Analysis of DNA replication during the SOS response in
Escherichia coli
Thesis submitted for the degree of Doctor of philosophy
at the University of Leicester
by
Mohammed A. Khidhir B.Sc. (University of Baghdad)
University of Leicester, Department of Genetics
March 1987 UMI Number: U000911
All rights reserved
INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion.
Disscrrlation Publishing
UMI U000911 Published by ProQuest LLC 2015. Copyright in the Dissertation held by the Author. Microform Edition © ProQuest LLC. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code.
ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346
Dedication : To my parents, my wife Nadia and my son Yasir Acknowledgement
First and most, I would like to thank Professor I.E. Holland for his interesting style of supervision and encouragement. I am also grateful to Dr S. Casaregola for his invaluable source of information and important discussion, I would like to thank the people in the laboratory and everyone in the department for the friendly atmosphere during the work on this project. Accurate and efficient typing of the thesis was done by Sheila Mackley for which I appreciate. Finally I would like to thank my wife Nadia for her interminable support and patience. Abbreviations
DMSO Dimethyl sulphoxide
DNA Deoxyribonucleic acid
DTT Dithio threitol
EDTA Ethylanediaminetetra-acetic acid h hours
Kb Kilobases
KD Kilodaltons min minutes
PEG Polyethylene glycol
rpm revolutions per minutes
SDS Sodium dodecyl sulphate
TCA Trichloroacetic acid
Tris Tris (hydroxy methyl) amino methane
TEMED N,N,N’,N’, tetra methyl ethylene diamine
Tet Tetracycline
CAM Chloramphenicol
UV Ultraviolet
ci curies
MP Minimally purified
Hp Highly purified
rif rifamycin/rifampicin
Ts Temperature sensitive
rNTP ribonucleoside triphosphate
dNTP deoxy nucleoside triphosphate
ATP Adenosine triphosphate
Cpm Counts per minutes Abbreviations continued .... 2
X-gal 5-bromo-4 chloro-3-indolyl-g-D-galactoside
MMS Methyl methane sulphonate dNMP deoxy nucleoside monophosphate. N = adenine,
quanosine, thymidine, cytidine rNMP ribonucleoside monophosphate
Moaps 3“(N-morpholino propane sulphonic acid) Contents
Page
Chapter 1.
1.1 A. Mechanisms of DNA replication in E. coli
i. Genetics of DNA replication in E. coli 1
ii. Small replicons as tools for the study of DNA 3
replication
iii. Origin and direction of replication 4
I.IB. The replication fork 5
i. Polymerase involved in DNA replication 5
ii. Discontinuous replication 7
iii. Nature of primer synthesis 9
iv. Unwinding and elongation of DNA chain iji vitro 10
V . Initiation of DNA replication at the 14
chromosomal origin
vi. Stable DNA replication 18
1.2. Fidelity and proof reading activities of E. coli 21
DNA polymerase
1.3. Overview of different DNA repair processes 25
1.4. The SOS response 29
i. Induction of the synthesis of RecA protein 30
ii. Stable DnA replication 31
iii. Cell division 31
iv. Inducible error prone repair (SOS-repair) 33
V . The genetic control of the SOS response 34
vi. The inducing signal 36
vii. Identification of SOS inducible genes under lexA 38
control Page
viii. The lexA binding sites 39
ix. The role of the umuD,C in UV and chemical 39
mutagenesis
Chapter 2. Materials and Methods
2.1. Bacterial and bacteriophage strains 42
2.2. Media 42
2.3. Growth of bacterial cultures 43
2.4. UV-irradiation 43
2.5. Measurement of bacterial cell number 43
2.6(a). DNA synthesis 44
2.6(b). Rate of DNA synthesis 44
2.7. Measurement of stable DNA replication 44
2.8. Generalized transduction using PI vir 45
a. Preparation of lysatee
b. PI-transduction
2.9. Transformation 46
a. The Rbcl method
b. Hanahan method
c. The calcium chloride method 47
2.10. Phenol extraction 48
2.11. Ethanol precipitation 48
2.12. Preparation of plasmid DNA 49
a. Rapid plasmid DNA preparation
b. Large scale plasmid preparation
2.13. SDS-polyacrylamide gel electrophoresis 50
a. Preparation and running of gels
b. Autoradiography 51 Page
2.14. Restriction enzyme digest 51
2.15. Preparation of cell-free extract for DNA replication 51
2 .16. Concentration of extract 52
2.17. Hydroxylamine treatment 52
2.18.' The J_n vitro replication essay 52
2.19. The measurement of the level of g-galactosidase 53
activity
Chapter 3. The kinetics of DNA synthesis following UV
3.1. Effect of recA~ and lexA(ind~1 ) mutations an 55
inhibition of DNA synthesis in UV-irradiated
bacteria
3.2. DNA synthesis in the recA44l mutant at the 57
restrictive temperature
3.3. DNA synthesis in lexA(ts) mutants at the 59
restrictive temperature
3.4. Effect of inhibition of protein synthesis on 6l
inhibition of DNA synthesis after UV-irradiation
3.5. Discussion 62
Chapter 4. Mechanism of the recovery of DNA synthesis in 64
Uv-irradiated bacteria
4.1. Effect of a split UV dose on recovery of DNA 64
synthesis after UV-irradiation
4.2. Recovery of DNA synthesis following UV-irradiation 65
in E. coli K12
4 .3. Effect of a split dose on the rate of DNA synthesis 66
in E. coli K12 (AB1157) Page
4.4. The recovery of DNA synthesis following UV 67
irradiation in mutants defective in DNA repair or
other SOS functions
4.5. Recovery of DNA synthesis in a umuC mutant 68
4.6. Discussion 69
Chapter 5. Further studies on the role of RecA protein in the
recovery of DNA synthesis following UV-irradiation
5.1. The recovery of DNA synthesis following UV in 70
recA430
5.2. The recovery of DNA synthesis following UV in 71
recA453 (zab-53)
5.3. The recovery of DnA synthesis in a recA constit- 71
utive mutant
5.4. Requirement for RecA protein in the recovery of 72
DNA synthesis
5.5. Effect of a split dose upon DNA synthesis in the 73
recA temperature sensitive mutant (recA-200)^®
5.6. Effect of inhibition of protein synthesis on the 74
recovery of DnA synthesis in a recA constitutive
mutant
5.7. Discussion 75
Chapter 6. Analysis of the role of stable DNA replication in
recovery of DNA synthesis after UV
6.1. Introduction 77
6.2. UV-sensitivity of constitutive "stable" replication 78
(cSdr) Page
6.3* The recovery of DNA synthesis following UV- 78
irradiation in an isdr strain
6.4. Recovery of DnA synthesis following UV-irradiation 79
of an rnh, recA^c double mutant
6.5. Discussion 80
Chapter 7. In vitro mutagenesis 83
7.1. The jji vitro replication system 84
7.2. UV-sensitivity of DNA replication vitro 84
7 :3. Replication of plasmid DNA in extracts from SOS 85
induced cells
7.4. Development of systems for vitro mutagenesis 86
i . Selection based on the E. coli lac system 86
ii. Selection based on the reversion of mutations in 87
tet or cam antibiotic resistance genes
7.5. Optimization of the procedure for the detection of 88
mutated plasmids
i . Transformation 88
ii. Isolation of replicated DNA for transformation 89
7.6 . Discussion 90
Chapter 8.
8. 1. In vivo mutagenesis of strain SC41 in the presence 92
or absence of pKMIOI
8.2. Attempts to mutagenise plasmid pMC7 carrying 92
laclQ vitro
8 .3. Determination of the level of g-galactosidase in 94
the lac+ transformants Page
8.4. Is the lac+ phenotype of strains isolated in 8.2 95
above due to a mutation in the pMC7 plasmid or in
the bacterial chromosome
8.5. Curing of plasmid pMC7 from tet^ lac+ trans 96
formants of CSH26
8.6. Discussion 97
Chapter 9. In vitro mutagenesis : Analysis of reversion to
tetracycline resistance
9.1 . Introduction 99
9.2. Production of antibiotic sensitive derivatives 99
of plasmid pBR325 Jji vitro
9.3. Attempts to mutagenise plasmid pLG7001 (tet^, 100
camR in vitro)
9.4. Discussion 101
Chapter 10. General discussion 102
10.1. The role of stable DNA replication and other 102
phenomena in the recovery of DNA synthesis following
UV-irradiation
10.2. Model(s) for trans-dimer synthesis by-pass 104
mechanism
10.3. Dri vitro) mutagenesis 107
10.4. Involvement of Reca protein in SOS mutagenesis 108
10.5. The SOS system in relation to other stress 109
responses
Future studies 111 Page
References 113
Appendix I. Mutations affecting or involved in SOS functions
used in this study I
i. Mutations in the recA gene I
ii. Mutations in the lexA gene II
Appendix II. IV Chapter 1
Introduction
1.1 A Mechanism of DNA replication in E.coli i) Genetics of DNA replication in E.coli
Contrary to earlier expectations that DNA synthesis required simply a polymerase, triphosphates and a single-strand template (reviewed in Kornberg, 1980), DNA replication i^ vivo has proved to be a surprisingly complex process. This stems primarily from the requirements for unwinding a double-stranded DNA molecule, the opposite chemical polarity of complementary strands and the inherent inability of Dna polymerases to initiate synthesis in the absence of a primer. This complexity was nevertheless indicated already in 1968 with the finding of
Epstein et al. that bacteriophage T4 replication appeared to involve the activity of at least five complementation groups.
Subsequent studies in E.coli confirmed this genetic complexity with several conditional lethal mutants being divided conveniently into delayed stop and fast stop classes with respect to DNA replication at high temperature C Gr o s s >197^ } Sevastopoulos et al., 1977;
Wechsler, 1978). Further characterisation of these mutants established that the two classes reflected the initiation and elongation steps of replication respectively. This initiation event in E.coli refers to the formation of a pair of replication forks at a specific site on the chromosome termed the origin (oriC). On the other hand "elongation" refers to replication fork movements around the chromosome in opposite directions to a relatively well defined "terminus" (Bouche ^ . , 1975).
As indicated above many E.coli mutants defective in DNA replication have been isolated and these mutants and their phenotype are
-1- summarized in Table 1.1, (for details see Gross, 1972; Wechsler, 1978).
As also indicated above many of these mutants exhibit a conditional lethal phenotype (temperature sensitive), and a modified pattern of DNA synthesis at a restrictive temperature. Other mutants display resistance to antibiotics that interfere with DNA synthesis. The conditional lethal mutants fall into two phenotypic classes. a) Mutants in which replication of chromosomes already initiated before the temperature shift continues to the terminus. Mutants in this class are defective in initiation and include dnaA and dnaC (reviewed by
Wechsler, 1978). Two additional mutants of this type dnaI and dnaP which have been shown recently to be alleles of dnaA and dnaG respectively
(Yota et ^ . , 1985) were also identified. Several studies have now also indicated that DAr^ gyrase is also involved in initiation (Staudenbaur,
1975; Orr ^ al., 1979; Fairweather, Ph.D Thesis, 1980). b) Conditional lethal mutants defective in the elongation of the previously initiated replication forks usually cease DNA replication immediately upon a shift to the restrictive temperature. Mutants dnaE, dnaB and dnaG are examples of this type. However, mutations affecting replication fork elongation are not necessarily lethal to the cell since mutants defective in rep function (Lane and Denhart, 1975) and many mutants defective in the lig and polA genes (Kuempel and Veomett, 1970
Gottesman et ^ . , 1973; ) have reduced fork movements or slow joining of replication intermediates but remain viable.
Novobiocin (and other coumermin drugs) and nalidixic acid are two groups of antibiotics which inhibit DNA synthesis. The isolation of mutants resistant to these antibiotics led to the identification of the target enzyme, DA/A gyrase (Gellert at ,al., 1976a; Sugino et , 1977), and its role in initiation (Fairweather, Ph.D Thesis, 1980; Orr et al.,
1979; Staudenbauer, 1975). This enzyme is composed of two different
-2- subunits, A and B, which are coded for by the genes gyrA (nalA) and gyrB
(cou) respectively. The A subunit is the target for nalidixic acid and oxalinic acid (Gellert ^ , 1977; Sugino et ^ . , 1977) whereas the B subunit has been identified as the target for novobiocin and the structurally related antibiotics coumermycin and clorobiocin (Gellert et al., 1976a; Fairweather et al., 1980).
ii) Small replicons as tools for the study of DNA replication
Much of our knowledge of DNA replication has come not from studies with chromosomal DNA, but from studies with smaller replicons of phage and plasmids present in E.coli. This is obviously due to the ease of isolation and handling of these small DNA molecules. At this point the properties and structure of these elements will be discussed briefly.
Plasmids ranging in molecular weight from 2x10^ to 10® (reviewed by
Clowes, 1972), can be separated from chromosomal DNA in crude cell extracts as covalently closed circular molecules of double-stranded DNA by caesium chloride density gradient centrifugation in the presence of ethidium bromide. On the other hand bacteriophage DNA can be isolated from purified phage particles with relative ease. Some large phages eg. X, PI and T4 contain a double-stranded linear DNA molecule which circularizes upon infection and replicates in this form. In contrast, other pahge DNAs eg. T7 remain linear throughout the replication cycle.
These large phages code for many of the enzymes necessary for their own replication, including DNA polymerases, ligases, primases and DNA binding proteins. In contrast, many smaller phages encode few replication proteins and consequently these have provided the most information about the biochemistry of DNA replication. Thus the single-stranded phages, bxi74 and the closely related G4 in particular when used as templates for in vitro DNA replication in wild-type E.coli extracts have led to the
-3- Table 1.1 Loci involved in DNA replication in E. noli K12
(a) Genetic nomenclature and map position are according to
Bachmann et (1976).
(b) It has been proposed that the nalA and cou loci be renamed gyrA
and gyrB respectively (Hansen and Von Meyenburg, 1979).
(c) The reader is also referred to the updated E. coli K12 linkage
map (Bachmann, 1983).
(d) It should be noted that where a gene product is involved in
elongation, this does not necessarily rule out a role in
initiation (and vice versa). Table 1.1
Mutant Map(&) Gehe product or References(o) designation(&) position (min) process affected
by mutation
dnaA 82 Initiation Hirota et (1968)
dnaB 91 Elongation Hirota et al. (1968)
Cari (1970)
dnaC 99 Elongation and Cari (1970)
initiation
dnaE Elongation; DNA Gefter et (1971 )
polymerase III
dnaG 66 Elongation; DNA Rowen and Kornberg
primase (1978)
dnal 37-44 Initiation in See Wechsler (1978),
E.coli B/r Beyersmann et al.
(1974)
dnaL 96 Elongation Sevastopoulos ^ al.
(1977)
dnaM 76 Elongation Sevastopoulos ^ al.
(1977)
dnaP 84 Elongation; Wada and Yura (1974)
possibly membrane
associated
dnaZ 10 Elongation; sub Filip et al. (1974),
(originally unit of DNA poly Wickner and Hurwitz.
dnaH) merase III (1976)
holoenzyme Table 1.1 Continued
Mutant Map(&) Gehe product or References(o) designation^^) position (min) process affected by mutation(ë)
polA 85 DNA polymerase I de Lucia and Cairns
(1979), Gross and
Gross (1969)
polB DNA polymerase II Campbell et al.
(1974)
lig 51 DNA ligase Gottesman £t al.
(1973)
cou(b) 82 Elongation and Ryan (1976), Gellert
(gyrB) initiation. DNA et (1976a), this
gyrase subunit B thesis
nalA(b) 48 Elongation. DNA Hane and Wood (1969)
(gyrA) gyrase subunit A Sugino et (1977)
ssb 90 Elongation. DNA Meyer et (1979)
binding protein
dna-517 82 Probable gyrB Projan and Wechsler
allele (1978)
rpoB 89 Initiation, g Lark (1972),
subunit of RNA Bagdassarian et al.
polymerase (1977)
rep 83 Elongation Lane and Denhardt
(1975)
sdrA 54 RnaseH, possible Kogoma (1978)
initiation identification and purification of many proteins involved in the normal bacterial replication process. This has been achieved by complementation of extracts from temperature sensitive dna mutants with wild-type extracts (see Wickner, 1978).
iii) Origin and direction of replication
Early studies indicated that the replication of the E.coli chromosome is initiated at a unique site located in the dnaA-ilv region
(between 74 and 83 minutes), and proceeds bidirectionally (Masters and
Broda, 1971; Holdfield and Vielmetter et ^ . , 1974). Subsequently, by hybridization studies using strains containing the bacteriophage Mu inserted into one of four different genes in the vicinity of the ilv locus, Fayat and Louarn (1978) were able to conclude that oriC lay between bglR and rbs (see Figure 1.1). Von Meyenburg et al. (1978) isolated various X transducing phages carrying chromosomal markers in the ori region. They found that some X asn phages were able to replicate in
E.coli X lysogens by virtue of autonomous replication from an origin disticnt from the X origin, presumably from oriC. From this study it was concluded that oriC lay between uncB and asn (see Fig. 1.1). Ligation of a restriction fragment from this Xasn replicon (Messer et ^ . , 1978) or from restricted E.coli DNA (Yasuda and Hirota, 1977) to a second non-replicating fragment coding for ampicillin resistance to form an autonomously replicating plasmid has enabled the origin to be studied in detail. The nucleotide sequence of a 4.2-4.3 Kb segment of chromosomal
DNA from the oriC region was determined and shown to contain a single
EcoRI fragment. This fragment appears to contain all the information necessary for efficient initiation of replication (Sugimoto et al., 1979)
(see Fig. 1.1).
-4- Fig. 1.1 Order of genes around the origin of replication of E. coli
This diagram represents the E. coli chromosome in the vicinity of the origin of replication (oriC) at approximately 82 minutes. The concluded order is taken from Fayet and Louarn (1978) and Von Meyenburg et al. (1978); p-oril, p-orir represent the two promoters within ori-region. R1-R4 represent the consensus sequences (binding sites) recognised by DnaA protein (Lother et , 1985). GATC boxes represent sites of DNA méthylation. .1
C
s P I cr o o < GT 4j Oi < CO 2 u CO CL O D I- CO < u < CO in < C (0 o 0> c g Q § o o I— w \ I LO
I CO o OJ
jO o U o c CO < Ë lO -J " (J CÔ CO TJ cr / § s _o o a -O / c2l / o Uo J\'S CM CM 10: o ■ S’ Ik o CO - CM o c -o E _o -o lO \ cJ il cEl CO \ Q. \ o RI \ ■IT) \ H a. m CO m The direction of replication usually from a fixed point has also been studied in other bacteria. In both Salmonella typhimurium and Bacillus subtilis replication appears to be bidirectional (Fujisawa and Einsenstark, 1973; Wake, 197%). With phage X (Schnos and Inman, 1970) and the mini-F plasmid (Eichenlaub et al., 1977) electron microscopic analysis has shown that replication is bidirectional, whilst phage P2 (Schnos and Inman, 1971) and the plasmid ColEI (Inselburg, 1974) replication appears to be unidirectional. B. The replication fork In this section I will summarize the important steps in the replication process (Fig. 1.2). i) Polymerases involved in DNA replication Three enzymes have been isolated from E.coli which direct the synthesis of DNA from the complementary strand as a template. These enzymes termed DNA polymerase I, II, III, are identified genetically by the loci polA, polB and dnaE respectively (see Table 1.1). The three polymerases extend chains in the direction 5 ’ to 3 ’ and require a primer oligonucleotide with a free 3 ’OH group bound to a single-stranded DNA template before polymerisation can occur. All three polymerases have co-purified with a 3 ’ to 5 ’ exonuclease activity, however, only poll and polIII were reported to have an additional 5* to 3 ’ exonuclease activity (Livingston and Richardson, 1975). In fact, more recently Kornberg (1986) has shown that polIII (dnaE gene product) has neither 5 ’ to 3 ’ exonuclease nor 3 ’ to 5 ’ editing function. Attempts to demonstrate the absolute requirement for the polymerase activity of poll for growth of E.coli have failed. However, polA mutants are sensitive to UV-irradiation (Gross and Gross, 1969) and show retarted joining of -5- Fig. 1.2 A schematic diagram of the replication fork taken from DNA replication by A. Kornberg (1980). rep PROTEIN; PREPRIMING (HELICASE) . ; PROTEINS (n,n',n",C) DNA BINDING PROTEIN (SS3) dnaB PROTEIN POLYMERASE 111 H 0 L 0 E N 2 V M E rNMP dNMP DNA POLYMERASE I © " " LIGASE — LAGGING STRAND nascent DNA fragments (Okazaki pieces; Kuempel and Veomett, 1970). Moreover, the polA mutation is lethal when combined with a non-lethal temperature-sensitive lig4 mutation (Gottesman ^ , 1973). In contrast, polAexl mutants which lack the 5 ’ to 3 ’ exonuclease are lethal, and therefore this activity is absolutely required for growth, (Konrad and Lehman, 1974; Olivera and Bonhoeffer, 1974). Thus, although the polymerase activity of poll may be involved in DNA replication, the major role for poll appears to be in repair synthesis and perhaps in the removel of RNA primers and the subsequent joining of Okazaki fragments (see later). However, the replication of plasmid ColEI is dependent upon poll, both jri vivo and hr vitro (Kingsbury and Helinski, 1973; Staudenbauer, 1976b), participating in an early step in replication prior to final replication of the molecule by polIII. The role of polll in either replication or repair in E.coli remains unclear and will not be discussed further. On the other hand there is now convincing evidence that polIII provides the polymerase activity at the replication fork. The conditional lethal mutants designated dnaE (polIII") rapidly cease DNA synthesis upon shifting to the restrictive temperature (Weschler and Gross, 1971), and elongation of single-stranded DNA phages and ColEI DNA vitro all require polIII Wickner et ^ . , 1972; Staudenbauer, 1976b). In fact the iji vitro systems for the replication of single-stranded DNA phages like G4 and ^X174 have been used to purify and characterise many of the E.coli replication proteins. Thus, studies with ^X174 DNA replication vitro have shown that the activity of polIII polymerase in this system is dependent upon its incorporation into a multimeric complex termed the holoenzyme (Wickner et ^ . , 1973). Df/A polymerase III holoenzyme has been shown to be the primary polymerisation complex involved in chain elongation in E.coli and also is therefore likely to be the major determinant of -6- fidelity (Kornberg, 1980; Echols, 1982). The polIII holoenzyme is composed of at least seven subunits a. I, 6, T, T, 6 and B (McHenry and Kornberg, 1977; Kornberg, 1980). The smallest sub assembly of polIII holoenzyme which can be readily prepared is the polIII core, containing the a, I and 9 subunits (McHenry and Crow, 1979). Protein a is the dnaE gene product (Welch and McHenry, 1982), and Z is the dnaQ gene product (Scheuerman et ^ . , 1983). The polIII core carries both the polymerase and the 3 ’ to 5 ’ exonuclease activity of the polIII holoenzyme (McHenry and Crow, 1979). Enzyme assays with subunits separated by SDS PACE have indicated that the large (a) subunit has the polymerase activity (Spanos et al., 1981). On the other hand mutations in the dnaQ gene (mutP) render polIII holoenzyme defective in the editing exonuclease (Echols and Burgens, 1983; Difrancesco et , 1984) and recently Richard et al. (1984) have found that Z carries a 3 ’ to 5' exonuclease activity with characteristics closely similar to those of the purified polIII core enzyme. These workers therefore concluded that the editing and polymerization activities of polIII holoenzyme reside on quite distinct subunits. This is in contrast to poll where these activities are contained within the polA polypeptide itself. Interestingly, the great majority of Eukaryote polymerases also lack an inherent 3 ’ to 5 ’ editing exonuclease which may therefore also be carried by an independent polypeptide. ii) Discontinuous replication Double-stranded DNA consists of two antiparallel chains and yet all known DNA polymerases extend chains only in the 5 ’ to 3 ’ direction, consequently, synthesis of at least one strand during coordinated advancement of the replication fork along both strands must present considerable difficulties. The first indications of the mechanism used -7- to Overcome these problems came from studies by Okazaki et (1968) who showed that the majority of the newly synthesised DNA was in the form of short fragments (Okazaki fragments). These fragments had a sedimentation coefficient of 10S, corresponding to 1000-2000 nucleotides as determined by alkaline gradient sedimentation of pulse labelled E.coli DNA m vivo. These fragments were rapidly chased into mature 38S pieces upon removal of label in wild-type strains, but accumulated in polA and lig mutants (Kuempel and Veomett, 1970; Gottesman et ^ . , 1973). In these initial studies Okazaki (1968) and Sternglanz et al. (1976) observed only one size class of DNA fragments (10S) consistent with discontinuous synthesis on both chains. However, Louarn and Bird (1974) studied the molecular polarity of newly synthesised DNA at a given point on the E.coli chromosome, the prophage lambda. These studies take advantage of the fact that the direction of replication and the polarity of integration of this prophage are known. Louarn and Bird found that newly synthesised DNA in E.coli was composed of two discrete size classes of DNA, with the large fragment (>53S) synthesised in the 5 ’ to 3* direction (the leading strand) indicating relatively continuous synthesis on this strand. In contrast, short fragments (10S) were apparently synthesised in the 3 ’ to 5 ’ direction indicating discontinuous synthesis on this strand. However, Louarn and Bird found that synthesis on both strands was discontinuous in polA mutants and they suggested that this was due to a possible role for DVA polymerase I in the sealing of short DNA fragments. Although contradictory evidence exists as to whether one or both chains are synthesised continuously in E.coli, many workers interpret the body of evidence to indicate discontinuous synthesis on both strands with relatively infrequent initiation on the leading strand. iii) Nature of primer synthesis One of the problems raised during the study of discontinuous replication was the nature of the priming mechanism for Okazaki pieces. First, that the mechanism of chain initiation in the course of discontinuous replication must be distinguished in some way from initiation at the origin of a round of chromosome replication. This aspect will be discussed later. Secondly, all DNA polymerases appear unable to initiate polynucleotide chains ^ novo ; RNA polymerase, on the other hand, does not require a primer and can transcribe single-stranded DNA forming an RNA chain with a 3 '-OH terminus which can then act as a primer for DNA polymerase. Okazaki et (1975) obtained the first evidence for RNA-DNA intermediates. However, identification of the enzyme responsible for synthesis of RNA primers in E.coli comes from the study of the dnaQ function of E.coli. This function is essential for growth, and a shift to the non-permissive temperature (420) of a dnaG mutant results in rapid cessation of DNA synthesis (Wechsler and Gross, 1971). Later studies _iji vitro with the replication of single-stranded phages such as G4 and ^X174 led to the identification of the DnaG protein (Kornberg et ^ . , 1974; Kornberg, 1978). Thus a simple primer system for DNA replication was demonstrated for G4 which vitro only requires DNA binding protein, ATP, ribo or deoxyribonucleotides and the dnaG gene product (Zechel et ^ . , 1975). Subsequent DNA synthesis in this system requires DNA polymerase III holoenzyme and deoxyribonucleotides. The DnaG protein in the presence of single-stranded DNA promotes the synthesis of oligonucleotides which contain both dNMP and rNMP residues. This special kind of RNA polymerase which is also rifampicin resistant (Bouche £t ^ . , 1975) is more correctly termed DNA primase. In contrast to G4, ^X174 has a more complex priming system requiring in addition to those proteins of the G4 system, the dnaB protein, dnaC protein and other -9- replication factors termed i, n, n*, n^* (Wickner and Hurwitz, 1974; Scheckman et , 1975). In these priming reactions, the E.coli DNA binding protein (Ssb) is thought to bind single-stranded DNA, and perhaps by inducing the formation of a particular secondary structure facilitates recognition of DNA by the Dna primase. Kornberg (1978) proposed that the role of dnaB protein in this system was to act as a mobile promoter. It was suggested that DnaB binds to single-stranded DNA coated with the DNA binding protein (Ssb) and migrates along the DNA in a 5* to 3' direction, ahead of the priming complex containing DnaG. The immediate cessation of DNA synthesis vivo in a dnaB mutant at the restrictive temperature is also consistent with this role for dnaB protein at the replication fork of the E.coli chromosome. The cellular role of the dnaC protein and the replication factors i, n, n ', n ’* identified in vitro is still unclear, although the dnaC gene product is also required for initiation of chromosomal replication vivo (see later). Nevertheless, Arai and Kornberg (1981) showed that the proteins DnaB, DnaC, i, n, n ', n ’’ and DnaG which are required for the synthesis of primers on ^X174 templates, form a complex called a "primosome" which appears to move along the DNA templates with the concomitant synthesis of RNA primers. iv) Unwinding and elongation of DNA chains in vitro One of the simplest DNA elongation reactions that has been described is the conversion of single-stranded phage DNA to the duplex circular form (RE). It has been shown that after priming, the only host component required for this reaction with phage DNA (j)X174, Ml 3 or G4 is the E.coli Ssb or phage specific DNA binding protein, and DNA polymerase III holoenzyme (Wickner and Kornberg, 1973; Hurwitz and Wickner, 1974; Kornberg, 1978). DV/4 polymerase I and Dna ligase are required for conversion of the resulting nicked circle into a covalently closed form. ■ -1 0- The E.coli rep function was identified by Denhardt et (1976) who isolated a mutant that could not replicate ^X174 REI DNA. The rep protein is a 68 Kd polypeptide which promotes the melting of a DNA duplex in vitro to separate DNA strands with the hydrolysis of ATP (Scott et al., 1977; Yarranton and Gefter, 1979). Scott et also found that in the absence of DNA synthesis the combined action of rep protein, cisA protein (a phage protein that nicks the viral (+) strand at a specific site) and Ssb protein will completely unwind the duplex REI of ^)X174 DNA. This result combined with the evidence that the E.coli rep mutant replicates chromosomal DNA more slowly than a wild-type strain (Lane and Denhardt, 1975) suggests that the rep protein also plays a role in strand separation ahead of the replication fork, (Eig. 1.2). The rep protein in fact appears to have two activities : catalytic separation of DNA strands at a replication fork (helicase), and ATPase activity. Kornberg et al. (1978) have shown that during the separation of strands accompanying replication vitro, two molecules of nucleoside triphosphate (ATP or dATP) are hydrolysed for every nucleotide polymerized. Thus utilization of ATP by rep protein might provide energy for catalytic strand separation at a fork in advance of replication. Other DNA unwinding enzymes have been isolated from E.coli, these are Dwq helicase I (Abdel-Monem et ^ . , 1976), DNA helicase II (Abdel-Monem et al., 1977), DNA helicase III (Yarranton et al., 1979). In contrast to helicases, topoisomerases are enzymes that catalyze the concerted nicking and closing of duplex DNA molecules with the consequent changes in the topological constraints of supertwisting. Thus for example the action of topoisomerase I (Depew et ^ . , 1978) leaves the DNA in a more relaxed state, whereas gyrase increases the level of negative supercoiling of DNA. Topoisomerases are multi-subunit enzymes which may relax negatively or positively supercoiled DNA ^ -11- molecules (Li et , 1979; Stetler et al., 1979). Another important topoisomerase (topoisomerase II) is DNA gyrase which was first identified in E.coli as required vitro for integrative recombination of pahge X DNA (Gellert et al., 1976a; Mizuuchi et , 1979a). This enzyme introduces negative supercoils into relaxed closed circular DNA e.g. X, ColEI or SV40 DNAs (Gellert et al., 1976a). Gellert ^ (1976a) found that gyrase activity required ATP and magnesium and that the supercoiling reaction proceeded in a series of steps as judged by the presence of many molecules of intermediate superhelical density amongst the reaction products. The supercoiling activity catalysed by DNA gyrase is blocked by two groups of antibiotics represented by novobiocin, coumermycin Al and clorobiocin (Gellert et ^ . , 1976b; Fairweather £t ad., 1980), and nalidixic acid and oxalinic acid (Sugino et ^ . , 1977; Gellert et al., 1977). These compounds inhibit DNA synthesis in E.coli and resistance to their activities map at separate loci, nalA (gyrA) at 48 minutes (resistance to nalidixic acid and oxalinic acid (Hane and Wood, 1969) and cou (gyrB) at 82 minutes (resistance to novobiocin, coumermycin and clorobiocin (Ryan, 1976; Orr et ^ . , 1979). Purification of DNA gyrase by Mizuuchi et (1978a) and of its individual subunits by Higgins et al. (1978) has shown that the enzyme is composed of two different subunits GyrA and GyrB of molecular weights 100-110,000 and 90-95,000 coded by the nalA and cou genes respectively. Gyrase purified from a nalidixic acid resistant strain is insensitive to nalidixic acid and oxalinic acid but is sensitive to novobiocin and coumermycin and vice versa (Sugino et ^ . , 1977; Gellert et ^ . , 1977). In principle, topoisomeraes could play several roles in the replication of closed circular duplex DNA. At initiation, a specific level of supercoiling could assist the binding of factors required for replication. On the other hand during chain elongation, a topoisomerase capable of relaxing -12- positive superhelical turns could serve as a swivel (Cairns, 1963) to remove the positive supercoiling that would otherwise accumulate in the unreplicated portion of the molecule. DNA gyrase in addition to satisfying this requirement, could maintain the DNA under negative superhelical strain and thus facilitate unwinding of the replication fork (Gellert et al., 1976). DNA replication in E.coli is inhibited by novobiocin (Smith and Davis, 1967) and by coumermycin (Ryan, 1976; Drlica and Snyder, 1978) and this was taken as evidence for a role for gyrase in replication fork movement. Replication of ColEI DNA vitro is also blocked by novobiocin (Gellert et sd., 1976; Staudenbauer, 1976) and synthesis can be restored by adding novobiocin-resistant DNA gyrase to the system (Gellert et al., 1976). In addition, Gellert ^ al* (1976) and Gellert £t (1977) have shown that supercoiling of DNA is required in this system for initiation of DNA synthesis. In order to investigate the role of DNA gyrase in E.coli chromosomal replication, Orr et al. (1979) isolated a temperature-sensitive, conditional lethal mutation at the gyrB locus. They showed that at the restrictive temperature, initiation in the mutant was inhibited, but the rate of chain elongation was essentially unchanged. This result was confirmed by experiments on several temperature-sensitive mutants of gyrase that have been shown to block the initiation and termination steps'of replication but do not appear to affect the elongation step (reviewed by Wang, 1985). However, one gyrase temperature-sensitive mutant, has been reported to stop relication rapidly at non-permissive temperature and has therefore led to suggestions that gyrase is implicated in both initiation and chain elongation (Filutowic and Jouczyk, 1983). Nevertheless, on the basis of the bulk of the evidence all these results can best be rationalized with the data using antibiotics as follows. Inhibitors such as nalidixic or -13- novobiocin may primarily block replication by the formation of an enzyme-drug complex on the DNA which prevents replication fork movement and the gyrase may not therefore be required directly for the elongation reaction. On the other hand there is increasing evidence for the role of gyrase in initiation of chromosomal replication in E.coli. Gyrase is essential for vitro initiation of oriC-plasmids (Kornberg, 1980), gyrase bind preferentially to sequences close to oriC (Lother £t al., 1984), and dnaA mutants are hypersensitive to gyrase inhibitors (Filutowicz, 1980). Finally, topoisomerases also appear to have a role in DNA transcription, recombination and repair mechanisms and these aspects have been extensively reviewed elsewhere (Gellert, 1981; Wang, 1985). v) Initiation of DNA replication at the chromosomal origin In E.coli the rate of DNA synthesis is controlled by the rate of initiation of chromosomal replication. Initiation of new rounds of replication is thought to be governed by the ratio of cell mass to the number of chromosomal origins. This was formulated as the requirement for the achievement of a critical value, the initiation mass before replication is triggered (Donachie, 1969). In order to explain how the cell ’measures’ its mass/origin ratio, several models have been proposed. In some models the period of growth between successive initiations is regarded as the time needed to accumulate some positive regulatory factor ( + ) (Jacob et ^ . , 1963), or to dilute out an inhibition of initiation (-) (Helmstetter et ^ . , 1968; Pritchard et ^ . , 1969; Sompayrac and Maaloe, 1973). Maal0e and Hanawalt (1961), and Lark (1972) have shown that the initiation of DNA replication in E.coli requires both ^ novo protein and RNA synthesis. Thus, starvation of a bacterial culture for essential -1 4- amino acids or addition of chloramphenicol or rifampicin allows the continued synthesis of DNA from pre-existing forks, but no new forks are initiated. The requirement for RNA synthesis appeared to be restricted to immediately before or at the time of initiation whereas the proteins necessary for initiation may be synthesised earlier in the cell cycle (Lark, 1972). Similar results for the role of protein