1089-97. KANDEL, E. R. & SCHWARTZ, J. H. 1991. Principles of Neural Science, New York, Elsevier. KANEHISA, M. & GOTO, S. 2000. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res, 28, 27-30. KANEKO, H., NOGUCHI, J., KIKUCHI, K., AKAGI, S., SHIMADA, A., TAYA, K., WATANABE, G. & HASEGAWA, Y. 2001. Production and endocrine role of inhibin during the early development of bull calves. Biol Reprod, 65, 209-15. KANG-DECKER, N., MANTCHEV, G. T., JUNEJA, S. C., MCNIVEN, M. A. & VAN DEURSEN, J. M. 2001. Lack of acrosome formation in Hrb-deficient mice. Science, 294, 1531-1533. KAPRANOV, P., SEMENTCHENKO, V. I. & GINGERAS, T. R. 2003. Beyond expression profiling: next generation uses of high density oligonucleotide arrays. Brief Funct Genomic Proteomic, 2, 47- 56. KASIMANICKAM, V. R., KASIMANICKAM, R. K., KASTELIC, J. P. & STEVENSON, J. S. 2013. Associations of adiponectin and fertility estimates in Holstein bulls. Theriogenology, 79, 766-777.e3. KASPERK, C. H., WERGEDAL, J. E., FARLEY, J. R., LINKHART, T. A., TURNER, R. T. & BAYLINK, D. J. 1989. Androgens directly stimulate proliferation of bone cells in vitro. Endocrinology, 124, 1576-8. KAWAI, M. & ROSEN, C. J. 2010. The IGF-I regulatory system and its impact on skeletal and energy homeostasis. J Cell Biochem, 111, 14-9. KAWANO, J. & ARORA, R. 2009. The Role of Adiponectin in Obesity, Diabetes, and Cardiovascular Disease. Journal of the CardioMetabolic Syndrome, 4, 44-49. KEBER, R., ROZMAN, D. & HORVAT, S. 2013. Sterols in spermatogenesis and sperm maturation. Journal of Lipid Research, 54, 20-33. KEDISHVILI, N. Y., POPOV, K. M., JASKIEWICZ, J. A. & HARRIS, R. A. 1994. Coordinated expression of valine catabolic enzymes during adipogenesis: analysis of activity, mRNA, protein levels, and metabolic consequences. Arch Biochem Biophys, 315, 317-22. KEOGH, K., KENNY, D. A., CORMICAN, P., MCCABE, M. S., KELLY, A. K. & WATERS, S. M. 2016. Effect of Dietary Restriction and Subsequent Re-Alimentation on the Transcriptional Profile of Bovine Skeletal Muscle. PLoS One, 11, e0149373. KEOGH, K., WATERS, S. M., KELLY, A. K., WYLIE, A. R. & KENNY, D. A. 2015. Effect of feed restriction and subsequent re-alimentation on hormones and genes of the somatotropic axis in cattle. Physiol Genomics, 47, 264-73. KETELSLEGERS, J. M., HETZEL, W. D., SHERINS, R. J. & CATT, K. J. 1978. Developmental changes in testicular gonadotropin receptors: plasma gonadotropins and plasma testosterone in the rat. Endocrinology, 103, 212-22. KHAN, M. A., WEARY, D. M. & VON KEYSERLINGK, M. A. 2011. Hay intake improves performance and rumen development of calves fed higher quantities of milk. J Dairy Sci, 94, 3547-53. KIM, J. B., SARRAF, P., WRIGHT, M., YAO, K. M., MUELLER, E., SOLANES, G., LOWELL, B. B. & SPIEGELMAN, B. M. 1998. Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest, 101, 1-9. KLEIMAN, S. E., YOGEV, L., GAL-YAM, E. N., HAUSER, R., GAMZU, R., BOTCHAN, A., PAZ, G., YAVETZ, H., MAYMON, B. B., SCHREIBER, L., BARZILAI, S., AMARIGLIO, N., RECHAVI, G. & SIMON, A. J. 2003. Reduced human germ cell-less (HGCL) expression in azoospermic men with severe germinal cell impairment. J Androl, 24, 670-5. KOMATSU, M., KOJIMA, M., OKAMURA, H., NISHIO, M., KANEDA, M., KOJIMA, T., TAKEDA, H., MALAU-ADULI, A. E. & TAKAHASHI, H. 2012. Age-related changes in gene expression of the growth hormone secretagogue and growth hormone-releasing hormone receptors in Holstein-Friesian cattle. Domest Anim Endocrinol, 42, 83-93. KOMORI, T., MORIKAWA, Y., NANJO, K. & SENBA, E. 2006. Induction of brain-derived neurotrophic factor by leptin in the ventromedial hypothalamus. Neuroscience, 139, 1107-15.
169
KÖNNER, A. C., JANOSCHEK, R., PLUM, L., JORDAN, S. D., ROTHER, E., MA, X., XU, C., ENRIORI, P., HAMPEL, B., BARSH, G. S., KAHN, C. R., COWLEY, M. A., ASHCROFT, F. M. & BRÜNING, J. C. 2007. Insulin Action in AgRP-Expressing Neurons Is Required for Suppression of Hepatic Glucose Production. Cell Metabolism, 5, 438-449. KORESSAAR, T. & REMM, M. 2007. Enhancements and modifications of primer design program Primer3. Bioinformatics, 23, 1289-1291. KOTANI, M., DETHEUX, M., VANDENBOGAERDE, A., COMMUNI, D., VANDERWINDEN, J.-M., LE POUL, E., BRÉZILLON, S., TYLDESLEY, R., SUAREZ-HUERTA, N., VANDEPUT, F., BLANPAIN, C., SCHIFFMANN, S. N., VASSART, G. & PARMENTIER, M. 2001. The Metastasis Suppressor Gene KiSS-1 Encodes Kisspeptins, the Natural Ligands of the Orphan G Protein-coupled Receptor GPR54. Journal of Biological Chemistry, 276, 34631-34636. KRIEGSFELD, L. J., MEI, D. F., BENTLEY, G. E., UBUKA, T., MASON, A. O., INOUE, K., UKENA, K., TSUTSUI, K. & SILVER, R. 2006. Identification and characterization of a gonadotropin- inhibitory system in the brains of mammals. Proceedings of the National Academy of Sciences of the United States of America, 103, 2410-5. KUBISTA, M., ANDRADE, J. M., BENGTSSON, M., FOROOTAN, A., JONAK, J., LIND, K., SINDELKA, R., SJOBACK, R., SJOGREEN, B., STROMBOM, L., STAHLBERG, A. & ZORIC, N. 2006. The real-time polymerase chain reaction. Mol Aspects Med, 27, 95-125. LAMOLET, B., PULICHINO, A. M., LAMONERIE, T., GAUTHIER, Y., BRUE, T., ENJALBERT, A. & DROUIN, J. 2001. A pituitary cell-restricted T box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell, 104, 849-59. LANDRY, D., CLOUTIER, F. & MARTIN, L. J. 2013. Implications of leptin in neuroendocrine regulation of male reproduction. Reprod Bio, 13, 1-14. LANDRY, D., PARÉ, A., JEAN, S. & MARTIN, L. J. 2015. Adiponectin influences progesterone production from MA-10 Leydig cells in a dose-dependent manner. Endocrine, 48, 957-967. LANFRANCO, F., BONELLI, L., BALDI, M., ME, E., BROGLIO, F. & GHIGO, E. 2008. Acylated ghrelin inhibits spontaneous luteinizing hormone pulsatility and responsiveness to naloxone but not that to gonadotropin-releasing hormone in young men: evidence for a central inhibitory action of ghrelin on the gonadal axis. Journal of Clinical Endocrinology and Metabolism, 93, 3633-9. LECHAN, R. M. & TONI, R. 2000. Functional Anatomy of the Hypothalamus and Pituitary. In: DE GROOT, L. J., CHROUSOS, G., DUNGAN, K., FEINGOLD, K. R., GROSSMAN, A., HERSHMAN, J. M., KOCH, C., KORBONITS, M., MCLACHLAN, R., NEW, M., PURNELL, J., REBAR, R., SINGER, F. & VINIK, A. (eds.) Endotext. South Dartmouth (MA). LEDERMAN, M. A., LEBESGUE, D., GONZALEZ, V. V., SHU, J., MERHI, Z. O., ETGEN, A. M. & NEAL- PERRY, G. 2010. Age-related LH surge dysfunction correlates with reduced responsiveness of hypothalamic anteroventral periventricular nucleus kisspeptin neurons to estradiol positive feedback in middle-aged rats. Neuropharmacology, 58, 314-20. LEE, D. K., NGUYEN, T., O'NEILL, G. P., CHENG, R., LIU, Y., HOWARD, A. D., COULOMBE, N., TAN, C. P., TANG-NGUYEN, A. T., GEORGE, S. R. & O'DOWD, B. F. 1999. Discovery of a receptor related to the galanin receptors. FEBS Letters, 446, 103-7. LEE, S., BOOKOUT, A. L., LEE, C. E., GAUTRON, L., HARPER, M. J., ELIAS, C. F., LOWELL, B. B. & ELMQUIST, J. K. 2012. Laser-Capture Microdissection and Transcriptional Profiling of the Dorsomedial Nucleus of the Hypothalamus. The Journal of comparative neurology, 520, 3617-3632. LEMOR, A., HOSSEINI, A., SAUERWEIN, H. & MIELENZ, M. 2009. Transition period-related changes in the abundance of the mRNAs of adiponectin and its receptors, of visfatin, and of fatty acid binding receptors in adipose tissue of high-yielding dairy cows. Domestic Animal Endocrinology, 37, 37-44.
