CALCIUM CHANNEL BETA SUBUNITS AND SCA6-TYPE CALCIUM CHANNEL ALPHA SUBUNITS C-TERMINI REGULATE TARGETING AND FUNCTION OF PRESYNAPTIC CALCIUM CHANNELS IN HIPPOCAMPAL NEURONS
By
MIAN XIE
Submitted in partial fulfillment of the requirents
For the degree of Doctor of Philosophy
Dissertation Adviser: Stefan Herlitze
Department of Neuroscience
CASE WESTERN RESERVE UNIVERSITY
January, 2008 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
Mian Xie
candidate for the PHD degree*.
(signed)
Lynn Landmesser (chair of the committee)
Robert Miller
Hisashi Fujioka
Stefan Herlitze
(date)
08/27/07
*We also certify that written approval has been obtained for any proprietary material contained therein.
DEDICATION
For my
grandparents
parents
and
my wife
ii TABLE OF CONTENTS
Title page…………………………………………………………………………………..i
Dedication…………………………………………………………………………………ii
Table of contents……………………………………………………………………...... iii
List of figures……………………………………………………………………………...v
Acknowledgements………………………………………………………………………vii
Abstract………………………………………………………………………………….viii
Chapter 1: Introduction……………………………………………………………………1
Structure, biophysical property, and distribution of Voltage-gated Calcium
Channels……………………………………………………………………………...2
Structure and function of Cavβ subunits……………………………………………..7
Cavβ subunits target VGCC in heterologous expression systems and neurons...... 9
Presynaptic VGCC and synaptic transmission……………………………………..12
Channelopathy caused by alteration of P/Q- type channel C- terminus: SCA6...... 14
Research goals……………………………………………………………………...17
Chapter 2: Facilitation versus Depression in cultured hippocampal neurons determined
2+ by targeting of Ca channel Cavβ4 versus Cavβ2 subunits to synaptic terminal………..19
Introduction…………………………………………………………………………20
Material and Methods…………………………………………………………...... 22
Results………………………………………………………………………………29
Discussion…………………………………………………………………………..41
iii Figures…..…………………………………………………………………………..48
Chapter 3: The human P/Q-type C-terminus underlying SCA6 forms cytoplasmic aggregates, impairs synaptic transmission and increases synapse number………………79
Introduction…………………………………………………………………………80
Material and Methods…………………………………………………………...... 84
Results………………………………………………………………………………89
Discussion…………………………………………………………………………..98
Figures……………………………………………………………………………..105
Chapter 4: Discussion…………………………………………………………………..123
Research conclusions…………………………………………………………...... 124
Importance of VGCC Cavβ subunits in subunit-specific channel targeting………125
Cavβ subunits and short-term synaptic plasticity………………………………….128
Physiological and pathological consequences of expression different P/Q-
type C-termini……………………………………………………………………..130
Remain questions and future directions…………………………………………...132
Figures……………………………………………………………………………..138
Chapter 5: Bibliography………………………………………………………………...145
iv List of Figures
Chapter 2: Facilitation versus Depression in cultured hippocampal neurons determined by
2+ targeting of Ca channel Cavβ4 versus Cavβ2 subunits to synaptic terminals
Figure 1…………………………………………………………………………49
Figure 2…………………………………………………………………………51
Figure 3…………………………………………………………………………54
Figure 4…………………………………………………………………………56
Figure 5…………………………………………………………………………58
Figure 6…………………………………………………………………………61
Figure 7…………………………………………………………………………63
Figure 8…………………………………………………………………………66
Figure 9…………………………………………………………………………68
Figure 10………………………………………………………………………..71
Figure 11………………………………………………………………………..73
Figure 12………………………………………………………………………..76
Chapter 3: The human P/Q-type C-terminus underlying SCA6 forms cytoplasmic aggregates, impairs synaptic transmission and increases synapse number
Figure 1………………………………………………………………………..106
Figure 2………………………………………………………………………..108
Figure 3………………………………………………………………………..110
Figure 4………………………………………………………………………..112
v Figure 5………………………………………………………………………..114
Figure 6………………………………………………………………………..116
Figure 7………………………………………………………………………..118
Figure 8………………………………………………………………………..120
Chapter 4: Discussion
Figure 1………………………………………………………………………..139
Figure 2………………………………………………………………………..141
Figure 3………………………………………………………………………..143
vi Acknowledgements
This thesis would not have been possible without the support of many people. I would like to express my thanks and appreciation to all those who have helped along the way. Especially, I would like to sincerely thank my adviser and mentor Dr. Stefan
Herlitze. Stefan has been an exceptional example of a successful, passionate and hard working scientist and provided me with his support, guidance and caring throughout the years. I would also like to thank other members in my committee, Dr. Lynn Landmesser,
Dr. Robert Miller, and Dr. Hisashi Fujioka, for their support, guidance and participation in my research.
Thanks to all former and present members in Herlitze lab for your kind and generous help. Thanks for my friends and family, especially my wife, for your love and support. There is no way I could have don this without your help.
vii Calcium Channel Beta Subunits and SCA6-type Calcium Channel Alpha Subunits C-Termini Regulate Targeting and Function of Presynaptic Calcium Channels in Hippocampal Neurons
Abstract by
MIAN XIE
Ca2+ channel β subunits determine the transport and physiological properties of high voltage activated Ca2+ channel complexes, and the poly-glutamination within the
C-terminus (CT) of the P/Q-type Ca2+ channel α subunit is linked with Spinocerebellar ataxia type 6 (SCA6). In the first part of this study we analyzed the distribution of the
Cavβ subunit family members in hippocampal neurons and correlated their synaptic distribution with their involvement in transmitter release. We found that exogenously expressed Cavβ4b and Cavβ2a subunits distribute in clusters and localize to synapses, while
Cavβ1b and Cavβ3 are homogenously distributed. According to their localization Cavβ2a and
4b subunits modulate the synaptic plasticity of autaptic hippocampal neurons, i.e. Cavβ2a induces depression, while Cavβ4b induces paired-pulse facilitation followed by synaptic
viii depression during longer stimuli trains. The induction of paired-pulse facilitation by
Cavβ4b is correlated with a reduction in the release probability and cooperativity of the transmitter release. These results suggest that Cavβ subunits determine the gating properties of the presynaptic Ca2+ channels within the presynaptic terminal in a subunit specific manner and may be involved in the organization of the Ca2+ channel relative to the release machinery.
We also examined whether the poly-glutamination of P/Q-type channel CT can increase the channel stability and induce a gradual accumulation of a CT degradation product. We demonstrated that the poly-glutaminated CT degradation product distributes in cytoplasmic aggregates in cultured neurons as found in SCA6 patients and has drastic physiological effects on synaptic function and synapse assembly. Our results show that the CTs induce a change in the Ca2+ dependence of transmitter release correlated with a reduced vesicular release probability, which causes synaptic depression during repetitive high frequency stimulations. The CT containing the SCA6 mutation also caused an increase in the number of synapses. Our results predict that CT degradation products derived from the P/Q-type channels in SCA6 patients would reduce synaptic strength in each synaptic terminal, but increased the overall synapse formation per neuron. The increased synapse formation may give a mechanistic explanation for the survival of nucleo-olivary pathways in SCA6, which is not observed in other SCAs.
ix Chapter 1: Introduction
1 Voltage gated Ca2+ Channel (VGCC) complexes mediate the voltage-dependent Ca2+ influx in subcellular compartments. They trigger diverse processes including neurotransmitter release, dendritic action potentials, excitation-contraction and excitation-transcription coupling. Targeting of biophysically defined VGCC complexes to the correct subcellular structures is therefore critical to proper cell and system function.
Minute changes in targeting of VGCC complexes are therefore related to the modulation of the channel functions within the subcellular structure, and alterations of the proper targeting of Ca2+ channels can lead to channelopathy such as SCA6.
Structure, biophysical property, and distribution of Voltage-gated Calcium Channels
VGCC complexes are composed of the pore forming α subunit (Cavα), the ancillary
β (Cavβ) and α2δ subunits, and these subunits are necessary to the function of the channels (Leveque et al., 1994; McEnery et al., 1991). Although γ subunits in skeletal muscle and their brain homologous are also important to the channel function, their assembly is not required to form functional channels (Catterall, 2000; Curtis and Catterall,
1984; Herlitze and Mark, 2005).
The structure of the Cavα subunit consists of four transmembrane domains, each of which contains six transmembrane segments. Inside each domain there is a segment considered function as the voltage sensor and a hairpin structure that most likely forms the pore of the channel (Catterall, 2000; Herlitze et al., 2003). The domains are connected
2 to each other by peptide loops, which are targets for intracellular protein-protein interactions and therefore important for channel targeting, modulation, sorting and clustering. The loop I-II and the C- terminus of the Cavα subunit are believed to have the sites for the binding of Cavβ subunits (Bichet et al., 2000; Dolphin, 2003; Sandoz et al.,
2004).
According to their activation voltage, VGCC complexes can be divided into three major classes: high voltage activated (HVA) Ca2+ channels, which include P/Q-, N-, and
L- type channels, intermediate voltage activated (IVA) Ca2+ channels, which are the R- type channels, and low voltage activated (LVA) Ca2+ channels, which are the T- type channels. All five types of VGCC complexes have been found in the central nervous system (CNS), heart and skeletal muscle, and each of them is characterized by distinct pharmacological and electrophysiological properties and subcellular distribution
(Catterall, 1998; Herlitze et al., 2003).
To date more than 40 putative genes have been described encoding functional Ca2+ channel subunits. Studies using heterologous expression systems to express the gene
products revealed that Cavα11.1 (formerly α1S), Cavα11.2 (formerly α1C) and Cavα11.3
(formerly α1D) encode the L-type channels; Cavα12.1 (formerly α1A) the P/Q-type
channels; Cavα12.2 (formerly α1B) the N-type channels; Cavα12.3 (formerly α1E) the
2+ R-type channels; and Cavα13.1-3 (formerly α1G-I) the T-type Ca channels (Catterall,
1998; Herlitze et al., 2003; Jones, 1998).
As mentioned above, L-type channels are encoded by the Cavα11.1, Cavα11.2,
3 Cavα11.3 and Cavα11.4 subunit. The Cavα11.1 subunit contains the dihydropyridine (DHP)
binding site and mediates the EC-coupling. Cavα11.4 had been first postulated to be retina
specific, but recently Cavα11.4 subunit mRNA was detected in dorsal root ganglion
neurons (Yusaf et al., 2001). Cavα11.2 and Cavα11.3 subunits encode for most of the
L-type currents in brain, heart, smooth muscle, pancreas, adrenal gland, kidney, ovary, testis and cochlea (Biel et al., 1990; Green et al., 1996; Iwashima et al., 1993; Mikami et al., 1989; Snutch et al., 1991; Williams et al., 1992). In brain, L-type channel currents, transcripts and proteins were described in various regions including hippocampus, cerebral cortex, cerebellum and retina (Chin et al., 1992; Ludwig et al., 1997; Safa et al.,
2001; Tanaka et al., 1995; Volsen et al., 1995). L-type channels are involved in excitation-transcription coupling, for example the CREB phosphorylation (Dolmetsch et al., 2001) in cortical neurons, which is important in neuronal plasticity and survival
(Shaywitz and Greenberg, 1999). At the cellular level, both Cavα11.2 and Cavα11.3 subunits were localized at the proximal dendrites and the cell bodies (Hell et al., 1993) and believed to be the major postsynaptic Ca2+ channels in neurons.
N-type channels were first discovered in sensory neurons as non-L-and-non-T- type channels (Fox et al., 1987; Nowycky et al., 1985) which can be blocked by the snail venom toxin ω-conotoxin GVIA (ω-CTx GVIA) (Sher et al., 1988). N-type channels are found in all CNS regions including cerebral cortex (layers 2 and 4), cerebellum, olfactory bulb, hippocampus (pyramidal cell layers CA1, CA2 and CA3), dentate gyrus, hypothalamus, thalamus and the spinal cord (Coppola et al., 1994; Dubel et al., 1992;
4 Tanaka et al., 1995; Volsen et al., 1995; Westenbroek et al., 1992). At the cellular level,
Cavα12.2 channels are localized along the entire length of the dendrites with a patchy pattern suggesting that these channels are involved in both neurotransmitter and hormone release (Westenbroek et al., 1992).
P-type channels were first found in the cerebellar Purkinje cells (Llinas et al., 1989;
Mintz et al., 1992) while Q-type channels were first found in cerebellar granule neurons
(Randall and Tsien, 1995; Zhang et al., 1993). Although there are difference in their channel inactivation properties and their sensitivity to the spider toxin ω-Aga-IVA between these two types of channels, later studies revealed that they are encoded by
splice variants of a single gene (Bourinet et al., 1999). Cavα12.1 subunits are expressed throughout the brain including hippocampus, dorsal cortex, olfactory bulb and cerebellum
(Ludwig et al., 1997; Tanaka et al., 1995). Punctate staining was observed in many types of neurons including cerebellar Purkinje cells, hippocampal neurons and cortical
pyramidal neurons, suggesting the presynaptic localization of the Cavα12.1 subunits in these cell types (Craig et al., 1998; Westenbroek et al., 1995). Electrophysiological studies using ω-Aga-IVA suggest P/Q-type channels are the key players at presynaptic sites during the synaptic transduction. Together with the N- type channels, they are the major channels controlling the presynaptic Ca2+ influx and ultimately the presynaptic modulation and short-term synaptic plasticity(Catterall, 2000; Jones, 1998).
Ca2+ currents resistant to the common L- and N/P/Q-type blockers were detected in cerebellar granule cells and are designated as R-type currents (Forti et al., 1994; Randall
5 and Tsien, 1995; Randall and Tsien, 1997). Cavα12.3 subunits are believed to encode for this R-type channels (Randall and Tsien, 1997; Zhang et al., 1993). Several different
Cavα12.3 isoforms have been described in brain, pancreas and kidney (Wilson et al.,
2000). In CNS, the Cavα12.3 protein is found in both projection neurons and interneurons
(Tanaka et al., 1995). At least in Purkinje cells, Cavα12.3 channels are detected at high levels in cell bodies and dendritic trees, while in axons they are expressed at a lower level.
T-type channels are encoded by Cavα13.1-3 and are all highly expressed in brain
(Cribbs et al., 1998; Lee et al., 1999; McRory et al., 2001; Perez-Reyes et al., 1998;
Talley et al., 1999). Among them the Cavα13.1 is the most prominently expressed LVA channel. Due to their low voltage activation property, T-type currents are involved in pacemaker activity in heart (Perez-Reyes, 1999) and in many CNS nuclei. According to their function in neurons, e.g. Ca2+ dependent burst firing, neuronal oscillation, and lowering threshold for spike generation, T-type channels are expected to be localized within the somatodendritic membrane. However, these channels have not been detected in presynaptic terminals and therefore may not play a role in synaptic transmission
(Huguenard, 1996).
During the process of synaptic transmission, HVA channels are suggested to be critical in controlling the synaptic strength and plasticity, in which the N- and P/Q- type channels play key roles in triggering the vesicle release at the presynaptic sites, while at the postsynaptic sites the L- type channels are the major players in modulation the
6 postsynaptic responses and gene expression (Catterall, 1998; Catterall, 2000; Jones,
1998).
Structure and function of Cavβ subunits
Cavβ subunits are important parts of VGCC complex and are required for the functionality of the channels. To date there are four Cavβ subunits. Cavβ1-4, have been identified with several isoforms (Cavβ1a and Cavβ1b, Cavβ2a and Cavβ2b, and Cavβ4a and
Cavβ4b), and all four subunits have been found in brain (Herlitze et al., 2003; Ludwig et al., 1997).
Sequence analysis of the Cavβ subunits revealed that they all consist of five domains, with the domains II and IV being highly conserved and the other three being variant among the four subunits (Birnbaumer et al., 1998). Recently, the crystal structures of the
Cavβ have been determined (Chen et al., 2004; Opatowsky et al., 2004; Van Petegem et al., 2004). Further analysis of the crystal structures revealed that the Cavβ subunits belong to the membrane-associated guanylate kinase (MAGUK) family, containing Src homology type 3 (SH3) and guanylate kinase (GK) domains. These domains fold in a way that an α subunit binding domain (AID) of the Cavβ subunit, which is located in the middle of the Cavβ subunit, interacts with β subunit binding domain (BID) at the loop I-II of the Cavα subunit. (Hanlon et al., 1999; Richards et al., 2004; Rousset et al., 2005).
The binding of the Cavβ subunits with the pore forming Cavα subunits leads to the transport of Cavα subunit to the plasma membrane (Dolphin, 2003; Herlitze et al., 2003).
7 In HEK cells, for example, expressions of Cavβ subunits drastically increased the plasma membrane localization of Cavα11.2 subunits from 50 to 80%, depending on the specific
Cavβ subunits coexpressed (Gerster et al., 1999). It is believed that Cavβ subunits shield an ER retention signal of Cavα subunits, thereby guiding the pore forming subunit through the ER to the plasma membrane, leading to an increase in the amount of functional channels at the target sites (Bichet et al., 2000). Mutagenesis studies of the
SH3 and GK domains showed that Cavβ subunits are responsible for scaffolding and precise localization of Ca2+ channel complexes to defined subcellular domains (McGee et al., 2004).
Cavβ subunits also modulate the function of the VGCC complex. In general, Cavβ subunits increase the open probabilities of the channels at lower potentials therefore sharpen the Ca2+ signal by varying the response window of the channel complex to a voltage change, and they determine channel biophysical properties in a subunits specific manner. In heterologous expression systems, for example, P/Q-type channels assembled with Cavβ1b and Cavβ3 subunits inactivate faster than those with Cavβ4 and Cavβ2 subunits
(Fellin et al., 2004; Luvisetto et al., 2004; Stea et al., 1994).
Among the four Cavβ subunits, Cavβ2 has the most dramatic effects on the channel
properties. Assembly of the Cavβ2 subunit causes a drastically slow inactivation of the
2+ Ca channels. Interestingly, the Cavβ2 subunit is the only subunit among the Cavβ subunits to have a palmitoylation site, and it is believed that this palmitoylated site at
N-terminal protein domain is responsible for the membrane localization of the subunit
8 (Chien et al., 1998).
Cavβ subunits target VGCC in heterologous expression systems and neurons
2+ The relationship between the transport / localization of Ca channels and Cavβ subunits were first studied in heterologous expression systems. In HEK293 cells, the
Cavβ2a subunits were found critical to the localization of L-type channel subunit Cavα11.2
(Chien et al., 1995) and expression of Cavβ subunits caused an increase of L-type currents in a time dependent manner. Currents were approximately 2-4 fold larger when cells were transfected with Cavα1/ Cavβ comparing with those transfected with Cavα1 alone. The currents reach a maximum after 40-50 h and then decay slowly. Later Gao et al. (Gao et al., 1999) showed that a redistribution of Cavα11.2 containing channels was accomplished by all Cavβ subunits. In COS-7 cells, Dolphin's group revealed the similar targeting effects of Cavβ subunits on P/Q-type channels (Bogdanov et al., 2000).
The expression of the four mammalian Cavβ subunits has been described for various brain regions (Dolphin, 2003; Ludwig et al., 1997; Tanaka et al., 1995), and at the cellular level, pre- and postsynaptic localizations have been suggested for Cavβ1, Cavβ3 and Cavβ4 subunits (Herlitze et al., 2003).
Ca2+ channels have been detected in vesicle like structures (Ahmari et al., 2000;
Leitner et al., 1999; Shapira et al., 2003), indicating that vesicle mediated transport plays a role for axonal and dendritic delivery of Ca2+ channel complexes. Mutations in the
9 ancillary Cavβ subunits cause severe malfunctions. In mice, a loss-of-function mutation in Cavβ4 results in an epileptic phenotype (lethargic; lh/lh)(Burgess and Noebels, 1999).
Excitatory synaptic transmission in lethargic mice is reduced, suggesting a presynaptic function for Cavβ4 subunits in transmitter release (Caddick et al., 1999). This is supported by previous studies from our lab. We revealed presynaptic location and function of Ca2+ channel Cavβ4 subunits in hippocampal neurons (Wittemann et al., 2000). Exogenously
2+ expressed Cavβ4 subunits, which presumably form presynaptic Ca channels containing
2+ the Cavβ4 subunits, lead to slower inactivation of the Ca channels in the hippocampal neurons, allowing a larger ion influx during repetitive stimulation for Cavβ4 assembled channels (Wittemann et al., 2000).
The importance of the Cavα subunit C-terminus in channel targeting
The C-terminus (CT) of the Cavα subunit is located intracellularly, has interaction domains for Cavα subunits as well as other proteins including modular adaptor proteins and proteins of the synaptic release machinery (Fig. 1). Since the CTs of Cavα subunits are important sites for alternative splicing and protein modification (Herlitze et al., 2003), the CTs have been suggested to play a role in synaptic targeting and clustering of the channel complexes (Gao et al., 2000; Herlitze and Mark, 2005), in modulation of channel function (Kobrinsky et al., 2003), and have been identified as targets of channelopathies such as SCA6 (Gazulla and Tintore, 2007; Zoghbi and Orr, 2000).
10 In L-type channels, Cavα11.1 and Cavα11.2 subunits contain the targeting signal in their C-termini (Flucher et al., 2000; Gao et al., 2000). In HEK293 cells, subsequent truncation of the full length Cavα11.2 subunit C-termini reduced membrane staining of the channels, indicating Cavα11.2 CTs are important in membrane targeting of the channels (Gao et al. 2000). Since Cavα11.1 and Cavα11.2 subunits have several truncated and expanded isoforms, the changes in the length of the CTs and consequently the number and locations of the protein-protein interaction sites on the CTs have implication in the targeting and function of the channels (De Jongh et al., 1994; De Jongh et al., 1991;
Hell et al., 1993; Lai et al., 2005).
Similar results were also reported for N- and P/Q-type Ca2+ channels, in which the
CTs were found to interact with modular adaptor proteins including Mint1, CASK and
Veli, which form a tripartite complex in the presynaptic terminal and interact with other signaling proteins like β- neurexins (Maximov et al., 1999). Mint1-1 and CASK were believed to bind to the C-terminus of N-type channel subunit Cavα12.2 and the interaction involves the first PDZ domain of Mint1 and the SH3 domain of CASK. Interestingly,
Mint-1only interacts with the long splice variants of P/Q- and N-type channels which contain the sequence motif, but not R- or L-type channels, suggesting that alteration of this interaction would have impact to the presynaptic HVA channels other than the other channels types. Therefore, HVA CTs and their interaction with protein signaling complexes implicate their important roles in clustering and precise positioning of channels within the presynaptic terminals (Bezprozvanny and Maximov, 2001; Jarvis and
11 Zamponi, 2001; Maximov and Bezprozvanny, 2002).
Presynaptic VGCC and synaptic transmission
Although multiple types of VGCCs expressing throughout the nervous system have different cellular/ subcellular distributions and biophysical properties, only presynaptic targeted HVA channels are believed to play a key role in synaptic transmission. During signal transduction, these channels control the amount of Ca2+ influx into the terminals, which is directly proportional to the amount of transmitter release. N-type and P/Q-type
Ca2+ channels are the main Ca2+ channel subtypes expressed in presynaptic nerve terminals of adult synapses, where their opening is linked to the rapid release of synaptic vesicles (Catterall, 1998; Jones, 1998; Sabatini and Regehr, 1999). In some neurons,
R-type Ca2+ channels might also contribute to synaptic release, but to a much smaller extent (Huguenard, 1996).
The roles of N-type and P/Q-type channels in synaptic transmission are considerably different. At the system level, the expression of the N-type or P/Q-type channels in the
CNS shows a distinct pattern, and genetic studies (knockout of these genes) give rise to drastically different phenotypes (Beuckmann et al., 2003; Jun et al., 1999; Miyazaki et al.,
2004). In knockout mice deficient in the Cavα12.1gene, the animals die at the 3rd or 4th week after birth, with severely ataxia and absence seizures (Jun et al., 1999). Conversely, mice lacking Cavα12.2 are generally normal, except being hyposensitive to certain types of pain stimuli (Ino et al., 2001; Saegusa et al., 2001). At the cellular level, excitatory and
12 inhibitory synaptic transmission in hippocampal CA1 pyramidal neurons are blocked to different extent by ω-conotoxin GVIA, indicating that N-type and P/Q-type channels have differential roles in excitatory and inhibitory neurotransmission (Potier et al., 1993).
At least in some synapses, for example the Calyx of Held, P/Q- type channels can trigger transmitter release faster than N-type channels, indicating they are located at different micro domains at the presynaptic sites (Wu et al., 1999). This phenomenon was not detected in hippocampal neurons, possibly due to the much smaller size of the synapses compared with the Calyx of Held (Reid et al., 1998).
The regulation of the presynaptic Ca2+ channels is complex, with multiple cellular and subcellular mechanisms involved to provide precise regulation of synaptic transmission. Besides the fact that Cavβ subunits and Cavα1 CTs have been associated with targeting and modulation of the channel complex, the channels can also be regulated by receptor-mediated trafficking, Ca2+-binding proteins, G-protein signaling pathways, syntaxin, PIP2 and PKC, with the interplay between the pathways and Cavβ subunits and multiple Cavα1 binding proteins (review see Evans and Zamponi, 2006) (Evans and
Zamponi, 2006). These multiple mechanisms work in concert to regulate the presynaptic
Ca2+ channels in a complex yet precise way, which serve as integration centers in controlling synaptic strength and plasticity.
As loss of P/Q-type or N-type channels produces vastly different phenotypes, it is possible that they are modulated in a channel subtype specific manner. However, these phenotypes might very likely also relate to their different expression patterns in the CNS,
13 their different roles in excitatory and inhibitory neurotransmission (Potier et al., 1993), and/or the extent of compensation by other Ca2+ channel subtypes that occurs in these knockouts (Inchauspe et al., 2004). Hence, these phenotypes may reflect a combination effects from these channel subtypes and their complex regulatory systems. On the other hand, a change in any of the modulators may have implication in the final synaptic output.
Since both P/Q-type and N-type channels are often expressed in the same nerve terminals and they share virtually all common regulatory mechanisms, it may be more important to distinguish the regulatory mechanisms involved in these channel subtypes rather than comparing their biophysical properties directly when address their roles in synaptic transmission.
Channelopathy caused by alteration of P/Q- type channel CTs: SCA6
Due to the importance of the presynaptic HVA channels and their modulation systems in synaptic transmission, alteration and/or modulation of the intracellular protein domains including the domains of the CTs, which have multiple binding sites for structural and modulatory intracellular proteins, may have drastic impact on the functionality of the channels. As expected, changes in channel targeting and function can cause CNS diseases. For example, alternative splicing of the P/Q-type channels, which creates an extended CT with poly-Q segment, leads to the Spinocerebellar ataxias type 6
(SCA 6).
14 SCA6 is a prototype of cerebellar cortical or cerebello-olivary atrophy, which is marked by severe cerebellar vermis atrophy and mild to moderate atrophy of the hemispheres (Ishekawa et al., 1999; Ishikawa et al., 2001). The disease leads to a remarkable loss of Purkinje cells in the cerebellar cortex while other cell types such as granule cells are less affected. At the cellular level, the surviving Purkinje cells in SCA6 patients have smaller cell bodies with drastically reduced dentritic trees. Since Purkinje cells are the single output source of the cerebellar cortex, alteration in this neuronal circuit results in impaired movement control, which gives rise to the typical SCA6 ataxic gait.
The P/Q- type channel Cavα12.1 gene has 47 exons, and the alternative splicing occurs between exon 46 and 47, which generates either a channel with a short or extended C-terminus (CT-short or CT-long). In humans, isoforms expressing the long and short C-termini have been found in the cerebellar cortex (Ishikawa et al., 1999).
However, the detailed expression levels and patterns of the CT splice variants are still unknown. The poly-Q segment is located within the C-terminal extension of exon 47.
The alternative splicing to generate CT-long and contains the poly-Q segment is believed to be the cause of the SCA6 gain-of-function phenotype, presumably due to the increased stability of the poly-Q protein (Chen et al., 2003; Emamian et al., 2003; Tsuda et al., 2005). Indeed, an increase in P/Q-type channel stability by poly-Q has been observed (Ishikawa et al., 1999; Ishikawa et al., 2001; Piedras-Renteria et al., 2001).
Morphologically, in SCA6 the polyQ aggregates are found in both the cytosol and the
15 nucleus in Purkinje cells, however, these inclusions are predominantly located in the cytosolic compartment and are not ubiquitinated (Ishikawa et al., 2001; Orr, 2001).
Although the role of these inclusions is still not fully understood, it is believed that these inclusions are probably due to insufficient proteosomal degradation of the misfolded proteins (Stenoien et al., 2002).
How proteosomal degradation and related mechanisms contribute to the SCA6 disease is still under investigation and remains controversial. For example, alterations in the degradation pathways are found to have direct impact on the severity of the diseases
(Cummings et al., 1999; Cummings et al., 2001; Fernandez-Funez et al., 2000). On the other hand, it has been reported that the proteosome function in disease models of polyQ is not disturbed (Bowman et al., 2005). In most studies, the poly-Q containing inclusion bodies are generally believed to be harmful and neurodegenerative (Koeppen, 2005; Orr,
2001; Zoghbi and Orr, 2000). However, in a Huntington disease model some results suggest that the presence of nuclear inclusion bodies is actually protective and can improve the chance for neuronal survival, presumably by reducing diffuse intracellular toxic levels of mutant huntingtin (Arrasate et al., 2004).
