Identification of Functional Domains Involved in BTG1 Cell Localization

Identi®cation of functional domains involved in BTG1 cell localization

A Rodier1, P Rochard1, C Berthet2, JP Rouault2, F Casas1, L Daury1, M Busson1, JP Magaud2, C Wrutniak-Cabello1 and G Cabello*,1

1UMR DieÂrenciation Cellulaire et Croissance (INRA, UniversiteÂ Montpellier II, ENSAM), UniteÂ d'Endocrinologie Cellulaire, INRA, 2 place Viala, 34060 Montpellier Cedex 1, France; 2UniteÂ INSERM U453, Centre LeÂon BeÂrard, 69373 Lyon Cedex 08, France

We have previously shown that BTG1 stimulates the basis of their sequence homology (GueÂ henneux et myoblast dierentiation. In addition, this protein displays al., 1997). Their predicted peptidic sequence displays a a major nuclear localization in con¯uent myoblasts, high degree of conservation in two regions of 22 and decreasing during the early steps of dierentiation, and is 20 amino acids named boxes A and B (GueÂ henneux et essentially detected in the cytoplasm of mature myo- al., 1997) which constitute the two signature motifs of tubes. To identify the domains involved in the cellular this family. tracking of BTG1, we observed the localization of A previous study demonstrated that BTG1 expres- several BTG1 sequences fused to bGalactosidase. The sion is easily detected in quiescent adult tissue (Rouault highly conserved B box among all members of the BTG et al., 1992). In agreement with this observation, BTG1 family induces a signi®cant nuclear localization of the mRNA is preferentially induced at the G0/G1 phase bGal moiety, enhanced by presence of the BTG1 transition of the cell cycle (Rouault et al., 1992) and carboxy-terminal sequence. In addition, a functional decreases as the cells progress throughout G1. More- Nuclear Export Signal (NES) overlaps the B box. over BTG1 and its related proteins inhibit proliferation Moreover, presence of the ®rst 43 NH2-terminal amino of several cell lines including NIH3T3, PC12 and QM7 acids reduced the nuclear localization of each chimeric quail myoblast lines (Rouault et al., 1992; Montagnoli protein tested. Last, the BTG1 amino-terminal domain et al., 1996; Matsuda et al., 1996; Rodier et al., 1999). bears an LxxLL motif favouring nuclear accumulation, Therefore, it is believed that these proteins are and another region encompassing the A box inhibiting members of an antiproliferative protein family. nuclear localization. In contrast to a BTG1 mutant However, their molecular role is poorly understood. exclusively localized in the cytoplasm, transient expres- The previous observation that Tob (Transducer Of sion of a mutant displaying a nuclear localization erbB-2) interacts with the membrane-bound growth enhanced myoblasts withdrawal from the cell cycle and factor receptor erbB2 suggests that it could be terminal dierentiation, thus mimicking the myogenic involved in growth factor-signalling pathway (Matsu- in¯uence of BTG1. In conclusion, several regions of da et al., 1996). More recent studies using a system of BTG1 are implicated in its cellular localization, and two hybrid interactions demonstrated that BTG1 and BTG1 myogenic activity is induced at the nuclear level. BTG2 (Tis21/PC3) interact with other proteins. First, Oncogene (2001) 20, 2691 ± 2703. Herschman's group reported an interaction with PRMT1 (Protein-Arginin N-MethylTransferase) (Lin Keywords: BTG1; NLS; NES; myoblast; cell localiza- et al., 1996), which asymmetrically methylates arginine tion residues occurring in the glycine- and arginine-rich domain (RGG) of hnRNP substrates (Rajpurohit et al., 1994) or histones (Ghosh et al., 1988). Further- Introduction more, by using CARM1, homologous to protein arginine methyltransferase PRMT1, Chen et al. The btg1 (B-cell Translocation Gene 1) gene coding (1999) demonstrated that arginine methylation con- sequence was isolated from a translocation break point tributes to transcriptional regulation. Other interac- t(8; 12) (q24; q22) in a case of B-cell Chronic tions have been subsequently reported with CAF1 Lymphocytic Leukaemia (CLL-B) (Rimokh et al., (Rouault et al., 1998; Bogdan et al., 1998) and the 1991; Rouault et al., 1992) and shared high homology homeoprotein Hoxb9 (Prevot et al., 2000). CAF1 is with the previously identi®ed tis21 (Fletcher et al., the murine homologue of a yeast component of the 1991) and pc3 (Bradbury et al., 1991) genes. To date, CCR4 transcriptional regulatory system (Draper et seven genes have been classi®ed in the same family on al., 1995) interacting with BTG1 and BTG2 through the B box (Rouault et al., 1998). More recently, Ikematsu et al. (1999) described such an interaction between Tob2 and the human homologue of CAF1, *Correspondence: G Cabello Received 19 December 2000; revised 23 January 2001; accepted 12 stressing a possible functional importance of this February 2001 association for BTG family proteins. In agreement Functional domains involved in BTG1 localization A Rodier et al 2692

Figure 1 The B box and the carboxy terminus domain of BTG1 are involved in the nuclear localization of the protein. Cells were transiently transfected with the vector pCH110 encoding the wild type bGalactosidase (a); or encoding the following sequences fused to bGal: box B, B/bGal (b); full length BTG1, BTG1/bGal (c); BTG1 without the B box, BTG1DB/bGal (d); B box and the carboxy-terminal region of BTG1, B-C-ter/bGal (e); carboxy-terminal domain of BTG1 (aa: 119 ± 171), C-ter/bGal (f); B box and