and RNA synthesis in the initiation of replication of Bacillus subtilis were also demonstrated by Laurent (1974). In E.coli, dnaA has been identified as essential for initiating a cycle of replication iji vivo (Kolten and Helinski, 1978; Tomizawa and Selzer, 1979), and in vitro (Fuller et al., 1981). The DnaA protein (52.5 Kd) has been purified and shown to bind specifically to double-stranded DNA from oriC (Chakraborty £t ^ . , 1982; Fuller and Kornberg, 1983). Genes dnaB and dnaC (whose products are also essential for ongoing replication), are also needed at or near the onset of a cycle of chromosome replication (Kolten and Helinski, 1979; Tomizawa and Selzer, 1979), although both probably act after DnaA (Zyskind et al., 1979). Mutations at the dnaA locus have been reported to be either recessive (Wechsler and Gross, 1971; Wehr, 1975; Gotfried and Wechsler, 1977) or dominant (Beyersman et al., 1974; Zahn et ^ . , 1977) depending upon the particular allele and strain background. The block in initiation in both dnaA and dnaC mutants is reversible. Thus upon shift from non-permissive to the permissive temperature initiation of a new round of replication takes place, although after a slight delay (Zyskind et al., 1977) in the case of dnaA. Zyskind et (1977) have shown that in the dnaA5 mutant, this reinitiation is sensitive to rifampicin, and this sensitivity is relieved by mutations in rpoB. Moreover, earlier results by Laurent (1972) with an initiation mutant dnaB in B.subtilis, and Lark (1972) with E.coli 15T- reported the direct involvement of RNA polymerase in the initiation of DNA replication. Finally the finding -15- that some suppressors of dnaA mutants map within rpoB (the structural gene for the g-subunit of Rna polymerase) has led various groups to suggest that there may be a direct interaction between Rna polymerase and the dnaA product, perhaps in an RNA priming reaction (Atlung, 1981 ; Bagdasarian et , 1977; Schaus et a l., 1981 a). The discovery of a soluble enzyme system that replicates plasmids carrying the origin of the E.coli chromosome (oriC) has been used to confirm that the dnaA protein is essential for initiation of bidirectional replication _in vitro (Fuller et ^ . , 1981 ; Kaguni et al., 1982; Fuller and Kornberg, 1983). The specific binding of DnaA protein to double-stranded DNA at oriC (Chakrabarty et ^ . , 1982; Fuller and Kornberg, 1983), appears to be essential for the action of the DnaA protein in promoting replication from oriC. These results indicate that DnaA acts at an early stage in the initiation reaction (Fuller and Kornberg, 1983; Fuller et ^ . , 1983), but after the action of RwA polymerase (Kaguni and Kornberg, 1984). The dnaA gene has been cloned (Hansen and von Meyenburg, 1979) and the nucleotide sequence of the promoter region and of the structural gene has been determined (Hansen et al., 1982; Hansen et ^ . , 1982). The dnaA gene is cotranscribed with the dnaN gene (Sakakibara et ^ . , 1981), encoding the g-subunit of DW4 polymerase III holoenzyme (Burgers et ^ . , 1981) from a promoter region positioned in front of dnaA. In this region two promoters dnaAlp and dnaA2p located 230 and 150 base pairs up stream of the start of the dnaA coding sequence, were identified by SI nuclease mapping of vivo transcript start sites (Hansen et al., 1982). Only the former promoter was identified as active in an vitro transcription assay (Ohmori et al., 1984). Interestingly, a 9 bp sequence which has four homologous counterparts within the minimal origin of replication was found between the two dnaA promoters (Hansen, 1982). It seems that these 9 bp -16- sequences are highly conserved among origins of the different species of Enterobacteriaceae (Zyskind e^ , 1981) and are probably required for the binding of the DnaA protein (Fuller et , 1984). Further studies have identified the need for three functional classes of protein required for initiation vitro ; (1) initiator proteins (RwA polymerasegyrase) which appear to recognise the oriC sequence and promote transcription in this region; (2) replication proteins (Dna polymerase III holoenzyme, Ssb, primosomal proteins) to initiate and elongate DNA chains; (3) specificity proteins such as, topoisomerase I (Kaguni and Kornberg, 1984); RNase H (Ogawa et al., 1984); protein HU (Dixon and Kornberg, 1984) which appear to suppress replication from extraneous sites throughout the DNA duplex whilst permitting initiation to occur at the oriC sequence complexed with DnaA protein (Chakraborty et al., 1982; Fuller and Kornberg, 1983). A similar role has been ascribed to RNaseH as will be discussed below (Kogoma £t al., 1985). Recently, the dnaA gene product was shown to repress its own synthesis (Braun £t ^ . , 1985; Atlung et ^ . , 1985). Thus overproduction of wild-type DnaA protein caused an upto four-fold inhibition of the synthesis of a DnaA-LacZ hybrid protein under control of the intact dnaA promoter region. The same pattern of regulation was also found when the tet gene of pBR322 was expressed from the dnaA promoters. These observations strongly suggest that the DnaA protein regulates its own synthesis and that autoregulation is at the transcriptional level (Atlung et al., 1985). Ribonuclease H (RNaseH) is an enzyme which hydrolyzes RNA in RNA-DNA hybrids. RNaseH is encoded by the rnh locus (Carl et ^ . , 1980), and is apparently required for dnaA+_depgndent initiation of replication exclusively at oriC (see later). In order to explain the -17- role of RNaseH in this process it has been proposed that the enzyme is required to eliminate DNA bound RNA transcripts which would allow abnormal priming of DNA replication. However, this explanation does not exclude more direct involvement of RNaseH in DnaA and oriC-dependent initiation, for example, in creation of a correct primer terminus for DNA synthesis as in the ColEI system (Itoh and Tomizawa, 1980). Another possible role for RNaseH is in the removal of the 5 ’ terminus of longer primer RNAs linked to nascent, short DNA (Okazaki) fragments, during discontinuous DNA replication (Ogawa and Okazaki, 1980). vi) Stable DNA replication In 1961 Maaloe and Hanawalt proposed that during and after amino acid starvation, respectively, protein and/or RNA synthesis are required to initiate but not to sustain DNA replication. By means of a series of density-shift experiments. Lark et (1963) subsequently showed that amino acid starvation resulted in the synchronisation of DNA replication in the population. Subsequently, this requirement for protein and RNA synthesis was shown to be a unique property of dnaA dependent initiation at the oriC site (Von Meyenburg £t ^ . , 1979). Despite the large amount of evidence demonstrating these requirement in E.coli, with similar evidence for B.subtilis (Laurent, 1973), neither the biochemical nature nor the function of the proteins and RNA involved in initiation has been established. Interestingly, Kogoma and Lark (1970; 1975) uncovered conditions in which this strict requirement for protein synthesis can be circumvented. The term stable DNA replication (SDR) was used to describe the ability of E.coli, for example after an extensive period of thymine starvation, to continue DNA replication in the absence of protein synthesis, e.g. in the presence of chloramphenicol (CAM). Genetic studies with different mutations at the recA and lexA loci has led to the -18“ proposal that such induced stable DNA replication (iSDR) is an SOS function (Kogoma et , 1979). This was supported by the demonstration that most SOS inducing treatments also induce SDR. Finally Kogoma et al. (1985) have demonstrated that recA is required for the initiation of constitutive SDR (see below) but not for the elongation steps in this form of DNA replication. In attempts to gain more insight into the genetic basis of this phenomenon, Kogoma (1978), reported the isolation of a mutant which expressed SDR constitutively (cSDR). The mutation, which was recessive to recA+ was mapped at a locus, sdrA at 4 min on the E.coli chromosome between metD and proA (Kogoma £t ^ . , 1981). Independently, Lark et al. (1981) isolated another sdrC mutant and mapped the mutation at another locus (sdrT at 99 min). Remarkably in the sdrT mutant recA+ is required not only for cSDR but also for normal replication. As indicated above sdr A mutants exhibit recA'*'-dependence only for the initiation of cSDR and not for normal replication. Thus recA~ mutations are not lethal in sdrA mutants (Torrey and Koagoma, 1982). Similarly, sdrA mutants can continue DNA replication in the total absence of recA^ function (e.g. in a recA-deletion strain), unless protein synthesis is inhibited (Torrey and Kogoma, 1982). This clearly indicates that the normal replication mechanism continues to operate in sdrA mutants and that blocking the normal system by the inhibition of protein synthesis either "activates" stable DNA replication or more likely simply reveals its presence. An extragenic suppressor mutation (rin) which specifically suppresses the requirement for recA in stable DNA replication (but not the recombination or proteolytic function of reck) has been isolated, although the nature of this effect is obscure (Torrey and Kogoma, 1982). Further studies of the phenomenon of stable replication have led to the conclusion that there are alternative initiation pathways in 19- E.coli distinct from the oriC, dnaA'*'-dependent initiation mechanism. Thus Kogoma and Von Meyenburg (1983) have recently reported that oriC and dnaA can be completely deleted without loss of viability in an sdrA mutant. Moreover, Kogoma et ^ . , (1981) and Horiuchi et (1984) have reported that DNA replication may initiate from one or more of several distinct "origins" in sdrA mutants when grown in the presence of chloramphenicol. Furthermore, de Massy et al. (1984) suggested that under oriC" conditions the inactivation of sdrA allowed certain nucleotide sequences, for example oriK, to be an alternative replication origin. A major development in our understanding of the phenomenon of stable replication came with the observation that sdrA mutants were devoid of RNaseH activity (Ogawa and Okazaki, 1984). Moreover, a cloned DNA fragment containing the rnh+ gene encoding RNaseH complements all the phenotypes of sdr+A mutants. This led to the conclusion that sdrA is allelic to rnh (Ogawa et ^ . , 1984). In order to determine if treatments which induce SDR, e.g. UV-irradiation and incubation with nalidixic acid, (Kogoma e^ ^ . , 1979) result in a loss of RNaseH activity, Bially and Kogoma (1986) measured the activity of the enzyme under these conditions. Surprisingly, they observed no detectable loss of RNaseH activity and concluded that the induction of iSDR in distinction to cSDR does not proceed via a direct inactivation of RNaseH. The molecular basis of these phenomena must therefore contain at least some disimilar components. Following the discovery that sdrA is the structural gene (rnh) encoding RNaseH Ogawa et £l. (1984), have also shown that the presence of RNaseH suppresses dnaA'''-independent replication in an vitro initiation system. These workers therefore proposed that RNaseH normally functions as an essential specificity factor in initiation by preventing -20- the use of certain nucleotide sequences other than the oriC sequence as a relication origin. In support of this Kogoma and Crouch (1984) have recently reported that attempts to replace the chromosomal rnh+ gene by an rnh allele insertionally inactivated by a transposon yield inviable cells. This result suggests that sdrA mutants do have low levels of RNaseH activity vivo sufficient for its role in initiation or other steps in replication which are essential for normal growth. In fact, Torrey et £l. (1984) have observed that rnh (sdrA) mutations render cells with certain genetic backgrounds extremely sensitive to nutritionally rich media (the srm~ phenotype), consistent with an essential role for RNaseH. 1.2 Fidelity and proof reading activities of E.coli DNA polymerase A most important feature of Dna polymerase I as a catalyst for polymerizing mononucleotides into long chains of DNA is its ability also to degrade these chains. The purified enzyme can degrade DNA from the primer terminus in a 3 ’ to 5 ’ direction (3' to 5 ’ exonuclease). The essential function of the 3' to 5 ’ exonuclease is to detect and excise a non-base-paired terminus (for review see Kornberg, 1980). In the case of polIII holoenzyme the dnaQ gene product fulfills this function (see below). Whatever the primer mechanism the fidelity of replication of DNA in vivo is extremely high. The frequency of spontaneous point mutations in E.coli is in the region of 10"9-10"10 per base replicated (Fowler ^ al., 1974). This high fidelity is thought to involve several distinct processes: (1) selection of the complementary base in the initial 5' to 3 ’ polymerisation, (2) exonucleolytic 3' to 5 ’ "editing" of a noncomplementary base at the growing point and (3) post-replicative mismatch repair. The combination of these mechanisms could be sufficient -21- to achieve the accuracy observed vivo (Kornberg, 1980; Echols, 1982; Loeb and Kunkel, 1982). Finally, it should be noted that the presence of Ssb protein increases fidelity several fold for a variety of polymerases in vitro (Kunkel et al., 1979), whilst Muzyczka et al. (1972) demonstrated a correlation between the vivo phenotype of mutant T4 polymerase and the relative levels of exonuclease to polymerase activity in vitro. They proposed that the most important factor governing fidelity were the ratio of the rate of exonuclease and polymerase activities. D W polymerase III (polIII) holoenzyme is the primary enzyme involved in chain elongation in E.coli and is therefore likely to be the major determinant of fidelity (Kornberg, 1980; Echols, 1982). The polIII holoenzyme has at least seven subunits in addition to the polIII core. These include the a, E and 0 subunits (McHenry and Crow, 1977) which contribute to the polymerase and the 3 ’ to 5 ’ exonuclease activity of polIII holoenzyme. An important role for E (the dnaQ gene product) comes from the observation that mutations in the dnaQ gene render polIII holoenzyme defective in the editing function (Echols et , 1983; Difrancesco al., 1984). Moreover, Richard ^ al. (1984) have shown that the polymerization and editing activities of polIII holoenzyme reside on distinct subunits a, (encoded by dnaE) and E (encoded dnaQ) respectively, and the latter carries a 3' to 5 ’ exonuclease activity. The presence of replication-inhibiting lesions in host DNA might induce the SOS repair system and Caillet-Fauquet et (1977) suggested that this process requires ^ novo protein synthesis in order to allow the DNA replication machinery to proceed across blocking lesions. In fact, pyrimidine dimers (Benbow et ^ . , 1974; Moore et ^ . , 1981 ; Doubleday et al., 1981) apurinic or apyrimidinic sites (AP-Sites) -22- (Shaaper et , 1983) were shown vivo and/or iji vitro to block DNA replication at or just before the site of the lesion. Thus jji vivo these should represent mutagenic sites after SOS induction, (Weigle, 1953; Caillet-Fauquet et ^ . , 1977; Shaaper and Loeb, 1981 ; Shaaper et al., 1983). As described earlier Villani et (1978) have suggested that idling of DNA polymerase at non-coding DNA lesions could result from the proof reading 3' to 5 ’ exonuclease activity. Therefore, they proposed that error-prone SOS repair could result from the transient inhibition of this proof reading function. In other words a single event could account for both the error prone replication (untargeted mutagenesis) and the by-pass of DNA lesions. This was consistent with results indicating a decreased fidelity of DNA synthesis by crude extracts of SOS "induced" bacteria (Villani et ^ . , 1977). However, further studies revealed that inhibition of the proof reading activity of DNA polymerase alone could not account for SOS associated mutagenesis. Thus termination of vitro DNA synthesis resulting from the presence of a lesion was demonstrated to be a more complicated process which involved a number of different factors, including the nature of the lesion (Moore et al., 1981). Several studies have demonstrated that the 3 ’ to 5' exonuclease activity of DNA polymerase does not play an essential role in the by-pass process. In fact, experiments with DNA polymerases lacking associated 3 ’ to 5 ’ exonuclease activity or with enzymes with an inhibited proof reading function revealed that the pyrimidine dimers were an absolute block to DNA replication vitro, irrespective of the presence of proof reading activity (Moore et ^ . , 1981 ; Doubleday et ^ . , 1981 ; Fersht et al., 1983). However, a possible role for the proof reading activity (or lack of it) in SOS mutagenesis cannot be excluded. RecA protein was recently shown to inhibit in vitro the proof reading function of DNA polymerase -23- III. This was paralleled by a decrease in the fidelity of vitro DNA synthesis (Fersht et , 1983). Therefore, it is suggested that inhibition or absence of proof reading activity might be necessary but not sufficient to allow efficient trans dimer synthesis (Doubleday et al., 1981). Recent data using phage X DNA as a probe to analyse separately the mutagenic process on damaged and undamaged DNA have indicated that the SOS mutator effect seems indeed to be due to an increased error rate in DNA replication by a process involving DNA polymerase III (Bretcorne et ^ . , 1985). Thus untargeted mutations of phage X were shown to result from replication errors, introduced in the newly synthesised strand as mismatched bases that can be recognised and corrected by the post-replicative mismatch repair system (Caillet-Fauquet et al., 1984). Mismatch repair deficient mut mutants (Clickman and Radman, 1980) have a high spontaneous mutator effect on the bacterial chromosome but a very weak effect on phage X, suggesting preferential mismatch correction of the bacterial chromosome. Therefore, this might suggest that the predominance of targetted chromosomal mutations, observed during UV-mutagenesis as opposed to the effect on phage DNA (Witkin and Wermundsen, 1978; Foster et al., 1982; Miller, 1982) may be the consequence of an efficient mismatch correction of untargetted mutations (Caillet-Fauquet, 1984). this hypothesis, however, does not exclude the proposal by Witkin and Wermundsen (1978), that the difference in the number of DNA replication rounds performed during the SOS response could also explain the different ratios of untargetted versus targetted mutations in phage and bacteria. -24- 1.3 Over view of different DNA repair processes Following DNA damage, various enzymatic systems act to repair the damage with high fidelity, i.e. by error free processes. In the case of UV-irradiation of wild-type E.coli there are at least two mechanisms which specifically repair UV-induced damage e.g. pyrimidine dimers. Firstly, by monomerization jji situ by a photo-reactivation enzyme (Rupert, 1975) in a reaction requiring visible light. Alternatively, the dimer can be recognised and excised by the uvrA, B and C gene products which are specific for double-stranded DNA (Sancar and Rupp, 1983). Div# polymerase I then probably completes the repair by inserting 12-30 nucleotides to fill the gap. Finally, the new patch is sealed by ligase. Another gene, uvrD which encodes helicase II was also identified (Ogawa et ^ . , 1968; Siegel, 1973; Horii and Clark, 1973; Kushner et ^ . , 1978; Siegel, 1981) that participates in some way with the excision repair of pyrimidine dimers (Kuemmerle and Masker, 1980). Unlike uvrA, uvrB and uvrC mutations, mutation at the uvrD locus can also cause a large increase in the spontaneous mutation rate. The reason for this additional phenotype is that the uvrD protein is also required for the process of methyl-directed mismatch repair which promotes correction of errors introduced during DNA replication (Radman et ^ . , 1980; Pukkila et al., 1983; Lu et ^ . , 1983). In addition, uvrD mutations also have an effect on the precise excision of transposons (Kleckner, 1981) and on recombination (Arthur and Lloyd, 1980). All four of the uvr genes have been shown to be inducible forming part of the SOS network (see later). Dimers or other bulky lesions which escape initial repair may have important consequences for further replication fork movement. In fact, Rupp et (1968) suggested that upon reaching a dimer the replication complex transiently halted and then somehow bypassed the -25- dimer, reinitiating replication downstream, resulting in the formation of single-âtranded gaps about 1000-1800 base pairs in length (see also Sedgwick, 1976). However, in the case of single-stranded $X174 DNA containing dimers, the replication fork appears to stop at the first dimer encountered and progresses no further (Caillet-Fauquet and Radman, 1977). Moreover, evidence from studies of the conversion of the DNA phage G4 positive strand to a circular duplex form vitro (Zechel and Kornberg, 1975; Bouche et al., 1975) and vivo (Hourcade and Dressier, 1978) also demonstrates that dimers completely block replication in these systems. These experiments involving a single-stranded DNA template indicate that unlike double-stranded DNA vivo no by-pass of dimers is possible. This may suggest some feature unique to duplex DNA which facilitates the by-pass process. However, since dimers also completely block replication at the nucleotide immediately upstream of the lesion on double-stranded DNA with purified polymerase vitro (Villani et al., 1978), the nature of possible by-pass mechanisms vivo remain obscure. Other studies by Rupp and Howard-Flanders (1968) demonstrated that post replication gaps once formed were subject to repair by recombination involving RecA. On the other hand it was also considered conceivable that a small proportion of such gaps opposite dimers, or in particular overlapping daughter strand gaps (Sedgwick, 1976), might be expected to be refractory to simple recombinational repair leading to some form of error prone repair (see below). Several studies have been concerned with the nature of the patches associated with the repair of bulky lesions such as dimers. Such patches fall into two classes, with the vast majority normally being approximately 20-30 nucleotides long and being 1500 nucleotide (so called long patches) or more in length (Cooper and Hanawalt, 1972; -26 - Kuemmerle et , 1981 ; Cooper, 1982). The relatively close correspondence between the size of the short patches (Ley and Setlow, 1972; Masker, 1977) and the size of the oligonucleotide released by the Uvr ABC double excision event (Haseltine, 1983; Walker, 1985) suggests that in most cases some DNA polymerase fills in the gaps left after the action of the UvrABC endonuclease with very little nick translation or exonucleolytic expansion of the gap. In fact, Dna polymerase I appears to play a major role in this limited resynthesis step of excision repair (Kelly et al., 1969; Hanawalt and Cooper, 1979). The process of long patch repair is more intrigueing and has been shown to be inducible (following DNA damage) and under the control of lexA as part of the SOS regulon (Cooper, 1982; Cooper and Gonesan, 1984). The kinetics of the appearance of long patch repair also differs from those of the short patch repair synthesis. Short patch synthesis can be detected immediately after UV-irradiation and is virtually completed prior to the synthesis of the majority of the long patches (Cooper, 1982). The nature of the induced function(s) that lead to long patch repair synthesis have not yet been determined. However, since mutants deficient in DNA polymerase I exhibit substantially increased levels of long patch repair this process may be mediated by DNA polymerase II or III (Cooper and Hanawalt, 1972; Tait £t ^ . , 1974). However, more recent studies have indicated that poll is primarily responsible for the long patch synthesis observed in wild-type cells (Cooper, 1982). Finally, Cooper (1982) has presented evidence that long patch repair is essentially error free and is independent of umuD,C. Genetic analysis of the process of recombination following conjugation in E.coli has led to the identification of seven genes whose products play various roles in homologous recombination - recA, recB, -27- recC, recF, reoj, recN and ruv (reviewed by Walker, 1985). The expression of at least three of these genes, reoA, recN and ruv is induced by DNA damage and is subject to control by the SOS regulatory circuit. Mutation of any one of these seven genes render the cells sensitive to killing by DNA damaging agents, indicating that the product of these recombinational genes play a direct or indirect role in the repair of DNA damage in E.coli. Two repair processes have been identified in which at least a subset of these recombinational genes appears to act directly. These are, a) daughter-strand gap repair (post-replication repair) which repairs gaps formed in daughter DNA strands using an undamaged parental strand as template, and b) repair of double-strand breaks. During daughter-strand gap repair, the gaps are filled in and the newly synthesised DNA becomes joined into molecules of high molecular weight (Waldstein et ^ . , 1974). The mechanism by which this occurs results in stretches of parental DNA becoming covalently attached to daughter-strands, indicating that recombinational strand exchange is involved (Rupp £t ^ . , 1971). Double-strand breaks in DNA can be created by various physical and chemical agents. One of the most widely studied of these agents is ionizing radiation (gamma rays). In E.coli, the capacity to repair double-strand breaks was shown to be inducible since pretreatment of cells with X-rays or UV resulted in resistance to subsequent killing by X-rays or gamma rays (Pollard and Ackey, 1975; Smith and Martignoni, 1976). Moreover, this process is under the control of the recA+, lexA+ regulatory circuit (Pollard and Ackey, 1975; Smith and Martignoni, 1976; Pollard £t ^ . , 1981) and requires de novo protein synthesis, (Pollard and Ackey, 1975; Smith and Martignoni, 1976; Pollard and Fugata, 1978; Krasin and Hutchinson, 1981). The inducible repair of double-strand breaks created by ionizing radiation or mitomycin-C requires a functional recA gene, in addition to -28- the regulatory role of RecA (Krasin and Hutchinson, 1977; Krasin and Hutchinson, 1981), and a functional recN gene (Picksley et al., 1984). Furthermore, recent vitro evidence suggests that recA participates in the repair of double-strand breaks (West and Howard-Flanders, 1984). This specific role of RecA in such SOS processing events during the SOS response will be discussed later. 1. 4 The SOS Response Following treatments that perturb or damage DNA, a set of pleiotrophic responses or functions called the "SOS response" are induced. Some treatments known to induce the SOS response are listed in Table 1.2, the common factor between them being damage to DNA and/or inhibition of DNA replication. These SOS functions summarised in Table 1.3 include phenomena such as an enhanced capacity for DNA repair and mutagenesis, inhibition of cell division (filamentation), prophage induction and massive synthesis of the RecA protein (see Witkin, 1976; Little and mount, 1982; Walker, 1984). Genetical and biochemical studies have established the role of two regulatory genes, recA and lexA in the induction process. Mutations that alter either gene product can prevent the expression of these responses (Mount et ad., 1972; Little and Mount, 1982) or alternatively, constitutive expression of the SOS functions (George et ^ . , 1975). Current understanding of the SOS regulon indicates that the LexA protein is a repressor which directly regulates the expression of a group of unlinked genes. These include uvrA,B and C genes involved in excision -29- Table 1.2 SOS inducing treatments UV, and X-irradiation. Nalidixic acid, novobiocin*, bleomycin, mitomycin-C, methyl methane sulphonate, NMG and other mutagens. Thymine starvation. Expression of temperature sensitive alleles of lig and several other dna genes. Introduction of irradiated (double stranded) replicons. * rather inefficient inducer - need very sensitive assay to detect induction. Table 1.3 SOS induced responses Prophage induction. Weigle reactivation. Weigle mutagenesis. Inhibition of cell division. Increased synthesis of RecA protein. Error prone repair of chromosomal lesions. Induction of synthesis of colicins in col+ strains Induction of increased excision repair capacity. Alleviation of restriction. Stable replication. Cessation of respiration. References to the above can be found in Walker (1984) repair (Fogliano and Schendal, 1981 ; Sancar et , 1982; Kenyon and Walker, 1981); sfiA which is necessary for filamentous growth observed after DNA damage (Huisman and D ’Ari, 1981 ; Huisman et al., 1980); himA required for integration of X and related bacteriophages (Miller, 1981); umuD,C, which are necessary for UV-induced mutagenesis (Bagg et al., 1981); recA itself (Little and Mount, 1981) and other din (damage inducible) genes (Kenyon and Walker, 1981). RecA protein acquires a protease activity (or the ability to promote protease activity) after DNA damage (Fig. 1.3) leading to cleavage of the LexA repressor and the repressors of certain prophages (Robert et ^ . , 1978; Little et al., 1980; Little et ^ . , 1981; Brent and Ptashne, 1981). The expression of many SOS functions has been shown to be chloramphenicol sensitive indicating a requirement for ^ novo protein synthesis. Thus division inhibition (Huisman £t ^ . , 1980), UV-induced mutagenesis (Kato et al., 1977), induction of stable DNA replication (Kogoma and Lark, 1975), and of course amplification of RecA itself all require protein synthesis. Discussion of the many varied responses induced following DNA damage is beyond the scope of this Introduction therefore I w ill try to summarize only those functions which have direct bearing upon the work in this project. i) Induction of the synthesis of RecA protein Induction of the synthesis of a 37,800 dalton protein during disturbance of DNA synthesis was first demonstrated by Inouye and Pardee in 1970. Subsequently, Emmerson and West (1977); McEntee (1977) and Little (1977) showed that this protein was the product of the recA gene. This protein is produced in massive amounts following induction to a level where it can represent 3-4% of total cell protein. In addition to -30- its regulatory function, RecA protein has an inherent role in recombination. Moreover, recent studies indicate a possible role for RecA in SOS mutagenesis (Walker, 1984; and see later). ii) Stable DNA replication This has been described in detail and will not be considered further here. iii) Cell division Cell division inhibition during the SOS response (see Witkin, 1976) is one of the most extensively studied events in the SOS response. This effect results in the filamentation of cells observed during expression of the SOS system either following DNA damage or upon shfit of a recA44l (tif) mutant to high temperature. Several genes have been identified which affect the expression of septation inhibition, some of these are quite specific having no effect on other manifestations of the SOS response. Thus in Ion mutants the septation block is observed even under conditions in which DNA replication is only slightly perturbed and the full SOS response is not induced for e.g. after a low dose of UV-irradiation (Howard-Flanders et ^ . , 1964). This division inhibition greatly increases the sensitivity of Ion strains to UV or alkylating agents such as MMS (Jones, 1985). The sfiA (sulA) and sfiB (sulB) mutations completely suppress the division inhibition observed in a recA44l mutant at 42^0 (George et al^, 1975). Similarly, these mutations suppress the lethal effects of Ion mutations (George £t ^ . , 1975). The infA,B mutations also appear to suppress the lethal effects of lexAftsI (tsl) and to some extent recA44l induced filamentation. However, mutations at these loci also appear to inhibit other SOS -31- functions such as the induction of X and mutagenesis (Bailone et al., 1975; Huisman et al., 1980a; Huisman and D ’Ari, 1983). George et al. (1975) proposed, in accordance with a model suggested by Witkin (1967), that the septation inhibition associated with the SOS response, in particular as expressed in the recA44l mutant was due to the induction of a specific inhibitor of division. They further proposed that the product of either the sfiA or sfiB genes might be involved in this process. However, more recent data (Burton and Holland, 1981) demonstrated that division inhibition during the SOS response is more complex, being dependent upon at least two different pathways or mechanisms. Thus in sfiA mutants, cell division is still transiently blocked in a cell in which DNA replication is also blocked although the magnitude of inhibition is less. Burton and Holland (1981) suggested that the sfiA,B independent mechanism might result from failure to terminate DNA replication triggering a feed back loop which operates in the normal cell cycle. Surprisingly, in these studies the second mechanism as well as the sfiA,B pathways was suppressed by a recA mutation. In contrast Jaffe £t (1986) concluded that division inhibition, independent of sf iA,B at least in thymine starved cells (Huisman and D ’Ari, 1980) was not blocked in recA mutants. In the last 2 years studies in the laboratory of D ’Ari and of Gottesman have clearly shown that the product of the sfiA gene is indeed a specific inhibitor of division. Moreover, these studies have also demonstrated that the sfiA gene is under LexA control and is specifically derepressed during the SOS response. -32- iv) Inducible error-prone repair (SOS-repair) Weigle (1953), reported that when E.coli K12 bacteria were exposed to a low UV-dose and then infected with UV-irradiated phage X, on the survival of the phage was higher than^the control, untreated host. Furthermore, amongst the reactivated phage the frequency of mutants was substantially increased (Kellenberger and Weigle, 1958). Weigle called this phenomena UV-reactivation but this process is now known also as Weigle reactivation, and consequently Weigle mutagenesis respectively. It has taken 20 years to elucidate the mechanism of UV-reactivation, although Radman (1974) proposed that UV-reactivation was due to an inducible error-prone repair system acting not only on phage DNA, but also on chromosomal DNA. Inherent in this proposal was the idea that certain lesions in damaged DNA can only be repaired at the expense of replication fidelity. Thus, for example, one or more of the normal DNA polymerases might be modified by an ’inducible’ protein which facilitates replication via trans-lesion synthesis with consequently reduced fidelity (Clark et al., 1978). Polymerase III was implicated in such a mutagenic repair from vitro studies, (Schaaper and Loeb, 1981 ; Straus et al., 1982; Schaaper et , 1983). Such a role for pol III becomes even more attractive with the demonstration that the 3 ’ to 5 ’ exonuclease activity of this enzyme may be specifically inhibited by certain nucleotide monophosphates (Byrnes et , 1978). Furthermore, as described above Villani et (1978) reported that prokaryote polymerases, all of which carry or are tightly associated with an 3 ’ to 5 ’ (editing) exonuclease, could not replicate past dimers on single-stranded DNA vitro. In contrast, polymerase a from mammalian cells, which lacks an editing function, was reported to be able to replicate damaged templates. The proposal that modification of the editing function was involved in error-prone repair was further refined by Radman in 1978. He suggested -33- that an active editing function on encountering a non-instructing template, e.g. a dimer, an idling’ reaction would result, in which triphosphates were converted to monophosphates with no net incorporation at the lesions. Removing this ’veto’ would then allow error-prone trans-dimer synthesis to proceed past the lesions. In additon to the random presence of single bulky lesions in DNA, Sedgwick (1976), suggested that error-prone repair was particularly important in repair of closely spaced lesions on opposite strands. Such lesions might overlap if, in the course of repair by excision or recombination, template DNA for repair synthesis was removed, even leading to double-strand breakage. Consequently, repair of such lesions by preferential trans-dimer synthesis, although error-prone might have important survival value. The different models of transdimer by-pass will be discussed in more detail in the general discussion (Chapter 10) as these will be relevant to some of the major findings in this thesis. In addition a detailed discussion of the SOS inducible genes umuD,C, involved in error-prone repair will be reserved to Section IX. v) The genetic control of the SOS response Mount and Little (1980) and Walker (1984) have formulated the most currently accepted models for regulation of the SOS response. Two types of functions were proposed through these reviews. First, functions which are regulated by the lexA repressor and secondly, functions which are regulated by other repressors which can be cleaved by the RecA protease. It is envisaged that this control system depends upon damage to DNA resulting in the production of an effector molecule presumed to interact with pre-existing RecA molecules. This would result in an allosteric change conferring a protease-like activity on a small number of RecA molecules (RecA*), Fig. 1.3. This form of RecA* cleaves LexA and -34- Fig. 1.3 A diagram showing the currently acceptable model of the control of the SOS response (A) Usually at rest the SOS system is switched off and the lexA protein represses itself, RecA and the products of SOS inducible genes. (B) Following DNA damage RecA becomes "activated" and lexA becomes cleaved, releasing repression