Since the P/Q- type channels play a key role in synaptic transmission, misfolding, degradation, and/or subcellular relocation of the channel proteins will inevitably impact the functionality of the channels and consequently, have serious pathological implication for the disease. Although the mechanisms of the proteosomal degradation of the poly-Q containing proteins are not yet clear, high concentrations of the CT degradation products,
16 which contain binding sites for proteins involved in channel trafficking, localization, synapse assembly and transmitter release, will most likely interfere with these events and therefore their roles in SCA6 are worth to investigate in details.
Research Goals
The goals of this thesis study are to understand Cavβ subunits and SCA6-type Cavα subunit C-Termini related changes in targeting and function of presynaptic Ca2+ channels.
The research is divided into two projects. The first focused on the Cavβ subunits associated mechanisms in targeting and function of the presynaptic HVA channels. In the second, we studied the P/Q- type CT related changes in channels targeting and function and the involvement of these changes in SCA6 pathological mechanisms.
In the first part, we wanted to know if and how each individual Cavβ subunit can affect the synaptic transmission and synaptic plasticity of synapses. To address this question, individual Cavβ subunits were overexpressed at high levels in autaptic hippocampal neurons to out-compete the endogenous ones, and the consequent changes on synaptic transmission were examined. In the second project, our goal is to test our hypothesis that P/Q- type channels containing poly-Q segments are more stable. Since the
P/Q-type channels are the key players at presynaptic sites, the numerical and/or functional changes of presynaptical Ca2+ channels are expected to cause changes in many parameters that reflect synaptic function (for example the paired-pulse ratio and transmitter release probability). This can be verified by electrophysiological recordings of
17 these cells.
A major advantage of studying the targeting of ion channels is that the precise localization of channel complexes can simultaneously be analyzed with fluorescent tags and markers in biochemical and cellular assays in combination with measuring their underlying currents and physiological responses in a native environment (e.g. synaptic transmission and synaptic plasticity). Thus, targeting events can be visualized, measured and quantified. In this thesis study, we used viral expression systems to overexpress fluorescent-tagged (GFP/YFP/CFP) Cavβ subunits or Cavα12.1 CTs in cultured hippocampal neurons to study the overexpression related targeting events. These results were then associated with quantified measurements of the electrophysiological properties of the synapses to answer the question how these events are involved in changes in synaptic function under physiological and/or pathological conditions. Our result revealed for the first time that Cavβ subunits can modulate presynaptic short-term plasticity in a subunit specific manner, and Cavα12.1 CTs caused changes in targeting and modulation of the presynaptic P/Q- type channels, a process which might be involved in the pathological mechanisms of the SCA6 disease.
18 Chapter 2: Facilitation Versus Depression In Cultured Hippocampal Neurons Determined By Targeting Of Ca2+
Channel Cavβ 4 Versus Cavβ 2 Subunits To Synaptic Terminals
19 Introduction
High voltage activated (HVA) Ca2+ channels in neurons consist of several subunits, a
poreforming α1 subunit (Cavα 1) and several auxiliary subunits including α2δ and β
(Cavβ)(Catterall, 2000).
Cavβ subunits are involved in the transport of the poreforming α1 subunit to the plasma membrane (Dolphin, 2003; Herlitze et al., 2003). Cavβ subunits shield an ER retention signal on the α1 subunit thereby guiding the poreforming subunit to the target membrane (Bichet et al., 2000).
2+ Cavβ subunits also determine the biophysical properties of the Ca channel. The effects of the Cavβ subunit family members on the biophysical properties are complex.
Four family members have been described (Cavβ1-4). P/Q-type channels assembled with
Cavβ1b and β3 subunits in heterologous expression systems are fast inactivating in comparison to Cavβ4 and β2 assembled channels (Fellin et al., 2004; Luvisetto et al., 2004;
Stea et al., 1994). Cavβ2 has the most dramatic effects on the channel properties, causing the channel to inactivate very slowly. In addition, the Cavβ2 subunit is unique since this subunit can be attached to the plasma membrane via its palmitoylated N-terminal protein domain (Chien et al., 1998).
Several studies also suggest that at least certain Cavβ subunit family members can target and function independently of the Cavα1 subunits at the plasma membrane and other intracellular structures such as the nucleus. These subunits may be involved for
20 example, in gene transcription (Hibino et al., 2003) and the regulation of Ca2+ oscillations and insulin secretion (Berggren et al., 2004).
Recently, the crystal structures of the Cavβ core domains and the interaction domain between Cavβ and Cavα1 have been determined (Chen et al., 2004; Opatowsky et al.,
2004; Van Petegem et al., 2004). These studies revealed that the Cavβ subunits belong to the membrane-associated guanylate kinase (MAGUK) family, containing Src homology type 3 (SH3) and guanylate kinase (GK) domains (Hanlon et al., 1999; Richards et al.,
2004; Rousset et al., 2005). Mutagenesis studies of the SH3 and GK domains showed that these domains regulate the inactivation of these Ca2+ channels (McGee et al., 2004) but also suggest that Cavβ subunits are involved in scaffolding and in the precise localization of Ca2+ channel complexes to defined subcellular domains. Indeed, deletion of the non-conserved N- and C-termini of the Cavβ4b subunit results in loss of synaptic localization and presynaptic function (Wittemann et al., 2000). In addition, the isolated
N-terminus of Cavβ4a is capable of interacting with proteins of the vesicle release machinery (Vendel et al., 2006).
All Cavβ subunits are expressed in the brain. Their subcellular distribution within neurons reveals that they are localized to neuronal cell bodies and dendrites. In addition,
Cavβ has been suggested to be localized to synaptic terminals (Herlitze and Mark, 2005).
However, its precise function for determining synaptic transmission and in particular synaptic plasticity is unclear. Therefore, the goal of the present study was to analyze the distribution of endogenously and exogenously expressed Cavβ subunits in hippocampal
21 neurons and to correlate their distribution with their effects on synaptic transmission. Our results suggest that Cavβ2a and Cavβ4b subunits are targeted to presynaptic terminals, where they determine whether synapses facilitate or depress.
Material and methods
Cell Culture: Micro-island and continental cultures of hippocampal neurons were prepared according to a modified version of published procedures (Bekkers and Stevens,
1991). Briefly, hippocampal CA1-CA3 neurons from newborn rats (P0-P3) were enzymatically dissociated in DMEM plus papain (2 units/ml, Worthington) for 60 min at
37°C. Dissociated neurons were either plated onto astrocyte covered PDL/collagen
(Sigma)-treated microislands, prepared 3-5 days prior to plating (autaptic cultures), or plated onto PDL/collagen-treated coverslips, which were placed invertly over astrocyte feeder cells (continental cultures). Neuronal cultures were grown in Neurobasal-A media
(Gibco) supplemented with 4% B-27 (Gibco) and 2 mM Glutamax (Gibco) for 12-15 days.
Pan-β-antibody: Polyclonal anti-pan-β antibody was raised by Harlan Bioproduct for
Science (Indiana, USA) according to a published procedure (Vance et al., 1998). In short, a highly conserved peptide sequence presented in all β subunits
(CESYTSRPSDSDVSLEEDRE) was synthesized and a standard 112-day protocol was used for polyclonal antibody production (Harlan Bioproduct for Science). The specificity
22 of the product was documented with Western blots using rat brain homogenate as well as homogenates of HEK cells expressing Cavβ1b,2,3 or 4 subunit and resulted in only bands with desired molecular weights.
Electrophysiology and analysis: For HEK293 cell recordings, HEK293 cells (tsA201
2+ cells) were tranfected with the Ca channel subunits Cavα12.1, Cavα2δ and Cavβ1b,2a,3 or 4b and with GFP to indentify positively transfected cells (molar ratio: 2:1:1:0.25). Whole cell recordings were performed as published previously (Li et al., 2005). For EPSC recordings, only dots containing a single neuron forming excitatory synapses (autapses) were used using an EPC-9 amplifier (HEKA). Recordings were performed at room temperature.
For EPSC measurements as well as for recordings of Ca2+ currents in HEK293 cells, the extracellular recording solution contained 172 mM NaCl, 2.4 mM KCl, 10 mM
HEPES, 10 mM glucose, 4 mM CaCl2, and 4 MgCl2 (pH 7.3); the internal solution contained 145 mM potassium gluconate, 15 mM Hepes, 1 mM potassium-EGTA, 4 mM
Na-ATP, and 0.4 mM Na-GTP (pH 7.3). For EGTA experiments (Figure 9 E and F) the internal solution contained either 10 mM potassium EGTA (Sigma), or 50 µM
EGTA-AM (Invitrogen) was applied 15 min prior to recording to the extracellular recording solution. Currents were elicited by a 2 ms long test pulse to 10mV and recorded and analyzed as published previously (Wittemann et al., 2000). For recordings using
2+ 2+ various extracellular Ca concentrations (extracellular [Ca ]o) solutions containing
23 2+ different extracellular [Ca ]o were applied directly onto the recorded neurons by using a fast-flow perfusion system (ALA Scientific Instruments).
Non-L-type channel recordings in cultured hippocampal neurons were performed as previously described (Han et al., 2006; Li et al., 2005). The internal recording solution contained (mM): 120 N-methyl-D-glucamine, 20 TEACl-, 10 HEPES, 1 CaCl2, 14 phosphocreatine (Tris), 4 Mg-ATP, 0.3 Na2GTP, 11 EGTA, pH 7.2, with methanesulfonic acid; the external solution (mM): 145 TEA, 10 HEPES, 10 CaCl2, 15 glucose, pH 7.4, with methanesulfonic acid. In addition, 1 µM TTX (Sigma) and 5 µM nimodipine (Sigma) were added to the external solution to block voltage-dependent Na+ channels and L-type Ca2+ channels. Non-L-type currents were elicited by 500 ms voltage clamp ramps from –60 to +90 mV with 1 min intervals and by 100 ms long voltage pulses from -60 to 0 mV (Figure 6B). Here capacitative and tail currents were subtracted after the experiment.
The sizes of readily releasable vesicle pools (RRP) were measured according to published procedures (Han et al., 2006; Rosenmund and Stevens, 1996). In short, 500 mM sucrose was applied directly onto the recorded autaptic neurons for 4 s by using a fast-flow perfusion system (ALA Scientific Instruments). The EPSC and RRP charge was calculated by integrating the currents elicited by the single action potential or the sucrose application.
The asynchronous and phasic release was calculated as described in Otsu et al., 2004
(Otsu et al., 2004). Briefly, we estimated the phasic release by integrating the EPSC after
24 each pulse within the 20 Hz stimulation protocol after subtraction of a baseline value measured 1 ms before each test pulse. The asynchronous release was calculated by subtracting the phasic release from the total integrated current for each EPSC. The holding current was subtracted before integration in every experiment. Statistical significance throughout the experiments was evaluated with ANOVA using Igor Pro
(Wavemetrics) Software. Standard errors are mean ± S.E.
Quantitiative real time PCR: 1 x 107 acutely dissociated hippocampal neurons were plated on poly-D-Lysine coated plates for continental culture as described above. The total RNA was subtracted from 14 DIV cultured neurons with RNeasy® Mini Kit
(Qiagen Inc.) and purified with on-column DNase digestion using RNase-Free DNase Set
(Qiagen Inc.). For RT-PCR, 1 µg of RNA was used for reverse transcription with
Advantage® RT-for-PCR Kit (BD Biosciences) to generate 100 µl cDNA, and 3 µl of the final RT product was used for real time PCR of each Cavbsubunit. Real time PCR quantification was performed on iCycler Iq® Detection System (Bio-Rad) with CYBR®
Green assay (Bio-Rad). The DNA fragments of Cavβ1b,2a,3 and 4b were amplified from cDNA with the following primer pairs:
Cavβ1b forward: ggctgtgaggttggtttcat;
Cavβ1b backward: tgtcacctgacttgctggag;
Cavβ2 forward: catgagaccagtggtgttgg;
Cavβ2 backward: cagggagatgtcagcagtga;
25 Cavβ3 forward: caggtttgatggcaggatct;
Cavβ3 backward: gtgtcagcatccaacaccac;
Cavβ4 forward: gagagcgaagtccaaacctg;
Cavβ4 backward: tcaccagccttcctatccac;
18 S forward: aaacggctaccacatccaag;
18 S backward: cctccaatggatcctcgtta.
Specificity of RT-PCR products was documented with gel electrophoresis and resulted in a single product with desired length. The melt curve analysis showed that each primer pair had a single product-specific melting temperature. All primer pairs have at least 95% of PCR efficiency, as reported from the slopes of the standard curves generated by iQ software (Bio-Rad, version 3.1). The PCR reactions used a modified 2-step profile with initial denaturation for 3 min at 95°C; 40 cycles of 95°C 15 sec and 57°C 25 sec.
Relative gene expression data was analyzed with 2-ΔΔCT method (Livak and Schmittgen,
2001).
Electron-microscopy: For immuno-electron microscopy of the cultured hippocampal neurons, 14 DIV neurons were infected with GFP tagged Cavβ2a or Cavβ4b subunits with the SFV expression system for 12 hours before fixing with 4% paraformaldhyde in 1×
PBS for 20 min at 4°C. Cells were washed with 1× PBS containing 0.05%(V/V) Triton
X-100, blocked with 10% goat serum (Invitrogen, USA), and incubated with polyclonal rabbit anti-GFP antibody (Molecular Probes, Netherlands) at 4°C overnight. The neurons
26 were then rinsed 5 times with PBS/0.05% Triton X-100 for 3 min, and then incubated with goat-anti-rabbit IgG conjugated with 10 nm gold particles (EMS, Fort Washington,
PA) for 2 hours at room temperature on a shaker. After rinsing, neurons were fixed with
2% glutaraldehyde and 4% paraformaldhyde in 0.1 M cacodylate buffer at 4°C overnight.
After postfixing with 1% osmium tetroxide and staining with 1% uranyl acetate, neurons were dehydrated through an ethanol series from 50 % to 100 % ethanol then transferred to propylene oxide, infiltrated with Embed 812 (EMS) for 12 hr, and hardened for 24 hr at 60°C. Coverslips were removed and 60 nm sections were cut on an ultramicrotome.
The slices were recovered on Formvar-coated single slot copper grids and examined in a
JEOL JEM-1200EX electronic microscope at 80 kV.
For the brain-slice immuno-electron microscopy, 100 nm thick adult rat brain slices were prepared on a Leica VT 1000S vibrating-blade microtome (Leica, Gemany) and immediately infected with GFP tagged Cavβ2a or Cavβ4b subunits with the SFV expression system for 12 hours in an incubator with 5% CO2 at 37°C. The expression of the subunits were verified by the GFP fluorescent signals before the slices were fixed with 4% paraformaldhyde in 1× PBS at 4˚C over night. The slices were rinsed with 1×
PBS containing 0.05%(V/V) Triton X-100 3 min for 5 time, blocked with 10% goat serum (Invitrogen, USA), and incubated with a polyclonal rabbit anti-GFP antibody
(Molecular Probes, Netherlands) overnight at 4°C. Procedures and conditions for the 2nd antibody, post-fixation, embedding etc. were the same as described above.
27 cDNAs and virus production: The rat Cavβ1b,2a,3 and 4b were gifts from Dr. Terry Snutch
(University of British Columbia, Vancouver, Canada) and Dr. Perez-Reyes (University of
Virginia, VA, USA). They were cloned in frame into pEGFP-C1-3 vectors (Clontech) and then into the Semliki forest virus vector pSFV1 (Life Technologies, Inc.) for virus production. Thus the GFP tag is located on the N-terminus of the Cavβ subunits.
Membrane fractionation: About 8 × 106 hippocampal neurons were cultured on four collagen/Poly-D-Lysine coated 100 mm culture dishes for 14 days and infected with GFP tagged Cavβ1b,2a,3 and 4b carrying virus for 13-16 h. Infected or non-infected cells were scraped in 0.32 M sucrose-TBS (0.15M NaCl, 0.05 Tris, pH 7.4) containing 1× Complete
Mini Protease Inhibitor (Roche, USA) and homogenized for 50 strokes with Dounce
Tissue Grinder (Wheaton Millville, USA) before promptly loaded on top of freshly prepared 0.8 M/1.2 M sucrose-TBS gradient for centrifugation. Centrifugation was performed in a Beckman J-2-21 M/E ultracentrifuge at 3 × 104 rpm with a SW 25.1 rotor for 45 min at 4°C. Equal volume of the cytosol and membrane fractions were used for
Western blots, which were performed according to standard procedures (Mark et al.,
1995).
28 Results
Distribution of endogenous Cavβ subunits in hippocampal neurons.
We first investigated if hippocampal neurons in culture express endogenous Cavβ subunits as would be predicted by the presence of the endogenous HVA Ca2+ channels
(Reid et al., 1998; Wittemann et al., 2000). We produced a peptide-derived antibody, which recognizes all β subunit family members (pan-β antibody). As indicated in Figure
1A the antibody recognized specifically Cavβ subunits in hippocampal neurons as demonstrated by antagonistic action of the epitope peptide (data not shown). Many but not all of the puncta colocalize with synaptic markers synpatobrevin 2 (Figure 1A-C) and synapsin 1 (Figure 1D). The subunits are expressed throughout the neuron with high and uniform staining detected in the soma and proximal dendrites with more clustered distribution in synaptic areas.
We next analyzed if we could detect Cavβ subunit specific mRNAs in these neurons and if we see quantitative differences among the four different Cavβ mRNAs. As a positive control we used 18S RNA. Real time PCR revealed highest mRNA levels for the
Cavβ3 subunits and lower mRNA levels for Cavβ1,2,4 (Cavβ1 ≥ Cavβ4 ≥ Cavβ2) (Figure 1E).
The results indicate that all four Cavβ subunits are expressed in hippocampal neurons in culture, which localize to the soma and to synapses.
Distribution of exogenously expressed Cavβ subunits in hippocampal neurons.
29 We next analyzed if the exogenous expression of the Cavβ members resembles the endogenous distribution of the Cavβ subunits as determined in Figure 1 and whether
Cavβ subunits when expressed alone in neurons can target to synaptic sites (Figure 2).
We found that the Cavβ1b and Cavβ3 subunits reveal a more homogenous distribution whereas the Cavβ2a and Cavβ4b subunits are highly clustered (Figure 2A-C). When cells expressing these exogenous subunits were immunostained with the synaptic marker synaptobrevin-II or synapsin 1 we found that Cavβ4b subunits revealed a higher degree of colocalization with synaptic markers than Cavβ2a. The association of the Cavβ subunits with the Cavα1 subunits predicts that both proteins should be distributed in cytoplasmic as well as membrane regions, which we confirmed by Western blots from cytosolic and membrane fractions of whole rat brain using the pan-Cavβ antibody (Figure 3A and B).
Exogenous expression of the Cavβ subunits revealed a similar distribution, with subtype specific enrichment within either the cytoplasmic or the membrane fraction
(Figure 3C). Cavβ2a subunits are highly enriched in the membrane fraction, while Cavβ1b was mostly concentrated in the cytoplasm (Figure 3C). Cavβ3 and Cavβ4 subunits were equally distributed in both fractions (Figure 3C).
2+ Since Ca channel Cavβ2a and Cavβ4b subunits reveal a mainly punctuate distribution within the neurons we wanted to know if we are able to detect Cavb subunits in presynaptic terminals, on vesicles or vesicular structures (Figure 4). The high expression levels of the GFP tagged subunits allowed us to study their localization by immuno-electron microscopy. As a negative control we used the untagged GFP
30 overexpressed in hippocampal neurons. As shown in Figure 4 Cavβ2a and Cavβ4b subunits were detected on vesicular structures (Figure 4A and B), and close to presynaptic terminals (Figure 4C and D). We also observed that both Cavβ2a and Cavβ4b were attached to the plasma membrane (see example in Figure 4D). In contrast, GFP was found only in the nucleus and outside of the nucleus but was not associated with vesicles or transported to the presynapse (data not shown). The results suggest that both Cavβ2a and Cavβ4b subunits are transported to synaptic sites and to the plasma membrane where they most likely associate with the Cavα1 subunits to form channel complexes.
2+ Effect of Cavβ subunits on Ca channel currents in HEK293 cells and hippocampal neurons.
2+ Cavβ subunits determine the biophysical properties of the Ca channel. When expressed with the P/Q-type channel in Xenopus oocytes or HEK293 cells Cavβ subunits determine in a subunit specific manner the time course of inactivation. Cavβ1b and Cavβ3 assembled channels inactivate rapidly, while Cavβ2a assembled channels inactivate slowly
(Stea et al., 1994). Cavβ4b assembled channels inactivate with a time course which lies
2+ between the Cavβ1b, 3 and Cavβ2a. The gating properties of the presynaptic Ca channels determine the Ca2+ influx into the presynaptic terminal and therefore transmitter release and synaptic plasticity, such as facilitation and depression.
We wanted to know how P/Q-type channels assembled with different Cavβ subunits open and close during AP wave-forms, which we obtained from cultured hippocampal
31 neurons. We expressed Cavα12.1 subunits together with the Cavα2δ and the various Cavβ subunits in HEK293 cells and applied 30 APs to analyze how many channels would be opened during AP trains. To determine the proportion of open channels we used the following protocol. Based on the voltage dependence of activation of P/Q-type channels, we applied a 10 ms depolarizing test pulse to a test potential where approximately 100% of channels within the cells are open (Herlitze et al., 1996; Herlitze et al., 1997; Herlitze et al., 2001; Mark et al., 2000). This value is given by the amplitude of the tail current.
We then compared the tail current elicited by the AP to the tail current elicited by the 10 ms depolarization to +100 mV. We were interested in three values. We wanted to know if activation with the AP wave-forms would reveal differences in the opening of the channels when assembled with different Cavβ subunits. The results indicated that the AP opens between 55-65% of the channels. No significant differences were observed between channels assembled with the different Cavβ subunits (Figure 5A and B).
We then compared the ratio between the amount of channels opened by the first and the second AP (Figure 5A). By comparing this value we can determine the paired-pulse ratio underlying paired-pulse facilitation or depression, which depends on the influx of
Ca2+ through presynaptic Ca2+ channels into the presynaptic terminal. No differences were detected between channels assembled with different Cavβ subunits. We next analyzed if a 20 Hz train of 30 APs leads to a decrease in channel opening as would be expected from the inactivation of Ca2+ channels during long, constant depolarizations
(Herlitze et al., 1997; Stea et al., 1994). When comparing the proportion of channels
32 opened by the first AP relative to the amount of channels opened by the 30th AP, we found that currents mediated by Cavβ1b and Cavβ3 assembled channels are reduced by
10-15 % (Figure 5D and E). In contrast, currents mediated by Cavβ4b assembled channels are reduced by 2% (Figure 5D and E) and currents mediated by Cavβ2a assembled channels increased by 5% (Figure 5D and E). Thus, P/Q-type channels assembled with different b subunits reveal significant differences in the amount of channel opening during long AP trains.
It has been shown that the biophysical properties of P/Q-type channels depends on the cellular environment in which the pore-forming Cavα1 subunit is expressed (Tottene et al., 2002). We found that the maximal current elicited by a 500 ms long voltage ramp is shifted to more negative potentials (around 20 mV) in neurons expressing non-L-type channels in comparison to HEK293 cells expressing P/Q-type channels encoded by the
Cavα12.1, Cavα2δ and Cavβ subunits (Figure 6A). Therefore Cavβ subunit mediated effects on presynaptic Ca2+ channel (non-L-type) inactivation may be shielded in neurons by for example neuronal specific channel interacting proteins. To show that the Cavβ subunits (i.e. Cavβ2a and Cavβ4b) also change the biophysical properties of non-L-type channels in hippocampal neurons we analyzed the Ca2+ channel inactivation of somatic neuronal non-L-type channels. As shown in Figure 6B, exogenous expression of Cavβ2a and Cavβ4b subunits reduce non-L-type channel inactivation in a subunit specific manner.
Cavβ2a subunit expression leads to an increase in the non-L-type current during a 100 ms test pulse from -60 mV to 0 mV, while neuronal non-L-type currents in the presence of
33 Cavβ4b subunits do not change in size. (Figure 6B).
Synaptic depression in autopatic hippocampal neurons has also been shown to be dependent on a change in the AP amplitude during fast, repetitive stimulation (Brody and
Yue, 2000), a process which is independent of the transmitter release. To exclude that a change in AP amplitude is the major contributor to the observed depression effect, we monitored the APs of autaptic hippocampal neurons using current-clamp recordings. We elicited the APs by 2 ms long step currents, a stimulation protocol which resembles the 2 ms step depolarization we used to elicit the EPSCs in the voltage clamp experiments and compared the AP amplitudes between Cavβ4b and Cavβ2a expressing and non-expressing neurons. There was no significant difference in the AP amplitude between infected and non-infected neurons analyzed (Figure 10) indicating that a change in AP amplitude is most likely not the main factor for the differences in synaptic depression for neurons expressing Cavβ4b or Cavβ2a subunits.
Effect of Cavβ subunits on synaptic transmission
Our results on the recombinant P/Q-type channels and endogenous neuronal Ca2+ channels suggest that the Ca2+ influx into the presynaptic terminal should be altered during long 20 Hz AP trains but not for paired-pulse responses. We analyzed the effect of the Cavβ subunits on paired-pulse facilitation (PPF) by comparing the first and second
EPSC (which is defined as the paired-pulse ratio, PPR) and on synaptic depression by comparing the first and last EPSCs (averaged 27-30 EPSC) within a 20 Hz stimulation
34 protocol when 30 pulses were elicited in 4 mM extracellular Ca2+ (Figure 7A and C).
Since we did not observe effects on synaptic transmission when Cavβ1b and Cavβ3 subunits were expressed in our initial studies (data not shown), we only analyzed Cavβ4b and Cavβ2a subunit effects on synaptic transmission in the following experiments.
According to our results regarding the effects of Cavβ subunits on the inactivation properties of Cav2 channels, we found that Cavβ2a subunits did not change the PPR as expected from the biophysical analysis described above. However, Cavβ4b subunits increased the PPR leading to facilitation (Figure 7A and C).
We next analyzed if the Cavβ4b and Cavβ2a subunits influence synaptic transmission during longer AP trains. The biophysical analysis predicts that in the presence of Cavβ4b
2+ and Cavβ2a subunits Ca influx into the presynaptic terminal should be increased due to the non-inactivating properties of the presynaptic Ca2+ channels in comparison with
2+ Cavβ1b and Cavβ3 subunits. The increased Ca influx may cause more vesicle depletion
(depression) and may influence asynchronous transmitter release, which has been shown
2+ to be proportional to the residual [Ca ]i (Atluri and Regehr, 1998). Analysis of the synaptic responses during 30 20 Hz AP trains revealed that Cavβ4b and Cavβ2a expressing neurons show larger depression in comparison to wild-type neurons (Figure 7 A-C) (Note, that the amount of depression is related to the largest EPSC compared to the minimal
EPSC at the end of the stimulus train. The largest EPSC in non-infected neurons and
Cavβ4b expressing neurons is the EPSC elicited by the second pulse. Therefore depression is significantly larger for Cavβ2a (0.34 ± 0.01 (n=14) as well as for Cavβ4b (0.49 ± 0.03
35 (n=15) in comparison to non-infected neurons (0.7 ± 0.01 (n=15)).
To determine whether Cavβ4b and Cavβ2a expressing neurons reveal more vesicle depletion during AP trains, we compared the readily releasable pool size before and after
20 Hz train stimulations. As shown in Figure 7E and F the pool size is significantly reduced in Cavβ2a expressing neurons (12 ± 3.5 %) and slightly reduced in Cavβ4b expressing neurons (9 ± 2.7 %) in comparison to control neurons (3 ± 2.2 %). However, the Cavβ4b effects were not significant. To further verify that Cavβ4b and Cavβ2a expressing neurons may increase the Ca2+ influx into the presynaptic terminal, we analyzed the asynchronous release. We found that the onset of the asynchronous release was much faster and the amount of asynchronous relative to the phasic release at the beginning of the AP train was increased in Cavβ4b and Cavβ2a expressing neurons in comparison to control neurons (Figure 7G). While the total amount of phasic and asynchronous release (Figure 7H) as well as the average EPSC amplitude (Figure 7D) was slightly increased in Cavβ4b expressing neurons in comparison to control and Cavβ2a expressing neurons the differences were not significant.
These results described above support the idea that during AP trains the Ca2+ influx into the presynaptic terminal is larger in the presence of Cavβ4b and Cavβ2a subunits. A
2+ larger Ca influx into the presynaptic terminal during AP trains in Cavβ4b and Cavβ2a subunit expressing neurons should also result in faster vesicle recycling (Stevens and
Wesseling, 1998). To test this hypothesis we repeated the experiments described in
Stevens and Wesseling (1998). We first analyzed the recovery of the readily releasable
36 vesicle pool (RRP) after RRP depletion without 20 Hz stimulation trains applied during depletion. No differences were found for the recovery of the RRP regardless whether
Cavβ4b or Cavβ2a subunits were expressed in the neurons (Figure 8A and B). Also the recovery of the EPSC after RRP depletion was not different between neurons expressing or not expressing Cavβ4b and Cavβ2a subunit (Figure 8C and D), suggesting that exogenously expressed Cavβ4b and Cavβ2a subunits most likely do not interfere with the vesicle recycling.