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2693 with these data suggesting that a part of their exclusive nuclear localization enhances myoblast with- antiproliferative activity involves the control of gene drawal from the cell cycle and their terminal expression, Guardavaccaro et al. (2000) reported that dierentiation, whereas a cytoplasmic mutant was cyclin D1 transcription is decreased by BTG2 devoid of any myogenic activity. These data suggest expression, leading to the accumulation of the that regulation of BTG1 cellular tracking partly hypophosphorylated, growth inhibitory forms of drives its in¯uence on myoblast dierentiation. pRb. In addition, it has been shown that CAF1 is capable of binding cyclin-dependent kinases (Ikematsu et al., 1999). Results In previous works (Marchal et al., 1995; Rodier et al., 1999) we demonstrated that the BTG1 protein is The B box and the carboxy terminus domain are involved located in the nucleus of con¯uent QM7 avian in the nuclear localization of BTG1 myoblasts. Its nuclear accumulation was increased by the presence of triiodothyronine (T3) or 8-Br-cAMP The well-conserved B box has been shown to mediate which also reduced proliferation and stimulated the interaction of BTG1 with the nuclear protein dierentiation in this cell line (Marchal et al., 1993, CAF1 in yeast (Rouault et al., 1998). This result raised 1995). Interestingly, we also observed that the nuclear the question of a possible involvement of this domain localization of BTG1 displays a transient feature since in the nuclear localization of BTG1. To test this in the early dierentiation steps, amounts of the hypothesis, we expressed a B box/bGal fusion protein protein decrease in the nucleus and BTG1 becomes in QM7 cells. Whereas bGal alone was detected in the essentially located in the cytoplasm of mature nuclei of a reduced number of transfected cells myotubes (Rodier et al., 1999). This cellular tracking (percentage of cells harbouring exclusive nuclear is probably associated with substantial changes in the staining N+percentage of cells harbouring simulta- activity of the protein. neous nuclear and cytoplasmic staining N/C=N+N/ The major aim of this study was to identify BTG1 C: 7%; Figure 1a), the B box drove signi®cant amounts sequences involved in the cellular tracking of the of this protein into the nuclei, re¯ected by an 11.5-fold protein, using chimeric constructs composed of BTG1 increase in the number of cells displaying nuclear domains fused to the bGalactosidase enzyme. We ®rst staining (N+N/C: 81%, P50.001; Figure 1b). Con- observed that BTG1 does not bear any Nuclear versely, deletion of the B box in the BTG1 integral Localization Sequence (NLS) similar to that pre- protein fused to bGal fully abrogated its nuclear viously identi®ed on SV40TAg (Newmeyer and localization (N+N/C: 0% vs 11% for BTG1/bGal, Forbes, 1988) or nucleoplasmin (Dingwall et al., P50.001; Figure 1d and c respectively). 1982) and we found that several sequences are In addition, although it was unable to aect by itself speci®cally involved in the determination of each the cell localization of the bGal moiety (Figure 1f), the BTG1 cellular localization. We concluded that the B presence of the BTG1 carboxy-terminal strongly box is sucient to drive signi®cant amounts of bGal potentiated the frequency of nuclear staining induced in the nucleus, and that its in¯uence is strongly by the B box (Figure 1e). Not only was bGal detected increased in the presence of the BTG1 carboxy- in the nuclei of all cells (N+N/C: 100% vs 81% for B terminal domain. Moreover, we identi®ed a functional box/bGal, P50.05; Figure 1e and b respectively), but Nuclear Export Signal (NES) overlapping the B box, in majority they displayed an exclusive nuclear staining closely related to that described in the viral Rev (N: 76% vs 4% for B box/ûGal, P50.001; Figure 1e protein (Fischer et al., 1995), cellular protein PKI and b respectively), thus underlining a major in¯uence (Wen et al., 1995) or MAPKK (Fukuda et al., 1996). of this sequence. In addition, 43 residues of BTG1 amino-terminus These data clearly suggested the involvement of a inhibit the nuclear accumulation of several chimeric cooperation between the B box and the carboxy proteins. We also characterized two other domains of terminal domain in the nuclear localization of BTG1. this amino-terminal region involved in BTG1 cellular In a recent study, Bogdan et al. (1998) found that the localization: an LxxLL motif favouring nuclear ability of BTG1 to interact with CAF1 depended on accumulation, and a region encompassing the A box the integrity of p34 cdk2 phosphorylation site (Ser involved in the cytoplasmic localization of the protein. 159) identi®ed in the carboxy-terminal domain of the Last, we observed that a BTG1 mutant displaying an protein. Similarly, we found that disruption of this

the carboxy-terminal region of BTG1 in which serine 159 was replaced by a glycine, B-CterS159G/bGal (g). Cells were submitted to immuno¯uorescence studies using an antibody raised against b-Gal and counted according to the cell localization of the bGal proteins. The percentage of cells that displayed exclusive bGal nuclear staining is expressed relatively to the total number of cells that displayed staining for the bGal (N). The percentage of cells that displayed bGal simultaneous nuclear and cytoplasmic staining is expressed relatively to the total number of cells that displayed staining for the bGal (N/C). The percentage of cells that displayed exclusive bGal cytoplasmic staining is expressed relatively to the total number of cells that displayed staining for the bGal (C). More than 100 cells positive for bGal were counted for each fusion protein. The results are mean+s.e.m. of ®ve separate experiments (n=5). (6400)

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2694 phosphorylation site by a glycine substitution to serine nuclear import of various proteins, we should admit 159 signi®cantly decreased the number of cells only passive phenomena (Guiochon-Mantel et al., displaying an exclusive nuclear staining (N: 46% vs 1994). In the same conditions, we also assessed the 76% for B box/C-ter/bGal, P50.001; Figure 1g and e in¯uence of the BTG1 carboxy-terminus. Energy respectively) without altering the detection frequency deprivation induced a two- (48C; P50.05; Figure of a nuclear localization (100% for the two con- 2Ab,B) or threefold reduction (sodium azide; structs). P50.05; Figure 2Ac,B) in the number of cells Guiochon-Mantel et al. (1994) have previously displaying a nuclear localization of the B box/ûGal reported that, besides inducing an energy-dependent protein, thus indicating that the nuclear import nuclear translocation, a classical Nuclear Localisation mediated by the B box was energy-dependent, whereas Signal (NLS) sequence could also mediate a passive the export process was energy-independent. Moreover, nuclear protein export. To compare the functionality of in the presence of the BTG1 carboxy-terminus, a the B box with that of a classical NLS, we studied the majority of cells displayed an exclusive nuclear staining cell localization of the B box/ûGal chimeric protein not in¯uenced by energy deprivation (Figure 2Ad ± under energy deprivation induced by sodium azide or f,B). This last result indicates that the carboxy-terminal incubation of the cells at 48C (Figure 2A,B). In these domain abrogates passive export of the B box/ûGal conditions previously shown to inhibit the active protein by a mechanism independent of energy.