170
LI, J., TAKAISHI, K., COOK, W., MCCORKLE, S. K. & UNGER, R. H. 2003. Insig-1 "brakes" lipogenesis in adipocytes and inhibits differentiation of preadipocytes. Proc Natl Acad Sci U S A, 100, 9476- 81. LINDGREN, I., GIWERCMAN, A., AXELSSON, J. & LUNDBERG GIWERCMAN, Y. 2012. Association between follicle-stimulating hormone receptor polymorphisms and reproductive parameters in young men from the general population. Pharmacogenetics and Genomics, 22, 667-672. LKHAGVADORJ, S., QU, L., CAI, W., COUTURE, O. P., BARB, C. R., HAUSMAN, G. J., NETTLETON, D., ANDERSON, L. L., DEKKERS, J. C. & TUGGLE, C. K. 2010. Gene expression profiling of the short-term adaptive response to acute caloric restriction in liver and adipose tissues of pigs differing in feed efficiency. Am J Physiol Regul Integr Comp Physiol, 298, R494-507. LOOMIS, P. R., AMANN, R. P., SQUIRES, E. L. & PICKETT, B. W. 1983. Fertility of unfrozen and frozen stallion spermatozoa extended in EDTA-lactose-egg yolk and packaged in straws. Journal of Animal Science, 56, 687-93. LOOR, J. J. 2010. Transcriptomics of muscle and fat development in growing cattle. In: CROVETTO, G. M. (ed.) Energy and Protein Metabolism and Nutrition. Wageningen: Wageningen Academic Publishers. LOWE, C. E., O'RAHILLY, S. & ROCHFORD, J. J. 2011. Adipogenesis at a glance. J Cell Sci, 124, 2681-6. LU, M., TANG, Q., OLEFSKY, J. M., MELLON, P. L. & WEBSTER, N. J. G. 2008. Adiponectin Activates Adenosine Monophosphate-Activated Protein Kinase and Decreases Luteinizing Hormone Secretion in LβT2 Gonadotropes. Molecular Endocrinology, 22, 760-771. LUCIDI, P., MURDOLO, G., DI LORETO, C., PARLANTI, N., DE CICCO, A., FATONE, C., TAGLIONI, C., FANELLI, C., BROGLIO, F., GHIGO, E., BOLLI, G. B., SANTEUSANIO, F. & DE FEO, P. 2005. Metabolic and endocrine effects of physiological increments in plasma ghrelin concentrations. Nutrition, metabolism, and cardiovascular diseases : NMCD, 15, 410-7. LUNSTRA, D. D. & ECHTERNKAMP, S. E. 1982. Puberty in beef bulls: acrosome morphology and semen quality in bulls of different breeds. J Anim Sci, 55, 638-48. LYNCH, C. J., GERN, B., LLOYD, C., HUTSON, S. M., EICHER, R. & VARY, T. C. 2006. Leucine in food mediates some of the postprandial rise in plasma leptin concentrations. Am J Physiol Endocrinol Metab, 291, E621-30. MANNA, P. R., CHANDRALA, S. P., KING, S. R., JO, Y., COUNIS, R., HUHTANIEMI, I. T. & STOCCO, D. M. 2006. Molecular Mechanisms of Insulin-like Growth Factor-I Mediated Regulation of the Steroidogenic Acute Regulatory Protein in Mouse Leydig Cells. Molecular Endocrinology, 20, 362-378. MARION, V., STOETZEL, C., SCHLICHT, D., MESSADDEQ, N., KOCH, M., FLORI, E., DANSE, J. M., MANDEL, J. L. & DOLLFUS, H. 2009. Transient ciliogenesis involving Bardet-Biedl syndrome proteins is a fundamental characteristic of adipogenic differentiation. Proc Natl Acad Sci U S A, 106, 1820-5. MARUSKA, K. P. & FERNALD, R. D. 2011. Social Regulation of Gene Expression in the Hypothalamic- Pituitary-Gonadal Axis. MARUYAMA, Y., AOKI, N., SUZUKI, Y., OHNO, Y., IMAMURA, M., SAIKA, T., SINOHARA, H. & YAMAMOTO, T. 1987. Sex-steroid-binding plasma protein (SBP), testosterone, oestradiol and dehydroepiandrosterone (DHEA) in prepuberty and puberty. Acta Endocrinologica (Copenh), 114, 60-7. MASUZAKI, H., OGAWA, Y., SAGAWA, N., HOSODA, K., MATSUMOTO, T., MISE, H., NISHIMURA, H., YOSHIMASA, Y., TANAKA, I., MORI, T. & NAKAO, K. 1997. Nonadipose tissue production of leptin: leptin as a novel placenta-derived hormone in humans. Nature Medicine, 3, 1029-33. MATSUZAKI, S., UENOYAMA, Y., OKUDA, K., WATANABE, G., KITAMURA, N., TAYA, K., CRUZANA, M. B. & YAMADA, J. 2001. Prepubertal changes in immunoreactive inhibin concentration in blood serum and testicular tissue in Holstein bull calves. J Vet Med Sci, 63, 1303-7.