We next analyzed the RRP recovery after 20 Hz stimulation trains were applied during the initial sucrose application (Figure 8E). We confirmed the observation described by Stevens and Wesseling (1998), that the RRP recovery for all neurons analyzed (regardless whether Cavβ subunits were expressed or not) was accelerated by the 20 Hz stimulus train (Figure 8E and F). Interestingly, RRP recovery was faster in
Cavβ4b and Cavβ2a subunit expressing neurons in comparison to control neurons (trec without 20 Hz train stimulation: control = 11.4 s; Cavβ2a 9.1 s; Cavβ4b 12.6 s and trec after 20 Hz train stimulation: control = 4.1 s; Cavβ2a 1.8 s; Cavβ4b 1.6 s), suggesting again that Ca2+ influx into the presynaptic terminal is increased during 20 Hz stimulations trains in Cavβ4b and Cavβ2a subunit expressing neurons.
While the exogenous expression of Cavβ subunits determines the synaptic responses during long AP trains according to the biophysical properties of the assembled
2+ presynaptic Ca channels, the induced facilitation by Cavβ4b during paired-pulses can not be explained by the biophysical properties of presynaptic Ca2+ channel assembled with
37 2+ the Cavβ4b subunit, but may suggest that in the presence of Cavβ4b subunit the Ca dependence of the vesicle release is altered, which may result in a reduced release probability (Thomson, 2000). We therefore compared the release probability of non-infected and Cavβ2a as well as Cavβ4b expressing neurons. The release probability can be examined by comparing the RRP to the number of vesicles elicited by a single AP.
The RRP size is determined by application of a hypertonic sucrose solution (Rosenmund and Stevens, 1996). As shown in Figure 9 we found that the release probability in the presence of Cavβ4b was reduced in comparison to non-infected and Cavβ2a expressing neurons. No differences in the mean RRP and EPSC size where detected between the neurons expressing different Cavβ subunits, probably because only a small number of cells were analyzed.
The relationship between the Ca2+ influx into the presynaptic terminal and the vesicle
2+ release is approximately given by the following equation: vesicle release ∝ [Ca ]Hill
2+ 2+ coefficient, where the Hill coefficient is defined as the Ca cooperativity. The Ca cooperativity in many synapses is high (3-4), indicating that a small change in Ca2+ influx can result in drastic changes in transmitter release. Thus in our experiments the Hill coefficient gives an indirect measure about the Ca2+ influx through presynaptic Ca2+ channels relative to the transmitter release. This means that a change in the number, localization or organization of the presynaptic Ca2+ channels most likely results in a change in the Ca2+ dependence of the transmitter release. Interestingly, in the presence of
2+ the Cavβ4b subunits the Ca dependent transmitter release dose-response curve became
38 shallower, with a small change in the half maximal [Ca2+] concentration (EC50) when compared to wild-type neurons or neurons exogenously expressing Cavβ2a subunits
(Figure 9).
Since the Cavβ4b subunit changed in particular the cooperativity of the transmitter
2+ release, this result may suggest that Cavβ4b is involved in the organization of the Ca channel domains necessary for efficient vesicle release. For example Cavβ4b assembled channels may be further apart from the release machinery. If this is the case, synaptic
2+ transmission in Cavβ4b expressing neurons should be more sensitive to the slow Ca buffer EGTA. Indeed, we found that when 10 mM EGTA was applied intracellularly or
50 µM EGTA-AM extracellularly that the EPSC amplitude was significantly more reduced in Cavβ4b expressing neurons to 60% and 93%, while in Cavβ2a expressing neurons and control neurons the EPSC amplitude was reduced only by 50% and 87-89%
(Figure 9E and F).
The differences in synaptic plasticity observed in the presence of the Cavβ2a and
Cavβ4b subunits might be caused by a change in the expression ratio of N- versus
P/Q-type channels. For example, Reid et al. (1998) observed a decrease in cooperativity in autaptic hippocampal neurons when either the N- or the P/Q-type channels were selectively blocked. Their explanation of this effect was that the distribution of N- and
P/Q-type channels is non-uniform across synaptic terminals, which leads to a shift in the
EC50 in only a subset of synaptic terminals. A mixture of terminals with different EC50 values will broaden the dose response curve and therefore reduce the Hill coefficient.
39 Therefore if Cavβ2a or Cavβ4b would preferentially assemble only with one channel type within the synaptic terminal a change in synaptic plasticity may occur. Thus, we analyzed if the Cavβ2a and Cavβ4b subunits change the relative contribution of the N- and P/Q-type channels to the non-L-type current measured at the soma of the hippocampal neurons. As shown in Figure 11 A and B application of the P/Q-type channel blocker ωCTx-MVIIC reduces the non-L-type current up to 45 % (or 30-35% when the N-type channel blocker
ωCTx-GVIA was first applied) and the remaining current by 90-95% of the original non-L-type current, when the N-type channel blocker ωCTx-GVIA (or P/Q-type channel blocker) is applied regardless of whether Cavβ2a and Cavβ4b are exogenously expressed in the neurons.
We also analyzed if the Cavβ2a and Cavβ4b subunits would change the relative contribution of the N- and P/Q-type channels for synaptic transmission. As shown in
Figure 11 C and D the presence of Cavβ2a or Cavβ4b did not change the percentage of
EPSC block by either toxin. For both N- and P/Q-type channel blockers the remaining
EPSC size was around 30%, which was further reduced by the second blocker to smaller than 10% of the original EPSC amplitude. These results suggest that the Cavβ2a or
Cavβ4b subunits do not affect the relative expression levels of N- and P/Q-type channels in neurons and most likely do not preferentially interact with either of these channel types.
40 Discussion
In this study we investigated the targeting and function of Cavβ subunits in hippocampal neurons. We found that Cavβ2a and Cavβ4b are sufficiently targeted to synaptic sites, where they influence synaptic transmission during long AP trains according to the biophysical properties that these subunits induce in the presynaptic Ca2+
2+ channel. During paired-pulses Cavβ4b subunits also altered the Ca dependence of transmitter release. The physiological consequences and implications of the findings are discussed below.
Targeting of Cavβ subunits to the plasma membrane and synaptic terminals.
We show here that the Cavβ2a and Cavβ4b are targeted to synaptic sites and colocalize with synaptic markers. All Cavβ subunits (exogenously and endogenously expressed) are found to various degrees in cytoplamic and membrane fractions as suggested by overexpression studies of Cavβ subunits in HEK293 cells (Chien et al., 1998). In particular, Cavβ2a subunits are associated with the membrane fraction as predicted from their N-terminal located palmitoylation site (Dolphin, 2003; Herlitze et al., 2003). This is in agreement with previous studies performed in HEK293 cells where palmitoylated
Cavβ2a subunits reach the plasma membrane independently from the Cavα1 subunit
(Bogdanov et al., 2000; Chien et al., 1998). Cavβ2a subunits could also be found on vesicular structures supporting the view that they most likely are associated with Cavα1
41 subunits where they are transported as preassembled channel complexes to synaptic sites
(Ahmari et al., 2000; Shapira et al., 2003). Our studies for Cavβ1b and Cavβ3 reveal that these subunits, when expressed alone, distribute more homogenously in neurons and do not significantly influence the synaptic parameters analyzed. The reason for this could be that Cavβ1b and Cavβ3 are not sufficiently transported to the presynaptic terminals as suggested by (Maximov and Bezprozvanny, 2002). On the other hand, since Cavβ3 is the main mRNA detected in hippocampal neurons, Ca2+ channels could be assembled with
Cavβ3 subunits in most synapses. Therefore the biophysical properties of the presynaptic
2+ Ca channels would not be affected by either Cavβ1b or Cavβ3, since the biophysical differences of channels assembled with these subunits are small.
Cavβ subunits may determine synaptic plasticity during longer AP trains due to the effects on the inactivation properties of the presynaptic Ca2+ channel complexes.
Cavβ in particular determines the time course of inactivation of high voltage activated Ca2+ channels. How P/Q-type channels assembled with different Cavβ subunits behave when AP waveforms derived from hippocampal neurons are used as command potentials had not been studied before. Interestingly we did not detect significant differences in the opening of the channels for the first two APs, which would determine the Ca2+ influx into the presynaptic terminal during paired-pulses underlying short-term synaptic plasticity, but found that Cavβ1b and Cavβ3 assembled channels exhibited significant differences in the proportion of channels open after 30 APs or longer trains
42 when compared to the Cavβ2a and Cavβ4b assembled channels (20 Hz, Figure 5D).
We have to point out that the determination of the biophysical properties of the
P/Q-type channel in HEK293 cells cannot directly be compared to the effects these subunits have on the native presynaptic Ca2+ channels. For example Tottene et al. (2002)
(Tottene et al., 2002) showed that the maximal current amplitude (when the peak current was analyzed with voltage step protocols) of the pore-forming human Cavα12.1 subunit expressed in neurons from Cavα12.1 knock-out mice was shifted by -20 mV when
compared to the same channel subunit coexpressed with Cavα2δ and Cavβ2e in HEK293 cells. A similar shift in the maximal current amplitude was seen in our experiments when
we compared the voltage ramps of rat Cavα12.1, Cavα2δ, Cavβ2a, 4b assembled channels in HEK293s with the non-L-type currents elicited by voltage ramps in non-infected or
Cavβ subunit infected neurons. This indicates that non-L-type currents in neurons differ in their biophysical properties probably because of cell-type specific interacting proteins and variations as well as combinations of splice variants contributing to the non-L-type current. The differences in channel opening and therefore Ca2+ influx correlate well with the observed effects Cavβ subunits have on synaptic depression, asynchronous release and activity dependent RRP recovery.
Synaptic depression can be achieved via various cellular mechanisms. Therefore an increase in Ca2+ influx leading to faster vesicle depletion is only one possibility (Zucker and Regehr, 2002). Synaptic depression can also be independent of vesicle depletion. For example, a decrease in presynaptic Ca2+ influx into the Calyx of Held is the major cause
43 of synaptic depression at this synapse type (Xu and Wu, 2005). In addition, a reduction in the AP amplitude during high repetitive firing (> 20 Hz) has been correlated with a reduction in the transmitter release (Brody and Yue, 2000). Since we did not observe any change in the AP amplitude, a decline in AP amplitude is most likely not involved in the depression effects observed (Figure 10). Since our synaptic terminals are too small to directly record the Ca2+ influx, we cannot exclude the possibility that the presynaptic
Ca2+ influx into the terminal is reduced. However, the decrease in channel inactivation in particular for Cavβ2a subunit assembled channels correlated with the faster RRP recovery and faster onset of asynchronous release does not agree with this mechanism, but rather suggests a larger Ca2+ influx into the presynaptic terminal.
Cavβ 4b subunits change the cooperativity of transmitter release
Exogenous expression of Cavβ4b subunits induced PPF. PPF occurs at low release probability synapses during high frequency stimulation and is associated with a restricted
Ca2+ influx during the first AP accompanied by a build-up in presynaptic Ca2+ concentration and thus an increase in the synaptic release probability once the second AP reaches the presynaptic terminal (Thomson, 2000; Zucker and Regehr, 2002). To analyze whether the increase in PPR in the presence of Cavβ4b subunits could account for a reduction in channel opening caused by Cavβ4b, we examined the possibility of detecting differences in the amount of channels opened by a hippocampal AP. We could not detect significant differences between the Cavβ assembled channels during the paired-pulse
44 protocol used.
To provide an explanation for the facilitation behavior of Cavβ4b expressing synapses we analyzed several parameters including the Ca2+ dependence of the transmitter release, the effect of the expression of Cavβ subunits on the contribution of N- and P/Q-type channels to synaptic transmission and somatic non-L-type currents. We found that the
2+ expression of Cavβ4b changes the shape of the Ca response curve, which is most likely not correlated with a change in the ratio between the P/Q or N-type channel or a Cavβ4b channel specific effect on the terminal (Figure 11). This result suggests that, in the
2+ presence of Cavβ4b subunits at the presynaptic terminal, the cooperativity of the Ca dependent transmitter release is changed. Recently, the cooperativity of the transmitter release was determined using the same rat hippocampal autapse system. The cooperativity was estimated to around 3 (Reid et al., 1998), a value which we determined and confirmed in our study of wild-type and Cavβ2a expressing neurons. The authors did not find a difference in the contribution between N- or P/Q-type channels. This is important to note since Cavβ4 could preferentially assemble with one or the other channel type. The preferential assembly with N- or P/Q-type channels would have for example important implications for the synaptic transmission at the Calyx of Held, where N-type channels are suggested to be further apart from the release site than P/Q-type channels
(Wu et al., 1999). The change in cooperativity in the presence of Cavβ4b subunits may suggests that the coupling between the Ca2+ channels and the release machinery is affected or that the Ca2+ channels are more distant from the release site. The idea is
45 supported by our finding that Cavβ4b expressing neurons are more sensitive to the slow
Ca2+ chelator EGTA. This is an important finding given the recent observation that the
N-terminus of the Cavβ4a subunit can bind synaptotagmin and the microtubule-associated protein 1A (Vendel et al., 2006). This raises the possibility that the Cavβ4a subunit is
2+ creating a Cavβ subunit specific anchor between the Ca channel and the synaptic release machinery (Weiss, 2006), while the Cavβ4b subunit would not. Therefore Cavβ4b subunit assembled channels might be further apart from the release machinery, which may cause the change in the Ca2+ response curve. In fact, it has been suggested recently that the recruitment and placement of the synaptic vesicles to sites where Ca2+ channel cluster are important for rapid neurotransmitter release (Wadel et al., 2007).
Physiological consequences of neuronal Ca2+ channels assembled with different
Cavβ subunits.
Cavβ subunit specific effects on synaptic transmitter release, i.e. facilitation and/or depression will arise if a certain subunit is abundant in a neuronal circuit or synapse. For example in the thalamus, a brain region, which is critical for seizure activity, high expression levels of Cavβ4 subunits are found, while Cavβ1-3 subunits seem to be absent or at a lower abundance (Burgess and Noebels, 1999; Tanaka et al., 1995). Loss of Cavβ4 subunit function results in absence seizure epilepsy correlated with a reduced excitatory synaptic transmission in the thalamus (Caddick et al., 1999). Cavβ2 subunits have been suggested to play a crucial role for Cav1.4 function at the ribbon synapse of the outer
46 plexiform layer of the retina, where these channels mediate glutamate release, while the role of Cavβ2 within the brain is poorly understood. Since Cavβ subunits are targets of protein phosphorylation and regulate the trafficking of the Ca2+ channels (Dolphin, 2003;
Herlitze et al., 2003), it can be expected that activity dependent trafficking of specific
Cavβ subtypes in and out of synaptic terminals may occur as an important mechanism for regulation of synaptic plasticity within a presynaptic terminal.
47 Figures
48
49 Figure 1. Endogenous distribution and expression of Cavβ subunits in cultured hippocampal neurons.
(A-C) (A, green) Confocal pictures of the endogenous Cavβ subunits detected with a pan-β antibody reveal punctate staining. (B, red) Hippocampal neurons were stained with an anti-synaptobrevin-II antibody and visualized with an Alexa 546-coupled secondary antibody. (C) Overlay of A and B demonstrates that the endogenous Cavβ subunits are partially colocalized with the synaptic vesicle marker synaptobrevin-II (bar = 25 µm).
(Right) Indicated areas from left pictures show that several pan-staining puncta are co-localized with synaptobrevin-II (arrows). (Right pictures in A-C) blow up of the indicated areas from the neuron shown on the left. (D) Cavβ subunits colocalize with the synaptic marker synapsin-I. Confocal images of the endogenous Cavβ subunits in hippocampal neurons visualized with the pan-β antibody (left), synapsin-I visualized with an anti-synapsin-I antibody (middle), and overlay of the two pictures (right) reveal that endogenous Cavβ subunits partially colocalize with the presynaptic marker synapsin-I (bar = 5 µm). (E) Endogenous Cavβ subunit mRNAs are expressed at different levels in cultured hippocampal neurons. The mRNA expression levels of Cavβ2a,3 and 4b were normalized to the mRNA level of the Cavβ1b subunit. The bar graph shows that the
Cavβ3 mRNA level was about 3 times higher than Cavβ1b, while the Cavβ2a expression level was about 50% lower (n = 12. *: P < 0.01) in comparison to Cavβ1b. The mRNA expression level for Cavb4b was not significantly different from that of Cavβ1b.
50
51 Figure 2. Exogenously expressed Cavβ 1-4 subunits distribute in different patterns in hippocampal neurons and colocalize to various degrees with presynaptic marker proteins. (A) Fluorescence pattern of neurons from low density hippocampal cultures infected with the indicated GFP-tagged Cavβ subunit (i.e. Cavβ1-4) reveal either a punctate
(Cavβ2a and 4b) or a more diffuse, cytosolic staining (Cavβ1b and 3). Bar = 15 µm. (B)
Increased magnification of hippocampal neurites reveal that Cavβ2a and 4b are clustered, while Cavβ1b and 3 are diffusely distributed. Bar = 2 µm. (C) Quantification of the percentage of transfected neurons showing punctate staining. The bar graph indicates that neurons overexpressing Cavβ2a and 4b mainly reveal punctate staining similar to the endogenous distribution of Cavβ subunits, while the majority of neurons infected with the
Cavβ1b and 3 or GFP alone do not reveal punctate staining. (n = 110-153 for each subunits.
**: P < 0.01 compared with GFP). Quantification of the percentage of transfected neurons showing punctate staining was performed by generating 11 – 13 randomly chosen fields within each group of neurons analyzed. In each field, the number of total infected neurons was counted and the percentage of those showing punctate patterns was calculated. The percentages in each group were then averaged. n is equal to the total number of infected neurons counted (D and E) Cavβ2a and 4b reveal differences in their percentage to colocalize with presynaptic marker proteins. (D) Cultured hippocampal neurons were infected with GFP tagged Cavβ2a and 4b and costained with synaptobrevin-II or synapsin-I (shown in red). Representative confocal images of hippocampal neurites reveal that the fluorescent puncta in Cavβ2a and 4b (in green) expressing neurons reveal a
52 different colocalization percentage with the presynaptic marker (in red). Bar = 2 µm. (E)
Quantification of the GFP puncta containing either Cavβ2a or 4b that colocalize with synaptobrevin-II. Percentage of synaptic colocalization is given as the number of Cavb
GFP puncta, which colocalized with the number of synpatobrevin-II puncta relative to the amount of GFP puncta within the region of interest analyzed (n = 20-21. *: P < 0.01).
53
54 Figure 3. Cavβ subunits are found in cytoplasmic and membrane fractions in hippocampal neurons. (A and B) Rat whole brains (P0-P3) were homogenized and fractionated in a discontinuous sucrose gradient. Primary membrane and cytosolic fractions were taken for Western blot analysis. (B) When immuno-blotted with the pan-b antibody, the endogenous Cavβ subunits were mainly located in the membrane fraction, but also found in the cytosolic fraction. (C) Exogenously expressed Cavβ subunits revealed a subunit specific distribution between the cytosolic and membrane fraction.
13-16 hours after infection with Cavβ subunits, 14 DIV hippocampal neurons were harvested, and cell extracts were blotted with anti-GFP antibodies.
55
56 Figure 4. Immuno-electron microscopy reveals that Cavβ 2a and Cavβ 4b subunits are associated with membranes and vesicular structures and targeted to presynaptic terminals in hippocampal neurons. (A-B) Immuno-electron microscopy pictures of 14
DIV autaptic neurons exogenously expressing GFP tagged Cavβ2a (A) or GFP-tagged
Cavβ4b (B) subunits. In neurons expressing Cavβ2a and Cavβ4b subunits gold particles were found attached or close to vesicular structures (arrowheads; bar = 50 nm). (C-D) In adult hippocampal slices, exogenously expressing GFP tagged Cavβ2a (C) and Cavβ4b subunits (D) were found in presynaptic terminals, close to synaptic vesicles and attached to the cell membranes (arrowheads; bar = 50 nm).
57
58 Figure 5. Hippocampal AP wave-form protocols detect differences in the amount of open P/Q-type channels assembled with the different Cavβ subunits during long 20
Hz stimulations but not for paired-pulses. (A) HEK293 cells expressing Cavα12.1,
2+ Cava2d and one of the four Cavβ1b,2a,3 and 4b subunits were held at -60 mV and Ca currents were elicited by a 20 Hz AP train 1 second after a pre-pulse to 100 mV for 10 ms.
This prepulse was given to open approximately 100% of the Ca2+ channels expressed in the cell (top). The tail current elicited by the prepulse was used to relate the tail current elicited by the AP to gain an understanding about the percentage of channels opened by the AP. The example whole-cell currents (top) and the bar graph (bottom) indicate that approximately the same amount of channels were opened by the 1st AP and the 2nd AP for the Cavβ1-4 assembled P/Q-type channels analyzed. (B) Increased time resolution of the underlying current elicited by the AP. The deactivation time of the tail currents can be fitted with a single exponential. Only currents were included and analyzed in the experiments described in A-E, which reveal fast deactivation kinetics and no change in the deactivation kinetics between the first and the last tail current elicited. (C) Examples of P/Q-type channel currents assembled with Cavβ1-4 subunits during a 20 Hz, 30 pulse
AP wave-form train. (D) Relative I-Ca2+ ratio for the P/Q-type channel currents assembled with Cavβ1-4 subunits. The tail current amplitudes were related to the tail current elicited by the first AP. (E) Comparison of the relative amplitude of the tail currents elicited by the 1st and 30th AP during the 20 Hz AP train reveals that currents through P/Q-type channels assembled with Cavβ1b and 3 subunits are relatively smaller than
59 currents through P/Q-type channels assembled with Cavβ2a and 4b. (* P < 0.05; ** P <
0.01).
60
61 Figure 6. Cavβ subunits expressed in hippocampal neurons change the biophysical properties of the endogenous non-L-type channels. (A) The activation of non-L-type channels in hippocampal neurons is shifted to more negative potentials when compared to
P/Q-type channels exogenously expressed in HEK293 cells. (Upper) Example current traces (IV curve) of non-L-type currents from hippocampal neurons in comparison to
currents through P/Q-type channels (Cavα12.1, Cavα2δ, Cavβ4b) expressed in HEK293 cells elicited by 500 ms voltage ramps from -60 to +90 mV. (lower) Diagram of the voltage at which the peak current appears during the voltage ramp for P/Q-type channels expressed in HEK293 cells and non-L-type currents from hippocampal neurons in the presence or absence of Cavβ2a and Cavβ4b subunits. (B) The inactivation properties of non-L-type channels in hippocampal neurons are changed in the presence of Cavβ2a and
Cavβ 4b subunits. (left) Example traces of non-L-type currents elicited by a voltage pulse from -60 mV to 0 mV reveals that in the presence of Cavβ2a and Cavβ4b subunits inactivation is slowed. (right) Diagram of the current change (%) within the 100 ms current trace. Compared were the current at the beginning of the test pulse (10 ms) to the current at the end of the test pulse (95 ms).
62
63 Figure 7. Cavβ subunit specific determination of facilitation and depression in autaptic hippocampal neurons. (A-B) EPSC recordings of autaptic hippocampal neurons exogenously expressing Cavβ2a and Cavβ4b subunits in 4 mM Ca2+. (A)
Representative autaptic EPSC traces from non-infected and Cavβ2a and Cavβ4b subunits infected neurons reveal that in the presence of Cavβ2a and Cavβ4b subunits synaptic depression is increased during long 20 Hz stimulations. Grey area represents the asynchronous release. (B) Bar graph of the quantified EPSC ratios of Cavβ2a and Cavβ4b subunits infected and non-infected neurons. Compared were the EPSC amplitudes of the
1st and 2nd EPSC (upper), the 1st and the average from the 27-30th EPSC (middle) and the largest EPSC during a train and the average from the 27-30th EPSC (lower). (C)
Relative EPSCs for Cavβ2a and Cavβ4b infected and non-infected neurons. The EPSC amplitudes during the 20 Hz pulse train were related to the EPSC elicited by the first pulse. The decline in EPSC amplitude could be fitted with a single exponential starting from the largest EPSC within the pulse train. (D) Bar graph of the average maximal
EPSC amplitude of Cavβ2a and Cavβ4b subunits infected and non-infected neurons during a 20 Hz pulse train. (E-F) Comparison of the RRP before and after 30 2 ms long pulses to
+10 mV (20 Hz stimulation). (E) Example traces of sucrose responses before (P2) and after the 20 Hz stimulation (P1). (F) Relative pool size for Cavβ2a and Cavβ4b infected and non-infected neurons. The relative pool size was determined by the ratio between the sucrose response after the 20 Hz stimulation (P1) and the sucrose response before the stimulation (P2). (G) Time course of asynchronous release during a 20 Hz pulse train.
64 Compared were the charge of the largest EPSC (EPSCmax) within the 20 Hz train to the charge of the asynchronous release for each EPSC. (H) Bar graph of the quantified total charge during a 20 Hz stimulation protocol for the phasic release and asynchronous release for Cavβ2a and Cavβ4b infected and non-infected neurons. The average values of time course of depression (C) and the asynchronous release (G) were fitted with a single exponential and the time constants for each fit and the number of experiments (in parenthesis) are given in the diagrams. (* P < 0.05; ** P < 0.01)
65
66 Figure 8. Cavβ 2a and Cavβ 4b subunits expressed in hippocampal neurons accelerate the recovery of the readily releasable pool when trains of APs have been evoked previously. To evaluate whether Cavβ2a and Cavβ4b subunits affect vesicle recycling we analyzed the recovery of the RRP and the EPSC after RRP depletion. The RRP was measured by applying hypertonic solution (500 mM sucrose) for 4 s. (A) Example traces of the time dependent RRP recovery. (B) Time course of the recovery of the RRP. There were no significant differences in the time course of RRP recovery between Cavβ2a,
Cavβ4b expressing and non-expressing neurons. (C) Example traces of the EPSC recovery after RRP depletion. (D) Time course of the recovery of the EPSC after RRP depletion. EPSCs were elicited by a 2 ms test pulse to 10mV. (E) Example traces of the time dependent RRP recovery when 20 stimulus trains have been evoked for 1 s at the end of the first sucrose application. (F) Time course of the recovery of the RRP reveals that in the presence of Cavβ2a and Cavβ4b the RRP recovery is faster. The relative recovery of the RRP and the EPSC was calculated by comparing the sucrose or EPSC response following the initial sucrose response to the initial (first) response. For RRP recovery in E and F the sucrose response after the first depletion (P1) was compared to the sucrose response 30 s after the second sucrose response (P2). The interpulse intervals are given in A, C and E. The average values of the recovery of the RRPs and EPSCs shown in B, D and F were fitted with a single exponential and the time constant for each fit are given in the diagram. Number of experiments are given in parenthesis.
67
68 Figure 9. Cavβ4b subunits expressed in hippocampal neurons reduce the synaptic release probability, change the Ca2+ dependent transmitter release and are more sensitive to EGTA. (A) (Left) Representative EPSC traces evoked by 2 ms depolarizing pulses form -60 mV to 10 mV are shown for non-infected and Cavβ2a and Cavβ4b infected neurons. (Right) Representative traces of the hypertonically mediated release of quanta from the same neuron shown on the left upon application of 500 mM sucrose for 4 s. (B)
Probability of synaptic vesicle release was evaluated by calculating the ratio of release evoked by the AP to that evoked by hypertonic sucrose. In autaptic neurons infected with
Cavβ4b the vesicular release probability is significantly reduced compared with non-infected or Cavβ2a subunit infected neurons (*p < 0.05). Error bars = SEM. (C)
Representative EPSC traces elicited by application of increasing extracellular Ca2+ concentrations of autaptic hippocampal neurons expressing Cavβ4b subunits. (D) Dose response curve of the EPSC amplitude by increasing extracellular Ca2+ concentrations.
2+ The Ca dependent EPSC responses of non-infected, Cavβ4b or Cavβ2a infected neurons were free fitted according to the Hill equation (EPSC =
2+ EPSCmaximal/(1+(EC50/[Ca ]o)Hill coefficient). The EPSCs were then normalized to the maximal EPSC given by each fit. The average normalized EPSCs for the given Ca2+ concentrations are shown. The curves again were fitted according to the Hill equation.
The Hill coefficients are 2.7 ± 0.4 for control and Cavβ2a infected neurons and 1.9 ± 0.4 for Cavβ4b infected neurons. (E) Representative EPSC traces before and after 50 µM
EGTA-AM application evoked by two 2 ms depolarizing pulses from -60 mV to 10 mV
69 within 50 ms are shown for non-infected and Cavβ2a and Cavβ4b infected neurons. (F) Bar graph of the remaining EPSC amplitude after 10 mM EGTA was applied intracellularly for 20 min (upper graph) and after 50 µM EGTA-AM was applied extracellularly for 15 min (lower graph).
70
71 Figure 10. The AP amplitude during 20 Hz stimulations is not reduced in non-infected or Cavβ 2a and Cavβ4b subunits expressing hippocampal neurons. (A)
(Left) Representative AP train traces evoked by 2 ms long 200 pA current injections of non-infected or Cavβ2a and Cavβ4b subunits expressing hippocampal neurons. (B) Bar graph of the comparison of the AP amplitude during the AP train. The second AP and the
30th AP amplitude was compared to the 1st AP amplitude of non-infected or Cavβ2a and
Cavβ4b subunits expressing hippocampal neurons. There was not reduced in the AP amplitude. The action potentials were stimulated by injection of 300 pA current pulses lasting 2 ms at the frequency of 20 Hz.
