DOCSLIB.ORG

Method for Determining the Origin of a Sample

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

University of Central Florida STARS UCF Patents Technology Transfer 1-20-2015 Method for Determining the Origin of a Sample John Ballantyne University of Central Florida Erin Hanson University of Central Florida Helge Lubenow QIAGEN GmbH Find similar works at: https://stars.library.ucf.edu/patents University of Central Florida Libraries http://library.ucf.edu This Patent is brought to you for free and open access by the Technology Transfer at STARS. It has been accepted for inclusion in UCF Patents by an authorized administrator of STARS. For more information, please contact [email protected]. Recommended Citation Ballantyne, John; Hanson, Erin; and Lubenow, Helge, "Method for Determining the Origin of a Sample" (2015). UCF Patents. 335. https://stars.library.ucf.edu/patents/335 Illlll llllllll Ill lllll lllll lllll lllll lllll 111111111111111111111111111111111 US008936909B2 c12) United States Patent (IO) Patent No.: US 8,936,909 B2 Lubenow et al. (45) Date of Patent: Jan.20,2015 (54) METHOD FOR DETERMINING THE ORIGIN (58) Field of Classification Search OF A SAMPLE None See application file for complete search history. (75) Inventors: Helge Lubenow, Langenfeld (DE); Jack Ballantyne, Chuluota, FL (US); Erin K. (56) References Cited Hanson, Oviedo, FL (US) U.S. PATENT DOCUMENTS (73) Assignees: Qiagen GmbH, Hilden (DE); 7,270,983 Bl 9/2007 Ballantyne University of Central Florida Research 8,039,234 Bl* 10/2011 Fang et al. 435/91.1 Foundation Inc., Orlando, FL (US) 2005/0123952 Al 6/2005 Griffrey ( *) Notice: Subject to any disclaimer, the term ofthis FOREIGN PATENT DOCUMENTS patent is extended or adjusted under 35 U.S.C. 154(b) by 448 days. WO WO 2007/073737 A 7/2007 WO WO 2007073737 Al * 7/2007 WO WO 2008/020008 2/2008 (21) Appl. No.: 13/054,721 WO WO 2008/029295 3/2008 OTHER PUBLICATIONS (22) PCT Filed: Jul. 20, 2009 Hanson et al., "Identification of forensically relevant body fluids (86) PCT No.: PCT/EP2009/005254 using a panel of differentially expressed microRNAs," Anal. § 371 (c)(l), Biochem. 2009, 387:303-314.* (2), ( 4) Date: Jan.4,2012 Zubakov et al., "MicroRNA markers for forensic body fluid identi­ fication obtained from microarray screening and quantitative RT­ (87) PCT Pub. No.: W02010/006814 PCR confirmation," Int. J. Legal Med. 2010, 124:217-226.* (Continued) PCT Pub. Date: Jan. 21, 2010 Primary Examiner - Samuel Woolwine (65) Prior Publication Data Assistant Examiner - Kaijiang Zhang US 2012/0094850Al Apr. 19, 2012 (74) Attorney, Agent, or Firm - Fanelli Haag & Kilger PLLC Related U.S. Application Data (57) ABSTRACT A method for determining the nature of a sample is provided, (60) Provisional application No. 61/082,056, filed on Jul. wherein the presence or absence of at least one marker small 18, 2008. non-coding RNA in the sample is detected. Suitable marker (51) Int. Cl. small non-coding RNAs for different samples such as blood, C12Q 1168 (2006.01) saliva, semen and vaginal secretions are provided. Also pro­ vided are suitable kits and methods for identifying marker (52) U.S. Cl. small-non coding RNAs. CPC .................................... C12Q 116881 (2013.01) USPC ........................................... 