B a) b)

Figure 2 Release of the B/bGal protein in the cytoplasm under energy depletion is abrogated by the carboxy-terminal region. (A) B/bGal overexpressing cells: control (a), or 10 mM sodium azide treated cells for 4 h (b), or cells incubated at 48C for 4 h (c). B- Cter/bGal overexpressing cells: control (d), or 10 mM sodium azide treated cells for 4 h (e), or incubated at 48C for 4 h (f). These cells were pretreated with cycloheximide (20 mg/ml) for 30 min to inhibit protein synthesis and incubated in presence of 6 mM 2- deoxy-glucose. (6400). (B)B/bGal (a) and B-C-ter/bGal (b) cell localizations under energy deprivation (sodium azide or low temperature). More than 100 cells positive for bGal were counted in each condition according to Figure 1 comments. The results are mean+s.e.m. of three separate experiments

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2695 A functional NES (Nuclear Export Signal) overlaps the bGal, P50.05; Figures 5a and 1c respectively). B box Conversely, fusion of the hydrophobic domain to a chimera mostly located in the nucleus (BTG1D1 ± 43/ An increasing number of proteins has been shown to bGal) induced an exclusive cytoplasmic localization of be exported from the nucleus by the way of an the new protein (N+N/C: 0% vs 85%, P50.001, interaction of the Nuclear Export Signal (NES) Figure 5c,b), thus indicating a particular importance of sequence with CRM1/Exportin 1, a nuclear export this domain. However, comparison of BTG1/bGal and receptor belonging to the importin b family (Fornerod BTG1D30 ± 43bGal suggested that functionality of the et al., 1997; Fukuda et al., 1997; Kudo et al., 1997; hydrophobic domain is clearly inhibited by the Ossareh-Nazari et al., 1997; Stade et al., 1997). NES sequence 30 ± 43 bearing two putative phosphorylation identi®ed to date share a characteristic Leucine rich sites (N+N/C: 11% vs 0%, P50.001, Figures 1c and sequence (Hall et al., 1983) shown in Figure 3Aa,b. 5c). Interestingly, in the absence of the BTG1 Interestingly, we identi®ed on BTG1 one putative NES, hydrophobic sequence, the 30 ± 43 sequence exerted overlapping the B box (Figure 3Ac). an opposite in¯uence: its deletion in the D1 ± 30 mutant Functionality of this putative NES was established in induced a threefold increase in the number of cells the following experiments (Figure 3B). First, juxtaposi- displaying a nuclear staining (N+N/C: 85 vs 25%, tion to the B box of the small sequence (amino acids P50.001, Figure 5a,b). This result suggests that the 94 ± 98) restoring the whole NES sequence induced a domain harbouring two putative phosphorylation sites ®vefold reduction in the number of cells displaying an could also regulate functionality of a downstream exclusive nuclear localization of the B box-C-ter/bGal BTG1 sequence. protein (N: 15% vs 76%, P50.001; Figure 3Ba,b). Second, we studied the in¯uence of Leptomycin B, which abrogates NES functionality by antagonizing its Two additional regions of BTG1 are involved in the interaction with CRM1 (Wol et al., 1997; Kudo et al., cellular localization of the protein 1998), upon the cellular localization of the endogenous To further extend the mapping of the BTG1 domains BTG1. After QM7 cells synchronization in G0/G1 by involved in its cellular localization, we paid particular serum starvation, as expected, BTG1 was essentially attention to the in¯uence of the LQELL sequence detected in the nucleus (Figure 3Cb compared to (amino acids 44 ± 48) corresponding to the consensus control non-synchronized Figure 3Ca); 6 h after the LxxLL motif considered as a domain of interaction release in G1 of the cells by adding 10% foetal calf with members of the nuclear receptor superfamily serum to the culture medium, BTG1 was clearly (Heery et al., 1997), and to the sequence encompassing exported from the nucleus (Figure 3Cc); however, the well-conserved A box. Leptomycin B fully abrogated this phenomenon Observation that deletion of the LQELL sequence (Figure 3Cd). induced a sixfold decrease in the frequency of cells displaying a nuclear localization of the BTG1D1 ± 43/ The amino-terminal region impedes nuclear localization of ûGal protein (N+N/C: 15% vs 85%, P50.001; Figure the bGal mutants 6a compared to Figure 5b), strongly suggests that this motif is involved in the nuclear localization of BTG1. During the course of this study, we obtained several This hypothesis is well supported by the additional data indicating that the BTG1 amino-terminal inhibits result that this LxxLL sequence drove signi®cant the nuclear localization of the chimeric proteins (Figure amounts of bGal into the nucleus (N+N/C: 42% vs 4a ± c). First, whereas a low but signi®cant number of 7% for bGal only, P50.001; Figure 6c compared to cells displayed a nuclear localization of the bGal Figure 1a). protein, fusion of the amino-terminal sequence to the A further deletion encompassing the A box enzyme was associated with an exclusive cytoplasmic (BTG1D1 ± 78) induced dramatic changes in the localization in all transfected cells. In the same way, localization of the chimeric protein. All cells displayed deletion of this 93 amino acids domain in BTG1/bGal a nuclear localization of this mutant (N+N/C: 100% (NES-B-C-ter/bGal) induced an eightfold increase in vs 15% for BTG1D1 ± 48/ûGal, P50.001; Figure 6b the frequency of the cells displaying a nuclear staining compared to 6a), thus indicating a strong in¯uence of (N+N/C: 93% vs 11% for BTG1/bGal, P50.001; this sequence upon BTG1 cytoplasmic retention. Figure 3Bb compared to Figure 1c). These observations led us to search for the BTG1 sequences involved in such a cytoplasmic retention. The carboxy-terminal part of BTG1 plays an important A hydrophobic domain (amino acids 8 ± 27) and role in the myogenic activity of the protein putative phosphorylation sites for PKC (serine 33) or We have previously shown that BTG1 overexpression casein kinase II (serine 43) have been previously induces myoblast withdrawal from the cell cycle and mapped in this BTG1 region (Rouault et al., 1992; stimulates terminal dierentiation. In addition, we have Figure 5). Deletion of the hydrophobic domain suggested that nuclear localization of this protein is (BTG1D1 ± 30/bGal) induced a twofold increase in the needed for this activity (Rodier et al., 1999). Char- number of cells in which the BTG1/bGal protein was acterization of functional domains involved in the cell located in the nucleus (N+N/C: 25 vs 11% BTG1/ localization of the protein allowed us to study the