171
MCCOARD, S. A., LUNSTRA, D. D., WISE, T. H. & FORD, J. J. 2001. Specific staining of Sertoli cell nuclei and evaluation of Sertoli cell number and proliferative activity in Meishan and White Composite boars during the neonatal period. Biol Reprod, 64, 689-95. MCCORMACK, S. E., SHAHAM, O., MCCARTHY, M. A., DEIK, A. A., WANG, T. J., GERSZTEN, R. E., CLISH, C. B., MOOTHA, V. K., GRINSPOON, S. K. & FLEISCHMAN, A. 2013. Circulating branched-chain amino acid concentrations are associated with obesity and future insulin resistance in children and adolescents. Pediatric Obesity, 8, 52-61. MCKINNELL, C., SAUNDERS, P. T., FRASER, H. M., KELNAR, C. J., KIVLIN, C., MORRIS, K. D. & SHARPE, R. M. 2001. Comparison of androgen receptor and oestrogen receptor beta immunoexpression in the testes of the common marmoset (Callithrix jacchus) from birth to adulthood: low androgen receptor immunoexpression in Sertoli cells during the neonatal increase in testosterone concentrations. Reproduction, 122, 419-29. MCMINN, J. E., WILKINSON, C. W., HAVEL, P. J., WOODS, S. C. & SCHWARTZ, M. W. 2000. Effect of intracerebroventricular alpha-MSH on food intake, adiposity, c-Fos induction, and neuropeptide expression. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology, 279, R695-703. MCSHANE, T. M., MAY, T., MINER, J. L. & KEISLER, D. H. 1992. Central actions of neuropeptide-Y may provide a neuromodulatory link between nutrition and reproduction. Biology of Reproduction, 46, 1151-7. MCSHANE, T. M., PETERSEN, S. L., MCCRONE, S. & KEISLER, D. H. 1993. Influence of food restriction on neuropeptide-Y, proopiomelanocortin, and luteinizing hormone-releasing hormone gene expression in sheep hypothalami. Biol Reprod, 49, 831-9. MEE, J. F. 2004. Temporal trends in reproductive performance in Irish dairy herds and associated risk factors. Ir Vet J, 57, 158-66. MELNICK, I., PRONCHUK, N., COWLEY, M. A., GROVE, K. L. & COLMERS, W. F. 2007. Developmental switch in neuropeptide Y and melanocortin effects in the paraventricular nucleus of the hypothalamus. Neuron, 56, 1103-15. MENDIS-HANDAGAMA, S. M. & SIRIL ARIYARATNE, H. B. 2005. Leydig cells, thyroid hormones and steroidogenesis. Indian J Exp Biol, 43, 939-62. MERCER, J. G., HOGGARD, N., WILLIAMS, L. M., LAWRENCE, C. B., HANNAH, L. T. & TRAYHURN, P. 1996. Localization of leptin receptor mRNA and the long form splice variant (Ob-Rb) in mouse hypothalamus and adjacent brain regions by in situ hybridization. FEBS Letters, 387, 113-6. MESSAGER, S., CHATZIDAKI, E. E., MA, D., HENDRICK, A. G., ZAHN, D., DIXON, J., THRESHER, R. R., MALINGE, I., LOMET, D., CARLTON, M. B., COLLEDGE, W. H., CARATY, A. & APARICIO, S. A. 2005. Kisspeptin directly stimulates gonadotropin-releasing hormone release via G protein- coupled receptor 54. Proceedings of the National Academy of Sciences of the United States of America, 102, 1761-6. MILLAR, R. P. 2005. GnRHs and GnRH receptors. Animal Reproduction Science, 88, 5-28. MILLER, W. L. 2007. Steroidogenic acute regulatory protein (StAR), a novel mitochondrial cholesterol transporter. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids, 1771, 663-676. MORGAN, F. J., BIRKEN, S. & CANFIELD, R. E. 1975. The amino acid sequence of human chorionic gonadotropin. The alpha subunit and beta subunit. Journal of Biological Chemistry, 250, 5247-58. MORRISON, C. D., WOOD, R., MCFADIN, E. L., WHITLEY, N. C. & KEISLER, D. H. 2002. Effect of intravenous infusion of recombinant ovine leptin on feed intake and serum concentrations of GH, LH, insulin, IGF-1, cortisol, and thyroxine in growing prepubertal ewe lambs. Domestic Animal Endocrinology, 22, 103-12. MORTON, G. J., CUMMINGS, D. E., BASKIN, D. G., BARSH, G. S. & SCHWARTZ, M. W. 2006. Central nervous system control of food intake and body weight. Nature, 443, 289-95.
172
MOUNZIH, K., LU, R. & CHEHAB, F. F. 1997. Leptin treatment rescues the sterility of genetically obese ob/ob males. Endocrinology, 138, 1190-3. MUIR, A. I., CHAMBERLAIN, L., ELSHOURBAGY, N. A., MICHALOVICH, D., MOORE, D. J., CALAMARI, A., SZEKERES, P. G., SARAU, H. M., CHAMBERS, J. K., MURDOCK, P., STEPLEWSKI, K., SHABON, U., MILLER, J. E., MIDDLETON, S. E., DARKER, J. G., LARMINIE, C. G. C., WILSON, S., BERGSMA, D. J., EMSON, P., FAULL, R., PHILPOTT, K. L. & HARRISON, D. C. 2001. AXOR12, a Novel Human G Protein-coupled Receptor, Activated by the Peptide KiSS-1. Journal of Biological Chemistry, 276, 28969-28975. MULLIS, K., FALOONA, F., SCHARF, S., SAIKI, R., HORN, G. & ERLICH, H. 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol, 51 Pt 1, 263-73. MURAKAMI, M., MATSUZAKI, T., IWASA, T., YASUI, T., IRAHARA, M., OSUGI, T. & TSUTSUI, K. 2008. Hypophysiotropic role of RFamide-related peptide-3 in the inhibition of LH secretion in female rats. Journal of Endocrinology, 199, 105-12. MUSUMECI, G., CASTORINA, S., CASTROGIOVANNI, P., LORETO, C., LEONARDI, R., AIELLO, F. C., MAGRO, G. & IMBESI, R. 2015. A journey through the pituitary gland: Development, structure and function, with emphasis on embryo-foetal and later development. Acta Histochem, 117, 355-66. NAVARRO, V. M., CASTELLANO, J. M., FERNANDEZ-FERNANDEZ, R., TOVAR, S., ROA, J., MAYEN, A., BARREIRO, M. L., CASANUEVA, F. F., AGUILAR, E., DIEGUEZ, C., PINILLA, L. & TENA-SEMPERE, M. 2005. Effects of KiSS-1 peptide, the natural ligand of GPR54, on follicle-stimulating hormone secretion in the rat. Endocrinology, 146, 1689-97. NAVARRO, V. M., GOTTSCH, M. L., CHAVKIN, C., OKAMURA, H., CLIFTON, D. K. & STEINER, R. A. 2009. Regulation of gonadotropin-releasing hormone secretion by kisspeptin/dynorphin/neurokinin B neurons in the arcuate nucleus of the mouse. J Neurosci, 29, 11859-66. NEAVES, W. B. 1975. Leydig cells. Contraception, 11, 571-606. NICHOLS, A. F. & SANCAR, A. 1992. Purification of PCNA as a nucleotide excision repair protein. Nucleic Acids Res, 20, 2441-6. NISHIZAWA, H., SHIMOMURA, I., KISHIDA, K., MAEDA, N., KURIYAMA, H., NAGARETANI, H., MATSUDA, M., KONDO, H., FURUYAMA, N., KIHARA, S., NAKAMURA, T., TOCHINO, Y., FUNAHASHI, T. & MATSUZAWA, Y. 2002. Androgens Decrease Plasma Adiponectin, an Insulin-Sensitizing Adipocyte-Derived Protein. Diabetes, 51, 2734. NOGUCHI, T., KURATA, L. M. & SUGISAKI, T. 1987. Presence of a somatomedin-C-immunoreactive substance in the central nervous system: immunohistochemical mapping studies. Neuroendocrinology, 46, 277-82. NRC 2001. Nutrient requirements of dairy cattle, Washington D.C., National Academy of Sciences. O'DONNELL, L., STANTON, P. & DE KRETSER, D. M. 2000. Endocrinology of the Male Reproductive System and Spermatogenesis. In: DE GROOT, L. J., CHROUSOS, G., DUNGAN, K., FEINGOLD, K. R., GROSSMAN, A., HERSHMAN, J. M., KOCH, C., KORBONITS, M., MCLACHLAN, R., NEW, M., PURNELL, J., REBAR, R., SINGER, F. & VINIK, A. (eds.) Endotext. South Dartmouth (MA). OBREGON, M.-J. 2008. Thyroid hormone and adipocyte differentiation. Thyroid, 18, 185-195. OCHOCIŃSKA, A., ŚNITKO, R., CZEKUĆ-KRYŚKIEWICZ, E., KĘPKA, A., SZALECKI, M. & JANAS, R. M. 2016. Evaluation of the immunoradiometric and electrochemiluminescence method for the measurement of serum insulin in children. Journal of Immunoassay and Immunochemistry, 37, 243-250. OHTAKI, T., SHINTANI, Y., HONDA, S., MATSUMOTO, H., HORI, A., KANEHASHI, K., TERAO, Y., KUMANO, S., TAKATSU, Y., MASUDA, Y., ISHIBASHI, Y., WATANABE, T., ASADA, M., YAMADA, T., SUENAGA, M., KITADA, C., USUKI, S., KUROKAWA, T., ONDA, H., NISHIMURA, O. & FUJINO, M. 2001. Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein- coupled receptor. Nature, 411, 613-617.