435/6.1; 435/6.12 7 Claims, 15 Drawing Sheets Table 1: Small non-coding RNAa sullllble u blood mark&!'$ miRNA Huma~ miRNAe tet7a hsa-laHa-UGAGGUAGUAGGUUGUAUAGUU - SEQ ID NO , let7b tisa·let-7t>-UGAGGUAGUAGGUUGUGUGGUU - SEQ 10 NO 2 iet7c Ma-lat-7c-UGAGGUAGUAGGUUGUAUGGUU - SEQ ID NO 3 let7d Ma-tet-711-AGAGGUAGUAGGUUGCAUAGUU. SEQ ID NO 4 hsa-let-7&-UGAGGUAGGAGGUUGUAUAGUU ·SEO 10 NO S 1817f~" hsa-~t-7!-UGAGGUAGUAGAUUGUAUAGUU ·SEQ ID NO 6 hsa-ieH~UGAGGUAGUAGUUUGUACAGUU ·SEQ ID NO 7 ~~~ hS8·1et-7~UGAGGUAGUAGUUUGUGCUGUU ·SEQ ID NO· 8 hsa-mlR-7-UGGAAGACUAGUGAUUUUGUUGU. SEQ ID NO: 9 m•R7 mlR1Ga hsa-mlR-158-UAGCAGCACAUAAUGGUUUGUG - SEQ ID NO 10 mlR15b hsa·mlR-15b·UAGCAGCACAUCAUGGUUUACA ·SEQ 10 NO. 11 miR1S nsa-m•R-16-UAGCAGCACGUAAAUAUUGGCG. SEQ 10 NO 12 mlR17 Ma-mlR-17-CAAAGUGCUUACAGUGCAGGUAG - SEQ ID NO 13 mlR18alb hsa·'™R-11!a·UAAGGUGCAUCUAGUGCAGAUAG - SEQ ID NO 14 h""·m1R-181l.UAAGGUGCAUCUAGUGCAGUUAG ·SEQ ID NO· 15 mlR18a" hsa-m1R-11!a"-ACUGCCCUAAGUGCUCCUUCUGG ·SEQ ID NO 16 mlR19a h ...m1R-19a.UGUGCAAAUCUAUGCAAAACUGA- SEQ ID NO 17 mrR20a hsa-mlR-20..-UAAAGUGCUUAUAGUGCAGGUAG ·SEQ ID NO. 18 mlR25 h.. ·ITllR-25-CAUUGCACUUGUCUCGGUCUGA - sea ID NO 19 mlR26b h:;a-m!A-25b--UUCAAGUAAUUCAGGAUAGGU ·SEQ ID NO· 20 m<R30b hsa-miR-JOb-UGUAMCAUCCUACACUCAGCU - SEO ID NO 21 m1R30ale· hsa-mlR-30a-UGUAAACAUCCUCGACUGGAAG - SEO ID NO· 22 '" hsa-mll'l-3Cle- UGUAAACAUCCUUGACUGGAAG- pr~IB!Ted ·SEO ID NO· 23 miR93 hsa-mll'l-93-CAMGUGCUGUUCGUGCAGGUAG ·SEQ ID NO· 24 mrR96 hsa-m•R-95-UUUOOCACUAGCACAUUUUUGCU ·SEQ ID NO. 25 m1R103 hsa-moR-103-AGCAGCAUUGUACAGGGCUAUGA- sea ID NO 26 //hsa-miR-107-AGCAGCAUUGUACAGGGCUAUCA. sea ID NO 29 h$1i-mlR-106o-AAAAGUGCUUACAGUGCAGGUAG - sea ID NO 27 // hsa-m•Fl-1 7-CAAAGUGCUUACAGUGCAGGUAG • SEQ 10 NO 13 mlR106b hsa-m1R-106~UAAAGUGCUGACAGUGCAGAU - SEQ ID NO 28 m1R107 hsa-mlR-107-AGCAGCAUUGUACAGGGCUAUCA- SEQ 10 NO 29 mlR126 h:!<l·mlR· 126-UCGUACCGUGAGUAAUAAUGCG • SEO ID NO 30 m1R125" hsa-mlR-12e·-CAUUAUUACUUUUGGUACOCG-SEOIDNO 31 miR12B has-miR-128-UCACAGUGAACCGGUCUCUUU ·SEQ ID NO. 32 mlfl130a hsa-mlR-130a-CAGUGCAAUGUUAAAAOGGCAU - SEQ 10 NO: 33 miR149b hs'1-m1R-14aa-UCAGUGCACUACAGAACUUUGU ·SEO ID NO 34 hs•-mlR-14&-UCAGUGCAUCACAGAACUUUGU ·SEQ ID NO: 35 hsi0-m1R·14Sa'·AAAGUUCUGAGACACUCCGACU ·SEQ ID NO 36 hsa·miR-148b'-AAGUUCUGUUAUACACUCAGGC ·SEQ ID NO 37 miR150 hsa-mlR-150-UCUCCCAACCCUUGUACCAGUG. sea 10 NO 36 mlR151 hsa-m1R-151-5p·UCGAGGAGCUCACAGUCUAGU - SEQ ID NO 39 hsa-mJR-151-Jp-CUAGACUGAAGCUCCUUGAGG- preferred - SEQ 10 NO: 40 m<R181a hsa-m<R-1S1a·AACAUUCAACGCUGUCGGUGAGU ·SEQ ID NO 41 m<R181c hsa-mlR-161c-AACAUUCAACCUGUCGGUGAGU -SEQ ID NO 42 US 8,936,909 B2 Page 2 (56) References Cited Suh, Mi-ra et al., "Human embryonic stem cells express a unique set of microRNAs," Developmental Biology, Academic Press, New OTHER PUBLICATIONS York, NY, US vol. 270 No. 2, May 6, 2004, pp. 488-498. Lagos-Quintana, Mariana et al., "New microRNAs from mouse and Wang et al., "A model for data analysis of microRNA expression in human, RNA," Cold Spring Harbor Laboratory Press Woodbury, NY, US vol. 9 No. 2, Feb. 1, 2003, pp. 175-179. forensic body fluid identification," Forensic Sci. Int. Genet. 2012, Jobling et al., "Encoded Evidence: DNA in Forensic Analysis," 6:419-423.