on all lexA controlled genes leading to induction of the SOS response. (C) Following the disappearance of the SOS inducible signal, RecA becomes "deactivated" and LexA levels rapidly rise to repress SOS inducible genes. (The diagram reproduced from C. Jones, 1984). Control of SOS afterUV A) □ recA lexA SOS inducible gene inducing signal 'activates' RecA B) r; T recA lexA SOS inducible gene C) □ recA lexA SOS inducible gene thus allows transcription of all the genes normally repressed by LexA (or other repressors like XCI) to proceed at higher rates. During the period in which the cell expresses the SOS response the lexA gene, which is also subject to autoregulation is derepressed and thus synthesis of LexA protein also proceeds at an increased rate under these conditions (Brent and Ptashne, 1980). Nevertheless, because 80/6 of LexA protein is cleaved within 3 min after a mild UV-dose ( 1 0 J m " 2 ) , the net level of LexA remains low (Brent and Ptashne, 1980; Little and Mount, 1982). During the period of DNA repair the continued presence of the effector presumably ensures the persistance of RecA* molecules, thereby maintaining a high level of transcription of recA and of other SOS genes. High level production of RecA is assumed to provide protective binding to single-stranded DNA forming during repair processes and perhaps aid the efficiency of recombination. When the concentration of DNA damage induced effector returns to the normal state, high levels of accumulation of LexA will resume and repression of the SOS system to the basal level is re-established. The majority of the genetic evidence for the SOS regulatory system came through the identification and properties of different recA and lexA mutations. The lexA gene was originally identified by a class of dominant mutations (lexA~, lexA(ind~)) which blocked induction of the SOS response and conferred extreme sensitivity to DNA damaging agents (Mount et ^ . , 1972). In addition, two classes of recessive lexA mutants were isolated as suppressors of lexA(ind~); tsl (lexA(ts)) which show induction of the SOS system at high temperature and spr (lexA(def)) which express SOS functions constitutively at all temperatures. Many recA" mutants have been isolated which fail to show induction of SOS functions (Appendix I) and consequently are highly sensitive to DNA damaging agents such as UV-irradiation. However, when a -35- recA mutation is combined with a lexA(ts) mutation, both recA and other SOS genes are induced at high temperature (Gudas and Pardee, 1975) indicating that lexA is epistatic to recA. In addition, studies of the production of recA mRNA in strains carrying various mutations in recA or lexA (McPartland et , 1980) led to the conclusion that lexA is a ; negative regulator and recA is a positive regulator of recA expression. vi) The inducing signal Identification of the signal which activates RecA has been the subject of much research. An altered DNA conformation caused by changes in supercoiling of the genome by bulky, impaired lesions might be a possible "signal". However, Herrero et (1981) showed that inactivation of the B subunit of DNA gyrase resulting in loss of supercoiling, did not lead to recA induction. Single-stranded gaps in DNA or DNA breakdown products have also been considered as likely candidates for the signal. Oishi and Smith (1978), showed that addition of oligonucleotides to a permeabilized lysogenic strain resulted in the induction of prophage X. However, this effect was dependent upon the presence of recB,C suggesting the indirect action of the oligonucleotides. Baluch £t (1980) showed that extensive DNA degradation associated with an ssbA-1 mutation at the non-permissive temperature did not result in the induction of SOS functions. However, other studies have indicated that Ssb itself is needed for induction (see below). Baluch et also suggested that after UV-irradiation and concomitant DNA repair, single-strand gaps accumulate in the cell. RecA protein would bind to these DNA regions, become activated and cleave the LexA repressor. Sedgewick(1976) proposed that closely spaced lesions on opposite DNA strands might not only be the source of premutagenic lesions, but also the trigger which activates RecA. This was shown to be - 36- unlikely by Bridges and Mothershead (1977) who showed that the SOS response was still induced in uvr, Ion strains having an average of only two dimers per cell. In contrast, they favoured single-stranded DNA as the effector. Curiously, however, infection of E.coli by single-stranded DNA phages is not itself sufficient for induction of the SOS response (R. D'Ari, personal communication). Other studies have indeed indicated additional complexities, with genes other than recA and lexA also apparently involved in the induction of the SOS response. For example, the recB,C enzyme is required for induction following treatment with nalidixic acid but not with UV-irradiation (Little and Hanawalt, 1977; Bockrath and Hanawalt, 1980). In contrast, Hanawalt et (1979)» have shown that induction of recA by UV-irradiation occurs in recB,C mutants, whilst UV-induction requires recF (McPartland £t al., 1980). The ssb gene is also apparently required for SOS induction, since ssbAI mutations suppress a number of the SOS responses, e.g. X-prophage induction (Vales et ^ . , 1980) and derepression of RecA synthesis (Baluch et ^ . , 1980). However, ssb mutations do not block expression of the SOS system in a recA44l strain. This strain is thought to produce a RecA protein with altered DNA binding properties at the non-permissive temperature (McEntee and Weinstock, 1981). These authors have proposed that the ssb gene is involved in generating the inducing signal, with, for example, the two DNA binding proteins Ssb and RecA interacting directly. Whatever the nature of the inducing signal and the precise mechanism of induction, some activation of RecA is required for efficient cleavage of LexA since increased RecA synthesis alone is not sufficient for the induction of X and other SOS genes. This was best demonstrated in lexA (def) cells or cells carrying multiple copies of recA or recAoO (Uhlin and Clark, 1981). As a further complication however. Little (1984) has shown that both purified LexA and the XCI protein are capable -37- of autodigestion in the absence of RecA, with proteolytic cleavage at precisely the same ala-gly- position as obtained with RecA*. Little interpretated this result to indicate that RecA* therefore acts indirectly as an allosteric effector stimulating the autocatalytic cleavage of LexA and XCI by these proteins. vii) Identification of SOS inducible genes under LexA control For the identification of SOS inducible genes the most practical approach has involved the use of a Mudl (Ap lac) bacteriophage. Kenyon and Walker (1980) took advantage of the Mudl (Ap, lac) bacteriophage constructed by Casadaban and Cohen (1980), which allows isolation of in vitro gene fusions in a single step (Kruegen and Walker, 1983). Kenyon and Walker (1980) used an E.coli strain deleted for lac and used Mudl (Ap, lac) to isolate ampicillin resistance derivatives with the bacteriophage integrated into the chromosomal DNA. Clones were then replica plated on to plates containing the chromogenic substrate X-gal and the SOS inducing agent mitomycin-C. Five different insertion derivatives were isolated with easily detectable g-galactosidase activity, presumably due to the fusion of the Mudl (Ap, lac) g- galactosidase gene into the promoters of damage inducible (din) genes. Several din loci were identified whose expression was increased by a variety of SOS inducing treatments. Subsequently, Kenyon and Walker (1981) showed that a Mudl (Ap, lac) insertion into dinE caused the bacteria to be UV-sensitive and mapped the site of insertion to the position of uvrA. Further genetic tests of the regulation of these fusions involving recA and lexA mutants clearly demonstrated that the din genes (Fig. 1.4) are subject to rec, lex control (Kenyon et al., 1982; Kenyon and Walker, 1981 ; Walker et al., 1982). In fact, the Mudl (Ap, lac) fusion technique has now been used to demonstrate lexA, recA control - 38- Fig. 1.4 A diagram showing the position on the E.coli chromosome of the SOS inducible genes described in Table 1.4. 90 O'/, 80 umuDC 70 30 60 40 Table 1.4 LexA target genes Gene Location Function References (min) recA 58 Recombination and Howard-Flanders and Theriot SOS control (1966), McPartland et (1980), Little et (1981) lexA 91 SOS repressor Brent and Ptashne (1980, (1981), Little et al. (1981) uvrA 92 Excision repair Kenyon and Walker (1981) uvrB 17 Excision repair Fogliano and Schendel (1981) umuDC 25 Mutagenesis Bagg et al. (1981) himA 38 Site-specific Miller _____ et al. (1981) recombination dinA 2 Untargetted mutagenesis Kenyon and Walker (1980) dinB 8 Unknown Kenyon and Walker (1980) dinP 80-85 Unknown Kenyon and Walker (1980) dinF 91 Unknown Kenyon and Walker (1980) sfiA 22 Division inhibition Huisman and D'Ari (1981) recN 57 RecF dependent Lloyd et (1983), recombination Lovett and Clark (1983) ssb 92 Single-strand Brandsma et al. (1983) binding protein ruv 41 UV resistance Shurvington and Lloyd (1982) uvrD 85 Excision repair Seigel (1983) (DNA helicase II) rpsU-dnaG- 67 See below Lupski et al. (1983) rpoD The rpsU-dnaG-rpoD operon has been sequenced and a LexA binding site found in the operator region. The rpsU gene encodes 30S ribosomal protein subunit S21, dnaG encodes DNA primase and rpoD encodes the 6 subunit of RNA polymerase. of the uvrB, s fiA, umuD,C, recA, himA, uvrD, ruv and recN genes (Fig. 1.4) and Table 1.4. In addition, construction of gene fusions vitro have been used to demonstrate the SOS dependent inducibility of lexA, uvrC and ssb genes (Fig. 1.4). v iii) The LexA binding sites Investigation of the LexA binding sites for different SOS inducible genes has identified a consensus DNA sequence upstream of the lexA promoter, (see Walker, 1984). These sequences have been termed "SOS" boxes Table 1.5. The lexA, umuD,C and colicin El (d e l) genes have been shown to possess two closely linked SOS boxes (see Walker, 1984). The kinetics of induction of g-galactosidase activity from the dinA, dinB, dinD and dinE promoters on treatment with mitomycin-C varies considerably. The basis of this differential expression may reflect the binding of LexA with different affinities to different SOS boxes. Thus, LexA binding to the recA operator is more tight than its binding to uvrB and lexA (Brent and Ptashne, 1981 ; Ebina d d ., 1983). ix) The role of the umuD,C in UV and chemical mutagenesis Kato and Shinoura (1977) isolated a mutant defective in UV-induction of mutation. This locus, umuC lies between himA and purB (at 25 min) and mutations at this locus result in a moderate increase in UV-sensitivity. More strikingly, umuC mutations virtually eliminate UV-mutagenesis of irradiated phage X without affecting the inducibility of prophage X or the inhibition of cell division following UV-irradiation. However, recently it has been shown that the mutagenesis of undamaged X observed in UV-irradiated cells is not affected by umuC (i.e. umuC is not involved in untargetted mutagenesis (Défais, 1983; Wood and Hutchinson, 1983). Further studies of umuC, including cloning the -39- Table 1.5 LexA binding sites of SOS inducible genes Gene Sequence Reference recA TA CT GTATGAGCATACAGTA Brent and Ptashne (1981) uvrA TACTGTATATTCATTCAGGT Sancar et al. (1982a) uvrB AACTGTTTTTTTATCCAGTA Sancar et d . (1982b) sf iA TACTGTACATCCATACAGTA Cole (1983) uvrD ATCTGTATATATACCCAGCT Walker (1984) lexA-1 TGCTGTATATACTCACACGA Horii et d . (198lb) lexA-2 AA CT GTA TATACACCCAGGG Horii et d . (1981b) clel-1 TGCTGTATATACTCACACGA Ebina et d. ( 1 981 ) clel-2 CAGTGGTTATATGTACAGTA Ebina et d. ( 1 981 ) Consensus taCTGTatata-a-aCAGta Capital letters indicate strongly conserved bases and small letters indicate weakly conserved bases. Other LexA binding sites have been found by comparison with the consensus sequence shown above but LexA binding has not yet been demonstrated. gene has in fact, identified two adjacent genes umuD and umuC (Elledge and Walker, 1983; Shinagawa et , 1983). These loci code for proteins with molecular weights of 16,000 and 45,000 respectively. UV-induced mutagenesis in E.coli or bacteriophage A by UV and chemical agents can be blocked by mutations at three different loci recA, lexA and umuD,C (Witkin, 1976; Kato and Shinouna, 1977), and by this and several other criteria umuD,C has been shown to be part of the SOS regulon. Consequently, it has been proposed that UV-mutagenesis results from the operation of an error-prone repair system (Witkin, 1976; Radman, 1975) (see error-prone repair). However, the biochemical mechanism of these processes has not been established (Villani and Radman, 1978; Walker, 1984). UmuD,C mutations are suppressed by the introduction of the plasmid pKMIOI (Mortelamens and Stoker, 1979). The muc (mutagenesis ^ and chemical) region of pKMIOI is required for this suppression and it is suggested that this constitutes an analogue of the chromosomal umuD ,C genes (Walker et , 1980). In fact, the pKMIOI mucA and mucB gene products (mol. wt. 16,000 and 45,000 respectively) are very similar in size to umuD and umuC gene products and share considerable homology with these genes (Elledge and Walker, 1983). When pKMIOI was introduced into a recA44l (tif-1) strain an increase in the spontaneous reversion rate of his-4 mutations was observed at 30^0 and a further 10-fold increase was observed when the strain was grown at 42^0 (Ciesla, 1982). From this and other experiments (Ciesla, 1982) the umuD,C products appeared to play not only an essential role in error-prone repair of damaged DNA and therefore in the generation of targeteci errors (Witkin and Weranundsen, 1978) but also in the fidelity of replication of undamaged DNA. The nature of this role again has not yet been elucidated. -40- Intrigueingly, the UmuD and MucA proteins are about 30% homologous with the carboxy-terminal region of both the LexA protein and the XCI repressor including the cleavage site ala-gly- (Perry and Walker, unpublished data cited in Walker, 1984). These authors speculated that UmuD and MucA might therefore be proteolytically cleaved in a RecA-mediated fashion, and that this is essential for error-prone repair. The suggestion that RecA* might have a role in mutagenesis in addition to cleavage of LexA had in fact been indicated by a number of earlier studies. Thus lexA (def) recA (def) strains do not show UV-induced mutagenesis despite the high level of the umuD and umuC gene products expressed constitutively in such a background (Bagg et al., 1981 ; Blanco et ^ . , 1982; Little and Mount, 1982). To date there is no evidence to support the idea that a second role of RecA in mutagenesis is to cause derepression of a gene that is regulated by a repressor other than LexA (Witkin and Kogoma, 1985). However, this additional role of RecA per se in mutagenesis still remains a mystery. Aims of this project Treatment with chemical carcinogens or UV-irradiation induces error-prone repair of DNA damaged in both prokaryote and eukaryote. Using Escherichia coli as a model system my concern was to ccncenitait on 1) establishing by vivo physiological analysis the mechanism of DNA synthesis-inhibition and recovery and its relation if any with rec-lex controls, 2) initiation of more direct studies to analyse directly some aspect of mutagenesis using an in vitro plasmid replication system. -41- Chapter 2 Materials and Methods 2.1 Bacterial and bacteriophage strains . ------and The bacterial strains used were ^ coli K-12 derivatives|E.coli 15T~,fheir genotypes are shown in Table 2.1. Cultures were maintained on nutrient agar at 4^0 when in current use, and frozen at -20^0 or -80®C (in nutrient broth containing ^0% glycerol for storage). Bacteriophage preparations were stored at -4°C in buffer containing a few drops of chloroform. 2.2 Media Nutrient broth : 2.5% w/v oxoid agar No.2 . Luria broth : 1% w/v oxoid tryptone, 0.5% w/v oxoid yeast extract, 0.5% w/v NaCl (pH7.4). M9 minimal medium : 40 mM Na2HP0%, 20 mM KH2PO11, 8 mM NaCl, 20 mM NH4CI, 1 mM CaCl2, 10 mM MgSO%. Added as required : glucose (0.4% w/v), L-amino acids (5 ug/ml), thiamine (2 yg/ml), thymine (5-50 pg/ml), Difco casamino acid (0.4% w/v). Solid media : nutrient broth, Luria broth or M9 minimal media were solidified with 1.45% w/v oxoid No.3 agar. Soft agar : nutrient broth, Luria broth or M9 minimal media solidified with 0.5% w/v oxoid No.3 agar. Antibiotics were used in the following fluid concentrations : sodium ampicillin 25 yg/ml. Tetracycline 10 yg/ml, chloramphenicol 25 or 150 yg/ml as stated in the experiment, rifampicin 260 yg/ml, streptomycin sulphate 200 yg/ml. Ampicillin and streptomycin were dissolved in -42- Table 2.1 Strain Number Genotype Source or reference A B U 57 F ’ thr,leu,pro,his,arg, Laboratory Collection th( ,lac,gal,ara,xyl mtl supE f sx, rpsL. LG388 as AB1157, lexA(Ts) CAM^ transductant malB :: 77^9 AB1157, donor GC2302 GC2302 F ’tsl-1 malB;:Tnq ALac(Ul69) complex derivative of thi,thyA,sfiB MC4100 (D. D'Ari) AB1886 as AB1157, uvrA Laboratory Collection JM12 as AB1157, recA44l, relA Castellazzi jet al. (1972) GW2100 as AB1157, umuC122:;Tn5 Elledge and Walker, 1983 LG20 as AB1157, recA56 Laboratory Collection sr/300::Tn10 JC5495 as AB1157, recAl3,recB21 Laboratory Collection DM49 as AB1157flexA3 Mount et al., 1972 LG373 as AB1157,recAQC Srl+ UV^ trans deoB or C ductant of LG20, donor N1434 (Thomas and Lloyd, 1980) NI 802 as AB1157,recA200 his+ Lloyd e^ , 1974 arg"^ 15T' F" t^y,arg,trp,met,r15' Laboratory Collection m15" Cont... Table 2.1 Continued .... 2 .... Strain Number Genotype Source or reference SC41 recA44l,sfiA11,spr55,uvrA, S. Casaregola th^ ,recB21, m a l B : : Th^. thr,leu,his,arg,pro,lac, gal,Str AB2470 as AB1157, recB21 B. Bridges AQ699 sdrA224,metD88,F",ilv,metB Torrey et al., 1984 his-29,trp9605,rpoB,(rifR, thyA,deoB or C) CSH26 ara, A(lac,pro),rpsL,thi Laboratory Collection SC62 as CSH26, ^80, lacZyA T1R,lac+ trans- ductants of SC6l donor JMX86 (Pfahl, 1972) SC89 as AQ666, srl::Tn10, recA44l Tet^Ts transduct- ants of AQ666, donor GC2418 SCI 46 as SC89, srl+, recAo^ Srl+TR transductants of SC89, donor N1434 (Thomas and Lloyd, 1980) JMX8634 [lac-pro]AStr^ ^80dlao Pfahl, 1972 [ trp~, tonB~, lac'^'i-] A GC776 as AB1157, recA453,recA44l Castellazzi et , 1 972b LG390 as LG373, thyA Spontaneous thy- mutants ‘trimethoprin JM776 as AB1157, recA430 Devoret et al., 1983 distilled water; tetracycline and chloramphenicol were dissolved in 50% ethanol. Rifampicin was dissolved in 50% K^COg, 50% ethanol. Bacterial buffer : 20 mM KH2POH, 50 mM HPO%, 70 mM NaCl, 0.4 mM MgSO^ (pH7.4). 2.3 Growth of bacterial cultures In most experiments bacteria were grown in M9 minimal medium or enriched media at the temperature indicated. Bacterial cell mass in growing cultures was monitored by measurement of absorbance at 450 nm (Ai|5o) using a Gilford microsample spectrophotometer 300N. 2.4 UV-irradiation An overnight culture was diluted to A1450 approximately 0.04-0.05 and was then grown to log phase at the temperature stated in each experiment. For most experiments at A450 • 0.1-0.2 cultures were irradiated using a Hanovia Bactericidal lamp. 25 ml vol of culture were swirled under the lamp in glass petri dishes. Dose rate was calibrated using a Latarjet dosimeter. 2.5 Measurement of bacterial cell number 0.2 samples were taken from a culture in minimal medium and fixed by dilution with 1.8 ml 0.8% w/v formaldehyde in saline (0.8% w/v NaCl). Samples were further diluted in saline by a factor of 25. A model 2B1 Coulter counter was used. Instrument settings were as follows; Amplification 1/4, current 2. All saline solutions were filtered through a 0.22 ym pore size millipore filter, then autoclaved. Counting was performed on the same day. - 43 - 2.6a DNA synthesis DNA synthesis was measured by accumulation of ^^C-thymidine. For thy'*' strains, cultures were grown in minimal medium containing 1 yci/^T?/ of I^C-thymidine (specific activity 58 mci/mMol), supplemented with 1.5 mM uridine. Labelling was continued for about 5 generations before sampling in order to ensure steady state growth and labelling conditions. For thy" strains labelled thymine was added to give a concentration of 0.01 yci/yg of I^C-thymine. For measurement of incorporation, 1 ml samples from exponentially growing cultures were mixed with 2 ml ice cold 10% trichloroacetic acid (TCA). Samples were kept over ice for at least 1 h, and then collected by suction onto Sctrtorious membrane filters ( 0* /?? p o r e sîj^e) ' Following washing with 5% TCA. Filters were dried for 10-15 min under an infra red lamp and then placed in non aqueous scintillation fluid consisting of 0.5% diphenyloxazide (PPG) and 0.0033% 1,4-bis-2-(4-methyl-5-phenyl- oxazdyD-benzene (dimethyl POPOP) in toluene. b. Rate of DNA synthesis Rate of DNA synthesis was measured by withdrawing 0.5 ml aliquots of cultures into 100 yl of prewarmed medium containing 1 yci ^h -thymidine (specific activity 85 yci/mM). The pulse was terminated after 2 min by addition of 2 ml ice cold 10% TCA. Samples were processed for counting as described above. Counting was carried out in Packard liquid scintillation counter. Each experiment was repeated at least twice to confirm the results obtained. 2.7 Measurement of stable DNA replication An exponential culture (A^^g.l-O.IS) was starved for thymine for 50-60 min. Cells were harvested and resuspended in minimal medium “44- with cold thymine (2 ug/ml) plus 150 yg/ml chloramphenicol (CAP) and incubated for 3 h, then labelled thymine (5 ]xGi/irtt ) was added and sampling continued for 2 h. 2.8 Generalized transduction using PI vir a. Preparation of lysates Donor strains were grown in nutrient broth to A450 0»5 and CaCl2 added to 2.5 mM. 0.3 ml of cells were mixed with 0.1 ml of PI lysate at a range of dilutions and left for 15 min at 37°C to allow phage adsorption. 3 ml of PI top layer agar (soft agar plus 2.5 mM CaCl2) was then added to each tube and the contents poured onto PI bottom layer agar plates (Nutrient agar 2.5 mM CaCl2 0.1% w/v glucose) and incubated for 6 to 7 h at 37°C or overnight at 30°C as required. The plates on which PI plaques were just confluent were selected and the top layer scraped off into a sterile bottle. A few drops of chloroform and 1 ml of buffer per plate were added. The suspension was mixed and incubated at 37°C for 15 min after which the tubes were centrifuged for 15 min at 6,000 rpm. The supernatant was taken off and stored at 4°C over chloroform. The titre was usually 2-5 x 10^0 phage/ml. b. PI transduction The recipient strains were grown in nutrient broth to Ay^Q : 0.5; 10 ml of cells were centrifuged and resuspended in 1 ml of Luria broth. 0.5 ml of these cells were added to 0.5 ml donor PI lysate (titre approximately 5 x 109 phage/ml) and 0.5 ml of prewarmed nutrient broth made 30 mM with respect to MgCl2 and 15 mM with respect to CaCl2 and the tubes incubated for 25-30 min for adsorption. 2 ml of nutrient broth + 0.25% sodium citrate were added and incubated for 3O-6O min to allow -45“ expression of transduced markers, then plated out onto selective agar plates and incubated overnight. Transductants were tested for selective markers or relevant phenotypes. 2.9 Transformation a. The RbCl method Competent cells were prepared by a modification of the method of Kushner (1978). An overnight culture was grown with shaking at 37®C in Luria broth. 0.5 ml were diluted 1/100 in the same medium and grown to an A 600 = 0.3. 1.4 ml aliquots of cells were pelleted by a 30s ’ spin in an Eppendorf centrifuge and the supernatant was removed and the cells (gently) resuspended in 0.5 ml of MR (MR = 10 mM Moaps, pH7.0, 10 mM RbCl). The cells were centrifuged again for 30s’ and the supernatant removed as before. The cells were resuspended in 0.5 ml of MRC (MRC = 100 mM Moaps, pH6.5, 10 mM RbCl, 5 mM CaCl2) and left on ice for 30 min. After another 30s’ spin the cells were resuspended in 0.15 ml of MRC and kept on ice until required. To each tube of ’’competent” cells was added 3 yl of fresh DMSG (dimethylsulphoxide) and DMA (0.2-0.2 yg). The mixture was left on ice for 1 h, placed at 55°C for 35s’, and cooled on ice for 1 min. 2 ml of Luria broth was added and the cells grown at 37°C with slow shaking for 1 h. Serial dilutions were plated out on selective media. b. Hanahan method Another transformation procedure modified from Hanahan (1983) was used for some experiments giving a high frequency of transformation, (107-10® transformants/ml). Competent cells were prepared by resuspending a fresh colony in 5 ml TY broth (TY : 2% tryptone, 0.5% •46- yeast extract, 10 mM NaCl, 20 mM MgCl2 , final pH7.6) and grown with moderate shaking at 37®C until A550 = 0 .2-0 .3. 1 ml was diluted 25 times in TY broth and the cells grown again with fast shaking until Ay^Q = 0.48-0.5. The culture was centrifuged for 5 min at 5000 rpm using a refrigerated Sorval centrifuge. The pellets after discarding the supernatent were resuspended "gently” in 8 ml transformation buffer number one (35 mM NaAc, 15% glycerol, 100 mM RbCl, 50 mM MnCl2, 10 mM CaCl2 , final pH5.8). After 5 min on ice, the cells were centrifuged again (4°C) at 5000 rpm for 5 min. The pellets were resuspended in 1 ml transformation buffer number two (10 mM Moaps, 75 mM CaCl2.2H20, 10 mM RbCl, 15% glycerol), and dispensed as aliquots of 200 yl in Eppendorf tubes. At this stage the competent cells can be frozen in an I.M.S./dry ice mixture and kept at -70 for several months. After 15 min on ice DMA was added (1-10 yl) in T.E. buffer (10 mM Tris-HCl pH7.5, 1 mM EDTA) and the cells left on ice for 10-20 min. The cells were then heat shocked for 90s’ at 42^C and left on ice again for 1-2 min. 400 yl of TY broth were added and incubated with slow agitation at 37°C for one h. 0.1-0.2 ml were plated on selective media (Luria agar and antibiotics). c . The calcium chloride method A modified procedure from Cohen £t ^ . , 1972 was used for some experiments. Recipient cells were grown in nutrient broth to A 1150 0.4-0.5 and chilled on ice. 10 ml of cells were pelleted and resuspended in 5 ml of cold 0.1M MgCl2 (all centrifugations were done at 4®C). Cells were again pelleted and resuspended in 5 ml of cold 0.1M CaCl2 and left on ice. After 20 min the cells were harvested and resuspended in 0.6 ml cold 0.1M CaCl2. Cells at 4°C remained competent for a few days but highest frequencies of transformation were achieved with cells - 47 - prepared 24 h before use. For transformation 200 yl of competent cells were taken and up to 10 yl of DNA added. After 1 h on ice, cells were heat shocked for 5 min at 42°C (2 min if the strain was temperature sensitive) and added to 2 ml of prewarmed nutrient broth and shaken for 1-2 h at 37°C (30*^0 for temperature sensitive strains). Serial dilutions were plated out onto selective agar plates and grown under appropriate conditions. 2.10 Phenol extraction To DNA samples the same volume of phenol mixture was added and the mixture then vortexed and centrifuged in an Eppendorf tube for 3 min. The upper layer was transferred to a new Eppendorf tube (sometimes the phenol treatment was repeated twice) and the same volume of TE buffer then mixed with the bottom layer and centrifuged for 3 min. The upper layer was removed and carefully added to the new tube containing the first separated layer. To remove the remaining traces of phenol the samples were treated with ether (3 times), and the ether then removed by aeration. Phenol extraction was usually followed by ethanol precipitation. 2.11 Ethanol precipitation DNA samples to be precipitated were first adjusted to 0.3M in NaAc. 2.5 vol of 100% ethanol then added and the samples cooled in a dry ice/IMS bath for 10 min. The DNA pellet was washed with 70% ethanol to remove salt, then the tubes were centrifuged again and the supernatant carefully removed. The DNA pellet was dried under vacuum for 5 min. and resuspended in TE buffer. -48- 2.12 Preparation of plasmid DNA a. Rapid plasmid DNA preparation A modification of the method described by Birnboim and Doly (1979) was used to prepare small amounts of plasmid DNA (Maniatis et , 1982). Details of solutions unless otherwise stated as in Table 2.2. 3 ml of an overnight culture of plasmid bearing cells were centrifuged in an Eppendorf tube. The pellets were resuspended in 0.1 ml of a 1 mg/ml lysozyme solution in TEG buffer and left on ice for 5 min, 0.2 ml of alkaline SDS was added and after 5 min on ice 0.15 ml of cold potassium acetate solution was added. After a further 5 min on ice, tubes were centrifuged for 4 min and extracted once with phenol. 1 ml of 100% ethanol at room temperature was added and then centrifuged for 7 min. The pellets were washed with 70% ethanol, vacuum dried and resuspended in 50 yl of TE buffer. RNA was removed if required by the addition of 5 yl of DNAse free RNase (1 mg/ml) and samples incubated at 37^0 for 30 min. b . Large scale plasmid preparation Details of solutions unless stated as in Table 2.2. 400 ml nutrient broth + antibiotics were inoculated with fresh cells containing the required plasmid and incubated overnight with vigorous agitation. After harvesting using a Sorvall GS3, 5,000 rpm, 4^0, the cells were chilled, washed with 10 ml bacterial buffer and resuspended in 3 ml Tris-sucrose, and 0.5 ml lysozyme (10 mg/ml)/RNase (300 yg/ml) solution was added. The mixture was incubated at room temperature for 5 min, 1 ml 0.25 M EDTA was added, and the mixture incubated for 5 min. 4 ml of Triton lysis mixture were added and the tube inverted until lysis was complete. The lysate was cleared by centrifugation (Sorvall 3334, 18,000 rpm, 20 min, 4o q ) and 2/3 volume of PEG/NaCl added to precipitate the DNA. After 3 h on ice the precipitate was collected by “49“ Table 2.2 Reagents used in the preparation of DNA Tris-Sucrose : 50 mM Tris-HCl pH8.0 25% sucrose (w/v) TE buffer : 10 mM Tris-HCl pH7.5 1 mM EDTA TES buffer : 50 mM Tris-HCl pH8.0 5 mM EDTA 50 mM NaCl TEG buffer : 25 mM Tris-HCl pH8.0 10 mM EDTA 50 mM glucose Alkaline SDS : 200 mM NaOH 1% SDS Potassium acetate : 60 ml 5 M KAc 11.5 ml glacial acetic acid 28.5 ml H2O Triton lysis mixture ; 2% Triton X-100 (v/v) 50 mM Tris-HCl pH8.0 PEG-NaCl : 25% polyethylene glycol 6000 1.25 M NaCl CsCl-EtBr mix : 80 g caesium chloride 52 ml TES buffer 8 ml EtBr (5 mg/ml) refractive index = 1.3990-1.4000 Phenol mixture 100 g phenol dissolved in 100 ml HCI3 4 ml 15% amyl alcohol 0.1 ml 8-hydroxyquinocoline centrifugation and resuspended in 1.1 ml of TES buffer. The 1.1 ml lysate was transferred to a Beckman Ti65 self-sealing tube and underlayed with 4 ml CsCl-EtBr solution. The tube was centrifuged to equilibrium in a Beckman VTi65 rotor (55,000 rpm, 3 h , 15°C). When plasmid DNA was clearly visible as a quite separate band from the chromosomal DNA it was removed from the side with a syringe needle. Ethidium bromide was removed from the DNA by extraction with NaCl-propan-2-ol and the DNA then dialysed to remove CsCl. If required the plasmid DNA was phenol extracted and/or concentrated by ethanol precipitation. DNA concentration was determined using CECIL Instrument (Micro sipette control plus ultraviolet spectrophotometer). For the minimally purified DNA (MP) ^ vitro DNA concentration was also measured by CECIL instrument. However, when compared with that estimated on gel they gave virtually the same concentration. 2.13 SDS polyacrylamide gel electrophoresis a. Preparation and running of gels The procedure was based on that of Laemmli (1970), using a Biorad 220 slab gel apparatus without cooling. The buffers, solutions and gel recipes used are given in Table 2.3. Gels were usually 1 mm thick and composed of a 7/5 acrylamide stacking gel with an 11% or 15% acrylamide separating gel, with 1 cm of effective stacking distance between the sample wells and the surface of the separating gel. All samples were boiled for 5 min before loading and electrophoresis carried out at 25 mAmps/gel, until the dye front was within 5 mm of the bottom of the gel. Gels were then either fixed by shaking in 200-300 ml of destain (Table 2.3) for at least 30 min or shaken in 200-300 ml of stain overnight. Stained gels were destained by diffusion in several changes of destain, shaking throughout. -50- Table 2.3 SDS PAGE solutions, buffers and gel recipes Gel composition 15% 11 % Separating gel: Buffer A 13.5 13.5 ml Acrylamide 9.2 6.8 ml H2O 3.6 6.0 ml Ammonium phosphate (APS) freshly made, 10 mg/ml 1.0 1.0 ml N,N,N’,N'-tetramethyl ethylenediamine (TEMED) 75 75 yl 7% Stacking gel: Buffer B 10.0 ml Acrylamide 3.3 ml H2O 6.7 ml APS 0.5 ml TEMED 40 yl TEMED was always added immediately before the gel was poured Buffer A Tris/Cl pH8, 0.75 M SDS 0.2% w/v Buffer B Tris/HCl pH6 0.25 M SDS 0.2% w/v Acrylamide Acrylamide 44% w/v N,N’-methylene-bis- acrylamide (bis) 0.8% w/v Table 2.3 continued Electrophoresis Trisma base 0.125 M buffer Glycine 0.192 M SDS 0.1% w/v Sample buffer Tris/HCl pH6.8 0.125 M Glycerol 20% v/v -mercaptoethanol 10% v/v SDS 4% w/v Bromophenol blue 0.05% w/v 1 /3 volume of this sample buffer was added to each sample before boiling and electrophoresis unless indicated otherwise. Destain Isopropanol 25% v/v Acetic acid 10% v/v Stain Coomassie brilliant blue 0.05% w/v in destain b. Aut or ad i ogr aph y For autoradiography,fixed gels were dried onto a sheet of Whatman No.17 chromatography paper using a Biorad slab gel drier model 1125. The dried gels were placed in a cassette with a sheet of Kodak XR P5 X-ray film for exposure and the film developed using Kodak DX-80 developer, a 1 % acetic acid wash and Kodak FX-40 fixer. 2.14 Restriction enzyme digestion Wherever possible restriction endonuclease enzymes were used in BRL core buffer. If this was not possible individual buffers canbe used. Table 2.4. Digestions were performed at 37°C for 90 min. Where difficulty was encountered in digesting DNA, spermidine (10 mM) was added to a final concentration of 4 mM. Reactions were stopped by heating at 65°C for 10 min or adding 1/5th volume of 0.1 M EDTA pH8.0. To minimize nuclease contamination sterile tube and reagent were preferred. 2.15 Preparation of a cell-free extract for DNA replication The procedure was based on that of Staudenbour (1976), the buffers, media and solutions are given in Table 2.5. An overnight culture was diluted in TY broth plus adenine (75 yg/ml) and reincubated at 37°, As the optical density reached 1.0 (Agoo the culture was adjusted to pH7.5 with 5M KOH. The cells then harvested (using GS-3 rotors, 10 min, 5000 rpm at 4°G) and the pellets were resuspended in 25 mM Hepes buffer (pH8.0). The cells then reharvested by centrifugation (using SS-35 rotors, 10 min, 10,000 rpm, at 4°C). Pellets were resuspended in 25 mM Hepes buffer (in a volume equal to the pellet weight) using 50Ti polycarbonate tubes, and the suspension frozen in liquid nitrogen. The frozen cells were thawed and 1/50th the vol of 15 mg/ml lysozyme in 50 mM EDTA added. The suspension was then placed for -51- Table 2.4 Restriction buffers (x 5) Enzyme Tris/HCl pH MgCl2 NaCl KCl DTT SH EDTA EcoRI 500 7.4 50 250 - 2.5 Core buffer 50 8.0 10 50 Figures represent mM concentrations Table 2.5 Solutions used in the preparation of cell free extract TY broth ; 8 g trypton 5 g yeast extract 5 g NaCl 25 mM Hepes buffer : 0.05M HCl (pH8.0) 1 mM DTT 30 min on ice to lyse the cells. The lysed cells were frozen in liquid nitrogen and thawed again followed by centrifugation in a 50Ti rotor for 30 min at 30,000 rpm and 2°C. The supernatant was removed and stored in liquid nitrogen. To avoid contamination and achieve maximum activity in the extract all steps were performed on ice and sometimes in a cold room at 40c. 2.16 Concentration of extract To maximize the extract activity (i.e. increasing protein concentrations) the extract was usually fractionated with 60% ammonium sulphate and agitated for 30 min on ice. The suspension was centrifuged for 15 min at 13,000 rpm, and the pellet was resuspended in 25 mM Hepes buffer. To remove excess ammonium sulphate the suspension was finally dialysed in Hepes buffer for 2 h with two changes. 2.17 Hydroxylamine treatment In order to mutagenize plasmids vitro a potent mutagenic compound like hydroxylamine was used in a procedure modified by Humphry et al., (1976). 10 ml plasmid DNA (0.5 yg/yl) was incubated with a mixture of 50 yl 0.1 M sodium phosphate pH6.0 and 1 M hydroxylamine, for 30 min at 75°C. Samples were then dialysed for 4 h in TE buffer (two changes). DNA was used for transformation and selection for mutated plasmids carried out. For plasmid pBR325 selection was carried out on Tet and CAM. 2.18 The in vitro replication essay The procedure was modified from Staudenbour, (1976), and all the buffers and solutions were described in Table 2.6. Plasmid DNA was incubated with the cell-free extract with dNTP and rNTP, an energy -52- Table 2.6 Mixture I dNTP 0.5 M Hepes pH8.0 1 M MgCl2 1 0 mM dATP 1 0 mM dCTP 10 mM dTTP 1 0 mM NAD 1 0 mM CAMP H2O Mixture II ENERGY 0.1 M ATP 0.5 M creatine phosphate creatine kinase (10 mg/ml) creatine phosphate dissolved in 25 mM Hepes pH8.0 creatine kinase dissolved in 25 mM Hepes pH8.0 100 mM Kcl, 10% Ethylene glycol Mixture III rNTP 40 mM CTP 40 mM GTP 40 mM UTP Stop mixture 0.5 N NaOH 0.5% SDS 10% Na pyrophosphate 0.5 mg/ml Calf thymus or DNA salmon sperm generating system and [methyl-3H]-thymidine 5 ’-triphosphate 43 ci/mmol to a total volume of 25 yl per tube (usually the total volume completed by Hepes buffer). Samples were incubated for 60 min at 30°. To measure the level of DNA synthesis, incorporation of ^H-thymidine was used. The reaction was stopped using stopping mixture (Table 2.5). The samples were then boiled for 5 min and placed on ice for 10 min. To each sample 1 ml of 2 M trichloroacetic acid was added and left for 15 min on ice. The samples were then collected by suction onto Sartorius membrane filters (0.45 ym pore size), the filters dried for 10-15 min under an infra red lamp and then placed in non aqueous scintillation fluid consisting of 0.5% diphenyl oxazide (PPG) and 0.0033% 1.4-bis-2-(4-methyl-5-phenyloxazdyl)-benzene (dimethyl POPOP) in toluene. Counting was carried out in a Packard liquid scintillation counter. 