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2696

NES B box

Figure 3 BTG1 protein bears a functional Nuclear Export Signal (NES). (A) Schematic representation of the consensus NES (a) and aligned NES sequences of rev, rex, MAPKK, PKI (b). Important hydrophobic residues in the sequence are in bold type (b). The putative NES sequence overlaps the amino-terminal residues present in the B box of BTG1 (c). (B) Cell localizations of B-C-ter/ bGal (a) and NES-B-C-ter/bGal (b) proteins studied by cytoimmuno¯uorescence as described in Figure 1. The results are presented as the mean+s.e.m. of ®ve separate experiments and cell counting (n=5). (6400). (C) Leptomycin B (LMB) in¯uences BTG1 endogenous localization after induction of QM7 cell cycle arrest by serum deprivation. Cytoimmuno¯uorescence experiments were performed using an antibody raised against BTG1. Control proliferative cells (a), G0 synchronized cells after 24 h of serum starvation (b), 6 h after addition of 10% serum in the absence (c) or presence of LMB (10 ng/ml) (d). (6400)

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2697

Figure 4 The amino terminal region impedes BTG1 nuclear localization. Immuno¯uorescence results obtained by staining the bGal present in fused protein bearing the amino-terminal region of BTG1: the N-ter-NES-B/bGal (a), N-ter-NES/bGal (b), and N- ter/bGal (c) in transient transfected QM7 cells. Results were assessed by counting positive cells for bGal as described in Figure 1. The results are presented as the mean+s.e.m. of ®ve separate experiments and cell counting (n=5). (6400) myogenic in¯uence of two BTG1 mutants displaying BTG1/CAF1 is probably an important event able to an essential nuclear or cytoplasmic localization. induce some of these processes. In QM7 cells we transiently expressed the B box/C- ter/bGal mutant displaying a major exclusive nuclear localization, and the N-ter-NES/bGal mutant display- Discussion ing an exclusive cytoplasmic localization. Cells expressing bGal were used as control. The involvement of members of the BTG family for Interestingly, B box/C-ter/bGal expression induced development and cell dierentiation is clearly appearing. a signi®cant acceleration of myoblast withdrawal Besides the general antiproliferative activity of this from the cell cycle (P50.001, Table 1) assessed by family, Xbtg1 has been implicated in gastrulation the number of myoblasts expressing connectin, a movements, and is a target of Xbra and Pintallavis, two post-mitotic marker, at cell con¯uence. Consequently, genes playing a major role in the early events of Xenopus this mutant also signi®cantly stimulated myoblast development (Saka et al., 2000). In addition, a novel dierentiation, as indicated by an increase in the member of the family, FOG3, controls sexual fate in value of the fusion index (P50.001, Table 1). In Caenorhabditis elegans germ cells (Chen et al., 2000). addition, expression of the N-ter-NES/bGal mutant Moreover, it has also been reported that TIS 21 did not in¯uence signi®cantly these two myogenic expression identi®es single neuroepithelial cells that events. switch from proliferative to neuron-generating divisions Last, as it has been reported that serine 159 plays a (Iacopetti et al., 1999). Similarly, in a previous study, we key role in the interaction between BTG1 and CAF 1 found that BTG1 is probably implicated in the induction (Bogdan et al., 1998), we studied the myogenic activity of myogenic dierentiation by increasing myoblast of the Bbox-C-ter S159G/bgal mutant. Whereas we withdrawal from the cell cycle (Rodier et al., 1999). In found that this protein was detected in the nucleus of this study, we have also provided the ®rst data indicating almost all cells, its expression did not signi®cantly the occurrence of a BTG1 cellular tracking. Whereas in¯uence myoblast dierentiation (Table 1). the protein is clearly located in the nucleus at myoblast This set of data clearly suggests that the B box and con¯uence, it gradually reaches cytoplasm during C-terminal domains of BTG1 play a major role in the myotube formation and maturation. These observations myogenic in¯uence of the protein, and that the nuclear suggest that BTG1 tracking is probably involved in the localization of the protein is involved in the stimulation regulation of its biological activity. As no data were of myoblast dierentiation. In addition, the interaction available on this aspect, we addressed this question by

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2698

Figure 5 The ®rst 43 residues of BTG1 are involved in BTG1 cell localization. Immuno¯uorescence study of the localization of chimera protein containing BTG1 deleted from the ®rst 30 residues encompassing the hydrophobic residues fusioned to bGal, BTG1D1 ± 30/bGal (a), BTG1 deleted from the ®rst 43 residues encompassing the hydrophobic domain and the potential phosphorylation sites domain fusioned to bGal, BTG1D1 ± 43/bGal (b), and BTG1 deleted of the potential phosphorylation site domain fusioned to bGal, BTG1D30 ± 43/bGal (c). Results were assessed by counting positive cells for bGal as described in Figure 1. The results are presented as the mean+s.e.m. of ®ve separate experiments and cell counting (n=5). (6400)

using transient expression of chimeric proteins including members drove signi®cant amounts of the bGal moiety dierent BTG1 domains fused to bGalactosidase. into the nucleus. Its functional role in the context of Cytoimmuno¯uorescence studies allowed us to observe the integral protein is also suggested by the observation the cellular localization of each chimera, and therefore to that deletion of this sequence fully abrogated the assess the importance of each domain for BTG1 nuclear localization of the protein fused to bGal. tracking. This approach could also provide some However only 4% of transfected cells displayed an indications concerning possible functional partners exclusive nuclear localization of the B box/bGal involved in BTG1 function, and the cell compartment protein, thus suggesting that this sequence could act involved in the myogenic activity of the protein. as a weak NLS. Alternatively, it could be proposed In this study, we found that several domains are that, although able to support an ecient nuclear involved in the cellular localization of BTG1. Overall, import mechanism, the B box is not able, by itself, to the COOH terminus is essentially involved in nuclear maintain bGal in the nucleus, thus inducing a import, export and retention whereas the amino- permanent shuttling between cytoplasm and nucleus. terminal part appears to play a major role in In experiments of energy deprivation, we obtained cytoplasmic retention. similar results for B box functionality to those previously reported for classical NLS (Kudo et al., 1997). In particular, B box is clearly involved in an Several domains are involved in the nuclear localization of active nuclear import process inhibited by sodium azide BTG1 or low temperature. Moreover, the B box/bGal protein, as the NLS of the progesterone receptor fused BTG1 nuclear import and retention We ®rst observed to bGal (Guiochon-Mantel et al., 1994), exits the that the well-conserved B box of the BTG family nucleus according to a passive pathway. These

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2699

Figure 6 Other amino-terminal domains regulate BTG1 cell localization. Immuno¯uorescence study of BTG1 deleted from the ®rst 48 residues of BTG1 containing the hydrophobic residues, the potential phosphorylation sites, and a LxxLL motif, BTG1D1 ± 48/ bGal (a), BTG1 deleted from the ®rst 78 amino acids encompassing the A box (b). Furthermore, we studied the localization of a fusion protein containing the ®ve residues of the LxxLL motif (LQELL) fusioned to the bGal (c). Results were assessed by counting positive cells for bGal as described in Figure 1. The results are presented as the mean+s.e.m. of ®ve (a,b) or three (c) separate experiments and cell counting. (6400)