* Nature Reviews in Genetics, vol. 5, p. 739; 2004. Chajut, A. et al., "MicroRNA profiles in body fluids as a novel class Mattick et al., "Non-coding RNA," Human Molecular Genetics 2006, ofbiomarkers," Proceedings of the Annual Meeting of the American vol. 15, Review Issue 1Rl7-R29. Association for Cancer Research, New York, NY, US vol. 49, Apr. 16, Cummins et al., "Implications of micro-RNA profiling for cancer 2008, p. 1231. diagnosis," Oncogene (2006) 25, pp. 6220-6227. Labourier, E. and Goldrick, M., "MiRNA Expression in White Blood Berezikov et al., "Approaches to microRNA discovery," Nature Cells," Applied Biosystems Technotes [Online] vol. 11 No. 3, May Genetics Supplement, vol. 38, Jun. 2006, pp. S2-S7. 2004, pp. 2-3. Kloosterman eta!., "The Diverse Functions of Micro RNAs in Animal Beuvink, Iwan et al., "A novel microarray approach reveals new Development and Disease," Developmental Cell 11, Oct. 2006 pp. tissue-specific signatures of known and predicted mammalian 441-450. microRNAs," Nucleic Acids Research vol. 35 No. 7, Apr. 2007, p. 3. Chomczynski et al., "The single-step method of RNA isolation by Lagos-Quintana, M et al., "Identification of novel genes coding for acid guanidinium thiocyanate-phenol-chloroform extraction: small expressed RNAs," Science, American Association for the twenty-something years on," Analytical Biochemistry Apr. 1987; Advancement of Science, US, Washington, DC vol. 294 No. 5543, 162: pp. 156-159. Oct. 26, 2001, pp. 853-858. Nussbaumer et al., "Messenger RNA profiling: A novel method for Sewer, Alain et al., "Identification of clustered microRNAs using an body fluid identification by Real-Time PCR," Forensic Science Inter­ ab initio prediction method," BMC Bioinformatics 2005, vol. 6, p. national, 157 (2006) pp. 181-186. 267. Juusola et al., "Multiplex mRNA profiling for the identification of Weber, Michel J, "New human and mouse microRNA genes found by body fluids," Forensic Science International, 152 (2005) pp. 1-12. homology search," FEBS Journal vol. 272 No. 1, Jan. 2005, pp. 59-73. * cited by examiner U.S. Patent Jan.20,2015 Sheet 1of15 US 8,936,909 B2 Table 1: Small non-coding RN As suitable as blood markers mi RNA Human miRNAs let7a hsa-let-7a-UGAGGUAGUAGGUUGUAUAGUU - SEQ ID NO: 1 let7b hsa-let-7b-UGAGGUAGUAGGUUGUGUGGUU - SEQ ID NO 2 let7c hsa-let-7c-UGAGGUAGUAGGUUGUAUGGUU - SEQ ID NO: 3 let7d hsa-let-7d-AGAGGUAGUAGGUUGCAUAGUU - SEQ ID NO: 4 let7e hsa-let-7e-UGAGGUAGGAGGUUGUAUAGUU - SEQ ID NO: 5 let7f hsa-let-7f-UGAGGUAGUAGAUUGUAUAGUU - SEQ ID NO: 6 let7g hsa-let-7g-UGAGGUAGUAGUUUGUACAGUU - SEQ ID NO: 7 let7i hsa-let-7i-UGAGGUAGUAGUUUGUGCUGUU - SEQ ID NO: 8 miR7 hsa-miR-7-UGGAAGACUAGUGAUUUUGUUGU - SEQ ID NO: 9 miR15a hsa-miR-15a-UAGCAGCACAUAAUGGUUUGUG - SEQ ID NO: 10 miR15b hsa-miR-15b-UAGCAGCACAUCAUGGUUUACA- SEQ ID NO: 11 miR16 hsa-miR-16-UAGCAGCACGUAAAUAUUGGCG - SEQ ID NO: 12 miR17 hsa-miR-17-CAAAGUGCUUACAGUGCAGGUAG - SEQ ID NO: 13 miR18a/b hsa-miR-18a-UAAGGUGCAUCUAGUGCAGAUAG - SEQ ID NO: 14 hsa-miR-18b-UAAGGUGCAUCUAGUGCAGUUAG ·SEQ ID NO: 15 miR1Ba· hsa-miR-18a*-ACUGCCCUMGUGCUCCUUCUGG - SEQ ID NO: 16 miR19a hsa-miR-19a-UGUGCMAUCUAUGCAAAACUGA- SEQ ID NO: 17 miR20a hsa-m1R-20a-UAAAGUGCUUAUAGUGCAGGUAG ·SEQ ID NO:
Recommended publications
  • Mirnas Generated from Meg3-Mirg Locus Are Downregulated During Aging

