Journal of Cell Science 1 Newhart Alyshia ATRX-dependent repression and transcriptional Daxx of analysis Single-cell Article Research eicroae nohtrcrmtnwt sebya these at assembly (Drane chaperones with different by heterochromatin regulated sites distinct into also to incorporated known active now of is be it sites 2002), states with Henikoff, and chromatin associated (Ahmad Originally transcription of 2010). inheritance al., epigenetic et the (Elsaesser to linked is which 2011). al., events et Zhao regulatory 2010; 2004; al., the et gene al., Shanbhag et observe 2007; of al., Shav-Tal et to (Darzacq organization chromatin at opportunity spatial directly unparalleled of and types an temporal these plasmids such, provide to As fused these and systems expressed. proteins, which binding are (Rafalska-Metcalf their proteins into when cells auto-fluorescent visualized sites be living genomic can in integrate The and visualized 2007). DNA allow be Janicki, sequence that carrying to bacteriophage plasmids and RNA has bacteria reporter cells from single of elements in development chromatin the imaging One to been cells. are advances intact regulators pivotal in critical cell the sites when of genomic in or specific to effects how recruited known average selectively not techniques, and is using it architecture interface. discovered populations, cellular were chromatin/DNA disrupt factors the these which multiple at of of functions coordinated many the Since be expressed, or must silenced be factors to gene a For Introduction for implications important has study this Therefore, and activated chromatin. robustly blocked words: be the function. Key is can into PML-NB/ND10 line assembly cell and unincorporated chromatin U2OS latency and ATRX-negative that at viral the recruited assembly suggests into silencing, chromatin integrated similarly also gene and array is repression understanding this an strongly transcriptional that H3.3 is DNA, for finding H3.3 required histone the the is histone by that with pathway ICP0- As supported ATRX in co-localize further environment. and array is chromatin not Daxx activated site repressed the this the does the that a from ICP0, but conclusion maintain depleted when The array to are induced activation. required Daxx during ICP0-activated be and are can the ATRX they transcription As to that However, expressed. suggests recruited activation. is HeLa this to at latency, into cells, refractory array, reverse integrated PML-NBs/ HeLa is to When transgene how expressing array transcription. required inducible regulate the ligase understood CMV-promoter-regulated they ATRX, ubiquitin completely which a and E3 through not HSV-1 Daxx used mechanisms both the is have express delineate we it the to which infection, enriched, Recently, As cells, are viral replication-independent structures. heterochromatin. ATRX to regulate and chromatin pericentric Daxx to resistance of and which found and inheritance telomeres were transcription epigenetic ATRX, at regulate the and assembly ND10s Daxx in chromatin proteins, implicated H3.3 (ND10) variant 10 histone H3 Domain expressed (PML-NB)/Nuclear body constitutively PML-nuclear a is H3.3 Histone Summary 10.1242/jcs.110148 doi: 5489–5501 125, ß Science Cell of Journal 2012 August 6 Accepted ( correspondence for *Author 2 sa 33seii hprn,wihfntosa igecopy single al., et Tagami at 2002; al., functions et Ray-Gallet 2010; which al., et chaperone, HIRA (Goldberg 2009). genes al., H3.3-specific et Wong an 2005; al., is et Hake 2010; al., et Goldberg nvriyo enyvna o n in aeo coasPormi oeua ieSine,Piaepi,P 90,USA 19104, PA Philadelphia, Sciences, Life USA Molecular 19104, in PA Program Philadelphia, Scholars Street, Vagelos Spruce Diana 3601 and Institute, Roy Wistar Pennsylvania, The of Program, University Oncogenesis Cellular and Molecular 02 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2012. itn 33i osiuieyepesdvrato itn H3, histone of variant expressed constitutively a is H3.3 Histone ax TX itn 33 C0 rncito,Chromatin Transcription, ICP0, H3.3, Histone ATRX, Daxx, 1 ln .Rafalska-Metcalf U. Ilona , [email protected] ) ´ ta. 2010; al., et 1 inYang Tian , 2 opnns nldn ax TXadPL nteefr to Chelbi-Alix, effort and the (Geoffroy infection in to the PML, resistance many and cellular in ATRX evade fact, Daxx, function In PML-NB including degrade viruses. and/or components, to disorganize and that proteins and (PML- genes encode viruses bodies of (ND10s) nuclear repression PML 10s factors transcriptional of these domain components of be NBs)/nuclear both to identified, known was were assembly chromatin al., for H3.3 et critical (Wong is 2009). al., organization pathway et Wong chromatin this 2010; dysfunction that telomeric telomere a indicates maintaining induces which ESCs either in phenotype, of ATRX knockdown or However, H3.3 2010). not histone are al., expression et gene (Goldberg in detected changes large-scale (ESCs), cells stem o noprtdit igecp ee nHIRA in genes different is single-copy H3.3 markedly into histone Although incorporated has chromatin. not pathways and transcription Daxx/ATRX on of effects and disruption are Interestingly, HIRA sites deposition. these the its how known by not linked replication is functionally it chromatin, of inactive and regulators active critical assembly. are chromatin H3.3 signals histone that independent suggests targeting sites Daxx/ exclusive that mutually finding their The regulate 2010). HIRA chromatin- al., and incorporation et ATRX Lewis Snf2-type H3.3 2010; al., for the et Goldberg required (Drane heterochromatin with pericentric is and telomeres into together ATRX, factor, Daxx, remodeling and 2004), mtiG Negorev G. Dmitri , eoetemcaitcrl fDx n TXi histone in ATRX and Daxx of role mechanistic the Before shsoeH. sicroae nobt transcriptionally both into incorporated is H3.3 histone As 1 n ua .Janicki M. Susan and 2 / 2 ´ 1, ta. 2010; al., et embryonic * 5489 Journal of Cell Science S otpoenwt h tmlosi h rncit and transcript, the in loops 4- stem the of activates with the and protein Newly of addition interaction repeats coat 2010). the through TRE MS2 al., monitored the be the et can to RNA (Rafalska-Metcalf synthesized until into binds 1A) entry (Fig. it its transcription cytoplasm where induces is nucleus media the the the receptor it to estrogen (4-OHT) (Cherry/CFP/YFP-tTA-ER), hydroxytamoxifen in the to domain retained fused binding is the hormone minimal protein When auto-fluorescent CMV with tagged activators. an the (tTA) activator protein tetracycline-regulated from transcriptional tetracycline-regulated auto-fluorescent induced using by an is visualized promoter to Transcription array fused inactive 1A). (Fig. repressor the and lac this of isolated expressing al., arrays be multi-copy et integrated (Janicki can cells stably transgene living with single lines RNA in Cell visualized DNA, 2004). be allows to which proteins system, and transgene engineered an we used transcription, regulate factors assembly line chromatin cell H3.3 replication-independent histone which U2OS through the mechanisms the in dissect is array To HIRA, transgene not the but to Daxx, recruited chaperone, H3.3 histone The Results activation. from histone during that H3.3 blocked suggests is histone this assembly the chromatin chromatin, prevents H3.3 from its and into PML activation, incorporated to and cells, being refractory its ATRX HeLa is Daxx, permits array into depletes array, the integrated ICP0 ATRX, is As and it activation. Daxx both when strongly of express that promoter is which report CMV and the we H3.3 at Here, transgene enriched 2004). are histone this al., PML and et that ATRX (Janicki Daxx, site and that active the activated cells to U2OS robustly recruited into be integrated intrinsic stably can transgene and regulated silencing promoter this gene of between position and interface critical Yao defense. the 2010; the cellular highlights Everett, at also and pathway this Lukashchuk 1995), 2011; Schaffer, al., U2OS further et line, regulation. cell (Heaphy this osteosarcoma telomere human ALT-positive in 2011), the and in ATRX-null factors virus wild-type al., as these well (alternative as replicates et HSV-1 of ICP0-deficient As telomerase-independent importance ALT (Heaphy the the telomeres) confirms termed for of in mechanism positive mutations lengthening inactivating are maintenance with ATRX PanNETs telomere all or As 2012). Daxx are al., 2012; H3.3 al., and et et ATRX (Schwartzentruber Wu Daxx, glioblastoma and pediatric (Heaphy 2012), in is mutated al., all medulloblastomas et ATRX Molenaar and 2011; 2011), al., al., et oligodendrogliomas pancreatic in et in mutated (Jiao are mutated (PanNETs) ATRX and tumors Daxx neuroendocrine 1996). al., et intellectual (Picketts the in mutated syndrome, is ATRX disability diseases. other several to linked 1998). al., and et of including (Everett replication disaggregation components PML their the viral of promotes degradation for genome, and PML-NBs/ND10s latent required the the Ishov ligase of ICP0, 2007; of activation Additionally, ubiquitin Bresnahan, Kalejta, 2006). E3 Nicholl, initiation and and and HSV-1 Hwang Preston the 2002; 2002; (Cantrell al., al., for et expression et important Hofmann gene 2006; viral is HCMV CMV the pp71, efficient by protein, Daxx of tegument degradation the Specifically, 2011). 