Table 1 In¯uence of B box-C-ter/bGal, N-ter-NES/bGal or B box-C-terS159G/bGal expression in myoblast withdrawal from the cell cycle and terminal dierentiation bGal B box-C-ter/bGal N-ter-NES/bGal B box-C-terS159G/bGal

% nuclei bGal positive (N+N/C) 6.3+1.2% 100+0.0% 0.0+0.0% 97.6+0.9% Post-mitotic cells 5.0+0.5% 10.0+0.9%** 4.9+0.5% 5.5+0.6% Fusion index 12.8+1.0% 31.6+1.9%** 16.6+2.0% 17.2+2.2%

In order to assess the in¯uence of BTG1 cell localization on myoblast withdrawal from the cell cycle and their terminal dierentiation, we tansiently expressed two BTG1 mutants displaying a major nuclear (B box-C-ter/bGal) or an exclusive cytoplasmic (N-ter-NES/bGal) localization in QM7 avian myoblasts. Cell localization was assessed at cell con¯uence at the induction of dierentiation; per cent of cells with bGal in the nuclei was established in all bGal-expressing cells. Myoblast withdrawal from the cell cycle was assessed by determining the number of cells expressing connectin (a post-mitotic marker) at cell con¯uence. Results are expressed as per cent of the total number of counted nuclei. Myoblast dierentiation was assessed by calculation of the fusion index (FI) 48 h after serum removal (FI=Number of nuclei included in myotubes6100/total number of nuclei in the same micrpscopic ®eld). The per cent of post-mitotic cells and the fusion index were established by counting of all cells, independently on bGal staining, in order to take into account a possible paracrine in¯uence induced by changes in gene expression resulting from BTG1 presence in the nucleus. All data are presented as the mean+s.e.mean of seven independent experiments. **P50.001 with bGal expressing cells observations, clearly in agreement with the second Another important result is the in¯uence of the possibility, explain the simultaneous detection of B BTG1 carboxy-terminal. Whereas this sequence did box/bGal protein in the cytoplasm and the nuclei of not change bGal cellular localization by itself, it 81% of the transfected cells. In addition, it appears induced dramatic changes in B box functionality. that though B box does not share any sequence Fusion of this domain to the B box abrogated the homology with previously described NLS, it clearly residual exclusive cytoplasmic localization of B box/ acts in a similar way than a classical NLS. bGal, and conversely resulted in an exclusive nuclear

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2700 localization of the chimera in 76% of the transfected functionality of NESs by altering their ability to cells. Moreover, we have shown that: (i) the BTG1 interact with CRM1 (Wol et al., 1997; Kudo et al., carboxy-terminus is not able to drive bGal into the 1998), is considered as a major characteristic of these nucleus and (ii) in energy deprivation experiments, this sequences. Interestingly, we showed that this antibiotic sequence abrogates the passive nuclear export process inhibited the nuclear eux of the endogenous BTG1 supported by the B box. These data clearly indicate protein occurring during myoblast release in G1 after that the BTG1 carboxy-terminal induced nuclear serum deprivation. Second, restoration of the NES retention of the protein sequence in a construct essentially detected in the In addition, a recent study demonstrated that BTG1 nucleus (B-C-ter/bGal) strongly reduced the frequency and CAF1 interaction depends on the integrity of a of this exclusive localization, thus involving the motif phosphorylation site (serine 159) identi®ed in the in the export sensitivity to Leptomycin B. Altogether, BTG1 carboxy-terminal (Bogdan et al., 1998). We our data clearly indicate that an atypical nuclear found that: (i) the presence of the C-terminus besides import motif (B box), a consensus NES, and to the B box induced nuclear retention of bGal and (ii) interactions with nuclear proteins regulated by the disruption of the phosphorylation site by a glycine phosphorylation, are involved in nuclear BTG1 to serine 159 substitution signi®cantly inhibited this accumulation. However, we showed that other activity. This clearly suggests that the nuclear retention processes are involved in the cellular localization of induced by the C-terminal is probably related to its the protein. phosphorylation-dependent ability to allow formation of a BTG1/CAF1 complex. In addition, Bogdan et al. Two domains are involved in the cytoplasmic retention of (1998) have established that disruption of the BTG1 BTG1 carboxy-terminal phosphorylation site not only inhibits the interaction of BTG1 with CAF1, but also its Further analysis of BTG1 led us to conclude that antiproliferative activity. All these data suggest that the several sequences located in the amino-terminal T3 induced rise in BTG1 nuclear accumulation domain of the protein were involved in a strong previously shown at cell con¯uence could play a major inhibition of BTG1 nuclear import. In particular, role in the increase of myoblast withdrawal rate from fusion of amino acids 1 ± 93 strongly reduced the the cell cycle, and the resulting stimulation of terminal nuclear localization of several chimeric proteins. In dierentiation (Marchal et al., 1995; Rodier et al., additional experiments, we found that two domains are 1999). essentially involved in the cytoplasmic retention of In addition to these sequences, we found that BTG1 BTG1. A hydrophobic domain has been previously displays an LxxLL-related sequence (LQELL, amino identi®ed in the ®rst 30 NH2-terminal amino acids of acids 44 ± 48). Such sequences, previously identi®ed in the protein. Interestingly, we found that, in the absence transcriptional coactivators, mediate their interaction of a juxtaposed sequence displaying two putative with members of the nuclear receptor superfamily phosphorylation sites (PP), addition of this domain (Heery et al., 1997). We found that this sequence was induced an exclusive cytoplasmic localization of a able to drive bGal to the nucleus, with reduced chimeric protein initially detected in the nucleus of a eciency relatively to the B box; in addition, deletion majority of cells. However, this in¯uence was sig- of this sequence clearly decreased the nuclear localiza- ni®cantly inhibited by the presence of the PP domain tion of the BTG1D1 ± 43/ûGal chimeric protein. These (2.5 decrease in the frequency of nuclear staining, D1± data raise the possibility that, by directly interacting 30), thus raising the hypothesis that the ability of the with BTG1, some nuclear receptors could contribute NH2-terminus to maintain BTG1 in the cytoplasm to its nuclear import. In addition, as this import could depend on phosphorylation of a downstream activity appears strongly decreased in the presence of sequence. In addition, the involvement of a hydro- a domain bearing two putative phosphorylation sites phobic domain in BTG1 retention suggests a possible (Ser 33 and Ser43), this putative interaction could be interaction with cell membranes, in agreement with under the control of post-transcriptional events. previous cytoimmuno¯uorescence data obtained in Therefore our data clearly raise the question of a mature myotubes (Rodier et al., 1999). possible interaction of BTG1 with nuclear receptors, Lastly, we also found that fusion of a sequence and of its involvement in the physiological activity of encompassing the well-conserved BTG A box led to a the protein. sevenfold decrease in the nuclear localization frequency of a chimeric protein (BTG1D1 ± 43/ûGal), thus under- The nuclear export of BTG1 is mediated by a Nuclear lining the functional importance of this sequence for Export Signal Besides the occurrence of an active the cytoplasmic retention of BTG1. As it has been import pathway, we demonstrated that a putative previously shown that members of the BTG family NES sequence encompassing the B box was indeed could physically interact with cytoplasmic or mem- involved in BTG1 tracking. Not only the sequence brane proteins, one possibility is that this sequence of this motif exactly matched the characteristic leucine could mediate such interactions, thus both inducing spacing reported in other NESs, but also we obtained alterations in some signalling pathways and preventing direct experimental evidence of its functional activity. the occurrence of mechanisms triggered at the nuclear First, sensitivity to Leptomycin B, shown to disrupt level.