    Mirnas Generated from Meg3-Mirg Locus Are Downregulated During Aging

    www.aging-us.com AGING 2021, Vol. 13, No. 12 Research Paper miRNAs generated from Meg3-Mirg locus are downregulated during aging Ana-Mihaela Lupan1,*, Evelyn-Gabriela Rusu1,*, Mihai Bogdan Preda1, Catalina Iolanda Marinescu1, Cristina Ivan2, Alexandrina Burlacu1 1Laboratory of Stem Cell Biology, Institute of Cellular Biology and Pathology “Nicolae Simionescu”, Bucharest 050568, Romania 2Department of Experimental Therapeutics, Division of Basic Science Research, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA *Equal contribution Correspondence to: Alexandrina Burlacu; email: [email protected] Keywords: aging, miRNA, Meg3-Mirg locus, cardiac fibroblasts, heart ventricles Received: October 31, 2020 Accepted: June 2, 2021 Published: June 22, 2021 Copyright: © 2021 Lupan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Aging determines a multilevel functional decline and increases the risk for cardiovascular pathologies. MicroRNAs are recognized as fine tuners of all cellular functions, being involved in various cardiac diseases. The heart is one of the most affected organs in aged individuals, however little is known about the extent and robustness to which miRNA profiles are modulated in cardiac cells during aging. This paper provides a comprehensive characterization of the aging-associated miRNA profile in the murine cardiac fibroblasts, which are increasingly recognized for their active involvement in the cardiac physiology and pathology. Next- generation sequencing of cardiac fibroblasts isolated from young and old mice revealed that an important fraction of the miRNAs generated by the Meg3-Mirg locus was downregulated during aging.
  • Molecular Reprogramming in Tomato Pollen During Development And

    Molecular Reprogramming in Tomato Pollen During Development And

    Molecular reprogramming in tomato pollen during development and heat stress Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften vorgelegt beim Fachbereich Biowissenschaften (FB15) der Goethe-Universität Frankfurt am Main von Mario Keller geboren in Frankfurt am Main (Hessen) Frankfurt am Main 2018 (D30) Vom Fachbereich Biowissenschaften (FB15) der Goethe-Universität als Dissertation angenommen. Dekan: Prof. Dr. Sven Klimpel Gutachter: Prof. Dr. Enrico Schleiff, Jun. Prof. Dr. Michaela Müller-McNicoll Datum der Disputation: 25.03.2019 Index of contents Index of contents Index of contents ....................................................................................................................................... i Index of figures ........................................................................................................................................ iii Index of tables ......................................................................................................................................... iv Index of supplemental material ................................................................................................................ v Index of supplemental figures ............................................................................................................... v Index of supplemental tables ................................................................................................................ v Abbreviations ..........................................................................................................................................
  • Full Text (PDF)