173
OLIVARES, A., MENDEZ, J. P., CARDENAS, M., OVIEDO, N., PALOMINO, M. A., SANTOS, I., PERERA- MARIN, G., GUTIERREZ-SAGAL, R. & ULLOA-AGUIRRE, A. 2009. Pituitary-testicular axis function, biological to immunological ratio and charge isoform distribution of pituitary LH in male rats with experimental diabetes. General and Comparative Endocrinology, 161, 304-12. OLSON, L. M., ZHOU, X. & SCHREIBER, J. R. 1994. Immunolocalization of Apolipoprotein E in the Testis and Epididymis of the Rat1. Biology of Reproduction, 50, 535-542. ORTAVANT, R., COUROT, M. & HORCHEREAU-DEREVIERS, M. T. 1977. Spermaotgenesis in domestic animals. In: COLE, H. H. & CUPPS, P. T. (eds.) Reproduction in Domestic Animals. Third ed. New York: Academic Press. ORTH, J. M. 1993. Cell biology of testicular development in the fetus and neonate. In: DESJARDINS, C. & EWING, L. L. (eds.) Cell and Molecular Biology of the Testis. Oxford: Oxford University Press. OSHLACK, A. & WAKEFIELD, M. J. 2009. Transcript length bias in RNA-seq data confounds systems biology. Biol Direct, 4, 14. OUCHI, N., PARKER, J. L., LUGUS, J. J. & WALSH, K. 2011. Adipokines in inflammation and metabolic disease. Nat Rev Immunol, 11, 85-97. OVERVEST, M. A., BERGERON, R., HALEY, D. B. & DEVRIES, T. J. 2016. Effect of feed type and method of presentation on feeding behavior, intake, and growth of dairy calves fed a high level of milk. J Dairy Sci, 99, 317-27. OWEN, O. E., KALHAN, S. C. & HANSON, R. W. 2002. The Key Role of Anaplerosis and Cataplerosis for Citric Acid Cycle Function. Journal of Biological Chemistry, 277, 30409-30412. OZATA, M., OZDEMIR, I. C. & LICINIO, J. 1999. Human leptin deficiency caused by a missense mutation: multiple endocrine defects, decreased sympathetic tone, and immune system dysfunction indicate new targets for leptin action, greater central than peripheral resistance to the effects of leptin, and spontaneous correction of leptin-mediated defects. Journal of Clinical Endocrinology and Metabolism, 84, 3686-95. PARK, C. J., LEE, J. E., OH, Y. S., SHIM, S., KIM, D. M., PARK, N. C., PARK, H. J. & GYE, M. C. 2011. Postnatal Changes in the Expression of Claudin-11 in the Testes and Excurrent Ducts of the Domestic Rabbit (Oryctolagus cuniculus domesticus). Journal of Andrology, 32, 295-306. PERERA-MARIN, G., MURCIA, C. & GONZALEZ-PADILLA, E. 2007. Luteinizing hormone (LH) isoforms in ruminants: characterization and physiological relevance. Animal Reproduction Science, 101, 187-207. PIETILÄINEN, K. H., NAUKKARINEN, J., RISSANEN, A., SAHARINEN, J., ELLONEN, P., KERÄNEN, H., SUOMALAINEN, A., GÖTZ, A., SUORTTI, T., YKI-JÄRVINEN, H., OREŠIČ, M., KAPRIO, J. & PELTONEN, L. 2008. Global Transcript Profiles of Fat in Monozygotic Twins Discordant for BMI: Pathways behind Acquired Obesity. PLoS Medicine, 5, e51. PILON, N., DANEAU, I., BRISSON, C., ETHIER, J. F., LUSSIER, J. G. & SILVERSIDES, D. W. 1997. Porcine and bovine steroidogenic acute regulatory protein (StAR) gene expression during gestation. Endocrinology, 138, 1085-91. POCOCK, G., RICHARDS, C. D. & RICHARDS, D. A. 2013. Human Physiology, Oxford, Oxford University Press. POWERS, M. L. & FLORINI, J. R. 1975. A direct effect of testosterone on muscle cells in tissue culture. Endocrinology, 97, 1043-7. POWLEDGE, T. M. 2004. The polymerase chain reaction. Adv Physiol Educ, 28, 44-50. QUENNELL, J. H., HOWELL, C. S., ROA, J., AUGUSTINE, R. A., GRATTAN, D. R. & ANDERSON, G. M. 2011. Leptin deficiency and diet-induced obesity reduce hypothalamic kisspeptin expression in mice. Endocrinology, 152, 1541-50. QUENNELL, J. H., MULLIGAN, A. C., TUPS, A., LIU, X., PHIPPS, S. J., KEMP, C. J., HERBISON, A. E., GRATTAN, D. R. & ANDERSON, G. M. 2009. Leptin indirectly regulates gonadotropin- releasing hormone neuronal function. Endocrinology, 150, 2805-12.