72
73 Figure 11. Cavβ subunits expressed in hippocampal neurons do not change the relative contribution of N- and P/Q-type channels to non-L-type currents and
EPSCs. (A and B) The relative distribution of N- and P/Q-type Ca2+ currents to the
2+ non-L-type Ca current is not altered by Cavβ2a and Cavβ4b subunits exogenously expressed in hippocampal neurons. (A) Example current traces (IV curve) of non-L-type currents from hippocampal neurons reveal that application of the P/Q-type channel blocker ωCTX-MVIIC and the N-type channel blocker ωCTX-GVIA does not reveal differences in the relative contribution of these two channel types to the non-L-type Ca2+ current in the presence or absence of exogenously expressed Cavβ2a and Cavβ4b subunits.
(B) Diagram of the remaining non-L-type Ca2+ current in percent after blocking first
P/Q-type channels and then N-type channels (left) and after blocking first N-type channels and then P/Q-type channels (right). (C and D) The relative contribution of N-
2+ and P/Q-type Ca channels to the EPSC amplitude is not altered by Cavβ2a and Cavβ4b subunits exogenously expressed in hippocampal neurons. (C) Example EPSC traces from autaptic hippocampal neurons reveal that application of the P/Q-type channel blocker
ωCTX-MVIIC and the N-type channel blocker ωCTX-GVIA does not reveal differences in the relative contribution of these two channel types to the EPSC amplitude in the presence or absence of exogenously expressed Cavβ2a and Cavβ4b subunits. (D) Diagram of the remaining EPSC amplitude in percent after blocking first P/Q-type channels and then N-type channels (left) and after blocking first N-type channels and then P/Q-type channels (right). In these experiments, the external solutions containing 2 µM
74 ω-conotoxin MVIIC (w-CTx-MVIIC) or 3 µM ω-conotoxin GVIA (CTx-GVIA) were applied directly onto the autaptic neurons by using a fast-flow perfusion system (ALA
Scientific Instruments) during the ramps. The coverslips and the external solutions were used only once when the toxins were applied.
75
76 Figure 12. The N-terminus of Cavβ4b interferes with synaptic transmitter release in hippocampal neurons. (A) Representative autaptic EPSC traces from non-infected and neurons infected with the N-terminus of Cavβ4b (Cavβ4b-NT) reveal that in the presence of
Cavβ4b-NT synaptic depression is increased, phasic and asynchronous release are reduced and no paired-pulse facilitation is observed during long 20 Hz stimulations (grey area represents the asynchronous release). (B) Comparison of the average maximal EPSC amplitude reveals that in the presence of Cavβ4b-NT EPSCmax is reduced. (C) Bar graph of the quantified EPSC ratios of Cavβ4b-NT infected and non-infected neurons. Compared were the EPSC amplitudes of the 1st and 2nd EPSC (upper), the 1st and the average from the 27-30th EPSC (middle) and the largest EPSC during a train and the average from the
27-30th EPSC (lower). The data show that Cavβ4b-NT infected neurons do not show PPF, but reveal an increased depression. (D) Time course of asynchronous release during a 20
Hz pulse train. Compared were the charge of the largest EPSC (EPSCmax) within the 20
Hz train to the charge of the asynchronous release for each EPSC. The experiments reveal that in the presence of Cavβ4b-NT asynchronous release is reduced. The average time course values of the asynchronous release were fitted with a single exponential. The time constant for each fit and the number of experiments (in parenthesis) are given in the diagrams. (E) Bar graph of the quantified total charge during a 20 Hz stimulation protocol for the phasic release and asynchronous release for Cavβ4b-NT infected and non-infected neurons. The data show that in the presence of Cavβ4b-NT, phasic as well as asynchronous release is reduced. Phasic and asynchronous release were calculated
77 according to Otsu et al. (2004). (F-G) To evaluate whether Cavβ4b-NT affects vesicle recycling, we analyzed the recovery of the EPSC after RRP depletion. The RRP was depleted by applying hypertonic solution (500 mM sucrose) for 4 s. (F) Example traces of the EPSC recovery after RRP depletion. (G) Time course of the recovery of the EPSC after RRP depletion. EPSCs were elicited by a 2 ms test pulse to +10mV. The experiments reveal that the EPSC recovery after RRP depletion is much slower in the presence of Cavβ4b-NT.
78 Chapter 3: The Human P/Q-type Channel C-terminus Underlying SCA6 Forms Cytoplasmic Aggregates, Impairs
Synaptic Transmission And Increases Synapse Number
79 Introduction
P/Q-type Ca2+ channels belong to the family of voltage gated Ca2+ channels. They participate in neurotransmitter release in many central synapses (Catterall, 2000).
Numerous miss-sense mutations in the P/Q-type Ca2+ channel sequence have been identified to date in both mouse and human that are linked to neurological defects
(Pietrobon, 2005). In the human, mutations of the P/Q-type Ca2+ channel sequence leads to dominantly inherited neurological diseases that manifest as migraines in Familial
Hemiplegic migraine (FHM-1), episodic ataxia and epilepsy in Episodic ataxia type 2
(EA-2), and to pure cerebellar ataxia in Spino-cerebellar ataxia type 6 (SCA6) (Bidaud et al., 2006). In SCA6 an insertion of a pentanucleotide sequence (GGCAG) introduced by alternative splicing results in a frame shift that allows the incorporation of an additional exon (exon 47) in the sequence. The resulting P/Q-type Ca2+ channel splice variant will express a novel distal CT domain, which contains a stretch of glutamine residues
(Zhuchenko et al., 1997). Familial studies have correlated the length of the polyQ stretch with neuronal dysfunction and degeneration (Zoghbi and Orr, 2000). Progressive ataxia and neuronal degeneration with predominant loss of Purkinje cells are hallmarks of SCA6, and occur only in individuals carrying polyQ stretches of 21-30 residues (Mantuano et al.,
2003).
While the mutations involved in FHM-1 and EA2 result in gain and loss of channel function respectively, the changes produced by SCA6 mutations are not clear. Findings
80 that support a gain of function induced by SCA6 mutations include changes in channel density accompanied with an increase in a degradation product of the channel (Bidaud et al., 2006). This hypothesis is in particular interesting, since the CT domain of the
Cavα12.1 subunit is susceptible to proteolytic processing (Kordasiewicz et al., 2006;
Kubodera et al., 2003). These findings were based on studies where the Cavα12.1 subunits were expressed in HEK-293 cells and revealed the presence of 60-75 kDa peptides that could be recognized by an antibody to the CT domain (Kubodera et al.,
2003). Furthermore, a difference in the stability of the proteolytic products were observed when subunits carrying 11 and 27 polyQ residues were compared (Kubodera et al., 2003).
In addition, using CT recognizing antibodies, antibody staining was detected in nuclei from human and mouse cerebellar Purkinje cells but also occurred in the cytoplasm
(Kordasiewicz et al., 2006). The CT containing the polyQ stretch induced cell death, which was dependent on its nuclear localization (Kordasiewicz et al., 2006). These results suggest that a degeneration product of the P/Q-type channel, the polyQ CT domain, might localize to the nucleus in Purkinje cells and at a later time point contribute to Purkinje cell degeneration. However, an important question to address is whether there are any physiological consequences of the polyQ CT degeneration product on neuronal function before cell death. Could the effect of CTs on neuronal physiology explain the first signs of ataxia seen in SCA6 patients?
Effects on the physiology are plausible, since the CT contains binding sites for proteins involved in Ca2+ channel targeting, modulation, clustering, and tethering to the
81 vesicle release machinery. Therefore accumulation of a CT degradation product could induce dominant negative effects on these parameters (Herlitze et al., 2003; Spafford and
Zamponi, 2003). In more detail, Mint-1 and CASK form part of a scaffolding system important in the targeting and clustering of N-type channels to synaptic terminals
(Maximov and Bezprozvanny, 2002; Maximov et al., 1999). These interactions are expected to play a role in P/Q-type Ca2+ channel targeting as the consensus sequences are conserved within the novel distal CT. A novel interaction has also been described with a protein from the dynein motor complex. The t-complex testis expressed-1 protein (tctex-1) is a light chain subunit of the dynein motor complex that participates in both retrograde and anterograde channel transport via interaction with a consensus sequence within the proximal CT of the P/Q-type Ca2+ channel (Lai et al., 2005). Besides the interactions with
β subunits via the loop I-II, that are known to aid in the delivery of Cavα12.1 for sufficient membrane expression, the proximal CT engages in secondary interactions with
β4 and β2 subunits (Herlitze et al., 2003).
The multiple interaction sites within the CT domain of the P/Q-type Ca2+ channels make it a critical domain for the regulation of channel targeting to the membrane and synapses. Decreased clustering and current density of the channels has been demonstrated by the use of peptides that out-compete the interactions with Mint-1, CASK and tctex-1
(Lai et al., 2005; Spafford et al., 2003). The CT also contains binding sites for proteins involved in synaptic transmitter release, including the Rim binding proteins (Hibino et al.,
2002; Shapira et al., 2003). Interestingly, RIM, Cavα1 and Cavβ have been shown to be
82 part of Piccolo-Bassoon transport vesicles (PTVs) (Shapira et al., 2003), suggesting that the Ca2+ channel is part of preformed presynaptic terminals. Therefore, high concentrations of the CT degradation products, which contain binding sites for proteins involved in channel trafficking, localization, synapse assembly and transmitter release in neurons will most likely interfere with these events.
Here we present findings from studies in which the short CT domain of the Cavα12.1 subunit (ending at exon 46) and the long CT isoform (ending at exon 47 and containing
27 polyQ residues) were expressed in autaptic hippocampal neuronal cultures. Our results reveal dominant negative effects on synaptic transmission and the clustering of the CTs in nuclear inclusions and cytoplasmic aggregates, which have also been observed in
SCA6 patients. More importantly, our findings show that expression of the CT constructs containing the long isoform induce membrane and synapse assembly. These experiments are important in two ways. First, they reveal that neuronal function is perturbed before neuronal degeneration and second they provide an explanation for the survival of nucleo-olivary pathways in SCA6, the downstream pathway of Purkinje cells, which degenerates in other SCAs.
83 Material and methods
Plasmid Constructs and Viral Preparation: The constructs for the human Cavα12.1 subunit corresponding to short or long isoforms were a generous gift of Dr. Cheng Chi
Lee (University of Texas-Houston Medical School). The Cavα12.1 short ends at exon 46, while the long isoforms contain an additional pentanucleotide sequence prior to the stop codon (GGCAG) inducing a frameshift. The long isoforms therefore express the additional exon 47. Two long isoforms were studied containing either 12 or 27 polyQ stretches encoded within the exon 47 sequence. The full-length Cavα12.1 subunits were cloned from the original vectors into pcDNA3.1+ via BamHI-XbaI sites and encodes the last 550 amino acids from the P/Q-type channels. From the Cavα12.1 subunit full-length sequences the carboxy terminals (CT) were excised via BglII-XhoI sites, cloned into pEYFP-C2 and the YFP tagged CT was inserted into the pSinRep5 sindbis virus vector.
The pSinRep5 vector was a generous gift of Dr. R Malinow, Cold Spring Harbor, NY.
From the cDNA for the various CT constructs, capped mRNA was synthesized by in vitro transcription with Sp6 RNA polymerase (Roche). The mRNA was extracted by standard procedures using Phenol:Chlorophorm followed by ethanol precipitation. The purified mRNA was electroporated into BHK cells at 400 V, 975µF in a Bio-Rad electroporator. For electroporation BHK cells were grown to confluency in GMEM
(Gibco) supplemented with 3.5% FCS, 10% Tryptose Phosphate Broth, 20 mM HEPES
(pH7.25 stock) and 10 mg/mL Penicillin/Streptomycin (P/S). For electroporation 8X106
84 cells were resuspended in a final volume of 800 µL Opti-MEM (Gibco). Cells were plated in flasks containing the supplemented GMEM and allowed to express the Cavα12.1
CT constructs for at least 24 hours prior to harvesting the virus. The supernatant was collected in small aliquots flash frozen with liquid nitrogen and stored at –80oC. For infection of hippocampal neurons aliquots were thawed at room temperature and added to the cells without changing the culture medium.
Neuronal Hippocampal cultures: Hippocampal neurons were harvested from P0-P3
Sprague-Dawley rats and grown as autapses. Briefly, coverslips were coated with 0.2%
Agarose Type II-A (Sigma) and allowed to dry. For microdots 0.5mg/mL Poly-D-Lysine
(Sigma), collagen (Collaborative Biomedical Products) and 17mM acetic acid were mixed in a 1:1:3 ratio and the mixture used to stamp the agarose coated coverslips. Pure astrocytes cultures were used to form microisland in the coated coverslips. For this, new astrocytes (P0) were kept in cultured in DMEM (Gibco) supplemented with 10%FBS and
0.1% Penicillin/Streptomycin. Astrocytes were shaken at 200rpm overnight several times prior to reaching 80-90% confluency. This was repeated through an additional passage and 12-15X106 (P2) astrocytes were generally used per coverslip to form microislands.
Once astrocytes formed a single cell and uniform layer over the stamped PDL:Collagen dots, hippocampal neurons were plated at 2-4 × 106 cells per coverslip to increase the odds of a single neuron per microisland. Neurons were kept for 12-14days in Neurobasal
85 A (Gibco) supplemented with 2% B27 (Gibco), 1% Glutamax (Gibco) and 0.2%
Penicillin/Streptomycin prior to recordings.
Microscopy and image analysis: The distribution of the YFP tagged Cavα12.1 CT proteins in hippocampal neurons was analyzed on an LSM510 confocal microscope
(Zeiss) using a 63x oil Plan Apo NA 1.4 objective. YFP fluorescence was detected by excitation with an argon laser (laser line 514nm). Slow-fade with Dapi (Molecular Probes) was used as mounting medium to label the nuclei of hippocampal neurons and was detected by excitation with a Diode laser at 405nm. To determine whether the Cavα12.1
CT expression could be found in presynaptic terminals a primary antibody to the presynaptic marker synapsin, Rabbit anti-synapsin 1:400 (Invitrogen) was used.
Detection of synapsin was by a Cy5 labeled goat to rabbit secondary antibody 1:1000
(Invitrogen). For confocal anlysis the Cy5 fluorescence was detected by excitation with an HeNe laser at 633nm. To determine the colocalization between CTs and Piccolo, a
Piccolo antibody was used (1:200) (Synaptic Systems, Goettingen, Germany) and visualized by an Alexa Fluor 546 labeld goat anti-rabbit IgG (1:1000) (Molecular Probes).
For immunostaining neurons were fixed for 10 minutes with a 4% formaldehyde solution
(Sigma) in PBS. Neurons were permeabilized for 30 minutes with 0.2%Triton (Sigma) and 10% Goat serum (Invitrogen) in PBS. Antibody buffer, 2% BSA in PBS was used for washing steps and for dilution of primary and secondary antibodies as described above.
Incubation with each antibody was for one hour and was followed by a final washing step
86 with PBS. Coverslips were mounted with Slow Fade Dapi and left at room temperature overnight. For long-term storage sealed coverslips were kept at 4oC. DAPI and CT YFP fluorescence was also detected on the upright Leica DMSFA using a 63x water objective
(NA 1.2) coupled to a DG5 light source (Sutter). The following Chroma filter sets were used (excitation // dichroic // emission): DAPI: D350/50x // 400DCLP // D460/50M; YFP;
HQ500/20s // Q515LP // HQ535/30m. Image analysis and deconvolution of images was performed using Volocity software.
Electrophysiology: To determine the effects of CT expression on non-L-type Ca2+ channel currents hippocampal neurons were grown as low-density cultures and used for recordings at 10-12 DIV. For these experiments the extracellular solution contained in mM: 128 sodium chloride, 5 potassium chloride, 5 barium chloride, 1 magnesium chloride, 10 Hepes, 10 TEA-Cl, 10 glucose, pH 7.3. The pipet solution contained in mM:
108 CsCl, 4.5 MgCl2, 10 EGTA, 25 Hepes, 4 sodium ATP and 0.3 sodium GTP, pH 7.2.
Ca2+ currents were recorded in the presence of TTX (0.5mM) to block sodium currents and the L-type Ca2+ channel blocker nifedipine (1µM).
Hippocampal neuron autapses were used for recordings of EPSCs. For this, neurons were allowed to grow and form synaptic connections for 12-14 days in vitro. Only single autaptic neurons were used for measurement of EPSCs. The pipet solution contained in mM: 145 potassium gluconate, 15 Hepes, 1 potassium EGTA, 4 sodium ATP and 0.4 sodium GTP, pH 7.3. The extracellular solution contained in mM: 172 sodium chloride,
87 2.4 potassium chloride, 10 Hepes, 10 glucose, 4 calcium chloride, 4 magnesium chloride, pH 7.3. EPSC were recorded following stimulation with 10 mV at 0.2 Hz. To determine the Ca2+ dependence for neurotransmitter release the concentration of Ca2+ in the extracellular solution was rapidly increased by the use of a perfusion system (Sutter
Instruments). The Ca2+ concentrations analyzed were in 0.4, 0.8, 1.2, 1.6, 2, 2.5, 3, 5, 7 and 10 mM. For repetitive stimulation, neurons received 30 pulses of 10 mV at 20 Hz.
To reduce vesicle depletion in experiments of Figure 4, 0.03 mM cadmium chloride was added to the external solution. To determine the size of the readily releasable pool (RRP)
and the probability of vesicular release (Pvr), the 10mV stimulation was applied to elicit an EPSC, this was followed by application of hypertonic sucrose solution 500mM, provided via a fast-flow perfusion system (ALA Scientific Instruments) for a period of
4sec. The ratio of the EPSCs elicited by the 10mV stimulation (Pr) and the EPSC elicited by the sucrose pulse (RRP) was calculated and corresponds to Pvr.
All experiments were approved by the institutional Animal Research Facility.
88 Results
CT-short forms exclusively nuclear inclusions, while CT-long also forms cytoplasmic aggregates in HEK 293 cells and hippocampal neurons.
PolyQ diseases are characterized by protein aggregations within the nucleus (nuclear inclusions) and cytoplasm (cytoplasmic aggregates). Interestingly, SCA6 patients reveal cytoplasmic aggregates with few nuclear inclusions found in cerebellar neurons
(Ishikawa et al., 2001; Ishikawa et al., 1999b; Koeppen, 2005). Recently Kordasiewicz et al. (2006) demonstrated that the CT of the P/Q-type channel is located within the nucleus of mouse and human Purkinje cells (Kordasiewicz et al., 2006). Since the CT of the
Cavα12.1 subunit has been identified as a proteolytic product of the channel
(Kordasiewicz et al., 2006; Kubodera et al., 2003), we analyzed how the 60-75 kDa CT degradation product of the P/Q-type channel Cavα1 subunit might be involved in the early phase of the SCA6 disease, i.e. before neuronal degeneration.
We first examined the distribution of the several CT constructs in HEK293 cells.
These constructs were the short CT without exon 47 (CT-short) and two forms of the long CT (including exon 47, i.e. CT with 12 Gln (CT-12) and 27 Gln (CT-27, “disease form”). The YFP tagged CTs showed a distinct pattern of expression with CT-short distributing predominantly to the nucleus and forming large, immobile nuclear inclusions
(Figure 1A-D and supplemental video). CT-12 and CT-27 distributed to the nucleus and the cytosol, where they formed mobile inclusions (Figure 1A-D). We found three patterns of CT-12/27 distribution, i.e. cells with exclusive nuclear aggregates (see Figure 1B
89 middle, CT-12), cells which revealed nuclear and cytoplasmic aggregates (see Figure 1B right, CT-27) and cells that only had cytoplasmic aggregates. For all CT-12/27 expressing cells the inclusions were consistently of smaller size and number (Figure 1D). This expression pattern was confirmed in hippocampal neurons where CT-short distributed predominantly to the nucleus forming very large aggregates (Figure 2A). Some non-nuclear distribution of CT-short inclusions was also observed (Figure 2B). In contrast to CT-short, the CT-12 and CT-27 showed a clear predominant distribution to the cytosol where they formed numerous inclusions (Figure 2A). The data suggest that possible degradation products of the P/Q-type channel (i.e. the CT-12 and CT-27) form mainly cytoplasmic aggregates in neurons as observed in SCA6 patients, while CT-short would be most likely found in the nucleus of neurons. Since there was no significant difference detected between the CT-12 and CT-27 for the distribution pattern in HEK293 cells and hippocampal neurons, we concentrated in the following studies on the characterization of physiological and morphological differences between neurons expressing CT-short and the disease form CT-27.
Dominant negative effects of CT-short and CT-27 on synaptic transmission in autaptic hippocampal neurons.
The CT domain of the P/Q-type Ca2+ channel consists of binding domains for proteins involved in modulation, targeting and structural organization of the channel complex in subcellular domains (Herlitze et al., 2003; Spafford et al., 2003). A CT
90 degradation product in neurons would therefore be expected to produce dominant negative effects on these parameters before the neuron degenerates. In particular
P/Q-type channels are tightly coupled to the transmitter release machinery. We therefore first characterized autaptic hippocampal neurons expressing CT-short and CT-27 for changes in parameters of transmitter release.
CT-short and CT-27 shift the Ca2+ dependence of neurotransmitter release to higher
Ca2+ concentrations.
Based on the supra-linear relationship between Ca2+ influx and neurotransmitter release, a small change in Ca2+ influx into the presynaptic terminal should have a significant influence on the probability of release (Sabatini and Regehr, 1999). The precise targeting of the endogenous channels to presynaptic terminals and the anchoring of the channel to the vesicle release machinery may be affected by expression of the CT constructs. Therefore, due to the potential disruption of Mint-1 and CASK interactions, the Ca2+ dependence of neurotransmitter release was measured. Neurons were stimulated by 10 mV test pulses with a frequency of 0.2 Hz while perfused with external solutions
containing 0.2-10 mM CaCl2. An example of the EPSC elicited by this protocol is shown in Figure 3A for neurons expressing CT-27. The amplitude of the elicited EPSC was normalized to compare the Ca2+ dependence of neurotransmitter release in control,
CT-short and CT-27 expressing neurons (Figure3B). Expression of CT-short and CT-27 induced a shift in the EC50 to higher Ca2+ concentrations. This suggests that the small
91 reduction in endogenous Ca2+ current densities was sufficient to induce changes in the release probability. However, alternative effects of the CT domains on the proper targeting of the endogenous Ca2+ channels thereby resulting in a decreased number of channels next to the release machinery, or on the coupling of the channel to the release machinery can not be excluded. Since CT-short was mainly localized to the nucleus the result also suggests that very small amount of the CT outside the nucleus is sufficient to cause this effect.
Repetitive stimulation induces depression in CT-short and CT-27 expressing hippocampal neurons via reducing the release probability.
The shift in the Ca2+ dependence of transmitter release to higher Ca2+ concentrations predicts that synaptic plasticity must be altered. Considering our results it is reasonable to expect that synapses in neurons expressing these constructs will show facilitation
(Thomson, 2000). This will be especially true if the shift in Ca2+ dependence relates directly to decreased Ca2+ influx, which would be expected if the number of Ca2+ channels at the synaptic release site were reduced or if the distance of the channel relative to the release site was increased by the CT peptides. Surprisingly, we found that these synapses do not exhibit more facilitation than those of control neurons when comparing synaptic responses to the first two stimuli of the 20 Hz train (Figure 4C, left). However, with subsequent stimuli the synapses undergo significant depression (Figure 4C, middle and right). (Note, these experiments were performed with 30 µM Cd2+ in the
92 extracellular solution to reduce vesicle depletion during long stimulus trains). The results suggest that the CT act downstream of the presynaptic Ca2+ channels most likely directly at the synaptic transmitter release machinery to interfere with the vesicle release process.
To elucidate the possible mechanism behind this depression effect we conducted hypertonic sucrose experiments. These experiments allowed us to address how the
probability of vesicular release (Pvr) and the size of the releasable pool may have been changed by CT-short and CT-27 expression. The EPSC charge elicited by a depolarization to 10 mV was compared to that elicited by a sucrose pulse. Representative currents elicited by depolarization or sucrose application are shown for control and
CT-short expressing neurons (Figure 5A). The probability of vesicular release is calculated from the percentage of charge released by a depolarizing pulse relative to the total ready releasable pool (RRP) as assessed by the sucrose pulse. For both CT-short and
CT-27 expressing neurons the Pvr as well as the RRP size was significantly reduced.
Therefore, synaptic depression at CT expressing synapses can occur because of a reduction in the RRP size. The reduction in RRP size may suggest that the vesicle recycling is perturbed in the presence of CT-short as well as CT-27. We therefore analyzed synaptic vesicle recycling. As indicated in Figure 6 there was no differences in the time course of the vesicle recycling as well as the amount of vesicles recovered, indicating that the dominant negative effects of the CTs on synaptic transmitter release occur before or during the vesicle release.
93 Antagonistic effects of CT-short and CT-27 on membrane capacitance, average
EPSC amplitude and synapse number in cultured hippocampal neurons.
The CT of the presynaptic Ca2+ channel is also involved in Ca2+ channel trafficking
(Herlitze et al., 2003). It has been shown that exogenous expression of the binding domain of tctex1, derived from the N-type channel CT, reduced non-L-type channel expression in hippocampal neurons (Lai et al., 2005). We therefore analyzed whether exogenous expression of the CT-short and CT-27 would interfere with non-L-type channel expression in hippocampal neurons. Therefore, CT-short and CT-27 were expressed in low-density hippocampal cultures. For recordings of Ba2+ currents TTX and the L-type Ca2+ channel blocker nifedipine were added to the extracellular solution at
500 nM and 1 mM, respectively. N-type Ca2+ channels were not blocked as they share great homology with the CT domain of the long form of the P/Q-type Ca2+ channel. The currents measured under these conditions are expected to reflect conductances through mainly P/Q- and N-type Ca2+ channels with a minor contribution from R-type Ca2+ channels (Zhang et al., 1993). The Ba2+ currents elicited by a ramp stimulation protocol where voltage was increased from –60 mV to 90 mV within 500 ms (Figure 7A) were used together with the cell capacitance to calculate the current densities. One should note that the cell capacitance measurements have to be interpreted cautiously for neurons with large processes because of possible voltage clamp errors. While there was a trend in decreased Ca2+ channel density induced by both CT-short and CT-27 expression, this
94 finding did not reach statistical significance (Figure 7B and C). This is in contrast to the very significant reduction in Ca2+ channel densities reported by others, while expressing a much shorter sequence within the CT domain that interferes with interactions of the channel and tctex-1 (Lai et al., 2005). It is possible that because we expressed the full length sequence of the CT domain, that the high affinity interactions that smaller peptides have via consensus sequences with tctex-1 are weakened, thereby resulting in a less dramatic effect. Interestingly, our results suggest that expression of CT-27 but not
CT-short results in effects at the level of the cell membrane where a significant increase in the capacitance was observed when compared to control neurons (Figure 7D).
The observed changes in the Ca2+ dependence of release and the decrease in the probability of vesicular release suggests that the average EPSC size measured for the first
EPSC elicited (representing Pvr) is reduced in the presence of the CT. Interestingly, we found that this is the case for CT-short but not for CT-27. CT-short expression significantly reduced the average EPSC size, while CT-27 had the opposite effect (Figure
7E and F). In light of our previous finding on the increased capacitance suggesting increased membrane surface area induced by CT-27, this novel finding prompted us to investigate whether both of these effects could be explained by an increase in the number of synapses. We therefore infected autaptic hippocampal neurons with CT-short and
CT-27 and visualized synapses with the antibody against the synaptic marker synapsin.
As indicated in Figure 7G and H, CT-27 infected neurons revealed twice as many synapsin puncta per autapse in comparison to CT-short infected neurons, suggesting that
95 more synapses are formed in the CT-27 infected neurons.
This synapse formation hypothesis is particularly tempting since the CT of the presynaptic Ca2+ channel binds several CAZ (cytomatrix assembled at active zones) proteins (Waites et al., 2005). In addition, the Ca2+ channel and its interacting proteins are found in PTVs, which have been suggested to be the precursors of presynaptic terminals
(Shapira et al., 2003). We were therefore interested if we could also find differences in the localization and amount of Piccolo containing structures in the presence and absence of CT-short and CT-27. For these experiments CT infected or non-infected low-density cultures of hippocampal neurons (12-13div) were stained with antibodies to Piccolo.
Confocal imaging was used to identify and quantify the number of CT and Piccolo containing puncta. As expected, we found that CT-27 forms more puncta outside nuclear areas (Figure 8A and B) and is colocalized to a higher degree with Piccolo in comparison to CT-short (Figure 8C).