5490 epeiul eotdta naryo nidcbeCMV- inducible an of array an that reported previously We significantly are ATRX and Daxx infections, viral to addition In ora fCl cec 2 (22) 125 Science Cell of Journal a taasmamna eadto,X-linked retardation, -thalassemia/mental ucina uulyecuiests(lase n li,2010; HIRA Allis, and and Daxx 2010). (Elsaesser that al., sites reports et exclusive Goldberg with it, mutually consistent that at is suggests function and assembly HIRA, array chromatin the not H3.3 histone at but Fig. regulates Daxx, ATRX, material with Cherry-tTA-ER, of together supplementary enrichment and and i–p; The activated repressor panels S1). and YFP-tagged 1B, Cherry-lac inactive (Fig. by the activator,respectively both at marked the enriched a arrays, by contrast, were marked panels Daxx endogenous array In 1B, (Fig. activated Cherry/CFP-tTA-ER. the nor HIRA YFP-tagged at Neither endogenous accumulated 2004). cells al., labeled U2OS into et integrated antibody (Janicki stably 2-6-3) array line, transgene (cell a at HIRA of Daxx localization the and evaluated we system, chromatin this using assembly at directly spatial and events temporal 2004). the regulatory al., defining et (Janicki gene for As tool of powerful translation. organization a protein this is and Therefore, it processing, such, pol cytoplasm. RNA mRNA for transcription, the required elements II the in of all CFP-SKL peroxisomes contains the gene ‘synthetic’ the of appearance in the by protein confirmed be can translation atvtdary) natvtdcnrlcls h ra was array the cells, control activated In arrays). regions Cherry-tTA-ER (activated the and array) of (inactive repressor areas Cherry-lac pixel by bound the measured on ATRX we of decondensation, effects array the 2004; evaluate al., To 2010). et al., et (Janicki Rafalska-Metcalf activation during decondenses that significantly suggested this site. a–d), the panels at 2B, functions (Fig. ATRX co-localized repressor. To Cherry-lac they line. and to As ATRX-YFP cell recruited co-expressed this 2011; we is array, in ATRX al., the functional expressed the et not exogenously that whether is (Heaphy suggests determine pathway this ATRX ATRX 2A), and express (Fig. Daxx 2010) not Everett, do and Lukashchuk cells U2OS As U2OS in array transgene the cells of activation represses ATRX ossetwt hsrsl,RAlvl ttetasrpinst in intensity, site Cherry-MS2 transcription by S2). the measured cells, at Fig. expressing levels material ATRX-YFP RNA result, supplementary this 2D; with (Fig. Consistent accumulation RNA prevents II it that pol the indicates is this cells, cells that control expressing to pol ATRX-YFP compared indicates RNA in lower the array which As activated 2D). the background, at (Fig. recruitment II below its for required are is activator RNA levels array inactive the II At we array. pol the transcription, at levels preventing II pol RNA by measured decondensation inhibits whether determine ATRX To 2010). al., factor et transcription (Rafalska-Metcalf and recruitment activator despite condensed remains array to in because required decondensation chromatin is activity helicase the state. condensed that the indicating maintain 2C) increased Fig. array cells, we i–l, activated expressing the (K1600R)-YFP domain, of ATRX area In proteins the helicase SWI/SNF 2011). in al., activity et ATRX ATPase (Mitson is abolish To which the to K1600R, used 2C). mutation, commonly Fig. the of containing construct e–h, function a expressed panels the 2B, (Fig. evaluate decondensation ATRX-YFP- in only represses However, was 2C). it (Fig. cells, site expressing inactive the than larger oivsiaerpiainidpnethsoeH. chromatin H3.3 histone independent replication investigate To rvosy erpre httetaseearyi hscl line cell this in array transgene the that reported we Previously, eas rvosyrpre httasrpini eurdfor required is transcription that reported previously also We , 1.7 6 agridctn htATRX that indicating larger a aaai-rae el,the cells, -amanatin-treated , od(i.2,panels 2B, (Fig. fold 3 , 4-fold , 2 5 6 h) Journal of Cell Science ne:1 inset: eurdt ers transcription. repress is activity to helicase required the that indicating the cells at expressing ATRX-YFP 3C) (Fig. levels are RNA array activated 2D; and (Fig. S2) II Fig. material pol Scal supplementary RNA line. the the cells, of start expressing the ATRX(K1600R)-YFP mark Asterisks p). and l are h, (d, profiles ins merge intensity enlarged the in in lines measured Yellow were (m–p). intensities Cherry-tTA-ER blue by and marked array, green activated red, the ( the and which Cherry-tTA-ER. (i–l), through or repressor path Cherry-lac repressor by Cherry-lac whic marked array, YFP-MS2, with inactive by co-expression the visualized by is monitored RNA with be The labeled can (SKL). HIRA signal array Cherry-tTA-ER 3 targeting activator, the The peroxisomal the transcript. to a the by cells. factors to in induced U2OS loops fused is stem in CFP Transcription the encodes visualized. array to be RNA transgene binds to transcribed the array The to transgene (4-OHT). inactive recruited 4-hydroxytamoxifen the of is allows Daxx, repressor chaperone, Cherry-lac of H3.3 Expression histone The 1. Fig. , m -odlwrta ncnrlcls(i.3) In 3C). (Fig. cells control in than lower 7-fold m. a HR nioy(–)i eaint hry rCPtAE,a h ciae rngn ra nUO -- el.YPDx serce at enriched is YFP-Daxx cells. 2-6-3 U2OS in array transgene activated the at CFP-tTA-ER, or Cherry- to relation in (e–h) antibody -HIRA , . n 4 and 2.5 6 ihr epciey oprdto compared respectively, higher, 9 n ftetasrpinui steito piigui fterabbit the of unit splicing 2 intron the is unit transcription the of end rncitoa ersinb axadAR 5491 ATRX and Daxx by repression Transcriptional xmndtelclzto fasre fYPtge ATRX Cherry-lac by YFP-tagged marked of array, series inactive the a To at ATRX. of constructs recruitment deletion localization we its recruitment, this the its for cells, for required examined U2OS required ATRX in within not region array the is identify transgene it the that at indicates enriched is transcription Daxx represses As domain helicase ATRX The ( A iga fteidcbetaseedant scale. to drawn transgene inducible the of Diagram ) B oaiaino IAYP(–)adendogenous and (a–d) HIRA-YFP of Localization ) b goi ee h erimn fYFP-tagged of recruitment The gene. -globin ntepresence the in , a:5 bar: e t hwthe show ets m m; h Journal of Cell Science hw ntegraph. the in shown rasi oto ( control in arrays 60aioai ein(i.3,,pnl –) si otisa contains it As e–l). 1189– panels the 3A,B, within (Fig. is region signal acid amino recruitment 1670 the that suggesting array TXK60)YP( ATRX(K1600R)-YFP rvosybe hw ob erie oPML-NBs/ND10s to recruited had be However to which a–d). shown (Be ATRX(1189–2492), panels been 3A,B, pericentric and (Fig. not previously array do ATRX(800–1670) to the modifications both 2011), histone to al., recruitment that ATRX et suggesting recruit Iwase enriched ATRX 2011; not al., was for et (Eustermann binding trimethylation heterochromatin required 9 H3-lysine histone module ADD atypical the includes an which domain, ATRX(1–1201), 3A,B). (Fig. 5 repressor bar: Scale line. the of start the mark Asterisks l). and h throu (d, path the profiles show intensity insets the merge in enlarged in measured lines were Yellow intensities Cherry-tTA-ER. by green marked and array, red activated (A) the the cells. at which U2OS (i–l) in ATRX(K1600R)-YFP and array (e–h) transgene ATRX-YFP the of activation transcriptional cells. represses ATRX 2. Fig. 5492 ( C ie ra fteiatv ra,mre yCer-a erso ( repressor Cherry-lac by marked array, inactive the of areas Pixel ) ´ rube c Tblni sda odn oto.( control. loading a as used is -Tubulin ´ ta. 08 age l,20) eeerce tthe at enriched were 2004), al., et Tang 2008; al., et ora fCl cec 2 (22) 125 Science Cell of Journal n 5 P 2,AR-F ( ATRX-YFP 12), auswr acltduigunpaired using calculated were values n 5 8 nUO -- el.