2.19 Measurement of the level of B-galactosidase activity The procedure was based on that of Miller (1972). The buffer and solutions are given in Table 2.7. 100 yl bacterial culture (A^gg 0.5) were mixed with 700 yl g-galactosidase buffer (Z buffer), one drop 0.1% SDS and two drops of chloroform. The mixture were shaken for 1 Os then incubated for 2 min at 28°. 200 yl of ONPG (4 mg/ml) was added, then incubated again at 29°. 500 yl of 1M Na2C0g was added to each tube developing yellow colouration and time of incubation was recorded for each individual sample. Then by using the following formula A420 " 1-75 X A550 = 1000 X ------T X V X Agoo where T = time V = volume = units of g-galactosidase, defined as the amount of enzyme which produces 1 my-mole/ml o-nitrophenol/min at 2 ^ tpH-7'0 -53- Table 2.7 B-galactosidase buffer and solutions P-galactosidase buffer (Z buffer) NaH2P0%l7H20 0 I0 6 M NaH2P0i|.H20 0.'o 4M KOI 0.01M MgS0%.7H20 0 I0 OIM -mercaptoethanol 0.05M *Do not autoclave : adjust pH to 7.0. 0-nitrophenyl-B-D-galactoside (ONPG) : 4 mg/ml in 0.1M phosphate buffer pH7.0 Chapter 3 The kinetics of DNA synthesis following UV The pattern of DNA synthesis in E.coli K12 following UV-irradiation was previously described by Darby and Holland (1979). Their data showed that in a wild-type E.coli strain the rate of DNA synthesis, measured by pulse labelling, prior to irradiation paralleled the rate of mass increase. The rate of DNA synthesis fell abruptly upon irradiation (inhibition phase), followed by a gradual increase (recovery phase) to approach the pre-treatment rate of DNA synthesis in about 40 min. As a prelude to the analysis of UV-irradiation on mutant strains in this project the pattern of inhibition and recovery phases in AB1157 (a wild-type strain) was therefore measured using the same procedures. An exponentially growing culture of AB1157 in M-9 minimal medium was irradiated at Ay^g = 0.10-0.15 with a UV dose of 10 Jm”^. The rate of DNA synthesis was measured by pulse labelling at intervals with [3n]-thymidine for 2 min (see Material and Methods) over a period of 30 min prior to irradiation until 90 min after treatment. Mass increase was also monitored over the same period. The results are plotted in Fig. 3.1a. The rate of DNA synthesis prior to irradiation paralleled the rate of mass increase. However, directly after UV there was a dramatic fall in the rate of DNA synthesis. The rate remained at this low level for 2-3 min before rapidly recovering. The over-shoot in the rate of DNA synthesis between 45 and 60 min (Fig. 3*la) before the culture returned to the control rate of synthesis was reproducibly observed. This over-shoot is presumably due to additional initiation from the origin -54- Fig. 3.1 Effect of UV-irradiation upon the rate of DNA synthesis in different repair mutants An exponentially growing culture of strains AB1157, LG20, JC5495 and DM49 in M9-minimal medium were pulse labelled with ^H-thymidine before and after UV-irradiation of 10 Jm“2. [3h ] counts were taken as a measure of the amount of DNA synthesis which took place during the 2 min pulse. Mass increase was also monitored. Ay^g straight line; 3h cpm o — o. a : /9 8/^^ 7 ^ : i a x o c c : ( K l l â Û , yecSS-i ) d : DH^Ç C ) UV UV 0.8 T o 0.6 X 0.5 E Q. ü co UV 1 UV 08 0.6 0.4 03 0.2 30 0 30 60 90 30 0 30 60 90 Time after UV (min) resulting from the continued increase in cell mass during the period of inhibition of DNA synthesis. There are two plausible explanations for this typical pattern of DNA synthesis observed after UV. The sharp reduction in DNA synthesis coulc( due to replication forks halting at dimers or other photo-lesions whilst subsequent recovery might be due to the production of replication Alternative^/ complexes capable of synthesising past d i m e r s . t h e effect of UV triggers an early SOS function which transiently inhibits DNA synthesis. In order to gain more information concerning the precise response of the DNA synthesising machinery to DNA damage jji vivo, the effect of UV-irradiation was measured using a variety of mutants isogenic with AB1157, defective in repair or specifically in recA-lexA functions. These results are described in the following sections. 3.1 Effect of recA" and lexA (ind~ ) mutations on inhibition of DNA synthesis in UV-irradiated bacteria One of the features displayed by E.coli undergoing the SOS response due to DNA damage, for example following UV-irradiation, is the transient inhibition of DNA synthesis. This inhibition might arise directly through blockage of polymerisation complexes at sites of DNA damage or through the synthesis of an inducible SOS inhibitor of replication. In 1980, Trgovcevic et suggested that at low doses of UV DNA synthesis was not inhibited in recA" strains indicating that inhibition of DNA synthesis is an inducible SOS functions under recA control. However, these results should be treated with some caution in view of the very low UV doses (i.e. 0.5 Jm"^) employed. In fact, Doudney (1972) and Burton (1981) have shown that in wild-type E.coli strains, DNA synthesis is inhibited in proportion to dose over the range "55- 0.75 Jm"2 to 20 Jm"^. Consequently, at the doses employed by Trgovcevic, equivalent to 20-25 dimers/genome, inhibition of DNA synthesis is not detectable in a wild-type strain. In order to examine the possible relationship of UV-induced inhibition of DNA synthesis to the SOS response a series of experiments were carried out in which the rate of DNA synthesis was determined in irradiated recA~ and lexA" strains. In such mutants the results can be complicated by the high rate of DNA breakdown which accompanies UV treatment (Willetts and Clark, 1969, Howe and Mount, 1975). This however, can be avoided by introducing an additional mutation in the recB or recC genes (Willetts and Clark, 1969) which together code for exonuclease V (Tomizawa and Ogawa, 1972). Exponentially growing cultures of AB1157 (wild-type), LG20 (recA56), JC5495 (recAl3, recB21), DM49 (lexA3) in M9 minimal medium supplemented with the required amino acids were irradiated at A^^g 0.1 to 0.2, with a UV dose of 10 Jm"^. Mass increase and the rate of DNA synthesis were monitored as described in Methods (Chapter 2). The results can be seen in Fig. 3.1. this shows that DNA synthesis was markedly inhibited in both the wild-type and recA~ mutant, although DNA synthesis failed to recover in the recA~ mutant. Similar patterns of inhibition were obtained with the isogenic strains carrying, lexA" or recA", recB~ mutations in which any DNA breakdown should be avoided. Moreover, in a mutant (recA200) which produces a temperature sensitive RecA protein, the inhibition of DNA synthesis observed at high temperature (42°) was fully reversible by subsequent growth of the culture at 30° (see Chapter 4). This indicated that DNA breakdown due to the absence of RecA protein is not the reason for the inhibition of DNA synthesis. "56- Since both the mutants and the wild-type showed identical patterns of inhibition of DNA synthesis, these data suggested that under these conditions functional recA and lexA genes are not required for inhibition of DNA synthesis by UV irradiation. In contrast, the slow rate of recovery of DNA synthesis in these mutants (the recA~ mutant in particular) indicated that recA and lexA genes are required for recovery of DNA synthesis after UV. The nature of the recovery phase will be described in the following chapters. The inhibition of DNA synthesis by UV irradiation of a wild-type strain described above could conceivably arise through the inhibition of initiation of chromosomal replication and/or the direct block to replication forks. Joncyk and Ciesla (1979) have reported that the effect is initially upon initiation. This experiment was repeated in this laboratory using a dnaA~ mutant to block initiation at 42°C (B. Weinhardt, B.Sc thesis, 1982; Khidhir £t al., 1985). This experiment showed that residual DNA synthesis, which at the non-permissive temperature represents continuation of pre-existing forks, was completely UV-sensitive, and we conclude in contrast to Joncyk and Ciesla, that active forks are in fact inhibited by UV-treatment. The data from the experiment with dnaAl also showed that DNA synthesis at 42°, following UV-irradiation, did eventually recover to produce the equivalent of a complete round of chromosomal replication. This result provides evidence that stalled replication forks do in fact resume elongation under these conditions. /•cçç^ y Oh/fi ^ u s LLè^cUjr 3.2 DNA synthesis in the recA44l mutant at the restrictive temperature The previous result in Fig. 3.1 suggested that inhibition of DNA synthesis by UV was not due to the induction of the recA-lexA dependent -57- SOS response. In order to test this hypothesis further and to avoid the complexity of UV-irradiation we used a mutant strain carrying a recA44l allele. In non lysogenic E.coli expression of the recA44l (formerly tif-1) mutation at the restrictive temperature causes an inhibition of septation, resulting in the formation of long filaments. This is one of several of the SOS response (see Chapter I) which is thermally inducible in recA44l mutants, arising from the cleavage of the LexA repressor by the altered RecA protein. If inhibition of DNA synthesis is a specific SOS function this effect should therefore also be observed in recA44l. Exponentially growing cultures in M9 minimal medium of JM1 2 (recA44l) and its isogenic parent AB1157 were therefore shifted to 42° and the rate of DNA synthesis was measured as described in Chapter 2. Adenine which has been shown to enhance SOS expression in recA44l mutants (Castellazzi et ^ . , 1972) was added to a final concentration of 75 yg/ml at the time of temperature shift. Microscopic examination indicated that cell division was more effectively expressed in the presence of adenine. Moreover, cell number determination with the Coulter Counter (see Chapter 2) confirmed that cell division was efficiently blocked at 42° indicating efficient induction of SOS functions. The result in Fig. 3.2, 3.3 for the recA44l mutant and AB1157 respectively showed that in particular in the presence of adenine a transient inhibition of DNA synthesis was observed before recovery and eventual restoration of the control rate. However, since this effect was also observed in the wild-type parent the result indicated a primary role for adenine rather than the recA44l mutation in this effect. Consequently, the same experiments were repeated with adenine added 60 min before shifting to the high temperature in order to allow maximum -58- Fig. 3.2 DNA synthesis in recA44l mutant at the restrictive temperature An exponentially growing culture of JM12 (recA44l) in M9-minimal medium was pulse labelled with [3h ]-thymidine before and after shift to 42°. Adenine (75 yg/ml) was added at the time of temperature shift. Mass increase was also monitored. A^^g #-----#; (- adenine)U ; (+ adenine) :m a; cells/ml :o □. 10 0*5 450 1.0 0.1 0.5 r-i 0.1 0 20 40 60 80 100 Time after Temperature shift ( min ) Fig. 3.3 DNA synthesis in a wild-type strain (AB1157) at the restrictive temperature An exponentially growing culture of AB1157 was pulse labelled with [^Hl-thymidine before and after shift to 42°. Adenine (75 yg/ml) was added at the time of temperature shift. A450 •------•; (- adenine) &; ( + adenine) :■---- 10 1-0 0-5 450 CO 'o X E a Ü I ts 0.1 O 20 40 60 80 100 Time after temperature shift (min.) enhancement of SOS response expression with minimal perturbation of DNA synthesis. As shown in Fig. S.^kthe wild-type parent now showed no transient inhibition of DNA synthesis. In contrast, recA44l still showed la transient delay or^ inhibition of DNA synthesis in three d i f f e r e n t {repeated experiments.These results clearly indicated that even in the absence of direct DNA damage induction of SOS functions in the recA44l mutant is accompanied by detectable inhibition of DNA synthesis at high temperature. Nevertheless, this effect unlike other SOS functions is only transient, suggesting that the effect may not be specific. Thus e.g. the presence of high levels of RecA protein itself might temporarily disrupt DNA replication. Consequently we must consider the possibility that the observed inhibition of DNA synthesis in UV-irradiated cells might result from both direct DNA damage and from a component of the SOS response itself. 3.3 DNA synthesis in lexA(ts) mutants at the restrictive temperature Since the result in the previous section indicated that inhibition of DNA synthesis might have some relationship to the expression of the SOS system, another approach was sought. This was achieved by analysing the effect of lexA mutations to turn on the SOS system under certain conditions. Mount and Walker (1973) isolated a tsl mutant carrying a thermosensitive suppressor of lexA which failed to grow normally at 42° forming large nonseptated filaments, presumably through derepression of the sfiA division inhibitor. In contrast, DNA synthesis was reported to be normal at high temperature in a lexA(ts) mutant (Mount and Walker, 1973). However, in view of the result described above with the recAMi mutant the effect of lexA(ts) expression on DNA synthesis was carefully -59" Fig. 3.^a DNA synthesis in lexA(ts) mutant at the restrictive temperature An exponentially growing culture of lexA(ts) strain (LG388) in M9-minimal medium (plus 0.1% casamino acid), was pulse labelled with [^H]-thymidine before and after shift to ^2°C. TCA precipitable [^H] count were taken as a measure of amount of DNA synthesis which took place during the 2 min pulse. Wild-type [3h] o ------o; lexA(ts) [^H] e------#. Fig. 3.^b DNA synthesis in recAM4l mutant and its isogenic parent AB1157 at the restrictive temperature An exponentially growing culture of AB1157 wild-type in M9-minimal medium was pulse labelled with [3H]-thymidine before and after shifting to 42°. Adenine (75 ^g/ml) was added 60 min prior to shift. Wild-type [3h] o o; recA44l [3h] # e. [1n]-Cpm X io ro ro 4^ CO . OD O o o oCO oCO oCO o c r G) O oCO re-examined. An exponentially growing culture of the lexA(ts) strain (N1987) in M9 minimal medium (plus 0.1% casamino acids) was pulse labelled with 3H-thymidine before shifting to 420c and also during subsequent growth at 42°. The results showed a transient inhibition of DNA synthesis before some recovery took place. However, the isogenic lexA(ts) parent (N1956) also showed the same degree of DNA synthesis inhibition following the shift to high temperature (data not shown). In view of this and to avoid the complexity of strain differences the lexA(ts) mutation in GC2303 was introduced into AB1157 by PI-transduction (see Chapter 2). The donor strain (GC2303) carried a malB;;Tnq (chloramphenicol resistant) insertion close to lexA and transductants in AB1157 were selected by growth on chloramphenicol. These were purified and examined microscopically for filamentation after shifting a growing culture from 30° to 42°. A new strain was therefore obtained carrying the lexA(ts) mutation in an AB1157 background and this was designated LG388. An exponentially growing culture of the lexA(ts) strain (LG388) in M9 minimal medium (plus 0.1% casamino acids) was pulse labelled with ^H-thymidine and shifted to 42° as before. The results (Fig. 3.4a) clearly showed that there was no detectable effect on the rate of DNA synthesis in the lexA(ts) mutant at 42°. In contrast, cell number determinations with the Coulter Counter gave the same pattern of inhibition of cell division as in recA44l mutants (data not shown). This result is consistent with the report of Mount et (1973) and Cudas (1976) that DNA synthesis in lexA(ts) mutant is indeed normal at the higher temperature. Therefore, consitutive expression of the SOS response under these conditions does not include a DNA synthesis inhibitor. Furthermore, this result indicates that the transient -60- inhibition of DNA synthesis observed in recA44l may be a specific consequence of high levels of the altered form of RecA present in that mutant. 3.4 Effect of inhibition of protein synthesis on inhibition of DNA synthesis after UV-irradiation Notwithstanding the results described above,if nevertheless the inhibition of DNA synthesis following UV was indeed an SOS function and therefore inducible, the effect should be blocked by inhibition of protein synthesis at the time of irradiation. An experiment was therefore designed to test this possibility. For this purpose it is important to note that under conditions of protein synthesis inhibition, further initiation is of course blocked and consequently the rate of DNA synthesis falls even in the absence of irradiation. Therefore, in order to carry out this experiment the technique of continuous labelling to measure accumulation of DNA was required. E.coli strain 15T“ was chosen for this purpose since many previous studies (e.g. Kogoma and Lark, 1975) have established the pattern of residual synthesis of DNA following inhibition of protein synthesis in this E.coli strain. Accordingly, an exponentially growing culture of strain E.coli 15T“ at 37° was labelled for several generations with l^c-thymine to ensure uniform labelling of the chromosome and therefore subsequent steady state conditions. As shown in Fig. 3*6 labelled DNA of strain E.coli 15T“ accumulated in parallel with mass increase prior to irradiation, the culture was then exposed to 10 Jm“^ UV and divided into two parts. To one part rifamyicin (260 pg/ml), to block further initiation and protein synthesis was added and the second part kept as a control. Both cultures were sampled for a further 3 h. As shown in Fig. 3*5 accumulation of DNA -61 - Fig. 3«5 The effect of UV and rifamycin upon the accumulation of DNA in E. coli 15T~ An exponentially growing culture of E. coli 1 5T“ in M9-minimal medium supplemented with 2 yg/ml thymine at 37° was labelled for several generations with I^Q-thymine. The culture was UV-irradiated with 10 JmT^ then split in two parts. To one part rifamycin (260 yg/ml) was added and the second part kept as control. DNA accumulation during the experiment was measured by mixing 1 ml of culture with 2 ml of 10% TCA. TCA precipitable [I^C] count were taken as a measure of amount of DNA accumulated mass increase was also monitored. Ai|5o : Q----- a; UV : [I^C] o------o; UV + rifamycin [I^C] # #. 0.6 0.4 450 0.2 0.1 8 6 CO I o 4 UV X E D. 2 O 1 0 30 60 90 Time after UV (min) in the control was completely inhibited for 20-25 min before recovering to that of an unirradiated culture. In contrast, in the presence of rifampicin DNA synthesis did not resume. Similar results were observed when this experiment was repeated with chloramphenicol (150 yg/ml) as an inhibitor of protein synthesis instead of rifamycin (data not shown). These results confirmed the previous finding that DNA synthesis was still inhibited by UV even when the induction of SOS functions was prevented. However, the data also indicated that RNA and/or protein synthesis is required for recovery of DNA synthesis. 3.5 Discussion The bulk of the evidence presented in this Chapter clearly indicates that the inhibition of DNA following UV is not due to the induction of an SOS inhibitor. Therefore we conclude that under these conditions functional recA and lexA genes are not required for inhibition of DNA synthesis by UV. The data are thus more consistant with the hypothesis that DNA lesions such as dimers, resulting from UV, are directly responsible for inhibition of polymerisation at blocked forks. Nevertheless, DNA synthesis subsequently resumes and this can apparently take place from existing replication forks (Rupp and Howard Flanders, 1968. Richard and Lark, 1964, B. Weinhardt B.Sc. thesis, 1982). It has also been suggested that replication occurs from the origin (Billen, 1969, Doudney, 1973), following irradiation. However, there is no evidence that replication from the origin occurs prematurely (i.e. at a lower initiation mass than normal under these conditions). The results obtained with the recA44l mutant indicated that active DNA replication complexes (or new initiations) are transiently inhibited at high temperature. Since this effect is transient in -62- contrast to expression of other SOS functions at 42° in this mutant it seems unlikely that this result reflects the synthesis of a DNA synthesis inhibitor under recA control. In fact the recA protein in the recA44l mutant has been shown (Phiziky and Roberts, 1981) to bind more tightly to single-stranded DNA. Thus at 42° the induction of high levels of this modified RecA protein (protease) might be sufficient to disrupt DNA replication by for example competing with single-stranded binding proteins in the vicinity of the replication fork. The initial result with the lexA(ts) mutant also indicated transient inhibition of DNA synthesis upon shift to 42° but this was finally shown to be a property of the wild-type parent strain when shifted to 42° rather than specific to lexA(ts). Thus, introduction of the lexA(ts) mutation into AB1157 (wild-type) resulted in no inhibition of DNA synthesis at 42°, although lexA(ts) dependent filamentation was clearly observed. This result is therefore in agreement with the result of Mount (1973) and Gudas (1976) which indicated that DNA synthesis was not inhibited at 42° in lexA(ts) mutants. - 63" Chapter 4 Mechanism of the recovery of DNA synthesis in UV-irradiated bacteria Introduction Several groups (e.g. Smith, 1969; Doudney, 1972) reported previously that protein synthesis was required for recovery of DNA synthesis following UV-irradiation in E. coli. This was attributed to new initiations from the chromosomal origin (Billen, 1969; Doudney, 1973) and its possible connection with the SOS response was not examined. The role of other phenomena, stable replication (Kogoma et ^ . . 1979) previously shown to be SOS inducible functions in the recovery of DNA synthesis following UV-irradiation will be discussed in Chapter 6. However, in this chapter attempts were made to identify any relationship between the SOS response and the ability of cells to recover DNA synthesis. 4.1 Effect of a split UV dose on recovery of DNA synthesis after UV-irradiation Previous data in Chapter 3 showed that inhibition of DNA synthesis following UV-irradiation is not under recA-lexA control. However, results from experiments with E. coli 15T" (Fig. 3.5) also indicated that protein synthesis is required for recovery of DNA synthesis after UV. In view of these previous results a split dose experiment was then carried out to investigate the mechanism of the recovery phase in response to UV damage and whether this requirement for protein synthesis could be met by prior induction of the SOS response. An exponentially growing culture of E. coli 15T" labelled for six generations with I^C-thymine was UV-irradiated with 5 Jm“^. The -64- culture was reincubated and 30 min later received a second UV dose (5 Jm"2), Then to half of the culture, rifamycin (260 yg/ml) was added (Fig. 4.1a). Accumulation of DNA before and after treatments was measured as described in Methods (Chapter 2). The same experiment was repeated with in this case half of the culture receiving a second UV dose plus rifamycin whilst the other half received rifamycin only (Fig. 4.1b). The results of the two experiments clearly indicated that inhibition of DNA synthesis was still observed following the second UV-irradiation in the presence of rifamycin. However, these cells resumed DNA synthesis following the second dose of UV-irradiation despite the inhibition of protein synthesis. This resumption of DNA synthesis apparently represented the completion of one round of DNA replication as in the control (Fig. 4.f6) with rifamycin alone. Similar results were observed on repeating the same experiment in the presence of chloramphenicol (150 yg/ml) an inhibitor of protein synthesis as shown in Fig. 4.2. 4.2 Recovery of DNA synthesis following UV-irradiation in E. coli K12 The previous accumulation experiments were carried out using the E. coli 15T" strain. As a further test the pattern of inhibition and recovery of DNA synthesis after UV-irradiation was examined in the E. coli K12 strain, AB1157. In order to carry out DNA labelling experiments with strain AB1157 which is thyA+ a thymine requiring derivative was constructed by growing AB1157 in the presence of trimethoprin (Materials and Method). An exponentially growing culture of the AB1157 thy" strain was then labelled for several generations with I^C-thymine. The culture was irradiated with 10 Jm"2 and half of the culture also received rifamycin (260 yg/ml). Accumulation of DNA was measured before and after UV-irradiation. The result (Fig. 4.3) showed the same pattern as with E. coli 15T". DNA synthesis was inhibited initially for 20 min -65“ Fig. 4.1a Effect of a split UV dose and rifamycin on the accumulation of DNA in an E. coli 15T~ strain An exponentially growing culture of E. coli 15T" in M9 minimal medium was continuously labelled with I^C-thymine. Following UV-irradiation (5 Jm“^) the culture was reincubated for 30 min then received a second UV dose (5 Jm”^). After the second dose, to half of the culture rifamycin (260 yg/ml) was added immediately. UV [l^C] : o------o; UV + rif [1^C] : #------# Fig. 4.1b The same strain and conditions as above but in this case half of the culture received a second UV dose plus rifamycin, whilst the other half received rifamycin only. Rifamycin added at 30 min [1^0] : o------o; irradiated and rifamycin added at 30 min : [1^0] e------e. UV 40 20 UV UV uv+rif : C4 ■o X E a u I % ^ 4 0 UV UV UV+ rif 0 30 60 90 120 Time after UV(min) Fig. 4.2 Effect of a split UV dose and chloramphenicol on the accumulation of DNA in an E.coli 15T~ strain A steady state culture of 15T" labelled with ^^C-thymidine for several operations was first established. The culture was then irradiated (5 Jm“^), 30 min later chloramphenicol (150 yg/ml) was added and half of the culture was irradiated again (5 Jm~^. CAM ^ A.; CAM + UV — ['’^c]:a b . •--- • 14 — 3 [ cl- c p m X 10 o o o o ' <71 ro 4^ 0) 00 < - 5 L—J N o o o > Cn Fig. 4.3 The recovery of DNA synthesis following UV-irradiation in the presence or absence of protein synthesis in a wild-type strain (AB1157 thy-) An exponentially growing culture of AB1157, thy" in M9 minimal medium supplemented with 2 mg/ml thymine was labelled with I^C-thymine for several generations, and then irradiated with 10 Jm"2 uV dose. Half of the culture also received rifamycin (260 yg/ml). Accumulation of DNA was measured before and after UV-irradiation. Mass increase was also monitored. Ah5o : o------o; [1^0] CPM (untreated)A------A.; [^^C] CPM + rifamycin : n B. 0.9 0.5 UV 450 « uv + rif 0.1 X 0.7 UV 0.5 0.4 0.3 O 20 4 0 6 0 80 100 Time after UV (min.) after UV-irradiation, but then DNA synthesis resumed to a level similar to that of the UV-irradiated control. Ori the other hand DNA synthesis was completely blocked in the presence of rifamycin. The data obtained from these experiments demonstrated that a protein or proteins synthesised in response to the initial damage was required for recovery. In addition, the experiments with E. coli 15T“ indicated that this requirement could be met by a primary UV dose, allowing recovery to take place following the second dose of irradiation. Moreover, the data with a split dose treatment (Figs. 4.1 and 4.2), also indicated that (in the absence of protein synthesis inhibitors) the period of inhibition after the second dose of UV was now much reduced. 4.3 Effect of a split dose on the rate of DNA synthesis in E. coli K12 (AB1157) The results from experiments described above (Figs. 4.1 and 4.2) indicated that DNA synthesis was more resistant to UV following a second dose. This was reinvestigated by the more sensitive technique of measuring the rate of DNA synthesis by pulse labelling with 3u-thymidine. An exponentially growing culture of AB1157 was irradiated with 5 Jm"^, reincubated and 30 min after a second dose (5 Jm"^) of UV was given. The rate of DNA synthesis was measured as described in Materials and Methods. As shown in (Fig. 4.4), the rate of DNA synthesis was still reduced by UV in cells which had previously been irradiated. This experiment also demonstrated however that the period and extent of inhibition after the second dose was significantly less than that after the first dose. This result confirmed the accumulation data above.I* the above results were confirmed by repeating the experiment twice. -66- Fig. 4.4 Effect of a second UV-dose on the rate of DNA synthesis in E. coli K12 (AB1157) An exponentially growing culture of AB1157 was irradiated with 5 Jm-2 UV and after 30 min incubation a second UV dose of 5 Jm“2 was given. TCA precipitable [3h ] counts were taken as a measure of the amount of DNA synthesis during the 2 min pulse. Mass increase was also monitored. Ai|5o a a ; ^H-CPM : o------o. Broken line represent the rate of DNA synthesis recovery following the first UV dose (5 Jm~2). 0.6 0.4 A 4 5 , 20 0.2 10 0.1 8 UV 6 UV 4 % 2 E a ü 1 co 0.8 0.6 0 3060 90 Time after UV (min) 4.4 The recovery of DNA synthesis following UV irradiation in mutants defective in DNA repair or other SOS functions In attempts to elucidate the nature of the proteins involved in post irradiation recovery, the rate of DNA synthesis in a variety of mutants isogenic with AB1157 and defective in one of the major repair pathways or other SOS functions was analysed. Excision repair is one of the major pathways involved in repair of UV-induced pyrimidine dimers (see Chapter 1). Thus in order to test the role of this repair process in recovery an exponentially growing culture of the mutant, AB1886, uvrA, which is defective in excision repair, was split into two parts and irradiated with 2.5 5 Jm~^ respectively. The rate of DNA synthesis was then determined by pulse labelling with ^H-thymidine. The results (Fig. 4.5) showed that the recovery of DNA synthesis was inhibited even at the low UV-dose, which agrees with the UV-sensitivity of such strains (Howard-Flanders et ^ . , 1964). The result also clearly implicated the continued presence of unexcised pyrimidine dimers (the main product upon UV-damage)in inhibiting recovery of stalled replication forks. Nevertheless, the cells irradiated with 2.5 Jm“^ were eventually able to recover to the full control rate indicating the blocked forks were eventually able to resume replication despite the presence of dimers. Similar experiments were carried out with a recB mutant (AB2470) using the same protocol as above. The result (Fig. 4.6) showed that the pattern of recovery of DNA synthesis in this mutant was virtually the same as that wild-type strain AB1157 (see Fig. 3.1). This result indicated that the recB,C was not essential for recovery. Other experiments were then designed to investigate the pattern of recovery of DNA synthesis in a double mutant which is defective in both the recB,C -67“ Fig. 4.5 The recovery of DNA synthesis following UV-irradiation in an excision repair mutant (uvrA) An exponentially growing culture of E. coli AB1886 (uvrA) was split in two parts and irradiated with 2.5 5 JmT^ respectively. The rate of DNA synthesis was determined by pulse labelling with [^H]-thymidine. Cell mass was also measured. M 50 • with 2.5 Jm“^ A ▲; with 5 Jm“^ q a Dashed line represent A450 2.5 Jm”^ and 5 Jm“^. 0-2 0.1 O X E UV a ü I T-l 0.1 0.05 8040 1 2 0 Time (min.) Fig. 4.6 The pattern of DNA synthesis following UV-irradiation in&recB mutant An exponentially growing culture of E. coli (AB2470) was split into two parts and irradiated with 2.5 5 Jm“^ respectively. The rate of DNA synthesis was monitored by pulse labelling with [^H]-thymidine. Ai|5o : #------9; [^H] with 2.5 Jm“^ [3h] with 5 Jm-2 : a g*. 0.5 450 02 0.1 0.5 UV O X E Q. Ü I I 0 1 0 30 60 90 Tim e after UV ( min.) recombination and the uvrA,B,C excision repair pathways. Two separate low doses of UV (1,2 and 2.5 Jm”^) were used in this experiment as it was anticipated that this strain SC41 (isogenic with AB1157) was very UV sensitive. Pulse labelling with ^H-thymidine was used as before and the rate of DNA synthesis was measured over a 115 min period. The result (Fig. 4.7) indicated greatly reduced recovery of DNA synthesis with a dose of 1.2 Jm"2, whilst a dose of 2.5 Jm“^ virtually abolished recovery. This result demonstrated that in absence of both the major repair pathways DNA synthesis recovery was significantly inhibited even at low doses. It is noteworthy that the strain selected for this purpose at the time these experiments were carried out did in fact also carry mutations, tif (recA) and spr (lexA) rendering the SOS system constitutive. Despite this, recovery was still poor further implicating the continual presence of pyrimidine dimers as efficient blocks to replication fork movement in the absence of repair processes. 4.5 Recovery of DNA synthesis in a umuC mutant Villani ^ (1978) proposed that replication forks halt at a dimer, and then eventually proceed by trans-lesion, error prone synthesis facilitated by an SOS inducible function. In view of this hypothesis, we therefore determined the recovery of DNA synthesis in a umuG mutant. The umuC mutation largely abolishes UV-induced mutagenesis in E. coli (Kato and Shinoura, 1977; Walker and Dobson, 1979). The umuC product is therefore a good candidate for an SOS inducible protein which promotes trans lesion synthesis and is therefore essential for recovery of DNA synthesis and survival. An exponentially growing culture of strain GW21GO (umuCI22) isogenic with AB1157 was irradiated with a UV-dose of 10 Jm"2 and the rate of DNA synthesis was measured by pulse labelling with thymidine. The result (Fig. 4.8) showed that DNA synthesis occurred -68- Fig. 4.7 The recovery of DNA synthesis in an E_;__cp].i uvrA recB double mutant An exponentially growing culture of SC44 (uvrA, recB, tif, spr, sfiA) multiple mutant was split in two parts and received 1.2 JmT^, 2.5 Jm“2 respectively. The rate of DNA synthesis was monitored by pulse labelling with [3h ]-thymidine before and after UV treatment. Ah5o : #------e; ^H-CPM at 1.2 Jm"^^ A; 3h-CPM at 2.5 Jm~^m b. 0.5 0.3 450 0.2 0.5 - 0:15 o UV X E a o I X co 0.1 20 4060 80 100 120 Time (min.) Fig. 4.8 The recovery of DNA synthesis following UV-irradiation in a umuc mutant An exponentially growing culture of E. coli GW2100 (umuC) was exposed to 10 Jm“2 yy dose. The rate of DNA synthesis was measured by 2 min pulse labelling with [3H]-thymidine throughout the experiment. Ai|5o a— —a; CPM : o------o. 0.4 0.2 Oin < 0.08 UV CO oI X 0.8 E Q. Ü X CO 0.2 0 30 60 90 Time after UV (min) with a pattern virtually indistinguishable from that shown by the wild-type strain AB1157 (see Fig. 3.1). This result suggested that the umuC locus does not play a major role in the recovery of DNA synthesis suggesting that it is not in fact involved in the resumption of replication at the majority of blocked forks. 4.6 Discussion In this chapter attempts were made to investigate the nature of proteins involved in post UV-recovery of DNA synthesis. The data demonstrated that in a uvrA mutant, a recB mutant and in particular a recB, uvrA double mutant when compared to the wild-type all showed a reduced ability to recover DNA synthesizing capacity. This result clearly indicates that unrepairereplisomes is not associated with UV-mutagenesis. -69- Chapter 5 Further studies on the role of RecA protein in the recovery of DNA synthesis following UV-irradiation Introduction The data in the previous chapters have shown that protein synthesis and a recA regulatory function are required for recovery. This could indicate the need to induce high levels of RecA protein and no other requirement. On the other hand, data has also shown that mutations affecting some of the major repair or mutagenic pathways have only limited effects upon eventual recovery of replication capacity. 5.1 The recovery of DNA synthesis following UV in recA430 In order to gain more insight into the role(s) of RecA protein during post UV recovery, experiments were conducted using strains carrying other recA alleles, in this case recA430 (formerly lexB30). This strain is partially defective in RecA UV-induced "protease" activity and is therefore UV-sensitive but is normal for recombination (Morand and Devoret, 1977, Glickman et ^ . , 1977). An exponentially growing culture of JM776 recA430 was irradiated with a UV-dose of 5 Jm“^. The rate of DNA synthesis was measured before and after UV-treatment by pulse labelling as before. The results (Fig. 5.1) showed that the rate of recovery of DNA synthesis was slower than in the wild-type under these conditions (Fig. 4.4). In fact, in this strain the rate of DNA synthesis was only 30% of that observed in the wild-type recA+ strains 30 min after irradiation. This result was consistent with an additional regulatory role for RecA normally leading to the synthesis of an SOS factor distinct from RecA itself. -70” Fig. 5.1 The effect of UV upon the rate of DNA synthesis in a mutant supposedly partially protease defective but recombination proficient An exponentially growing culture of JM776 (recA430) was pulse labelled with [^Hj-thymidine before and after UV-irradiation (5 Jm"^) TCA precipitable counts were taken as a measure of the amount of DNA synthesis during the 2 min pulse. Ai|5o o □; ^H-incorporation • ---- # . 