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2701 The nuclear localization is involved in the myogenic influence of BTG1 We have previously shown that BTG1 is at the brink of detection in proliferative myoblasts; it is essentially expressed at cell con¯uence in avian myoblasts, just before the induction of dierentiation. At this stage, it increases myoblast withdrawal from the cell cycle and stimulates consequently their terminal dierentiation Figure 7 Domains of BTG1 involved in the cellular localization (Rodier et al., 1999). These data suggest that, in this of the protein. From our study, several functional domains are cell type, BTG1 function is more related to the involved in BTG1 cell localization: (i) the B box, a Nuclear induction of the myogenic program than to an Localization Sequence (amino acids 98 ± 117), whose activity is enhanced by the carboxy-terminal domain of BTG1. This inhibition of proliferation. In addition, we found that in¯uence depends on the integrity of a phosphorylation site BTG1 displays a major nuclear localization at cell (serine 159); (ii) a functional Nuclear Export Signal (amino acids con¯uence, signi®cantly increased by T3, which also 94 ± 104) which drives the protein in the cytoplasm; (iii) stimulates myoblast withdrawal from the cell cycle and cytoplasmic retention sequences located in the ®rst 43 residues of BTG1 and in a region encompassing the A box and (iv) a terminal dierentiation. Therefore, it was tempting to LxxLL motif (amino acids 43 ± 47) which drives the bGal to the propose that BTG1 nuclear localization is strongly nucleus and could act as a weak Nuclear Localization Sequence involved in the myogenic activity of this hormone. The present study well supports this hypothesis. First, we found that the B box and C-terminal domains more as a myogenic inductor than as an antiprolifera- of BTG1 are sucient to induce the myogenic in¯uence tive protein in this cell type. Moreover, as the present of BTG1; second, it appears that a BTG1 mutant study suggests that the nuclear localization of BTG1 is devoid of these domains does not display any myogenic important for the myogenic in¯uence of the protein, we activity. Therefore, the B box and/or C-terminal can hypothesize that BTG1 is probably involved in the domains of BTG1 have a key role in the stimulation stimulation of myoblast dierentiation induced by of myoblast dierentiation. In addition, as this part of treatments potentiating its nuclear accumulation, as the protein includes a functional NLS and a nuclear triiodothyronine, retinoic acid (unpublished data) or retention domain, it is also strongly involved in the cAMP (Marchal et al., 1995). nuclear localization of BTG1. Over all our data demonstrate that: (i) a BTG1 mutant essentially located in the nucleus mimics the myogenic in¯uence of BTG1 Materials and methods and (ii) the domains involved in the nuclear localization of BTG1 are necessary and sucient to stimulate Construction of DNA recombinant molecules myoblast dierentiation. Therefore, they clearly suggest that BTG1 exerts its myogenic activity at the nuclear We constructed gene fusion with various parts of the human btg1 coding sequence fused to the 5' end of the E.coli Lac Z level, thus raising the question of its in¯uence upon gene. The recombinant DNA molecules were generated using gene expression through interactions with PRMT1, PCR with speci®c primers described below and inserted in the CAF1 or Hoxb9. The results indicating that mutation HindIII/KpnI sites of the pCH110 (Hall et al., 1983) vector, in of serine 159, involved in the interaction with CAF1 frame with the bGal coding sequence. The parts of BTG1 (Bogdan et al., 1998), abrogates the myogenic in¯uence ampli®ed, and the corresponding set of primers are of the Bbox-C-ter mutant clearly suggest that this summarized in Table 2. component of the CCR4 transcriptional regulatory The LxxLL/bGal encoding vector was obtained by complex is involved in the BTG1 myogenic activity. hybridizing the primers GCGAAGCTTGCCATGCTGCAG- GAGCTGCTGGTACCGCG and CGCGGTACCAGCAG- CTCTGCA GCATGGCAAGCTTCGC followed by HindIII/ Conclusions KpnI digestion and ligation in the pCH110. The BTG1D30 ± 43/bGal encoding vector was obtained by In this study, we brought evidence that BTG1 cellular inserting a fragment encoding aa 1 ± 30 in the HindIII/KpnI localization is under a complex control mediated by sites of pCH110, followed by insertion of the fragment several domains inducing nuclear import, export and encoding aa 43 ± 171 in KpnI site. The BTG1DB/bGal was retention, as well as cytoplasmic retention, as summar- obtained by inserting a fragment encoding aa 1 ± 98 in ized in Figure 7. In addition, presence of phosphoryla- HindIII/XbaI sites of the pCH 110 and a fragment encoding tion sites in sequences altering functionality of these aa 117 ± 171 in XbaI/KpnI sites of the resulting vector. BTG1 domains points out the occurrence of post- translational regulatory events. Last, the present Cell culture and transient transfections identi®cation of these sequences could help to ®nd QM7, a previously established quail myoblast cell line (Antin new BTG1 partners, possibly nuclear receptors, and Ordahl, 1991) was cultured in M199 medium (Gibco, involved in the physiological action of the protein. BRL) with 10% foetal bovine serum, tryptose phosphate In addition, related to previous data (Rodier et al., 0.2%, L-glutamine 2 mM, gentamicin (50 mg/ml) and incu- 1999), it appears that BTG1, whose expression is bated at 378C under 5% CO2. For all experiments the cells induced at cell con¯uence in avian myoblasts, acts were plated at a density of 76103 cells/cm2.