    Full Text (PDF)

    Published OnlineFirst November 11, 2014; DOI: 10.1158/0008-5472.CAN-14-1041 Cancer Tumor and Stem Cell Biology Research Loss of Estrogen-Regulated microRNA Expression Increases HER2 Signaling and Is Prognostic of Poor Outcome in Luminal Breast Cancer Shannon T. Bailey1,2,3, Thomas Westerling1,2,3, and Myles Brown1,2,3 Abstract Among the genes regulated by estrogen receptor (ER) are Genome Atlas (TCGA). Among luminal tumors, these miRNAs miRNAs that play a role in breast cancer signaling pathways. To are expressed at higher levels in luminal A versus B tumors. determine whether miRNAs are involved in ER-positive breast Although their expression is uniformly low in luminal B tumors, cancer progression to hormone independence, we profiled the they are lost only in a subset of luminal A patients. Interestingly, expression of 800 miRNAs in the estrogen-dependent human this subset with low expression of these miRNAs had worse breast cancer cell line MCF7 and its estrogen-independent deriv- overall survival compared with luminal A patients with high ative MCF7:2A (MCF7:2A) using NanoString. We found 78 expression. We confirmed that miR125b directly targets HER2 miRNAs differentially expressed between the two cell lines, and that let-7c also regulates HER2 protein expression. In addi- including a cluster comprising let-7c, miR99a, and miR125b, tion, HER2 protein expression and activity are negatively corre- which is encoded in an intron of the long noncoding RNA lated with let-7c expression in TCGA. In summary, we identified LINC00478. These miRNAs are ER targets in MCF7 cells, and an ER-regulated miRNA cluster that regulates HER2, is lost with nearby ER binding and their expression are significantly progression to estrogen independence, and may serve as a bio- þ decreased in MCF7:2A cells.
  • Timo Lassmann, Yoshiko Maida 2, Yasuhiro Tomaru, Mami Yasukawa

    Timo Lassmann, Yoshiko Maida 2, Yasuhiro Tomaru, Mami Yasukawa

    Int. J. Mol. Sci. 2015, 16, 1192-1208; doi:10.3390/ijms16011192 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Telomerase Reverse Transcriptase Regulates microRNAs Timo Lassmann 1,†, Yoshiko Maida 2,†, Yasuhiro Tomaru 1, Mami Yasukawa 2, Yoshinari Ando 1, Miki Kojima 1, Vivi Kasim 2, Christophe Simon 1, Carsten O. Daub 1, Piero Carninci 1, Yoshihide Hayashizaki 1,* and Kenkichi Masutomi 2,3,* 1 RIKEN Omics Science Center, RIKEN Yokohama Institute, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045, Japan; E-Mails: [email protected] (T.L.); [email protected] (Y.T.); [email protected] (Y.A.); [email protected] (M.K.); [email protected] (C.S.); [email protected] (C.O.D.); [email protected] (P.C.) 2 Cancer Stem Cell Project, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045, Japan; E-Mails: [email protected] (Y.M.); [email protected] (M.Y.); [email protected] (V.K.) 3 Precursory Research for Embryonic Science and Technology (PREST), Japan Science and Technology Agency, 4-1-8 Honcho Kawaguchi, Saitama 332-0012, Japan † These authors contributed equally to this work. * Authors to whom correspondence should be addressed; E-Mails: [email protected] (Y.H.); [email protected] (K.M.); Tel.: +81-45-503-9248 (Y.H.); +81-3-3547-5173 (K.M.); Fax: +81-45-503-9216 (Y.H.); +81-3-3547-5123 (K.M.). Academic Editor: Martin Pichler Received: 22 November 2014 / Accepted: 26 December 2014 / Published: 6 January 2015 Abstract: MicroRNAs are small non-coding RNAs that inhibit the translation of target mRNAs.
  • Charakterisierung Interindividueller Strahlenempfindlichkeit in Zellen Aus Tumorpatienten

    Charakterisierung Interindividueller Strahlenempfindlichkeit in Zellen Aus Tumorpatienten