10 0.5 Q.if 450 0-2 u V 0 .5 - 0.3 20 40 6 0 80 loo 120 140 Time (min) 5.2. The recovery of DNA synthesis following UV in recA#53 (zab51) In view of the previous results the rate of DNA synthesis following UV was measured in another mutant, recA453 (formerly zab-53) also defective in UV-induced protease activity. This mutant, which carries a down promoter mutation for recA is also reported to be deficient in recombination. An exponentially growing culture of GC776 (recA453) the mutant was exposed to 5 JmT^ of UV and the rate of DNA synthesis was measured in the usual way. The result (Fig. 5.2) showed quite clearly that the recovery of DNA synthesis was greatly reduced even compared to the recA430 mutant. This result is also consistant with the idea that in addition to the regulatory role of RecA in induction of DNA recovery, other properties of the molecule, its role in recombination and or induction of other functions under RecA control were also essential. On the other hand in this mutant if induced levels of RecA protein are low this might in itself be expected to limit recovery. 5.3 The recovery of DNA synthesis in a recA constitutive mutant The following experiment was conducted in order to determine whether high levels of RecA protein were sufficient for recovery of DNA replication, using a recA mutant constitutive for high levels of RecA in the absence of DNA damage (Thomas and Lloyd, 1980). The mutant strain (N1434) carrying recApc is distinct from AB1157 and therefore the mutant allele was transferred to AB1157 by PI-mediated transduction as described in Chapter 2. Thus, a sorbitol independent (srl+) derivative of LG20 (AB1157, recA", srl") was selected. Finally, the production of a high level of RecA in the recombinant strain LG373 was confirmed by SDS-PAGE (Fig. 5.3a). -71- Fig. 5.2 The effect of UV upon the rate of DNA synthesis in a mutant defective in protease activity and recombination An exponentially growing culture of strain GC776 (recA453) was split in two parts and received 2.5 Jm"2, 5 jm"2 respectively. The rate of DNA synnthesis was monitored by pulse labelling with [3h]-thymidine before and after UV-treatment. Ai|5o : # ------e; 2.5 Jm"2 [3h]a-----a; 5 Jm"2 [3h] ■---- ■ Recovery Of DNA Synthesis After UV-irradiation Zab 53-mutant ( Recomb-Rf'otease ) 450 UV CO -2 a: 2.5 J.m -2 □ ;5 J.m 0.05 0 20 40 60 80 100 120 Time (min.) Fig. 5.3a Levels of RecA protein in reoApC transductants Whole cell lysates of recAo*^-transduct ants of AB1157, were prepared and analysed on SDS/PAGE as in Chapter 2. The position of high levels of a protein with the mol. wt. expected of RecA, track 3 is indicated. S, molecular weight standards. Tracks 1 : spr mutant 2 : AB1157 3 : recAoC transductant 4 ; recA“ mutant (LG20) s 1 2 3 4 46 — — Rec A KD 25 - - A I- In order to determine the kinetics of inhibition and recovery of DNA synthesis in LG373 after UV-irradiation, an exponentially growing culture was divided into two parts and irradiated with a UV dose of 2.5 Jm“2 and 5 Jm”^ respectively. The data in Fig. 5.3b showed that the rate of DNA synthesis in this mutant was inhibited much less than in the wild-type, although full recovery was achieved in about the expected time. This result indicated that high levels of RecA protein do reduce the inhibitory action of UV on DNA synthesis and increase the efficiency of repair and hence the speed of recovery. Nevertheless, high levels of RecA did not completely abolish inhibition of DNA synthesis. 5.4 Requirement for RecA protein in the recovery of DNA synthesis In order to investigate more carefully the role of RecA per se in recovery, DNA synthesis was analysed following UV in a mutant carrying the recA200(ts) allele which renders the RecA protein inactive at 42^0 (Lloyd et al., 1974). An exponentially growing culture of a mutant strain (N1802) carrying the recA200 allele was pulse labelled with [^Hj-thymidine (1 lici/ml) at intervals before and after UV (2.5 Jm“2). The culture was then split into two parts and growth continued at 30°C and 42^0. Mass increase was monitored throughout the experiment. The results (Fig. 5.4a) clearly showed that RecA protein was required for recovery, since the shift to 42°C at the time of irradiation completely blocked recovery. The culture maintained at 30°C throughout recovered normally. Control experiments with the isogenic parent (AB1157) in contrast showed that a temperature shift immediately after irradiation did not affect the normal pattern of inhibition and recovery (data not shown). -72- Fig. 5.3b The effect of UV upon the rate of DNA synthesis in a recA constitutive mutant (LG373) An exponentially growing culture of LG373 was divided into two parts and irradiated with a UV dose of 2.5 Jm"^ and 5 Jm"^ respectively. 0.5 ml aliquots were pulse labelled with [3H]-thymidine before and after irradiation. TCA precipitable counts were taken as a measure of the amount of DNA synthesis during the 2 min pulse. ^450 •---- •; 2.5 Jm~2 [3^]^----4 ; 5 Jm“^ [^H]* a. 1 0 ^4 5C CO lO 1 0.1 E Q. O I 0.5 i CO 0.3 O 2 0 40 60 80 Time after UV (min.) Fig. 5.4a The effect of UV upon the rate of DNA synthesis in a recA temperature sensitive mutant (recA200) An exponentially growing culture of strain N1802 was pulse labelled with [3H]-thymidine at intervals before and after UV (2.5 Jm"2) The culture was split into two parts and growth continued at 30° and 42° Mass increased was also monitored. Fig. 5.4b Experimental details as above but the culture at 42° was shifted back to 30° after 30 min at 42°. Ai|5o : O O; [^H]-CPM at 30° : o------o; [3h ]-CPM at 42° #----- #. [ H] -CPm X !o^ P O O O r\D 4^ Œ) C D O Dû 4^ P œ 3 CD CD —H CDf-+- c < ? ro o o P o o .50 Another experiment using the same protocol was carried out with the culture of strain N1802 grown first at 42^0 then shifted back to 30°C after 30 min at high temperature. As shown in (Fig. 5.4b) under these conditions DNA synthesis rapidly recovered to the rate of an untreated control upon return to 30°. These results confirmed the absolute requirement for RecA protein for post-UV recovery. 5.5 Effect of a split dose upon DNA synthesis in the recA temperature sensitive mutant (recA200)ts The experiments with E.coli 15T“ (Chapter 4) indicated that protein synthesis was not required for recovery from a second dose of UV. Consequently, the following experiment was carried out in order to determine whether RecA protein is also still required for recovery after a second successive dose of UV. An exponentially growing culture of N1802 (recA200) grown at 30° was exposed to two UV doses (2.5 Jm“^ each) at 20 min intervals. After the second dose, half of the culture was shifted to 42°C and the rate of DNA synthesis was measured. The results shown in Fig. 5.5, include a control culture kept at 30° which also received a split dose. In the latter case DNA synthesis recovered normally whilst in the culture switched to 42° after the second dose, recovery was completely blocked. This result strongly implicated RecA protein itself in recovery in addition to its regulatory role in switching on the SOS response (after the first dose). In other words prior induction of SOS function is still not sufficient for recovery if RecA protein is itself inactive after the second dose. -73- Fig. 5.5 The effect of a split dose upon the rate of DNA synthesis in the recA temperature sensitive mutant (recA200) An exponentially growing culture of N1802 was exposed to two UV doses (2.5 Jm"^ each) at 20 min intervals. After the second dose half of the culture was shifted to 42°. 0.5 ml aliquots were pulse labelled for 2 min with [3h ]-thymidine at intervals throughout the experiment. Ai|5oa q; [3h]-CPM at 30° o o; [3h]-CPM at 42° # — #. 0.6 0.4 S 0.2 0.1 8 UV 6 4 00 oI UV 2 E Q. O 1 00 0.8 0.6 42 0.4 0 30 60 90 Time after UV (min) 5.6 Effect of inhibition of protein synthesis on the recovery of DNA synthesis in a recA constitutive mutant I also investigated the role of RecA per se in post UV recovery by the analysis of the kinetics of inhibition of protein synthesis during the recovery phase in a recA constitutive mutant (LG390). An exponentially growing culture of LG390 and its isogenic parent (AB1157, thyA) were labelled for six generations with ^^C-thymine and irradiated with 10 Jm“^. Further accumulation of DNA was measured in the presence or absence of rifamycin (260 yg/ml) to block protein synthesis. The same experiment was repeated using chloramphenicol (150 yg/ml) as the inhibitor of protein synthesis. The higher dose^of UV in this case was selected in order to obtain a clear inhibitory effect in these accumulating experiments. The results (Fig. 5.6, 5.6b) showed that in the wild-type strain after a single UV-dose the addition of rifampicin completely blocked recovery of DNA synthesis. However, in LG390 although inhibition of DNA synthesis was indistinguishable from that of the wild-type under these conditions, DNA synthesis in the presence of rifamycin, recovered more quickly as expected with the initial high levels of RecA protein. When protein synthesis was inhibited in the recA^c strain by rifamycin, DNA synthesis, although showing a low level of recovery amounting to a 10-20% increment after 9 0 min (reproduced in several experiments), did not recover to the maximal extent expected under these conditions (i.e. a 40% increment, see Fig. 4.1, Chapter 4). These results therefore indicated that although high levels of RecA protein reduce the overall level of inhibition of DNA synthesis by UV, an additional inducible factor appears to be required to promote full recovery. It is interesting to note that rather higher levels of recovery were detected in LG390 in the presence of chloramphenicol(data not shown) * -74- Fig. 5.6a DNA synthesis following UV and rifamycin treatment in recA constitutive mutant A steady state culture of LG390 (recAoC thy") in M9 minimal medium established by continuous labelling with [1^C]-thymine for several generations was UV-irradiated (10 Jm“2). After UV-irradiation 260 yg/ml rifamycin was added to half of the culture. 1 ml samples for acid precipitable counting were taken throughout the experiment. Ai|5o □ o ; [”'^C] CPM o------o; irradiated + rifamycin [^^C] CPM Straight line represent CAM + UV. Dashed line represent DNA synthesis (background) at the time of UV-irradiation. ' Fig. 5.6b Experimental detils as above but in this case strain AB1157 ^6^ used. A450CJ q; irradiated [I^C] CPM o— — o; irradiated + rifamycin [I^C] CPM #----- #. 0.6 0.4 UV UV 0.2 7 1 « UV + rif- o 0.8 H 0.6 o E in a Ü 0.6 O 0.4 UV UV 0.2 UV + rif - 0.1 0.8 0.6 0 3 0 6 0 9 0 Time after UV (min) However, interpretation of this result is complicated by the fact that CAM is a less effective inhibitor of initiation of chromosomal replication (Shen et £l., 1977; Lycett ^ , 1980) than rifampycin and moreover stimulates the synthesis of stable RNA (Shen ^ , 1977) which might affect initiation of DNA replication at abnormal sites. Consequently in most experiments rifamycin was the preferred inhibitor. Discussion In Chapter 4 data was presented indicating the absence of any requirement for protein synthesis for recovery of DNA synthesis after a second dose of irradiation. Experiments in this chapter clearly demonstrated that functional RecA is however still required for recovery in such a split dose experiment. This result indicates that induction of SOS functions is not sufficient for recovery if active RecA is not present throughout. Thus it should be emphasised (Fig. 5.5) that active RecA protein was still required for recovery after the second dose although under these conditions all protein synthesis requirements should have been met (Fig. 4.1a, Chapter 4). Consequently, RecA protein itself is apparently involved in the actual recovery mechanism. The contribution of an additional SOS function under recA control was not however ruled out by these findings. The results obtained with the recA constitutive mutant also suggested a RecA requirement for actual recovery. In contrast, these studies indicated that an additional, inducible function(s) under recA control is also required. Thus despite the high level of RecA present in the recAOc mutant (LG390) protein synthesis, perhaps for the induction of a specific protein, was still required for substantial recovery of DNA -75- synthesis. The results with the protease defective RecA mutants were also consistent with this interpretation. The requirement for RecA itself in the DNA recovery mechanism might also explain the production of high levels of RecA protein synthesised during the normal SOS response. In the light of these findings defining a role for RecA protein and an additional inducible function under recA control, a proposed model of events at the stalled replication fork will be described in the final Discussion. Finally, the very poor recovery observed in recA453 (zab-53) in comparison with both the wild-type and recA430 might imply that the recombinational role for RecA in repair is also an important limiting factor when induction of the SOS response is poor. However, it seems likely that in the normal response the coordination of full SOS induction and post-replication, recombinational repair are all required for maximum recovery. Nevertheless, the omission of individual repair systems independently may have a marginal effect on the efficiency of recovery as shown in Chapter 4. -76- Chapter 6 Analysis of the role of "stable" DNA replication in recovery of DNA synthesis after UV 6 .1 Introduction The analysis of the nature of the DNA recovery process (Chapters 4 and 5) has revealed that recovery is dependent upon an inducible SOS function under recA-lexA control. The data have further shown that RecA protei n is directly involved in recovery in addition to its regulatory function. On the basis of these results it was proposed that an inducible function is either necessary for active by-pass of stalled replication complexes or for a reinitiation event downstream of a dimer following by-pass by the replisome. Several authors have shown that so called "stable" replication (see Chapter 1) a form of replication which does not require protein synthesis for maintenance, is an inducible SOS function (iSdr) in E. coli. Furthermore, mutants defective in lexA and recA (constitutive for SOS functions) are capable of displaying Sdr without induction. On the other hand through the isolation of sdrA (rnh) mutants, which are constitutive for "stable" replication (Kogoma et al., 1978) the RNaseH (rnh gene product) (Ogawa et ^ . , 1984) has been implicated as an ai important factor for normal initiation of DNA replication^oriC (Lindhal and Lindhal, 1984). Finally, consistent with this view rnh mutants were shown to initiate DNA replication independently of dnaA from several sites distinct from oriC (De Massy et ^ . , 1985). Also consistent with the above findings is the possibility that induction of "stable" DNA replication, e.g. through modulation of RNaseH activity, might play a -77- crucial role in the recovery process through reinitiation events at abnormal sites created by UV-lesions. Consequently, we decided to analyse the inhibition and recovery of DNA synthesis in strains in which "stable" replication has been induced or in strains which are defective in RNaseH activity. 6.2 UV-sensitivity of constitutive "stable" replication (cSdr) It has been reported that "stable" DNA replication is more resistant to UV-irradiation (Kogoma et al., 1979). In order to test this a kinetic analysis of the effect of UV-irradiation on DNA synthesis in an sdrA mutant (constitutive for stable DNA replication) was carried out. An exponentially growing culture of strain (AQ699), was incubated in the presence of chloramphenicol (150 pg/ml) for 3 h at 37°. Half of the culture was then exposed to UV-irradiation (10 Jm“2) and the rate of DNA synthesis was measured by pulse labelling, (2 min) at intervals with [3n]-thymidine before and after irradiation. The results obtained (Fig. 6.1) showed that DNA synthesis was clearly inhibited by UV. On the other hand no sign of recovery was observed for nearly 2 h post UV. This result demonstrated that constitutive stable DNA replication is inherently UV-sensitive and that specific inducing conditions prior to chloramphenicol treatment might be essential in order to promote recovery of DNA synthesis. However, the slow decline of DNA synthesis in control apparently due to long term affect of chloramphenicol which result in DNA degradation. 6.3 The recovry of DNA synthesis following UV-irradiation in an isdr strain For the purpose of this experiment an E. coli 15T- strain was used since Sdr is relatively poorly inducible in E.coli K12 at low - 78 - Fig. 6.1 The effect of UV upon the rate of DNA synthesis in a mutant constitutive for stable replication An exponentially growing culture of SC699 (sdrA) was incubated in the presence of chloramphenicol (150 yg/ml). Half of the culture was irradiated (10 Jm"2)^ and the rate of DNA synthesis was measured by pulse labelling (2 min) at intervals with [3n]-thymidine throughout the experiment. Non-irradiated [3h]A— — irradiated [3h ]o a. 6 UV 4 3 E Q. O I I— I 2 30 60 90 Time after UV (min.) UV-doses such as those employed in this study (data not shown; T. Kogoma personal communication). An exponentially growing culture of E. coli 15T~ was incubated for 50 min in the absence of thymine and then incuabted for 3 h in the presence of chloramphenicol plus cold thymine. Thus the only form of DNA replication taking place should be iSDR. The culture was then split and one part was UV-irradiated (10 Jm"2). The rate of DNA synthesis was monitored by pulse labelling with [^Hl-thymine for 2 min. The result in Fig. 6.2 showed that DNA synthesis was in fact clearly inhibited by UV-irradiation to a relative degree similar to that of a wild-type strain. However, DNA synthesis then recovered (despite the continued inhibition of protein synthesis) to a rate close to that of the unirradiated control. This result clearly demonstrated that all the factors required for recovery had been induced and were stable over the 4 h pre-irradiation period. 6.4 Recovery of DNA synthesis following UV-irradiation of an rnh. recA^c double mutant Previous data has shown that the RecA protein is required for recovery of DNA synthesis. Moreover, partial recovery was observed in a mutant producing a high constitutive level of RecA protein even when induction of other SOS functions was blocked (Chapter 4 and 5). Therefore in order to analyse the importance of a reduced level of RNaseH in the recovery of DNA synthesis a double mutant carrying rnh", recA°^ was used. The effect of UV on DNA synthesis was then measured under conditions where induction of the SOS functions was blocked by rifamycin. An exponential growing culture of strain SCI 43 was divided into two parts. One part was treated with rifamycin (260 ug/ml), the other part received a 10 Jm~^ UV-dose plus rifamycin. p^jA synthesis was measured by pulse labelling with ^^C-thymine before and -79- Fig. 6.2 The effect of UV upon the rate of DNA synthesis in a strain displaying iSDR An exponentially growing culture of E. coli 15T“ was incubated for 50 min in the absence of thymine followed by 3h in the presence of chloramphenicol (150 yg/ml) plus 10 yg/ml thymine. Half of the culture was exposed to a 10 Jm"2 uv dose. The rate of DNA synthesis was monitored by pulse labelling with [3n]-thymidine for 2 min. Non-irradiated [3h]A A; irradiated [3h]BI Q. 4 3 CO ' o X E Q. ü 2 I I CO 30 60 90 120 Time after UV(min.) Fig. 6.3 The effect of rifamycin on the rate of DNA synthesis following UV-irradiation of an rnh. recAo^ double mutant A steady state culture of SCI 43 (rnh", recAo^) in M9 minimal medium was first established by continuous labelling with [I^C]- thymidine for several generations as described in Chapter 2. Following UV-irradiation (10 Jm"^) the culture was divided into two parts, one part was treated with rifamycin (260 pg/ml), the second part left as control. 1 ml samples for acid precipitable counting were taken throughout the experiment. Irradiated t rifcwi^cin CC 3 a m > rifamycin [^^C]n--- □ 10 uv Q- 0.5 0.2 20 40 60 80 100 120 Time after UV ( min.) after UV treatment. The results, Figure 6.3, first of all showed only a relatively brief period (10-15 min) of transient inhibition of DNA synthesis following UV-irradiation. Strikingly, DNA synthesis then resumed and continued for -éu/o hours. On the other hand in the portion of the culture which was treated with rifamycin only (as control), DNA synthesis terminated after an approximately 50% increase in DNA as further initiation from the origin is blocked. These results demonstrated that high levels of RecA protein and reduced RnaseH activity are sufficient for recovery of DNA synthesis following UV-irradiation even though induction of the SOS functions are blocked. As shown in Chapter 5 and Fig. 6.1 overproduction of RecA protein alone, or absence of RNaseH alone do not allow recovery. This experiment also appeared to show that irradiation of an rnh", recA^c double mutant, presumably leading to "activation" of RecA protein also renders initiation of new rounds of chromosomal replication independent of protein synthesis and resistant to rifamycin. That is, a new form of "stable" replication is present which is not only capable of replication of initially damaged templates but whose maintenance, unlike the previously described iSdr, is not dependent upon RNA polymerase (see Table 6.1). 6.5 Discussion The data in Chapter 5 are consistent with an inducible dimer by-pass mechanism which is required for recovery of DNA synthesis following UV-irradiation. This may involve for example an RNA priming event beyond the dimer. The data in Chapter 5 indicated that such a priming event is rifamycin resistant and therefore does not involve RNA polymerase. One possible means of promoting reinitiation of DNA replication at stalled replisomes is through some form of stable -80- replication. The role of stable DNA replication in recovery of DNA synthesis following UV-irradiation was therefore analysed. The results showed clearly that in a strain displaying cSDR (i.e. a strain lacking RNaseH) DNA synthesis was sensitive to UV and recovery did not take place. On the other hand SDR induced by irradiation of a wild-type strain although initially blocked by UV then recovered. This supported the previous report (Kogoma et al., 1979) that iSDR is by this definition "resistant" to UV. The recovery of a strain displaying iSDR must however take account of the fact that treatments which induce iSDR also induce other 80S functions. Thus when SDR is induced all other inducible proteins required for recovery are present including a high level of RecA protein (see also Discussion, Chapter 10). Other studies have suggested that RNaseH is involved in processing or eliminating potential RNA primers in the oriC region in undisturbed cultures (Kogoma and Von Meyenburg, 1983; Horiuchi et ^ . , 1983; Lindhal and Lindhal, 1984; Ogawa et al., 1984; Kogoma et ^ . , 1985). We have investigated the possibility in this laboratory that removal or inhibition of RNaseH might then facilitate reinitiation from abnormal sites such as UV-lesions. However, neither increasing nor reducing the level of RNaseH through increased copy number or mutation of rnh respectively has any detectable effect upon the kinetics of recovery of DNA synthesis following UV-irradiation of otherwise wild-type strains (Serge Casaregola, personal communication). Modulation of RNaseH activity alone is not sufficient to facilitate the reactivation of stalled replication forks. We have also investigated the role of RNaseH in the recovery of DNA synthesis in a strain lacking rnh and constitutive for RecA protein synthesis. This experiment was also conducted to demonstrate whether protein synthesis (see Khidhir et ^ . , 1985, and Chapter 5) was still required for recovery of DNA synthesis under these -8l - conditions. The results, Fig. 6.3, show that in the absence of RNaseH and in the presence of high levels of RecA protein recovery of DNA synthesis no longer required protein synthesis or RNA synthesis (dependent upon RNA polymerase). This result in fact mimics exactly the results of split dose experiments following a second UV-dose in the presence of rifamycin (see Chapter 5). In view of the results mentioned previously I have summarized the properties of the different kinds of stable replication (Table 6.1). Finally, the results obtained (this chapter) together with the modulation of RNaseH activity will be discussed in details with the proposed model for dimer by-pass mechanism (in Chapter 10). -82- Table 6.1 The properties of the different form of "stable" DNA replication in response to UV-irradiation or rifamycin treatment Treatment cSDR iSDR rnh” , recA°o rifamycin Sensitive Sensitive Resistant UV-irradiation Sensitive Resistant Resistant Note: Sensitive and resistant in this context indicates ability to recover DNA synthesis following U.V. Chapter 7 In vitro mutagenesis Introduction A variety of vitro and vivo studies have led several authors to propose that altered DNA polymerases or a modified replication complex able to replicate past lesions in DNA with reduced fidelity, could be responsible for error-prone DNA synthesis (Villani et , 1978; Lackey et , 1982). Accordingly, studies in our laboratory have included the establishment of an vitro system for E. coli in order to examine the nature of DNA replication on damaged (plasmid) templates and if possible to detect any factors induced during the SOS response which might be involved in modification of the replication complex. The objective of this vitro work has involved three specific areas; (1) The establishment of an in vitro system in which plasmid (ColEI) molecules are replicated (see Staudenbauer, 1974, 1976). (2) To determine whether DNA synthesis using irradiated templates can be stimulated or restored completely by the use of cell extracts derived from bacteria undergoing the SOS response. (3) Attempts to use the vitro replication system as a tool to analyse the process of mutagenesis vitro under certain conditions. The latter will be the subject of this chapter, however, as a necessary introduction some of the results relating to the other areas will be described briefly. -8 3- 7.1 The in vitro replication system Bacterial plasmids serve as model systems for studying the regulation of DNA replication (Kolter and Helinski, 1979). Elucidation of the molecular mechanisms involved in plasmid DNA synthesis have required the development of efficient cell free, replication systems. Thus Sakakibara and Tomizawa (1974a) and Staudenbauer (1976) have developed an vitro system for replication of the double-stranded DNA plasmid ColEI. As with the bacterial chromosome the initiation of replication of ColEI both vivo and vitro is blocked by rifampicin presumably reflecting a role for RNA polymerase. Unusually, maintenance of the ColEI plasmid in E. coli shows a unique dependence on the function of DNA polymerase I (Tomizawa, 1978; Staudenbour, 1976) and vitro studies have shown that the first stage in elongation requires poll with DNA polymerase III required for later stages (Tomizawa, 1978). Other factors involved in replication are similar to those required for replication of the bacterial chromosome. 7.2 UV-sensitivity of DNA replication in vitro Several attempts have been made to replicate UV-irradiated DNA in vitro, although most such studies have been limited to single-stranded DNA phages (Caillet-Faquet et , 1977; Villani et ^ . , 1978; Straus et ^ . , 1978). In this laboratory we have preferred to use double-stranded DNA (e.g. ColEI) for such studies developed by Dr S. Casaregola since plasmid replication should show more similarities with chromosomal replication. Thus purified ColEI DNA was incubated with a cell free bacterial extract (prepared as described in Chapter 2), this reaction requires all four dNTPs and rNTPs plus an energy generating system (see Materials and Methods) the results of a typical experiment are shown in Fig. 7.1 in -84- Fig. 7.1 replication of plasmid ColEI incubated with different cell-free bacterial extracts Plasmid ColEI DNA was incubated with cell-free extracts prepared from a wild-type strain AB1157, or AB1886 (uvrA), dNTP, rNTP, or energy generating system, and [3H]-thymidine triphosphate were added to a total volume of 25 pi. TCA precipitable counts were taken as a measure of the amount of DNA synthesised during 60 min incubation at 30°. AB1157, No UV ;û A ; AB1157, + UV A; AB1886, No UV :q q ; AB1886, + UV : a a 100 80 o E a 60 •D o 4-«(ü t - O Q. O 40 cO 20 20 40 60 80 Time (min.) which UV-irradiated ColEI containing an.average of 15-20 dimers per molecule, was incubated with a cell free extract from wild-type cells (AB1157) DNA synthesis was only reduced about 2-fold when compared with a normal (non-irradiated) template. However, when an extract from uvrA cells (deficient in excision repair) was used, synthesis was reduced to about 30% of that obtained with the non-irradiated template (Fig. 7.1). On the other hand DNA replication on the irradiated DNA was further reduced by the use of a uvrA, recB strain (deficient in both excision repair and post replication repair) as a source of the iji vitro extract. Under these conditions, as first shown by S. Casaregola the residual synthesis on the UV-irradiated template was only 20% of that on the normal template (Fig. 7.1). These results confirmed that dimers (or other bulky lesions) can effectively block DNA replication vitro. However, the results indicated that both excision repair and post replication repair occur in vitro at a significant level in wild-type extracts. Nevertheless, as shown in Chapter 4 DNA synthesis vivo can eventually recover in such mutants. Finally, analysis of the labelled products from these experiments on alkaline CsCl gradients demonstrated that in the absence of UV the product was mostly supercoiled whilst on UV-irradiated templates the product was largely open circular or fragments of ColEI, which might be blocked at some point in the replication cycle. 7.3 Replication of plasmid DNA in extracts from SOS induced cells In order to determine whether an SOS function can promote DNA replication on irradiated templates, extracts from a strain which had been irradiated or treated with mitomycin C to induce the SOS response were analysed in this laboratory by Serge Casaregola. Using the system -85- described above attempts were made to stimulate DNA replication of irradiated ColEI (or an oriC plasmid) by the addition of such ’SOS* extracts. Some stimulation of DNA synthesis was obtained but the results were not reproducible. Similarly, significant stimulation of DNA replication on irradiated templates could not be obtained using extracts prepared from strain SC41 (uvrA, recB, recA44l, sfiA, spr55) expressing SOS functions constitutively. Consequently, in view of these results it was not possible to use the iji vitro system to analyse any factors involved in error-prone replication leading to mutagenesis on UV-irradiated plasmid DNA. Since, however, untargetted mutagenesis has also been identified as an SOS function distinct from error prone repair of lesions involving umuD,C (Lannoye and Maenhaut-Michel, 1986), it was decided to attempt to identify factors involved in this process vitro using non-irradiated DNA. This approach and the development of different assay systems to measure iji vitro mutagenesis will be described in the following sections. 7.4 Development of systems for in vitro mutagenesis In order to use the vitro replication system as a tool to detect mutations good selective markers were required. Two different selections were adopted for this purpose, mutations in the l a d gene to loss of function and reversion mutations in cat or tet. i) Selection based on the E. coli Lac system For this selective system plasmid pMC7 (a derivative of ColEI) was chosen (Fig. 7.2). This plasmid carries the l a d gene which encodes the repressor of the lac operon. This gene has been extensively studied in -86“ Fig. 7.2 Restriction endonuclease sites and functional map of plasmid pMC7 The position of the tetracycline, ampicilin resistance genes are shown together with the region required for plasmid replication. HP : Hpal H : HacII P : psti E : EcoRII p PMC7 8.3 kb la d H respect to UV and other mutagens (Coulondre and Miller, 1977; Miller ^ al., 1978). The plasmid pMC7 carries a mutation in the promoter region of the l a d gene (laclQ which increases the production of l a d repressor molecules (Caillet-Fauquet, 1978). Upon introduction of this plasmid (about 60 copies/cell) into a strain carrying the lac operon (Lac+-phenotype) but deleted for the l a d gene (i.e. expressing constitutively the lacZYA genes), the transcription of the lac operon is completely blocked rendering the cells Lac". This is illustrated in the cartoon shown in Fig. 7.3. The selective strategy was therefore based upon the fact that the introduction of plasmid pMC7 carrying a mutation, for example, in the l a d structural gene would permit a partial or total derepression of the resident lac genes, allowing growth on lactose. Consequently, the plasmid pMC7 would be replicated vitro using extracts from SOS induced bacteria, followed by extraction of the replicated DNA and finally transformation of strain SC60 (lacZYA* l a d ") and identification of transformants which remain Lac+ (blue). ii) Selection based on the reversion of mutations in tet or cam anti biotic resistance genes This selection was based on the antibiotic resistance genes of plasmid pBR325. A tetracycline sensitive or chloramphenicol sensitive, derivative of pBR325 was first obtained by mutagenizing the normal pBR325 (tet^, capR) in vitro with hydroxylamine as described in Materials and Methods. Then by replicating vitro the mutated plasmid together with the SOS extract from strain SC4l it was hoped to increase the frequency of back mutations. These would be detected by subsequent transformation with DNA recovered from the vitro system. This latter approach will be described in Chapter 9. -87- 7.5 Optimization of the procedure for the detection of mutated plasmids i) Transformation In order to increase the probability of detecting mutations in plasmids replicated vitro a highly efficient transformation system is essential. Thus in order to establish conditions for optimum transformation efficiencies several experiments were carried out with a range of concentrations of highly purified DNA (see Methods section 2.10b). The results obtained using the rhubidium chloride procedure (Kushner, 1978) which is reported to give very high levels of transformation in E. coli are shown in Table 7.1. With strain JMX as the recipient strain the highest frequencies were obtained with an initial DNA concentration of 0.1 to 0.2 pg/ml. On the other hand the calcium chloride and the Hanahan (1983) methods showed no significant increase in transformation over this range. Maximum transformation frequencies of 6.3 X 105 were obtained with these methods. Strain JMX carries lacZYA and lacks l a d , however, although this strain overall gave high transformation frequencies the growth rate is slow and the strain proved difficult to subculture and handle generally. Consequently, it was necessary to construct an alternative E. coli strain carrying lacZYA'*'. Strain CSH26 (a fast growing strain with a generation time of 20 min in rich medium) known to give efficient transformation was selected for this purpose. Strain CSH26 is deleted for lac and the protocol adopted for transferring lacZYA prsent in JMX on an feSO prophage, is described in Appendix II. Strain SC62 was therefore constructed and high constitutive levels of g-galactosidase confirmed. This strain was then in turn optimized for transformation with a range of DNA concentrations using two different Table 7.1 Transformation efficiency of strain JMX Different DNA concentrations of plasmid pMC7 were used to transform strain JMX using the rhubidium chloride method (see Materials and Methods). Transformants were selected on NA + Tet plates. Table 7.1 DNA concentration No. of transformants/yg DNA yg/ml 0.05 3.2 X 105 0.1 6.1 X 105 0.2 6.3 X 105 0.4 5.1 X 105 0.6 3.21 X 105 0.8 2.1 X 105 transformation procedures, the rhubidium chloride and Hanahan methods. The latter has the advantage of being able to freeze the competent cells and store at -80° for several months, allowing highly reproducible transformation conditions. The results in Fig. 7.4 show that the highest frequencies (7 x 10^/yg DNA) were obtained with 0.06 yg/ml DNA using the modified Hanahan method as described in Chapter 2. The calcium chloride method was also tried but this produced lower frequencies of transformation. The Hanahan method was therefore adopted for all subsequent experiments. ii) Isolation of replicated DNA for transformation Efficient transformation requires DNA free of proteins. At the same time a relatively simple procedure for rapid extraction of replicated DNA was required. A variety of procedures were therefore carried out to establish the minimal number of steps in the purification procedure consistant with efficient transformation. In order to remove associated proteins the replicated DNA was treated with pronase (1 yg/ml) or proteinase K (1 yg/ml) and incubated at 370, ij^o or 60° for 30 min. After a subsequent single phenol extraction and ethanol precipitation the DNA was analysed by electrophoresis in agarose. As shown in Fig. 7.5a, 7.5b after pronase treatment at 45°C a higher proportion of DNA (particularly open circular) was recovered compared with other treatments. In fact, with proteinase K very little DNA, in particular, supercoiled DNA was recovered. Nevertheless, as shown in Fig. 7.5b the extraction procedure with pronase followed by phenol extraction results in recovery of only about 10$ of the input DNA. Alternative treatments including elimination of the phenol step led to better recovery but transformation were reduced by frequencies, 15-300-fold (as shown in Chapter 8). As a result of -89- Fig. 7.4 Transformation efficiency of plasmid pMC7 using SC62 as recipient strain Different concentrations of highly purified plasmid DNA were transformed into strain SC62 (recipient), using the Rubidium chloride and Hanahan method. Transformants were selected on Luria agar plates supplemented with 10 yg/ml) tetracycline (10 yg/ml).a q Hanahan method; Rbcl method: a A • 8 o O) 6 tf) *-»c (0 E c(0 (Ü 4 O Ô 2 10 0.03 0.06 0.09 0.12 o.i5 o.l8 DNA Concetration (/jg/ml) Fig. 7.5a Proteinase K treatment of in vitro replicated pMC7 plasmid DNA The vitro replicated plasmid was treated with proteinase K (1 yg/ml) final concentration, then incubated at 37°, 45° or 60° for 30 min. This was followed by a single phenol extraction and ethanol precipitation. C Untreated (Hp) DNA. 1 Replicated Mp-DNA at 37°. 