( cells. 2-6-3 U2OS in 68) n 5 4 n TXK60)YP( ATRX(K1600R)-YFP and 14) B niheto TXYPa h ncieary akdb hrylcrpesr(–) nihetof Enrichment (a–d). repressor Cherry-lac by marked array, inactive the at ATRX-YFP of Enrichment ) D enitniylvl fRAplI 48A tiig tteiatv ( inactive the at staining) Ab (4H8 II pol RNA of levels intensity Mean ) t -test. n 5 6,adteCer-T-Ratvtdary ncnrl( control in arrays activated Cherry-tTA-ER the and 16), n 5 8 xrsigUO -- el.Sadr eitos ntefr ferrbr,are bars, error of form the in deviations, Standard cells. 2-6-3 U2OS expressing 18) eetelws nAR(1929)epesn cells significant most expressing the has ATRX(1189–2492) domain repression. helicase in on effect the RNA lowest levels that RNA indicating constructs, measure the have deletion not the did with were Among to ATRX(1–1201) Consistent effect. array, the repressive 3C). to a (Fig. Cherry-MS2 recruitment array of lack activated its used the at accumulation we its through transcription, recruited is (Tang ATRX that (DID) Daxx. suggests with domain this interaction 2004), interaction al., Daxx et identified previously oeaut h fet fteedlto osrcson constructs deletion these of effects the evaluate To etr lto noeosAR nUO -- n HeLa and 2-6-3 U2OS in ATRX endogenous of blot Western n 5 n 6 n F-T-Ractivated CFP-tTA-ER and 16) 5 6,AR-F ( ATRX-YFP 16), m ;ist 1 inset: m; n 5 m 2 and 82) m. gh Journal of Cell Science eecluae sn unpaired using calculated were ( elwlnsi nagdmreist hwtept hog hc h e n re neste eemaue nteitniypoie d n ) Ast l). and h (d, profiles intensity the ( in measured control were in intensities arrays green 5 activated and bar: red CFP-tTA-ER Scale the and line. which through the path of the start show the insets merge enlarged in lines Yellow nPLNsN1s hrfr,w vlae h oaiainof localization the found also evaluated are we ATRX therefore, and Daxx PML-NBs/ND10s, a–h). in multi- panels the 4A, at (Fig. repressor array YFP-lac copy Daxx with immunofluorescence, co-localized By both 1-1). ATRX HI and line, 1A) (cell (Fig. cells transgene HeLa inducible into the Daxx integrated both stably expresses we which ATRX, line, and cell a in transcription of evaluate promoter To CMV the at transgene enriched the are PML and ATRX Daxx, composit acid amino the (A) and cells. mutation U2OS catalytic K1600R in the array domain, transgene ATPase/helicase the the ( of (DID), constructs. repression domain deletion and interaction YFP-tagged Daxx recruitment the the for domain, required ADD domains the ATRX of the location of Analysis 3. Fig. n 5 7 n TX18–42-F ( ATRX(1189–2492)-YFP and 37) t m ts n r hw ntetable. the in shown are and -test ;ist 1 inset: m; B oaiaino h TXdlto osrcsa h nciearyi 2S263clsmre yCer-a repressor. Cherry-lac by marked cells 2-6-3 U2OS in array inactive the at constructs deletion ATRX the of Localization ) n 5 8 xrsigUO -- el.Sadr eitos ntefr ferrbr,aesoni h rp.Pvalues P graph. the in shown are bars, error of form the in deviations, Standard cells. 2-6-3 U2OS expressing 38) m n .( m. 5 4,AR-F ( ATRX-YFP 34), C nertditniymaueet fteacmlto fCer-S RA tteiatv ra ( array inactive the at (RNA) Cherry-MS2 of accumulation the of measurements intensity Integrated ) n 5 1,AR(10R-F ( ATRX(K1600R)-YFP 41), rncitoa ersinb axadAR 5493 ATRX and Daxx by repression Transcriptional oietf h rngn eunet hc ax TXand ATRX Daxx, which to sequence transgene which the S3). line, Fig. identify material cell To is (supplementary it U2OS activation that during and the recruitment displaced its not for in required not array the is ATRX activated that that indicates both and at suggests enriched inactive also this is the PML i–l), PML-NB/ND10. a panels is array 4A, transgene (Fig. with repressor co-localized also YFP-lac PML structures As these 2011). of Chelbi-Alix, component and defining (Geoffroy the is which protein, PML n 5 7,AR(–21-F ( ATRX(1–1201)-YFP 57), iga fAR hwn the showing ATRX of Diagram n 5 8,ATRX(800–1670)-YFP 28), rssmark erisks n o of ion 5 20) Journal of Cell Science lgtge osrcsi aieCI sa Fg A.I HeLa In 5A). (Fig. used assay we lines, ChIP cell native U2OS a and in HeLa chromatin constructs the the flag-tagged in into arrays H3.3 transgene histone the of of incorporation the evaluate To array cells transgene HeLa the at in enriched specifically is H3.3 Histone arrays. and transgene ATRX these the Daxx, to of that PML recruitment indicate the at therefore, regulates enriched results, sequence similarly These promoter are 4B). HeLa PML the (Fig. and promoter in immunoprecipitation Daxx promoter the cells, CMV chromatin U2OS the Standa in at experiments. line; used enriched independent cell three are we least three at All recruited, of (ChIP). average graphs. path 5 the are the bar: the are Scale in show line. Results presented insets PML the cells. are merge of 2-6-3 bars, enlarged start U2OS error the in and mark of lines Asterisks 1-1 form Yellow l). HI the cells. and HeLa, in h 1-1 inactive (d, deviations, HI profiles from HeLa, intensity prepared in the lysates repressor in cells. chromatin measured U2OS YFP-lac were and marked intensities HeLa array in DAPI inactive transgene and 1 the green the of red, at promoter the (i–l) CMV which the PML through at and enriched (e–h) are ATRX PML and (a–d), ATRX Daxx, 4. Fig. 5494 m .( m. B iga ftetaseesoigtelcto fpiesue o eltm C nteCI sas ax TX n M eeeautdin evaluated were PML and ATRX, Daxx, assays. ChIP the in PCR real-time for used primers of location the showing transgene the of Diagram ) ora fCl cec 2 (22) 125 Science Cell of Journal P auswr acltduigunpaired using calculated were values ofre hthsoeH. smr nihdi h a operator lac the in of enriched more analysis cells is ChIP HeLa H3.3 in 5C). histone expressed (Fig. that stably confirmed Intensity H3.2-YFP H3.2-YFP and h). to H3.3-YFP compared panel histone site profile, the is intensity at H3.3-YFP in of that overlap signals indicated note measurements green YFP-tagged 5B; The and (Fig. when visually expressed red 5A). detected transiently (Fig. be were array also cells transgene constructs could the U2OS cells into HeLa H3.3 in in histone of chromatin incorporated incorporation lac comparably transgene increased were the they the in contrast, variant, into In enriched replication-dependent 5A). more the (Fig. to H3.2 significantly compared is repeats operator H3.3 histone cells, t ts n r hw ntetables. the in shown are and -test ( A muoloecnelclzto fDaxx of localization Immunofluorescence ) , 24 6 oeenriched more m ;inset: m; rd Journal of Cell Science erso nHL I11cls xml mgsaesoni .Sadr eitos ntefr ferrbr,aepeetdi h graphs. the in presented are bars, error of form the in deviations, Standard B. in shown are images Example unpaired cells. using 1-1 calculated HI HeLa in repressor hoto n haxepesn el Fg A.Hwvr as However, in 6A). levels (Fig. comparable cells to shDaxx-expressing induced and analysis is we shControl (qRT-PCR) transcription transcription, RT-PCR that Quantitative on indicated 2010). (Lukashchuk Daxx construct Everett, shRNA depleting validated and a using of down To it activation. effects knocked for we required the induced, is rapidly Daxx evaluate be whether can determine cells to U2OS wanted in array transgene the in As activation array transgene cells for U2OS required not is Daxx transgene. the of in chromatin repeats the operator into ATRX, lac incorporated and the Daxx preferentially both is express H3.3 which histone cells, HeLa therefore, in result, that These indicate S4). Fig. material (supplementary repeats line. the of start the mark Asterisks h). and (d profiles intensity enlar the in lines in Yellow measured cells. were 1-1 intensities HI green HeLa and in graphs. repressor, red the Cherry-lac the by in which marked 5 presented 2-6- unpaired through array, using are U2OS, transgene path (CLs). calculated inactive and bars, the lysates were the 1-1 show error at and crude HI insets of (e–h) tables in HeLa, H3.3-YFP form the and inactive and in the (a–d) in antibody presented in H3.2-YFP ChIP are flag histone deviations, native pair with Standard primer by immunoprecipitated experiments. each evaluated H3.3 independent using were levels and three (A) H3.3 H3.3 least and cells. and H3.2 at HeLa H3.2 histone of in of Flag-tagged comparison average chromatin assay. the array ChIP are transgene the Results the in cells. into PCR real-time incorporated for specifically used is primers H3.3 Histone 5. Fig. m ;ist 1 inset: m; m .( m. C nest esrmnso rninl xrse 32YP( H3.2-YFP expressed transiently of measurements Intensity ) t -test. c rncitoa ersinb axadAR 5495 ATRX and Daxx by repression Transcriptional Tblni sda odn oto.