174
RAMASWAMY, S. & WEINBAUER, G. F. 2014. Endocrine control of spermatogenesis: Role of FSH and LH/ testosterone. Spermatogenesis, 4, e996025. RAWLINGS, N., EVANS, A. C., CHANDOLIA, R. K. & BAGU, E. T. 2008. Sexual maturation in the bull. Reprod Domest Anim, 295-301. RAWLINGS, N. C. & EVANS, A. C. 1995. Androgen negative feedback during the early rise in LH secretion in bull calves. J Endocrinol, 145, 243-9. RECABARREN, M. P., ROJAS-GARCIA, P. P., EINSPANIER, R., PADMANABHAN, V., SIR-PETERMANN, T. & RECABARREN, S. E. 2013. Pituitary and testis responsiveness of young male sheep exposed to testosterone excess during fetal development. Reproduction, 145, 567-576. RECABARREN, S. E., ROJAS-GARCIA, P. P., RECABARREN, M. P., ALFARO, V. H., SMITH, R., PADMANABHAN, V. & SIR-PETERMANN, T. 2008. Prenatal testosterone excess reduces sperm count and motility. Endocrinology, 149, 6444-8. REDMOND, J. S., BAEZ-SANDOVAL, G. M., SPELL, K. M., SPENCER, T. E., LENTS, C. A., WILLIAMS, G. L. & AMSTALDEN, M. 2011. Developmental changes in hypothalamic Kiss1 expression during activation of the pulsatile release of luteinising hormone in maturing ewe lambs. J Neuroendocrinol, 23, 815-22. REICHENBACH, A., STEYN, F. J., SLEEMAN, M. W. & ANDREWS, Z. B. 2012. Ghrelin receptor expression and colocalization with anterior pituitary hormones using a GHSR-GFP mouse line. Endocrinology, 153, 5452-66. REY, R. A., MUSSE, M., VENARA, M. & CHEMES, H. E. 2009. Ontogeny of the androgen receptor expression in the fetal and postnatal testis: its relevance on Sertoli cell maturation and the onset of adult spermatogenesis. Microsc Res Tech, 72, 787-95. ROA, J. & HERBISON, A. E. 2012. Direct regulation of GnRH neuron excitability by arcuate nucleus POMC and NPY neuron neuropeptides in female mice. Endocrinology, 153, 5587-99. ROA, J. & TENA-SEMPERE, M. 2010. Energy balance and puberty onset: emerging role of central mTOR signaling. Trends in Endocrinology and Metabolism: TEM, 21, 519-28. ROA, J. & TENA-SEMPERE, M. 2014. Connecting metabolism and reproduction: Roles of central energy sensors and key molecular mediators. Mol Cell Endocrinol. ROBELIN, J. & CHILLIARD, Y. 1989. Short-Term and Long-Term Effects of Early Nutritional Deprivation on Adipose Tissue Growth and Metabolism in Calves. Journal of Dairy Science, 72, 505-513. ROBERTS, K. P. 2010. What are the components of the male reproductive system? In: ROBAIRE, B. & CHAN, P. (eds.) Handbook of Andrology. Kansas: Allen Press. ROBERTSON, K. M., SCHUSTER, G. U., STEFFENSEN, K. R., HOVATTA, O., MEANEY, S., HULTENBY, K., JOHANSSON, L. C., SVECHNIKOV, K., SÖDER, O. & GUSTAFSSON, J.-A. K. 2005. The Liver X Receptor-β Is Essential for Maintaining Cholesterol Homeostasis in the Testis. Endocrinology, 146, 2519-2530. RODE, K., SIEME, H., RICHTERICH, P. & BREHM, R. 2015. Characterization of the equine blood-testis barrier during tubular development in normal and cryptorchid stallions. Theriogenology, 84, 763-72. RODRIGUEZ, R. E. & WISE, M. E. 1989. Ontogeny of pulsatile secretion of gonadotropin-releasing hormone in the bull calf during infantile and pubertal development. Endocrinology, 124, 248-56. ROJAS-GARCIA, P. P., RECABARREN, M. P., SARABIA, L., SCHON, J., GABLER, C., EINSPANIER, R., MALIQUEO, M., SIR-PETERMANN, T., REY, R. & RECABARREN, S. E. 2010. Prenatal testosterone excess alters Sertoli and germ cell number and testicular FSH receptor expression in rams. American Journal of Physiology. Endocrinology and Metabolism, 299, E998-E1005. ROMAO, J. M., HE, M. L., MCALLISTER, T. A. & GUAN, L. L. 2014. Effect of age on bovine subcutaneous fat proteome: molecular mechanisms of physiological variations during beef cattle growth. J Anim Sci, 92, 3316-27.
175
ROSE, K. A., STAPLETON, G., DOTT, K., KIENY, M. P., BEST, R., SCHWARZ, M., RUSSELL, D. W., BJORKHEM, I., SECKL, J. & LATHE, R. 1997. Cyp7b, a novel brain cytochrome P450, catalyzes the synthesis of neurosteroids 7alpha-hydroxy dehydroepiandrosterone and 7alpha-hydroxy pregnenolone. Proceedings of the National Academy of Sciences of the United States of America, 94, 4925-30. ROSENZWEIG, B. A., PINE, P. S., DOMON, O. E., MORRIS, S. M., CHEN, J. J. & SISTARE, F. D. 2004. Dye bias correction in dual-labeled cDNA microarray gene expression measurements. Environ Health Perspect, 112, 480-7. ROTA, A., BALLARIN, C., VIGIER, B., COZZI, B. & REY, R. 2002. Age dependent changes in plasma anti- Müllerian hormone concentrations in the bovine male, female, and freemartin from birth to puberty: relationship between testosterone production and influence on sex differentiation. General and Comparative Endocrinology, 129, 39-44. ROTH, C. L. & SATHYANARAYANA, S. 2012. Mechanisms affecting neuroendocrine and epigenetic regulation of body weight and onset of puberty: potential implications in the child born small for gestational age (SGA). Reviews in Endocrine & Metabolic Disorders, 13, 129-40. SABIN, M. A., HOLLY, J. M. P., SHIELD, J. P. H., TURNER, S. J., GROHMANN, M. J., STEWART, C. E. H. & CROWNE, E. C. 2006. Mature Subcutaneous and Visceral Adipocyte Concentrations of Adiponectin Are Highly Correlated in Prepubertal Children and Inversely Related to Body Mass Index Standard Deviation Score. J Clin Endocrin Metab, 91, 332-335. SAHU, A., DUBE, M. G., PHELPS, C. P., SNINSKY, C. A., KALRA, P. S. & KALRA, S. P. 1995. Insulin and insulin-like growth factor II suppress neuropeptide Y release from the nerve terminals in the paraventricular nucleus: a putative hypothalamic site for energy homeostasis. Endocrinology, 136, 5718-24. SAIKI, R. K., SCHARF, S., FALOONA, F., MULLIS, K. B., HORN, G. T., ERLICH, H. A. & ARNHEIM, N. 1985. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, 230, 1350-4. SAKATA, I., NAKAMURA, K., YAMAZAKI, M., MATSUBARA, M., HAYASHI, Y., KANGAWA, K. & SAKAI, T. 2002. Ghrelin-producing cells exist as two types of cells, closed- and opened-type cells, in the rat gastrointestinal tract. Peptides, 23, 531-536. SANCHEZ-GARRIDO, M. A. & TENA-SEMPERE, M. 2013. Metabolic control of puberty: roles of leptin and kisspeptins. Horm Behav, 64, 187-94. SANCHEZ, J., OLIVER, P., PALOU, A. & PICO, C. 2004. The inhibition of gastric ghrelin production by food intake in rats is dependent on the type of macronutrient. Endocrinology, 145, 5049-55. SAUERWEIN, H. & HÄUßLER, S. 2016. Endogenous and exogenous factors influencing the concentrations of adiponectin in body fluids and tissues in the bovine. Domest Anim Endocrin, 56, Supplement, S33-S43. SAUERWEIN, H., HEINTGES, U., HENNIES, M., SELHORST, T. & DAXENBERGER, A. 2004. Growth hormone induced alterations of leptin serum concentrations in dairy cows as measured by a novel enzyme immunoassay. Livest Prod Sci, 87, 189-195. SCHÄFF, C. T., GRUSE, J., MACIEJ, J., MIELENZ, M., WIRTHGEN, E., HOEFLICH, A., SCHMICKE, M., PFUHL, R., JAWOR, P., STEFANIAK, T. & HAMMON, H. M. 2016. Effects of Feeding Milk Replacer Ad Libitum or in Restricted Amounts for the First Five Weeks of Life on the Growth, Metabolic Adaptation, and Immune Status of Newborn Calves. PLOS ONE, 11, e0168974. SCHALLY, A. V., BABA, Y., NAIR, R. M. & BENNETT, C. D. 1971. The amino acid sequence of a peptide with growth hormone-releasing activity isolated from porcine hypothalamus. Journal of Biological Chemistry, 246, 6647-50. SCHANBACHER, B. D. 1979. Relationship of in vitro gonadotropin binding to bovine testes and the onset of spermatogenesis. J Anim Sci, 48, 591-7. SCHANBACHER, B. D. 1982. Hormonal interrelationships between hypothalamus, pituitary and testis of rams and bulls. Journal of animal science, 55 Suppl 2, 56-67.