2 Replicated Mp-DNA at 45°. 3 Replicated Hp-DNA at 60°. OC Open circular DNA. SC Super coiled DNA. 1 -oc -SC Fig. 7.5b Pronase treatment of in vitro replicated pMC7 plasmid DNA Experiment conditions as above, but pronase was used. C : Untreated (Hp) DNA. 1 : Replicated Mp-DNA at 37°. 2 : Replicated Mp-DNA at 45°. 3 : Replicated Mp-DNA at 60°. OC : Open circular DNA. SC ; Super coiled DNA. oc sc these experiments the protocol adopted involved pronase treatment and extraction of plasmid DNA with a single phenol treatment, ethanol precipitation. This DNA termed minimally purified (MP) DNA in contrast with the highly purified (HP) DNA which used as control as in Fig. 7.5. Discussion The first aim in the work described in this chapter was to establish the optimal conditions for a highly efficient replication system in vitro, based on the system described by Staudenbauer (1976). It has been shown in this laboratory (S. Caseregola, personal communication) that the double-stranded DNA plasmid, ColEl, when UV-irradiated and incubated with cell-free extracts from wild-type cells was able to direct DNA synthesis almost as efficiently as a normal template. However, when an extract from uvrA cells (deficient in excision repair) was used, synthesis was reduced to about 30% of that obtained with non-irradiated templates. These results confirmed that unrepaired bulky lesions can effectively block DNA replication jji vitro. Moreover, the results showed that the excision repair system of E. coli which is governed by the uvr genes is very efficient in this vitro system. On the other hand the amount of DNA synthesis directed by the irradiated template was further reduced by the use of extracts from a uvrA recB strain (deficient in both excision repair and post replication repair). Unfortunately it was not possible reproducibly to restore replication with UV-irradiated templates using extracts from cells in which the SOS system was activated. Consequently, it was not possible to adopt this sytem for the analysis of targetted mutagenesis vitro. As an alternative approach it was decided to attempt to establish conditions for the analysis of SOS dependent (i.e. as in recA44l) untargetted mutagenesis in vitro using non-irradiated templates. -90- As a first step it was essential to optimise several procedures for the recovery of replicated DNA and tests for mutagenesis. Thus, during this chapter conditions for efficient transformation and a routine simple procedure for extracting DNA, involving pronase treatment, single phenol extraction and ethanol precipitation following replication in vitro were established. The system selected was the laclQ gene since the mutants are easy to detect. Results of this experiment will be discussed in the next chapter. -91- Chapter 8 8.1 In vivo mutagenesis of strain SC4l in the presence or absence of pKMIOI Before attempting to measure mutagenesis vitro, it was necessary to demonstrate the presence of high levels of mutagenesis in vivo in a strain to be used as the source of extract of vitro replication. For this purpose strain SC4l (uvrA, recB, spr, recA44l, sfiA) was selected. In order to acheive enhanced levels of mutagenesis the effect of the presence of the plasmid pKMIOI (Walker, 1977) carrying muc genes which encode proteins involved in mutagenesis, was also analysed. Overnight cultures of SC4l , SC4l (pKMIOI) and AB1157 all of which are his" grown in minimal medium with histidine at 37° were diluted to an A^^g = 0.2. Several dilutions were plated on M9 minimal medium supplemented with 'all the required amino acids except histidine (as described in Chapter 2). Revertants which grew on this selective medium at 37° were scored and the frequency of mutation calculated. The results in Table 8.1 showed that with the SC4l strain a 26-fold increase above the background (wild-type) was obtained at 42°. On the other hand the presence of plasmid pKMIOI led to a further 4-fold increase in the frequency of revertants. These results are consistant with similar experiments carried out previously by Mount (1977) and Walker (1977). These results indicated therefore that SOS extracts prepared from Sc4l or SC4l (pKMIOI) should be a suitable source of an SOS extract capable of promoting mutation vitro. 8.2 Attempts to mutagenise a plasmid pMC7 carrying laclQ in vitro With optimal conditions for successful vitro replication, extraction of the product DNA and efficient transformation established. -92- Table 8.1 Expression of SOS-mutagenesis in vivo Approximately 2 x 10? cells of each strain grown in M9-minimal plus adenine (75 yg/ml) medium at 37° were spread on M9-minimal medium plates plus a trace of histidine and incubated for 48 hr at 37°. Plates scored for viable cells were obtained by spreading samples on M9 plates containing histidine. Table 8.1 Expression of SOS-mutagenesis in vitro Strains His+ colonies/10& viable cells SC41 368 SC41, pKMIOI 1440 AB1157 14 Fig. 8.1 Gel analysis of plasmid DNA replication in vitro - using extracts Plasmid pMC7 DNA was replicated in the presence of cell-free extracts prepared from three different strains AB1157, SC4l and SC4l, pKMIOI. The replicated mixtures were treated with pronase (1 yg/ml) at 45° for 30 min, then followed by phenol extraction and ethanol precipitation. Samples of the extracted DNA (MP) were dried under vacuum and analysed on an agarose gel (0.8%). Usually equivalent amount (0.6 yg/ml) of DNA (MP) to that originally replicated (as in control) were loaded (see Materials and Methods). C Control (pMC7) highly purified (HP) DNA OC Open circular DNA L Linear DNA see Supercoiled DNA R Replicated MP-DNA NR Non-replicated, MP-DNA (/) o > 73 0 ) 00 n -A S U ü l c R NR R NR R NR OC L Scc mutagenesis experiments with pMC7 were attempted. This plasmid which carries laclQ was therefore replicated in a cell-free extract prepared from E. coli SC4l which is constitutive for SOS functions (Mount, 1977). As shown above this strain vivo produces high levels of spontaneous untargetted mutations. The plasmid DNA was replicated for 60 min in the iri vitro extract as described previously (Chapter 7). As non-replicating control a duplicate sample was incubated for only 5 min under which conditions only extremely low levels of DNA synthesis are detected (Table 8.2). The same experiemnt was also conducted using an extract from a wild-type strain (AB1157) for comparison. All the samples were then treated with pronase for 30 min at 45° to remove excess protein and this minimally purified (MP) DNA prepared as described above. The recovered DNA was also analysed by agarose gel electrophoresis and compared with an identical amount of highly purified (HP) plasmid DNA initially added to the replication extracts. As shown in Fig. 8.1 and as indicated above the recovered MP-DNA gives a reduced yield and a greater proportion of open circular and linear DNA with variable levels of material remaining in the agarose slot at the top of the gel in different experiments. The DNA recovered from the jji vitro replication extract was resuspended in TE buffer and used for transformation of SC62 carrying lacZYA. Transformants were selected on M9 minimal medium supplemented with lactose as the only carbon source plus 10 yg/ml tetracycline. The transformants were purified using the same selective media and then additionally screened on X-gal plates plus tetracycline for blue colonies to indicate the Lac+ phenotype. Fig. 8.2 indicates that transformants of this kind showing typical blue colonies on X-gal plates as compared with SC62 carrying pMC7 (laclq+^^ were indeed obtained. -93“ Table 8.2 ^ v itro mutagenesis by replicating plasmid pMC7 in vitro, in the presence of SOS-induced extracts A. Plasmid pMC7 was replicated jji vitro for various times with cell-free extracts prepared from strains SC41, SC4l, pKMIOI and AB1157. Transformants using minimally purified (MP) DNA from replication mixtures were selected on M9~minimal medium plates with lactose (as carbon source) plus tetracycline (10 yg/ml) or on Tet alone. TCA precipitable counts were taken as a measure of the amount of DNA synthesis in vitro. B. The same experiment condition as above, but only extracts fr om SC41 and AB1157 were used. Table 8.2 A. Selection Treatment Incorporation Lac+ Tet trans- Tet transformants (cpm) formants/yg Hp- 1 yg replicated DNA MP-DNA SC41 85100 2.5 X 103 1l4 X 10^ (60 min) SC41 1630 1.7 X 103 1.1 X 10^ (5 min) SC41, pKMIOl 82220 5.5 X 103 2.96 X 10^ (60 min) SC41, pKMIOl 1450 1.85 X 103 1.5 X 10% (5 min) ABU 57 35020 4.8 X 102 8.6 X 103 (60 min) ABU 57 1280 3.8 X 102 4.38 X 103 (5 min) Control HP-DNA None 3.4 X 10^ non-treated Table 8.2 continued B. Selection Treatment Incorporation Lac'*’ tet trans- Tet transformants (cpm) formants/yg HP - 1 yg replicated DNA MP-DNA SC41 105311 3.5 X 103 2.8 X 105 (60 min) SC41 2818 2.9 X 103 1.8 X 105 (5 min) ABU 57 39630 4.2 X 102 6 X 103 (60 min) ABU 57 1365 3.6 X 102 5 X 103 (5 min) Control HP-DNA none 4.8 X 10^ non-treated Fig. 8.2 Lac'*', tet^ transformants on X-gal plates Transformants (l a c '*', tet^) were purified on X-gal plates plus tetracycline (10 yg/ml), and compared to a known lac+ strain (SC62, pBR322) and a lac" strain (yellow colonies). The lac" strain is SC62 harbouring the normal untreated pMC7 (laclQ+). Lac Lac The results in Table 8.2 showed that as expected transforming DNA which had been partially purified after incubation with replication extracts gave a reduced transformation efficiency, about 100-300-fold less as compared with untreated (HP) DNA. In particular, very poor transformation frequencies were sometimes obtained from extracts prepared from the wild-type strain AB1157, indicating the presence of inhibitors in such extracts. Nevertheless, high levels of l a d mutants were apparently obtained compared to the untreated plasmid DNA. When the frequency of Lac+ transformants (as a proportion of total Tet^ transformants) was measured it was however quite clear that there is no significant difference when replicated and non-replicated DNA are compared or whether SC41 and SC41 + pKMIOI or wild-type extracts are compared. Moreover, in all cases the actual level of Lac+ transformants was surprisingly high, 14% and 1.4% in two experiments respectively. The results therefore suggested that Lac'*’ colonies were being selected in some way by a mechanism independently of Jji vitro mutagenesis. The properties of some Lac+ transformants were therefore analysed in more detail as described in the next section. 8.3 Determination of the level of g-galactosidase in the lac'*' transformants In view of the surprisingly high rate of "mutation" of the l a d gene amongst tet^ transformants described above it was deemed necessary to characterize the nature of the Lac+ phenotype in these bacteria in more detail. As the first step the level of g-galactosidase activity in the transformants was measured in comparison with the initial Lac'*' host strain (SC62) as control. Overnight cultures of the relevant strains (in the absence of any inducer of the lac operon) were diluted to an A450 of 0.2 and the level of g-galactosidase measured as described in Chapter “94- 2. Two controls were used, SC62, lac+ (Lac+-phenotype) and SC62 carrying the untreated pMC7 (Lac“-phenotype), In the latter strain laclQ is of course present. The results, Table 8.3, show that the level of g-galactosidase in the tet^ transformants carrying putative laclQ" mutations in pMC7 lies between 200 and 500 units. On the other hand the control represented by SC62 carrying the untreated plasmid gave only one unit. However, the level of g-galactosidase in the control strain SC62, Lac+, was 8000 units, presumably the derepressed, constitutive level of expression of the lacZYA genes in the complete absence of l a d . Thus the relatively low or intermediate level of g-galactosidase in the putative lacl~ transformants was not apparently due to a simple mutation to inactivate the repressor gene. Consequently, further experiments were required in order to elucidate the nature of the Lac+ phenotype. 8.4 Is the Lac+ phenotype of strains isolated in 8.2 above due to a mutation in the pMC7 plasmid or in the bacterial chromosome? Plasmid DNA was prepared from 15 of the Lac+, tet^ transformants of SC62 using the mini-plasmid preparation procedure (Birmboin _et al., 1977). The presence and size of the expected plasmid was first confirmed by agarose gel electrophoresis and the plasmid DMAs then used to transform the initial host SC62, lacZYA+ selecting for Tet^. Surprisingly, none of these transformants formed blue colonies on X-gal plates indicating that the incoming plasmid was still carrying the laclQ gene. This was confirmed directly by measuring 3-galacto- sidase activity in these transformants. Table 8.4. The results showed a dramatic fall in the level of g-galactosidase similar to that observed when SC62 lacZYA carries the non-treated pMC7 plasmid. Therefore the results clearly suggested that the "mutation" leading to the intermediate -95- Table 8.3 Levels of g-galactosidase in Lao+. tet^ transformants The " lac'*', tet^ transformants obtained after treatment of pMC7 DNA in cell-free extracts were purified and levels of g-galactosidase determined. * units of g-galactosidase are defined as the amount of enzyme which produces 1 mp-mole/ml 0-nitrophenol/min at 28°, pH7.0. (See Chapter 2). Table 8.3 Levels of 3-galactosidase in "Lac+" tet^ transformants Strains P-galactosidase "Lac"'’", tet^ p-galactosidase activity transformants activity (units) SC62, lacZYA+ 8000 "Lac'*'", tet^ 285 transformant no - 14 SC62, pHCY ill "Lac'*'", tet^ 372 (Lao") transformant no - 16 "Lac+",tetR 217 "Lac'*'" ,tet^ 311 transformant transformant no - 2 no - 19 "Lac+",tetR 500 "Lac'*'", tet^ 372 transformant transformant no - 3 no - 20 "Lac+",tetR 357 "Lac'*'", tet^ 462 transformant transformant no - 6 no - 22 "Lac'^", tet^ 482 "Lac'*'", tet^ 244 transformant transformant no - 9 no - 26 "Lao+",tetR 367 "Lac'*'" ,tetR 300 transformant transformant no - 11 no - 35 "Lac+",tetR 321 "Lac'*'", tet^ 41 0 transformant transformant no - 13 no - 40 Table 8.4 g-galactosidase levels in SC62 clones transformed with pMC7 DNA from "lac'*'", tet^ transformants Plasmid DNA prepared from several "lac"*'", tet^ transformants were transformed into SC62 (CSH26, l a c ZYA'*'). The level of g-galactosidase was determined. Units of g-galactosidase are defined as the amount of enzyme which produces 1 mp-mole/ml o-nitrophenol/min at 28°, pH7.0. * No change in colour after 24 h incubation, i.e. no detect able g-galactosidase activity. Other details as in Table 8.3. Table 8.4 g-galactosidase levels in SC60 clones tranformed with pMC7 DNA from "Lac'*'"tet^ transformants Strains P-galactosidase "Lac'*'", tetR ^galactosidase activity transformants activity (units) SC62, lacZYA+ 7840 Lac'*', tet^ * (Lac-*-) transformant no - 14 SC62, pMC7 1.05 Lac'*', tet^ 1.03 (Lac") transformant no - 16 "Lac'*"", tet^ 1.01 Lac'*', tet^ * transformant transformant no - 2 no - 19 "Lac'*’" , tet^ * Lac'*', tet^ * transformant transformant no - 3 no - 20 "Lac'*'", tetR * Lac'*', tet^ * transformant transformant no - 6 no - 22 "Lac'*'", tet^ * Lac'*', tet^ * transformant transformant no - 9 no - 26 "Lac+",tetR * Lac'*', tet^ * transformant transformant no - 11 no - 35 "Lac+",tetR * Lac+,tetR * transformant transformant no - 13 no - 40 level in the original expression tet^ Lac+ transformants might be present in the chromosomal lac operon rather than due to mutations acquired during vitro replication of pMC7. 8.5 Curing of plasmid pMC7 from tet^. Lac'*' transformants of CSH26 In order to investigate more precisely whether the mutation leading to Lac'*' was on the plasmid or on the bacterial chromosome as suggested by the previous experiment, attempts were made to cure some of the original transformants of plasmid pMC7. Several of these initial tranformants were therefore grown in nutrient broth overnight without antibiotics and re-subcultured in nutrient broth from three consecutive days. The cultures were then diluted and plated on NA plates with and without tetracycline. Tetracycline sensitive clones were identified, purified and then tested for g-galactosidase activity. Table 8.5. In addition, these apparently cured strains were re-transformed independently with both normal (HP-DNA) untreated pMC7 DNA and the pMC7 DNA isolated from the tet^ pseudo Lac'*' transformants. These new transformants selected on tetracycline plates were then tested for levels of g-galactosidase activity. Full details of all these various procedures to characterise the nature of the "mutant" Lac'*' phenotype are illustrated in the cartoon shown in Fig. 8.3. The results (Table 8.5) showed quite clearly that the cured "Lac'*'" strains now displayed high levels of g-galactosidase activity (7000-8000 units), typical of normal fully derepressed strains lacking the pMC7 plasmid. However, much more significantly both untreated (i.e. incubated in vitro replication extracts) pMC7 plasmid DNA or pMC7 DNA extracted from the initial "Lac'*'" tet^ transformants when used to re-transform the cured strains, the resulting transformants again showed the same intermediate level (200-500) of g-galactosidase activity (Table -96- Fig. 8.3 Schematic diagram summarizing the step of in vitro mutagenesis and the characterization of the "Lac'*'", tet^ transformants Figures in brackets indicate g-galactosidase units of activity. PMC 7 ( tet,R TQ+ ) / \ invitro mutag . + 1 ran sform. t ransformation SC62 (lac ZYA^) SC62 ( lac ZYA*) C 8000 units ) \ Transformants (“Lac*”,tet** ) Transformants (Lac", tet ) ( 2o o - 5"oo) ( 1 - 15 units ) cured derivatives V SC62 (tet ) (~"8000 units ) / \ Re— transformation with PMC7 PMC 7 / ** +" \ ( untreated ) ( from Lac tet Strain ) V Transformants Transformants 8000 units) (-U8000 units ) Table 8.5 Levels of g-galactosidase in "lac+", tet^ transformants after curing of the pMCY plasmid Several "lac"*'", tet^ transformants were curred of their plasmids by subsequent culturing in nutrient broth without antibiotics (tetracycline). Clones were screened on nutrient agar plates ± tetracycline. Tet^ colonies were purified and the level of g-galacto- sidase was determined. Table 8.5 Levels of B-galactosidase in Lac+ tet^ transformants after curing of the pMC7 plasmid Strain g-galactosidase Strain g-galactosidase activity activity (units) ( units ) SC62 (lacZYA-*-) 7500 SC62-19 5920 "Lac+" SC62 - 3 6593 SC62-20 5792 SC52 - 6 6250 SC62-22 6920 SC62 - 9 6766 SC62-26 5883 SC62 - 11 5840 SC62-35 5595 SC62 - 16 3 2 0 5 SC62-40 5772 8.6) as the original isolates. Taken together all these results clearly demonstrate that the mutations leading to "lac'*’" tet^ transformants were not due to laclQ on pMC7 but were located somewhere on the bacterial chromosome. Discussion Several experiments were carried out in which pMC7 was replicated in SOS active extracts obtained from strain SC41 (uvrA, recB, recA44l, spr-55. sfiA) and "Lac'*'" transformants of a lacZYA* recipient obtained. However, the frequency of "mutations" obtained was not significantly increased compared to that obtained with extracts from a wild-type strain not expressing SOS functions. Moreover, the frequency of "mutations" was not dependent upon plasmid replication in the cell-free extracts. Finally, the very high frequency (up to 14%) of "Lac'*'" transformants relative to total tet^ clones led to questions about the actual origin of the "mutations". Indeed, analysis of several of these transformants ("Lac'*'", tet^) demonstrated an unusual, intermediate level of g-galactosidase (200-500 units), rather than the high (8000 units) levels expected of fully constitutive clones. More importantly, curing of the pMC7 plasmid present in these clones followed by re-transformation with the same or with normal pMC7 DNA obtained from "non-mutant" transformants demonstrated quite unequivocally that the mutations leading to the initial Lac* tet^ transformants were not indeed due to lacl^ changes in the incoming, vitro replicated pMC7. Rather these Lac* phenotypes were due to mutations in the bacterial chromosome arising during transformation of the SC62 recipient and selection on lactose plates. This is a most surprising result since this class of mutant to -97- Table 8.6 Level of g-galactosidase in SC62 clones (cured) subsequent to transformation with replicated or non-replicated pMC7 plasmid DNA Several SC62 strains (originally "lac*", tet^) were cured and then re-transformed with either normal pMC7 (column 2) or pMC7 extracted from the "lac*", tetR initial transformants (column 3). Transformants were selected on nutrient agar plates plus tetracycline (10 yg/ml), and the level of g-galactosidase was determined. Table 8.6 Strain ^-galactosidase activity p-galactosidase activity of lac*,tetR of lac*,tet^ transformants transformants with normal pMC7 with normal pMC7 SC62,pMC7-2 370 280 SC62,pMC7-3 321 262 SC62,pMC7-6 315 231 SC62,pMC7-9 354 267 SC62,pMC7-11 285 218 SC62,pMC7-13 296 223 SC62,pMC7-l4 282 209 SC62,pMC7-l6 317 252 * = As a control SC62 (lacZYA* lacl") showed the usual high level of g-galactosidase activity "Lac*" was not detected when strain SC62 was transformed with highly purified pMC7 DNA obtained directly from bacteria carrying this plasmid. Preliminary genetic studies have indicated that the "Lac*" mutation is closely linked to the lac operon (data not shown) and this together with the properties of the mutants, (low level expression in the presence of laclQ*) indicates possible operator mutations. It is hoped to confirm this interpretation by DNA sequence analysis of the lac region. The basis of the selection pressure leading to appearance of the putative operator mutations amongst SC62 derivatives transformed with MP pMC7 remains a mystery. The frequency of these mutations nevertheless rendered the system impracticable for the detection of Jji vitro induced mutations in pMC7 at least without rigorous purification of DNA from replication mixtures. Consequently, an alternative system was investigated and this is descriebd in the next chapter. -98- Chapter 9 In vitro mutagenesis : Analysis of reversion to tetracyline resistance 9.1 Introduction In order to analyse mutagenesis jjri vivo several studies have used the approach of measuring the reversion frequency (back mutation) of a selectable marker, either independence of an amino acid requirement or resistance to antibiotics. Accordingly, in this study attempts were made to demonstrate vitro mutagenesis in SOS extracts by measuring the frequency of reversion of a tetracycline resistance gene carried by the plasmid pBR325 (Fig. 9.1). 9.2 Production of antibiotic sensitive derivatives of plasmid pBR325 in vitro For the purpose of this study plasmid pBR325 was chosen since this carries both tet^ and cam^ genes (Fig. 9.1). In order to indentify antibiotic sensitive clones, plasmid DNA was incubated with different concentrations of hydroxylamine for 30 min as described in Chapter 2. This plasmid DNA was then used to transform strain CSH26, with selection on plates containing chloramphenicol (25 yg/ml). 300-400 CAM^ transformants were then tested for their sensitivity to tetracycline. By this procedure 10 tet^ strains were identified. Restriction enzyme digests of mini plasmid preparations were then used to confirm that the plasmid carried by these tet^ clones was as far as could be detected intact, i.e. not carrying large deletions. Moreover, plating these strains on tetracycline led to the appearance of Tet^ colonies at a -99“ Fig. 9.1 Restriction and functional map of plasmid vector pBR325 The position of the tetracycline, ampicillin and chloramphenicol resistance genes are shown together with the region required for plasmid replication. H - Hindlll E - EcoRI B - BamHI on frequency of 5 x 10“^. These results suggested that point mutations in tet had been obtained and one derivative, designated pLGTOOl , was taken for further study. 9.3 Attempts to mutagenise plasmid pLGTOOl (tetS. cam^ in vitro) The plasmid pLGTOOl (carrying tet^, cam^) was replicated vitro in cell free extracts prepared from strain SC41, SC4l (pKMIOI) or AB1157 as described in the previous Chapter. The DNA was extracted from replication extracts as before and used to transform CSH26 with selection on two different NA plates, one supplemented with tetracycline and the other with chloramphenicol. The results presented in Fig. 9.2 showed that at least 10% of the DNA was recovered plus at least (some DNA apparently left in the slot) as compared with the original amount of input DNA represented by the untreated pLGTOOl (control). In addition, the results (Table 9.1) showed at least a 50-fold increase in the frequency of back mutation when the SC41 extract (constitutive for SOS functions) was used, as compared with the spontaneous rate of reversion showed by the untreated plasmid (control). Moreover, at least a 10-fold apparent increase in reversion frequency was obtained when the results from the SC41 extract were compared with the AB115T extract. However, the results showed no significant difference between replicated and non-replicated plasmid DNA re-extracted from the SCMl extract. Moreover, the presence of plasmid pKMIOI in strain SC^I prior to preparation of the extract did not lead to any additional increase in the rate of reversion of the tet gene after incubation with the extracts in vitro. -100- Fig. 9.2 %n vitro mutagenesis of plasmid pLGTOOl (tet^, cam^) Plasmid pLGTOOl DNA was replicated vitro with cell-free extracts prepared from strains SC4l (STS), SC41, pKMI01, and wild-type AB115T. The replication mixture was treated with pronase (1 yg/ml) (see text), then phenol extracted and ethanol precipitated. The resulting (MP) DNA was analysed on an agarose gel (0.8%). Equal volumes of DNA was loaded. CO : Control : highly purified (HP) untreated pLGTOOl plasmid DNA. A : Plasmid pLGTOOl replicated with SC41 extract for 5 min. B : Plasmid pLGTOOl replicated with SC41 extract for 60 min. C : Plasmid pLGTOOl replicated with SC41 , pKMIOI extract for D 60 min. E : Plasmid pLGTOOl replicated with SC41 , pKMIOI extract for 5 min. F : Plasmid pLGTOOl replicated with AB115T, pKMIOI extract for 50 min. G ; Plasmid pLGTOOl replicated with AB115T, pKMIOI extract for 5 min. 00 : Open circular DNA L : Linear DNA SCO : Supercoiled DNA CO A B c D E F OC Scc Table 9.1 In vitro mutagenesis of plasmid pLGTOOl (tet^. cam^) A : Plasmid pLGTOOl DNA was replicated ^ vitro with cell-free extracts prepared from strains SC41, pKMI01 and AB115T for 60 min at 30°. The replicated DNA after a short procedure of purific ation (MP DNA, see text) was used to transform strain CSH26 with equivalent amount of DNA. Transformants were selected on nutrient agar plates supplemented with tetracycline (10 yg/ml) or chloram phenicol (25 yg/ml). TCA precipitable counts were taken as a measure of the amount of DNA synthesis vitro during a period of 60 min. B : The same as above but extracts from strain SC41 were used. The second column shows the number of tet^ transformants/plate. The third column represents the frequency of tet^ tet^ revertants. CP LO o n o n o n o n o 1 1 1 1 1 1 1 O o o o o OO >1 ce a E sz 05 X X XX X X X CD ü 3 LO o n CM MO CM CM b - c r ce E L ce O El (p rH (Q en E ül sz \ 03 en Cb o o O LO O 00 00 P p LO o o CM c r \ MO ■=r P C LO LOLO • o 03 (U ce p 03 (U Q) H L -P o I o C 03 O c e x • a E I o m E o ro \ o LT> LO Lf\ LO b o o O o o o 00 r— I ( t E- < s P: c Q c P p E ü ü P P E 05 05 ü ü O OOPP p 03 05 MO LO PP P CD P P S X X sz P P P CD CD § i X X X (D O bO o oo C g-.S' •rH 0) p ■ = T CM > . P P ed ü I P E O P O P I—I en E lO C \ o cü tn O O O p p b- VP CM LT. lO “ § CM cep (D en " H 8 % l C eeJ P I C E a b LO LO LO en O O O o OT Ë p o C \ o ü ct3 en X X X PJ p p > , ex MO LO LO ü § c en eu 1 a o eu p p eu rC P p H T3 ü ü In view of results in the previous chapter (Chapter 8), an alternative approach to study untargetted mutagenesis vitro was devised. In this approach the frequency of back mutations (reversion) in an antibiotic resistance marker carried by the plasmid pBR325 (tet^, camR) was utilised. The new plasmid pLGTOOl (tet^ cam^) showed a low but significant spontaneous reversion frequency (5 x 10“5 - 1 x 10“^) which made it suitable for such a study. The results in Table 9.1 showed that with the SC4l extract (SOS extract), the frequency of back mutation was considerably increased over the background represented by the wild-type extract AB115T. Surprisingly however, the results again showed no significant difference between the treated plasmids whether or not extensive replication took place jji vitro prior to re-extraction. Conversely, it is interesting that incubation in the presence of the "SOSY extract led to an increased reversion frequency for the tet gene largely in the absence of replication. It is not easy to interpret these results in view of the complexity of such an vitro essay and the multistep re-extraction and transformation process. However, at face value it appears that the SOS extract does contain some form of mutagenic factor, perhaps associated with a repair process. -101 - Chapter 10 General discussion The bulk of evidence presented in this work clearly indicates that inhibition of DNA synthesis following UV-irradiation does not result from the induction of an SOS rec-lex dependent inhibitor. On the other hand the data (Chapter 4 and 5) demonstrated that protein synthesis and the rec-lex system were required for recovery of DNA synthesis following UV. Importantly, in split dose experiments although protein synthesis was not required in order for recovery to take place after the second dose, a functional RecA porotein was still required for recovery. These Results indicated that induction of the SOS response is not sufficient for recovery if RecA protein does not continue to be present. However, the contribution of an additional SOS function under recA control, required for normal recovery in addition to the amplification of RecA itself, was not ruled out in these experiments. On the other hand, the results obtained with the recA constitutive mutant demonstrated that high levels of RecA protein alone were not sufficient for recovery in the absence of protein synthesis. Indeed, other studies indicated that an additional, inducible function(s) under recA control is also required. 10.1 The role of stable DNA replication and other phenomena in the recovery of DNA synthesis following UV-irradiation Two other phenomena, stable DNA replication (Kogoma et ^ . , 1979) and long patch excision repair (Cooper, 1982) have previously been shown (see Introduction) to be SOS inducible functions. In addition, it has been proposed that both play a role in the recovery of DNA synthesis -102- following UV-irradiation. In the case of long patch repair the data however appear to support a role in post-replication gap filling rather than participation in the by-pass event itself. So called stable DNA replication, which is maintained in the absence of protein synthesis, has recently been shown to be DnaA and oriC independent (Kogoma and Von Meyenburg, 1983). Moreover, stable replication observed in an sdrA mutant appears to involve initiation of DNA replication from alternative origins (de Massy et al., 1985). Other studies suggest that RNaseH (the rnh gene product) is involved in processing or eliminating a potential RNA primer in the oriC region under normal conditions (Kogoma and Von Meyenburg, 1983; Horiuchi et ^ . , 1983; Lindhal and Lindhal, 1984; Ogawa et , 1984; Kogoma et ^ . , 1985). On the basis of these properties it is certainly possible to envisage that "stable replication" of some form may play a role in the "re-initiation" of DNA synthesis at stalled replisomes. Consequently, in this study I was concerned to determine whether this was the case. Thus on further analysis of this phenomenon it was shown that in a strain displaying cSDR (i.e. lacking RNaseH) DNA synthesis was still UV sensitive i.e. no recovery if protein synthesis was also blocked. In contrast, SDR induced by (UV) in a wild strain, although initially inhibited by UV, was followed by full recovery of DNA synthesis. These results indicated either a significant difference in the nature of stable replication in the two conditions (which may also be true) or more likely that stable replication per se is not sufficient for recovery and that other (inducible) SOS functions were required. The results with the recA constitutive mutant (Chapter 5) are consistent with an additional requirement for an inducible transdimer replication mechanism, which may involve reinitiation through RNA priming -103- for recovery of DNA synthesis following UV. In contrast, the results obtained with an rnh", recA^o double mutant (Fig. 6.3) indicated that under these conditions (the absence of RNaseH and in the presence of high levels of RecA protein) neither protein synthesis nor RNA synthesis were required for recovery of DNA synthesis. This result in fact exactly paralled the results of split dose experiments (Chapter 5). Whilst these data suggest that these conditions may indeed pertain in wild-type strains undergoing the SOS response we have not excluded that other factors in addition to lowering RNaseH levels may be equally important for recovery. 10.2 Model(s) for trans-dimer synthesis by-pass mechanisms Extensive evidence exists demonstrating that dimers in single stranded DNA do indeed block the E. coli polymerase vitro and vivo (see Chapter 1). However, in a more recent study Livneh (1986) showed that the extent of initiation of replication on the primed single-stranded DNA of ^X1?4 was not completely blocked by the presence of UV-induced lesions in the DNA. He noted that SSB protein stimulated the apparent by-pass mechanism since in its absence the fraction of full length DNA decreased 5-fold. In the case of chromosomal DNA synthesis in E. coli this is clearly initially drastically reduced by UV-irradiation in vivo. However, other studies (Rupp and Howard-Flanders, 1968; Pritchard and Lark, 1964; Khidhir et ^ . , 1985) have demonstrated that blocked replication complex DNA subsequently resume activity vivo apparently from pre-existing forks. Replication also restarts from the origin (Pritchard and Lark, 1964; Billen, 1969; Doudney, 1973), although presumably only as a result of new "initiation mass" achieved during growth following irradiation. Thus if we consider that dimers are the major blocking lesion we may consider three possible mechanisms for dimer -104- by-pass (Fig. 10.1) during the SOS facilitated recovery of DNA synthesis. Model A, when replication forks halt at a dimer, replication then resumes by proceeding past the dimer by 'error-prone* replication facilitated by an SOS inducible function as proposed originally by Villani et (1978). In model B, the replication fork halts briefly at dimers and then proceeds past the lesion without inserting any nucleotide in an uncoupled reaction actively promoted by an SOS inducible function until at some distance downstream polymerization is resumed. Model C, on the other hand suggests that normal replication forks operating on double-stranded DNA Jjn vivo may have the ability to translocate some distance past dimers without insertion of nucleotide, with a specific reinitiation event downstream of the lesion, in this case promoted by an SOS inducible function. Trans-dimer synthesis (model A) is inconsistent with the finding by Rupp and Howard-Flanders (1968) that post-replication gaps, opposite UV-lesions, do appear in newly synthesised DNA following UV-irradiation. In addition, DNA synthesis following UV recovers apparently normally in a umuD,C mutant (which probably lacks an error prone trans-dimer repair function), providing further evidence against model A. This result with a umuD,C mutant also supports the observation (Cooper, 1982) that error prone repair is not associated with a major function required for survival of UV-irradiated cells. Models B and C on the other hand are both consistent with the presence of post replication gaps and the data presented in this work that protein synthesis is required for reactivation of stalled replisomes. In the light of the new findings defining a role for RecA protfîn in DNA synthesis recovery and an additional inducible function under recA control and taking into consideration some aspects of stable DNA replication, a more detailed model of events at the stalled replication fork can now be proposed. -105- gf 0 I#03 '(/) C CL .5 a 0 lû cq JD 03 s z E E O) c o 0 o 0 > ü C ü C L_ en 0 0 _O 03 u . ^ ^ & > Q 0 c ■0 "O n > 0 0 L_ oL_ m 0 > Q. 0 o k_ i!t o o 0 ce S II !!Î C c O g +-» L- 0 0 C (fi (fi 0 0 0 L_ Q. 0 0 > > > '(fi (fi en k_ 0 (fi o 0 Q. Wk en 0 E en 0 CL y (fi 0 O 0 «9 0 # « < ■ O Q. > c CL CÛ 0 L_ _a < 4-» t . O 0 0 0 > > > ‘0 o 0 ü 0 < û- O LL C o 0 O « O ■q . 