Since PTVs have been suggested to form presynaptic terminals in a quantal manner, the CT-27 may induce formation of PTVs and/or promote fusion of PTVs to larger vesicles. We therefore analyzed the Gaussian distribution of Piccolo containing puncta
(Figure 8D). By binning the amount of Piccolo mediated fluorescence detected within the fluorescent area (i.e. mean fluorescence * area) and fitting the distribution of the fluorescence with two Gaussian’s we found that Piccolo reveals two peaks, where the second peak is approximately double the fluorescence of the first peak. In the presence of
CT-27 the size of the second peak was increased relative to the first peak (peak 2 relative
96 to peak 1 approximately 50%) in comparison to CT-short (peak 2 relative to peak 1 approximately 25%), suggesting that in the presence of CT-27 more larger Piccolo containing puncta were formed (Figure 8E). This is also supported by the fact that in the presence of CT-27 77% of the Piccolo puncta where larger than 15 pixels. In contrast, in non-infected neurons around 68% and in CT-short only 62% of the piccolo puncta were larger than 15 pixels. The formation of larger Piccolo cotaining puncta suggests the formation of more functional synapses.
Together the results suggest that CT-short is mainly localized to the nucleus, while
CT-27 forms mainly cytoplasmic aggregates in neurons. Both, CT-short and CT-27 act as dominant-negative mutants on several steps within the synaptic release process, while only CT-27 induce positive effects on membrane and/or synapse assembly. The effect of
CT-27 on PTVs and synapsin staining in autapses both representing synapse number suggests that the long CT-terminus contains additional binding sites for proteins involved in synapse assembly such as MINT and CASK and probably other CAZ proteins.
97 Discussion
The currently favored mechanism for many polyQ diseases is a toxic gain of function of the polyQ protein presumably mediated by the increased stability of the polyQ protein e.g.(Chen et al., 2003; Emamian et al., 2003; Tsuda et al., 2005). An increase in P/Q-type channel stability by polyQ has also been observed (Ishikawa et al., 1999a; Ishikawa et al.,
2001; Piedras-Renteria et al., 2001). Under the assumption that the stability of the polyQ
P/Q-type channel is increased in SCA6 patients, several possible mechanisms for the
SCA6 disease phenotypes related to alterations in P/Q-type channel function can be put forward. The reason that cytoplasmic aggregates are the predominant inclusion bodies found in SCA6 patients is most likely related to the finding that CT degradation resulting in a 60-75 kDa protein is more pronounced for the SCA channel than for the “healthy” channel types (Kubodera et al., 2003) This has in particular recently been confirmed by
Kordasiewicz et al. (2006) (Kordasiewicz et al., 2006), who showed that the Cavα1 subunit of the P/Q-type channel is cleaved at the CT producing a 60-75 kDa protein which localizes to the nucleus in HEK293 cells, NIH3T3 cells and cultured neurons. The
CT constructs used in our studies are similar to this 60-75 kDa degradation product.
Functional consequences of the differential distribution between CT-short and
CT-long: nuclear versus cytoplasmic aggregates.
Most polyQ disorders are characterized by nuclear inclusions found in the cerebellar
98 Purkinje cells. Although nuclear inclusions are a hallmark of neurodegenerative disorders
(due to their concentration within disease susceptible cells), their role in the induction and progression of the observed pathogenesis is ambiguous. In fact, it has been shown recently, that the proteosome function in disease models of polyQ is not disturbed
(Bowman et al., 2005), even though alterations in the degradation pathways has an impact on the severity of the disease (Cummings et al., 1999; Cummings et al., 2001;
Fernandez-Funez et al., 2000). Arrasate et al. proposed for example that the presence of nuclear inclusion bodies protected and improved the chance for neuronal survival by reducing diffuse intracellular toxic levels of mutant huntingtin (Arrasate et al., 2004).
What has been established for polyQ disorders, is that the diseased protein and ubiquitin colocalize within nuclear inclusions; suggesting insufficient proteosomal degradation of the misfolded protein (Stenoien et al., 2002). With respect to SCA6, Kordasiewicz et al.
2006 showed recently that the CT-long of the P/Q-type channel localizes to the nucleus and that the increase in polyQ causes cell death, but only if the CT localizes to the nucleus (Kordasiewicz et al., 2006). Using an antibody against the CT they also demonstrate that antibody staining is found in the nucleus of Purkinje cells from mice and human. According to our studies, this antibody staining would most likely result from the
CT-short staining, rather than CT-long, which forms mainly cytoplasmic aggregates.
Comparable cytoplasmic aggregates containing long CTs with more than 20 polyQs are also found in SCA6 patients (Ishikawa et al., 1999a; Ishikawa et al., 2001). It is tempting to speculate that the CT-short is neuroprotective and delays disease onset, while the
99 CT-long leads to ataxia via formation of cytoplasmic aggregates in Purkinje cells that induce physiological changes within the Purkinje cell and neuronal network and alterations in synapse formation. Transgenic animals expressing the CT-short and CT long in cerebellar Purkinje cells will be necessary to address this question.
The physiological consequences of the dominant negative effects of the CTs.
The P/Q-type channel CTs (CT-short and CT-long) contain several binding sites for structural and modulatory intracellular proteins. Both CTs for example bind proteins which are involved in channel transport, i.e. the Cavβ subunits and the motor protein tctex1 (Herlitze, 2005; Lai et al., 2005). It was therefore expected that exogenous expression of the CTs would lead to a robust decrease in Ca2+ channel expression. We examined this possible dominant negative effect of the CT by measuring the non-L-type
Ca2+ currents (mostly N- and P/Q-type channels) and found that the peak current amplitude was reduced but not significantly in comparison to non-infected neurons. The reason for the non-significant reduction in current amplitude might be related to the slow turnover rate of the P/Q-type channels at somato-dendritic sites, which likely would be longer or equivalent to the CT expression time allowed in the neurons (i.e. 20-28 h). We did not analyze neurons, where the CT was expressed for longer than 28 h because of possible toxic effect of the virus expression. Another possibility is that the CTs are transported primarily to the nucleus and synaptic sites and therefore do not interfere with
Ca2+ channel trafficking to the soma, the site where the current was measured.
100 Robust dominant negative effects of the CTs were observed on synaptic transmission, which is likely related to the fact that binding sites of proteins involved in presynaptic targeting and clustering (MINT and CASK (Maximov and Bezprozvanny, 2002;
Maximov et al., 1999)) and proteins involved in synaptic vesicle release (Rim binding proteins (RBPs)) have been identified in the extended CT (Herlitze and Mark, 2005;
Herlitze et al., 2003; Hibino et al., 2002; Lai et al., 2005). Part of these binding sites must also be preserved in CT-short since the human P/Q-type channel containing the CT-short targets to synaptic sites (Hu et al., 2005) and rescues synaptic transmission in neuronal cultures from P/Q-type channel knock-out mice (Cao et al., 2004).
We found that the Ca2+ dependence of transmitter release is shifted to higher Ca2+ concentrations and that this was correlated with a reduction in the vesicular release probability and the RRP size. Both the reduction in release probability and in the size of the RRP would be expected to contribute to synaptic depression with repetitive stimulations, as we observed. The CT may therefore act directly at the Ca2+ channel to
2+ reduce Ca influx either via sequestering the Cavβ subunits or reducing the number and/or orientation of the Ca2+ channel complex relative to the release machinery. In addition, the CT may act downstream of the Ca2+ channel, probably on the priming but not on the refilling of the vesicle pool, since we found that repetitive firing led to strong depression with no change in the recovery of the release. The physiological consequence of the dominant negative effects on synaptic transmission in SCA6 patients would be a drastically reduced transmitter release at Purkinje cells terminals, which may lead to the
101 silencing of the neuron during high frequency firing episodes. Since Purkinje cells fire
APs in frequencies more than 100 Hz, the depletion effects would be expected to be even more pronounced than in our studies tested with 20 Hz stimulation protocols. Effects in
Purkinje cell output would thus be expected to occur before Purkinje cell degeneration and contribute to the ataxic phenotype.
At higher CT concentrations increased amounts of cytoplasmic aggregates are expected, which eventually may lead to degeneration and cell death. The mechanism for cell death may involve the collapse of cellular defenses against aggregated proteins.
These ideas fit well with the fact, that overexpression of CT P/Q-type channels fragments in HEK293 cells increase cell death in comparison to overexpressed full-length P/Q-type channels or CT fragments (Kordasiewicz et al., 2006; Kubodera et al., 2003). The polyQ stretch by itself did not cause toxicity, probably because the number of polyQs in SCA6 is small (Kubodera et al., 2003). Several studies have addressed the potential role of toxic cleavage products in other polyQ diseases (DiFiglia et al., 1997; Goldberg et al., 1996;
Ikeda et al., 1996; Schilling et al., 1999).
The long CT enhances synapse formation.
A very interesting result of our study is that CT-27 increases synapsin containing puncta in autapses and the number of large PTVs representing most likely functional presynaptic terminals (synapses) within a relatively short period of time (within 20 h incubation time). The increase in synapsin containing puncta and larger PTVs correlates
102 with the increase in the somatic membrane area, i.e. increased capacitance. The results suggest that the additional protein domains encoded by exon 47 contain information to be involved in synapse assembly. PTVs are thought to represent pre-assembled packets of presynaptic terminals (Shapira et al., 2003). These PTVs contain various voltage gated
2+ Ca channel subunits including Cavβ and Cavα1 subunits and several interacting proteins of the Ca2+ channel including the CT (i.e. RIM, Syntaxin and SNAP25). It is therefore possible that the CT end of the Cavα1 subunit is involved in synapse assembly.
The functional consequence is the increase in the overall transmitter release of one particular neuron during low frequency stimulations, but more importantly the formation of new postsynaptic contact sites. In SCAs retrograde atrophy in the inferior olivary nuclei occur as a consequence of Purkinje cell degeneration. Surprisingly, this is not the case in SCA6. One suggestion has been that increased sprouting of climbing fibers may lead to an induction and therefore a partial re-innervation of the olivary neurons following the loss of Purkinje cell innervation. With respect to the increased synapse formation observed in our study, one could speculate that Purkinje cells, which have not degenerated, make more contacts with the olivary neurons. Through these additional collaterals the loss of Purkinje cells may be compensated by an overall increased innervation of the olivary neurons. It is interesting to note that impaired synapse elimination in the climbing fiber pathway as observed in PKC knock-out mice leads to ataxic phenotypes in the mouse (Kano et al., 1995). It will be interesting and important to analyze if Purkinje cells of SCA patients increase the synapse number and innervation in
103 the nucleo-olivary pathway, the pathway downstream of Purkinje cells.
104 Figures
105
106 Figure 1. CT-short predominantly targets to the nucleus, while CT-12 and CT-27 are found in both the cytoplasm and the nucleus in HEK293 cells. HEK293 cells were transfected with CT-short, CT-12 and CT-27 and incubated for 14-20 h at 37˚C. (A)
Comparison of the distribution of CT-short, CT-12 and CT-27 reveals that CT-short is exclusively found in the nucleus, while CT-12 and CT-27 can be found within and outside the nucleus. (Top) phase contrast and (lower) DAPI and YFP fluorescence images of transfected HEK293 cells. (B) XYZ images of the cells shown in A demonstrates that CT-short formed nuclear aggregates are larger in size in comparison to nuclear and cytoplasmic CT-12 or CT-27 formed aggregates. The volume images contain
60 0.1 µm z-stack images taken on an upright motorized Leica DMLSFA, which were deconvolved using Volocity software. (C) Bar graph of the fluorescence distribution of
CTs between the nuclear and non-nuclear region of the cell. Cell borders were identified by the phase contrast image while nuclear regions were defined by the DAPI staining.
The diagram shows that >90 of the YFP fluorescence of CT-short is found in the nucleus, while 50-60 % of the CT-12 and CT-27 YFP fluorescence is outside of the nuclear areas.
(D) Diagram of the size of CT containing aggregates reveal that CT-short forms larger aggregates than CT-12 or CT-27. Statistical significance was evaluated with ANOVA
(*p<0.05, **p<0.01). Error bars = SEM.
107
108 Figure 2. In hippocampal neurons CT-short is predominantly targeted to the nucleus, while CT-12 and CT-27 are predominantly found in cytoplasmic aggregates.
Neuronal preparations from P0-P2 Sprague-Dawley rats were cultured for 10-12 DIV.
Neurons were infected with pSinRep5 sindbis virus containing the different CTs.
Neurons were fixed and mounted with Slow-fade Dapi (Molecular Probes) following 24 hrs after the viral infection. Fluorescence was visualized on an LSM510 confocal microscope. (A) CT-short is found in the nucleus, while CT-12 or CT-27 are found outside of the nucleus. (left) CT-short, middle (CT-12), right (CT-27). (B) Small amounts of CT-short are detected also outside of the nucleus in cultured hippocampal neurons.
Cultured hippocampal neurons (14 div) were infected with YFP tagged CT-short and colocalized with the synaptic marker synapsin (red). CT-short is mainly localized to the nucleus (out of focal plain), but is also found in the cytoplasm and synapses (bright spot, arrow). Following expression, neurons were immunostained with Cy5 labelled anti-synapsin. (C) Diagram of the fluorescence distribution of CTs between the nuclear and non-nuclear region of the neuron. Cell borders were identified by phase contrast images while nuclear regions were defined by the DAPI staining. The diagram shows that
80% of the YFP fluorescence of CT-short is found in the nucleus, while 70% of CT-27
YFP fluorescence is outside of nuclear areas. Statistical significance was evaluated with
ANOVA (*p<0.05, **p<0.01). Error bars = SEM.
109
110 Figure 3. CT-short and CT-27 shift the Ca2+ dependence of neurotransmitter release to higher Ca2+ concentrations. The Ca2+ dependence of neurotransmitter release was compared among control hippocampal neurons and those expressing CT-short and CT-27.
The Ca2+ concentration in the extracellular solution was gradually increased from 0.4 to
10 mM, and EPSCs were recorded from autapses at 12-13 DIV following 10 mV test pulses at 0.2 Hz. (A) Examples of EPSCs elicited by 10 mV stimulations at 0.2 Hz in control and CT-27 expressing neurons. (B) The normalized release probability was plotted against the Ca2+ concentration for control, CT-27 , and
CT-shortexpressing neurons.
111
112 Figure 4. CT-short and CT-27 enhance synaptic depression during 20 Hz stimulation. (A) The stimulation protocol consisted of repetitive 10 mV pulses at 20 Hz.
The experiments were performed in 0.03 mM Cd2+ to reduce synaptic depression during the 20 Hz stimulation. (B) Example of EPSCs elicited in control, CT-short and CT-27 expressing neurons. (C) The second EPSC, average of 7-10 and average of 27-30 were compared to the first EPSC elicited by the repetitive stimulation protocol. Significant synaptic depression was induced by the expression of both CT-short and CT-27.
Statistical significance was evaluated with ANOVA (*p<0.05, **p<0.01). Error bars =
SEM.
113
114 Figure 5. CT-short and CT-27 decrease the probability of vesicular release. (A) (Left)
Examples of EPSCs evoked by 2 ms depolarizing pulses from -60 mV to 10 mV are shown for non-infected neurons (upper) and CT-short expressing neurons (lower). (Right)
Examples of the hypertonically mediated release of quanta from the same neuron shown on the left upon application of 500 mM sucrose for 4 s. (B) Probability of synaptic vesicle release was evaluated by calculating the ratio of release evoked by the action potential to that evoked by hypertonic sucrose. In the presence of CT-short and CT-27 the vesicular release probability as well as the RRP size are significantly reduced compared with non infected neurons. Statistical significance was evaluated with ANOVA (*p<0.05,
**p<0.01). Error bars = SEM.
115
116 Figure 6. CT-short and CT-27 do not alter the time course and amount of EPSC recovery after EPSC depletion. The recovery of the RRP following activity is not different between non-infected and CT-short or CT-27 infected neurons. The depletion was determined by measuring the recovery of the EPSC amplitude at varying time points following depletion induced by 20 2 ms long voltage pulses to 10 mV at 20 Hz. These experiments were performed in 4 mM Ca2+ without Cd2+ in the extracellular solution to promote vesicle depletion. (A) Example recovery EPSC traces of non-infected (control) and CT-27 infected neurons. (B) The recovered EPSCs were normalized to the first EPSC in the 20 Hz stimuli train. Statistical significance was evaluated with ANOVA (*p<0.05,
**p<0.01). Error bars = SEM.
117
118 Figure 7. CT-27 increases cell capacitance and mean EPSC size in hippocampal neurons. (A-D) CT-27 increases cell capacitance. Following expression of CT-short and
CT-27 cells were stimulated with a ramp protocol where voltage was increased from –60 mV to 90 mV to elicit non-L-type Ca2+ currents. Examples of the elicited currents are shown in (A), for control neurons in the absence of CT expression (black) and for neurons expressing CT-27 (gray). The membrane capacitance was measured for each condition (C), and was used to calculate the Ca2+ current densities (D) by dividing the whole cell Ca2+ current (B) by the capacitance. The number of cells analyzed per condition is indicated. (E-F) CT-short reduces, while CT-27 increases the mean EPSC amplitude. (E) Example of EPSCs elicited in control, CT-short and CT-27 expressing hippocampal autapses. (F) Summary of EPSC currents elicited by 10 mV at 0.2 Hz.
Significant differences between control and CT-short (p<0.01**) or CT-27 expressing neurons (p<0.05*) were found. (G-H) CT-27 expressing autaptic hippocampal neurons reveal higher number of synapsin puncta per autapse when compared to CT-short expressing neurons. (G) Cultured autaptic hippocampal neurons (14 div) were infected with YFP tagged CT-short (left) and CT-27 (right) and colocalized with the synaptic marker synapsin (red). Following expression, neurons were immunostained with Cy5 labelled anti-synapsin. (H) Diagram of the number of synapsin puncta per autapse in
CT-short and CT-27 expressing autapses, suggesting that the number of synapsin containing synapses is higher in CT-27 expressing neurons. Statistical significance was evaluated with ANOVA (*p<0.05, **p<0.01). Error bars = SEM.
119
120 Figure 8. CT-27 increases the amount of large Piccolo-Bassoon transport vesicles in hippocampal neurons. Low density hippocampal neurons were infected with CT-short and CT-27, respectively, and the number of Piccolo containing puncta in non-nuclear areas as well as the colocalization between Piccolo and the CTs were compared. (A)
Example of low-density hippocampal neurons expressing either CT-short (upper) or
CT-27 (lower). (Left) CT-short and CT-27 were visualized via their YFP fluorescence,
(middle) and Piccolo was visualized by an anti-Piccolo antibody coupled to an
AlexaFluor 546 coupled secondary antibody. (right) Colocalization of CT-short and
CT-27 with Piccolo. The inset in each picture shows a representative area of the neuron in higher magnification. (B) The number of fluorescent puncta were compared in a 50
µm2 area among different neurons expressing or not expressing CT-short and CT-27. As indicated for a 50 µm2 area which contain comparable amounts of Piccolo puncta (right) more CT-27 puncta are detected than CT-short puncta. (C) Diagram of the colocalization between CT-short and CT-27 with Piccolo. (left) More Piccolo puncta colocalize with
CT-27 than with CT-short. (right) >50% of the CT-27 puncta colocalize with Piccolo, while only <25% of CT-short colocolize with Piccolo. (D) Comparison of the Gaussian distribution of the fluorescent Piccolo puncta in CT-short and CT-27 expressing neurons.
The mean fluorescence intensity of a puncta was multiplied by the fluorescent area
(number of pixels; given as arbitrary units) and binned. Bin width was 5 area* fluorescent intensity units and bin start was at 70 units to subtract background noise. The distribution was fitted with a double Gaussian fit according to
121 2 2 (y01+A1exp[(-x1-x01/w1) ]))+(y02+A2exp[(-x2-x02/w2) ])). The figure demonstrates that in the presence of CT-27 in comparison to CT-short the amount of larger Piccolo puncta is increased relative to small Piccolo puncta. (E) Example image of Piccolo puncta with a puncta size smaller than 15 pixel (bottom) and larger than 15 pixel (top). (F) Diagram of the analysis of Piccolo puncta in non-expressing and CT-short and CT-27 expressing neurons which are larger than 15 pixel reveal that in the presence of CT-27 >75%,
CT-short <65% and control <70% of all Piccolo puncta are larger than 15 pixel.
Statistical significance was evaluated with ANOVA (*p<0.05, **p<0.01). Error bars =
SEM.
122 Chapter 4: Discussion
123 Research conclusions
Thesis research studied the targeting and function of presynaptic HVA channels.
Specifically it focused on two aspects: 1) the Cavβ subunits related changes in targeting and function of the HVA channels, with respect to the synaptic transmission, synaptic plasticity, and more importantly, the underlying mechanism of the functional changes that we observed; 2) the effects of the splice variants of human P/Q- type channel CTs, i.e. CT-short and CT-long, on synaptic strength and synaptic formation. The findings of this study supply a mechanistic explanation for the P/Q- type channel C-terminus related to channel targeting and synaptic modulation, with the implications on the biophysical, physiological, and pathological aspects in the SCA6 disease.
Our first part of the study, which is described in the Chapter 2, for the first time revealed how the Cavβ subunits impact synaptic transmission and short-term plasticity in a subunit specific manner. The Cavβ2a subunits and the Cavβ4b subunits are found sufficiently targeted to synaptic sites, where they influence synaptic transmission and short-term synaptic plasticity. During paired-pulse stimulations Cavβ4b subunits altered the Ca2+ dependence of transmitter release, while during long action potential trains both the Cavβ2a subunits and Cavβ4b subunits induced synaptic depression, which is in accordance with the biophysical properties of the presynaptic Ca2+ channel assembled with these subunits. Our results on facilitation indicate that the presynaptic location of the
Cavβ2a subunits and Cavβ4b subunits are different, suggesting that Cavβ2a subunits and
124 Cavβ4b may target HVA channel complexes to different presynaptic microdomains and consequently affect the coupling of the channels with the vesicle release machinery.
The second part of the thesis presented findings that the short form of CT, which ends at exon 46, and the long form CT, which ends at exon 47, showed differences in physiological effects and synapse formation. When expressed in HEK293 cells or hippocampal neurons, the long form of the CT from the human Cavα12.1 subunit, which contains 27 polyQ residues and resembles the degradation product derived from the human SCA6 P/Q- type channel, produced cytoplasmic aggregates. These aggregates resemble those found in SCA6 patients, while the short C termini localized only in the nucleus. In autaptic hippocampal neurons, our results revealed dominant negative effects of these two forms of C-termini on synaptic transmission. Both C-termini induced synaptic depression, had antagonistic effects on membrane capacitance, and reduced
EPSC amplitude. In addition, the long form C-termini reduced the synaptic strength but increased the total number of synaptic formations, suggesting that this disease form
C-terminus induces membrane and synapse assembly.
Importance of VGCC Cavβ subunits in subunit-specific channel targeting
In agreement with previous studies in HEK293 cells (Chien et al., 1998; Scott et al.,
1998), this study shows that all Cavβ subunits are located to various degrees in cytoplamic and membrane fractions in hippocampal neurons. More importantly, we
125 provided evidence that Cavβ2a and Cavβ4b subunits target to presynaptic sites, where they affect the targeting and function of the presynaptic HVA channels and cause changes in short-term plasticity.
Our results show that overexpression of Cavβ1b and Cavβ3 subunits do not significantly affect the synaptic parameters that we analyzed. The reason for this could be the high expression level of the endogenous Cavβ3 in hippocampal neurons and the biophysical resemblance of the HVA channels assembled with Cavβ1b and Cavβ3 subunits. Since the channels assembled with these two types of subunits inactivate faster than those with Cavβ2a and Cavβ4b, the implication of our study is that most likely at normal physiological conditions the majority of the HVA channels undergo rapid inactivation. This phenomenon could prevent the intracellular Ca2+ overload in neurons, particular those which fire with very high frequencies. The high extent of the Cavβ1b and
Cavβ3 subunits in cytosol, which are presumably assembled with Cavα1 subunits, suggest that HVA channels could exist in cytosolic domains as Ca2+ channel complex reserves. In addition, the Cavβ subunits might be involved locally in the regulation of the turnover of
Ca2+ channel in the plasma membrane. This idea is supported by reports from other groups that Cavβ1b and Cavβ3 subunits are not sufficiently transported to the presynaptic terminals (Maximov and Bezprozvanny, 2002), and Cavβ3 subunits have the lowest binding affinity with the Cavα1 subunits among the Cav subunit family members (De
Waard et al., 1995). One possibility is that channels assembled with Cavβ1b and Cavβ3 subunits traffick to neurites, with majority of them not immediately being targeted to the
126 synaptic membrane. These channels would stay in nearby cytosolic domains where they can be further regulated by for example Cavβ2a and Cavβ4b subunits, G protein βγ subunits
(Herlitze et al., 2001; Li et al., 2005) and/or other Ca2+ channel regulatatory proteins
(Catterall, 2000; Herlitze et al., 2003) to fine-tune the channel functionality before they are assembled and targeted to synaptic membrane.
This thesis study demonstrated that Cavβ2a and Cavβ4b subunits target to presynaptic sites at the EM level. This verified the previous reports from our lab (Wittemann et al.,
2000) regarding the synaptic localization of Cavβ4b. The N- and C- termini of the Cavβ4b subunits are required for the synaptic targeting of the Cavβ4b subunits (Wittemann et al.,
2000). In this study, the N- terminus of the Cavβ4b subunits acts as a dominant negative, inhibiting synaptic transmission in hippocampal autapses. This suggests that Cavβ4b subunit-dependent Ca2+ channel targeting is critical for the channel function, and changes or loss of this targeting could cause drastic changes in synaptic transmission. As predicted from previous studies in HEK293 cells (Bogdanov et al., 2000; Chien et al.,
1998), when expressed in neurons, the Cavβ2a subunit showed preferential subcellular localization to the plasma membrane. This can be explained by the fact that the targeting of Cavβ2a subunits involves the palmitoylation site in the N-terminus (Dolphin, 2003;
Herlitze et al., 2003). Our finding that Cavβ2a subunits are located at presynaptic sites also suggests that these synapses assembled with slow-inactivating Ca2+ channels, which may resemble the high-fidelity synapses found in heart (Takahashi et al., 2003; Yamada et al.,
2001). These synapses probably only exist in very small quantity in the hippocmapl
127 neurons, as indicated by the low endogenous expression mRNA level of the Cavβ2a subunit in this neuron type.
Cavβ subunits and short-term synaptic plasticity
A new finding of this thesis study is that that both Cavβ2a subunits and Cavβ4b subunits can induce synaptic depression in hippocampal neurons. Although to date the exact mechanism of the synaptic depression is still unclear, the changes that we found in this study can be explained, at least in part, by the Cavβ subunits specific responses of the
P/Q-type channels to the action potential waveforms, a novel phenomenon that has not been reported. In contrast to findings in heart (Takahashi et al., 2003; Yamada et al.,
2001), in CNS the increased Ca2+ influx through the slow-inactivating channels leads to decreased synaptic strength during repeated train stimulation, probably due to the increased depletion of the vesicle pool at the presynaptic sites.
In agreement with our previous study (Wittemann et al., 2000), we found that overexpression of Cavβ4b subunits leads to paired-pulse facilitation, which can be explained by Cavβ4b subunit induced cooperativity changes in the synapses. Since this phenomenon is caused by the decrease of the first EPSC rather than the increase of the second EPSC, it suggests that when responding to the single action potential, synapses
2+ containing presynaptic Ca channels assembled with Cavβ4b subunits may have reduced
EPSC responses compared to those synapses with Ca2+ channels containing for example
Cavβ2a subunits. However, we were not able to detect the difference between the absolute
128 EPSC values from cells expressing Cavβ4b subunits and other Cavβ subunits, probably due to the limited sample size. However, the changes in cooperativity and vesicle release probability support the idea that synapses assembled with Cavβ4b subunits are more reluctant to respond.
The changes in cooperativity and EGTA blockage of the autapses expressing Cavβ4b subunits indicate that these subunits are located relatively further away from the vesicle release machinery. Based on our results, we proposed that Cavβ2a and Cavβ4b subunits may target HVA channels to different presynaptic subdomains (Figure 1). Although the electron microscopy study we performed did not show difference in the synaptic localizations of the Cavβ2a and Cavβ4b subunits, our unpublished biochemical study using continuous gradient ultracentrifugation revealed that Cavβ4b but not Cavβ2a subunits are located at the light membrane fraction (Figure 2). This is an intriguing finding, given that the light membrane fractions are rich of lipid rafts, which serve as multifunctional communication hubs for endocytosis (Gruenberg, 2001; Puri et al., 2005) and numerous signal transduction events (Peiro et al., 2000; Sternberg and Schmid, 1999; Wu et al.,
1997).
Our model supplies a novel mechanistic explanation for the Cavβ2a and Cavβ4b related subunit-specific effects on synaptic modulation and short-term plasticity. Cavβ subunits determine the time course of inactivation of high voltage activated Ca2+ channels, which would then determine the Ca2+ influx into the presynaptic terminal during paired-pulses, --the basis of short-term synaptic plasticity. Our findings indicate
129 that with roughly the same amount of Ca2+ influx the short-term plasticity can be drastically different due to the varied assembly of the Cavβ2a and Cavβ4b subunits. The possible localization of Cavβ4b at the lipid rafts may form a platform for the interaction of the HVA channels with multiple signaling pathways so that many regulatory proteins can influent the Cavβ4b assembled HVA channels and through these channels affect the final output of the synaptic signal.