( control. loading a as used is -Tubulin 5mnt h i itr Fg C opr aescadg), and c activator to panels prior compare array the 6C, at (Fig. enriched is picture Daxx min that comparing determined 0 we By the at 6C). accumulates to Cherry-tTA-ER (Fig. min which activation in 15 nucleus imaged after the min and of a region 30 YFP-Daxx the in and expressing 15 Cherry-tTA-ER, stably 0, activator, line cells cell this the 2-6-3 expressed cells, U2OS was we Daxx-depleted cells, YFP-MS2 single activation. in evaluate for As required array to not 6B). is activated (Fig. it YFP-MS2 that the confirmed cells used at we single blot present which Therefore, in western cells, of the it. the transcription advantage death, in express selective cell the seen still reflects of protein likely the levels 6A) (Fig. of high depletion induced incomplete Daxx down knocking n oeaut h neato fDx ihtetaseearyin array transgene the with Daxx of interaction the evaluate To 5 5 n 33YP( H3.3-YFP and 25) n 5 iga ftetaseesoigtelcto of location the showing transgene the of Diagram 3 tteiatv ra,mre yCherry-lac by marked array, inactive the at 23) B niheto rninl expressed transiently of Enrichment ) t ts.Wsenbo hw itn H3.2 histone shows blot Western -test. P auswere values ausfor values P e merge ged cl bar: Scale 3 Journal of Cell Science tbyepesdYPDx arw nteUO -- elln.Iae eetkna i n 5ad3 i fe h diino -H.Ylo ie in lines Yellow 4-OHT. of addition the the mark after Asterisks l). min and 30 h and (d, profiles and 15 intensity (circle) and the endogenous in min measured of 0 were levels at intensities the green taken and shows were red blot Images the bar:10 Western which line. Scale through YFP-Daxx. cell line. path expressing 2-6-3 the stably show U2OS insets 2-6-3 the merge 5 U2OS in enlarged bar: in (arrow) Scale Cherry-tTA-ER, YFP-Daxx cells. by expressed these marked in stably levels array, Daxx transgene image to the used at were settings exposure same The shRNAs. tA el xrsigcnrladDx hNs eut r h vrg ftreidpneteprmns tnaddvain,i h omo ro b error of form the in deviations, Standard experiments. independent three of average the ( are control. Results graphs. shRNAs. the Daxx in and presented control expressing cells rtTA) osrc Lkscu n vrt,21)(i.7) As 7A). (Fig. shRNA validated 2010) a Everett, permit using and to down sufficient (Lukashchuk it is knocked construct ATRX we depleting activation, To 7A). cells, regulated whether (Fig. expressing activation activator to refractory determine in is CMV-promoter HeLa array induced the not that the indicates was ATRX this in RNA the As activation which line. transcriptional cell through of evaluated we mechanism transgene, transcription the delineate represses further To cells transgene HeLa the in of array activation transcriptional the permits in ICP0 sequences repeat the 2000). the to al., to due et bind not (Tsukamoto which is transgene proteins recruitment of Daxx that presence indicates This binding. cells. U2OS in activation array transgene for required not is Daxx 6. Fig. 5496 B igecl nlsso F-S cuuaina h ciae rncito iei 2S(--/F-S/tA el xrsigcnrladDaxx and control expressing cells (2-6-3/YFP-MS2/rtTA) U2OS in site transcription activated the at accumulation YFP-MS2 of analysis Single-cell ) ora fCl cec 2 (22) 125 Science Cell of Journal m ;ist 2 inset: m; P auswr acltduigunpaired using calculated were values m m. t ts.Wsenbo hw axpoenlvl nkokoncells. knockdown in levels protein Daxx shows blot Western -test. ( A uniaieR-C nlsso N olce rmUO (2-6-3/YFP-MS2/ U2OS from collected RNA of analysis RT-PCR Quantitative ) a out hrytAE cuuae tteary which array, activation the indeed, at Cherry-tTA-ER; accumulated Cherry-tTA-ER activator, YFP- robust. co-expressed the we was line, cell and of HeLa the activation ICP0 in permit to array Therefore, would transgene 2004). expression the Roizman, ICP0 and chromatin whether (Hagglund repressed determine state convert active rapidly an to to to and able replication are lytic latency, promote to reverse required is which ICP0, ligase, by repressive reversed efficiently a ATRX, be establishes alone. of cannot ATRX this pathway depleting that in levels ATRX/Daxx that environment low or the chromatin present either knock still type, are that ATRX cell repression, suggests maintain in to this induced sufficient significantly cells, not down was transcription oee,vrlpoen,icuigteHV1E ubiquitin E3 HSV-1 the including proteins, viral However, m ;ist 1 inset: m; m .( m. C igecl ielpeiaigo YFP-Daxx of imaging lapse time Single-cell ) c Tblni sda loading a as used is -Tubulin tr fthe of start r,are ars, Journal of Cell Science acltduigunpaired using calculated n ( ie nelre eg nesso h ahtruhwihterd re n leitniiswr esrdi h nest rfls(,h n ) Ast l). and h, (d, profiles intensity the in measured were cells intensities 1-1 blue HI and HeLa green 5 (i–l) red, bar: ICP0-expressing the Scale and which line. (e–h) through the control path of in the start array show the transgene insets activated merge CFP-tTA-ER enlarged the in at lines ATRX of staining Immunofluorescence (a–d). idn oi nteRN igrdmi sdltd eut r naeaeo tlattreidpneteprmns etr ltsosAR rti l protein ATRX shows zin blot the Western which experiments. independent in three ICP0-FxE, least and at ICP0 of shRNAs, average an ATRX are and Results control deleted. co-expressing is cells. those domain finger knockdown to RING compared the are in cells motif binding control expressing Cherry-tTA-ER and Inactive eoeratvto Eeete l,19;PrisnadEverett, and viral cells Parkinson and 1998; in degradation al., et PML increase (Everett for zinc- reactivation required not finger genome is RING did which the motif, of levels deleted binding mutant RNA array a RNA ICP0-FxE, As the expressing that 7A). on (Fig. indicates controls analysis effects qRT-PCR its are levels direct. with that co-localizes are YFP-ICP0 suggests chromatin As cytoplasm this 7C). the Fig. in Cherry-tTA-ER, a–d; peroxisomes panels the 7B, in (Fig. accumulated protein SKL decondensed activation. to permissible cells HeLa in array transgene the makes ICP0 7. Fig. n 5 5 5 (+)ICP0, 25; 8.( 38). D esrmn fma nest fDx [( Daxx of intensity mean of Measurement ) , 1fl ihri C0epesn el oprdto compared cells ICP0-expressing in higher 11-fold , n 5 c -odcmae oteiatv ie n h CFP- the and site, inactive the to compared 7-fold Tblni sda odn oto.( control. loading a as used is -Tubulin 4 tteatvtdaryi ea I11 el.Sadr eitos ntefr ferrbr,aepeetdi h graphs. the in presented are bars, error of form the in deviations, Standard cells. 1-1, HI HeLa, in array activated the at 24] t -test. m ;ist 1 inset: m; m .( m. C esrmn fteae fteatvtdtaseearyi eaH -cls ( 1-1cells, HI HeLa in array transgene activated the of area the of Measurement ) 2 )ICP0, B erimn fYPIP oteatvtdary akdb hrytAE,i eaH - cells 1-1 HI HeLa in Cherry-tTA-ER, by marked array, activated the to YFP-ICP0 of Recruitment ) n 5 5 (+)ICP0, 25; rncitoa ersinb axadAR 5497 ATRX and Daxx by repression Transcriptional n oacs t idn ie Fg B aeseh i.7) nfact, unable In is 7D). site. the Fig. it identify e–h; to that needed panels was 7B, suggesting repressor YFP-lac (Fig. array, of sites co-expression the binding its around access control ring to In faint array. formed a activated CFP-tTA-ER only and the enriched at remained ATRX levels cells, ICP0(-) PML and Daxx ATRX, activation evaluated we environment, for chromatin permissive RING transcriptionally required ICP0 is the activity that ligase indicates 7A). this (Fig. ubiquitin 2011), E3 al., finger et Smith 2000; 5 ( A 5,AR [( ATRX 25], oietf h ehns hog hc C0cetsa creates ICP0 which through mechanism the identify To uniaieR-C nlsso N olce rmHL I11cells. 