176
SCHANBACHER, B. D. & FORD, J. J. 1977. Gonadotropin secretion in cryptorchid and castrate rams and the acute effects of exogenous steroid treatment. Endocrinology, 100, 387-93. SCHEFERS, J. M. & WEIGEL, K. A. 2012. Genomic selection in dairy cattle: Integration of DNA testing into breeding programs. Animal Frontiers, 2, 4-9. SCHENA, M., SHALON, D., DAVIS, R. W. & BROWN, P. O. 1995. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science, 270, 467-70. SCHWARTZ, M. W., WOODS, S. C., PORTE, D., JR., SEELEY, R. J. & BASKIN, D. G. 2000. Central nervous system control of food intake. Nature, 404, 661-71. SCOTT, M. A., NGUYEN, V. T., LEVI, B. & JAMES, A. W. 2011. Current Methods of Adipogenic Differentiation of Mesenchymal Stem Cells. Stem Cells and Development, 20, 1793-1804. SEGAL, J. P. 2006. A Molecular Dissection of the Ventromedial Hypothalamic Nucleus. PhD Unpublished, The Rockefeller University. SEMINARA, S. B., MESSAGER, S., CHATZIDAKI, E. E., THRESHER, R. R., ACIERNO, J. S., JR., SHAGOURY, J. K., BO-ABBAS, Y., KUOHUNG, W., SCHWINOF, K. M., HENDRICK, A. G., ZAHN, D., DIXON, J., KAISER, U. B., SLAUGENHAUPT, S. A., GUSELLA, J. F., O'RAHILLY, S., CARLTON, M. B., CROWLEY, W. F., JR., APARICIO, S. A. & COLLEDGE, W. H. 2003. The GPR54 gene as a regulator of puberty. The New England Journal of Medicine, 349, 1614-27. SHAPIRO, E., HUANG, H., MASCH, R. J., MCFADDEN, D. E., WU, X. R. & OSTRER, H. 2005. Immunolocalization of androgen receptor and estrogen receptors alpha and beta in human fetal testis and epididymis. J Urol, 174, 1695-8. SHARPE, R. M., MCKINNELL, C., KIVLIN, C. & FISHER, J. S. 2003. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction, 125, 769-84. SHERWOOD, N. M., SOWER, S. A., MARSHAK, D. R., FRASER, B. A. & BROWNSTEIN, M. J. 1986. Primary structure of gonadotropin-releasing hormone from lamprey brain. Journal of Biological Chemistry, 261, 4812-4819. SHORS, T. J., ANDERSON, L. M., CURLIK, D. M. & NOKIA, S. M. 2012. Use it or lose it: How neurogenesis keeps the brain fit for learning. Behavioural Brain Research, 227, 450-458. SIMONI, M., WEINBAUER, G. F., GROMOLL, J. & NIESCHLAG, E. 1999. Role of FSH in male gonadal function. Annales d'endocrinologie (Paris), 60, 102-6. SMITH, J. T., ACOHIDO, B. V., CLIFTON, D. K. & STEINER, R. A. 2006. KiSS-1 neurones are direct targets for leptin in the ob/ob mouse. J Neuroendocrinol, 18, 298-303. SMITH, L. B. & WALKER, W. H. 2014. The regulation of spermatogenesis by androgens. Semin Cell Dev Biol, 30, 2-13. SODHI, M. S. K. & SANDERS-BUSH, E. 2004. Serotonin and brain development. International Review of Neurobiology. Academic Press. SORISKY, A., MOLGAT, A. S. D. & GAGNON, A. 2013. Macrophage-Induced Adipose Tissue Dysfunction and the Preadipocyte: Should I Stay (and Differentiate) or Should I Go? Advances in Nutrition: An International Review Journal, 4, 67-75. SQUIRES, E. J. 2003. Applied animal endocrinology, Wallingford, Oxon, CABI Publishing. STAFFORD, L. J., XIA, C., MA, W., CAI, Y. & LIU, M. 2002. Identification and Characterization of Mouse Metastasis-suppressor KiSS1 and Its G-Protein-coupled Receptor. Cancer Research, 62, 5399- 5404. STANLEY, S., WYNNE, K., MCGOWAN, B. & BLOOM, S. 2005. Hormonal Regulation of Food Intake. STEINBERG, G. R. & KEMP, B. E. 2007. Adiponectin: Starving for Attention. Cell Metabolism, 6, 3-4. STOCCO, D. M. 2001. StAR protein and the regulation of steroid hormone biosynthesis. Annu Rev Physiol, 63, 193-213. STROBEL, A., ISSAD, T., CAMOIN, L., OZATA, M. & STROSBERG, A. D. 1998. A leptin missense mutation associated with hypogonadism and morbid obesity. Nature Genetics, 18, 213-5.
177
SUN, Y., WANG, P., ZHENG, H. & SMITH, R. G. 2004. Ghrelin stimulation of growth hormone release and appetite is mediated through the growth hormone secretagogue receptor. Proceedings of the National Academy of Sciences of the United States of America, 101, 4679-4684. SUZUKI, R., TOBE, K., AOYAMA, M., SAKAMOTO, K., OHSUGI, M., KAMEI, N., NEMOTO, S., INOUE, A., ITO, Y., UCHIDA, S., HARA, K., YAMAUCHI, T., KUBOTA, N., TERAUCHI, Y. & KADOWAKI, T. 2005. Expression of DGAT2 in white adipose tissue is regulated by central leptin action. J Biol Chem, 280, 3331-7. TABANDEH, M. R., HOSSEINI, A., SARKOOHI, P. & SEIFI, S. 2011. Changes in the gene expression of adiponectin and adiponectin receptors (AdipoR1 and AdipoR2) in pituitary and hypothalamus during the estrous cycle and pregnancy. Clin Biochem, 44, S303. TAN, K. A., DE GENDT, K., ATANASSOVA, N., WALKER, M., SHARPE, R. M., SAUNDERS, P. T., DENOLET, E. & VERHOEVEN, G. 2005. The role of androgens in sertoli cell proliferation and functional maturation: studies in mice with total or Sertoli cell-selective ablation of the androgen receptor. Endocrinology, 146, 2674-83. TANIGUCHI, C. M., EMANUELLI, B. & KAHN, C. R. 2006. Critical nodes in signalling pathways: insights into insulin action. Nat Rev Mol Cell Bio, 7, 85-96. TAOUIS, M., CHEN, J. W., DAVIAUD, C., DUPONT, J., DEROUET, M. & SIMON, J. 1998. Cloning the chicken leptin gene. Gene, 208, 239-42. TATEMOTO, K., CARLQUIST, M. & MUTT, V. 1982. Neuropeptide Y--a novel brain peptide with structural similarities to peptide YY and pancreatic polypeptide. Nature, 296, 659-60. TENA-SEMPERE, M. 2007. Roles of Ghrelin and Leptin in the Control of Reproductive Function. Neuroendocrinology, 86, 229-241. TENA-SEMPERE, M. & BARREIRO, M. L. 2002. Leptin in male reproduction: the testis paradigm. Moleuclar and Cellular Endocrinology, 188, 9-13. TENA-SEMPERE, M. & HUHTANIEMI, I. 2003. Gonadotropins and gonadotropin receptors. In: FAUSER, B. C. J. M. (ed.) Reproductive medicine—Molecular, cellular and genetic fundamentals. New York: Parthenon Publishing. TENA-SEMPERE, M., PINILLA, L., GONZALEZ, L. C., DIEGUEZ, C., CASANUEVA, F. F. & AGUILAR, E. 1999. Leptin inhibits testosterone secretion from adult rat testis in vitro. Journal of Endocrinology, 161, 211-8. THOMAS, M. G., GAZAL, O. S., WILLIAMS, G. L., STANKO, R. L. & KEISLER, D. H. 1999. Injection of neuropeptide Y into the third cerebroventricle differentially influences pituitary secretion of luteinizing hormone and growth hormone in ovariectomized cows. Domestic Animal Endocrinology, 16, 159-69. THUE, T. D. & BUCHANAN, F. C. 2004. Linkage mapping of NPY to bovine chromosome 4. Animal Genetics, 35, 245-6. THUNDATHIL, J. C., DANCE, A. L. & KASTELIC, J. P. 2016. Fertility management of bulls to improve beef cattle productivity. Theriogenology. THUNDATHIL, J. C., RAJAMANICKAM, G. D., KASTELIC, J. P. & NEWTON, L. D. 2012. The effects of increased testicular temperature on testis-specific isoform of Na+/K+ -ATPase in sperm and its role in spermatogenesis and sperm function. Reprod Domest Anim, 47 Suppl 4, 170-7. TILBROOK, A. J., DE KRETSER, D. M. & CLARKE, I. J. 1999. Changes in the suppressive effects of recombinant inhibin A on FSH secretion in ram lambs during sexual maturation: evidence for alterations in the clearance rate of inhibin. J Endocrinol, 161, 219-29. TONG, Q., DALGIN, G., XU, H., TING, C. N., LEIDEN, J. M. & HOTAMISLIGIL, G. S. 2000. Function of GATA transcription factors in preadipocyte-adipocyte transition. Science, 290, 134-8. TOPPARI, J. & SKAKKEBAEK, N. E. 1998. Sexual differentiation and environmental endocrine disrupters. Bailliere's Clinical Endocrinology and Metabolism, 12, 143-56. TREIER, M., GLEIBERMAN, A. S., O'CONNELL, S. M., SZETO, D. P., MCMAHON, J. A., MCMAHON, A. P. & ROSENFELD, M. G. 1998. Multistep signaling requirements for pituitary organogenesis in vivo. Genes Dev, 12, 1691-704.