0 ÛC •0 0 "0 (/) Thus it is suggested that UV-irradiation leads to the induction of a replisome reactivation factor(s) (Irr) which is essential for recovery of DNA synthesis during the SOS response. The Irr factor might be required for uncoupling the replisome for dimer by-pass or for example, for the inhibition of RNaseH activity in order to facilitate novel priming reactions and therefore reinitiation of DNA synthesis downstream at new (secondary) sites. RecA protein on the other hand which was also shown to be directly involved in recovery, might act to promote the action of the Irr factor, for example, by binding to single stranded regions at stalled replisomes. It is also note worthy that a recombination mechanism to promote initiation of replication dependent on RecA or RecA-like proteins has been reported for T4 bacteriophage (Luder and Mosig, 1982; Dannenberg and Mosig, 1983). This requirement for recA protein in the recovery mechanism following UV might also explain the production of high levels of RecA synthesised during the SOS response. This was indeed shown with strain LG390 in which (constitutive) high levels of RecA are sufficient to allow a small amount of post-UV DNA synthesis for several hours in the presence of chloramphenicol (Chapter 5). Moreover, Quillardet et (1982) have shown that a mutant expressing high constitutive levels of RecA do in fact show significantly increased survival after UV. In addition, in split dose experiments with the recAOc mutant, the delay before resumption of DNA synthesis in the presence of rifamycin added at the time of the second irradiation is largely abolished((icdai^oishown)«Thus all the above data indicates that high levels of RecA protein are able to promote slow or inefficient recovery of DNA synthesis even in the absence of any additional Irr factors. “106- 10.3 In vitro mutagenesis During this part of my work in collaboration with Dr S. Casaregola we have established the optimal conditions for a highly efficient replication system in vitro (basically described by Staudenbauer, 1976). The results have shown that the excision repair system (uvrA,B,C genes) is very efficient in this vitro system. This study also confirmed that unrepaired bulky lesions can effectively block replication iui vitro. On the other hand in attempts to study untargetted mutagenesis vitro we established optimal conditions both for extraction of DNA (after being replicated vitro) and for efficient DNA transformation procedures. Using a test system to generate lacl~ mutants vitro it was surprising that all the "lac"*"", tet^ transformants obtained showed an unusual intermediate level of g-galactosidase (200-500 units) rather than high (8000 units) levels expected of fully constitutive clones. Further analysis demonstrated that the mutations leading to the initial lac+ , tetR transformants were not indeed due to l a d Q changes in the replicated pMC7, but to mutations in the bacterial chromosome which apparently arose during transformation of the recipient. The frequency of these mutations unfortunately rendered the system impractical for detection of mutations generated in l a d during hi vitro replication of the plasmid. Using the alternative approach of measuring the frequency of back mutations in antibiotic resistance markers in pBR325 increased frequencies of back mutation were obtained with the treated DNA (incubated in replication extracts) compared with that obtained with highly purified plasmid DNA which was not exposed to the vitro extract. More significantly treatment with the recA4l mediated ’SOS’ extract ^ vitro led to a substantially larger increase in reversion frequency for the tet gene. This increase was observed independently of -107- extensive replicaton and these results therefore suggest that the SOS extract does contain some form of mutagenic factor(s) which might be associated with specific repair event uncoupled from replication. 10.4 Involvement of RecA protein in SOS mutagenesis In addition to its role in recombination RecA protein is also capable of carrying out a very different reaction, specific to the recovery from DNA damage. Thus in the presence of products of DNA damage RecA either acting directly or indirectly as a protease cleaves specific repressors of transcription e.g. LexA allowing induction of a set of DNA repair functions (see Chapter 1 for details and references). However, it is now generally accepted that the ’activated’ form of RecA protein plays yet another role in the process of UV and chemical induced mutagenesis (Witkin and Kogoma, 1984; and for review Walker, 1984). This role for activated RecA protein (RecA*) could be to modify the fidelity of the replicative complex by acting either directly on DNA polymerase (Fersht and Knill-Jones, 1983), or other proteins of the replicative complex, or indirectly by modifying the structure of DNA. In fact it has been suggested that DNA polymerase III is involved in SOS mutagenesis (Bridges et al., 1976). However, at the present there is no direct evidence for its role in the fixation of either targetted (corresponding to a base change occurring at the site of DNA damage) or untargetted mutations (corresponding to mutations occurring on undamaged portions of the genome). Interestingly, however, two mutator mutations affecting the DNA polIII holoenzyme complex, polC74 (Sevastopoulos and Glaser, 1977) and MutD (dnaQ) Scheuermann et ^ . , 1983) were shown to increase untargeted mutagenesis of phage X (Maenhaut et ad., 1985). Moreover, the polC74 mutation also increased UV-induced mutagenesis of the bacterial chromosome (Maenhaut et al., 1985). These results suggested that DNA -108- polymerase III is involved in the process of UV-induced mutagenesis in E. coli. However, it also appears that the increase in error rate afforded by polC74 is not sufficient by itself to allow mutagenic trans-lesion synthesis (Brotcorne-Lannoye and Maenhaut, 1985). Finally, Brotcorne-Lannoye and Maenhaut (1985) also showed that polC74 appears to compensate partially for the requirement for RecA protein for UV-induced mutagenesis of phage X. In conclusion, it can be suggested that UV-induced mutagenesis, and perhaps more generally SOS-induced mutagenesis requires two distinct functions. The first function which is responsible for the mutation effect on undamaged portions of DNA could result from a RecA-dependent, transiently induced decrease in the fidelity of DNA polymerase III. This error prone function which has also been suggested to be responsible for the first step in mutagenic trans-lesion synthesis (Bridges and Woodgate, 1984) does not require the umuD,C function. The second function which depends on umuD,C gene products is required to allow mutagenic replication of damaged DNA, i.e. DNA strand elongation past a blocking lesion. It is note worthy at this point that a modified form of DNA polymerase I "called poll*" which replicates DNA with a lower fidelity in vitro has also been found in SOS-induced cells (Lackey et ^ . , 1982). Interestingly, this activity is found in recA", dinA, dinE, dinF and umuD,C cells that have been treated with an inducing agent like nalidixic acid (Lackey ejb ^ . , 1985). This polymerase, however, does not seen to play a major role in UV-mutagenesis, since pelA mutants exhibit normal UV-mutagenesis (Witkin, 1976; Lackey et ^ . , 1985). 10.5 The SOS system in relation to other stress responses When a culture of wild-type E. coli is shifted to high temperature (42-5QOo), the synthesis of a specific set of proteins, (at least 13) -109- is markedly enhanced (induced) (Yamamori et , 1978). Similar heat-shock induction of proteins has been observed in a variety of eucaryotic organism and seems to represent a general homeostatic or adaptive response to shift-up of temperature and other environmental forms of stress (see Schlesinger ^ fd., 1982). In E. coli this induction is under the control of the htpR gene (Neidhardt and Van Bogelen, 1984). Krueger and Walker (1984) showed that the heat-shock proteins GroEL and DnaK are also induced by UV-irradiation and that this induction is dependent on htpR+. It has also been reported that ethanol, coumermycin, chlorobiocin and UV (Travers and Mace, 1982; Fairweather ^ al., 1981; Kruger and Walker, 1984) can induce at least some heat shock proteins which led to the suggestion that the heat shock regulatory system is a general response to cell stress. A further link between the SOS and the heat shock response is that the Lon protein appears to be a heat shock protein, under htpR control (Phillips et » 1984). Furthermore, it is interesting to note that a mutant sigma subunit of RNA polymerase which is degraded slowly in Ion cells (Grossman et ^ . , 1983) is also broken down more slowly in htpR cells (Walker, 1984). This might suggest that Ion is induced by heat shock in order to more rapidly degrade abnormal proteins. Other papers also suggest now that accumulation of high levels of abnormal proteins also turn on the heat shock response. One of the most interesting heat shock genes is dnaK (Tilley et al., 1983). The DnaK protein is required for X replication (Georgopoulos and Hershowitz, 1971) has both ATPase and autophosphorylase activity (Zylicz et ^ . , 1983) and is a highly conserved protein between E. coli and Man. Moreover, the DnaK analogue Hsp70, is one of the first proteins to be synthesised in embryonic development. This further emphasises the universality of the heat shock regulon and its undoubtedly, although as yet unclear, role in global -110- control of key metabolic pathways under certain conditions. Similarly, the SOS system itself and other DNA damage inducible systems (summarized in Fig. 10.2) is likely to be highly conserved. Evidence already exists for an SOS like system in several bacteria and yeast and there has been much discussion of SOS-like repair processes involved in both mutagenesis and recovery of DNA synthesis after DNA damage in mammalian systems (reviewed by Sarasin ^ , 1982). Although it is still not clear that a true inducible error prone repair system exists in mammalian cells, undoubtedly further studies will continue in this expectation. In this context it is likely that the E. coli system will continue to be used as an important model for determining the basis of mutagenic events and the mechanism of reinitiation of DNA synthesis on damaged DNA templates. Future Studies For future work several experiments would be important in order to give a more complete picture of some of the work done in this thesis. First, experiments to investigate the role of RNaseH in the recovery process and dimer by-pass. This would include direct analysis of RNaseH levels in cells undergoing the SOS response. However, this would depend fAof upon a better RNaseH assayj^hitherto available. In particular an assay specific for RNaseH itself. It is noteworthy to mention that not yet shown in wild-type that RNaseH activity is inhibited during the SOS response. Secondly, for the Jji vitro mutagenesis it would be interesting to investigate the precise nature of the mutations to "lacO^" on the bacterial chromosome. Thus DNA sequence analysis of the lac region would hopefully identify the type of mutations obtained. In particular whether this resulted from for e.g. transposition or insertion events. Thirdly, -111- Heat "Heat Shock" Response at Eton htpR ^ least 1 3 genes (dnaK, groEL, groES, etc.) UV. nal UV. nal 80S Response at SOS-inducing recA at least 15 genes .. ^ Agents lexA (uvrA, umuC, sulA, etc.) / MeNNG MeNNG / Adaptive Response at Methylating ' ada least 2 genes > A e-ants — (alkA, gene for methyl- transferase) The different regulatory networks of E . coli which can be induced by agents that damage DNA. Nalidixic acid, MeNNG, N-methyl-N-nitro-nitrosoguanidine (derived from Krueger et al., 1984). further investiation of the exciting possibility of the mutagenic factor present in SOS extracts through purification of factors promoting tet reversion. -112- References Abdel-Monem, M., Durwald, H. and Hoffman-Berling, H. 1976. Enzymic unwinding of DNA. 2. Chain separation by an ATP-dependent DNA unwinding enzyme. Eur. J. Biochem. 65, 441-449. Abdel-Monem, M., Lauppe, H.-F., Kartenbeck, J., Durwald, H. and Hoffman- Berling, H. 1977. Enzymatic unwinding of DNA. III. Mode of action of Escherichia coli unwinding enzyme. J. Molec. Biol. 110, 667-685. Aral, K., Yasuda, S. and Kornberg, A. 1981. Mechanism of dnaB protein action. J. Biol. Chem. 256, 5247-5252. Arthur, H.M, and Lloyd, R.G. 1980. Hyper-recombination in uvrD mutants of Escherichia coli K-12. Mol. Gen. Genet. 180, 185-191. Atlung, T. 1981. Analysis of seven dnaA suppressor loci in Escherichia coli. ICN-UCLA Symp. Mol. Cell Biol. 21, 297-314. Atlung, T., Clausen, E.S. and Hanse, F.G. 1985. Autoregulation of the dnaA gene of Escherichia coli K12. Molec. Gen. Genet. 200, 442-450. Bagg, A., Kenyon, C. and Walker, G.C. 1981. Inducibility ofa gene product required for UV - and chemical mutagenesis in E. coli. Proc. Natl. Acad. Sci. USA. 78, 5749-5753. Bachmann, B.J, 1983. Linkage map of E. coli K-12, Edition 7. Microbiol. Rev. 47, 180-230. Bachmann, B.J., Low, K.B. and Taylor, A.L. 1976. Recalibrated map of Escherichia coli K-12. Bacteriol. Rev. 40, 116-167. Bagdasarian, M . , Izakowska, M. and Bagdasarian, M. 1977. Suppression of the DnaA phenotype by mutation in the rpoB cistron of ribonucleic acid polymerase in Salmonella typhymurium and Escherichia coli. J. Bacteriol. 130, 577-582. Bagg, A., Kenyon, C.J. and Walker, G.C. 1981. Inducibility of a gene product required for UV and chemical mutagenesis in Escherichia coli. Proc. Natl.' Acad.' Sci.' 78, 5749-5753. Bailone, A., Levine, A. and Devoret, R. 1979. Inactivation of prophage lambda repressor in vivo. J. Mol. Biol. 131, 553-572. Baluch, J., Chase, J.W. and Sussman, R. 1980. Synthesis of recA protein and induction of bacteriophage lambda in single-stranded deoxyribonucleic acid-binding protein mutants of E. coli. J. Bacteriol. 144, 489-498. Benbow, R.M., Zuocarelli, A.J. and Sinsheimer, R.L. 1974. A role for single-strand breaks in bacteriophage 0X174 genetic recombination. J. Mol. Biol. 88, 629-651. Beyersmann, D., Messer, W. and Schlicht, M. 1974. Mutants of Escherichia coli B/r defective in deoxyribonucleic acid initiation : dnal, a new gene for replication. J. Bacteriol. 118, 783-789. -113- Billen, D. 1969. Replication of the bacterial chromosome : location of new initiation sites after irradiation. J. Bacteriol. 97, 1169-1175. Bialy, H. and Kogoma, T. 1986. RNase H is not involved in the induction of stable DNA replication in Escherichia coli. J. Bacteriol. 165, 321-323. Bird, R.E., Louarn, J., Manruscelli, J. and Caro, L.G. 1972. The origin and direction of chromosomal replication in E. coli. J. Mol. Biol. 70, 549- Birnboim, B.C. and Doly, J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nuc. Acid Res. 7, 1513-1523. Blanco, M., Guadalupe, H., Collado, P., Rebollo, J.E. and Botelia, L.M. 1982. Influence of RecA protein on induced mutagenesis. Biochemie. 64, 633-636. Bockrath, R.C. and Hanawalt, P.C. 1980. Ultraviolet light induction of recA protein in a recB uvrB mutant of Escherichia coli. J. Bact. 143, 1025-1028. Bouche, J.-P., Zechel, K. and Kornberg, A. 1975. dnaG gene product, a rifampicin-resistant RNA polymerase, initiates the conversion of a single-stranded coliphage DNA to its duplex replicative form, j ’ Biol. Chem. 250, 5995-6001. Braun, R.E., O'Day, K. and Wright, A. 1985. Autoregulation of the DNA replication gene dnaA in E. coli K12. Cell 40, 159-169. Brant, R. and Ptashne, M. 1980. The lexA gene product represses its own promoter. Proc. Natl. Acad. Sci. USA. 77, 1932-1936. Brent, R. and Ptashne, M. 1981. Mechanism of action of the lexA gene product. Proc. Natl. Acad. Sci. 78, 4204-4208. Bridges, B.A., Mottershead, R.P. and Green, M.H.L. 1977. Cell division in E. coli Bs-12 is hyposensitive to deoxyribonucleic acid damage by ultraviolet light. J. Bacteriol. 130, 724-728. Bridges, B.A., Mottershead, R.P. and Sedgwick, S.G. 1976. Mutagenic DNA repair in Escherichia coli III. Requirement for a function of DNA polymerase III in ultraviolet light mutagenesis. Mol. Gen. Genet. 144, 52-58. Bridges, B.A. and Woodgate, R. 1984. Mutagenic repair in Escherichia coli. Mol. Gen. Genet. 196, 364-366. Brotcorne-Lannoye, A., Maenhaut, M.G., and Radman, M. 1985. Involvement of DNA polymerase III in UV-induced mutagenesis of bacteriophage lambda. Mol. Gen. Genet. 199, 64-69. Brotcorne-Lannoye, A. and Maenhaut, M.G. 1986. Role of RecA protein in untargetted UV mutagenesis of bacteriophage X : Evidence for the requirement for the dinB gene. Proc. Natl. Acad. Sci. 83, 3904- 3908. -114- Brown, P.O., Peebles, C.L. and Cozzarelli, N.R. 1979. A topoisomerase from Escherichia coli related to DNA gyrase. Proc. Natl. Acad. Sci. 76, 6110-6114. Burgers, P.M.J., Kornberg, A. and Sakakibara, Y. 1981. The dnaA gene codes for the 3 subunit of DNA polymerase III holoenzyme of Escherichia coli. Proc. Natl. Acad. Sci. USA. 78, 5391-5395. Burton, P. 1981. Two pathways of division inhibition in UV-irradiated E. coli. B.Sc. thesis. University of Leicester. Burton, P. and Holland, I.B. 1983. Two pathways of division inhibition in E. coli. Molec. Gen. Genet. 190, 309-314. Caillet-Fauguet, P., Défais, M. and Radman, A. 1977. Molecular mechanisms of induced mutagenesis. Replication jji vivo of bacteriophage 0X174, single stranded ultraviolet light irradiated DNA in intact and irradiated host cells. J. Mol. Biol. 117, 95-112: Caillet-Fauquet, P., Maenhaut-Mlchel, G. and Radman, M. 1984. SOS mutator effect in E. coli mutants deficient in mismatch correction. EMBO J. 3, 707-712. Cairns, J. 1963. The chromosome of Escherichia coli. Cold Spring Harbour Symp. Quant. Biol. 28, 43-46. Carl, P.L., Bloom, L. and Crouch, R.J. 1980. Isolation and mapping of a mutation in Escherichia coli with altered levels of ribonuclease H. J. Bacteriol. 144, 28-35. Casadaban, M.J. and Cohen, S.N. 1980. Lactose genes fused to exogenous promoters in one step using Mu-lac bacteriophage : vivo probe for transcriptional control sequences. Proc. Natl. Acad. Sci. 76, 4530-4533. Casaregola, S., D'Ari, R. and Huisman, D. 1982. Quantitative evaluation of recA gene expression in Escherichia coli. Molec. Gen. Genet. 185, 430-4 39. Castellazi, M. , George, J. and Buttin, G. 1972a. Prophage induction and cell division in E. coli 1. Further characterization of the thermosensitive mutant tif-1 whose expression mimics the effect of UV-irradiation. Molec. Gen. Genet. 119, 139-152. Castellazi, M. , George, J. and Buttin, G. 1972. Prophage induction and cell division in E. coli II. linked (recA, zab) and unlinked (lexA) suppressors of tif-1 mediated induction and filamentation. Mol. Gen. Genet. 119, 153-174. Chakroborty, T., Yoshinaga, K., Lother, H. and Messer, W. 1982. Purification of the E. coli dnaA gene product. EMBO J. 1, 1545-1549. Churchward, G., Holmans, P. and Bremer, H. 1983. Increased expression of the dnaA gene has no effect on DNA replication in a dnaA+ strain of Escherichia coli. Mol. Gen. Genet. 192, 506-508. -115- Ciesla, Z. 1982._ Plasmid pKMI01-mediated mutagenesis in E. coli is inducible. Mol. Gen. Genet. 186, 298-300. Clark, A.J. and Volkert, H.R. 1978. A new classification of pathways repairing pyrimidine dimers in DNA. In DNA repair mechanism (ed. Hanawalt, P.O., Friedberg, E.G. and Fox, C.F.). p.57-72, Academic New York. Clark, A.J., Volkert, H R. and Margossian, L.J. 1978. A role for recF in repair of UV damage to DNA. Cold Spring Harbor Symb. Quant. Biol. pp.887-892 Clowes, R.C. 1972. Molecular structure of bacterial plasmids. Bact. Res. 36, 361-405. Cohen, S.V., Chang, A.C.Y. and Hsu, L. 1972. Non chromosomal anti biotic resistance in bacteria : genetic transformation of E. coli by R-factor DNA. Proc. Natl. Acad. Sci. 69, 2110-2114. Cooper, P.K. 1982. Characterization of long patch excision repair of DNA in ultraviolet-irradiated E. coli : An inducible function under Rec-lex control. Mol. Gen. Genet. 185, 189-197. Cooper, P.K. and Hanawalt, P.C. 1972. Heterogeneity of patch size in repair replicated DNA in E. coli. J. Mol. Biol. 67, 1-10. Cooper, P.K. and Ganesan, A.K. 1984. Role of the recF gene of Escherichia )coli in inducible excision repair and daughter strand gap repair. ' Photochem. photobiol. 39, (Suppl);82. Coulondre, C. and Miller, J.H. 1977. Genetic studies of the lac repressor. IV. Mutagenic specificity in the l a d gene of E. coli. J. Mol. Biol. 117, 577-606. Dannenberg, R. and Mosig, G. 1983. Early intermediates in bacteriophage T4 replication and recombination. J. Virol. 45, 813-831. Darby, V. and Holland, I.B. 1979. A kinetic analysis of cell division and induction and stability of RecA protein in UV-irradiated lon+ and Ion" strains of Escherichia coli K12. Molec. Gen. Genet.' 176, 121-128. Défais, M. 1983. Role of the E. coli UmuC gene product in the repair of single stranded DNA phage. Mol. Gen. Genet. 192, 509-511. Denhardt, D.T., Dressier, D.H. and Hathaway, A. 1967. The abortive replication of 0X174 DNA in a recombination-deficient mutant of Escherichia coli. Proc. Natl. Acad. Sci. 57, 813-820. De Massy, B., Fayet, 0. and Kogoma, T. 1984. Multiple origin usuage for DNA replication in sdrA (rnh) mutants of Escherichia coli K-12 : initiation in the absence of oriC. J. Mol. Biol. 178, 227-236. Depew, R.E., Liu, L.F. and Wang, J.C. 1978. Interaction between DNA and Escherichia coli protein W. Formation of a complex between single stranded DNA and W protein. J. Biol. Chem. 253, 511-518. -11 6- Devoret, R., Pierre, M. and Moreau, P.L. 1982. Prophage 080 is induced in E. coli K-12 recA^goI Mol’ Gen.' Genet. 189, 199-206.’ Difrancesco, R., Bhatnagar, S.K., Brown, A. and Bessman, M.J. 1984. The interaction of DNA polymerase III and the product of the Eschrichia coli mutator gene, mutD. J. Biol. Chem. 259, 5567- 5573. Dixon, N.E. and Kornberg, A. 1984. Protein HU in the enzymatic replic ation of the chromosomal origin of Escherichia coli. Proc. Natl. Acad. Sci.' USA. 81,424-428.' Donachie, W.D. 1968. Relationship between cell size and time of initiation of DNA replication. Nature 219, 1077-1079. Doubleday, O.P., Manhaut, M.G., Brandenburger, A., Leconte, P. and Radman, M. 1981. In Chromosome damage and repair (ed. E. Seeberg and K. Kleppe). Plenum Publ. Corp. N.Y. pp.447-459. Doudney, 0.0. 1972. Chloromphenicol effects on DNA replication in UV- damaged bacteria. Mut. Res. 17, 1-12. Doudney, C.O. 1973. Rifamycin limitation of DNA synthesis in ultra violet damaged bacteria : Evidence for post irradiation replication synchrony. Biochem. Biophys. Acta. 312, 243-247. Drlica, K. and Snyder, M. 1978. Superhelical Escherichia coli DNA : Relaxation by coumermycin. J. Molec. Biol. 120, 145-154. Ebina, Y., Takahara, Y., Kishi, F., Nakazawa, A. and Brent, R. 1983. LexA protein is a repressor of the colicin El gene. J. Biol. Chem. 258, 13258-13269. Echols, H. 1982. Mutation rate ; Some biological and biochemical considerations. Biochemie, 64, 571-575. Echols, H., Chi, L. and Burgers, P.M.J. 1983. Mutator strain of E. coli mutD and dnaQ with defective exonucleolytic editing by DNA poly merase III holoenzyme. Proc. Natl. Acad. Sci. USA. 80, 2189-2192. Eichenlaub, R., Figurski, D. and Helinski, D. 1977. Bidirectional replication from a unique origin in a mini-F plasmid. Proc. Natl, Acad. Sci. 74, 1138-1141. Eichenlaub, E. 1979. Mutants of the mini-F plasmid pML31 thermo sensitive in replication. J. Bacteriol. 138, 559-566. Elledge, S.J. and Walker, G.C. 1983. Proteins required for ultraviolet light and chemical mutagenesis : identification of the product of the umuC locus of E. coli. J. Mol. Biol. 164, 175-192. Emmerson, P.T. and West, S.C. 1977. Identification of protein X of Escherichia coli as the recA+/tif+ gene product. Mol. Gen. Genet. 155, 77-85. Epstein, R.H., Bolle, A., Steinberg, C.M., Kellenberger, E., Boy, E., DELA Tour, Chevalley, R., Edgar, R.S., Susman, M., Denhardt, G., and Leilausin, A. Physiological studies of conditional lethal mutations of Bacteriophage T4D. -117- Fairweather, N.F., Orr, E. and Holland, I.B. 1980. Inhibition of DNA gyrase in : effects on nucleic acid synthesis and cell division in E. coli K-12. J. Bacteriol.' 142,’ 153-161 ’ Fayat, 0. and Louarn, J-M. 1978. Map position of the replication origin of the E. coli K12 chromosome. In : DNA synthesis-present and future pp.27-31 ed. Molineux, I. and Kohiyama, M. Plenum Press. Fersht, A.R. and Knill-Jones, J.W. 1983. Contribution of 3*-5’ exo nuclease activity of DNA polymerase III holoenzyme from Escherichia coli to specificity. J. Mol. Biol. 165, 669-682. Filutowicz, M. 1980. Requirement of DNA gyrase for initiation of chromosome replication in Escherichia coli K12. Mol. Gen. Genet. 177, 301-309. Filutowicz, M. and Jonczyk, P. 1983. The gyrB gene product functions in both initiation and chain polymerization of Escherichia coli chromosome replication : suppression of the initiation deficiency in gyrB-ts mutant by a class of rpoB mutations. Mol. Gen. Genet. 1 9 1, 283-287. Fogliono, M. and Schendel, P. 1981. Evidence for inducibility of the uvrB operon. Nature 289, 196-198. Foster, P.L., Eisenstade, E. and Cairns, J. 1982. Analysis of the frequency distribution of mutations. Nature 299, 365-367. Fowler, R.G., Dengnen, G.E. and Cox, E.C. 1974. Mutational specificity of conditional E. coli mutator, mutD5. Mol. Gen. Genet. 133, 179-191. Fujisawa, T. and Eisenstark, A. 1973. Bi-directional chromosomal replication in Salmonella typhimurium. J. Bacteriol. 115, I68- 176. Fuller, R.S., Bertsch, L.L., Dixon, N.E., Flynn, J.E. Jr., Kaguni, J.M., Low, R.L., Ogawa, T. and Kornberg, A. 1983. Enzymes in the intiation of replication at the E. coli chromosomal origin. In mechanisms of DNA replication and recombination. UCLA Symp. Mol. Cell. Biol. New series. Vol. 10, N. Cozzarelli, ed. (New York : Alan R. Liss, Inc.) pp.275-288. Fuller, R.S., Kaguni, J.M. and Kornberg, A. 1981. Enzymatic replication of the origin of the Escherichia coli chromosome. Proc. Natl. Acad. Sci. USA.' 78, 7370-7374. Fuller, R.S. and Kornberg, A. 1983. Purified DNA protein in initiation of replication at the Escherichia coli chromosomal origin of replication. Proc. Natl. Acad. Sci. USa. 80, 5817-5821. Fuller, R.S., Funnell, B.E., Kornberg, A. 1984. The dnaA protein complex with E. coli chromosomal replication origin (oriC) and other DNA sites. Cell 38, 889-900. Gefter, M.L., Hirota, Y., Kornberg, T., Weschler, J.A. and Barnoux, C. 1971. Analysis of DNA polymerase II and III in mutants of Escherichia coli thermosensitive for DNA synthesis. Proc. Natl. Acad. Sci. 68, 3150-3153. -118- Gellert, M., Mizuuchi, K., O'Dea, M.H., Itoh, T. and Nash, H.A. 1976a. DNA gyrase : An enzyme that introduces superhelical turns into DNA. Proc. Natl. Acad. Sci. 73, 3872-3876. Gellert, M., O'Dea, N.H., Itoh, T. and Tomizawa, J. 1976b. Novobiocin and coumermycin inhibit DNA supercoiling catalysed by DNA gyrase. Proc. Natl. Acad. Sci. 73, 4474-4478. Gellert, M., Mizuuchi, K., O'Dea, M.H., Itoh, T. and Tomizawa, J.I. 1977. Nalidixic acid resistance : A second genetic character involved in DNA gyrase activity. Proc. Natl. Acad. Sci. 74, 4772-4776. Gellert, M., Fisher, L.M. and O'Dea, M.H. 1979. DNA gyrase : purific ation and catalytic properties of a fragment of gyrase B protein. Proc. Natl. Acad. Sci. 76, 6289-6293. George, J., Castelazzi, M. and Buttin, G. 1975. Prophage induction and cell division in E. coli. Ill Mutations sfiA and sfiB restore division in tif and Ion strains and permit the expression of the mutator properties of tif. Molec. Gen. Genet. 140, 309-332. Georgopoulos, C.P. and Hershowitz, I. 1971. Escherichia mutants blocked in lambda DNA synthesis. In : The bacteriophage lambda. Ed. Hershey, A.D. Cold Spring Harbour Laboratory (New York) pp.553“ 564. Glickman, B.W., Guizt, N. and Morand, P. 1977. The genetic character ization of lexB30, lexB33 and lexB35 mutations of E. coli : Location and complementation pattern for UV resistance. Mol. Gen. Genet. 157, 83-89. Glickman, B.W. and Radman, M. 1980. Escherichia coli mutator mutants deficient in méthylation instructed DNA mismatch correction. Proc. Natl. Acad. Sci. (USA). 77, 1063-1067. Gotfield, F. and Weschler, J.A. 1977. Dominance of dnaA'*' to dnaA in Escherichia coli. J. Bacteriol. 130, 963-964. Gottesman, M.M., Hicks, M.L. and Gellert, M. 1973. Genetics and functions of DNA ligase in Escherichia coli. J. Mol. Biol. 77, 531-547. Gottesman, M.M., Hicks, M.L. and Gellert, M. 1983. Genetics and function of DNA ligase in Escherichia coli. J. Molec. Biol. 77, 531-547. Gottesman, S. and Neidhardt, F.C. 1983. Global control systems. In : Gene function in prokaryotes. Ed. Beckwith, J., Davies, J. and Gallant, J.A. Cold Spring Harbour Laboratory (New York). pp.l63- 183. Gross, J.D. 1972. DNA replication in bacteria. Curr. Top. Immunol. 57, 39-74. Gross, J. and Gross, M. 1969. Genetic analysis of an E. coli strain with a mutation affecting DNA polymerase. Nature 224, 1166-1168. Grossman, A.D., Burgess, R.R., Walter, W. and Gross, C.A. 1983. Mutations in the Ion gene of E. coli K-12 phenotypically suppress a mutation in the sigma subunit of RNA polymerase. Cell 32, 151-159. -119- Gudas, L. and Pardee, B. 1975. Model for regulation of Escherichia coli DNA repair functions. Proc. Natl. Acad. Sci. (USA). 72, 2330-2334. Hanawalt, P.O., Cooper, P.K., Gameson, A.K. and Smith, C.A. 1979. DNA repair in bacteria and mammalian cells. Ann. Rev. Biochem. 48, 783-836. Hane, M.W. and Wood, T.H. 1969. Escherichia coli K-12 mutants resistant to nalidixic acid : genetic mapping and dominance studies. J. Bact. 99, 239-241. Hansen, F.G., Hansen, E.B. and Atlung, T. 1982. The nucleotide sequence of the dnaA gene promoter and the adjacent rpmH gene, coding for the ribosomal protein L34 of Escherichia coli. EMBO J. 1, 1043- 1048. Hansen, E.B., Hansen, F.G., and Von Meyenburg, K. 1982. The nucleotide sequence of the dnaA gene and the first part of the dnaA gene of Escherichia coli K-12. Nucleic Acid Res. 10, 7373-7385. Hansen, F.G. and Von Meyenburg, K. 1979. Characterization of the dnaA gyrB and other genes in the dnaA region of the Escherichia coli chromosome on specialized transducing phages Xtna. Mol. Gen. Genet. 175, 135-144. Haseltine, W.A. 1983. Ultraviolet light repair and mutagenesis revisited. Cell 33, 13-17. Helmstetter, G.E. and Cooper, S. 1968. DNA synthesis during division cycle of rapidly growing Escherichia coli B/r. J. Mol. Biol. 31, 507-518. Helmstetter, G.E., Cooper, S., Pierucci, 0. and Révélas, E. 1968. On the bacterial life sequence. Cold Spring Harbour Symp. Quant. Biol. 33, 809-822. Herrero, E., Orr, E. and Holland, I.B. 1981. Induction of recA protein ; Effect of inactivation of DNA gyrase. FEMS Microbiology Letters 10, 369-372.' Higgins, N.P., Peebles, C.L., Sugino, A. and Cozzarelli, N.R. 1978. Purification of subunits of Escherichia coli DNA gyrase and reconstitution of enzymic activity. Proc. Natl. Acad. Sci. 75, 1773- 1777. Hohlfeld, R. and Vielmetter, W. 1973. Bidirectional growth of the E. coli chromosome. Nat. New Biology. 118, 130-132. Horii, Z.I. and Clark, A.J. 1973. Genetic analysis of the recF pathway to genetic recombination in Escherichia coli K12 : Isolation and characterization of mutants. J. Mol. Biol. 80, 327-344. Horiuchi, T., Maki, H. and Sekiguchi, M. 1984. RNase H defective mutants of Escherichia coli : a possible discriminatory role of RNase H in initiation of DNA replication. Mol. Gen. Genet. 195, 17-22. -120- Hourcade, D. and Dressier, D. 1978. Site-specific initiation of a DNA fragment. Proc. Natl. Acad. Sci. 75, 1652. How, W.H. and Mount, D.W. 1975. Production of cells without deoxy ribonucleic acid during thymidine starvation of lexA" cultures of Escherichia coli K-12. J. Bacteriol. 124, 1113-1121. Howard-Flanders, P. and Theriot, L. 1966. Mutants of Escherichia coli K-12 defective in DNA repair and in genetic recombination. Genetics 53, 1137-1150.’ Huisman, 0., D'Ari, R. and George, J. 1980c. Inducible sfi dependent division inhibition in Escherichia coli. Molec. Gen. Genet. 177, 629-639. Huisman, 0., D'Ari, R. and Gottesman, S. 1978. Cell division control in E. coli ; specific induction of the SOS function sfiA protein is sufficient to block septation. Proc. Natl. Acad. Sci. 81, 4490- 4494. Huisman, 0. and D'Ari, R. 1981. An inducible DNA replication - cell division coupling mechanism in E. coli. Nature (London) 209, 797-799. Hurwitz, J. and Wickner, S. 1974. Involvement of two protein factors and ATP in vitro DNA synthesis catalysed by DNA polymerase III of Escherichia coli. Proc. Natl. Acad. Sci. 71, 6-10. Inouye, M. 1971. Pleiotropic effect of the recA gene of E. coli : uncoupling of cell division from deoxyribonucleic acid replication. J. Bacteriol. 106, 539-542. Inouye, M. and Pardee, A.B. 1970. Changes of membrane proteins and their relation to DNA synthesis and cell division of E. coli. J.' Biol. Chem. 245, 581 3-5819. Inselburg, J. 1974. Replication of ColEI plasmid DNA in mini cells from a unique replication initiation site. Proc. Natl. Acad. Sci. 71, 2256-2259. Itoh, T., Tomizawa, J. 1980. Formation of an RNA primer for initiation of replication of ColEI DNA by ribonuclease H. Proc. Natl. Acad. Scil USA. 77, 2450-2454. Jacob, F., Brenner, S. and Cuzin, F. 1963. On the regulation of DNA replication in bacteria. Cold Spring Harbor Symp. Quant. Biol. 28, 329-348. Jaffe, A., D'Ari, R. and Norris, V. 1986. SOS independent coupling between DNA replication and cell division in Escherichia coli. J. Bacteriol. 165, 66-71. Joncyk, P. and Ciesla, Z. 1979. DNA synthesis in UV-irradiated E. coli K12 strain carrying danA mutation. Mol. Gen. Genet. 171, 53-58. Jones, C.A. 1984. SfiB and the control of cell division in E. coli. Ph.D thesis. University of Leicester. -121- Kaguni, J.M., Fuller, R.S. and Kornberg, A. 1982. Enzymatic replication of E. coli chromosomal origin is bidirectional. Nature 296, 623- 627. Kaguni, J.M. and Kornberg, A. 1984. Replication initiated at the origin (oriC) of the E. coli chromosome reconstituted with purified enzymes. Cell 38, 183-190. Kato, T. and Shinoura, Y. 1977. Isolation and characterization of mutants of E. coli deficient in induction of mutations by ultraviolet light. Molec. Gen. Genet. 156, 121-131. Kelly, R.B., Atkinson, M.R., Huberman, J.A. and Kornberg, A. 1969. Nature 224, 495-501. Kenyon, C.J. and Walker, G.C. 1980. DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli. Proc. Natl. Acad. Sci. 77, 2819-2823. Kenyon, C.J. and Walker, G.C. 1981. Expression of the E. coli uvrA gene is inducible. Nature 289, 808-810. Kenyon, C.J. 1983. The bacterial response to DNA damage. Trends. Biochem. Sci. 8, 84-87. Khidhir, M.A., Casaregola, S. and Holland, I.B. 1985. Mechanism of transient inhibition of DNA synthesis in ultraviolet-irradiated E. coli : Inhibition is independent of recA whilst recovery requires RecA protein itself and an additional inducible function. Molec. Gen. Genet. 199, 133-140. Kingsbury, D.T. and Helinski, D.R. 1973. Temperature-sensitive mutants for the replication of plasmid in Escherichia coli : requirement for deoxyribonculeic acid polymerase I in the replication of the plasmid ColEI. J. Bacteriol. 114, 1116-1124. Kleckner, N. 1981. Transposable elements in prokaryotes. Ann. Rev. Genet. 15, 341-404. Kogoma, T. 1978. A novel Escherichia coli mutant capable of DNA replication in the absence of protein synthesis. J. Mol. Biol. 121, 55-69. Kogoma, T., Bialy, H., Subia, N.L., Torrey, T.A., and Pickett, G. 1985. The role of RNase H in initiation of DNA replication in E. coli. The molecular biology of bacterial growth, pp.311-324. Kogoma, T. and Lark, K.G. 1975. Characterization of the replication of Escherichia coli DNA in the absence of protein synthesis : stable DNA replication. J. Mol. Biol. 94, 243-256. Kogoma, T. and Lark, K.G. 1970. DNA replication in Escherichia coli : replication in absence of protein synthesis after replication inhibition. J. Mol. Biol. 52, 143-164. Kogoma, T., Torrey, T.A., Subia, N.L. and Pickett, G.G. 1981. The initiation of DNA replication, ICN-UCLA symposia on Molecular and Cellular Biology. In Ray, D.S. (ed.). Vol. 22, Academic Press, NY. pp.361-374. -122- Kogoma, T., Subia, N.L. and Von Meyenburg, K. 1985. Function of ribo nuclease H in initiation of DNA replication in E. coli Kl 2. Mol. Gen. Genet. 200, 103-109. Kogoma, T., Torrey, T.A. and Connaughton, M.J. 1979. Induction of UV- resistant DNA replication in Escherichia coli : Induced stable DNA replication as an SOS function. Mol. Gen. Genet. 176, 1-9. Kogoma, T., Skarstad, K., Boye, E., Von Meyenburg, K. and Steen, H. 1985. RecA protein acts at the initiation of stable DNA replication in rnh mutants of E. coli K-12. J. Bacteriol. 163, 439-444. Kogoma, T. and Von Meyenburg, K. 1983. The origin of replication, oriC, and the dnaA protein are dispensable in stable DNA replication (sdrA) mutants of Escherichia coli K-12. EMBO Vol. 2, No. 3, pp.463-468. Kolter, R. and Helinski, D.R. 1978. Trans-complementation dependent replication of a low molecular weight origin fragment from plasmid R6K. Cell 15, 1199-1208. Kolter, R. and Helinski, D.R. 1979. Regulation of initiation of DNA replication. Ann. Rev. Genet. 13, 355-391. Konrad, E.B. and Lehman, I.R. 1974. A conditional lethal mutant of Escherichia coli K12 defective in the 5'-3' exonuclease associated with DNA polymerase I. Proc. Natl. Acad. Sci. 71, 2048-2051. Kornberg, A. 1974. DNA synthesis. Freeman and Company, San Francisco. Kornberg, A. 1978. Enzymatic replication of DNA in E. coli probed by small phages. In : DNA synthesis 7 Present and Future pp.705- 728, Ed. Molineux, I. and Kohiyama, M. Plenum Press, NY. Kornberg, A. 1980. Regulation of replication. In : DNA replication. W.H. Freeman and Company. Krasin, F. and Hutchinson, F. 1977. Repair of DNA double-strand breaks in E. coli which requires recA function and the presence of a duplicate genome. J. Mol. Biol. 116, 81-98. Krasin, F. and Hutchinson, F. 1981. Repair of DNA double-strand breaks in E. coli cells requires synthesis of proteins that can be induced by UV light. Proc. Natl. Acad. Sci. (USA). 