1-1 HI HeLa from collected RNA of analysis RT-PCR Quantitative ) 2 )ICP0, n 5 8 (+)ICP0, 18; n 5 1 n M [( PML and 21] 2 IP ( )ICP0 n 5 3 n (+)ICP0 and 43) 2 P )ICP0, au was value rssmark erisks Yellow . vl in evels c- Journal of Cell Science ne:1 inset: h ahtruhwihterdadgenitniiswr esrdi h nest rfls( n ) seik aktesato h ie cl a:5 bar: Scale line. the of start the mark transfections. Asterisks independent h). three and in (d counted profiles were intensity cells ins the 100 merge in enlarged cells. measured in 2-6-3 lines were U2OS Yellow intensities (e–h). and cells green 2-6-3 and U2OS, red and (a–d) the cells which 1-1 through HI HeLa, path ICP0-expressing the in Cherry-tTA-ER, by marked array, transgene i.8 itn 33i erie oteatvtdtaseearyi 2SadIP-xrsigHL cells. HeLa ICP0-expressing and U2OS in array transgene activated the to recruited is H3.3 Histone 8. Fig. were As which 8A). array (Fig. Cherry-tTA-ER activated with the non-overlapping H3.3- of but e–h), adjacent regions panels in 5B, accumulated co- the (Fig. completely YFP repressor it of where Cherry-lac cells majority with HeLa in localization localizes the array it cell inactive to the to contrast HeLa at in pattern However, and recruited 8A,B). U2OS (Fig. strongly sites the activated is on both H3.3-YFP effect In lines, Cherry-tTA-ER. the ATRX-mediated in to localization investigate H3.3-YFP and relation examined To we Daxx recruitment, blocked. H3.3 when histone is suggests relieved assembly this is chromatin lines, ATRX- cell repression the HeLa in that induced ICP0-expressing robustly and is null-U2OS activation chromatin the array into transgene incorporated As not activated is the but to array recruited transgene strongly is H3.3 Histone CMV-promoter- the with 7D). PML, (Fig. and array ATRX regulated Daxx, likely to but limited including factors, alteringnot regulatory by multiple activation of permits association the ICP0 ICP0 that by suggests reduced similarly this were expression, levels i–l; PML panels and 7B, Daxx (Fig. As 7D). cells Fig. ICP0-expressing strongly in becomes array activator the the at and enriched depleted is ATRX contrast, In 5498 m .( m. ora fCl cec 2 (22) 125 Science Cell of Journal B ecnaeo el nwihH.-F cuuae tteatvtdtaseearyi oto,IP n C0FEepesn ea I11cells 1-1 HI HeLa, expressing ICP0-FxE and ICP0 control, in array transgene activated the at accumulated H3.3-YFP which in cells of Percentage ) ciae ra sdet h a prtrado S tmloop stem MS2 and/or operator lac the array to due activated is array the activated of on i–l). regions panels function S5, and/or same Fig. DNA material the (supplementary transgene the occupy to chromatin, factors, directly II that pol bind confirms RNA however, which non- of (supplementary YFP-tTA-ER, not co-localization activator, region but The the also e–h). this with adjacent panels is in S5, H3.3 in Fig. chromatin the material histone the localized on into that II incorporated suggesting accumulate pol protein regions that RNA overlapping binding and factors its DNA ( H3.3-YFP to evaluate unit To the relation a–d). transcription with panels in S5, co-localize localization Fig. H3.3- material not Again, line. (supplementary did U2OS the in YFP repressor Cherry-lac expressed ( recruitment. H3.3 repeats also histone this ICP0- for arrays, required in activated not Daxx are the and they at that ATRX present indicates not As into are region. incorporated cells this not expressing ( in is repeats nucleosomes H3.3-YFP TRE that the the suggests to this directly transgene, binds activator the odtriewehrteH.-F cuuaina the at accumulation H3.3-YFP the whether determine To operator lac the to relation in H3.3-YFP histone evaluate To , 0k)lclzto tteatvtdary eco- we array, activated the at localization kb) 10 , . b,w aee ihRAplII. pol RNA with labeled we kb), 1.7 ( A 33YPercmn tteactivated the at enrichment H3.3-YFP ) , b nthe in kb) 4 t show ets m m; Journal of Cell Science bec fwihwscnimdb h ako Cherry-lac of lack the the by elements, (supplementary confirmed sequence site the these at was accumulation Cherry-MS2 to and which repressor due indicates of not line is of cell absence this recruitment enrichment array in The its array 60-1). activated that activated the line, at an (cell stably H3.3-YFP is cells histone which to U2OS elements, into these recruitment without integrated transgene its a of evaluated composed we repeats, 08 evse l,21;Zage l,21) ti o known the not of Reed, is repression however, It Daxx-mediated and CMV 2010). the genes, Puto al., for 2008; these required et and viral is Zhang al., ATRX 2010; genes et and whether al., Morozov et target cellular Reeves 2006; 2008; RelB al., repress et c-met, transcriptionally (Croxton including and/or H3.3 promoters, histone to to reported of the been bind previously that recruitment has suggests Daxx the factors. which assembly chromatin transgene, regulates the sequence of promoter promoter CMV the at nuclear between Shevtsov 2011; link al., 2011). et Dundr, the (Mao and function supporting of molecular and formation further organization the groups seed bodies, RNA other nuclear and two transcription methodology, that demonstrated engineering Using sites. conversely, transgene transcription and are similar PML-NBs/ND10s PML-NB/ND10, the some a that least at as suggests at classified enriched that this be cells, all can U2OS are array and PML the HeLa Chelbi- both and and in are ATRX (Geoffroy arrays which Daxx, transgene protein As PML PML-NBs/ND10s, 2011). of to Alix, presence localize the by to regulates defined known were elucidated pathway both were assembly ATRX chromatin (Drane H3.3 and histone independent Daxx promoter. CMV results viral the the these at together, repression the transcriptional that Taken that rescued. indicating be line indicate can cell U2OS defect ATRX-null repression the II is ATRX in pol when reduced expressed significantly activation-induced RNA are array and Additionally, the at expression accumulation either and chromatin. mRNA Daxx by decondensation, regulate the depletes chromatin disrupted ATRX which from is expression, ATRX pathway and ICP0 robustly this be or Daxx transgene can ATRX-deletion when a Transcription that however, promoter. of CMV induced, array show the multi-copy by a we regulated at study, repression transcriptional this In Discussion activated the transcription. to of H3.3 result histone disrupted a of is is recruitment array pathway the ATRX that and suggest Daxx and the the when at blocked array the is transgene assembly strengthen chromatin further H3.3 therefore, histone that results, conclusion These S6). Fig. material motn tpi h salsmn fltnyi h raino a an of creation factors. that the transcription suggests is excludes latency that This II environment of line. chromatin establishment by pol the cell reduced in RNA U2OS significantly step that the important is in showing array expression al., result activated ATRX et our the the (Liu at respectively of at accumulation infection, reminiscent of Daxx, is phases including during latent 2010), genes and factors, (IE) early lytic immediate repressive the CMV including murine and the factors, of II, active promoters of pol enrichment RNA exclusive mutually the Additionally, 2012). al., et (Valadez-Graham the mechanism mediated repress to shown recently eoetefntoso axadAR nreplication- in ATRX and Daxx of functions the Before eas hwb hP htAR,Dx n M r enriched are PML and Daxx ATRX, that ChIP, by show also We ´ ta. 00 odege l,21;Lwse l,2010), al., et Lewis 2010; al., et Goldberg 2010; al., et Drosophila pannier eetruhapromoter- a through gene TXhmlgwas homolog ATRX rncitoa ersinb axadAR 5499 ATRX and Daxx by repression Transcriptional oe ihteFA a opU(XbaI/ pLU to (NotI/ tag USA) FLAG MO, the was Louis, with product St moved PCR (Sigma, H3.3 by p3XFLAG-CMV-14 an made into pLU-H3.3-3XFLAG, in cloned make was (Ser-Arg-Pro-Pro-Val-Ala-Thr) To linker H3.2-YFP of aa construct. (gift 7 described. H3.3-YFP same 2004) the previously the al., include were et to (Rafalska-Metcalf Ahmad) Janicki PCR overlapping K. 2002; plasmid Henikoff, and and Henikoff lentiviral (Ahmad S. H3.3-YFP pLU 2010), Cherry/YFP/CFP-tTA-ER, al., the et Cherry/YFP-MS2, and pLU-YFP/Cherry-tTA-ER, repressor, SV2-Cherry/CFP-lac Plasmids 400 in line selecting YFP- cell by and 2-6-3 made (U2OS/2-6-3/YFP-MS2/rtTA) U2OS were The rtTA (2-6-3/YFP-Daxx) USA). and Daxx NY, 700 YFP-MS2 in Island, expressing selecting Grand Grand by stably Technologies, made Technologies, 1-1/H3.3- were (HI (Life (Life H3.3-YFP 1-1/H3.2-YFP) G418 expressing (HI mM) stably (1:100), H3.2-YFP lines (2 cell and Penicillin-streptomycin 1-1 L-glutamine YFP) HI The USA), and USA). NY, mM) CA, Island, (1 View, pyruvate Eagle’s in Approved Mountain sodium grown Tet-System are 10% (Clontech, cells with 1-1 supplemented FBS HI (MEM) USA). 