Physiological and pathological consequences of expressing different P/Q-type C-termini
The C-termini of the voltage gated Ca2+ channels contain targeting signals (Flucher et al., 2000; Gao et al., 2000) and interaction domains for modular adaptor proteins and proteins of the synaptic release machinery (Bezprozvanny and Maximov, 2001; Jarvis and Zamponi, 2001; Maximov et al., 1999). The interactions of the VGCC C-termini with their binding partners are therefore important for synaptic targeting and clustering of the
Ca2+ channels. It is believed that Ca2+ channels are cleaved at the C-termini during the degradation process, and the C-termini with extended polyQ repeats interfere with this process (Gazulla and Tintore, 2007; Kordasiewicz and Gomez, 2007).
In this thesis study, we used P/Q-type channel derived C-termini of different sizes to mimic the biochemical and pathological conditions of SCA6. Our results revealed the variant subcellular localizations of the CT-short and CT-27, accompanied with differences in the physiological effects these C-termini have on synaptic transmission.
130 The observed CT-27 induced synaptic changes may shed new light on the current understanding of SCA6 pathogenesis. These data are in agreement with the current opinion (Chen et al., 2003; Emamian et al., 2003; Tsuda et al., 2005) that like other polyQ diseases, SCA6 is caused by a toxic gain of function of the proteins containing polyQ repeats, which lead to the increased stability of the Ca2+ channels (Ishikawa et al.,
1999; Ishikawa et al., 2001; Piedras-Renteria et al., 2001). Moreover, our results, which showed an increased number of synaptic puncta and increased EPSC amplitude in the
CT-27 expressing neurons, suggest that the CT-27 can lead to increased number of synapses containing P/Q-type channels assembled with the PQ-27 splice isoforms. This is an intriguing finding, as it implies that the increased synaptic formation may compensate the decreased synaptic transmission.
To date, the mechanism of the formation of SCA6 inclusion bodies is still not fully understood, and the roles of these formations in the disease are controversial (Gazulla and
Tintore, 2007; Kordasiewicz and Gomez, 2007; Ross and Poirier, 2005). Many investigators believe that these inclusions are harmful either because they are toxic to the neurons or their existence in the subcellular domains disrupts the normal cellular functions (Koeppen, 2005; Kordasiewicz et al., 2006). Others think these inclusion bodies are actually beneficial and are compensative changes to the disease (Ross, 1997;
Ross and Poirier, 2005). Our results support the second hypothesis. In particular, our data suggests that the existence of CT-containing nuclear inclusions is beneficial, while the cytosolic inclusions are harmful to the neurons. One explanation could be that the polyQ
131 repeats make the C-terminus more stable (Kubodera et al., 2003); therefore causing the slower membrane turnover rate for channels assembled with the CT-27. During the degradation process, all the CTs are cut from the channels as the normal degradation products (Kordasiewicz and Gomez, 2007) and go to the nucleus for further degradation and reprocessing, while those CTs with polyQ repeats are stopped in a cytosolic compartment (Ishikawa et al., 2001). This could be due to the misfolding of these proteins (Jana and Nukina, 2004; Soong and Paulson, 2007), which causes the disruption of the degradation process (Verhoef et al., 2002) and together with the increased number of channels at plasma membrane may eventually cause neuronal damage.
The results from this thesis study have significant implications in the disease pathology and therapy. For example, if the increased PQ-27 containing Ca2+ channels within the membrane are in part causative to the pathological conditions of SCA6, one possible therapeutic method could be to block the membrane targeting of P/Q-type channels in Purkinje neurons. Similarly, understanding the degradation process of CT-27 would allow us to develop drugs that help eliminate the polyQ containing fragments so that the normal function of the cellular degradation system can be restored.
Remaining questions and future directions
In this thesis study, we investigated the changes in Ca2+ channel targeting and function caused by the expression of Cavβ subunits and Cavα1 subunits C-termini. While our study revealed the mechanisms underlying the synaptic modulation and short-term
132 plasticity induced by the Cavβ subunits and Cavα1 subunit C-termini, these results also raise new questions worthy of future study.
One question regarding the functional synaptic changes mediated by the different
Cavβ subunits is their relative location to the Cavα1 subunits. Although Cavβ subunits are speculated to be associated with Cavα1 subunits and transported as preassembled channel complexes to synaptic sites (Ahmari et al., 2000; Shapira et al., 2003), it is still unclear how Cavβ and Cavα1 subunits interact with each other locally at the presynaptic sites and how this local interplay affects the modulation of the channel function (Opatowsky et al.,
2004). This is especially important for understanding the channel modulation by Cavβ2a and Cavβ4b subunits, which can bind to the second low-affinity binding sites at the
C-termini of the Cavα1 subunits (Herlitze, 2005; Herlitze et al., 2003; Kobayashi et al.,
2007; Walker et al., 1998). Current hurdles for resolving this problem include the lack of an efficient Cavα1 antibody (because to the extremely low antigenity of the Cavα1 subunits) and the difficulty of expressing tagged Cavα1 subunits in neurons because of their size (Catterall, 2000). Our lab is now generating a Cavα12.1-GFP knock-in mouse line, which will supply a powerful tool to study this question. Future experiment using the knock-in neurons and/or brain slices will help to elucidate the mechanism regarding the interplay between the Cavα1 and Cavβ subunits at the presynaptic sites and its association with the modulation of the channel function and synaptic plasticity.
The synaptic facilitation and depression caused by the Cavβ subunits also raises the question whether the Cavβ subunits are involved in activity dependent regulation of
133 synaptic transmission, i.e., whether the expression and synaptic localization of the Cavβ subunits are activity dependent. Our unpublished data using real-time PCR revealed that in cultured hippocampal neurons, the expression levels of all Cavβ subunit mRNAs significantly increased shortly (10 min) after KCL application (Figure 3). Since KCL is a very powerful stimulant and vast amounts of the mRNA are detected from the cell body, where the majority of Ca2+ channels are the postsynaptic L-type ones, future experiments could be designed to detect if any Cavβ subunit expression changes occur in neurites.
This can be analyzed by using neuronal substrate lane cultures (Burnett et al., 2007;
Francisco et al., 2007) in combination with more specific activity stimulations like field stimulations or applications of presynaptic channel agonists.
The crystal structures of the Cavβ subunits have been recently resolved (McGee et al., 2004; Opatowsky et al., 2004; Vendel et al., 2006a; Vendel et al., 2006b) and it is known that both GK and SH domains serve as sites for protein-protein interactions
(Kobayashi et al., 2007; McGee et al., 2004; Takahashi et al., 2004; Takahashi et al.,
2005). It is unclear for the Cavβ subunits if there are other proteins to interact with the
2+ Cavβ subunits, and if yes how these proteins will affect the Ca channel function. It will be interesting and important to search for these potential binding partners, for example, by using yeast two-hybrid assay and then verify the protein interactions with immuno- precipitation studies. Studies in this direction will help to explore the upstream regulatory
2+ mechanisms regarding the Cavβ subunits associated regulation relative to the Ca channel targeting and function.
134 Since all four Cavβ subunits can be expressed in cultured hippocampal neurons, as indicated by this thesis study, it would be interesting to investigate the relationships between these subunits and their implication for synaptic transmission. At least at the
Cavα loop I-II BID region, different Cavβ subunits bind the Cavα subunits with different affinity (De Waard et al., 1995). However, clear evidence is still missing regarding whether a certain Cavβ subunit binds only one type of subunit, or whether it can bind to two different types of Cavβ subunits at the same time. Also unknown is if and how these
Cavβ subunits, which very likely co-exist in the same presynaptic site, can compete with each other at the same Cavα subunit. These mechanisms could be used for the fine-tuning of the channel function. Experiments using fusion proteins and single channel recording may help to solve these questions (Feinberg-Zadek and Treistman, 2007; Sandoz et al.,
2001). However, gaining a complete understanding of the detailed mechanism may be difficult, given that the Cavβ subunits are normally expressed at very low levels and that the changes in channel function may be too subtle to record and easily masked by other non-relevant activities.
To date most investigators believe that both the normal and the SCA6 form of
Cavα12.1 subunits are cleaved, but that the expended C-terminus is selectively resistant to degradation (Kordasiewicz and Gomez, 2007). However, the degradation pathway of the
Ca2+ channels and their CTs are still unclear, and little progress has been made in elucidating the exact Cavα12.1 degradation pathways and the underlying mechanisms since Catterall lab (De Jongh et al., 1994; Hell et al., 1996) and Campbell lab (Scott et al.,
135 1998) first described the cleavage of HVA channels over a decade ago. Recently, some exciting findings on C-termini nuclear translocation have been reported and several potential nuclear localization signals have been characterized on the CT fragments
(Kordasiewicz et al., 2006). Future studies on the mechanisms of Cavα12.1 degradation will be not only essential in understanding the underlying physiological and pathological consequences of the degradation products, but also critical in developing effective therapeutic methods to the SCA6 disease.
In this thesis study we used C-terminal fragments to analyze/reproduce the mechanisms of the SCA6 disease, which has a caveat that the overexpressed C-termini may act differently compared with the Cavα12.1 whole channels with and without polyQ extensions. Currently many polyQ knock-in mouse lines have been generated (Bowman et al., 2007; Bowman et al., 2005; Watase et al., 2003), and future work using the SCA6 knock-in mouse as model will enable the characterization of Cavα12.1 whole channel degradation pathway under the pathological conditions.
The different subcellular localization of the CTs and the CT-27 induced synaptic formation observed in this study also let us speculate that the trafficking of the CT-27 and
CT-short may be different and that the Ca2+ channels containing the CT-27 may have a slower membrane turnover rate. These can be verified by using the total internal reflection fluorescence (TIRF) microscopy to quantify the membrane fluorescent signals in neurons expressing the constructs that we used in this thesis study. Future studies of our lab will try to answer these questions, and the outcome of these studies will
136 contribute to our current knowledge of the physiological mechanism of Ca2+ channel membrane turn-over and the pathological implications caused by the poly-Q extensions.
Our knowledge of targeting and function of Ca2+ channels have greatly expanded over the past several decades. However, we are far from the end of the journey and many important pieces of information are still missing. We still do not know the exact location of these channels at the presynaptic sites at the ultra-structural level, and many portions of our current knowledge about how Ca2+ channels work to cause vesicle release are speculative. It is clear that the trafficking, targeting, modulation, membrane turnover, and degradation process of the Ca2+ channels are such complex processes that multiple factors and regulatory pathways are involved. Understanding the complete picture requires our knowledge in not only the factors and pathways per se but also more importantly, the crosstalk and interplay among these factors and pathways. Continuous efforts in each of these areas are still required and the integration of the information will lead us to the ultimate understanding the mechanism of Ca2+ channel related synaptic transmission and regulation.
137 Figures
138
β2 β4
Figure 1: A model of the different targeting of presynaptic calcium channels by Cavβ2 and Cavβ 4
139 Figure 1: A model of the different targeting of presynaptic calcium channels by
Cavβ 4 and Cavβ 2
Based on our experimental results, we speculate that presynaptic Ca2+ channels are differentially targeted in a subunit dependent manner, in which the channels assembled with Cavβ2a are located close to the vesicle release machinery, while those assembled with Cavβ4b are more remotely located. The subtle difference in the presynaptic locations of these channels in these subdomains, which probably have different different biochemical properties, causes the changes in synaptic transmission and impacts the short-term synaptic plasticity.
140
141 Figure 2: The distribution patterns of exogenously expressed Cavβ subunits in subcellular fractionations from cultured hippocampal neurons.
Cultured hippocampal neurons of 14 DIV with Cavβ−GFP expression were harvested and put on the top of 10-30% glycerol gradient and ultracentrifugated for 45 min. Eight fractions with equal volume were immediately taken from the top. After the spin, the distributions of the proteins of interest were examined by Western blot. Anti-GFP antibody was used for the distributions of exogenously expressed GFP-tagged Cavβ subunits. The distict two-peak distribution of the VAMP-II was used as control for the successful separation of the proteins by the gradient. The results show that the Cavβ2a subunit only exists in the heavy membrane fraction, which located at the lane 8, while the other subunits can be found in both the heavy membrane fraction and the light membrane fraction, which is located at the lane 2. The truncated form of Cavβ4, which does not have the N’ and C’ (Cavβ4Δ50 - 407), shows a different distribution pattern.
142
143 Figure 3: Activity dependent changes in Cavβ mRNA expression levels in cultured hippocampal neurons detected by real-time RT-PCR
Cultured hippocampal neurons of 14 DIV were given KCl (50mM) for 10 min and the Cavβ mRNA expression levels were examined. Control neurons were processed in parallel in each step. The expression levels of the Cavβ mRNAs were first normalized to that of the 18S before they are compared between the KCL and control groups. Results show that the brief KCL stimulation is sufficient to cause drastic increase in Cavβ mRNA expressions.
144 Bibliograpy
Ahmari, S.E., J. Buchanan, and S.J. Smith. 2000. Assembly of presynaptic active zones
from cytoplasmic transport packets. Nat Neurosci. 3:445-51.
Aizenman, C.D., E.J. Huang, and D.J. Linden. 2003. Morphological correlates of intrinsic
electrical excitability in neurons of the deep cerebellar nuclei. J Neurophysiol.
89:1738-47.
Altier, C., S.J. Dubel, C. Barrere, S.E. Jarvis, S.C. Stotz, R.L. Spaetgens, J.D. Scott, V.
Cornet, M. De Waard, G.W. Zamponi, J. Nargeot, and E. Bourinet. 2002.
Trafficking of L-type calcium channels mediated by the postsynaptic scaffolding
protein AKAP79. J Biol Chem. 277:33598-603.
Amarenco, P. 1993. [Cerebellar infarctions and their mechanisms]. Rev Neurol (Paris).
149:728-48.
Arrasate, M., S. Mitra, E.S. Schweitzer, M.R. Segal, and S. Finkbeiner. 2004. Inclusion
body formation reduces levels of mutant huntingtin and the risk of neuronal death.
Nature. 431:805-10.
Atluri, P.P., and W.G. Regehr. 1998. Delayed release of neurotransmitter from cerebellar
granule cells. J Neurosci. 18:8214-27.
Austin, M.C., M. Schultzberg, L.C. Abbott, P. Montpied, J.R. Evers, S.M. Paul, and J.N.
Crawley. 1992. Expression of tyrosine hydroxylase in cerebellar Purkinje neurons
of the mutant tottering and leaner mouse. Brain Res Mol Brain Res. 15:227-40.
Barrett, C.F., Y.Q. Cao, and R.W. Tsien. 2005. Gating deficiency in a familial hemiplegic
145 migraine type 1 mutant P/Q-type calcium channel. J Biol Chem. 280:24064-71.
Barski, J.J., K. Dethleffsen, and M. Meyer. 2000. Cre recombinase expression in
cerebellar Purkinje cells. Genesis. 28:93-8.
Becker, W., A. Bergmann, M.A. Hink, K. Konig, K. Benndorf, and C. Biskup. 2004.
Fluorescence lifetime imaging by time-correlated single-photon counting.
Microsc Res Tech. 63:58-66.
Bekkers, J.M., and C.F. Stevens. 1991. Excitatory and inhibitory autaptic currents in
isolated hippocampal neurons maintained in cell culture. Proc Natl Acad Sci U S
A. 88:7834-8.
Berggren, P.O., S.N. Yang, M. Murakami, A.M. Efanov, S. Uhles, M. Kohler, T. Moede,
A. Fernstrom, I.B. Appelskog, C.A. Aspinwall, S.V. Zaitsev, O. Larsson, L.M. de
Vargas, C. Fecher-Trost, P. Weissgerber, A. Ludwig, B. Leibiger, L.
Juntti-Berggren, C.J. Barker, J. Gromada, M. Freichel, I.B. Leibiger, and V.
Flockerzi. 2004. Removal of Ca2+ channel beta3 subunit enhances Ca2+
oscillation frequency and insulin exocytosis. Cell. 119:273-84.
Beuckmann, C.T., C.M. Sinton, N. Miyamoto, M. Ino, and M. Yanagisawa. 2003. N-type
calcium channel alpha1B subunit (Cav2.2) knock-out mice display hyperactivity
and vigilance state differences. J Neurosci. 23:6793-7.
Bezprozvanny, I., and A. Maximov. 2001. Classification of PDZ domains. FEBS Lett.
509:457-62.
Bi, G.Q., and M.M. Poo. 1998. Synaptic modifications in cultured hippocampal neurons:
146 dependence on spike timing, synaptic strength, and postsynaptic cell type. J
Neurosci. 18:10464-72.
Bichet, D., V. Cornet, S. Geib, E. Carlier, S. Volsen, T. Hoshi, Y. Mori, and D.W. M.
2000. The I-II loop of the Ca2+ channel alpha1 subunit contains an endoplasmic
reticulum retention signal antagonized by the beta subunit. Neuron. 25:177-90.
Bidaud, I., A. Mezghrani, L.A. Swayne, A. Monteil, and P. Lory. 2006. Voltage-gated
calcium channels in genetic diseases. Biochim Biophys Acta. 1763:1169-74.
Biel, M., P. Ruth, E. Bosse, R. Hullin, W. Stuhmer, V. Flockerzi, and F. Hofmann. 1990.
Primary structure and functional expression of a high voltage activated calcium
channel from rabbit lung. FEBS Lett. 269:409-12.
Birnbaumer, L., N. Qin, R. Olcese, E. Tareilus, D. Platano, J. Costantin, and E. Stefani.
1998. Structures and functions of calcium channel beta subunits. J Bioenerg
Biomembr. 30:357-75.
Bogdanov, Y., N.L. Brice, C. Canti, K.M. Page, M. Li, S.G. Volsen, and A.C. Dolphin.
2000. Acidic motif responsible for plasma membrane association of the
voltage-dependent calcium channel beta1b subunit. Eur J Neurosci. 12:894-902.
Bossu, J.L., J.L. Dupont, and A. Feltz. 1989. Calcium currents in rat cerebellar Purkinje
cells maintained in culture. Neuroscience. 30:605-17.
Bourinet, E., T.W. Soong, K. Sutton, S. Slaymaker, E. Mathews, A. Monteil, G.W.
Zamponi, J. Nargeot, and T.P. Snutch. 1999. Splicing of alpha 1A subunit gene
generates phenotypic variants of P- and Q-type calcium channels. Nat Neurosci.
147 2:407-15.
Bowman, A.B., Y.C. Lam, P. Jafar-Nejad, H.K. Chen, R. Richman, R.C. Samaco, J.D.
Fryer, J.J. Kahle, H.T. Orr, and H.Y. Zoghbi. 2007. Duplication of Atxn1l
suppresses SCA1 neuropathology by decreasing incorporation of
polyglutamine-expanded ataxin-1 into native complexes. Nat Genet. 39:373-9.
Bowman, A.B., S.Y. Yoo, N.P. Dantuma, and H.Y. Zoghbi. 2005. Neuronal dysfunction
in a polyglutamine disease model occurs in the absence of ubiquitin-proteasome
system impairment and inversely correlates with the degree of nuclear inclusion
formation. Hum Mol Genet. 14:679-91.
Brody, D.L., and D.T. Yue. 2000. Release-independent short-term synaptic depression in
cultured hippocampal neurons. J Neurosci. 20:2480-94.
Burgess, D.L., and J.L. Noebels. 1999. Voltage-dependent calcium channel mutations in
neurological disease. Ann N Y Acad Sci. 868:199-212.
Burnett, J.C., G. Ruthel, C.M. Stegmann, R.G. Panchal, T.L. Nguyen, A.R. Hermone,
R.G. Stafford, D.J. Lane, T.A. Kenny, C.F. McGrath, P. Wipf, A.M. Stahl, J.J.
Schmidt, R. Gussio, A.T. Brunger, and S. Bavari. 2007. Inhibition of
metalloprotease botulinum serotype A from a pseudo-peptide binding mode to a
small molecule that is active in primary neurons. J Biol Chem. 282:5004-14.
Burright, E.N., H.B. Clark, A. Servadio, T. Matilla, R.M. Feddersen, W.S. Yunis, L.A.
Duvick, H.Y. Zoghbi, and H.T. Orr. 1995. SCA1 transgenic mice: a model for
neurodegeneration caused by an expanded CAG trinucleotide repeat. Cell.
148 82:937-48.
Caddick, S.J., C. Wang, C.F. Fletcher, N.A. Jenkins, N.G. Copeland, and D.A. Hosford.
1999. Excitatory but not inhibitory synaptic transmission is reduced in lethargic
(Cacnb4(lh)) and tottering (Cacna1atg) mouse thalami. J Neurophysiol.
81:2066-74.
Cao, Y.Q., E.S. Piedras-Renteria, G.B. Smith, G. Chen, N.C. Harata, and R.W. Tsien.
2004. Presynaptic Ca2+ channels compete for channel type-preferring slots in
altered neurotransmission arising from Ca2+ channelopathy. Neuron. 43:387-400.
Catterall, W.A. 1998. Structure and function of neuronal Ca2+ channels and their role in
neurotransmitter release. Cell Calcium. 24:307-23.
Catterall, W.A. 2000. Structure and regulation of voltage-gated Ca2+ channels. Annu
Rev Cell Dev Biol. 16:521-55.
Chen, H.K., P. Fernandez-Funez, S.F. Acevedo, Y.C. Lam, M.D. Kaytor, M.H.
Fernandez, A. Aitken, E.M. Skoulakis, H.T. Orr, J. Botas, and H.Y. Zoghbi. 2003.
Interaction of Akt-phosphorylated ataxin-1 with 14-3-3 mediates
neurodegeneration in spinocerebellar ataxia type 1. Cell. 113:457-68.
Chen, S., O. Gil, Y.Q. Ren, G. Zanazzi, J.L. Salzer, and D.E. Hillman. 2001. Neurotrimin
expression during cerebellar development suggests roles in axon fasciculation and
synaptogenesis. J Neurocytol. 30:927-37.
Chen, Y.H., M.H. Li, Y. Zhang, L.L. He, Y. Yamada, A. Fitzmaurice, Y. Shen, H. Zhang,
L. Tong, and J. Yang. 2004. Structural basis of the alpha1-beta subunit interaction
149 of voltage-gated Ca2+ channels. Nature. 429:675-80.
Chien, A.J., T. Gao, E. Perez-Reyes, and M.M. Hosey. 1998. Membrane targeting of
L-type calcium channels. Role of palmitoylation in the subcellular localization of
the beta2a subunit. J Biol Chem. 273:23590-7.
Chien, A.J., X. Zhao, R.E. Shirokov, T.S. Puri, C.F. Chang, D. Sun, E. Rios, and M.M.
Hosey. 1995. Roles of a membrane-localized beta subunit in the formation and
targeting of functional L-type Ca2+ channels. J Biol Chem. 270:30036-44.
Chin, H., M.A. Smith, H.L. Kim, and H. Kim. 1992. Expression of
dihydropyridine-sensitive brain calcium channels in the rat central nervous system.
FEBS Lett. 299:69-74.
Ciechanover, A., and P. Brundin. 2003. The ubiquitin proteasome system in
neurodegenerative diseases: sometimes the chicken, sometimes the egg. Neuron.
40:427-46.
Cingolani, L.A., M. Gymnopoulos, A. Boccaccio, M. Stocker, and P. Pedarzani. 2002.
Developmental regulation of small-conductance Ca2+-activated K+ channel
expression and function in rat Purkinje neurons. J Neurosci. 22:4456-67.
Coppola, T., R. Waldmann, M. Borsotto, C. Heurteaux, G. Romey, M.G. Mattei, and M.
Lazdunski. 1994. Molecular cloning of a murine N-type calcium channel alpha 1
subunit. Evidence for isoforms, brain distribution, and chromosomal localization.
FEBS Lett. 338:1-5.
Craig, P.J., A.D. McAinsh, A.L. McCormack, W. Smith, R.E. Beattie, J.V. Priestley, J.L.
150 Yip, S. Averill, E.R. Longbottom, and S.G. Volsen. 1998. Distribution of the
voltage-dependent calcium channel alpha(1A) subunit throughout the mature rat
brain and its relationship to neurotransmitter pathways. J Comp Neurol.
397:251-67.
Cribbs, L.L., J.H. Lee, J. Yang, J. Satin, Y. Zhang, A. Daud, J. Barclay, M.P. Williamson,
M. Fox, M. Rees, and E. Perez-Reyes. 1998. Cloning and characterization of
alpha1H from human heart, a member of the T-type Ca2+ channel gene family.
Circ Res. 83:103-9.
Cummings, C.J., E. Reinstein, Y. Sun, B. Antalffy, Y. Jiang, A. Ciechanover, H.T. Orr,
A.L. Beaudet, and H.Y. Zoghbi. 1999. Mutation of the E6-AP ubiquitin ligase
reduces nuclear inclusion frequency while accelerating polyglutamine-induced
pathology in SCA1 mice. Neuron. 24:879-92.
Cummings, C.J., Y. Sun, P. Opal, B. Antalffy, R. Mestril, H.T. Orr, W.H. Dillmann, and
H.Y. Zoghbi. 2001. Over-expression of inducible HSP70 chaperone suppresses
neuropathology and improves motor function in SCA1 mice. Hum Mol Genet.
10:1511-8.
Curtis, B.M., and W.A. Catterall. 1984. Purification of the calcium antagonist receptor of
the voltage-sensitive calcium channel from skeletal muscle transverse tubules.
Biochemistry. 23:2113-8.
De Jongh, K.S., A.A. Colvin, K.K. Wang, and W.A. Catterall. 1994. Differential
proteolysis of the full-length form of the L-type calcium channel alpha 1 subunit
151 by calpain. J Neurochem. 63:1558-64.
De Jongh, K.S., C. Warner, A.A. Colvin, and W.A. Catterall. 1991. Characterization of
the two size forms of the alpha 1 subunit of skeletal muscle L-type calcium
channels. Proc Natl Acad Sci U S A. 88:10778-82.
De Waard, M., D.R. Witcher, M. Pragnell, H. Liu, and K.P. Campbell. 1995. Properties
of the alpha 1-beta anchoring site in voltage-dependent Ca2+ channels. J Biol
Chem. 270:12056-64.
DiFiglia, M., E. Sapp, K.O. Chase, S.W. Davies, G.P. Bates, J.P. Vonsattel, and N.
Aronin. 1997. Aggregation of huntingtin in neuronal intranuclear inclusions and
dystrophic neurites in brain. Science. 277:1990-3.
Dittman, J.S., A.C. Kreitzer, and W.G. Regehr. 2000. Interplay between facilitation,
depression, and residual calcium at three presynaptic terminals. J Neurosci.
20:1374-85.
Dittman, J.S., and W.G. Regehr. 1998. Calcium dependence and recovery kinetics of
presynaptic depression at the climbing fiber to Purkinje cell synapse. J Neurosci.
18:6147-62.
Dolmetsch, R.E., U. Pajvani, K. Fife, J.M. Spotts, and M.E. Greenberg. 2001. Signaling
to the nucleus by an L-type calcium channel-calmodulin complex through the
MAP kinase pathway. Science. 294:333-9.
Dolphin, A.C. 2003. Beta subunits of voltage-gated calcium channels. J Bioenerg
Biomembr. 35:599-620.
152 Dove, L.S., L.C. Abbott, and W.H. Griffith. 1998. Whole-cell and single-channel analysis
of P-type calcium currents in cerebellar Purkinje cells of leaner mutant mice. J
Neurosci. 18:7687-99.
Dubel, S.J., T.V. Starr, J. Hell, M.K. Ahlijanian, J.J. Enyeart, W.A. Catterall, and T.P.
Snutch. 1992. Molecular cloning of the alpha-1 subunit of an
omega-conotoxin-sensitive calcium channel. Proc Natl Acad Sci U S A.
89:5058-62.
Duchala, C.S., H.E. Shick, J. Garcia, D.M. Deweese, X. Sun, V.J. Stewart, and W.B.
Macklin. 2004. The toppler mouse: a novel mutant exhibiting loss of Purkinje
cells. J Comp Neurol. 476:113-29.
Dunlap, K., J.I. Luebke, and T.J. Turner. 1995. Exocytotic Ca2+ channels in mammalian
central neurons. Trends Neurosci. 18:89-98.
Edgerton, J.R., and P.H. Reinhart. 2003. Distinct contributions of small and large
conductance Ca2+-activated K+ channels to rat Purkinje neuron function. J
Physiol. 548:53-69.
Edwards, F.A., A. Konnerth, B. Sakmann, and T. Takahashi. 1989. A thin slice
preparation for patch clamp recordings from neurones of the mammalian central
nervous system. Pflugers Arch. 414:600-12.
Emamian, E.S., M.D. Kaytor, L.A. Duvick, T. Zu, S.K. Tousey, H.Y. Zoghbi, H.B. Clark,
and H.T. Orr. 2003. Serine 776 of ataxin-1 is critical for polyglutamine-induced
disease in SCA1 transgenic mice. Neuron. 38:375-87.
153 Erickson, M.G., B.A. Alseikhan, B.Z. Peterson, and D.T. Yue. 2001. Preassociation of
calmodulin with voltage-gated Ca(2+) channels revealed by FRET in single living
cells. Neuron. 31:973-85.
Erickson, M.G., D.L. Moon, and D.T. Yue. 2003. DsRed as a potential FRET partner
with CFP and GFP. Biophys J. 85:599-611.
Evans, R.M., and G.W. Zamponi. 2006. Presynaptic Ca2+ channels--integration centers
for neuronal signaling pathways. Trends Neurosci. 29:617-24.