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2702 Table 2 Primers used for generation by PCR of plasmids encoding BTG1 mutants Chimera Forward primer Reverse primer

B 5'GCGAAGCTTAGAATGCTCCCAAGTGAACTCACAC3' 5'CGCGGTACCTCTCCAATTCTGTAGGAC3' BTG1 5'GCGAAGCTTGCCATGCATCCCTTCTACACC3' 5'CGCGGTACCCCTGATACAGTCATCATCATATTG3' B-C-ter 5'GCGAAGCTTAGAATGCTCCCAAGTGAACTCACAC3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3' C-ter 5'GCGAAGCTTGCCATGGACGGCTCCATCTGT3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3' B-C-terS159G 5'GCGAAGCTTAGAATGCTCCCAAGTGAACTCACAC3' 5'CGCGGTACCCCTGATACAGTCATCATATTGTAG- TTTTTGGAAGGGCCCGTTCTGCCCAA3' NES-B-C-ter 5'CTAAGCTTGCCATGCTGTTCAGGCTTCTCCCAAGT3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3' BTG1D1±30 5'GCGAAGCTTGCCATGCTGACGAGCGAGCGA3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3' BTG1D1±43 5'GCGAAGCTTGCCATGCTGCAGGAGCTGCTG3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3' BTG1D1±48 5'GCGAAGCTTGCCATGGCAGAACATTATAAA3' 5'CGCGGTACCCCTGATACAGTCATGATATTG3' BTG1D1±78 5'GCGAAGCTTGCCATGCTGATTGGACAGGCA3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3' N-ter-NES-B 5'GCGAAGCTTGCCATGCATCCCTTCTACACC3' 5'CCGGTACCTCTCCAATTCTGTAGGAC3' N-ter-NES 5'GCGAAGCTTGCCATGCATCCCTTCTACACC3' 5'CCGGTACCAGTGTGAGTTCACTTGGGAG3' N-ter 5'GCGAAGCTTGCCATGCATCCCTTCTACACC3' 5'CCGGTACCTCCTGACTGCTCAGTCCCAAT3' BTG1D30 ± 43 aa 1 ± 30 5'GCGAAGCTTGCCATGCATCCCTTCTACACC3' 5'CGCGGTACCCTTGGTGCGGAG3' aa 43 ± 171 5'GCGGGTACCCTGCAGGAGCTGCTGGCA3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3' BTG1DB aa 1 ± 98 5'GCGAAGCTTGCCATGCATCCCTTCTACACC3' 5'GTCCTAGGACCACCAAGCCTGAACAGCTCC- TGAC3' aa 117 ± 171 5'GTTCTAGAGGTGGTGATGGCTCCATCTGTGTGCT3' 5'CGCGGTACCCCTGATACAGTCATCATATTG3'

In some experiments, cell synchronization in G0 was After two additional rinses in PBS and PBS-gelatin 0.2%, a induced by a 24-h serum deprivation. Where indicated second ¯uorochrome conjugated antibody raised against Leptomycin B (kindly provided by Dr B Wol-Winiski, Mouse IgG (Jackson Immunoresearch) diluted at 1/30 in Vienna, Austria) was added to the medium at a ®nal PBS-0.2% gelatin was added and incubated for 45 min at 378C. concentration of 10 ng/ml. For energy depletion, sodium Immuno¯uorescent staining of endogenous BTG1 protein azide (Sigma, St Louis, MO, USA) was used at a ®nal was carried out as previously described (Marchal et al., 1995) concentration of 10 mM, in the presence of cycloheximide and analysed using a standard Zeiss Axiophot immuno¯uor- 20 mg/ml and 6 mM 2-deoxyglucose. escence microscope. DNA transfections were performed using calcium phos- The intracellular localization of the chimeric proteins was phate coprecipitation with a total of 2 mg of plasmid DNA as assessed by quanti®cation. Cells were counted according to described previously (Wigler et al., 1978). After 20 h, the the following localization features: (i) exclusive bGal nuclear DNA containing medium was replaced with fresh medium for staining (N), (ii) simultaneous nuclear and cytoplasmic a further 20 h. staining (N/C) and (iii) exclusive bGal cytoplasmic staining (C). More than 100 bGal expressing cells were counted for each fusion protein in each experiment. In the ®rst part of the Study of myoblast withdrawal from the cell cycle and terminal study, localization was studied in proliferative myoblasts. In differentiation experiments focused on the myogenic in¯uences of chimeric Myoblast withdrawal from the cell cycle was assessed at cell proteins, localization was assessed 24 h later, at cell con¯uence by counting of all cells expressing connectin, a con¯uence, at the induction of dierentiation. post-mitotic marker. Connectin was detected by cytoimmu- Statistical analyses were performed using the paired t-test no¯uorescence using a ®rst antibody raised against the (Snedecor, 1961). protein (Marchal et al., 1995) and a second ¯uorescein conjugated raised against mouse immunoglobulins, as described below. The results are expressed as per cent of the total number of cells counted. The extent of myoblast dierentiation was assessed by Acknowledgements calculation of the fusion index (FI), 48 h after serum removal The authors thank Dr Barbara Wol-Winiski (Novartis, (FI=Number of nuclei included in myotubes6100/total Vienna, Austria) for the gift of Leptomycin B. This work number of nuclei counted in the same microscopic ®eld). was supported by grants from I.N.R.A. (Institut National de Recherche Agronomique), A.F.M. (Association Fran- cËaise pour la recherche contre les Myopathies), A.R.C. Immunofluorescence (Association pour la Recherche contre le Cancer), Ligue de For immunostaining of LacZ fusion proteins, QM7 cells were recherche contre le cancer and reÂ gion RhoÃne-Alpes. A rinsed twice with room temperature PBS and ®xed at 7208C Rodier, P Rochard, F Casas and L Daury were supported for 10 min in cold methanol. After two rinses in PBS and two in by fellowships from Ligue Nationale de recherche contre le PBS containing 0.2% gelatin, a primary antibody raised cancer, Fondation pour la Recherche MeÂ dicale, I.N.R.A., against bGal (Gibco-BRL-Life technologies) diluted in PBS- Ligue DeÂ partementale de l'HeÂ rault contre le cancer, 0.2% gelatin was added and incubated for 45 min at 378C. respectively.