150 medium MO, in essential Louis, selection 1-1) minimal St. with (HI (Sigma, 2000) al., B line et Hygromycin cell Tsukamoto of 2004; HeLa described al., p3216PECMS2 The et previously of (Janicki 2010). array were described al., integrated conditions et stably growth the Rafalska-Metcalf its containing 2004; and al., 2-6-3, et line, (Janicki cell U2OS The culture Cell Methods and Materials otisteTErpas h M iia rmtr F-K oigsequence coding CFP-SKL p16PECh by promoter, 3 the minimal made the CMV was of and the 60-1, repeats, array TRE line, the multi-copy cell contains U2OS a The integrating USA). stably NY, Island, Grand Technologies, 04 yslcini 100 in selection by 2004) erimn.Ti eut hrfr,sget hthsoeH. is its H3.3 for histone required that not suggests are therefore, ATRX the result, and This in Daxx ICP0-expressing recruitment. that in site Daxx indicates as the cells well as HeLa surprising the at cells) to (U2OS enrichment the ATRX recruited of strongly its absence 2008), is Additionally, H3.3 Knipe, histone array. that activated and is study this (Cliffe in finding infection pathway lower are lytic genome ATRX HSV-1 the during and with associated histones Daxx of levels the that the reports with consistent disrupting is in and repression transcriptional relieves how DNA in for satellite explanation enriched and is ESCs 2010) 2009). in is al., H3.3 telomeres et al., region (Schneiderman including histone et genome repetitive the that (Goldberg this of reports regions into repetitive incorporation with Daxx both Its express consistent which cells, ATRX. HeLa indicate in and operator analyses transgene lac ChIP the the into of clear, incorporated repeats specifically completely is not H3.3 histone is the that assembly process Although chromatin this H3.3 latency. histone in viral independent a and replication activation of is repression role transcriptional organization of chromatin permits regulator that and critical conclusion cells the supports HeLa further in array the ue l,21)as uprsteie hti a ea active an delivered be merely may not it and that nucleosome. events the idea driver to signaling the passively function cellular supports also in of 2012) participant 2012; gain al., al., et et acquires (Schwartzentruber Wu glioblastoma H3.3 pediatric in histone recent mutations The conditions. that these by discovery unmasked non-nucleosomal been a has have which may it function, that suggests replication. harness assembly absence the chromatin own in to of array activated their the able to H3.3 promote histone are of recruitment to viruses The mechanisms how the at regulatory of factors cellular proof dramatic regulatory of visible The localization provides the array mechanism. on has chaperone ICP0 chaperone-independent unidentified that yet effects a as an through by array or activated the to recruited lhuhls fcrmtnasml rvdsasatisfying a provides assembly chromatin of loss Although from ATRX and Daxx depletes ICP0 that demonstration Our 9 n ftehuman the of end m /lo yrmcnB(im,S oi,M,USA). MO, Louis, St (Sigma, B Hygromycin of g/ml b goi eea rvosydsrbd(aik tal., et (Janicki described previously as gene -globin Sal ) omk L-323FA,an pLU-H3.2-3XFLAG, make To I). b b lbntasee which transgene, globin a aea previously as made was m /lo 48(Life G418 of g/ml Drosophila Bam m I then HI) /lof g/ml m g/ml Journal of Cell Science C0 (NheI/ ICP0s C0adIP-x DA gf fRgrEeet eecoe butNcoI/ (blunt cloned were Everett) Roger YFP-C3. of into (gift (XhoI/XbaI) products cDNAs Eco PCR ICP0-FxE cloning and by ICP0 made were TTGGGAAG) gctctagaTCACATTGATTTCCC- Rev: ccgctcgagATGCTAA- GAACAAGCACTAAAAGGAAGCAAG; ATRX(1189–2492)(For: and ATGTAGCTTCTCTCCTG) gctctagaTCACTGCAGC- YFP-N1 Rev: into TCTATAATTTCTAAAAAGAAACGACAAAC; (XhoI/SacII) ccgctcgagATGAGC- gctctagaTCATGTAA- product ATRX(800–1670)(For: USA). PCR Rev: TGTCAGCTTGCTTCCTTTTAGT) CA, cloning ( ccgctcgagATGACCGCTGAGCCCATGAGT; Clara, by site Santa (For: AgeI made Technologies, point the was (Agilent a at kit introducing ATRX(1–1201) YFP-N1 by QuikChange made YFP using was to 2011) mutation al., frame et in (Mitson fused pLU-ATRX(K1600R)-YFP been had which rz A S)4 USA) CA, Cruz, 4 USA), MO, Louis, nest rflsfrmre itrswr eeae sn ipeC software SimplePCI using generated were pictures merged 2010). al., for et profiles (Rafalska-Metcalf Intensity previously described were methodologies Imaging Imaging MgCl mM 2.5 7.5; pH HEPES mM (20 to grown Cells immunoprecipitation chromatin Native to grown Cells 2006). al., et (Zeng described as done was ChIP Cross-linked immunoprecipitation chromatin Cross-linked 65 to heated USA), WI, Madison, (Promega, I DNase with treated 1 analysis qPCR and RT-PCR David of (gift ATRX length full of product PCR a cloning ATRX-YFP- (Be (XhoI/SacII). by of Picketts) linker (gift made HIRA 23-aa was of a product N1 included PCR a which cloning Almouzni), by Genevieve made was HIRA-YFP-N1 Maul). Gerd (XbaI/ ( pLU cDNA Daxx to the (XbaI/XhoI) moving tag FLAG (NotI/ p3XFLAG-CMV-14 the into with cloned was product PCR H3.2 5500 nuae niefr2 i,te pna ,0 p 1 i)t olc uli For nuclei. collect to min) digestion MNase (10 of rpm ml 3,600 buffer(20mMHEPES,pH7.5,10mMNaCl,3mMMgCl 1 at in resuspended spun were then nuclei digestion, min, nuclease micrococcal 25 for ice on incubated rz A S)ad2 and USA) CA, Cruz, and inhibitors) 2 protease using described added previously 2010) freshly as al., done 8.0, was et Immunoprecipitation pH min. (Rafalska-Metcalf Tris 20 for mM ice 50 on incubated EDTA, mM 10 SDS, AD nUO el n h erccieatvtri eaclsfor cells HeLa 5 in used: activator were tetracycline pairs using the guidance primer AB and to following GCCTATCAG-3 cells according The method U2OS ddCt normalization. Real- using in USA). Fast analyzed CA, 7500 GAPDH Carlsbad, the was Technologies, using data Life USA) Biosystems, qPCR MO, (Applied by Louis, RT system followed St PCR USA) Strand-specific (Sigma, Time CA, USA). Green Valencia, SYBR CA, (Qiagen, with Valencia, OmniScript qPCR using (Qiagen, done kit were RNeasy reactions the with purified Sga t oi,M,UA a de o nte 0mn rs-ikn was Cross-linking min. rpm; 10 (1500 centrifuged another (1%) were Cells Formaldehyde for min. shaking. 10 added 5min;4 for gentle was mM) succinate])(Pierce with (50 USA) glycine-PBS MO, temperature with quenched MO, Louis, room glycolbis[succinimidyl Louis, St. at St. (Sigma, min (Sigma, (ethylene DMSO 25 in for dissolved EGS USA) USA) IL, Rockford, mM Biotechnology, 1.5 1 in prepared resuspended trypsinized, were confluency itns h hoai uentnswr nuae vrih t4 at overnight incubated 8000 were supernatants at chromatin centrifugation the and reaction histones, the by stop to pelleted added was were EDTA mM nuclei 50 USA). MO, Louis, St (Sigma, 5386) rsp .,5m DA %SS.DAwsioae sn IqikPCR QIAquick using isolated as qPCR was by DNA analyzed 2010). were al., SDS). Samples et (Rafalska-Metcalf described USA). 1% mM previously CA, (10 EDTA, Valencia, buffer (Qiagen, elution mM kit with 3 5 purification chromatin with IPed glycerol; 8.0, GFP eluted 5% pH and NaCl; was Tris USA) mM chromatin MO, 50 Louis, IPed EDTA; St mM (Sigma, Flag 0.2 PMSF). 7.5; pH mM Tris-Cl 0.1 mM (20 buffer BC50 nioywsbudwt rti grs/amnsemDA(Millipore, DNA sperm agarose/salmon A 4 at protein hr 1 with for USA) bound CA, Temecula, was antibody 2 and USA) a MO, Louis, St (Sigma, (A-2220) agarose M2 Anti-flag xn3;5 3); exon 65 again heated hr), (1 ice on cooled rtaeihbtr)adicbtdfr1 i t37 at min 10 for incubated and inhibitors) protease TTTTGG-3 CGAGTTTACGGGTTGTTAAA-3 GPatbd A20 Acm abig,M,UA,rsetvl.GFP respectively. USA), MA, Cambridge, (Abcam, (Ab290) antibody -GFP m fTIo Lf ehoois rn sad Y S)ioae N was RNA isolated USA) NY, Island, Grand Technologies, (Life TRIzol of g I noYPC butXho/ (blunt YFP-C3 into RI) ˚ ) ahdtiewt 1 with twice washed C), 9 9 -ATGGAAATCCCATCACCATCTT-3 ´ ora fCl cec 2 (22) 125 Science Cell of Journal hAD) 5 (hGAPDH); Bam rube , ´ 0 ofunywr cae rmdse nhptncTSbuffer TMS hypotonic in dishes from scraped were confluency 80% 9 I eemvdit L (XbaI/ pLU into moved were HI) ta. 08 nopU(XbaI/ pLU into 2008) al., et m n 5 and gofmouse m frabbit of g m abtIG(ba,Cmrde A USA). MA, Cambridge, (Abcam, IgG rabbit g Bam 9 9 -TTTGTGAGCCAGGGCATTG-3 -ACAGCGCATTAGAGCTGCTTAAT-3 I rmGPDX-1(so ta. 99 gf of (gift 1999) al., et (Ishov GFP-DAXX-C1 from HI) 6 a a PL(GM)(at rzBoehooy Santa Biotechnology, Cruz (Santa (PG-M3) -PML AR H0)(at rzBoehooy Santa Biotechnology, Cruz (Santa (H300) -ATRX ˚ B,rsseddi LSSLssBfe (1% Buffer Lysis SDS mL 1 in resuspended PBS, Eco .Atbd-on ed eewse 3 washed were beads Antibody-bound C. 9 tt ftAactivator). tTA of (tetR I.Frlniia xrsin F tagged YFP expression, lentiviral For RI). m ˚ 2 1 i) oldo c 5mn and min) (5 ice on cooled min), (15 C frabbit of g 5 MScoe n . MPMSF), mM 0.1 and Sucrose; mM 250 ; g 6 Sal 5mn.FrFa n YFP-tagged and Flag For min). (5 Sal B n nuae ihfreshly with incubated and PBS ˚ ) F-axC a aeby made was YFP-Daxx-C1 I). ih20Um fMae(N- MNase of U/ml 200 with C 9 Bam )te elcn h 3 the replacing then I) a n 5 and DX D80 Sga St (Sigma, (D7810) -DAXX HI). 