Feinberg-Zadek, P.L., and S.N. Treistman. 2007. Beta-subunits are important modulators
of the acute response to alcohol in human BK channels. Alcohol Clin Exp Res.
31:737-44.
Fellin, T., S. Luvisetto, M. Spagnolo, and D. Pietrobon. 2004. Modal gating of human
CaV2.1 (P/Q-type) calcium channels: II. the b mode and reversible uncoupling of
inactivation. J Gen Physiol. 124:463-74.
Fernandez-Chacon, R., A. Konigstorfer, S.H. Gerber, J. Garcia, M.F. Matos, C.F. Stevens,
N. Brose, J. Rizo, C. Rosenmund, and T.C. Sudhof. 2001. Synaptotagmin I
functions as a calcium regulator of release probability. Nature. 410:41-9.
Fernandez-Funez, P., M.L. Nino-Rosales, B. de Gouyon, W.C. She, J.M. Luchak, P.
Martinez, E. Turiegano, J. Benito, M. Capovilla, P.J. Skinner, A. McCall, I. Canal,
H.T. Orr, H.Y. Zoghbi, and J. Botas. 2000. Identification of genes that modify
ataxin-1-induced neurodegeneration. Nature. 408:101-6.
Fletcher, C.F., A. Tottene, V.A. Lennon, S.M. Wilson, S.J. Dubel, R. Paylor, D.A.
154 Hosford, L. Tessarollo, M.W. McEnery, D. Pietrobon, N.G. Copeland, and N.A.
Jenkins. 2001. Dystonia and cerebellar atrophy in Cacna1a null mice lacking P/Q
calcium channel activity. Faseb J. 15:1288-90.
Flucher, B.E., N. Kasielke, and M. Grabner. 2000. The triad targeting signal of the
skeletal muscle calcium channel is localized in the COOH terminus of the
alpha(1S) subunit. J Cell Biol. 151:467-78.
Forti, L., A. Tottene, A. Moretti, and D. Pietrobon. 1994. Three novel types of
voltage-dependent calcium channels in rat cerebellar neurons. J Neurosci.
14:5243-56.
Fox, A.P., M.C. Nowycky, and R.W. Tsien. 1987. Kinetic and pharmacological
properties distinguishing three types of calcium currents in chick sensory
neurones. J Physiol. 394:149-72.
Francisco, H., B.B. Yellen, D.S. Halverson, G. Friedman, and G. Gallo. 2007. Regulation
of axon guidance and extension by three-dimensional constraints. Biomaterials.
28:3398-407.
Fukata, Y., A.V. Tzingounis, J.C. Trinidad, M. Fukata, A.L. Burlingame, R.A. Nicoll,
and D.S. Bredt. 2005. Molecular constituents of neuronal AMPA receptors. J Cell
Biol. 169:399-404.
Gao, T., M. Bunemann, B.L. Gerhardstein, H. Ma, and M.M. Hosey. 2000. Role of the C
terminus of the alpha 1C (CaV1.2) subunit in membrane targeting of cardiac
L-type calcium channels. J Biol Chem. 275:25436-44.
155 Gao, T., A.J. Chien, and M.M. Hosey. 1999. Complexes of the alpha1C and beta subunits
generate the necessary signal for membrane targeting of class C L-type calcium
channels. J Biol Chem. 274:2137-44.
Gazulla, J., and M. Tintore. 2007. The P/Q-type voltage-dependent calcium channel: a
therapeutic target in spinocerebellar ataxia type 6. Acta Neurol Scand.
115:356-63.
Gerster, U., B. Neuhuber, K. Groschner, J. Striessnig, and B.E. Flucher. 1999. Current
modulation and membrane targeting of the calcium channel alpha1C subunit are
independent functions of the beta subunit. J Physiol. 517 (Pt 2):353-68.
Geurts, F.J., E. De Schutter, and S. Dieudonne. 2003. Unraveling the cerebellar cortex:
cytology and cellular physiology of large-sized interneurons in the granular layer.
Cerebellum. 2:290-9.
Goldberg, Y.P., D.W. Nicholson, D.M. Rasper, M.A. Kalchman, H.B. Koide, R.K.
Graham, M. Bromm, P. Kazemi-Esfarjani, N.A. Thornberry, J.P. Vaillancourt,
and M.R. Hayden. 1996. Cleavage of huntingtin by apopain, a proapoptotic
cysteine protease, is modulated by the polyglutamine tract. Nat Genet. 13:442-9.
Green, G.E., K.M. Khan, D.W. Beisel, M.J. Drescher, J.S. Hatfield, and D.G. Drescher.
1996. Calcium channel subunits in the mouse cochlea. J Neurochem. 67:37-45.
Green, M.C., and R.L. Sidman. 1962. Tottering--a neuromusclar mutation in the mouse.
And its linkage with oligosyndacylism. J Hered. 53:233-7.
Gruenberg, J. 2001. The endocytic pathway: a mosaic of domains. Nat Rev Mol Cell Biol.
156 2:721-30.
Gruol, D.L. 1983. Cultured cerebellar neurons: endogenous and exogenous components
of Purkinje cell activity and membrane response to putative transmitters. Brain
Res. 263:223-41.
Guida, S., F. Trettel, S. Pagnutti, E. Mantuano, A. Tottene, L. Veneziano, T. Fellin, M.
Spadaro, K. Stauderman, M. Williams, S. Volsen, R. Ophoff, R. Frants, C. Jodice,
M. Frontali, and D. Pietrobon. 2001. Complete loss of P/Q calcium channel
activity caused by a CACNA1A missense mutation carried by patients with
episodic ataxia type 2. Am J Hum Genet. 68:759-64.
Han, J., M.D. Mark, X. Li, M. Xie, S. Waka, J. Rettig, and S. Herlitze. 2006. RGS2
determines short-term synaptic plasticity in hippocampal neurons by regulating
Gi/o mediated inhibition of presynaptic Ca2+ channels. Neuron. 51:575-86.
Hanlon, M.R., N.S. Berrow, A.C. Dolphin, and B.A. Wallace. 1999. Modelling of a
voltage-dependent Ca2+ channel beta subunit as a basis for understanding its
functional properties. FEBS Lett. 445:366-70.
Hans, M., S. Luvisetto, M.E. Williams, M. Spagnolo, A. Urrutia, A. Tottene, P.F. Brust,
E.C. Johnson, M.M. Harpold, K.A. Stauderman, and D. Pietrobon. 1999.
Functional consequences of mutations in the human alpha1A calcium channel
subunit linked to familial hemiplegic migraine. J Neurosci. 19:1610-9.
Heikal, A.A., S.T. Hess, G.S. Baird, R.Y. Tsien, and W.W. Webb. 2000. Molecular
spectroscopy and dynamics of intrinsically fluorescent proteins: coral red (dsRed)
157 and yellow (Citrine). Proc Natl Acad Sci U S A. 97:11996-2001.
Hell, J.W., R.E. Westenbroek, L.J. Breeze, K.K. Wang, C. Chavkin, and W.A. Catterall.
1996. N-methyl-D-aspartate receptor-induced proteolytic conversion of
postsynaptic class C L-type calcium channels in hippocampal neurons. Proc Natl
Acad Sci U S A. 93:3362-7.
Hell, J.W., R.E. Westenbroek, C. Warner, M.K. Ahlijanian, W. Prystay, M.M. Gilbert,
T.P. Snutch, and W.A. Catterall. 1993. Identification and differential subcellular
localization of the neuronal class C and class D L-type calcium channel alpha 1
subunits. J Cell Biol. 123:949-62.
Hendry, I.A. 1976. A method to correct adequately for the change in neuronal size when
estimating neuronal numbers after nerve growth factor treatment. J Neurocytol.
5:337-49.
Herlitze, S. 2005. Sorting and trafficking of voltage gated Ca2+ channels in neurons: The
C-terminus and the dynein motor complex. Cellscience Reviews. 1:4-10.
Herlitze, S., D.E. Garcia, K. Mackie, B. Hille, T. Scheuer, and W.A. Catterall. 1996a.
Modulation of Ca2+ channels by G-protein beta gamma subunits. Nature.
380:258-62.
Herlitze, S., G.H. Hockerman, T. Scheuer, and W.A. Catterall. 1997. Molecular
determinants of inactivation and G protein modulation in the intracellular loop
connecting domains I and II of the calcium channel alpha1A subunit. Proc Natl
Acad Sci U S A. 94:1512-6.
158 Herlitze, S., and M. Koenen. 1990. A general and rapid mutagenesis method using
polymerase chain reaction. Gene. 91:143-147.
Herlitze, S., and M.D. Mark. 2005. Distribution and targeting mechanisms of voltage
activated Ca2+ channels. Kluwer Academic/Plenum Publishers, New York, New
York, Georgetown, Texas. 113-40 pp.
Herlitze, S., M. Raditsch, J.P. Ruppersberg, W. Jahn, H. Monyer, R. Schoepfer, and V.
Witzemann. 1993. Argiotoxin detects molecular differences in AMPA receptor
channels. Neuron. 10:1131-40.
Herlitze, S., J.P. Ruppersberg, and M.D. Mark. 1999. New roles for RGS2, 5 and 8 on the
ratio-dependent modulation of recombinant GIRK channels expressed in Xenopus
oocytes. J Physiol. 517:341-52.
Herlitze, S., A. Villarroel, V. Witzemann, M. Koenen, and B. Sakmann. 1996b. Structural
determinants of channel conductance in fetal and adult rat muscle acetylcholine
receptors. J Physiol (Lond). 492:775-87.
Herlitze, S., M. Xie, J. Jan, A. Hummer, K.V. Melnik-Martinez, R.L. Moreno, and M.D.
Mark. 2003. Targeting Mechanisms of High Voltage-Activated Ca2+ Channels. J
Bioenerg Biomembr. 35:621-637.
Herlitze, S., H. Zhong, T. Scheuer, and W.A. Catterall. 2001. An Allosteric Mechanism
for Modulation of Ca2+ Channels by G Proteins, Voltage-dependent Facilitation,
Protein Kinase C, and Cavb Subunits. Proc Natl Acad Sci U S A. 98:4699-4704.
Herrup, K., and K. Sunter. 1987. Numerical matching during cerebellar development:
159 quantitative analysis of granule cell death in staggerer mouse chimeras. J
Neurosci. 7:829-36.
Herrup, K., and S.L. Wilczynski. 1982. Cerebellar cell degeneration in the leaner mutant
mouse. Neuroscience. 7:2185-96.
Hess, E.J., and M.C. Wilson. 1991. Tottering and leaner mutations perturb transient
developmental expression of tyrosine hydroxylase in embryologically distinct
Purkinje cells. Neuron. 6:123-32.
Hibino, H., R. Pironkova, O. Onwumere, M. Rousset, P. Charnet, A.J. Hudspeth, and F.
Lesage. 2003. Direct interaction with a nuclear protein and regulation of gene
silencing by a variant of the Ca2+-channel beta 4 subunit. Proc Natl Acad Sci U S
A. 100:307-12.
Hibino, H., R. Pironkova, O. Onwumere, M. Vologodskaia, A.J. Hudspeth, and F. Lesage.
2002. RIM binding proteins (RBPs) couple Rab3-interacting molecules (RIMs) to
voltage-gated Ca(2+) channels. Neuron. 34:411-23.
Hikosaka, O., K. Nakamura, K. Sakai, and H. Nakahara. 200. Central mechanisms of
motor skill learning. Curr Opin Neurobiol. 12:217-22.
Hu, Q., H. Saegusa, Y. Hayashi, and T. Tanabe. 2005. The carboxy-terminal tail region
of human Cav2.1 (P/Q-type) channel is not an essential determinant for its
subcellular localization in cultured neurones. Genes Cells. 10:87-96.
Hudmon, A., H. Schulman, J. Kim, J.M. Maltez, R.W. Tsien, and G.S. Pitt. 2005.
160 CaMKII tethers to L-type Ca2+ channels, establishing a local and dedicated
integrator of Ca2+ signals for facilitation. J Cell Biol. 171:537-47.
Huguenard, J.R. 1996. Low-threshold calcium currents in central nervous system neurons.
Annu Rev Physiol. 58:329-48.
Hummer, A., O. Delzeith, S.R. Gomez, R.L. Moreno, M.D. Mark, and S. Herlitze. 2003.
Competitive and synergistic interactions of G protein beta(2) and Ca(2+) channel
beta(1b) subunits with Ca(v)2.1 channels, revealed by mammalian two-hybrid and
fluorescence resonance energy transfer measurements. J Biol Chem.
278:49386-400.
Ikeda, H., M. Yamaguchi, S. Sugai, Y. Aze, S. Narumiya, and A. Kakizuka. 1996.
Expanded polyglutamine in the Machado-Joseph disease protein induces cell
death in vitro and in vivo. Nat Genet. 13:196-202.
Inchauspe, C.G., F.J. Martini, I.D. Forsythe, and O.D. Uchitel. 2004. Functional
compensation of P/Q by N-type channels blocks short-term plasticity at the calyx
of held presynaptic terminal. J Neurosci. 24:10379-83.
Ino, M., T. Yoshinaga, M. Wakamori, N. Miyamoto, E. Takahashi, J. Sonoda, T. Kagaya,
T. Oki, T. Nagasu, Y. Nishizawa, I. Tanaka, K. Imoto, S. Aizawa, S. Koch, A.
Schwartz, T. Niidome, K. Sawada, and Y. Mori. 2001. Functional disorders of the
sympathetic nervous system in mice lacking the alpha 1B subunit (Cav 2.2) of
N-type calcium channels. Proc Natl Acad Sci U S A. 98:5323-8.
Ishikawa, K., H. Fujigasaki, H. Saegusa, K. Ohwada, T. Fujita, H. Iwamoto, Y.
161 Komatsuzaki, S. Toru, H. Toriyama, M. Watanabe, N. Ohkoshi, S. Shoji, I.
Kanazawa, T. Tanabe, and H. Mizusawa. 1999a. Abundant expression and
cytoplasmic aggregations of [alpha]1A voltage-dependent calcium channel
protein associated with neurodegeneration in spinocerebellar ataxia type 6. Hum
Mol Genet. 8:1185-93.
Ishikawa, K., and H. Mizusawa. 1999. [Clinical, neuropathological and genetic
characteristics of spinocerebellar ataxia type 6 (SCA6)]. Nippon Rinsho.
57:880-5.
Ishikawa, K., K. Owada, K. Ishida, H. Fujigasaki, M. Shun Li, T. Tsunemi, N. Ohkoshi,
S. Toru, T. Mizutani, M. Hayashi, N. Arai, K. Hasegawa, T. Kawanami, T. Kato,
T. Makifuchi, S. Shoji, T. Tanabe, and H. Mizusawa. 2001. Cytoplasmic and
nuclear polyglutamine aggregates in SCA6 Purkinje cells. Neurology. 56:1753-6.
Ishikawa, K., M. Watanabe, K. Yoshizawa, T. Fujita, H. Iwamoto, T. Yoshizawa, K.
Harada, K. Nakamagoe, Y. Komatsuzaki, A. Satoh, M. Doi, T. Ogata, I.
Kanazawa, S. Shoji, and H. Mizusawa. 1999b. Clinical, neuropathological, and
molecular study in two families with spinocerebellar ataxia type 6 (SCA6). J
Neurol Neurosurg Psychiatry. 67:86-9.
Iwashima, Y., W. Pugh, A.M. Depaoli, J. Takeda, S. Seino, G.I. Bell, and K.S. Polonsky.
1993. Expression of calcium channel mRNAs in rat pancreatic islets and
downregulation after glucose infusion. Diabetes. 42:948-55.
Iwata, A., J.C. Christianson, M. Bucci, L.M. Ellerby, N. Nukina, L.S. Forno, and R.R.
162 Kopito. 2005. Increased susceptibility of cytoplasmic over nuclear polyglutamine
aggregates to autophagic degradation. Proc Natl Acad Sci U S A. 102:13135-40.
Jacquin, T.D., and D.L. Gruol. 1999. Ca2+ regulation of a large conductance K+ channel
in cultured rat cerebellar Purkinje neurons. Eur J Neurosci. 11:735-9.
Jana, N.R., and N. Nukina. 2004. Misfolding promotes the ubiquitination of
polyglutamine-expanded ataxin-3, the defective gene product in SCA3/MJD.
Neurotox Res. 6:523-33.
Jares-Erijman, E.A., and T.M. Jovin. 2003. FRET imaging. Nat Biotechnol. 21:1387-95.
Jarvis, S.E., and G.W. Zamponi. 2001. Interactions between presynaptic Ca2+ channels,
cytoplasmic messengers and proteins of the synaptic vesicle release complex.
Trends Pharmacol Sci. 22:519-25.
Jones, S.W. 1998. Overview of voltage-dependent calcium channels. J Bioenerg
Biomembr. 30:299-312.
Jones, S.W. 2002. Calcium channels: when is a subunit not a subunit? J Physiol. 545:334.
Ju, W., W. Morishita, J. Tsui, G. Gaietta, T.J. Deerinck, S.R. Adams, C.C. Garner, R.Y.
Tsien, M.H. Ellisman, and R.C. Malenka. 2004. Activity-dependent regulation of
dendritic synthesis and trafficking of AMPA receptors. Nat Neurosci. 7:244-53.
Jun, K., E.S. Piedras-Renteria, S.M. Smith, D.B. Wheeler, S.B. Lee, T.G. Lee, H. Chin,
M.E. Adams, R.H. Scheller, R.W. Tsien, and H.S. Shin. 1999. Ablation of
P/Q-type Ca(2+) channel currents, altered synaptic transmission, and progressive
163 ataxia in mice lacking the alpha(1A)-subunit. Proc Natl Acad Sci U S A.
96:15245-50.
Kabeya, Y., N. Mizushima, T. Ueno, A. Yamamoto, T. Kirisako, T. Noda, E. Kominami,
Y. Ohsumi, and T. Yoshimori. 2000. LC3, a mammalian homologue of yeast
Apg8p, is localized in autophagosome membranes after processing. Embo J.
19:5720-8.
Kaneda, M., M. Wakamori, C. Ito, and N. Akaike. 1990. Low-threshold calcium current
in isolated Purkinje cell bodies of rat cerebellum. J Neurophysiol. 63:1046-51.
Kang, M.G., C.C. Chen, R. Felix, V.A. Letts, W.N. Frankel, Y. Mori, and K.P. Campbell.
2001. Biochemical and biophysical evidence for gamma 2 subunit association
with neuronal voltage-activated Ca2+ channels. J Biol Chem. 276:32917-24.
Kano, M., K. Hashimoto, C. Chen, A. Abeliovich, A. Aiba, H. Kurihara, M. Watanabe, Y.
Inoue, and S. Tonegawa. 1995. Impaired synapse elimination during cerebellar
development in PKC gamma mutant mice. Cell. 83:1223-31.
Kobayashi, T., Y. Yamada, M. Fukao, K. Shiratori, M. Tsutsuura, K. Tanimoto, and N.
Tohse. 2007. The GK domain of the voltage-dependent calcium channel beta
subunit is essential for binding to the alpha subunit. Biochem Biophys Res
Commun. 360:679-83.
Kobrinsky, E., E. Schwartz, D.R. Abernethy, and N.M. Soldatov. 2003. Voltage-gated
mobility of the Ca2+ channel cytoplasmic tails and its regulatory role. J Biol
Chem. 278:5021-8.
164 Koeppen, A.H. 2005. The pathogenesis of spinocerebellar ataxia. Cerebellum. 4:62-73.
Kordasiewicz, H.B., and C.M. Gomez. 2007. Molecular pathogenesis of spinocerebellar
ataxia type 6. Neurotherapeutics. 4:285-94.
Kordasiewicz, H.B., R.M. Thompson, H.B. Clark, and C.M. Gomez. 2006. C-termini of
P/Q-type Ca2+ channel alpha1A subunits translocate to nuclei and promote
polyglutamine-mediated toxicity. Hum Mol Genet. 15:1587-99.
Kubodera, T., T. Yokota, K. Ohwada, K. Ishikawa, H. Miura, T. Matsuoka, and H.
Mizusawa. 2003. Proteolytic cleavage and cellular toxicity of the human alpha1A
calcium channel in spinocerebellar ataxia type 6. Neurosci Lett. 341:74-8.
Kulik, A., K. Nakadate, A. Hagiwara, Y. Fukazawa, R. Lujan, H. Saito, N. Suzuki, A.
Futatsugi, K. Mikoshiba, M. Frotscher, and R. Shigemoto. 2004.
Immunocytochemical localization of the alpha 1A subunit of the P/Q-type
calcium channel in the rat cerebellum. Eur J Neurosci. 19:2169-78.
Kurata, H.T., L.R. Phillips, T. Rose, G. Loussouarn, S. Herlitze, H. Fritzenschaft, D.
Enkvetchakul, C.G. Nichols, and T. Baukrowitz. 2004. Molecular basis of inward
rectification: polyamine interaction sites located by combined channel and ligand
mutagenesis. J Gen Physiol. 124:541-54.
Lai, M., F. Wang, J.G. Rohan, Y. Maeno-Hikichi, Y. Chen, Y. Zhou, G. Gao, W.A.
Sather, and J.F. Zhang. 2005. A tctex1-Ca2+ channel complex for selective
surface expression of Ca2+ channels in neurons. Nat Neurosci. 8:435-42.
Lambright, D.G., J. Sondek, A. Bohm, N.P. Skiba, H.E. Hamm, and P.B. Sigler. 1996.
165 The 2.0 A crystal structure of a heterotrimeric G protein. Nature. 379:311-9.
Lee, J.H., A.N. Daud, L.L. Cribbs, A.E. Lacerda, A. Pereverzev, U. Klockner, T.
Schneider, and E. Perez-Reyes. 1999. Cloning and expression of a novel member
of the low voltage-activated T-type calcium channel family. J Neurosci.
19:1912-21.
Leitner, B., P. Lovisetti-Scamihorn, J. Heilmann, J. Striessnig, R.D. Blakely, L.E. Eiden,
and H. Winkler. 1999. Subcellular localization of chromogranins, calcium
channels, amine carriers, and proteins of the exocytotic machinery in bovine
splenic nerve. J Neurochem. 72:1110-6.
Leveque, C., O. el Far, N. Martin-Moutot, K. Sato, R. Kato, M. Takahashi, and M.J.
Seagar. 1994. Purification of the N-type calcium channel associated with syntaxin
and synaptotagmin. A complex implicated in synaptic vesicle exocytosis. J Biol
Chem. 269:6306-12.
Li, X., D. Gutierrez, M.G. Hanson, J. Han, M.D. Mark, H. Chiel, P. Hegemann, L.T.
Landmesser, and S. Herlitze. 2005a. Fast non-invasive activation and inhibition of
neural and network activity by vertebrate rhodopsin and green algae
channelrhodopsin. Proc Natl Acad Sci USA. 102:17816-21.
Li, X., A. Hummer, J. Han, M. Xie, K. Melnik-Martinez, R.L. Moreno, M. Buck, M.D.
Mark, and S. Herlitze. 2005b. G protein beta2 subunit-derived peptides for
inhibition and induction of G protein pathways. Examination of voltage-gated
Ca2+ and G protein inwardly rectifying K+ channels. J Biol Chem.
166 280:23945-59.
Liu, S., and D.D. Friel. 2004. Absence of spontaneous electrical activity in cerebellar
Purkinje cells from leaner mice - A causative role in ataxia? J Neurosci
Abstract:638.14.
Livak, K.J., and T.D. Schmittgen. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods.
25:402-8.
Llinas, R., M. Sugimori, J.W. Lin, and B. Cherksey. 1989. Blocking and isolation of a
calcium channel from neurons in mammals and cephalopods utilizing a toxin
fraction (FTX) from funnel-web spider poison. Proc Natl Acad Sci U S A.
86:1689-93.
Lorenzon, N.M., C.M. Lutz, W.N. Frankel, and K.G. Beam. 1998. Altered calcium
channel currents in Purkinje cells of the neurological mutant mouse leaner. J
Neurosci. 18:4482-9.
Ludwig, A., V. Flockerzi, and F. Hofmann. 1997. Regional expression and cellular
localization of the alpha1 and beta subunit of high voltage-activated calcium
channels in rat brain. J Neurosci. 17:1339-49.
Luvisetto, S., T. Fellin, M. Spagnolo, B. Hivert, P.F. Brust, M.M. Harpold, K.A.
Stauderman, M.E. Williams, and D. Pietrobon. 2004. Modal gating of human
CaV2.1 (P/Q-type) calcium channels: I. The slow and the fast gating modes and
their modulation by beta subunits. J Gen Physiol. 124:445-61.
167 Malenka, R.C. 2003. Synaptic plasticity and AMPA receptor trafficking. Ann N Y Acad
Sci. 1003:1-11.
Manto, M.U. 2005. The wide spectrum of spinocerebellar ataxias (SCAs). Cerebellum.
4:2-6.
Mantuano, E., L. Veneziano, C. Jodice, and M. Frontali. 2003. Spinocerebellar ataxia
type 6 and episodic ataxia type 2: differences and similarities between two allelic
disorders. Cytogenet Genome Res. 100:147-53.
Mark, M.D., Y. Liu, S.T. Wong, T.R. Hinds, and D.R. Storm. 1995. Stimulation of
neurite outgrowth in PC12 cells by EGF and KCl depolarization: a
Ca(2+)-independent phenomenon. J Cell Biol. 130:701-10.
Mark, M.D., J.P. Ruppersberg, and S. Herlitze. 2000a. Regulation of GIRK channel
deactivation by Galpha(q) and Galpha(i/o) pathways. Neuropharmacology.
39:2360-73.
Mark, M.D., S. Wittemann, and S. Herlitze. 2000b. G protein modulation of recombinant
P/Q-type calcium channels by regulators of G protein signalling proteins. J
Physiol. 528 Pt 1:65-77.
Matsuyama, Z., M. Wakamori, Y. Mori, H. Kawakami, S. Nakamura, and K. Imoto. 1999.
Direct alteration of the P/Q-type Ca2+ channel property by polyglutamine
expansion in spinocerebellar ataxia 6. J Neurosci. 19:RC14.
Maximov, A., and I. Bezprozvanny. 2002. Synaptic targeting of N-type calcium channels
in hippocampal neurons. J Neurosci. 22:6939-52.
168 Maximov, A., T.C. Sudhof, and I. Bezprozvanny. 1999. Association of neuronal calcium
channels with modular adaptor proteins. J Biol Chem. 274:24453-6.
McDonough, S.I., and B.P. Bean. 1998. Mibefradil inhibition of T-type calcium channels
in cerebellar purkinje neurons. Mol Pharmacol. 54:1080-7.
McDonough, S.I., K.J. Swartz, I.M. Mintz, L.M. Boland, and B.P. Bean. 1996. Inhibition
of calcium channels in rat central and peripheral neurons by omega-conotoxin
MVIIC. J Neurosci. 16:2612-23.
McEnery, M.W., A.M. Snowman, A.H. Sharp, M.E. Adams, and S.H. Snyder. 1991.
Purified omega-conotoxin GVIA receptor of rat brain resembles a
dihydropyridine-sensitive L-type calcium channel. Proc Natl Acad Sci U S A.
88:11095-9.
McGee, A.W., D.A. Nunziato, J.M. Maltez, K.E. Prehoda, G.S. Pitt, and D.S. Bredt. 2004.
Calcium channel function regulated by the SH3-GK module in beta subunits.
Neuron. 42:89-99.
McRory, J.E., C.M. Santi, K.S. Hamming, J. Mezeyova, K.G. Sutton, D.L. Baillie, A.
Stea, and T.P. Snutch. 2001. Molecular and functional characterization of a family
of rat brain T-type calcium channels. J Biol Chem. 276:3999-4011.
Meyers, E.N., M. Lewandoski, and G.R. Martin. 1998. An Fgf8 mutant allelic series
generated by Cre- and Flp-mediated recombination. Nat Genet. 18:136-41.
Mikami, A., K. Imoto, T. Tanabe, T. Niidome, Y. Mori, H. Takeshima, S. Narumiya, and
S. Numa. 1989. Primary structure and functional expression of the cardiac
169 dihydropyridine-sensitive calcium channel. Nature. 340:230-3.
Mintz, I.M., M.E. Adams, and B.P. Bean. 1992a. P-type calcium channels in rat central
and peripheral neurons. Neuron. 9:85-95.
Mintz, I.M., B.L. Sabatini, and W.G. Regehr. 1995. Calcium control of transmitter
release at a cerebellar synapse. Neuron. 15:675-88.
Mintz, I.M., V.J. Venema, K.M. Swiderek, T.D. Lee, B.P. Bean, and M.E. Adams. 1992b.
P-type calcium channels blocked by the spider toxin omega-Aga-IVA. Nature.
355:827-9.
Miyazaki, T., K. Hashimoto, H.S. Shin, M. Kano, and M. Watanabe. 2004. P/Q-type
Ca2+ channel alpha1A regulates synaptic competition on developing cerebellar
Purkinje cells. J Neurosci. 24:1734-43.
Nagy, A. 2000. Cre recombinase: the universal reagent for genome tailoring. Genesis.
26:99-109.
Nagy, A., C. Moens, E. Ivanyi, J. Pawling, M. Gertsenstein, A.K. Hadjantonakis, M.