    Charakterisierung interindividueller Strahlenempfindlichkeit in Zellen aus Tumorpatienten Anne Maria Dietz Charakterisierung interindividueller Strahlenempfindlichkeit in Zellen aus Tumorpatienten Dissertation an der Fakultät für Biologie der Ludwig-Maximilians-Universität München zur Erlangung des Doktorgrades der Naturwissenschaften Angefertigt an der Klinik und Poliklinik für Strahlentherapie und Radioonkolgie in der Arbeitsgruppe Molekulare Strahlenbiologie unter der Leitung von PD. Dr. Anna Friedl Vorgelegt von Anne Maria Dietz München, den 03. Dezember 2014 Erstgutachter: PD Dr. Anna A. Friedl Zweitgutachter: Prof. Dr. Peter Becker Tag der mündlichen Prüfung: 05.05.2015 Meinem Vater Inhaltsverzeichnis Inhaltsverzeichnis 1 Zusammenfassung ........................................................................................................................... 5 2 Einleitung ......................................................................................................................................... 7 2.1 Individuelle Strahlenempfindlichkeit ...................................................................................... 7 2.2 Das Chromosomeninstabilitätssyndrom Ataxia Telangiectasia .............................................. 9 2.3 Biomarker-Entdeckung im Zeitalter der Omics-Technologien .............................................. 12 2.3.1 Charakterisierung eines validen Biomarkers ................................................................. 12 2.3.2 Biomarker für Strahlenempfindlichkeit ........................................................................
  • Insights Into Transcription Through Nascent RNA Sequencing

    Insights Into Transcription Through Nascent RNA Sequencing

    Insights into transcription through nascent RNA sequencing by Artur Botelho Veloso A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in The University of Michigan 2014 Doctoral Committee: Professor Mats E.D. Ljungman, Chair Associate Professor Scott E. Barolo Professor Daniel M. Burns Jr. Assistant Professor Hui Jiang Professor Kerby A. Shedden Associate Professor Thomas E. Wilson c Artur B Veloso 2014 All Rights Reserved Para os meus pais, L´eae Rog´erio. ii ACKNOWLEDGEMENTS At´eonde eu me lembro, o meu interesse em ci^enciae pesquisa me acompanhou durante toda a minha vida. Quando crian¸caeu me sentia fascinado pelo mundo cient´ıficoe almejava o dia em que eu faria parte desse mundo. Durante a ´ultima d´ecadaeu tive a oportunidade de perseguir esse sonho, mas isso foi feita a duras penas. A minha decis~aode mudar de pa´ıse deixar fam´ıliae amigos para tr´asn~ao foi tomada facilmente. Eu n~aoa teria tomado, no entanto, se n~aotivesse recebido tanto apoio dessas mesmas pessoas. Esse processo n~aofoi f´acilpara mim, assim como n~aofoi f´acilpara eles. Por isso, eu primeiramente gostaria de agradecer `as pessoas que tem me apoiado durante toda minha vida. Minha m~aee meu pai, L´eae Rog´erio,foram fundamentais em meu desenvolvimento. Al´emdas qualidades b´asicas que bons pais ensinam a filhos, eles me ajudaram a desenvolver um forte sentido de independ^encia.Essa independ^enciafoi fundamental na minha decis~aode estudar em outro pa´ıs. Outro aspecto importante nessa decis~aofoi a minha ambi¸c~ao.Uma das pessoas que tiveram o maior impacto nessa caracter´ıstica foi meu irm~ao,Cristiano.
  • Untersuchung Zur Rolle Des La-Verwandten Proteins LARP4B Im Mrna- Metabolismus

    Untersuchung Zur Rolle Des La-Verwandten Proteins LARP4B Im Mrna- Metabolismus

    Untersuchung zur Rolle des La-verwandten Proteins LARP4B im mRNA-Metabolismus Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Maritta Küspert aus Schwäbisch Hall Würzburg 2014 Eingereicht bei der Fakultät für Chemie und Pharmazie am: ....................................... Gutachter der schriftlichen Arbeit: 1. Gutachter: Prof. Dr. Utz Fischer 2. Gutachter: Prof. Dr. Alexander Buchberger Prüfer des öffentlichen Promotionskolloquiums: 1. Prüfer: Prof. Dr. Utz Fischer 2. Prüfer: Prof. Dr. Alexander Buchberger 3. Prüfer: Prof. Dr. Stefan Gaubatz Datum des öffentlichen Promotionskolloquiums: ......................................................... Doktorurkunde ausgehändigt am: ................................................................................ Zusammenfassung Eukaryotische messenger-RNAs (mRNAs) müssen diverse Prozessierungsreaktionen durchlaufen, bevor sie der Translationsmaschinerie als Template für die Proteinbiosynthese dienen können. Diese Reaktionen beginnen bereits kotranskriptionell und schließen das Capping, das Spleißen und die Polyadenylierung ein. Erst nach dem die Prozessierung abschlossen ist, kann die reife mRNA ins Zytoplasma transportiert und translatiert werden. mRNAs interagieren in jeder Phase ihres Metabolismus mit verschiedenen trans-agierenden Faktoren und bilden mRNA-Ribonukleoproteinkomplexe (mRNPs) aus. Dieser „mRNP-Code“ bestimmt das Schicksal jeder mRNA und reguliert dadurch die Genexpression auf posttranskriptioneller
  • Gynecologic and Obstetric Pathology