6 2 MCaCl mM 3 , 9 -CGCCCCACTTGA- lgppie(F4799) peptide Flag Bam 9 9 -GGTGCAGGCT- (rabbit m ˚ Cwith20 I hnmoved then HI) gofChIP-grade Bam 9 ˚ 1 min), (15 C n 5 and 2 n fresh and , HI/ b -globin 6 , 9 9 Sal -GG- m 80% with end, lof I). tiigwr ae sn h ec C P Icnoa irsoe(Leica microscope confocal II DAPI SP5 with TCD images Leica the Confocal Germany). using Wetzler, normalization. Microsystems, taken for three were of used value staining averaged was using The done regions USA). Health, was background of analysis Institutes Image (National USA). software ImageJ PA, Sewickley, Corporation, (Hamamatsu lase,S .adAls .D. C. Allis, and J. S. Elsaesser, M. D. Knipe, and R. A. Cliffe, A. W. Bresnahan, and R. S. Cantrell, lase,S . odeg .D n li,C D. C. Allis, and D. A. Goldberg, J., S. Elsaesser, and D. R. Drane Phair, M., S. Cuddy, Shenoy, Y., F., Brody, Hanaii, V., Turris, S., de Torii, Y., Shav-Tal, M., X., Thomas, Darzacq, I., Belle, de A., L. Puto, R., Croxton, Be oe vrt o egns ayLRyfrassac ihthe with assistance for LeRoy and Gary Picketts reagents, David for Almouzni, Genevieve Everett Adams, Roger Peter thank We Acknowledgements Louis, St Sigma, M2; (1:10,000; Flag USA). Millipore, and MO, USA); EMD IN, 07-471; Indianapolis, Roche, (1:1000; (1:1000; (1:2000; Daxx USA), with USA), and ATRX MA, done CA, Billerica, USA) was Cruz, blotting antibodies: CA, Western Santa Adams). Cruz, Biotechnology, Peter following Santa of (gift USA); Biotechnology, 2007) the CA, al., Cruz Cruz, et Santa (Zhang Santa HIRA MO, Biotechnology, PG-M3; Louis, Cruz (1:250; St Santa Sigma, PML H300; D7810; 4H8; (1:250; (1:500; (1:4000; ATRX II DAXX (Rafalska- pol USA); RNA USA); described used: CA, were previously Emeryville, antibodies following Covance, as The 2010). done al., et was Metcalf staining immunofluorescence, For blotting western and Immunofluorescence infection. 2010). shRNA Everett, after pLKO-shDaxx2, and hrs (Lukashchuk and 96–120 described induced previously pLKO-shATRX90 was as Activation vectors respectively, Everett) cells, Roger lentiviral U2OS of and (gifts using HeLa in achieved Daxx and was ATRX endogenous of Depletion analysis down Knock utran . ag .C,Lw .J,Ao,R,Camn .M,Jelinska, M., L. Chapman, R., Amos, J., M. Law, C., J. Yang, S., Eustermann, S. Henikoff, and K. Ahmad, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.110148/-/DC1 online available material Supplementary the and CA10815; months. for 12 P30 PMC after in number release Deposited Facilities. [grant Genomics/Sequencing Wistar Grant and The Imaging 093000-02]; Core GM National Center R01 Award, number Emerald Cancer O’Connor [grant Basil Health The Young of Dimes Foundation; Institutes Beckman of March the Mallinckrodt The funding; The Foundation; (CURE) Award; Institute, Health Wistar Investigator The of from funding Department start-up PA by funded was work This Funding Ellen and discussions design, critical manuscript. primer for Maul ChIP technical Gerd to Pure for and contributions Strumfels Dahmane for Elizabeth Nadia White and David Bell assistance, Laurence ChIP, native ´rube et-soitdpoenDX sanvlhsoecaeoeivle nthe in involved Biol. chaperone complexes. predeposition histone H3.3-Containing Histone novel a H3.3. is of deposition DAXX replication-independent protein death-associated Biol. Mol. Struct. H. R. Singer, factor-kappaB. nuclear by regulated C. genes J. Reed, and infection. M. lytic during DNA viral on acetylation replication. 12030-12038. and HCMV removal of histone repression hDaxx-mediated relieves Virol. (pp71) J. product gene Genet. Hum. J. D. . arc,D,Cye,D,Gbos .J,Roe,D tal. et D. Rhodes, J., R. Gibbons, D., Clynes, D., Garrick, C., H3.3. histone for substitute no variant: assembly. nucleosome replication-independent by ´ ,P,Oaahi . eax . hab .adHmce A. Hamiche, and M. Shuaib, A., Depaux, K., Ouararhni, P., ´, edBoe n ai lir o rtclcmet nthe on comments critical for Altieri Dario and Blobel Gerd , ,N . el,J,Mdn,C . u . ogo,T,Jga .adPicketts, and M. Jagla, T., Hodgson, S., Wu, F., C. Medina, J., Healy, G., N. ´, 2010 20) ain uain le TXtreigt M ula bodies. nuclear PML to targeting ATRX alter mutations Patient (2008). 80 27-34. , 6188-6191. , 16 (2007). 192-201. , 14 796-806. , 20) axrpessepeso fasbe fantiapoptotic of subset a of expression represses Daxx (2006). c tbln(:00 im,S oi,M,UA,adGFP and USA), MO, Louis, St Sigma, (1:1000; -tubulin nvivo In 20) h itn ain 33mrsatv chromatin active marks H3.3 variant histone The (2002). yaiso N oyeaeI transcription. II polymerase RNA of dynamics 21) IAadDx osiuetoindependent two constitute Daxx and HIRA (2010). 20) epssmlxvrsIP rmtsboth promotes ICP0 virus simplex Herpes (2008). 20) ua yoeaoiu HM)UL82 (HCMV) cytomegalovirus Human (2006). ur pn ee.Dev. Genet. Opin. Curr. acrRes. Cancer ee Dev. Genes a o.Cell Mol. 21) e ucin o nold an for functions New (2010). AR;H0;SnaCruz Santa H300; -ATRX; odSrn ab yp Quant. Symp. Harb. Spring Cold 66 24 9026-9035. , 1253-1265. , 9 1191-1200. , 21) Combinatorial (2011). 20 110-117. , .Virol. J. 21) The (2010). u.J. Eur. Nat. 82 , Journal of Cell Science ei,P . lase,S . o,K . tde,S .adAls .D. C. Allis, and C. S. Stadler, M., K. Noh, J., S. Elsaesser, W., Schulick, P. A., Lewis, Maitra, S., D. Klimstra, F., R. Wilde, de H., B. Edil, C., Shi, Y., Jiao, R., Sachidanandam, P., W. Tansey, E., S. Salghetti, T., Tsukamoto, M., S. D., C. Janicki, Allis, C., J. Cochrane, W., P. Lewis, T., Ren, S., Ghosh, B., Xiang, S., Iwase, so,A . ldmrv,O .adMu,G G. G. Maul, and V. O. Vladimirova, M., A. Ishov, so,A . onkv .G,Ngrv . ldmrv,O . ef . Kamitani, N., Neff, V., O. Vladimirova, D., Negorev, G., A. Sotnikov, M., A. Ishov, wn,J n aet,R F. R. Kalejta, and J. Hwang, ikts .J,Hgs .R,Bco,S,Bae .J,Qarl,O .adGibbons, and W. O. Quarrell, J., D. Blake, S., Bachoo, R., D. Higgs, J., D. Picketts, epy .M,d id,R . io . li,A . dl .H,Si C., Shi, H., B. Edil, P., A. T. Stamminger, Klein, and H. Y., Sindre, Jiao, H., Hofmann, F., R. Wilde, de M., C. Heaphy, and F. D. Hunt, J., Shabanowitz, P., S. Baker, M., Kauer, A., B. Garcia, B., S. Hake, akno,J n vrt,R D. R. Everett, and J. Parkinson, ooo,V . asl,N . ldmrv,O . al .G n so,A M. A. Ishov, and G. G. Maul, V., O. Vladimirova, A., N. Massoll, M., V. Morozov, agud .adRimn B. Roizman, and R. Hagglund, K. M. Chelbi-Alix, and C. M. Geoffroy, oear .J,Kse,J,Zinnug .A,vnSus . aetj,L . van J., L. Valentijn, P., Sluis, van A., D. Zwijnenburg, J., Koster, J. J., R. J. Gibbons, Molenaar, and R. D. Higgs, J., M. Sternberg, A., L. Kelley, M., Mitson, odeg .D,Bnsysi .A,Nh .M,Lws .W,Esesr .J., S. Elsaesser, W., P. Lewis, M., K. Noh, A., L. Banaszynski, D., A. Goldberg, and M. Kathoria, A., Orr, M., Dasso, H., Saitoh, P., Freemont, D., R. Everett, a,Y . uwo . hn,B n pco,D L. D. Spector, and B. Zhang, H., Sunwoo, S., Y. Mao, D. R. Everett, and V. Lukashchuk, i,X . a,S,Aeass .adHme,M. Hummel, and M. Abecassis, S., Yan, F., X. Liu, .D,Tn,L . ofag .L,Coi .A tal. et A. neuroendocrine M. pancreatic Choti, in altered L., frequently are C. tumors. genes Wolfgang, pathway mTOR H., and L. MEN1, Tang, D., R. cells. al. single et in H. analysis R. real-time Singer, expression: E., 698. gene Bertrand, Y., to Shav-Tal, silencing T., From Ried, V., K. mental-retardation Prasanth, human al. to et mechanism H. Li, recognition syndrome. J., methylation D. histone Patel, atypical J., D. Picketts, ntaino ia neto tteencerdomains. facilitates nuclear ND10 these at at pp71 infection viral protein of tegument initiation cytomegalovirus human of accumulation omto n eristePLitrcigpoendx oti ula structure nuclear this to daxx protein SUMO-1. PML-interacting by G. modified the G. Maul, when recruits and 3rd and F., J. formation Strauss, T., E. Yeh, T., erdto fDx ytevrlp7 rti nhmncytomegalovirus-infected human in protein pp71 viral the by cells. Daxx of degradation .J. R. 10017. h p1poeno ua yoeaoiu n h M-neatn rti human protein PML-interacting the al. and cytomegalovirus et human Daxx. S. of protein Hebbar, mutations. pp71 G., DAXX the and C. ATRX Eberhart, with tumors J., in F. telomeres Altered Rodriguez, C., Bettegowda, chromosomes. metaphase in USA centromeres bordering regions D. C. Allis, ipe iu ye1IP fetclua tutrsadproteins. and structures cellular affect ICP0 1 type virus simplex 20) euaino -e xrsinb rncito erso Daxx. repressor transcription by expression c-met 27 of Regulation (2008). otcl yhre ipe iu 1. virus simplex herpes by cell host 691. 21) eunigo erbatm dniiscrmtrpi n eet in al. et defects J. and Arkel, van chromothripsis A., B. identifies Westerman, neuroblastoma J., genes. Nes, of neuritogenesis van Sequencing M., Hamdi, (2012). I., Ploeg, der tde,S,Dwl,S,Lw . u,X,L,X tal. et X. regions. Li, genomic X., specific at Guo, localization M., H3.3 variant Law, histone S., control Dewell, S., Stadler, PML several defense. of antiviral host loss in protein proteasome-dependent and Vmw110- the isoforms. with correlates J. Parkinson, ucinlsgiiac fmttosi h n2dmi fATRX. of domain Snf2 the 20 in mutations of significance Functional RNAs. noncoding by body nuclear 13 a of assembly co-transcriptional the hDaxx. and ATRX components ND10 by infection 4026-4040. 