178
TRIPATHI, U. K., ASLAM, M. K., PANDEY, S., NAYAK, S., CHHILLAR, S., SRINIVASAN, A., MOHANTY, T. K., KADAM, P. H., CHAUHAN, M. S., YADAV, S. & KUMARESAN, A. 2014. Differential proteomic profile of spermatogenic and Sertoli cells from peri-pubertal testes of three different bovine breeds. Front Cell Dev Biol, 2, 24. TSAI-MORRIS, C.-H., SATO, H., GUTTI, R. & DUFAU, M. L. 2012. Role of Gonadotropin Regulated Testicular RNA Helicase (GRTH/DDX25) on Polysomal Associated mRNAs in Mouse Testis. PLOS ONE, 7, e32470. TSCHOP, M., SMILEY, D. L. & HEIMAN, M. L. 2000. Ghrelin induces adiposity in rodents. Nature, 407, 908-13. TSUTSUI, K. 2009. A new key neurohormone controlling reproduction, gonadotropin-inhibitory hormone (GnIH): Biosynthesis, mode of action and functional significance. Progress in Neurobiology, 88, 76-88. TSUTSUI, K., BENTLEY, G. E., BEDECARRATS, G., OSUGI, T., UBUKA, T. & KRIEGSFELD, L. J. 2010a. Gonadotropin-inhibitory hormone (GnIH) and its control of central and peripheral reproductive function. Frontiers in Neuroendocrinology, 31, 284-95. TSUTSUI, K., BENTLEY, G. E., KRIEGSFELD, L. J., OSUGI, T., SEONG, J. Y. & VAUDRY, H. 2010b. Discovery and evolutionary history of gonadotrophin-inhibitory hormone and kisspeptin: new key neuropeptides controlling reproduction. Journal of Neuroendocrinology, 22, 716-27. TSUTSUI, K., SAIGOH, E., UKENA, K., TERANISHI, H., FUJISAWA, Y., KIKUCHI, M., ISHII, S. & SHARP, P. J. 2000. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochemical and Biophysical Research Communications, 275, 661-7. UBUKA, T., MORGAN, K., PAWSON, A. J., OSUGI, T., CHOWDHURY, V. S., MINAKATA, H., TSUTSUI, K., MILLAR, R. P. & BENTLEY, G. E. 2009. Identification of human GnIH homologs, RFRP-1 and RFRP-3, and the cognate receptor, GPR147 in the human hypothalamic pituitary axis. PLoS One, 4, e8400. UKENA, K., IWAKOSHI, E., MINAKATA, H. & TSUTSUI, K. 2002. A novel rat hypothalamic RFamide- related peptide identified by immunoaffinity chromatography and mass spectrometry. FEBS Letters, 512, 255-8. ULLAH, M., STICH, S., HAUPL, T., EUCKER, J., SITTINGER, M. & RINGE, J. 2013. Reverse differentiation as a gene filtering tool in genome expression profiling of adipogenesis for fat marker gene selection and their analysis. PLoS One, 8, e69754. VAILATI-RIBONI, M., KANWAL, M., BULGARI, O., MEIER, S., PRIEST, N. V., BURKE, C. R., KAY, J. K., MCDOUGALL, S., MITCHELL, M. D., WALKER, C. G., CROOKENDEN, M., HEISER, A., ROCHE, J. R. & LOOR, J. J. 2016. Body condition score and plane of nutrition prepartum affect adipose tissue transcriptome regulators of metabolism and inflammation in grazing dairy cows during the transition period. J Dairy Sci, 99, 758-770. VALASEK, M. A. & REPA, J. J. 2005. The power of real-time PCR. Adv Physiol Educ, 29, 151-9. VALASSI, E., SCACCHI, M. & CAVAGNINI, F. 2008. Neuroendocrine control of food intake. Nutrition, Metabolism and Cardiovascular Diseases: NMCD, 18, 158-68. VAN DER MOLEN, H. J. R., F.F.G 1981. Testicular steroidogenesis. In: BURGER, H. D. K., D. (ed.) The Testis. New York: Raven Press. VIGIER, B., PICARD, J. Y., TRAN, D., LEGEAI, L. & JOSSO, N. 1984. Production of anti-Mullerian hormone: another homology between Sertoli and granulosa cells. Endocrinology, 114, 1315- 20. VILLALPANDO, I. & LOPEZ-OLMOS, V. 2003. Insulin-like growth factor I (IGF-I) regulates endocrine activity of the embryonic testis in the mouse. J Steroid Biochem Mol Biol, 86, 151-8. WAHAB, F., ULLAH, F., CHAN, Y. M., SEMINARA, S. B. & SHAHAB, M. 2011. Decrease in hypothalamic Kiss1 and Kiss1r expression: a potential mechanism for fasting-induced suppression of the HPG axis in the adult male rhesus monkey (Macaca mulatta). Hormone and Metabolic Research, 43, 81-5.