Pirity, and J. Rossant. 1998. Dissecting the role of N-myc in development using a
single targeting vector to generate a series of alleles. Curr Biol. 8:661-4.
Nakamura, K., S.Y. Jeong, T. Uchihara, M. Anno, K. Nagashima, T. Nagashima, S. Ikeda,
S. Tsuji, and I. Kanazawa. 2001. SCA17, a novel autosomal dominant cerebellar
ataxia caused by an expanded polyglutamine in TATA-binding protein. Hum Mol
Genet. 10:1441-8.
Nisimaru, N. 2004. Cardiovascular modules in the cerebellum. Jpn J Physiol. 54:431-48.
170 Nowycky, M.C., A.P. Fox, and R.W. Tsien. 1985. Three types of neuronal calcium
channel with different calcium agonist sensitivity. Nature. 316:440-3.
O'Gorman, S., N.A. Dagenais, M. Qian, and Y. Marchuk. 1997. Protamine-Cre
recombinase transgenes efficiently recombine target sequences in the male germ
line of mice, but not in embryonic stem cells. Proc Natl Acad Sci U S A.
94:14602-7.
Oberdick, J., R.J. Smeyne, J.R. Mann, S. Zackson, and J.I. Morgan. 1990. A promoter
that drives transgene expression in cerebellar Purkinje and retinal bipolar neurons.
Science. 248:223-6.
Oliveira-Dos-Santos, A.J., G. Matsumoto, B.E. Snow, D. Bai, F.P. Houston, I.Q.
Whishaw, S. Mariathasan, T. Sasaki, A. Wakeham, P.S. Ohashi, J.C. Roder, C.A.
Barnes, D.P. Siderovski, and J.M. Penninger. 2000. Regulation of T cell
activation, anxiety, and male aggression by RGS2. Proc Natl Acad Sci U S A.
97:12272-7.
Opatowsky, Y., C.C. Chen, K.P. Campbell, and J.A. Hirsch. 2004. Structural analysis of
the voltage-dependent calcium channel beta subunit functional core and its
complex with the alpha 1 interaction domain. Neuron. 42:387-99.
Orr, H.T. 2001. Beyond the Qs in the polyglutamine diseases. Genes Dev. 15:925-32.
Otsu, Y., V. Shahrezaei, B. Li, L.A. Raymond, K.R. Delaney, and T.H. Murphy. 2004.
Competition between phasic and asynchronous release for recovered synaptic
vesicles at developing hippocampal autaptic synapses. J Neurosci. 24:420-33.
171 Peiro, S., J.X. Comella, C. Enrich, D. Martin-Zanca, and N. Rocamora. 2000. PC12 cells
have caveolae that contain TrkA. Caveolae-disrupting drugs inhibit nerve growth
factor-induced, but not epidermal growth factor-induced, MAPK phosphorylation.
J Biol Chem. 275:37846-52
Perez, M.K., H.L. Paulson, S.J. Pendse, S.J. Saionz, N.M. Bonini, and R.N. Pittman.
1998. Recruitment and the role of nuclear localization in polyglutamine-mediated
aggregation. J Cell Biol. 143:1457-70.
Perez-Reyes, E. 1999. Three for T: molecular analysis of the low voltage-activated
calcium channel family. Cell Mol Life Sci. 56:660-9.
Perez-Reyes, E., L.L. Cribbs, A. Daud, A.E. Lacerda, J. Barclay, M.P. Williamson, M.
Fox, M. Rees, and J.H. Lee. 1998. Molecular characterization of a neuronal
low-voltage-activated T-type calcium channel. Nature. 391:896-900.
Piedras-Renteria, E.S., K. Watase, N. Harata, O. Zhuchenko, H.Y. Zoghbi, C.C. Lee, and
R.W. Tsien. 2001. Increased expression of alpha 1A Ca2+ channel currents
arising from expanded trinucleotide repeats in spinocerebellar ataxia type 6. J
Neurosci. 21:9185-93.
Pietrobon, D. 2005. Function and dysfunction of synaptic calcium channels: insights from
mouse models. Curr Opin Neurobiol. 15:257-65.
Potier, B., P. Dutar, and Y. Lamour. 1993. Different effects of omega-conotoxin GVIA at
excitatory and inhibitory synapses in rat CA1 hippocampal neurons. Brain Res.
616:236-41.
172 Puri, C., D. Tosoni, R. Comai, A. Rabellino, D. Segat, F. Caneva, P. Luzzi, P.P. Di Fiore,
and C. Tacchetti. 2005. Relationships between EGFR signaling-competent and
endocytosis-competent membrane microdomains. Mol Biol Cell. 16:2704-18.
Pyott, S.J., and C. Rosenmund. 2002. The effects of temperature on vesicular supply and
release in autaptic cultures of rat and mouse hippocampal neurons. J Physiol.
539:523-35.
Raman, I.M., and B.P. Bean. 1997. Resurgent sodium current and action potential
formation in dissociated cerebellar Purkinje neurons. J Neurosci. 17:4517-26.
Raman, I.M., and B.P. Bean. 1999. Ionic currents underlying spontaneous action
potentials in isolated cerebellar Purkinje neurons. J Neurosci. 19:1663-74.
Randall, A., and R.W. Tsien. 1995. Pharmacological dissection of multiple types of Ca2+
channel currents in rat cerebellar granule neurons. J Neurosci. 15:2995-3012.
Randall, A.D., and R.W. Tsien. 1997. Contrasting biophysical and pharmacological
properties of T-type and R-type calcium channels. Neuropharmacology.
36:879-93.
Regan, L.J. 1991. Voltage-dependent calcium currents in Purkinje cells from rat
cerebellar vermis. J Neurosci. 11:2259-69.
Reid, C.A., J.M. Bekkers, and J.D. Clements. 1998. N- and P/Q-type Ca2+ channels
mediate transmitter release with a similar cooperativity at rat hippocampal
autapses. J Neurosci. 18:2849-55.
Restituito, S., R.M. Thompson, J. Eliet, R.S. Raike, M. Riedl, P. Charnet, and C.M.
173 Gomez. 2000. The polyglutamine expansion in spinocerebellar ataxia type 6
causes a beta subunit-specific enhanced activation of P/Q-type calcium channels
in Xenopus oocytes. J Neurosci. 20:6394-403.
Reynolds, I.J., J.A. Wagner, S.H. Snyder, S.A. Thayer, B.M. Olivera, and R.J. Miller.
1986. Brain voltage-sensitive calcium channel subtypes differentiated by
omega-conotoxin fraction GVIA. Proc Natl Acad Sci U S A. 83:8804-7.
Richards, M.W., A.J. Butcher, and A.C. Dolphin. 2004. Ca2+ channel beta-subunits:
structural insights AID our understanding. Trends Pharmacol Sci. 25:626-32.
Riley, B.E., H.Y. Zoghbi, and H.T. Orr. 2005. SUMOylation of the polyglutamine repeat
protein, ataxin-1, is dependent on a functional nuclear localization signal. J Biol
Chem. 280:21942-8.
Rosenmund, C., and C.F. Stevens. 1996. Definition of the readily releasable pool of
vesicles at hippocampal synapses. Neuron. 16:1197-207.
Ross, C.A. 1997. Intranuclear neuronal inclusions: a common pathogenic mechanism for
glutamine-repeat neurodegenerative diseases? Neuron. 19:1147-50.
Ross, C.A., and M.A. Poirier. 2005. Opinion: What is the role of protein aggregation in
neurodegeneration? Nat Rev Mol Cell Biol. 6:891-8.
Roth, B.L., D.J. Sheffler, and W.K. Kroeze. 2004. Magic shotguns versus magic bullets:
selectively non-selective drugs for mood disorders and schizophrenia. Nat Rev
Drug Discov. 3:353-9.
Rousset, M., T. Cens, and P. Charnet. 2005. Alone at last! New functions for Ca2+
174 channel beta subunits? Sci STKE. 2005:pe11.
Rousset, M., T. Cens, S. Restituito, C. Barrere, J.L. Black, 3rd, M.W. McEnery, and P.
Charnet. 2001. Functional roles of gamma2, gamma3 and gamma4, three new
Ca2+ channel subunits, in P/Q-type Ca2+ channel expressed in Xenopus oocytes.
J Physiol. 532:583-93.
Rustay, N.R., D. Wahlsten, and J.C. Crabbe. 2003. Influence of task parameters on
rotarod performance and sensitivity to ethanol in mice. Behav Brain Res.
141:237-49.
Sabatini, B.L., and W.G. Regehr. 1999. Timing of synaptic transmission. Annu Rev
Physiol. 61:521-42.
Saegusa, H., T. Kurihara, S. Zong, A. Kazuno, Y. Matsuda, T. Nonaka, W. Han, H.
Toriyama, and T. Tanabe. 2001. Suppression of inflammatory and neuropathic
pain symptoms in mice lacking the N-type Ca2+ channel. Embo J. 20:2349-56.
Safa, P., J. Boulter, and T.G. Hales. 2001. Functional properties of Cav1.3 (alpha1D)
L-type Ca2+ channel splice variants expressed by rat brain and neuroendocrine
GH3 cells. J Biol Chem. 276:38727-37.
Sakmann, B., and E. Neher. 1995. Single-Channel Recording. Plenum Press.
Sakurai, T., R.E. Westenbroek, J. Rettig, J. Hell, and W.A. Catterall. 1996. Biochemical
properties and subcellular distribution of the BI and rbA isoforms of alpha1A
subunits of brain calcium channels. J Cell Biol. 134:511-28.
Sandoz, G., D. Bichet, V. Cornet, Y. Mori, R. Felix, and M. De Waard. 2001. Distinct
175 properties and differential beta subunit regulation of two C-terminal isoforms of
the P/Q-type Ca(2+)-channel alpha(1A) subunit. Eur J Neurosci. 14:987-97.
Sandoz, G., I. Lopez-Gonzalez, S. Stamboulian, N. Weiss, C. Arnoult, and M. De Waard.
2004. Repositioning of charged I-II loop amino acid residues within the electric
field by beta subunit as a novel working hypothesis for the control of fast P/Q
calcium channel inactivation. Eur J Neurosci. 19:1759-72.
Sasaki, H., I. Yabe, and K. Tashiro. 2003. The hereditary spinocerebellar ataxias in Japan.
Cytogenet Genome Res. 100:198-205.
Sawada, K., S. Komatsu, H. Haga, X.Z. Sun, S. Hisano, and Y. Fukui. 1999. Abnormal
expression of tyrosine hydroxylase immunoreactivity in cerebellar cortex of
ataxic mutant mice. Brain Res. 829:107-12.
Scherzinger, E., A. Sittler, K. Schweiger, V. Heiser, R. Lurz, R. Hasenbank, G.P. Bates,
H. Lehrach, and E.E. Wanker. 1999. Self-assembly of polyglutamine-containing
huntingtin fragments into amyloid-like fibrils: implications for Huntington's
disease pathology. Proc Natl Acad Sci U S A. 96:4604-9.
Schilling, G., J.D. Wood, K. Duan, H.H. Slunt, V. Gonzales, M. Yamada, J.K. Cooper,
R.L. Margolis, N.A. Jenkins, N.G. Copeland, H. Takahashi, S. Tsuji, D.L. Price,
D.R. Borchelt, and C.A. Ross. 1999. Nuclear accumulation of truncated
atrophin-1 fragments in a transgenic mouse model of DRPLA. Neuron.
24:275-86.
Schols, L., P. Bauer, T. Schmidt, T. Schulte, and O. Riess. 2004. Autosomal dominant
176 cerebellar ataxias: clinical features, genetics, and pathogenesis. Lancet Neurol.
3:291-304.
Scott, M.M., K.C. Krueger, and E.S. Deneris. 2005. A differentially autoregulated Pet-1
enhancer region is a critical target of the transcriptional cascade that governs
serotonin neuron development. J Neurosci. 25:2628-36.
Scott, V.E., R. Felix, J. Arikkath, and K.P. Campbell. 1998. Evidence for a 95 kDa short
form of the alpha1A subunit associated with the omega-conotoxin MVIIC
receptor of the P/Q-type Ca2+ channels. J Neurosci. 18:641-7.
Scotti, A.L., and C. Nitsch. 1992. Differential Ca2+ binding properties in the human
cerebellar cortex: distribution of parvalbumin and calbindin D-28k
immunoreactivity. Anat Embryol (Berl). 185:163-7.
Shaner, N.C., R.E. Campbell, P.A. Steinbach, B.N. Giepmans, A.E. Palmer, and R.Y.
Tsien. 2004. Improved monomeric red, orange and yellow fluorescent proteins
derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 22:1567-72.
Shapira, M., R.G. Zhai, T. Dresbach, T. Bresler, V.I. Torres, E.D. Gundelfinger, N.E. Ziv,
and C.C. Garner. 2003. Unitary assembly of presynaptic active zones from
Piccolo-Bassoon transport vesicles. Neuron. 38:237-52.
Shaywitz, A.J., and M.E. Greenberg. 1999. CREB: a stimulus-induced transcription
factor activated by a diverse array of extracellular signals. Annu Rev Biochem.
68:821-61.
Shepherd, G.M. 2004. The synaptic organization of the brain. Oxford University Press.
177 Sher, E., A. Pandiella, and F. Clementi. 1988. Omega-conotoxin binding and effects on
calcium channel function in human neuroblastoma and rat pheochromocytoma
cell lines. FEBS Lett. 235:178-82.
Slemmer, J.E., C.I. De Zeeuw, and J.T. Weber. 2005. Don't get too excited: mechanisms
of glutamate-mediated Purkinje cell death. Prog Brain Res. 148:367-90.
Snutch, T.P., W.J. Tomlinson, J.P. Leonard, and M.M. Gilbert. 1991. Distinct calcium
channels are generated by alternative splicing and are differentially expressed in
the mammalian CNS. Neuron. 7:45-57.
Soong, B.W., and H.L. Paulson. 2007. Spinocerebellar ataxias: an update. Curr Opin
Neurol. 20:438-446.
Spacey, S.D., M.E. Hildebrand, L.A. Materek, T.D. Bird, and T.P. Snutch. 2004.
Functional implications of a novel EA2 mutation in the P/Q-type calcium channel.
Ann Neurol. 56:213-20.
Spafford, J.D., D.W. Munno, P. Van Nierop, Z.P. Feng, S.E. Jarvis, W.J. Gallin, A.B.
Smit, G.W. Zamponi, and N.I. Syed. 2003. Calcium channel structural
determinants of synaptic transmission between identified invertebrate neurons. J
Biol Chem. 278:4258-67.
Spafford, J.D., and G.W. Zamponi. 2003. Functional interactions between presynaptic
calcium channels and the neurotransmitter release machinery. Curr Opin
Neurobiol. 13:308-14.
Stea, A., W.J. Tomlinson, T.W. Soong, E. Bourinet, S.J. Dubel, S.R. Vincent, and T.P.
178 Snutch. 1994. Localization and functional properties of a rat brain alpha 1A
calcium channel reflect similarities to neuronal Q- and P-type channels. Proc Natl
Acad Sci U S A. 91:10576-80.
Stenoien, D.L., M. Mielke, and M.A. Mancini. 2002. Intranuclear ataxin1 inclusions
contain both fast- and slow-exchanging components. Nat Cell Biol. 4:806-10.
Sternberg, P.W., and S.L. Schmid. 1999. Caveolin, cholesterol and Ras signalling. Nat
Cell Biol. 1:E35-7.
Stevens, C.F., and J.F. Wesseling. 1998. Activity-dependent modulation of the rate at
which synaptic vesicles become available to undergo exocytosis. Neuron.
21:415-24.
Swensen, A.M., and B.P. Bean. 2003. Ionic mechanisms of burst firing in dissociated
Purkinje neurons. J Neurosci. 23:9650-63.
Takahashi, S.X., J. Miriyala, and H.M. Colecraft. 2004. Membrane-associated guanylate
kinase-like properties of beta-subunits required for modulation of
voltage-dependent Ca2+ channels. Proc Natl Acad Sci U S A. 101:7193-8.
Takahashi, S.X., J. Miriyala, L.H. Tay, D.T. Yue, and H.M. Colecraft. 2005. A CaVbeta
SH3/guanylate kinase domain interaction regulates multiple properties of
voltage-gated Ca2+ channels. J Gen Physiol. 126:365-77.
Takahashi, S.X., S. Mittman, and H.M. Colecraft. 2003. Distinctive modulatory effects of
five human auxiliary beta2 subunit splice variants on L-type calcium channel
gating. Biophys J. 84:3007-21.
179 Talley, E.M., L.L. Cribbs, J.H. Lee, A. Daud, E. Perez-Reyes, and D.A. Bayliss. 1999.
Differential distribution of three members of a gene family encoding low
voltage-activated (T-type) calcium channels. J Neurosci. 19:1895-911.
Tanaka, O., H. Sakagami, and H. Kondo. 1995. Localization of mRNAs of
voltage-dependent Ca(2+)-channels: four subtypes of alpha 1- and beta-subunits
in developing and mature rat brain. Brain Res Mol Brain Res. 30:1-16.
Thomson, A.M. 2000. Facilitation, augmentation and potentiation at central synapses.
Trends Neurosci. 23:305-12.
Tomita, S., L. Chen, Y. Kawasaki, R.S. Petralia, R.J. Wenthold, R.A. Nicoll, and D.S.
Bredt. 2003. Functional studies and distribution define a family of transmembrane
AMPA receptor regulatory proteins. J Cell Biol. 161:805-16.
Toru, S., T. Murakoshi, K. Ishikawa, H. Saegusa, H. Fujigasaki, T. Uchihara, S.
Nagayama, M. Osanai, H. Mizusawa, and T. Tanabe. 2000. Spinocerebellar ataxia
type 6 mutation alters P-type calcium channel function. J Biol Chem.
275:10893-8.
Tottene, A., T. Fellin, S. Pagnutti, S. Luvisetto, J. Striessnig, C. Fletcher, and D.
Pietrobon. 2002. Familial hemiplegic migraine mutations increase Ca(2+) influx
through single human CaV2.1 channels and decrease maximal CaV2.1 current
density in neurons. Proc Natl Acad Sci U S A. 99:13284-9.
Tsuda, H., H. Jafar-Nejad, A.J. Patel, Y. Sun, H.K. Chen, M.F. Rose, K.J. Venken, J.
Botas, H.T. Orr, H.J. Bellen, and H.Y. Zoghbi. 2005. The AXH domain of
180 Ataxin-1 mediates neurodegeneration through its interaction with Gfi-1/Senseless
proteins. Cell. 122:633-44.
Tybulewicz, V.L., C.E. Crawford, P.K. Jackson, R.T. Bronson, and R.C. Mulligan. 1991.
Neonatal lethality and lymphopenia in mice with a homozygous disruption of the
c-abl proto-oncogene. Cell. 65:1153-63.
Urbano, F.J., E.S. Piedras-Renteria, K. Jun, H.S. Shin, O.D. Uchitel, and R.W. Tsien.
2003. Altered properties of quantal neurotransmitter release at endplates of mice
lacking P/Q-type Ca2+ channels. Proc Natl Acad Sci U S A. 100:3491-6.
Usowicz, M.M., M. Sugimori, B. Cherksey, and R. Llinas. 1992. P-type calcium channels
in the somata and dendrites of adult cerebellar Purkinje cells. Neuron. 9:1185-99.
Van Petegem, F., K.A. Clark, F.C. Chatelain, and D.L. Minor, Jr. 2004. Structure of a
complex between a voltage-gated calcium channel beta-subunit and an
alpha-subunit domain. Nature. 429:671-5.
Vandaele, S., D.T. Nordquist, R.M. Feddersen, I. Tretjakoff, A.C. Peterson, and H.T. Orr.
1991. Purkinje cell protein-2 regulatory regions and transgene expression in
cerebellar compartments. Genes Dev. 5:1136-48.
Vendel, A.C., C.D. Rithner, B.A. Lyons, and W.A. Horne. 2006a. Solution structure of
the N-terminal A domain of the human voltage-gated Ca2+channel beta4a subunit.
Protein Sci. 15:378-83.
Vendel, A.C., M.D. Terry, A.R. Striegel, N.M. Iverson, V. Leuranguer, C.D. Rithner,
B.A. Lyons, G.E. Pickard, S.A. Tobet, and W.A. Horne. 2006b. Alternative
181 splicing of the voltage-gated Ca2+ channel beta4 subunit creates a uniquely
folded N-terminal protein binding domain with cell-specific expression in the
cerebellar cortex. J Neurosci. 26:2635-44.
Verhoef, L.G., K. Lindsten, M.G. Masucci, and N.P. Dantuma. 2002. Aggregate
formation inhibits proteasomal degradation of polyglutamine proteins. Hum Mol
Genet. 11:2689-700.
Volsen, S.G., N.C. Day, A.L. McCormack, W. Smith, P.J. Craig, R. Beattie, P.G. Ince,
P.J. Shaw, S.B. Ellis, A. Gillespie, and et al. 1995. The expression of neuronal
voltage-dependent calcium channels in human cerebellum. Brain Res Mol Brain
Res. 34:271-82.
Wadel, K., E. Neher, and T. Sakaba. 2007. The Coupling between Synaptic Vesicles and
Ca(2+) Channels Determines Fast Neurotransmitter Release. Neuron. 53:563-75.
Wahlsten, D., N.R. Rustay, P. Metten, and J.C. Crabbe. 2003. In search of a better mouse
test. Trends Neurosci. 26:132-6.
Waites, C.L., A.M. Craig, and C.C. Garner. 2005. Mechanisms of vertebrate
synaptogenesis. Annu Rev Neurosci. 28:251-74.
Walker, D., D. Bichet, K.P. Campbell, and M. De Waard. 1998. A beta 4
isoform-specific interaction site in the carboxyl-terminal region of the
voltage-dependent Ca2+ channel alpha 1A subunit. J Biol Chem. 273:2361-7.
Wallrabe, H., and A. Periasamy. 2005. Imaging protein molecules using FRET and FLIM
microscopy. Curr Opin Biotechnol. 16:19-27.
182 Walter, J.T., K. Alvina, M.D. Womack, C. Chevez, and K. Khodakhah. 2006. Decreases
in the precision of Purkinje cell pacemaking cause cerebellar dysfunction and
ataxia. Nat Neurosci. 9:389-97.
Wan, J., R. Khanna, M. Sandusky, D.M. Papazian, J.C. Jen, and R.W. Baloh. 2005.
CACNA1A mutations causing episodic and progressive ataxia alter channel
trafficking and kinetics. Neurology. 64:2090-7.
Wappl, E., A. Koschak, M. Poteser, M.J. Sinnegger, D. Walter, A. Eberhart, K.
Groschner, H. Glossmann, R.L. Kraus, M. Grabner, and J. Striessnig. 2002.
Functional consequences of P/Q-type Ca2+ channel Cav2.1 missense mutations
associated with episodic ataxia type 2 and progressive ataxia. J Biol Chem.
277:6960-6.
Watase, K., K.J. Venken, Y. Sun, H.T. Orr, and H.Y. Zoghbi. 2003. Regional differences
of somatic CAG repeat instability do not account for selective neuronal
vulnerability in a knock-in mouse model of SCA1. Hum Mol Genet. 12:2789-95.
Weiss, N. 2006. The calcium channel beta4a subunit: a scaffolding protein between
voltage-gated calcium channel and presynaptic vesicle-release machinery? J
Neurosci. 26:6117-8.
Westenbroek, R.E., J.W. Hell, C. Warner, S.J. Dubel, T.P. Snutch, and W.A. Catterall.
1992. Biochemical properties and subcellular distribution of an N-type calcium
channel alpha 1 subunit. Neuron. 9:1099-115.
Westenbroek, R.E., T. Sakurai, E.M. Elliott, J.W. Hell, T.V. Starr, T.P. Snutch, and W.A.
183 Catterall. 1995. Immunochemical identification and subcellular distribution of the
alpha 1A subunits of brain calcium channels. J Neurosci. 15:6403-18.
Williams, M.E., D.H. Feldman, A.F. McCue, R. Brenner, G. Velicelebi, S.B. Ellis, and
M.M. Harpold. 1992. Structure and functional expression of alpha 1, alpha 2, and
beta subunits of a novel human neuronal calcium channel subtype. Neuron.
8:71-84.
Wilson, S.M., P.T. Toth, S.B. Oh, S.E. Gillard, S. Volsen, D. Ren, L.H. Philipson, E.C.
Lee, C.F. Fletcher, L. Tessarollo, N.G. Copeland, N.A. Jenkins, and R.J. Miller.
2000. The status of voltage-dependent calcium channels in alpha 1E knock-out
mice. J Neurosci. 20:8566-71.
Wittemann, S., M.D. Mark, J. Rettig, and S. Herlitze. 2000. Synaptic localization and
presynaptic function of calcium channel beta 4-subunits in cultured hippocampal
neurons. J Biol Chem. 275:37807-14.
Womack, M., and K. Khodakhah. 2002a. Active contribution of dendrites to the tonic and
trimodal patterns of activity in cerebellar Purkinje neurons. J Neurosci.
22:10603-12.
Womack, M.D., C. Chevez, and K. Khodakhah. 2004. Calcium-activated potassium
channels are selectively coupled to P/Q-type calcium channels in cerebellar
Purkinje neurons. J Neurosci. 24:8818-22.
Womack, M.D., and K. Khodakhah. 2002b. Characterization of large conductance
Ca2+-activated K+ channels in cerebellar Purkinje neurons. Eur J Neurosci.
184 16:1214-22.
Womack, M.D., and K. Khodakhah. 2003. Somatic and dendritic small-conductance
calcium-activated potassium channels regulate the output of cerebellar purkinje
neurons. J Neurosci. 23:2600-7.
Womack, M.D., and K. Khodakhah. 2004. Dendritic control of spontaneous bursting in
cerebellar Purkinje cells. J Neurosci. 24:3511-21.
Womack, M.D., J.W. Walker, and K. Khodakhah. 2000. Impaired calcium release in
cerebellar Purkinje neurons maintained in culture. J Gen Physiol. 115:339-46.
Wu, L.G., R.E. Westenbroek, J.G.G. Borst, W.A. Catterall, and B. Sakmann. 1999.
Calcium channel types with distinct presynaptic localization couple differentially
to transmitter release in single calyx-type synapses. J Neurosci. 19:726-36.
Wu, L.L., C. Tang, and M.S. Liu. 1997. Hyper- and hypocardiodynamic states are
associated with externalization and internalization, respectively, of
alpha-adrenergic receptors in rat heart during sepsis. Shock. 7:318-23.
Xu, J., and L.G. Wu. 2005. The decrease in the presynaptic calcium current is a major
cause of short-term depression at a calyx-type synapse. Neuron. 46:633-45.
Yamada, Y., M. Nagashima, M. Tsutsuura, T. Kobayashi, S. Seki, N. Makita, Y. Horio,
and N. Tohse. 2001. Cloning of a functional splice variant of L-type calcium
channel beta 2 subunit from rat heart. J Biol Chem. 276:47163-70.
Yang, Q., Y. Hashizume, M. Yoshida, Y. Wang, Y. Goto, N. Mitsuma, K. Ishikawa, and
H. Mizusawa. 2000. Morphological Purkinje cell changes in spinocerebellar
185 ataxia type 6. Acta Neuropathol (Berl). 100:371-6.
Yang, Y., and K. Herrup. 2005. Loss of neuronal cell cycle control in
ataxia-telangiectasia: a unified disease mechanism. J Neurosci. 25:2522-9.
Yoon, K.W., D.F. Covey, and S.M. Rothman. 1993. Multiple mechanisms of picrotoxin
block of GABA-induced currents in rat hippocampal neurons. J Physiol.
464:423-39.
Yu, S.P., L.M. Canzoniero, and D.W. Choi. 2001. Ion homeostasis and apoptosis. Curr
Opin Cell Biol. 13:405-11.
Yusaf, S.P., J. Goodman, R.D. Pinnock, A.K. Dixon, and K. Lee. 2001. Expression of
voltage-gated calcium channel subunits in rat dorsal root ganglion neurons.
Neurosci Lett. 311:137-41.
Zhang, J.F., A.D. Randall, P.T. Ellinor, W.A. Horne, W.A. Sather, T. Tanabe, T.L.
Schwarz, and R.W. Tsien. 1993. Distinctive pharmacology and kinetics of cloned
neuronal Ca2+ channels and their possible counterparts in mammalian CNS
neurons. Neuropharmacology. 32:1075-88.
Zhuchenko, O., J. Bailey, P. Bonnen, T. Ashizawa, D.W. Stockton, C. Amos, W.B.
Dobyns, S.H. Subramony, H.Y. Zoghbi, and C.C. Lee. 1997. Autosomal
dominant cerebellar ataxia (SCA6) associated with small polyglutamine
expansions in the alpha 1A-voltage-dependent calcium channel. Nat Genet.
15:62-9.
Zoghbi, H.Y., and H.T. Orr. 2000. Glutamine repeats and neurodegeneration. Annu Rev
186 Neurosci. 23:217-47.
Zucker, R.S., and W.G. Regehr. 2002. Short-term synaptic plasticity. Annu Rev Physiol.
64:355-405.
Zwingman, T.A., P.E. Neumann, J.L. Noebels, and K. Herrup. 2001. Rocker is a new
variant of the voltage-dependent calcium channel gene Cacna1a. J Neurosci.
21:1169-78.
187