1 type virus simplex edu fhsoeH oiiain pcfe oaiaino TXt hetero- to ATRX of localization specifies modifications H3 histone chromatin. of readout rncitoa ersost h uiectmglvrsmjrimmediate-early major cytomegalovirus infection of murine course the the during to promoter repressors replication- transcriptional in ATRX with telomeres. cooperates at and 14075-14080. assembly chaperone chromatin histone independent H3.3-specific an is 2177-2186. , 2603-2610. , 95-101. , 102 Virology 19) TXecdsanvlmme fteSF aiyo proteins: of family SNF2 the of member novel a encodes ATRX (1996). .Virol. J. Science 6344-6349. , .Virol. J. a.Src.Ml Biol. Mol. Struct. Nat. a.Src.Ml Biol. Mol. Struct. Nat. 20) eie3 hshrlto fhsoevratH. sseii to specific is H3.3 variant histone of phosphorylation 31 Serine (2005). 19) h irpino D0drn epssmlxvrsinfection virus simplex herpes during ND10 of disruption The (1998). 367 76 331 5769-5783. , 72 334-338. , 1199-1203. , 6581-6591. , Nature .Cl Biol. Cell J. 483 20) oeo C0i h taeyo oqeto the of conquest of strategy the in ICP0 of Role (2004). 20) rtaoedpnet ubiquitin-independent Proteasome-dependent, (2007). 20) lhhrevrspoen eae oherpes to related proteins Alphaherpesvirus (2000). 589-593. , .Itreo yoieRes. Cytokine Interferon J. 18 18 21) euaino C0nl uatherpes mutant ICP0-null of Regulation (2010). .Virol. J. 769-776. , 777-782. , nvv.J Virol. J. vivo. in 147 21) oeo rmeoyi leukemia promyelocytic of Role (2011). 21) TXADdmi ik an links domain ADD ATRX (2011). 78 20) ucinlitrcinbetween interaction Functional (2002). 221-234. , 2169-2178. , rc al cd c.USA Sci. Acad. Natl. Proc. 19) M sciia o ND10 for critical is PML (1999). 21) ihscrcutetof recruitment Biphasic (2010). .Virol. J. 21) ietvsaiainof visualization Direct (2011). 84 3631-3643. , 20) Daxx-mediated (2002). 21) itntfactors Distinct (2010). 31 21) DAXX/ATRX, (2011). rc al cd Sci. Acad. Natl. Proc. 76 145-158. , Science .Virol. J. 7705-7712. , u.Ml Genet. Mol. Hum. Cell Cell a.Cl Biol. Cell Nat. 21) Daxx (2010). .Virol. J. 333 74 Oncogene 116 140 10006- , 425. , (2004). (2011). (2011). 683- , 678- , 107 84 , , rncitoa ersinb axadAR 5501 ATRX and Daxx by repression Transcriptional cniemn .I,Ski . odti,S n ha,K. Ahmad, and S. Goldstein, A., Sakai, I., J. Schneiderman, evs . odal . opo,T n icar J. Sinclair, and T. Compton, D., Woodhall, M., Reeves, Almouzni, and M. Lipinski, M. M., E. S. Martini, Janicki, C., Scamps, and P., J. G. Quivy, D., LeRoy, Ray-Gallet, M., L. Joo, L., S. Powers, U., I. Rafalska-Metcalf, aasaMtaf .U n aik,S M. S. Janicki, and U. I. Rafalska-Metcalf, C. J. Reed, and A. L. Puto, J. M. Nicholl, and M. C. Preston, eg .Y,Vkc .R,Ce,Z . lbl .A n egr .L. S. Berger, and A. G. Blobel, C., Z. Chen, R., C. Vakoc, Y., P. Zeng, ho . aaua . u . aa,Z n pco,D L. D. Spector, and Z. Lazar, Y., Fu, T., Nakamura, R., Zhao, hvsv .P n ud,M. Dundr, and P. S. Shevtsov, a,F n cafr .A. P. Schaffer, and F. Yao, C., Qu, J., Becksfort, S., B. Paugh, C., Lu, A., D., T. McEachron, R. A., Hannan, Broniscer, G., S., Wu, Ahn, A., M. Anderson, M., Sim, D., J. McGhie, H., L. Wong, Va A., Kawamori, O., and Velazquez, S. Y., A. Yoshioka, Belmont, V., T., Valadez-Graham, Tumbar, M., S. Janicki, N., Hashiguchi, T., Tsukamoto, hn,J,H,Y . ul,L,L,S,Wn,M,Kn,X,L,T,Se,P n Ma, and P. Shen, T., Li, X., Kong, M., Wang, S., Li, L., Xueli, Z., Y. Hu, J., Zhang, hvTl . azc,X,Seo,S . uc,D,Jnci .M,Setr .L. D. Spector, M., S. Janicki, D., Fusco, M., S. Shenoy, X., and Darzacq, M. Y., S. Shav-Tal, Janicki, C., Balane-Bolivar, U., I. Rafalska-Metcalf, M., N. Shanbhag, og .H,Rn . ilas . che . h,S,Sm . a,A,Earle, A., Tam, M., Sim, S., Ahn, J., McGhie, E., Williams, H., Ren, H., L. Wong, J. D. Picketts, R., Shiekhattar, G., O. Barak, R., Stratt, H., Liu, S., Wu, J., Tang, Y. Nakatani, and G. Almouzni, D., Ray-Gallet, H., J. Tagami, D. Davido, and C. Boutell, C., M. Smith, hn,R,Ce,W n dm,P D. P. Adams, and W. Chen, R., Zhang, cwrznrbr . osuo,A,Lu .Y,Jns .T,Paf . ao,K., Jacob, E., Pfaff, T., D. Jones, Y., X. Liu, A., Korshunov, J., Schwartzentruber, eoee agt yai hoai nDrosophila. in chromatin dynamic targets remodeler yoeaoiu E2poenitrcswt h rncitoa erso Dx to hDaxx infection. repressor lytic transcriptional during expression the gene with LUNA interacts regulate protein IE72 cytomegalovirus synthesis. G. dynamics. activation transcriptional of analysis e10272. cell Single (2010). xrsini iigcells. living in expression expression. gene immediate-early cytomegalovirus ehlrnfrs erimn n N hypermethylation. DNA and recruitment methyltransferase syndrome. ATR-X the underlying mechanism common Genet. a Mol. to point mutations okakn ceeae h ieiso otmttctasrpinlre-activation. Biol. transcriptional post-mitotic Cell of kinetics the accelerates bookmarking ulcoslnigfrietfcto fidrc N-soitdpoen ychromatin by herpes proteins DNA-associated of indirect of protein identification for regulatory cross-linking dual major a ICP0, 1. non-brainstem for type virus functionally and simplex substitute gliomas can pontine U2OS intrinsic diffuse pediatric Hospital– in glioblastomas. Research Children’s alterations Jude Project pluripotent St. H3 Genome al.; Cancer in et Pediatric M. University H. Parker, integrity Washington R., K. Huether, structural Choo, L., Ding, and telomere R. maintaining J. in Mann, cells. stem A., H3.3 embryonic K. with Morgan, interacts J., A. George, 871-878. L. D. Spector, 20369-20377. Daxx. Y. Biol. H. Science R. Singer, and breaks. double-strand DNA to cis A. R. Greenberg, nqeadfntoal seta eoei hoai nebyncse cells. stem embryonic in chromatin telomeric essential Res. Genome functionally al. et and J. Mann, unique A., M. Anderson, E., expression. gene regulate to chromatin 1474. the M. Zurita, in and DREF M. Yamaguchi, A., Neumann, protein. syndrome ATR-X the and protein domain-associated X. Yang, and replication. viral eecneascae eeohoai foci. heterochromatin senescence-associated uain nhsoeH. n chroma and To H3.3 A., D. histone Quang, glioblastoma. in M., A. mutations Fontebasso, D., Sturm, 14472-14477. 33cmlxsmdaencesm sebyptwy eedn rindependent or dependent pathways synthesis. assembly DNA of nucleosome mediate complexes H3.3 immunoprecipitation. 20) IAi rtclfrancesm sebyptwyidpneto DNA of independent pathway assembly nucleosome a for critical is HIRA (2002). 21) h niiino M rmtrb etsokfco bi euae by regulated is 4b factor shock heat by promoter CMV of inhibition The (2010). 13 n.J ice.Cl Biol. Cell Biochem. J. Int. 167-173. , 304 o.Cell Mol. 13 1797-1800. , 5 1295-1304. , 1899-1907. , 19 Nature a.Genet. Nat. 20) iulzto fgn ciiyi iigcells. living in activity gene of Visualization (2000). 20) oe rncito euaoycmlxcnann death containing complex regulatory transcription novel A (2004). 404-414. , uueVirol. Future 21) T-eedn hoai hne iec rncito in transcription silence changes chromatin ATM-dependent (2010). Cell 9 20) yaiso igemNsi ulio iigcells. living of nuclei in mRNPs single of Dynamics (2004). 482 1091-1100. , .Virol. J. Biotechniques eoeRes. Genome 116 226-231. , .Cl Sci. Cell J. 44 20) axrpessRl agtpooesvaDNA via promoters target RelB represses Daxx (2008). 51-61. , 19) natvt pcfe yteotoacm line osteosarcoma the by specified activity An (1995). 21) ulaino ula oisb RNA. by bodies nuclear of Nucleation (2011). 251-253. , 69 6 421-429. , 20) oeo h ellrpoenhaxi human in hDaxx protein cellular the of Role (2006). 6249-6258. , 42 Cell 1698-1707. , 20 41 120 20) itn 33icroainpoie a provides incorporation H3.3 Histone (2009). 351-360. , 9,66 698. 696, 694, , 141 20) oeua iscino omto of formation of dissection Molecular (2007). 2301-2307. , 970-981. , 21) S- C0 aigtewyfor way the paving ICP0: HSV-1 (2011). 20) hwadtl:vsaiiggene visualizing tell: and Show (2007). i eoeln ee npaediatric in genes remodelling tin o.Cl.Biol. Cell. Mol. 21) N/AR neat with interacts XNP/dATRX (2012). .Gn Virol. Gen. J. ne,M tal. et M. ¨njes, rc al cd c.USA Sci. Acad. Natl. Proc. uli cd Res. Acids Nucleic .Virol. J. ee Dev. Genes 20) itn 31and H3.1 Histone (2004). 21) oai histone Somatic (2012). 27 2343-2358. , .Bo.Chem. Biol. J. 84 87 20) h XNP The (2009). 7185-7194. , a.Cl Biol. Cell Nat. 21) Human (2010). 1113-1121. , 21) ATRX (2010). 21) Driver (2012). (2006). LSONE PLoS 21) Gene (2011). 22 zuz M., ´zquez, 998-1010. , 40 a.Cell Nat. 1460- , nvivo In Hum. 279 106 Nat. 5 2 , , , ,