    Gynecologic and Obstetric Pathology

    ANNUAL MEETING ABSTRACTS 273A Design: From January 2011 to August 2013, 162 patients underwent robotic laparoscopic radical prostatectomy for clinically localized prostatic carcinoma at our institution. Gynecologic and Obstetric Pathology Periprostatic fat pads, yielded during defatting of the prostate, were dissected and sent to pathology for histopathologic examination in 133 cases. Clinical and pathological 1128 Recurrent Grade I, Stage Ia Endometrioid Carcinomas of the Uterus: staging was recorded according to the 2009 American Joint Committee on Cancer Analysis of Pathology and Correlation with Clinical Data (AJCC) criterion. SN Agoff. Virginia Mason Medical Center, Seattle, WA. Results: Of 133 patients whose periprostatic fat was examined, 32 (24%) patients had Background: Low-grade and low-stage endometrioid carcinoma of the uterus is thought lymph nodes in the periprostatic fat pads. Metastatic prostatic carcinoma to periprostatic to have an excellent prognosis in the vast majority of patients. However, despite the lack lymph nodes was detected in 5 individuals (3.8%). All 32 patients had bilateral pelvic of myometrial invasion or superfi cial invasion, some patients develop recurrent disease, lymphadenectomy. 3 of the 5 patients with positive periprostatic lymph nodes had no often in the vaginal apex. There is limited literature on these tumors, but recent analyses metastasis in pelvic lymph nodes, thereby upstaging 3 cases from T3N0 to T3N1. No have implicated the pattern of myoinvasion as a prognostic factor. The emphasis of relationship exists between the presences of periprostatic LNs and prostate weight, the current study is non-invasive or stage Ia, grade I endometrioid adenocarcinomas. patient age, pathological staging or Gleason score.
  • The Discovery Potential of RNA Processing Profiles

    The Discovery Potential of RNA Processing Profiles

    bioRxiv preprint doi: https://doi.org/10.1101/049809; this version posted April 22, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. The discovery potential of RNA processing profiles Amadís Pagès1,2, Ivan Dotu1,3, Roderic Guigó1,2 and Eduardo Eyras1,4,* 1Universitat Pompeu Fabra (UPF), E08003 Barcelona, Spain. 2Centre for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, E08003 Barcelona, Spain. 3IMIM - Hospital del Mar Medical Research Institute. E08003 Barcelona, Spain. 4Catalan Institution for Research and Advanced Studies, E08010 Barcelona, Spain *correspondence to: [email protected] Abstract Small non-coding RNAs are highly abundant molecules that regulate essential cellular processes and are classified according to sequence and structure. Here we argue that read profiles from size-selected RNA sequencing, by capturing the post-transcriptional processing specific to each RNA family, provide functional information independently of sequence and structure. SeRPeNT is a computational method that exploits reproducibility across replicates and uses dynamic time-warping and density-based clustering algorithms to identify, characterize and compare small non-coding RNAs, by harnessing the power of read profiles. SeRPeNT is applied to: a) generate an extended human annotation with 671 new RNAs from known classes and 131 from new potential classes, b) show pervasive differential processing between cell compartments and c) predict new molecules with miRNA-like behaviour from snoRNA, tRNA and long non-coding RNA precursors, dependent on the miRNA biogenesis pathway.
  • Identification of Forensically Relevant Fluids and Tissues by Small RNA Profiling Author(S): Jack Ballantyne, Ph.D

    Identification of Forensically Relevant Fluids and Tissues by Small RNA Profiling Author(S): Jack Ballantyne, Ph.D