78, 3450- 3453. Krueger, J.H. and Walker, G.C. 1984. GroEL and dnaK genes of Escherichia coli are induced by UV-irradiation and nalidixic acid in an htpR-dependent fashion. Proc. Natl. Acad. Sci. 81, 1499-1503. Kruger, U.H. and Walker, G. 1984. groEl and dnaK genes of Escherichia coli are induced by UV irradiation and nalidixic acid in an htpR+-dependent fashion. Proc. Natl. Acad. Sci. (USA) 81, 1499-1503. -123- Kuemmerle, N., Ley, R. and Masker, W. 1981. Analysis of resynthesis tracts in repaired E. coli deoxyribonucleic acid. J. Bacteriol. 147, 333-339. Kuemmerle, N.B. and Masker, W.E. 1980. Effect of the uvrD mutations on excision repair. J. Bacteriol. 142, 535-546. Kuempel, P.L. and Veomett, G.E. 1970. A possible function of DNA poly merase in chromosome replication. Biochem. Biophys. Res. Comm. 41, 973-980. Kunkel, T.A., Meyer, R.R. and Loeb, L.A. 1979. Single strand binding protein enhances fidelity of DNA synthesis _in vitro. Proc. Natl. Acad. Sci. (USA). 76, 6331-6335. Kushner, S.R., Shepherd, J., Edwards, G. and Maples, V.F. 1978. In DNA repair mechanism : ICN-UCLA Symp. Ed. P.C. Hanawalt, E.C. Friedberg and C.F. Fox. Mol. Cell Biol. 9, 251-254. Kushner, S.R, 1978. An improved method for transformation of E. coli with ColEI derived plasid : In genetic engineering. Boyer, H. W. and Nicosia (eds.) North Holland Biomedical press, Amsterdam, pp.17-23. Lackey, D., Waldkraun, S. and Linn, S. 1982. Isolation of an altered form of DNA polymerase I from Escherichia coli cells induced for recA/lexA functions. Proc. Natl. Acad. Sci. (USA). 79, 330-334. Lackey, D., Waldkraun, S. and Linn, S. 1984. Characterization of DNA polymerase I, a form of DNA polymerase I found in E. coli expressing SOS functions. J. Biol. Chem. 260, 3178-3184. Lackey, D., Krauss, S.W. and Linn, S. 1985. Characterization of DNA polymerase I*, a form of DNA polymerase I found in E. coli expressing SOS functions. J. Biolog. Chem. 260, 3178-3184. Laemmli, U.K. 1970. Cleavage of structure proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lane, H.E.D. and Denhardt, D.T. 1975. The rep mutation. IV. Slower movement of replication forks in Escherichia coli rep strains. J. Molec. Biol. 97, 99-112. Lark, K.G. 1972. Evidence for a direct involvement of RNA in the initiation of DNA replication in Escherichia coli 15T“ . J. Molec. Biol. 64, 47-60. Lark, K.G., Lark, C.A. and Meenen, E.A. 1981. The initiation of DNA replication. ICN-UCLA Symposia on Molecular and Cellular Biology, Vol. 22, Academic Press, NY. pp.337-360. Lark, K.G., Repko, T. and Hoffman, E.J. 1963. The effect of amino acid deprivation on subsequent deoxyribonucleic acid replication. Biochem. Biophys. Acta. 76, 9-24. -124- Laurent, S.J, 1974. Control of deoxyribonucleic acid synthesis in a Bacillus subtilis mutant temperature sensitive for initiation of chromosome replication. J. Bacteriol. 117, 329-336. Ley, R.D. and Setlow, R.B. 1972. Repair replication in Escherichia coli as measured by the photolysis of bromodeoxyuridine. Biophys. J. 12, 420-431. Lindahl, G. and Lindahl, T. 1984. Initiation of DNA replication in Escherichia coli : RNase H-deficient mutants do not require the dnaA function. Mol. Gen. Genet. 196, 283-289. Little, J.W. and Hanawalt, P.C. 1977. Induction of protein X in Escherichia coli. Mol. Gen. Genet. 150, 237-248. Little, J.W., Edmison, S.H., Pacelli, Z. and Mount, D.W. 1980. Cleavage of the Escherichia coli lexA protein by the recA protease. Proc. Natl. Acad. Sci. 77, 3225-3229. Little, J.W., Mount, D.M. and Yanish-Perron, C.P. 1981. Purified LexA protein is a repressor of the recA and lexA genes. Proc. Natl. Acad. Sci. 78, 4199-4203^ Little, J.W. and Mount, D.W. 1982. The SOS regulatory system of Escherichia coli. Cell 29, 11-22. Little, J.W. 1984. Autodigestion of lexA and phage X repressor. Proc. Natl. Acad. Sci. 81, 1375-1379. Livingston, D.M. and Richardson, C.C. 1975. Deoxyribonucleic acid polymerase III of Escherichia coli. Characterization of associated exonuclease activities. J. Biol. Chem. 250, 470-478. Livneh, Z. 1986. Mechanism of replication of ultraviolet-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli. J. Biol. Chem. 261, 9526-9533. Lloyd, R.G., Low, B., Godson, N. and Birge, H. 1974. Isolation and characterization of an E. coli K-12 mutant with a temperature sensitive Rec" phenotype. J. Bacteriol. 120, 407-415. Lloyd, R.G., Picksly, S.M. and Prescott, C. 1983. Inducible expression of a gene specific to the recF pathway for recombination in Escherichia coli K-12. Mol. Gen. Genet. 190, 162-167. Lovett, S.T. and Clark, A.J. 1983. Genetic analysis of regulation of the recF pathway of recombination in Escherichia coli K-12. J. Bact. 153, 1471-1478. Liu, L.F., Liu, C.C. and Albert, B.M. 1979. T4 DNA topoisomerase : a new ATP-dependent enzyme essential for initiation of T4 bacteriophage DNA replication. Nature 281, 456-461. Lother, H., Lurz, R. and Orr, E. 1984. DNA binding and antigenic specification of DNA gyrase. Nucl. Acid. Res. 12, 901-914. Lother, H., Rolling, R., Kucherer, C. and Schawzu, M. 1985. dnaA protein regulated transcription : effects on the vitro replication of E. coli chromosome. EMBO 4, 555-560. -125- Louarn, J-M. and Bird, R.E. 197^. Size distribution and molecular polarity of newly replicated DNA in Escherichia coli. Proc, Natl. Acad. Sci. 71i 329-333. Lu, A.L., Clark, S. and Modrich, P. 1983. Methyl-directed repair of DNA base-pair mismatches in vitro. Proc. Natl. Acad. Sci. USA. 80, 4639-4643. Luder, A. and Mosig, G. 1982. Two alternative mechanisms for DNA replication forks in bacteriophage T4 ; priming by RNA poly merase and by recombination. Proc. Natl. Acad. Sci. USA. 79, 1101-1105. Lupski, J.R., Smiley, B.L. and Godson, G.N. 1983. Regulation of the rpsU-dnaO-rpoD macromolecular synthesis operon and the initiation of DNA replication in Eschrichia coli. Mol. Gen. Genet. 189, 48-57. Lycett, G.W., Orr, E. and Pritchard, R.H. 1980. Chloramphenicol release a block in initiation of chromosome replication in a dnaA strain of Escherichia coli K12. Mol. Gen. Genet. 178, 329-336. Maaloe, 0. and Hanawalt, P.C. 1961. Thymine deficiency and the normal DNA replication cycle. J. Mol. Biol. 3, 144-155. Maenhaut, M.G. 1985. Mechanism of SOS-induced targeted and untargeted mutagenesis in E. coli. Biochemie, 67, 365-369. Masker, W.E. 1977. Deoxyribonucleic acid repair j_n vitrro by extracts of Escherichia coli. J. Bacteriol. 129, 1415-1423. Masters, M. and Broda, P. 1971. Evidence for the bidirectional replication of the Escherichia coli chromosome. Nature New Biology, 232, 137-140. McEntee, K. 1977. Protein X is the product of the recA gene of Escherichia coli. proc. Natl. Acad. Sci. 74, 5275-5279. McEntee, K., Weinstock, G.M. and Lehman I.R. 1980. RecA protein catalysed strand assimilation : stimulation by E. coli single stranded DNA binding protein. Proc. Natl. Acad. Sci. (USA) 77, 857-861. McHenry, C. and Crow, W. 1979. DNA polymerase III of Escherichia coli purification and identification of subunits. J. Biol. Chem. 254, 1748-1753. McHenry, C. and Kornberg, A. 1977 DNA polymerase III holoenzyme of E. coli. purification and resolution into subunits. J. Biol. Chem. 252, 6478-6485. McPartland, A., Green, L. and Echols, H. 1980. Control of recA gene RNA in E. coli : Regulatory and signal genes. Cell 20, 731-737. Messer, W . , Bergmans, H.E.N., Meijer, M., Womack, J.E., Hansen, E.G. and Von Meyenburg, K. 1978. Minichromosomes : plasmids which carry the E. coli replication origin. Mol. Gen. Genet. 162, 269-275. -1 26- Meyer, R.R., Glassberg, J. and Kornberg, A. 1979. An Escherichia coli mutant defective in single-strand binding protein is defective in DNA replication. Proc. Natl. Acad. Sci. 76, 1702-1705. Miller, J.H., Coulondre, C. and Farabaugh, P.J. 1978. Correlation of nonsense sites in the l a d gene with specific codons in the nucleotide sequence. Nature 274, 770-777. Miller, H.I., Kirk, M. and Echols, H. 1981. SOS induction and auto regulation of the hinA gene for site-specific recombination in E. coli. Proc. Natl. Acad. Sci. 78, 6754-6758. Miller, H.I. and Nash, H.A. 1981. Direct role of the hinA gene product in phage integration. Nature 290, 523-526. Miller, J.H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Miller, J.H. 1980. The l a d gene : Its role in lac operon control and its use as a genetic system. In : Miller, J.H. Reznikoff, W.S. (eds) The operon. Cold Spring Harbor Laboratory, New York, pp.31-88. Miller, J.H. 1982. Carcinogens induce targeted mutations in Escherichia coli. Cell 31, 5-7. Mizuuchi, K., O'Dea, M.H. and Gellert, M. 1978a. DNA gyrase : subunit structure and ATPase activity of the purified enzyme. Proc. Natl. Acad. Sci. 75, 5960-5963. Mizuuchi, K . , Gellert, M. and Nash, H.A. 1978b. Involvement of super twisted DNA in integrative recombination of bacteriophage lambda. J. Molec. Bioll 121, 375-392. Moore, P.O., Bose, K.K., Rabkin, S.D. and Strauss, B.S. 1981. Sites of termination of vitro DNA synthesis on ultraviolet and N-acetyl- aminofluorene-treated 0X174 templates by prokaryotic and eukaryotic DNA polymerases. Proc. Natl. Acad. Sci. (USA) 78, 110-114. Morand, P., Blanco, M. and Devoret, R. 1977. Characterization of lexB mutations of E. coli K12. J. Bacteriol. 131, 572-582. Morand, P., Goze, A. and Devoret, R. 1977b. Complementation pattern of lexB and recA mutations in E. coli K-12. Maping of fif-1, lexB and recA mutations. Mol. Gen. Genet. 157, 69-82. Morita, M. , Sugimoto, K., Oka, A., Takanami, M. and Hirota, Y. 1981. Mapping of promoters in the replication origin region of the E. coli chromosome. In : Ray, D. (ed) The initiation of DNA replication. ICN-UCLA Symp. Molec. Cell Biol. Vol 22, Academic Press, New York, pp.29-35. Mortelmans, K.E. and Stoker, B.A.D. 1979. Ultraviolet light protection, enhancement of ultraviolet light mutagenesis and mutator effect of plasmid R46 in Salmonella typhimurium. J. Bacteriol. 128, 271-282. -127- Mount, D.W., Low, K.B. and Edmiston, S. 1972. Dominant mutants (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet light-induced mutations. J. Bacteriol. 112, 886-893. Mount, D.W., Walker, A.C. and Kosel, C. 1973. Suppression of lex mutations affecting deoxyribonucleic acid repair in Escherichia coli by closely linked thermosensitive mutations. J. Bact. 116 , 950-956. Mount, D.W. 1977. A mutant of E. coli showing constitutive expression of the lysogenic induction and error prone DNA repair pathways. Proc. Natl. Acad. Sci. (USA). 78, 6236-6240. Muzyczka, N., Poland, R.L. and Bessman, M.J. 1972. Studies on the biochemical basis of spontaneous mutation. I. A comparison of the deoxyribonucleic acid polymerases mutator, antimutator and wild type strain of bacteriophage T4. J. Biol. Chem. 247, 7116-7122 . Neidhardt, F.C. and Van Bongelen, R.A. 1981. Protein regulating gene for temperature controlled proteins in E. coli. Biochem. Biophys. Res. Comm. 100, 894-900. Ogawa, H., Shimada, K. and Tomizawa, S. 1968. Mol. Gen. Genet. 101, 227-244. Ogawa, T., Hirose, S., Okazaki, T. and Okazaki, R. 1977. Mechanism of DNA chain growth. %VI. Analysis of RNA-linked DNA pieces in Escherichia coli with polynucleotide kinase. J. Molec. Biol. 112, 1 21-140. Ogawa, T. and Okazaki, T. 1980. Discontinuous DNA replication. Ann. Rev. Biochem. 49, 421-457. Ogawa, T. and Okazaki, T. 1984. Function of RNase H in DNA replication revealed by RNase H defective mutants of Escherichia coli. Mol. Gen. Genet. 193, 231-237. Ogawa, T., Pickett, G.G., Kogoma, T. and Kornberg, A. 1984. Rnase H confers specificity in the dnaA-dependent initiation of replication at the unique origin of the Escherichia coli chromosome in vivo and in vitro. Proc. Natl. Acad. Sci. USA. 81, 1040-1044. Ohmori, H., Kimura, M. , Nagata, T. and Sakakibara, Y. 1984. Structural analysis of the dnaA and dnaN genes of Escherichia coli. J. Bacteriol. 28, 159-170. Oishi, M. and Smith, C.L. 1978. Inactivation of phage repressor in a permeable cell synthesis : role of recB,C DNase induction. Proc. Natl. Acad. Sci. (USA) 75, 3569-3573. Okazaki, R., Okazaki, T., Hirose, S., Sugino, A., Ogawa, T., Kurosawa, Y., Shinozaki, K. , Tamanoi, F., Seki, T., Machida, Y . , Fujiyama, A. and Kohara, Y. 1975. In DNA synthesis and its regulation (Goulion, M. , Hanawalt, P. and Fox, F.C. eds.) Benjamin, menlo park p.832. -128- Okazaki, R., Okazaki, T., Sakabe, K., Sugimoto, K. and Sugino, A. 1968. Mechanism of DNA chain growth. I. Possible discontinuity and unusual secondary structure of newly synthesised chain. Proc. Natl. Acad. Sci. 59, 598-605. Olivera, B.M. and Bonhoeffer, F. 1974. Replication of Escherichia coli requires DNA polymerase I. Nature 250, 513-514. Orr, E., Fairweather, N.F., Holland, I.B. and Pritchard, R.H. 1979. Isolation and characterization of a strain carrying a conditional lethal mutation in the cou gene of E. coli K-12. Mol. Gen. Genet. 177, 103-112. Pacelli, L.Z., Edmiston, S.H. and Mount, D.W. 1979. Isolation and characterization of amber mutation in the lexA gene of E. coli K-12. J. Bacteriol. 137, 568-573. Peebles, C.L., Higgins, N.P., Kreuzer, K.N., Morrison, A., Brown, P.O., Sugino, A. and Cozzarelli, N.R. 1979. Structure and activities of Escherichia coli DNA gyrase. Cold Spring Harbour Symp. Quant. Biol. 1978. 43, 41-52.' Phillips, T.A., Van Bogelen, R.A. and Neidhardt, F.C. 1984. Lon gene product of Escherichia coli in a heat-shock protein. J. Bacteriol. 159, 283-287. Phizicky, E.M. and Roberts, J.W. 1981. Induction of SOS functions ; regulation of proteolytic activity of E. coli RecA protein by interaction with DN"A and nucleotide triphosphate. Cell 25, 259-267. Picksley, S.M., Lloyd, R.G. and Buckman, C. 1984. Genetic analysis and regulation of inducible recombination in Escherichia coli K-12. Cold Spring Harbour Symp. Quant. Biol. 49, 469-474. Pollard, E.C. and Achey, P.M. 1975. Induction of radio resistance in Escherichia coli. Biophys. J. 15, 1141-1154. Pollard, E.C. and Fugate, J.K. Jr. 1978. Relative rates of repair of single-strand breaks and post irradiation DNA degradation in normal and induced cells of Escherichia coli. Biophys. J. 24, 429-437. Pritchard, R.H. and Lark, K.G. 1964. Induction of replication by thymine starvation at the chromosomal origin in E. coli. J. Mol. Biol^ 9, 288-307. Pritchard, R.H., Barth, P.T. and Collins, J. 1969. Control of DNA synthesis in bacteria. In: 19th Symp. Soc. Gen. Microbiol, pp.263-297. ed. Meadow, P.M. and Pirt, S.J. Cambridge University Press. Pritchard, R.H. 1978. Control of DNA replication in bacteria. In: DNA synthesis - present and future pp.1-26, ed. Molineux, I. and Kohiyoma, M. Plenum press. Pukkila, P.J., Peterson, J., Herman, G., Modrich, P. and Meselson, M. 1983. Effect of high levels of DNA adenine méthylation on methyl-direcgted mismatch repair in Escherichia coli. Genetics 104, 571-582.' -129- Qullardet, P., Moreau, P.L., Ginsbury, H., Mount, D.W. and Devoret, R. 1982. Cell survival, UV-reactivation and induction of prophage \ in E. coli K-12 overproducing RecA protein. Mol. Gen. Genet. 188, 37-43. Radman, M. 1974. Phenomenology of an inducible mutagenic DNA repair pathway in Escherichia coli ; SOS repair hypothesis p.128-142. In L. Prakash, F. Sherman, M. Miller, C. Lawrence and H.W. Tabor (ed.). Molecular and environmental aspects of mutagenesis. Charles C. Thomas publisher, Springfield III. Radman, M. 1975. SOS repair hypothesis : phenomenology of an inducible DNA repair which is accompanied by mutagenesis p.355-367. In P. Hanawalt and R.B. Setlow (ed.) Molecular Mechanism for repair of DNA. Part A. Plenum Publication Corp. New York. Radman, M., Vitloni, G., Boiteux, S., Défais, M. , Caillet-fauquet, P. and Spadari, S. 1977. In: Origins of human cancer, eds. Hiatt, H.H., Watson, J.D. and Waniton, J.A. (Cols Spring Harbour) Book B, 903-922. Richard, H., Scheuermann and Harrison, E. 1984. A separate editing exonuclease for DNA replication : The subunit of Escherichia coli DNA polymerase III holoenzyme. Proc. Natl. Acad. Sci. (USA) 81, 7747-7751. Roberts, J.W. and Roberts, C.W. 1975. Proteolytic cleavage of bacterio phage lambda repressor in induction. Proc. Natl. Acad. Sci. USA. 72, 147-151. Roberts, J.W. and Roberts, C.W. 1981. Two mutations that alter the regulatory activity of E. coli recA protein. Nature 290, 422-423. Roberts, J.W., Roberts, C.W. and Craig, N.L. 1978. E. coli recA gene product inactivates phage X repressor. Proc. Natl. Acad. Sci. USA 75, 4714-4718. Rupert, C.S. 1975. Enzymatic photo reactivation : overview. In : Molecular mechanism for repair of DNA. Part A. (ed) P.C. Hanawalt and R.B. Setlow. Plenum Press, New York, p.73-87. Rupp, W.D. and Howard Flanders, D. 1968. Discontinuities in the DNA synthesized in an excision defective strain of E. coli following ultraviolet irradiation. J. Mol. Biol. 31» 291-304. Rupp, W.D., Wilde, C.E. III., Reno, D.L. and Howard Flanders, P. 1971. Exchanges between DNA strands in ultraviolet-irradiated Escherichia coli. J. Mol. Biol. 61, 25-44. Ryan, M.J. 1976. Coumermycin A1 : A preferential inhibitor of replicative DNA synthesis in E. coli. I. vivo cjharacter- ization. Biochemistry 15, 3769-3777. Sancar, A., Hack, A.M. and Rupp, W.D. 1979. Simple method for identification of plasmid encoded proteins. J. Bact. 137, 692-693. Sancar, A., Stachelek, C., Koningsberg, W. and Rupp, W.D. 1980. Sequence of the recA gene and protein. Proc. Natl. Acad. Sci. USA. 77, 2611-2615. -130- Sancar, A., Sancar, G.B. and Rupp, W.D. 1982a. LexA protein inhibits transcription of the E. coli uvrA gene in vitro. Nature 298, 96-98. Sancar, G.B., Sancar, A., Little, J.W. and Rupp, W.D. 1982b. The uvrB gene of E. coli has both lexA repressed and lexA independent promoters. Cell 28, 2523-2530. Sancar, A. and Rupp, W.D. 1983. A novel repair enzyme : uvrABC excision nuclease of E. coli cuts a DNA strand on both sides of the damage region. Cell 33, 249-260. Sakakibara, Y . , Tsukano, H. and Sako, T. 1981. Organization and trans cription of the dnaA and dnaN genes of Escherichia coli. Gene 13, 47-55. Sarasin, A., Bourre, F. and Benoit, A. 1982. Error-prone replication of ultraviolet-irradiated simian virus 40 in carcinogen-treated monkey kidney cells. Biochemie 64, 815-821. Schaper, R.M., Kunkel, T.A. and Loeb, L.A. 1983. Infidelity of DNA synthesis associated with by-pass of a purinic sites. Proc. Natl. Acad! Sci. USA. 80, 487-491. Schaaper, R.M. and Loeb, L.A. 1981. Depurinatin causes mutations in SOS- induced cells. Proc. Natl. Acad. Sci. )USA). 78, 1773-1777. Schaus, N.A., O'Day, K. and Wright, A. 1981a. Suppression of amber mutations in the dnaA gene of Escherichia coli K-12 by secondary mutations in rpoB. ICN-UCLA Symp. Mol. Cell Biol. 22, 315-323. Scheckman, R., Weiner, J.H., Weiner, A. and Kornberg, A. 1975. Ten proteins required for conversion of 0X174 single-stranded DNA to duplex form i_n vitro. J. Biol. Chem. 250, 5859-5865. Scheuermann, R., Schuman, T., Burgers, P.M.J., Lu, C. and Echols, H. 1983. Identification of the e-subunits of E. coli DNA polymerase III holoenzyme as the dnaQ gene product : A fidelity subunit for DNA replication. Proc. Natl. Acad. Sci. (USA). 80, 7085-7089. Schlesinger, M.J., Ashburner, M. and Tissieres, A. 1982. Heat shock from bacteria to man. Cold Spr. Harb. Lab. New York. Schnos, M. and Inman, R.B. 1970. Position of branch point in replicat ing X DNA. J. Molec. Biol. 51, 61-73. Schnos, M. and Inméin, R.B. 1971. Starting point and direction of replciation in P2 DNA. J. Molec. Biol. 55, 31-38, Scott, J.F., Eisenberg, S., Bertsoh, L.L. and Kornberg, A. 1977. A mechanism of duplex DNA replication revealed by enzymatic studies of phage 0x 174 : catalytic strand separation in advance of replication. Proc. Natl. Acad. Sci. 74, 193-197. Sedgwick, S.G. 1976. Misrepair of overlapping daughter strand gaps as a possible mechanism for UV-induced mutagenesis in uvr strains of E. coli : general model for induced mutagenesis by misrepair (SOS repair) of closely spaced DNA lesions. Mutations Res. 41, 185-2 0 0 . -131- Sevastopoulos, C.G., Wehr, C.T. and Glaser, D.A. 1977. Large scale automated isolation of Escherichia coli mutants with thermo sensitive DNA replication. Proc. Natl. Acad. Sci. 74, 3485-3489. Sevastopoulos, C.G. and Glaser, D.A. 1977. Mutator activity by Escherichia coli strain carrying dnaE mutations. Proc. Natl. Acad. Sci. (USA).' 74, 3947-3950. Shen, V. and Bremer, H. 1977. Chloramphenicol induced changes in the synthesis of ribosomal, transfer and messenger ribonucleic acids in E. coli B/r. J. Bacteriol. 130, 1098-1108. Shinagawa, H.T., Kato, T.I., Makino, K. and Nakata, A. 1983. Cloning and characterization of the umu responsible for inducible mutagenesis in E. coli. Gene 23, 167-174.' Shurvington, C.E. and Lloyd, R.G. 1982. Damage to DNA induces expression of the ruv gene of Escherichia coli. Mol. Gen. Genet. 185, 352- 355. Siegle, E.C. 1983. The Escherichia coli uvrD gene is inducible by DNA damage. Mol. Gen. Genet. 191, 397-400. Siegel, E.C. 1973. Ultraviolet-sensitive mutator strain of Escherichia coli K-12. J. Bacteriol. 113, 145-160. Siegel, E.C. 1981. Complementation studies with the repair deficient uvrD3, uvrEI56 and recLI52 mutations in Escherichia coli. Mol. Gen. Genet. 184, 526-530. Smith, D.H. and Davis, B.D. 1967. Mode of action of novobiocin in E. coli. J. Bacteriol. 93, 71-79. Smith, K.C. and Martignoni, K.D. 1976. Protection of E. coli cells against the lethal effects of ultraviolet and x irradiation by prior X irradiation : A genetic and physiological study. Photchem. Photobiol. 24, 515-523. Sompayrac, L. and Maaloe, 0. 1973. Autorepressor model for control of DNA replication. Nature New Biol. 241, 133-135. Spanos, A., Sedgwick, S.J., Yarranton, G.T., Hubscher, V. and Banks, G.R. 1981. Detection of the catalytic activities of DNA polymerase and their associated exonucleases following SDS-polyacrylamide gel electrophoresis. Nucl. Aci. Res. 9, 1825-1839. Staudenbauer, W.L. 1974. Replication of colicinogenic factor El DNA : evidence of a discontinuous replication mechanism. Nucl. Acid Res. 1, 1153-1164. Staudenbauer, W.L. 1975. Novobiocin - a specific inhibitor of semi conservative DNA replication in permeabilized E. coli cells. J. Molec. Biol. 96, 201-205. Staudenbauer, W.L. 1976a. Replication of small plasmids in extracts of Escherichia coli. Mol. Gen. Genet. 145, 273-280. -132- staudenbauer, W.L. 1976b. Replication of small plasmids in extracts of Escherichia coli : Requirement for both DNA polymerase I and III. Mol. Gen. Genet. 149, 151-158.' Sternglanz, R., Wang, H.F. and Donegan, J.J. 1976. Evidence that both growing DNA chains at a replication fork are synthesized dis- continuously. Biochemistry 15, 1838-1843. Stetler, G.L., King, G.J. and Huang, W.M. 1979. T4 DNA-delay proteins, required for specific DNA replication from a complex that has ATP- dependent DNA topoisomerase activity. Proc. Natl. Acad. Sci. 76, 3737-3741. Stonington, O.G. and Dettijohn, D.E. 1971. The folded genome of Escherichia coli isolated in a protein-DNA-RNA complex. Proc. Natl. Acad. Sci. 68, 6-9. Straus, B., Rabkin, S., Sagher, D. and Moore, P. 1982. The role of DNA polymerase in base substitution mutagenesis on non-instructional templates. Biochemie 64, 829-838. Straus, S.E., Sebring, E.D. and Rose, J.A. 1978. Self primed replication of adeno-associated-virus DNA. In Replication of mammalian parvoviruses, ed. D.C. Ward, P. Tattersall, pp.243-255. Sugimoto, K., Oka, A., Sugisaki, H., Takanami, M. , Nishimura, A., Yasuda, Y. and Hirota, Y. 1979. Nucleotide sequence of Escherichia coli K-12 replication origin. Proc. Natl. Acad. Sci. 76, 575-579. Sugino, A., Peebles, C.L., Kreuzer, K.N. and Cozzarelli, N.R. 1977. Mechanism of action of nalidixic acid : purification of E. coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme. Proc. Natl. Acad. Sci. 74, 4767-4771. Tait, R.C., Harris, A.L. and Smith, D.W. 1974. DNA repair in Escherichia coli mutants deficient in DNA polymerase I, II and/or III. Proc. Natl. Acad. Sci. (USA). 71, 675-679. Thomas, A. and Lloyd, R.G. 1980. Altered regulation of the recA gene in E. coli strain carrying a recA-linked suppressor of lexA. Molec. Gen. Genet. 179, 355-358. Tilley, K., McKittrick, N., Zylicz, M. and Georgopoulos, C. 1983. The DnaK protein modulates the heat shock response of Escherichia coli. Cell 34, 641-646. Tomizawa, J. 1978. Replication of colicin El plasmid DNA Jji vitro. In DNA synthesis in present and future (Molineux, I., Kohiyama, M. eds.) pp.797-826. New York ; Plenum. Tomizawa, J. and Ogawa, H. 1972. Structural genesof ATP-dependent deoxyribonuclease of Escherichia coli. Nat. New Biol. 239, 14. Tomizawa, J.I. and Selzer, G. 1979. Initiation of DNA synthesis in E. coli. Ann. Rev. Biochem. 48, 999-1034. Torrey, T.A., Atlung, T. and Kogoma, T. 1984. DnaA suppressor (dasF) mutants of Escherichia coli are stable DNA replication (SdrA/rnh) mutants. Mol. Gen. Genet. 196, 350-355. -133- Torrey, T.A. and Kogoma, T. 1982. Suppressor mutations (rin) that specifically suppress the recA+ dependence of stale DNA replic ation in Escherichia coli K-12. Mol. Gen. Genet. 187, 225-230. Travers, A.A. and Mace, H.A.T. 1982. The heat shock phenomenon in bacteria - A protein against DNA relaxation. In: Heat shock : From bacteria to man. Eds. Schlesinger, M.J., Ashburner, M. and Tissieres, A. Cold Spring Harbour Laboratory (New York), pp.127- ISO. Trgovcevic, Z., Petrovenovic, D., Petrovenovic, M. and Salajsmic, E. 1980. RecA gene product is responsible for inhibition of DNA synthesis after UV-irradiation. J. Bacteriol. 143, 1506-1508. Uhlin, B.E. and Clark, A.J. 1981. Overproduction of the E. coli RecA protein without stimulation of its proteolytic activity. J. Bacteriol. 148, 386-390. Villani, G., Boiteux, S. and Radman, M. 1978. Mechanism of ultraviolet induced mutagenesis : Extent and fidelity of jji vitro DNA synthesis on irradiated templates. Proc. Natl. Acad. Sci. (USA). 78, 3037-3041. Villani, G., Défais, M., Spadari, S., Caillet-Fauquet, P., Boiteux, S. and Radman, M. 1977. In : Research in photobiology (ed. Castellani, A) Plenum Publ. Corp. N.Y. Vol. 88, pp.709-720. Von Meyenburg, K., Hansen, F.G. Nielsen, L.D. and Riise, E. 1978. Origin of replication, oriC of the Escherichia coli chromosome of specialized transducing phages X asn. Mol. Gen. Genet. 160, 287- 295. Wake, R.G. 1974. Termination of Bacillus subtilis chromosome replication are visualized by autoradiography. J. Molec. Biol. 86, 223-231. Waldstein, E.A., Sharon, R. and Ben-Ishai, R. 1974. Role of ATP in excision of ultraviolet radiation damage in Escherichia coli. Proc. Natl. Acad. Sci. (USA) 71, 2651. Walker, G.C. 1977. Plasmid (pKMI01)-mediated enhancement of repair and mutagenesis : Dependence on chromosomal genes in E. coli K12. Mol. Gen. Genet. 152, 93-103. Walker, G.C. 1978. Isolation and characterization of mutants of the plasid pKMIOI deficient in their ability to enhance mutagenesis and repair. J. Bact. 133, 1203-1211. Walker, G.C. 1984. Mutagenesis and inducible responses to deoxyribo nucleic acid damage. Microb. Rev. 48, 60-93. Walker, G.C. 1985. Inducible DNA repair systems. Ann. Rev. Biochem. 54, 425-457. Walker, G.C. and Dobson, P.P. 1979. Mutagenesis and repair déficiences of E. coli umuG mutants are suppressed by the plasmid pKMIOI. Wechsler, J.A. 1978. The genetics of E. coli DNA replication. In: DNA synthesis, pp.49-70 ed. Molineux, I. and Kohiyama, M. Plenum Press, N.Y. -134- Wechsler, J.A. and Gross, J.D. 1971. Escherichia coli mutants temperature-sensitive for DNA synthesis. Mol. Gen. Genet. 113, 273-284.' Wehr, C.T., Waskell, L. and Glaser, D.A. 1975. Characteristics of cold- sensitive mutants of Escherichia coli K-12 in deoxyribonucleic acid replication. J. Bact. 121, 99-107. Weigler, J.J. 1953. Induction of mutation in a bacterial virus. Proc. Natl. Acad. Sci. 39, 628-636. Weinhardt, A.B. 1982. A study of cell division and DNA synthesis following damage to the E. coli chromosome. (B.Sc. thesis University of Leicester). Welch, M. and McHenry, C. 1982. Cloning and identification of the product of the dnaE gene of Escherichia coli. J. Bacteriol. 152, 351-356. West, S.G. and Howard-Flanders, P. 1984. Duplex-duplex interactions catalyzed by RecA protein allow strand exchanges to pass double strand breaks in DNA. Cell 37, 683-691. Whittier, R.F. and Chase, J.W. 1981 . DNA repair in E. coli strains deficient in single-stranded DNA binding protein. Mol. Gen. Genet. 183, 341-347. Wickner, R.B., Wright, M., Wickner, S. and Hurwitz, J. 1972. Conversion of 0X174 and fd single-stranded DNA to replicative forms in extracts of Escherichia coli. Proc. Natl. Acad. Sci. 69, 3233- 3237. Wickner, S.H. 1978. DNA replication protein of Escherichia coli. Ann. Rev. Biochem. 47, 1163-1191. Wickner, S.H and Hurwitz, J. 1974. Conversion of 0X174 viral DNA to double-stranded form by purified Escherichia coli proteins. Proc. Natl. Acad. Sci. 4120-4124. Wickner, W. and Kornberg, A. 1973. DNA polymerase III star requires ATP to start synthesis on a primed DNA. Proc. Natl. Acad. Sci. 70, 3679-3683. Wickner, W. , Scheckman, R., Geider, K. and Kornberg, A. 1973. A new form of DNA polymerase III and a co-polymerase replicate a long, single-stranded primer-template. Proc. Natl. Acad. Sci. 70, 1764-1767. Willetts, N.S., Clark, A.J. and Low, K.B. 1969. Genetic location of certain mutations conferring recombination deficiency in Escherichia coli. J. Bacteriol. 97, 244. Witkin, E.M. 1967. The radiation sensitivity of E. coli B : A hypothesis relating filament formation and prophage induction. Proc. Natl. Acad. Sci. 57, 1275-1279. Witkin, E.M. 1976. Ultraviolet mutagenesis on inducible DNA repair in E. coli. Bact. Rev. 40, 869-907. -135- Witkin, E.M. and Wermundsen, E. 1978. Targeted and untargeted mutagenesis by various inducers of SOS function in E. coli. Cold Spring Harbor Symp. Quant. Biol. 43, 881-886. Witkin, E. and Kogama, T. 1984. Involvement of the activated form of RecA protein in SOS mutagenesis and stable DNA replication in E. coli. Proc. Natl. Acad. Sci. USa. 81, 7539-7543. Wood, R.D. and Hutchinson, F. 1984. Non targeted mutagenesis of un irradiated lambda phage in E. coli. Host cell irradiated with ultraviolet light. J. Mol. Biol. 173, 293-305. Yamamori, T., Itoh, K., Nakamura, Y. and Yura, T. 1978. Transient regulation of protein synthesis in E. coli upon shift-up of growth temperature. J. Bact. 134, 1133-1140. Yarranton, G.T. and Gefter, M.L. 1979. Enzyme catalysed DNA unwinding : studies on Escherichia coli rep protein. Proc. Natl. Acad. Sci. 76, 1658-1662. Yasuda, S. and Hirota, Y. 1977. Cloning and mapping of the replication origin of Escherichia coli. Proc. Natl. Acad. Sci. 74, 5458-5462. Yota, M., Nagata, T., Schwartz, W . , Wada, C. and Yura, T. 1985. Novel dnaG mutation in a dnaP mutant of Escherichia coli. J. Bacteriol. 162, 830-832. Zahn, G., Tippe-Schindler, R. and Messer, W. 1977. Trans-dominance of dnaA mutants in Escherichia coli. Mol. Gen. Genet. 153, 45-49. Zechel, K., Bouche, J.P. and Kornberg, A. 1975. Replicator of phage G4. A novel and simple system for the initiation of deoxyribonucleic acid synthesis. J. Biol. Chem. 250, 4684-4689. Zyskind, J.W. and Smith, D.W. 1977. Novel E. coli dnaB mutant : Direct involvement of the dnaB252 gene product in the synthesis of an origin-ribonucleic acid species during initiation of a round of deoxyribonucleic acid replication. J. Bact. 129, 1476-1486. Zylicz, M. , Lebowitz, J., McMachan, R. and Georgopoulos, C. 1983. The DnaK protein of E. coli possesses an ATPase and autophos- phorylating activity and is essential in an in vitro DNA replication system. Proc. Natl. Acad. Sci. 80, 6431-6435. Zyskind, J.W., Harding, N.E., Takeda, Y. , Cleary, J.M. and Smith, D.W. 1981. The DNA replication origin of the Enterobacteriaceae. ICN UCLA Symp. Mol. Cell. Biol. 22, 13-25. -136- Appendix I Mutations affecting or involved in SOS functions used in this study There are a variety of mutations in different genes which have effects upon SOS activity. These mutations are one of two classes: (1) mutations in genes directly involved in the regulation or functioning of the response; (2) mutations which result in damage to DNA or disrupt the replication apparatus. These latter for example, include certain temperature sensitive dnaA mutations, which therefore lead to activation of the SOS response in an exactly analogous manner to other SOS inducing treatments. Mutations of the latter class are listed in Table 1.1, while the mutations of the former type which are of relevance to this project are discussed below and can be found listed in Table 1.4. (i) Mutations in the RecA gene As would be expected from the wide range of recA gene activities, mutations in this gene are particularly complex. Some mutations in recA encode a product unable to participate in either recombinational activities or protease functions. These include recA-1, recA-13 which are ochre nonsence mutations and recA-99 an amber nonsence mutation. Other mutations in recA, however, affect only one group of functions and not the other, for example recA-430 (formerly lexB30) encodes a protein deficient in protease activity, but its still recombination proficient (Roberts and Roberts, 1981). This pattern of phenotypes from different recA” mutations, implies that there could be at least two functional domains (Sancer et , 1980, suggest at least three); one concerned with recombination and one with protease activity. The heterogeneity of the different mutations within the gene support this suggestion. Another -I- mutation in the recA gene is the recA453 (formerly Zab-53)> a promoter down mutation which is deficient in recombination and SOS induction (Clark and Vollcan, 1978; Casoregola et , 1982). Mutants carrying the recA200 allele which renders the RecA protein inactive at 42° was isolated by Lloyd et (1979). Another mutation of particular interest, is recA44l (formerly tif-1), a nonsence mutation which at 42° produces a form of RecA more easily activated to the protease state (Castellazzi at al., 1972; Mount, 1979; Phizicky and Roberts, 1981). In fact the protease form of the recA44l protein has been shown, vitro to be more active than the protease form of wild-type recA, cleaving both LexA repressor and cl-repressor approximately three-fold faster (Little et ^ . , 1980). Activation of the RecA44l protein (acquired protease activity), which leads to constitutive expression of the SOS functions at 42°, is known to be independent of DNA damage (Castellazzi et ^ . , 1972). However, the exact mechanism of the activation is not clear, suggested that the simplest mechanism to account for the activation was that the RecA44l protein spontaneously acquires protease activity at 42°, possibly via a change in secondary or tertiary structure. However, recA44l activity is also known to be stimulated by adenine and inhibited by guanosine or cytidine (Castellazi et al., 1972) (ii) Mutations in the LexA gene Mutations in the lexA gene can also have either a suppressing or inducing effect upon the SOS response. Dominant lexA mutations, such as lexA-3 or lexA-102, produce repressor proteins which are highly resistant to cleavage by RecA protease and block expression of most SOS functions (Little et ^ . , 1980). Two other mutations in the lexA gene however have an opposite effect, these are lexA(ts) (formerly tsl) and spr mutations : -II- lexA(Ts) mutations produce a thermosensitive gene product, whislt spr mutations (lexA def) are thought to produce very little of, or a non-functioning form of the lexA gene product (Pacelli et , 1979). During the expression of these mutations the cells filament and this is eventually lethal. Therefore, the spr mutation can only be 'isolated in an sfi~ background. Expression of these mutations, as well as resulting in filamentation, also leads to the induction of various other (primarily lexA controlled) SOS functions including increased synthesis of RecA protein (Pacelli et al., 1979). -Ill- Appendix II By using normal PI-transduction it was not possible to introduce the lacZYA genes into strain SC60 (transformation efficient). Thus since the lacZYA genes in the JMX strain were located on a phage 080, phage 080 was introduced into strain SC60 (deleted for lac) to create the same homology. The new strain was designated SC6l. Then by using normal PI-transduction the lacZYA carried by JMX was transduced to the new recipient (SC6l). Blue and T1 resistant transductants were selected on nutrient agar plates supplemented with X-gal and drops of T1-phage. This double selection was used since phage 080 carries a tonB mutation confers T1 resistance, and the blue colour indicates the presence of the lacZYA genes. Transductants which showed the highest level of g-galacto- sidase activity (5000-8000 units) were selected and designated SC62. This construction was carried out in collaboration with Dr S. Casaregola. -IV- Analysis of DNA replication during the SOS response in Escherichia coli by M.A. Khidhir Abstract. Recovery of DNA synthesis in UV-irradiated E. coli. E. coli undergoing the SOS response to DNA damage (e.g. UV-irradiation) displays transient inhibition of DNA synthesis. The mechanism of the inhibition and of the recovery of DNA synthesis following UV-irradition was analysed in several mutants defective in repair or in the regulation of the RecA-LexA dependent SOS response. The results indicated that inhibition is not an inducible function and is probably due to the direct effect of lesions in the template blocking replisome movement. In contrast, recovery of DNA synthesis after UV required protein synthesis and was clearly shown to be an SOS function under RecA control. In addition, analyses involving a recA200 (temperature sensitive RecA) and recA constitutive mutants demonstrated that RecA protein was directly required for recovery in addition to its regulatory role. These experiments however also suggested that an inducible Irr (inducible replisome reactivation) factor under RecA control was also required for post UV-recovery. In vitro mutagenesis. In this part of my study attempts were also made to establish an vitro system for untargeted mutagenesis based upon a 'plasmid-repl-ication systenr. “ Ttiis~ Involved establlshtng-xjpttmum --- conditions for extracting plasmid DNA (replicated vitro) and a highly efficient transformation system, in order to analyse directly mutagenic events.