179
WAKIL, S. J. 1989. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry, 28, 4523- 30. WANG, Y. H., BOWER, N. I., REVERTER, A., TAN, S. H., DE JAGER, N., WANG, R., MCWILLIAM, S. M., CAFE, L. M., GREENWOOD, P. L. & LEHNERT, S. A. 2009a. Gene expression patterns during intramuscular fat development in cattle. J Anim Sci, 87, 119-30. WANG, Z., GERSTEIN, M. & SNYDER, M. 2009b. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet, 10, 57-63. WATSON, R. E., JR., HUTCHINSON, R. K., LANGUB, M. C., JR., LANDIS, J. W., SEKSARIA, S., RAINEY, D. M. & KEIL, L. C. 1994. Colocalization of natriuretic peptide and estrogen receptor immunoreactivities in preoptic nuclei in the female rat. J Neuroendocrinol, 6, 79-87. WEN, J. P., LV, W. S., YANG, J., NIE, A. F., CHENG, X. B., YANG, Y., GE, Y., LI, X. Y. & NING, G. 2008. Globular adiponectin inhibits GnRH secretion from GT1-7 hypothalamic GnRH neurons by induction of hyperpolarization of membrane potential. Biochem Biophys Res Commun, 371, 756-61. WHITE, J. D. 1993. Neuropeptide Y: a central regulator of energy homeostasis. Regulatory Peptides, 49, 93-107. WHITNEY, S. E., SUDHIR, A., NELSON, R. M. & VILJOEN, H. J. 2004. Principles of rapid polymerase chain reactions: mathematical modeling and experimental verification. Comput Biol Chem, 28, 195-209. WHITTIER, J. C. 1993. Reproductive Anatomy and Physiology of the Bull [Online]. [Accessed 07/11/2016]. WIDBERG, C. H., NEWELL, F. S., BACHMANN, A. W., RAMNORUTH, S. N., SPELTA, M. C., WHITEHEAD, J. P., HUTLEY, L. J. & PRINS, J. B. 2009. Fibroblast growth factor receptor 1 is a key regulator of early adipogenic events in human preadipocytes. Am J Physiol Endocrinol Metab, 296, E121-31. WILLIAMS, G. L., AMSTALDEN, M., GARCIA, M. R., STANKO, R. L., NIZIELSKI, S. E., MORRISON, C. D. & KEISLER, D. H. 2002. Leptin and its role in the central regulation of reproduction in cattle. Domestic Animal Endocrinology, 23, 339-349. WILLIAMS, L. M., ADAM, C. L., MERCER, J. G., MOAR, K. M., SLATER, D., HUNTER, L., FINDLAY, P. A. & HOGGARD, N. 1999. Leptin receptor and neuropeptide Y gene expression in the sheep brain. Journal of Neuroendocrinology, 11, 165-9. WILSON-FRITCH, L., BURKART, A., BELL, G., MENDELSON, K., LESZYK, J., NICOLORO, S., CZECH, M. & CORVERA, S. 2003. Mitochondrial biogenesis and remodeling during adipogenesis and in response to the insulin sensitizer rosiglitazone. Mol Cell Biol, 23, 1085-94. WOLF, F. R., ALMQUIST, J. O. & HALE, E. B. 1965. Prepuberal Behavior and Puberal Characteristics of Beef Bulls on High Nutrient Allowance. J Anim Sci, 24, 761-5. WOLFE, A., DIVALL, S. & WU, S. 2014. The regulation of reproductive neuroendocrine function by insulin and insulin-like growth factor-1 (IGF-1). Frontiers in Neuroendocrinology. WROBEL, K.-H., SCHILLING, E. & ZWACK, M. 1986. Postnatal development of the connexion between tubulus seminiferus and tubulus rectus in the bovine testis. Cell and Tissue Research, 246, 387-400. WROBEL, K. H. 2000. Prespermatogenesis and spermatogoniogenesis in the bovine testis. Anat Embryol (Berl), 202, 209-22. WU, J., BOSTRÖM, P., SPARKS, L. M., YE, L., CHOI, J. H., GIANG, A.-H., KHANDEKAR, M., NUUTILA, P., SCHAART, G., HUANG, K., TU, H., VAN MARKEN LICHTENBELT, W. D., HOEKS, J., ENERBÄCK, S., SCHRAUWEN, P. & SPIEGELMAN, B. M. 2012. Beige Adipocytes are a Distinct Type of Thermogenic Fat Cell in Mouse and Human. Cell, 150, 366-376. WYNNE, K., STANLEY, S., MCGOWAN, B. & BLOOM, S. 2005. Appetite control. Journal of Endocrinology, 184, 291-318.
180
XIAO, L., SOBUE, T., ESLIGER, A., KRONENBERG, M. S., COFFIN, J. D., DOETSCHMAN, T. & HURLEY, M. M. 2010. Disruption of the Fgf2 gene activates the adipogenic and suppresses the osteogenic program in mesenchymal marrow stromal stem cells. Bone, 47, 360-70. XIONG, Y., ZHANG, H. & BEACH, D. 1992. D type cyclins associate with multiple protein kinases and the DNA replication and repair factor PCNA. Cell, 71, 505-14. YABUTA, Y., OHTA, H., ABE, T., KURIMOTO, K., CHUMA, S. & SAITOU, M. 2011. TDRD5 is required for retrotransposon silencing, chromatoid body assembly, and spermiogenesis in mice. The Journal of Cell Biology, 192, 781-795. YAMAUCHI, T., IWABU, M., OKADA-IWABU, M. & KADOWAKI, T. 2014. Adiponectin receptors: A review of their structure, function and how they work. Best Practice & Research Clinical Endocrinology & Metabolism, 28, 15-23. YAMAZAKI, H. & SHIMADA, T. 1997. Progesterone and testosterone hydroxylation by cytochromes P450 2C19, 2C9, and 3A4 in human liver microsomes. Archives of Biochemistry and Biophysics, 346, 161-9. YAO, B., LIU, H. Y., GU, Y. C., SHI, S. S., TAO, X. Q., LI, X. J., GE, Y. F., CUI, Y. X. & YANG, G. B. 2011. Gonadotropin-releasing hormone positively regulates steroidogenesis via extracellular signal-regulated kinase in rat Leydig cells. Asian journal of andrology, 13, 438-45. YAP, D. B., WALKER, D. C., PRENTICE, L. M., MCKINNEY, S., TURASHVILI, G., MOOSLEHNER-ALLEN, K., DE ALGARA, T. R., FEE, J., DE TASSIGNY, X. D. A., COLLEDGE, W. H. & APARICIO, S. 2011. Mll5 Is Required for Normal Spermatogenesis. PLOS ONE, 6, e27127. YEUNG, C.-M., CHAN, C.-B., LEUNG, P.-S. & CHENG, C. H. 2006. Cells of the anterior pituitary. The international journal of biochemistry & cell biology, 38, 1441-1449. YOSHIDA, H., HABATA, Y., HOSOYA, M., KAWAMATA, Y., KITADA, C. & HINUMA, S. 2003. Molecular properties of endogenous RFamide-related peptide-3 and its interaction with receptors. Biochimic et Biophysica Acta, 1593, 151-7. YOU, L. & SAR, M. 1998. Androgen receptor expression in the testes and epididymides of prenatal and postnatal Sprague-Dawley rats. Endocrine, 9, 253-61. YOUNG, M. D., WAKEFIELD, M. J., SMYTH, G. K. & OSHLACK, A. 2010. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol, 11, R14. ZAMANI, N. & BROWN, C. W. 2011. Emerging roles for the transforming growth factor-{beta} superfamily in regulating adiposity and energy expenditure. Endocr Rev, 32, 387-403. ZARAGOSI, L. E., WDZIEKONSKI, B., VILLAGEOIS, P., KEOPHIPHATH, M., MAUMUS, M., TCHKONIA, T., BOURLIER, V., MOHSEN-KANSON, T., LADOUX, A., ELABD, C., SCHEIDELER, M., TRAJANOSKI, Z., TAKASHIMA, Y., AMRI, E. Z., LACASA, D., SENGENES, C., AILHAUD, G., CLEMENT, K., BOULOUMIE, A., KIRKLAND, J. L. & DANI, C. 2010. Activin a plays a critical role in proliferation and differentiation of human adipose progenitors. Diabetes, 59, 2513-21. ZHAO, L., BAKKE, M., KRIMKEVICH, Y., CUSHMAN, L. J., PARLOW, A. F., CAMPER, S. A. & PARKER, K. L. 2001. Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development, 128, 147-54. ZIEBA, D. A., AMSTALDEN, M. & WILLIAMS, G. L. 2005. Regulatory roles of leptin in reproduction and metabolism: a comparative review. Domest Anim Endocrinol, 29, 166-85. ZUNIGA, L. A., SHEN, W. J., JOYCE-SHAIKH, B., PYATNOVA, E. A., RICHARDS, A. G., THOM, C., ANDRADE, S. M., CUA, D. J., KRAEMER, F. B. & BUTCHER, E. C. 2010. IL-17 regulates adipogenesis, glucose homeostasis, and obesity. J Immunol, 185, 6947-59.
181