    The author(s) shown below used Federal funding provided by the U.S. Department of Justice to prepare the following resource: Document Title: Identification of Forensically Relevant Fluids and Tissues by Small RNA Profiling Author(s): Jack Ballantyne, Ph.D. Document Number: 251895 Date Received: July 2018 Award Number: 2009-DN-BX-K255 This resource has not been published by the U.S. Department of Justice. This resource is being made publically available through the Office of Justice Programs’ National Criminal Justice Reference Service. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. National Center for Forensic Science University of Central Florida P.O. Box 162367 · Orlando, FL 32826 Phone: 407.823.4041 Fax: 407.823.4042 Web site: http://www.ncfs.org/ Biological Evidence _________________________________________________________________________________________________________ Identification of Forensically Relevant Fluids and Tissues by Small RNA Profiling FINAL REPORT December 16, 2013 Department of Justice, National Institute of justice Award Number: 2009-DN-BX-K255 (1 November 2009 – 31 December 2013) _________________________________________________________________________________________________________ Principal Investigator: Jack Ballantyne, PhD Professor Department of Chemistry Associate Director for Research National Center for Forensic Science P.O. Box 162367 Orlando, FL 32816-2366 Phone: (407) 823 4440 Fax: (407) 823 4042 e-mail: [email protected] 1 This resource was prepared by the author(s) using Federal funds provided by the U.S. Department of Justice. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S.
  • Rejuvenation of Aged Heart Explant-Derived Cells for Repair of Ischemic Cardiomyopathy

    Rejuvenation of Aged Heart Explant-Derived Cells for Repair of Ischemic Cardiomyopathy

    Rejuvenation of Aged Heart Explant-Derived Cells for Repair of Ischemic Cardiomyopathy Ghazaleh Rafatian This thesis is submitted to the Faculty of Graduate and Postdoctoral Studies as partial fulfillment of the Doctor of Philosophy program in Cellular Molecular Medicine. Department of Cellular and Molecular Medicine Faculty of Medicine University of Ottawa, Ottawa, ON Supervisors: Darryl R Davis, MD Erik J Suuronen, PhD © Ghazaleh Rafatian, Ottawa, Canada, 2019 Table of Contents Sources of Funding................................................................................................................. VIII Abstract ..................................................................................................................................... IX List of Tables .............................................................................................................................. X List of Figures ........................................................................................................................... XI List of abbreviations ............................................................................................................... XIII Acknowledgments ................................................................................................................. XVII 1. INTRODUCTION ................................................................................................................... 1 1.1.1 Aging .............................................................................................................................
  • Mirna Expression Changes in Arsenic-Induced Skin Cancer in Vitro and in Vivo

    Mirna Expression Changes in Arsenic-Induced Skin Cancer in Vitro and in Vivo

    University of Louisville ThinkIR: The University of Louisville's Institutional Repository Electronic Theses and Dissertations 8-2017 MiRNA expression changes in arsenic-induced skin cancer in vitro and in vivo. Laila Al-Eryani University of Louisville Follow this and additional works at: https://ir.library.louisville.edu/etd Part of the Medicine and Health Sciences Commons Recommended Citation Al-Eryani, Laila, "MiRNA expression changes in arsenic-induced skin cancer in vitro and in vivo." (2017). Electronic Theses and Dissertations. Paper 2767. https://doi.org/10.18297/etd/2767 This Doctoral Dissertation is brought to you for free and open access by ThinkIR: The University of Louisville's Institutional Repository. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of ThinkIR: The University of Louisville's Institutional Repository. This title appears here courtesy of the author, who has retained all other copyrights. For more information, please contact [email protected]. MIRNA EXPRESSION CHANGES IN ARSENIC-INDUCED SKIN CANCER IN VITRO AND IN VIVO By Laila Al-Eryani A Dissertation Submitted To The Faculty of the School Of Medicine of the University Of Louisville In Partial Fulfillment of the Requirements For The Degree Of Doctor of Philosophy in Pharmacology and Toxicology Department Of Pharmacology and Toxicology University Of Louisville Louisville, Kentucky August 2017 MIRNA EXPRESSION CHANGES IN ARSENIC-INDUCED SKIN CANCER IN VITRO AND IN VIVO By Laila Al-Eryani Dissertation approved on August 03, 2017 By the following Dissertation Committee: J. Christopher States, Ph.D. Carolyn M. Klinge Ph.D. Shesh N. Rai, Ph.D.