Oncogene Functional domains involved in BTG1 localization A Rodier et al 2703 References

Antin PB and Ordahl CP. (1991). Dev. Biol., 143, 111 ± 121. Kudo N, Wol B, Sekimoto T, Schreiner EP, Yoneda Y, Bogdan JA, Adams-Burton C, Pedicord DL, Sukovich DA, Yanagida M, Horinouchi S and Yoshida MS. (1998). Exp. Ben®eld PA, Corjay MH, Stoltenborg JK and Dicker IB. Cell. Res., 242, 540 ± 547. (1998). Biochem. J., 336, 471 ± 481. Lin WJ, Gary JD, Yang C, Clarke S and Herschman HR. Bradbury A, Possenti R, Shooter EM and Tirone F. (1991). (1996). J. Biol. Chem., 271, 15034 ± 15044. Proc. Natl. Acad. Sci. USA, 88, 3353 ± 3357. Marchal S, Cassar-Malek I, Magaud JP, Rouault JP, Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT, Wrutniak C and Cabello G. (1995). Exp. Cell. Res., 220, Aswad DW and Stallcup MR. (1999). Science, 284, 2174 ± 1±10. 2177. Marchal S, Cassar-Malek I, Pons F, Wrutniak C and Cabello Chen PJ, Singal A, Kimble J and Ellis RE. (2000). Dev. Biol., G. (1993). Biol. Cell., 78, 191 ± 197. 217, 77 ± 90. Matsuda S, Kawamura-Tsuzuku J, Ohsugi M, Yoshida M, Dingwall C, Sharnick SV and Laskey RA. (1982). Cell, 30, Emi M, Nakamura Y, Onda M, Yoshida Y, Nishiyama A 449 ± 458. and Yamamoto T. (1996). Oncogene, 12, 705 ± 713. Draper MP, Salvadore C and Denis CL. (1995). Mol. Cell. Montagnoli A, Guardavaccaro D, Starace G and Tirone F. Biol., 15, 3487 ± 3495. (1996). Cell Growth Dier., 10, 1327 ± 1336. Fischer U, Huber J, Boelens WC, Mattaj IW and Luhrmann Newmeyer DD and Forbes DJ. (1988). Cell, 52, 641 ± 653. R. (1995). Cell, 82, 475 ± 483. Ossareh-Nazari B, Bachelerie F and Dargemont C. (1997). Fletcher B, Lim RW, Varnum BC, Kujubu DA, Koski RA Science, 278, 141 ± 144. and Herschman HR. (1991). J. Biol. Chem., 266, 14511 ± Prevot D, Voeltzel T, Birot AM, Morel AP, Rostan MC, 14518. Magaud JP and Corbo L. (2000). J. Biol. Chem., 275, Fornerod M, Ohno M, Yoshida M and Mattaj IW. (1997). 147 ± 153. Cell, 90, 1051 ± 1060. Rajpurohit R, Lee SO, Park JO, Paik WK and Kim S. (1994). Fukuda M, Asano S, Nakamura T, Adachi M, Yoshida M, J. Biol. Chem., 269, 1075 ± 1082. Yanagida M and Nishida E. (1997). Nature, 390, 308 ± Rimokh R, Rouault JP, Wahbi K, Gadoux M, Lafage M, 311. Archimbaud E, Charrin C, Gentilhomme O, Germain D, Fukuda M, Gotoh I, Gotoh Y and Nishida E. (1996). J. Biol. Samarut J and Magaud JP. (1991). Genes Chromosomes Chem., 271, 20024 ± 20028. Cancer, 3, 24 ± 36. Ghosh SK, Paik WK and Kim S. (1988). J. Biol. Chem., 263, Rodier A, Marchal-Victorion S, Rochard P, Casas F, 19024 ± 19033. Cassar-Malek I, Rouault JP, Magaud JP, Mason DY, Guardavaccaro D, Corrente G, Covone F, Micheli L, Wrutniak C and Cabello G. (1999). Exp. Cell Res., 249, D'Agnano I, Starace G, Caruso M and Tirone F. (2000). 337 ± 348. Mol. Cell. Biol., 20, 1797 ± 1815. Rouault JP, Prevot D, Berthet C, Birot AM, Billaud M, GueÂ henneux F, Duret L, Callanan MB, Bouhas R, Hayette Magaud JP and Corbo L. (1998). J. Biol. Chem., 273, S, Berthet C, Samarut C, Rimokh R, Birot AM, Wang Q, 22563 ± 22569. Magaud JP and Rouault JP. (1997). Leukemia, 11, 370 ± Rouault JP, Rimokh R, Tessa C, Paranhos G, Ffrench M, 375. Duret L, Garoccio M, Germain D, Samarut J and Magaud Guiochon-Mantel A, Delabre K, Lescop P and Milgrom E. JP. (1992). EMBO J., 11, 1663 ± 1670. (1994). Proc. Natl. Acad. Sci. USA, 91, 7179 ± 7183. Saka Y, Tada M and Smith JC. (2000). Mech. Dev., 93, 27 ± Hall CV, Jacob PE, Ringold GM and Lee F. (1983). J. Mol. 39. Appl. Genet., 2, 101 ± 109. Snedecor GW. (1961). Statistical methods. Ames, IA: Iowa Heery DM, Kalkhoven E, Hoare S and Parker MG. (1997). State University Press. Nature, 387, 733 ± 736. Stade K, Ford CS, Guthrie C and Weis K. (1997). Cell, 90, IacopettiP,MicheliniM,StuckmannI,ObackB,Aaku- 1041 ± 1050. Saraste E and Huttner WB. (1999). Proc. Natl. Acad. Sci. Wen W, Meinkoth JL, Tsien RY and Taylor SS. (1995). Cell, USA, 96, 4639 ± 4644. 82, 463 ± 473. Ikematsu N, Yoshida Y, Kawamura-Tsuzuku J, Ohsugi M, Wigler M, Pellicer A, Silverstein S and Axel R. (1978). Cell, Onda M, Hirai M, Fujimoto J and Yamamoto T. (1999). 14, 725 ± 731. Oncogene, 18, 7432 ± 7441. Wol B, Sanglier JJ and Wang Y. (1997). Chem. Biol., 4, Kudo N, Khochbin S, Nishi K, Kitano K, Yanagida M, 139 ± 147. Yoshida M and Horinouchi S. (1997). J. Biol. Chem., 272, 29742 ± 29751.

Oncogene